WorldWideScience

Sample records for al primer huevo

  1. Alérgenos del huevo: digestión gastrointestinal, inmunorreactividad y mecanismos de desensibilización

    OpenAIRE

    Martos, Gustavo

    2012-01-01

    La alergia al huevo es una de las causas más frecuentes de hipersensibilidad inmediata a los alimentos en los países industrializados, sobre todo durante la infancia. La ubicuidad del huevo en los alimentos supone un gran riesgo de ingestión accidental para las personas alérgicas, que deben llevar una dieta muy restringida. En la presente Tesis Doctoral, se estudia la digestibilidad de distintos alérgenos del huevo empleando un modelo in vitro de digestión gastrointestinal fisiológicamente re...

  2. Primer Reporte de Huevos de Mosca de la Carne (Diptera: Sarcophagidae en Pristimantis achatinus (Anura: Craugastoridae de Colombia -resumen-

    Directory of Open Access Journals (Sweden)

    Sebastian Escobar-Vargas

    2014-12-01

    Full Text Available En el marco de un proyecto para el estudio de la microflora bacteriana gramnegativa asociada a la cloaca de ranas de la especie Pristimantis achatinus‚ se hizo el hallazgo de huevos de individuos de la familia Sarcophagidae (Díptera depositados en la cloaca de una de las ranas. El material cloacal fue extraído con micropipetas de punta amarilla (10-100µL y fue disuelto en caldo peptonado e incubado a 37°C durante 24 horas. Posteriormente‚ 0‚1mL de la muestra fueron sembrados por extensión en cajas de Petri con agar cristal violeta.‚ y transcurridas 72 horas de incubación a la misma temperatura‚ se encontraron 12 larvas de Dípteros correspondientes a la familia Sarcophagidae en una de las cajas petri‚ cuyo tamaño se encontraba alrededor de 0‚8mm de longitud. Se plantean varias hipótesis de la causa por la cual estos huevos se encontrasen en la cloaca. Una es que un adulto de Sarcophagidae haya sido ingerido‚ y sus huevos hayan sobrevivido al viaje a través del tracto digestivo del P. achatinus‚ sin embargo nunca ha sido reportado individuos de Sarcophagidae en la dieta de P. achatinus en ninguno de sus estados. Además‚ Se propone también la hipótesis de que puede tratarse de un caso de parasitismo‚ ya que algunas especies de la familia Sarcophagidae han sido categorizadas como parásitos asociados a varias familias de anuros‚ incluso en anuros del mismo género (P. thectopternus. A pesar de la información colectada es imposible concluir con certeza que esto es un caso de depredación o parasitismo‚ incluso cuando la evidencia externa permite suponer que esto es un caso de parasitismo.

  3. Primer Reporte de Huevos de Mosca de la Carne (Diptera: Sarcophagidae) en Pristimantis achatinus (Anura: Craugastoridae) de Colombia -resumen-

    OpenAIRE

    Sebastian Escobar-Vargas; Mateo Marín-Martínez; Juan C Zuluaga-Izasa

    2014-01-01

    En el marco de un proyecto para el estudio de la microflora bacteriana gramnegativa asociada a la cloaca de ranas de la especie Pristimantis achatinus‚ se hizo el hallazgo de huevos de individuos de la familia Sarcophagidae (Díptera) depositados en la cloaca de una de las ranas. El material cloacal fue extraído con micropipetas de punta amarilla (10-100µL) y fue disuelto en caldo peptonado e incubado a 37°C durante 24 horas. Posteriormente‚ 0‚1mL de la muestra fueron sembrados por extensión e...

  4. Detección de alérgenos de huevo en fideos secos por método de elisa Detection of egg allergens in dried pasta using elisa method

    Directory of Open Access Journals (Sweden)

    María Julieta Binaghi

    2012-06-01

    Full Text Available Debido a la inminente incorporación al Código Alimentario Argentino del artículo 235 séptimo que contempla la rotulación de alérgenos en alimentos, resulta necesario realizar el control de productos comerciales para detectar la posible presencia de proteínas alergénicas. En la elaboración de fideos secos y de productos a base de harina de trigo pan y/o sémola de trigo candeal es probable la presencia de alérgenos de huevo por contaminación cruzada. El objetivo del presente trabajo fue determinar por un método de ELISA la posible contaminación con proteínas de huevo en productos elaborados con harina de trigo pan y/o sémola de trigo candeal provistos por una industria para verificar una posible contaminación con proteínas de huevo y analizar muestras comerciales con leyendas precautorias. Se analizaron diecinueve productos a base de harina de trigo pan y/o sémola de trigo candeal provistos por una industria y nueve muestras de fideos secos comerciales. El alérgeno huevo se analizó con kit de huevo de la marca r-biopharm. Las muestras se analizaron por duplicado siguiendo el protocolo de trabajo del kit. Entre las muestras provistas por la industria había: productos elaborados en línea cercana a elaboración de pastas con huevo en los que se obtuvieron valores por debajo del límite de cuantificación del kit; productos elaborados con bajo porcentaje de productos molidos que pudieron elaborarse con huevo, en los que se obtuvieron cantidades muy bajas de alérgeno huevo (menores a 5 ppm y productos elaborados con alto porcentaje de productos molidos que pudieron haberse elaborado con huevo en los que se obtuvieron concentraciones mayores de huevo (mayores a 5 ppm de huevo en polvo. En las muestras comerciales hubo cinco que presentaron concentraciones por debajo o igual al límite de cuantificación mientras que en las otras cuatro se obtuvieron concentraciones entre 5 y 12 ppm de huevo en polvo con el kit de r-biopharm. De

  5. Conocimientos, opiniones y prácticas respecto al huevo de gallina en familias de comunidades urbana-rural, Costa Rica Knowledge, opinions and practices related to chicken eggs in families of urban-rural communities, Costa Rica

    Directory of Open Access Journals (Sweden)

    Marcela Peña Vázquez

    2011-06-01

    Full Text Available Objetivo: Indagar sobre los conocimientos, opiniones y prácticas de la población respecto al consumo de huevo de gallina, con el objetivo de poder orientar los mensajes que se dirigen a la población en general, para mejorar el uso del mismo en los hogares. Materiales y método: Estudio descriptivo que aplica técnicas cualitativas y se apoya en variables cuantitativas. La población está compuesta por familias que residen en los distritos Central de Alajuela o Piedades de Santa Ana. Se empleó una muestra, seleccionada a conveniencia, 23 familias de Alajuela Centro y 29 de Piedades de Santa Ana. Además se trabajó con el personal de salud que labora en los Equipos Básicos de Atención en Salud. Resultados: Con respecto a conocimientos, las participantes conocen que el huevo es fuente de proteínas y vitaminas. Prefieren los huevos caseros y de cáscara de color oscuro; sin embargo consumen más los huevos industriales. Las razones de consumir huevo son la costumbre, buen sabor, versatilidad, rapidez y facilidad para prepararlo, además de un precio accesible. A nivel nutricional comparan el huevo con el aguacate y con alimentos pertenecientes al grupo de las carnes. Respecto a las prácticas, el huevo se consume en todos los tiempos de comida y principalmente en frituras. Discusión: no existen diferencias marcadas entre los conocimientos, prácticas y opiniones, entre población urbana y rural estudiada. Los conocimientos relacionados con el huevo tanto en las comunidades y el personal de salud son generales y difieren entre sí, dejando entrever una falta de información en ambos gruposObjective: To inquire into the knowledge, views and practices of the population regarding the consumption of chicken eggs, in order to target messages that go to the general population, to improve the use of the same household. Materials and Methods: A descriptive study applies techniques based on qualitative and quantitative variables. The population

  6. FACTORES AMBIENTALES QUE AFECTAN LA EDAD AL PRIMER PARTO Y PRIMER INTERVALO DE PARTOS EN VACAS DEL SISTEMA DOBLE PROPOSITO

    OpenAIRE

    Caty Martínez B; Luz Botero A; Oscar Vergara G

    2009-01-01

    Objetivo. Determinar los factores que influyen en la edad al primer parto (AFC) y primer intervalo de parto (PIDP) en hembras bovinas bajo el sistema de doble propósito, en la finca “El Rodeo”, municipio de Magangué, Bolívar - Colombia. Materiales y métodos. Se analizaron 379 datos provenientes de los registros productivos entre los años 1993 hasta 2002, usando el programa estadístico GLM del Statistical Analysis System, donde se obtuvieron la media y el error estándar de cada fuente de vari...

  7. Oferta y demanda de servicios de salud en Manizales. Primer semestre 1995 al primer semestre 1997.

    Directory of Open Access Journals (Sweden)

    Alba Lucía Vélez Arango

    2009-10-01

    Full Text Available Se analizó el comportamiento de los indicadores de cobertura de afiliación al Sistema de Seguridad Social en Salud (SSSS, capacidad instalada de las instituciones del sector en términos de recursos físicos y humano, extensión e intensidad de uso de la consulta externa médica general, consulta odontológica y consulta de urgencia, al igual que la utilización de los servicios hospitalarios en términos de porcentaje ocupacional y productividad, en el período comprendido entre enero, 1995 y diciembre, 1996. En el período de estudio se observó en Manizales un aumento en la afiliación al SSSS en el régimen contributivo, pasando de 262,858 afiliados en 1995 a 311,901 a diciembre de 1996, lo cual representó un aumento de 18% con una cobertura aproximada de 80% del total de la población objetivo. En relación con la cobertura de afiliación en el Régimen Subsidiado a finales de 1996 se informó un total de 37,177 afiliados al SSSS en la ciudad de Manizales, representando una cobertura de 80% de la población identificada mediante el Sistema de Identificación de Población (SISBEN. En lo que tiene que ver con la extensión de uso se observó un aumento en la consulta odontológica, consulta externa médica general y consulta de urgencias durante el período 1995-1997. En relación con la intensidad de uso no se observó una variación significativa en la consulta externa médica general y de urgencias, mientras que la consulta odontológica presentó un ligero aumento en 1997. En cuanto a la utilización de los servicios de hospitalización se observaron diferencias apreciables entre las distintas Empresas Sociales del Estado existentes en la ciudad. Por último, los resultados encontrados en relación con la utilización de los servicios de hospitalización durante el período 1995-1997 tienen gran importancia para el análisis de la oportunidad y calidad de la atención en salud y en la planeación de la infraestructura de servicios

  8. Eficacia, seguridad y parámetros predictivos de eventos adversos del tratamiento de inmunoterapia oral en niños alérgicos a proteínas de huevo y leche de vaca. Evolución de parámetros inmunológicos humorales a lo largo del seguimiento

    OpenAIRE

    Vázquez Ortiz, Marta

    2013-01-01

    INTRODUCCIÓN La inmunoterapia oral (ITO) es un tratamiento experimental prometedor para alergia alimentaria, que es una enfermedad prevalente que afecta la salud y la calidad de vida. OBJETIVOS 1. Evaluar eficacia y seguridad de ITO en niños alérgicos a huevo y leche de vaca de 5 a 18 años. 2. Definir fenotipos clínicos de acuerdo al perfil de seguridad observado durante ITO. 3. Analizar la utilidad de los parámetros clínicos e inmunológicos basales para predecir el r...

  9. Luis López-Ballesteros: primer traductor de las obras completas de Freud al castellano

    OpenAIRE

    Juan Manuel Martín Arias; Lorenzo Gallego Borghini

    2011-01-01

    El castellano fue el primer idioma al que se tradujeron las obras completas de Sigmund Freud. A ello contribuyeron diversos factores, entre los que se destaca la figura de Luis López-Ballesteros, a quien le encargó la traducción la editorial Biblioteca Nueva. En este artículo se esbozan someramente la recepción del psicoanálisis en España y las traducciones de Freud al español y se ofrece una breve semblanza de Luis López-Ballesteros. --------------------------------------------- Luis López-B...

  10. Digestibilidad alergenicidad in vitro y efecto inmunomodulador de proteínas de huevo procesado

    OpenAIRE

    Jiménez Saiz, Rodrigo

    2012-01-01

    La alergia a alimentos es un problema de salud mundial, siendo la alergia a huevo de las más prevalentes en niños. Los alérgenos principales del huevo son la ovoalbúmina (OVA) y el ovomucoide (OM), aunque la lisozima también es relevante dada su ubiquidad. En esta tesis doctoral se ha comprobado que el procesado habitual de los alimentos, como el tratamiento térmico o el almacenamiento, o la matriz alimentaria (presencia de lípidos y polisacáridos), puede reducir o aumentar la capacidad de un...

  11. El alga Sargassum spp. como alternativa para reducir el contenido de colesterol en el huevo

    OpenAIRE

    Silvia Carrillo; Bahena, A.; M. Casas; Carranco, M.E.; C.C. Calvo; E. Ávila; F. Pérez-Gil

    2012-01-01

    Para determinar el efecto que tiene en el contenido de colesterol del huevo la adición del alga marina (AM) Sargassum spp. en la dieta de gallinas ponedoras, se utilizaron 225 gallinas Leghorn, de 19 semanas de edad, distribuidas al azar en cinco tratamientos (0, 2, 4, 6 y 8 % del alga marina). El experimento tuvo una duración de cinco semanas, durante las que se registraron las variables productivas. La calidad física se evaluó en 75 huevos por tratamiento. Se tomaron 35 piezas de cada trata...

  12. Les primeres locutores de ràdio a Catalunya, dels inicis de l’invent al primer franquisme

    OpenAIRE

    Espinosa i Mirabet, Sílvia

    2009-01-01

    Aquest article posa de manifest el paper preponderant que tingueren les locutores en les emissores de ràdio que operaven a Catalunya sota l’epígraf EAJ durant els anys vint i trenta del segle XX. Les locutores foren les primeres professionals del mitjà que crearen programes (els femenins) amb un format que més endavant es coneixeria com a magazín, en un moment històric (anys vint) en el qual la ràdio estava plena de conferències i xerrades. La segona gran aportació de les dones a la història ...

  13. Congelación de semen de carnero en pellets con los diluyentes Tris-glucosa-yema de huevo o Lactosa-yema de huevo

    Directory of Open Access Journals (Sweden)

    F. I. Brito

    2004-01-01

    Full Text Available El objetivo del trabajo fue comparar la recuperación de la motilidad al descongelar el semen congelado en pellets utilizando el diluyente Tris glucosa-yema de huevo o Lactosa-yema de huevo. Se obtuvieron 30 eyaculados de nueve carneros por medio de una vagina artificial y se evaluó el volumen, la motilidad progresiva, la concentración y la morfología espermática. Cada eyaculado se dividió en dos partes, una de ellas se diluyó con Tris-glucosa yema de huevo y la otra con Lactosa yema de huevo, de manera que la dilución final contuviera 100 x 106 de espermatozoides en 0.1 ml. Los pellets se prepararon goteando 0.1 ml del semen diluido en perforaciones realizadas en hielo seco. Se evaluó la motilidad inicial, después de diluir y al descongelado. Se evaluó la motilidad de cinco pellets de cada eyaculado preparado con cada diluyente (300 en total. Los datos se analizaron estadísticamente mediante análisis de varianza, considerando la motilidad progresiva como variable dependiente y transformando al arcoseno los valores expresados en porcentaje. No se encontraron diferencias en la motilidad inicial de los eyaculados diluidos con tris o Lactosa (P>0.05. La motilidad espermática al descongelar fue significativamente mayor (P<0.05 en el semen diluido con Lactosa-yema (45.8%, que con Tris-glucosa-yema (40.2%

  14. Luis López-Ballesteros: primer traductor de las obras completas de Freud al castellano

    Directory of Open Access Journals (Sweden)

    Juan Manuel Martín Arias

    2011-12-01

    Full Text Available El castellano fue el primer idioma al que se tradujeron las obras completas de Sigmund Freud. A ello contribuyeron diversos factores, entre los que se destaca la figura de Luis López-Ballesteros, a quien le encargó la traducción la editorial Biblioteca Nueva. En este artículo se esbozan someramente la recepción del psicoanálisis en España y las traducciones de Freud al español y se ofrece una breve semblanza de Luis López-Ballesteros. --------------------------------------------- Luis López-Ballesteros: the first Spanish translator of Freud's complete works. Sigmund Freud's complete works were translated first into Spanish. Several factors contributed to this circumstance, not least among them the figure of Luis López-Ballesteros, who was entrusted with the translation by publishing house Biblioteca Nueva. In this article we briefly outline the reception of psychoanalysis in Spain and the translations of Freud into Spanish. We also give a brief biographical sketch of Luis López-Ballesteros.

  15. Modificación en la composición de ácidos grasos del huevo al incluir aceite de sardina y ácido linoleico conjugado en dietas para gallinas ponedoras Modulation in egg fatty acids composition when laying hens diets are supplemented with sardine oil and conjugated linoleic acid

    Directory of Open Access Journals (Sweden)

    S Carrillo

    2012-01-01

    Full Text Available Actualmente el consumo regular de ácidos grasos omega 3 (C18:3 ALA, C20:5 EPA, C22:6 DHA y de ácido linoleico conjugado (C18:2 CLA es recomendado debido a la importancia que estos compuestos bioactivos tienen en la prevención y control de enfermedades cardiovasculares, diabetes y diferentes tipos de cáncer. El objetivo de este estudio fue determinar el efecto sobre la composición en ácidos grasos del huevo cuando la dieta de las gallinas es suplementada con aceite de sardina y CLA. 240 gallinas Bovans White fueron distribuidas aleatoriamente en cuatro tratamientos con cinco réplicas de 12 aves cada una. Los tratamientos fueron: testigo (T1 con una dieta basal, la misma que T1 más 2,5% de aceite de sardina (T2, la misma que T2 pero adicionando 1% y 2% de CLA (T3 y T4 respectivamente. El ensayo experimental tuvo una duración de cuatro semanas. Al final de este período, 50 huevos de cada tratamiento fueron tomados para realizar la determinación de ácidos grasos por cromatografía de gases. Con respecto al tratamiento testigo, los resultados mostraron un incremento en la concentración total de ácidos grasos omega 3 (1,6% vs 6,0% del total de ácidos grasos y de CLA (0,7% vs 3-5% del total de ácidos grasos en el huevo de los tratamientos T3, T4 y T5 en conjunto, y una relación n6:n3 de 11:1 vs 1.3:1 (P The regular intake of omega 3 fatty acids (C18:3 ALA, C20:5 EPA, C22:6 DHA and conjugated linoleic acid (C18:2 CLA is currently recommended due to their importance in the prevention and control of cardiovascular diseases, diabetes and several types of cancer. The aim of this study was to determine the effect of supplementing laying hens diets with sardine oil and CLA on egg fatty acid composition. 240 Bovans White hens were randomly distributed into four treatments with 5 replicates of 12 hens each one. The treatments consisted in a control diet (T1, T1 plus 2.5% of sardine oil (T2, and T2 padded with 1% and 2% of CLA (T3 and T4

  16. Bajo peso al nacer, crecimiento y desarrollo en el primer año de vida

    Directory of Open Access Journals (Sweden)

    Elia Rosa Lemus Lago

    1997-04-01

    Full Text Available Se efectuó un estudio descriptivo, longitudinal y retrospectivo en el área de salud del Policlínico Docente "19 de Abril" con los niños nacidos con peso inferior a los 2 500 g, en el año 1994, y se siguió su evolución clínica durante el primer año de vida, que correspondió a una muestra de 23 infantes. Los datos fueron recogidos de las historias clínicas individuales de los niños y de la embarazada. Se analizaron los parámetros peso, talla, circunsferencia cefálica, valoración nutricional y desarrollo psicomotor. Predominó el bajo peso para la edad gestacional con un 65,2 y el 34,7 % correspondió a los nacidos antes del término de la gestación. El 100 % de los pretérmino al año de vida tuvieron una valoración nutricional normal. No se comportaron de igual forma los de bajo peso para la edad gestacional en los que el 20 % quedaron por debajo del 3er. percentil.A descriptive, longitudinal and retrospective study was conducted at the health area of the "19 de Abril" Teaching Polyclinic. 23 infants who were born in 1994 with a birth weight < 2 500 g were included in the sample. Their clinical evolution was followed during the first year of life. The data were obtained from the individual medical histories of the children and of the pregnant women. The following parameters were analyzed: weight, size, cephalic perimeter, nutritional assessment and psychomotor development. Low weight prevailed for the gestational age with 65.2 %, whereas 34.7 % corresponded to preterm deliveries. 100 % of the preterm infants had a normal nutritional assessment after the first year of life. However, 20 % of those with low weight at the gestational age remained under the third percentile.

  17. Primer caso de resistencia al amitraz en la garrapata del ganado Boophilus microplus en México

    OpenAIRE

    Noé Soberanes Céspedes; Minerva Santamaría Vargas; Hugo Fragoso Sánchez; Zeferino García Vázquez

    2002-01-01

    El objetivo de este estudio fue documentar el primer caso de la resistencia de la garrapata B. microplus al Amitraz, en México. Se obtuvo una muestra de garrapatas B. microplus del municipio de Emiliano Zapata, Tabasco, con reportes de fallas de control con este acaricida. La cepa de garrapatas fue denominada “San Alfonso” y se utilizaron larvas (F1) provenientes de la generación parental de hembras repletas, éstas se probaron con dosis discriminate de Amitraz 0.0002 %, (Taktic®) en formulaci...

  18. Demo 94. Campana de vacío : hinchar un globo sin soplar y cocer un huevo en el Everest

    OpenAIRE

    Garro Martínez, Núria

    2013-01-01

    Objetivo: a) Hinchar un globo sin soplar: Experimentar la relación entre el volumen y la presión de los gases. Demostrar que es posible hinchar un globo sin insuflar aire en su interior, reduciendo la presión (atmosférica). b) Cocer un huevo en el Everest: Comprobar la disminución del punto de ebullición del agua al reducir la presión (atmosférica)

  19. La salud de las gallinas es la calidad del huevo

    OpenAIRE

    Callejo Ramos, Antonio

    2011-01-01

    La bioseguridad en la producción de huevos pretende limitar la entrada de gérmenes en una granja, evitar que se multipliquen y difundan los que están dentro y tratar de eliminarlos, así como aumentar la resistencia de los animales a las enfermedades. Un correcto manejo de las instalaciones y de los animales reducirá las posibilidades de infección.

  20. Apgar bajo al nacer y convulsiones neonatales. Desarrollo motor grueso en el primer año de vida.

    Directory of Open Access Journals (Sweden)

    Carlos Armando Echandía

    2009-11-01

    Full Text Available Objetivo: Determinar si haber tenido un Apgar bajo a los cinco minutos y/o convulsiones neonatales aumenta el riesgo de trastornos del desarrollo motor grueso, que se identifican como resultado anormal de Infanib al año de edad. Diseño: Cohorte histórica. Escenario: Programa de seguimiento de recién nacidos de riesgo en un hospital de nivel 1 de complejidad, con una población de estrato socioeconómico bajo de Cali entre 1989 y 1997. Población: Se incluyeron 287 lactantes que completaron un año de seguimiento en el programa. Intervenciones: No aplica. Desenlaces principales: Frecuencia de compromiso neuromotor estimado mediante la prueba de Infanib. Resultados: Al año se evaluaron 80% de los niños que eran parte del programa. En 39 (13.6% hubo un Apgar anormal a los 5 minutos. En 36 (12.5% presentaron convulsiones neonatales, asociadas principalmente con asfixia perinatal severa e hipoglicemia. La prueba de Infanib fue anormal en 47 niños para una incidencia acumulada de 16.4% y una densidad de incidencia de 1.3 casos nuevos por 100 lactantes-año. La presencia de convulsiones se asoció con un Infanib anormal (RR crudo = 2.39 IC 95% 1.37-4.16. No hay modificación de efecto entre Apgar bajo y convulsiones. De los potenciales modificadores de efecto sólo el antecedente de meningitis bacteriana confundió el estimativo de la asociación entre convulsiones y un Infanib anormal. Conclusiones: Tanto las convulsiones neonatales como la meningitis bacteriana se asociaron independientemente con un Infanib anormal al año. Las convulsiones son un factor de riesgo importante (RR ajustado = 2.51 IC 95% 1.10-5.72 y fácil de reconocer que permite al clínico identificar pacientes con alto riesgo de compromiso neuromotor durante el primer año de vida.

  1. El consumo de huevos podría prevenir la aparición de deficiencia de vitamina D en escolares

    Directory of Open Access Journals (Sweden)

    Elena Rodríguez-Rodríguez

    2013-06-01

    Full Text Available Introducción: La vitamina D es esencial para la prevención de diversas enfermedades crónicas. Aunque se puede sintetizar a nivel cutáneo, esta fuente no es siempre suficiente para cubrir sus necesidades, por lo que el consumo de alimentos ricos en la misma, como el huevo, podría ser muy beneficioso en individuos que están en riesgo de presentar deficiencia. Objetivo: Estudiar la relación entre el estatus en vitamina D y el consumo diario de huevos en un colectivo de escolares. Metodología: Se incluyeron 564 escolares (9 a 12 años de la Comunidad de Madrid. La ingesta de alimentos, de energía y nutrientes (incluidos el huevo y la vitamina D, se determinó empleando un registro del consumo de alimentos durante 3 días. Se calculó el Índice de Masa Corporal a través del peso corporal y la talla. Se valoró el colesterol total, lipoproteínas, triglicéridos y vitamina D sérica. Resultados: El consumo medio de huevos fue de 32,7 ± 20,9 g/día (inferior a 0,5 huevo/día recomendados en el 36,3% de los escolares. Se dividió a los escolares en función de que tuvieran un consumo > o < 0,5 huevo/día (grupos SH e IH, respectivamente. La ingesta y los niveles séricos de vitamina D fueron significativamente superiores en el grupo SH que en el IH. Además, los primeros tuvieron menor riesgo de presentar deficiencia moderada de vitamina D (< 50 nmol/L (OR = 0,41 (0,19-0,88; p = 0,022. No se observaron diferencias significativas entre los grupos en relación con las cifras de colesterol total y triglicéridos. Conclusión: Es recomendable fomentar el consumo de al menos 0,5 huevo/día entre la población infantil debido a su alto contenido en vitamina D, lo que podría evitar la aparición de problemas de salud.

  2. Mecanismos de tribalización en la patagonia: desde la gran crisis al primer gobierno peronista.

    Directory of Open Access Journals (Sweden)

    Walter Delrio

    2005-12-01

    Full Text Available En 1937 el gobierno argentino decide desalojar y trasladar a la tribu Nahuelpán bajo acusaciones de extranjería e in-civilización. Luego de seis años, la medida es revisada y se inicia un proceso de restitución parcial de las tierras involucradas seleccionándose desde el estado a quienes se continuaría reconociendo como "tribu" Nahuelpán. A partir de este caso enmarcado en el contexto de las relaciones establecidas por las comunidades indígenas del territorio nacional de Chubut con las autoridades nacionales y las redes locales de poder, se propone un análisis del proceso de construcción del espacio social para los pueblos originarios en la matriz estado-nación-territorio en el período que va de la gran crisis del '30 al primer gobierno peronista. Se abordan en particular los mecanismos de tribalización en la interfase entre políticas oficiales y agencia aborigen.In 1937, the Argentine government decided to displace and remove the Nahuelpán tribe accused of foreign and uncivilized behavior. Six years later this measure was reviewed starting a process of partial land restitution in which the state selected who will continue to be considered as member of the above mentioned tribe. Focusing in that case, framed by the relationship established between indigenous communities of the national territory of Chubut and state authorities or local nets of power, this article analyzes the process leading to the construction of a social space in the state-nation-territory matrix since the 1930' great crisis until the first period of President Juan Perón.

  3. Modificación en la composición de ácidos grasos del huevo al incluir aceite de sardina y ácido linoleico conjugado en dietas para gallinas ponedoras Modulation in egg fatty acids composition when laying hens diets are supplemented with sardine oil and conjugated linoleic acid

    OpenAIRE

    Carrillo, S.; E. Ávila; C.Vásquez; C Calvo; ME Carranco; F. Pérez-Gil

    2012-01-01

    Actualmente el consumo regular de ácidos grasos omega 3 (C18:3 ALA, C20:5 EPA, C22:6 DHA) y de ácido linoleico conjugado (C18:2 CLA) es recomendado debido a la importancia que estos compuestos bioactivos tienen en la prevención y control de enfermedades cardiovasculares, diabetes y diferentes tipos de cáncer. El objetivo de este estudio fue determinar el efecto sobre la composición en ácidos grasos del huevo cuando la dieta de las gallinas es suplementada con aceite de sardina y CLA. 240 gall...

  4. Efecto de grupo racial y edad al primer parto sobre el número de partos durante la vida útil de vacas cebú

    OpenAIRE

    JC Segura-Correa; JG Magaña-Monforte; F Centurión-Castro; VM Segura-Correa

    2013-01-01

    El objetivo del estudio fue determinar el efecto de grupo racial (GG) y grupo de edad al primer parto (EPP) sobre el número de partos de por vida de las vacas de un sistema de producción localizado en el estado de Yucatán, México. Los datos incluyeron los registros de 765 vacas de los grupos raciales Brahman (Br, n=313), Nelore (Ne, n = 184) y Cebú comercial (CC, cruzas indefinidas de Suizo pardo y Cebú (n = 268), nacidas de 1981 a 2002. Del total de vacas, 391 habían sido desechadas y 374 aú...

  5. Regímenes de transición al primer empleo: Chile, México, Estados Unidos y Uruguay comparados

    OpenAIRE

    Tabaré FERNÁNDEZ; Soledad BONAPELCH; Vanessa ANFITTI

    2013-01-01

    Dentro de los estudios de cursos de vida, el ingreso al mercado de trabajo comprende el conjunto de eventos de transición que marcan el final de un status social de inactividad económica y el comienzo de un status de responsabilidades y posible acceso a una independencia económica. El propósito de este artículo es describir el calendario con que se produce el primer empleo cronológico en Chile, México, Uruguay y Estados Unidos, adaptando y contrastando hipótesis macrosociales e...

  6. l aceite de atún como fuente de ácidos grasos ω-3 en el huevo de gallina

    Directory of Open Access Journals (Sweden)

    Vázquez-Valladolid, J. L.

    2005-06-01

    Full Text Available Fish oils are a source of polyunsaturated omega 3 fatty acids (AG ω3, mainly eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA, which supply many benefits to human health. Tuna oil was used as a source of marine 3ω FA to enrich eggs by supplementing the diet of egg-laying hens with tuna oil. One hundred and twenty White Leghorn hens of 90 weeks old were allocated on three treatments with four replicates each, on a completely random design. Treatments consisted of adding 1 % and 2 % of tuna oil to the diets. The total lipids and ω3FA of the eggs were determined. The egg-laying hen dietary tuna oil supplement (1 and 2 % enriched eggs with 300 % more EPA (0.40, 1.37, 1.54 mg/g lipids and DHA (7.90, 24.67, 24.50 mg/g lipids versus the control egg . The ω6:ω3 ratio decreased ( 11.4:1, 3.8:1, 3.0:1 as dietary tuna oil increased. There were no differences (p>0.05 among treatments in productive performance and egg quality, except egg weight which decreased with the tuna oil.Los aceites de pescado son una fuente de lípidos poliinsaturados de origen animal, principalmente de los ácidos grasos omega-3 (AG ω-3, eicosapentaenoico (EPA y docosahexaenoico (DHA, beneficiosos para la salud. En este trabajo se utilizó el aceite de atún como fuente de estos nutrientes en el huevo para consumo. Se utilizaron 120 gallinas blancas Leghorn Isa-Babcock B-300 de 90 semanas de edad, distribuidas al azar en tres tratamientos, con cuatro réplicas cada uno. Los tratamientos consistieron en adicionar 1% y 2% de aceite de atún en la dieta de las gallinas ponedoras. Se determinaron los lípidos totales y AG ω-3 en el huevo, obteniéndose 300 % más de EPA (0,40, 1,37, 1,54 mg/g lípidos y DHA (7,90, 24,67, 24,50 mg/g lípidos al adicionar 1 y 2% de aceite de atún en la dieta de las aves, que en el grupo testigo. La relación ω-6: ω-3 en el huevo disminuyó con el suplemento dietético de aceite de atún (11,4:1, 3,8:1, 3:1, lo mismo ocurri

  7. Phonics Primer

    Science.gov (United States)

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  8. Descripción del nido y huevos de la matraca serrana (Campylorhynchus gularis)

    OpenAIRE

    Adrián Ceja-Madrigal; Javier Salgado-Ortiz

    2013-01-01

    El nido y huevos de la matraca serrana (Campylorhynchus gularis) han permanecido como formalmente no descritos de acuerdo con algunos autores. Aquí, describimos las características físicas y las dimensiones promedio del nido y huevos de una población del Área Natural Protegida Cerro Punhuato en Morelia, Michoacán. Como parte de un estudio de su biología reproductiva, colectamos dos nidos de la matraca serrana durante la temporada reproductiva del año 2010, describiéndolos como similares en la...

  9. La calcárea phosphórica en el mejoramiento de la calidad de la cáscara del huevo en gallinas ponedoras (Phosphoric calcarea on the impruvement of egg shell thickness quality in eggs laying hens

    Directory of Open Access Journals (Sweden)

    Estrada, C., Osmaida; Larrent, N., Marroquin, T. Angelita; Cos, D. Yusell, Bárzaga, G.

    2008-03-01

    Full Text Available ResumenEl presente trabajo se realizó en una granja de ponedora comercial raza White Leghorn (L33 en baterías. Con el objetivo de evaluar la utilización de la Calcárea phosphórica como estimulante para mejorar la calidad de la cáscara del huevo, se escogieron al azar un total de 50 jaulas con 4 gallinas por jaula, por un total de 200 animales; se establecieron dos grupos de estudio de 100 aves cada uno, control y experimental al que se le suministró: Calcárea phosphorica 12CH en solución hidroalcohólica, evaluando los siguientes indicadores: grosor de la cáscara, % huevos cascados, % de huevos rotos, y como indicador complementario, producción de huevos. Para el procesamiento estadístico de los datos se utilizó la prueba de hipótesis para dos proporciones, mediante el paquete estadístico Statistic versión 6.0 para Windows. Se pudo evidenciar que la producción total de huevos, grosor de la cáscara y % de huevos rotos y cascados tuvo mejores resultados en el grupo experimental. Se concluye que la aplicación de la Calcárea phosphorica influye positivamente sobre los indicadores previamente mencionados.Abstract This work was done at the layer farm, the breed exploited being the White Leghorn (L33 in battery.With the objective to evaluate the homeopathic remedy “Calcárea Phosphorica” 12CH in hydro alcoholic solution was applied at a dose of 5 drops or 0.25ml per animal in drinking water. 50 cages with 4 animals per cage were selected randomly, giving a total of 200 animals, 25 control cages and 25 subject cages. The following indicators were observed and monitored: egg shell thickness, cracked egg shell percentage, broken egg shell percentage, the final eggs production, % of broken eggs, Statistic package version 6.0 was used for statistical processing Hypothesis test was made for two proportions. Were observed better results in the experimental group with relation of egg shell thickness, cracked egg shell percentage, broken

  10. La calcárea phosphórica en el mejoramiento de la calidad de la cáscara del huevo en gallinas ponedoras (Phosphoric calcarea on the impruvement of egg shell thickness quality in eggs laying hens)

    OpenAIRE

    Estrada, C., Osmaida; Osmaida .; Larrent, N.; Marroquin, T.; Angelita; Cos, D., Yusel.; Yusell; Bárzaga, G.

    2008-01-01

    ResumenEl presente trabajo se realizó en una granja de ponedora comercial raza White Leghorn (L33) en baterías. Con el objetivo de evaluar la utilización de la Calcárea phosphórica como estimulante para mejorar la calidad de la cáscara del huevo, se escogieron al azar un total de 50 jaulas con 4 gallinas por jaula, por un total de 200 animales; se establecieron dos grupos de estudio de 100 aves cada uno, control y experimental al que se le suministró: Calcárea phosphorica 12CH en soluc...

  11. Reología de derivados de la yema de huevo deshidratada

    Directory of Open Access Journals (Sweden)

    Partal, Pedro

    2000-08-01

    Full Text Available The emulsification process, as weIl as and the emulsion rheology and stability, greatly depends on the rheological properties of the continuous phase, the most important ingredient of which is yolk. However, since native yolk is not microbiologically stable, processing of yolk, such as spray-drying, is necessary for food applications. The influence of processing by spray-drying on the microstructure and rheological properties of yolk was investigated using oscillatory, creep and steady state flow measurements. The spray-drying process produces denaturation of proteins giving rise to a dramatic change from a fluid-like behaviour, as corresponds to the native yolk, to a gel-like behaviour corresponding to the reconstituted dried yolk (45% solids. Temperature exerts a slight influence on the linear viscoelastic properties of processed yolk.Tanto el proceso de emulsificación como las propiedades reológicas y la estabilidad de una emulsión alimentaria, tipo mayonesa, dependen en gran medida de la microestructura y la reología de la fase continua acuosa, cuyo ingrediente principal es la yema de huevo. Debido a la inestabilidad microbiológica de ésta se hacen necesarios procesos de deshidratación por atomización para conservarla con fines alimentarios. En este trabajo se trata de determinar la influencia que ejerce la deshidratación sobre la microestructura analizando las propiedades reológicas de la yema mediante ensayos reológicos de cizalla oscilatoria, de flujo en estado estacionario y de fluencia viscosa. Se llegó a la conclusión de que la deshidratación produce la desnaturalización de las proteínas provocando un cambio desde un comportamiento tipo fluido (yema nativa a un comportamiento tipo gel (yema deshidratada reconstituida al 45% en sólidos. Por otro lado, se ha observado una escasa variación de las propiedades viscoelásticas lineales de la yema deshidratada con la temperatura.

  12. Características técnico-sanitarias de expendios de carnes, pescados, aves y huevos de la ciudad de Tunja 2003

    Directory of Open Access Journals (Sweden)

    Fred Gustavo Manrique-Abril

    2011-02-01

    Full Text Available Se presenta una caracterización epidemiológica de los expendios de carnes, pescado y aves de Tunja en el año 2003, resultado del diagnóstico sanitario del municipio y las visitas adelantadas por la unidad de saneamiento. Al partir del compromiso que el sector salud tiene en el componente de ambiente, surge la necesidad de crear un sistema de vigilancia epidemiológica ambiental, cuya metodología y estrategia esté orientada hacia el conocimiento de los factores de riesgo ambientales a que están expuestos los grupos humanos, con el fin de determinar prioridades y orientar los recursos de salud disponibles en el desarrollo de intervenciones; es por eso que se implantó en Tunja la vigilancia de factores de riesgo del consumo en esta estrategia, la cual, incluye la de expendios decarnes y derivados, aves huevos y pescado; entonces, se usaron las actas de inspección sanitaria y se tabuló en EPIINFO 2002 para su análisis con SPSS 11,5. Así se realizó un análisis descriptivo a 173 establecimientos y se encontró que existen condiciones diversas de sanidad respecto de la estructura física, los procesos productivos y el producto para la venta; también hay un incumplimiento de normas técnico-sanitarias, en diferentes sectores de la ciudad, que se priorizan para el control por parte de la autoridad sanitaria. Al 75% de los establecimientos no cumplen con las condiciones higiénico sanitarias en cárnicos; el 66,6% no cuenta con las condiciones en establecimiento de venta de pescados ý el 52,5% delos establecimientos de venta de aves y huevos, no cumplen con las condiciones higiénico sanitarias para tal fin.

  13. Influence of nutritional and management practices on productive performance and egg quality of brown egg-laying hens = Influencia de factores nutricionales y de manejo sobre la productividad y calidad del huevo en gallinas ponedoras rubias

    OpenAIRE

    Perez-Bonilla, A.

    2012-01-01

    El objetivo general de esta Tesis Doctoral fue estudiar la influencia de diversos factores nutricionales y de manejo sobre la productividad y la calidad del huevo en gallinas ponedoras comerciales rubias. Los factores estudiados fueron: 1) Cereal principal y tipo de grasa en la dieta; 2) Nivel de proteína bruta y grasa en la dieta; 3) Nivel energético de la dieta; 4) Peso vivo al inicio del período de puesta. En el experimento 1, la influencia del cereal principal en la dieta y el tipo de gra...

  14. Molino de martillos vs. Molinos de rodillo si efectos de l a molienda del cereal principal de la dieta sobre la productividad y la calidad del huevo en gallinas ponedoras rubias.

    OpenAIRE

    Perez-Bonilla, A.; Frikha, M.; Mohiti-Asli, M.; Martín Díaz, A.; Garcia Alonso, Javier; Herrera, J.; Gonzalez Mateos, Gonzalo

    2013-01-01

    La influencia del cereal principal de la dieta y el tipo de molienda sobre los parámetros productivos y la calidad del huevo fue estudiada en 420 ponedoras rubias de la estirpe Hy -Line en el período 24 a 59 semanas de vida. Se utilizó un diseño completamente al azar con 6 tratamientos ordenados factorialmente bajo un esquema 3 x 2, con 3 tipos de cereales (cebada, trigo blando y maíz) y dos tipos de moliendas (molino de martillo o molino de rodillos). Cada tratamiento fue replicado 7 v...

  15. Evaluación sensorial de huevos de codorniz en conserva y composición nutricional (Sensory evaluation of pickled quail eggs and nutritional composition

    Directory of Open Access Journals (Sweden)

    González Sánchez José Fernando

    2011-08-01

    Full Text Available ResumenEl objetivo de este estudio fue evaluar la aceptabilidad de los huevos de codorniz en escabeche y determinar la composición nutricional de huevo de codorniz.SummaryThe aim of this study was to evaluate the acceptability of pickled quail eggs and determine the nutritional composition of quail egg

  16. Evaluación sensorial de huevos de codorniz en conserva y composición nutricional (Sensory evaluation of pickled quail eggs and nutritional composition)

    OpenAIRE

    González Sánchez José Fernando; Hernández Unzón Aideé

    2011-01-01

    ResumenEl objetivo de este estudio fue evaluar la aceptabilidad de los huevos de codorniz en escabeche y determinar la composición nutricional de huevo de codorniz.SummaryThe aim of this study was to evaluate the acceptability of pickled quail eggs and determine the nutritional composition of quail egg

  17. Estudio del mercado del huevo como materia prima para la elaboraci??n de ovoproductos

    OpenAIRE

    Zuluaga Duque, Diana Mar??a; Fern??ndez Sierra, Pilar

    2014-01-01

    En este estudio se realiza una descripci??n de la industria de los ovoproductos en el departamento de Antioquia, abordado desde dos posiciones: aceptaci??n del consumidor (ama de casa) y producci??n -- Para lograr este prop??sito, se realiz?? un estudio descriptivo con revisi??n de informaci??n de la industria del huevo y los ovoproductos tanto a nivel mundial como nacional y, l??gicamente, en el departamento en cuesti??n -- As?? mismo se realizaron entrevistas a un grupo de avicultores, y en...

  18. Desarrollo y caracterización de nuevos productos a partir de la yema de huevo y de sus fracciones

    OpenAIRE

    Valverde García, Damián

    2015-01-01

    El objetivo del presente trabajo ha sido el desarrollo y la caracterización de diferentes productos base a partir de la yema de huevo y sus fracciones (plasma y gránulos). Dicha caracterización ha sido llevada a cabo mediante diversas técnicas (reometría, texturometría, colorimetría, microscopia electrónica de barrido, evaluación sensorial y recuento de mesófilos totales). El empleo de derivados de huevo ha demostrado ser determinante en las propiedades de los diferentes productos. En las...

  19. Ingesta de huevo y factores de riesgo cardiovascular en adolescentes; papel de la actividad física: Estudio HELENA

    OpenAIRE

    Soriano-Maldonado, A.; Cuenca-García, M; Moreno, L A; González-Gross, M; Leclercq, C; Androutsos, O.; E. J. Guerra-Hernández; Castillo, M.J. (Manuel J.); Ruiz, J. R.

    2013-01-01

    Introducción: Las enfermedades cardiovasculares (ECVs) suponen la principal causa de morbi-mortalidad en los países occidentales. El incremento del colesterol plasmático se ha relacionado con el desarrollo de ECV. El huevo, por su alto contenido en colesterol, ha sido indirectamente relacionado con el riesgo de desarrollar ECVs. Objetivo: Examinar la asociación entre ingesta de huevo y factores de riesgo cardiovascular en adolescentes, estudiando si dicha relación está influenciada por la act...

  20. RETENCIÓN DE HUEVOS EN HEMBRA DE JABOTÍ-PIRANGA (Geochelone carbonaria - Spix, 1824 EN CAUTIVERIO

    Directory of Open Access Journals (Sweden)

    Fabiana Rodrigues da Silbeira, M.V

    2009-12-01

    Full Text Available Un Jabotí-Piranga adulto (Geochelone carbonaria, hembra, con peso de 3.5 kg ingresó por consulta en la escuela clínica “Dr. Cataldi Luiz de Souza”, del “Centro Universitário Serra dos Órgãos - Teresopolis, Río de Janeiro”, con historia de retención de huevos. En la evaluación clínica y radiológica, se encontró tres huevos en posiciones normales. Teniendo en cuenta la temporada de reproducción, se aconsejó la observación del animal. Después de un año, dicho animal regresó a la clínica por no haber todavía expulsado los huevos. Tras nuevo examen radiográfico se observó que los 3 huevos continuaban en la misma posición. A continuación, se aplicó 0.03 ml de oxitocina por vía subcutanea (10 UI x ml, en el apéndice anterior del animal. Tres horas después de la aplicación de la hormona, el animal expulsó los huevos naturalmente, sin la necesidad de una intervención quirúrgica, con lo que se puede sospechar de la eficacia de la aplicación de oxitocina para este procedimiento en jabotí Piranga.

  1. Herramienta de educación nutricional para alergicos a huevo y proteína de leche de vaca de edad pediátrica®

    Directory of Open Access Journals (Sweden)

    Ismael San Mauro Martín

    2014-05-01

    Full Text Available Introducción: La alergia alimentaria afecta a gran parte de la población y sus cifras siguen aumentando. Aunque, se esta avanzando en el conocimiento de la patología, los alérgicos encuentran grandes dificultades para llevar una vida normal, especialmente en lo relativo a su alimentación. Hasta ahora el colectivo no contaba con herramientas prácticas que les ayudasen en la elaboración diaria de una dieta equilibrada, como existen para la población en general, en forma de pirámides y guías alimentarias. Con este trabajo se ha cubierto esta necesidad para dos de las alergias más prevalentes en los primeros años de vida. Objetivos: Recopilar información sobre la alergia a la proteína de leche de vaca (APLV y huevo, para diseñar una pirámide alimenticia para estos pacientes, basada en los consensos, recomendaciones y guías científicas. Resultados: Tras comprobar la inexistencia de un trabajo similar, se diseñaron pirámides alimenticias para alérgicos a huevo y APLV, adaptadas a cada uno de ellos, así como una pirámide conjunta a ambas alergias. Además se incluyeron recomendaciones basicas para la alimentación saludable en general y, en particular, con interés especial para el colectivo (higiene alimentaria, aditivos alimentarios, productos de cosmética, medicamentos, etc. Conclusiones: Debido a la importancia que la nutrición adquiere en la infancia y las dificultades subyacentes a este colectivo, poder planificar adecuadamente la alimentación es muy importante pues puede prevenir accidentes y carencias nutricionales a largo plazo. Por ello, facilitar herramientas gráficas y prácticas para este fin, es de gran importancia comunitaria y medico-científico, y es el resultado de este trabajo.

  2. El jugo de naranja agria como estimulante de la producción de huevos en ponedoras comerciales (Sour orange juice as stimulant on the eggs production in egg laying hens

    Directory of Open Access Journals (Sweden)

    Rodríguez-Hidalgo, Richar

    2007-11-01

    Full Text Available Resumen El trabajo se realizó en una granja de ponedora comercial en batería piramidales; se seleccionaron mediante un diseño completamente aleatorizado, 168 gallinas White Leghor, línea L33 de 32 semanas de edad con el mismo índice de postura. Se conformaron dos grupos (A y B de 84 animales con 7 réplicas de 12 gallinas cada uno. Cada grupo fue ubicado dentro de la misma nave en hileros de 7 jaulas a razón de 4 gallinas por huecos. El grupo(A sirvió como control, mientras que el grupo (B se le aplicó jugo de naranja agria en el pienso a razón de 10 ml por animal en dos dosis diarias por animal. El manejo fue el mismo para los dos grupos, durante el experimento. Se evaluaron los indicadores producción final de huevos, huevos por gallinas, índice de postura, % de huevos rotos, cascados, sucios y en fárfara. Para el procesamiento de la información se utilizó el paquete estadístico Statistic versión 6.0 realizándose una prueba de hipótesis para dos medias y una prueba de hipótesis para dos proporciones. Se obtuvo diferencia significativa para p<0.05, en cuanto al porcentaje de la postura, porcentaje de huevos rotos, cascados y sucios, así como la viabilidad del grupo experimental con relación al control. Se concluye que la utilización del jugo de naranja agria constituye un estimulante en la producción de huevos de gallinas ponedoras White Leghorn. Abstract The work was in the interprice commercial eggs laying hen in pyramidal battery. 168 hens White Leghorn line L 33 from 32 weeks have the same in laying index were selected using a completely randomized do sing. Two group were formed having 84 animals each group with 7 replies of 12 hens each. Each group was located in the same housing in cage of 7 cage, 4 hens for cage. Group A was a control and group B was experimental. To wich sour orange juice on the feed was applied using a ration of 10 ml per ration per animal into daily dosages during 28 days. The management was the

  3. Política exterior argentina frente al conflicto palestino-israelí durante el primer gobierno de Cristina Fernández

    OpenAIRE

    Fabani, Ornela

    2012-01-01

    Tradicionalmente, Medio Oriente ha sido un espacio descuidado y relegado por la política exterior argentina, en tanto éste fue concebido como un área de importancia secundaria en lo que al relacionamiento externo del país respecta. Sin embargo, la trascendencia política, estratégico-militar y económica de las problemáticas presentes en dicha región conlleva fijar una postura por parte de la Argentina. Entre las citadas problemáticas, el conflicto palestino-israelí fue y continúa siendo uno de...

  4. RETENCIÓN DE HUEVOS EN HEMBRA DE JABOTÍ-PIRANGA (Geochelone carbonaria - Spix, 1824) EN CAUTIVERIO

    OpenAIRE

    Fabiana Rodrigues da Silbeira, M.V; Eduardo Cárdenas Nogueira Rubião, M.Sc; Igor Mansur Muniz, M.Sc; Denise de Mello Bobány, M.Sc

    2009-01-01

    Un Jabotí-Piranga adulto (Geochelone carbonaria), hembra, con peso de 3.5 kg ingresó por consulta en la escuela clínica “Dr. Cataldi Luiz de Souza”, del “Centro Universitário Serra dos Órgãos - Teresopolis, Río de Janeiro”, con historia de retención de huevos. En la evaluación clínica y radiológica, se encontró tres huevos en posiciones normales. Teniendo en cuenta la temporada de reproducción, se aconsejó la observación del animal. Después de un año, dicho animal regresó a la clínica por no ...

  5. Efecto del butirato de sodio en dietas para gallinas sobre el comportamiento productivo, calidad del huevo y vellosidades intestinales

    OpenAIRE

    Isaías Sánchez Herrera; Elizabeth Posadas Hernández; Ezequiel Sánchez Ramírez; Benjamín Fuente Martínez; Jorge Hernández Espinoza; José Luis Laparra Vega; Ernesto Ávila González

    2009-01-01

    En el presente estudio se evaluó el comportamiento productivo, calidad del huevo y análisis histológico de vellosidades intestinales de duodeno (largo y ancho) en gallinas de la estirpe Bovans, de 63 semanas de edad, con adición de butirato en la dieta (0, 300, 500 ppm). Los resultados obtenidos en diez semanas de experimentación mostraron respuesta (P 0.05) en porcentaje de postura (86.4, 92.2 y 89.6), peso del huevo (63.4, 63.4 y 64.1 g) consumo/ave/día (111.4, 111.9 y 113.4 g), conversión...

  6. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the

  7. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  8. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  9. Primer on Social Economics.

    Science.gov (United States)

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  10. ENRIQUECIMIENTO DE HUEVOS CON ÁCIDOS GRASOS OMEGA-3 MEDIANTE LA SUPLEMENTACIÓN CON SEMILLA DE LINO (Linum usitatissimum) EN LA DIETA

    OpenAIRE

    Gonzalo Díaz; Liliana Betancourt

    2009-01-01

    Objetivo. Enriquecer los huevos de gallina con ácidos grasos omega-3 (n-3) mediante la inclusión de semillas de lino en la dieta. Materiales y métodos. La dieta de las aves fue formulada con niveles de 0 (L0), 10 (L10), 15 (L15) y 20% (L20) de linaza. Se determinó la composición de ácidos grasos por cromatografía de gases y se evaluó la producción y calidad del huevo. Resultados. El porcentaje de producción de huevo fue superior en los grupos L0 y L15 (p

  11. Números de orden de la colección de huevos de Santo Domingo de Silos (Burgos, 1928-1936)

    OpenAIRE

    Valverde Gómez, José Antonio, 1926-2003

    2008-01-01

    Numeración de la colección de huevos de Santo Domingo de Silos, en Burgos, que agrupaba ejemplares desde 1928 a 1936, comprendiendo las siguientes especies: Alca torda (Alca común), Alcedo atthis (Martín pescador común), Aquila chrysaetos (Águila real, llamada ocasionalmente Águila liebrera por el autor), Andarríos (llamados "Andarius sp." por el autor, pudiendo ser Acittis sp. o Tringa sp.), Athene noctua (Mochuelo europeo), Avión (probablemente, el Avión común, Delichon urbica), Buitre (pud...

  12. Influencia del procesado térmico sobre la reología de geles de albumen de huevo

    OpenAIRE

    Aguilar García, José Manuel; Jaramillo, Alexander; Cordobés, Felipe; Guerrero Conejo, Antonio Francisco

    2010-01-01

    El objetivo del trabajo ha consistido en la caracterización del proceso de gelificación térmica de dispersiones de albumen de huevo mediante ensayos viscoelásticos dinámicos. Las variables estudiadas han sido el tiempo de procesado térmico, manteniendo constante la velocidad de calentamiento y enfriamiento, la concentración de proteína y el pH del medio acuoso. Durante el procesado térmico se ha encontrado un aumento drástico de las propiedades viscoelásticas lineales ...

  13. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  14. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  15. Harina de crustáceos en raciones de gallinas ponedoras. Efecto en la calidad física del huevo almacenado en distintas condiciones

    OpenAIRE

    M. Elena Carranco; M. de la Concepción Calvo; Silvia Carrillo; Rebeca Ramírez; Morales, E.; Leonor Sanginés; B. Fuente; E. Ávila; F. Pérez-Gil

    2011-01-01

    Para conocer el efecto de la harina de camarón (HC) y la harina de langostilla (HL) en el huevo fresco y almacenado, se utilizaron 135 gallinas distribuidas en tres tratamientos: testigo, HC (20 %) y HL (4 %). Después de cuatro semanas, se recolectaron huevos de cada tratamiento para evaluar su calidad física a 0, 15 y 30 d/4° y 20 °C. Los resultados se analizaron a partir de un diseño factorial 3 x 3 x 2 y la diferencia entre medias, por la prueba de rango múltiple de Duncan. Los valores más...

  16. ALGUNAS CONSIDERACIONES CONTEXTUALES EN TORNO AL PRIMER VIAJE A JAPÓN DE JACQUES LACAN (1963 Contextual considerations on the subject of lacan’s first trip to japan (1963

    Directory of Open Access Journals (Sweden)

    Mercè Altimir

    2012-07-01

    Full Text Available Nuestro propósito es dar a conocer la importancia y el influjo de la cultura y el pensamiento oriental y Japón en la obra de Lacan, para cuya tarea hemos tomado el eje del viaje que realizó al archipiélago en la primavera de A partir de esta coordenada de tiempo hemos retrocedido hasta la presencia del país oriental en la obra de Sigmund Freud y hemos referido la mención del mikado y de los ainus en Tótem y tabú. En cuanto al budismo, centro del interés de Lacan en este primer viaje a las islas, Freud se mostró cauto, reticente, incluso hostil. Lacan, en cambio, se entusiasma por oriente y se interesa por el budismo, en especial por el zen. Hemos seleccionado los comentarios que hizo a su regreso de Japón. En los mismos, el psicoanalista francés pone el dedo en la llaga y nos habla del escamoteo que sufre la sexualidad femenina en el budismo, lo que le sirve de aviso para orientar la práctica del psicoanálisis.My aim in this paper is to make known the importance and influence of Eastern culture and thought and of Japan on Lacan’s works. I have taken as a starting point the trip he made to this country during the spring of 1963. After this I have gone backwards to consider the presence of Japan in Sigmund Freud’s works, calling attention to his mention of the Mikado and the Ainu in Totem and Taboo. Towards Buddhism, which was the focus of Lacan’s interest in this first trip to the archipelago, Freud was cautious, reticent and even hostile. Lacan, on the other hand, was enthusiastic about Orient and interested in Buddhism, especially in Zen. I have made a selection of the comments he made on his return from Japan, in which he pointed out weaknesses and commented on how feminine sexuality is eschewed in Buddhism, which he took note of in order to direct his practice in psychoanalysis accordingly.

  17. OBTENCIÓN DE ANTICUERPOS POLICLONALES IgY ANTIPARVOVIRUS CANINO A PARTIR DE YEMA DE HUEVO DE GALLINA

    Directory of Open Access Journals (Sweden)

    Pinto, J.

    2005-06-01

    Full Text Available Inmunizando un grupo de diez gallinas de postura raza Lohmann de 16 semanas de edad con parvovirus canino (CPV cepa vacunal, se obtuvieron anticuerpos IgY policlonales contra CPV en yema de huevo.En la extracción de los anticuerpos de la yema se requirieron dos pasos, el primero para la remoción de lípidos y el segundo para la precipitación de proteínas. Para la remoción de lípidos se usó el método PBS:Cloroformo y para la precipitación de los anticuerpos solubles (Inmunoglobulinas-IgY se usó el método de salting-out con sulfato de amonio ((NH42SO4. La evaluación del proceso se efectuó empleando el método comercial estándar “EGGstract IgY Purification System®” de PROMEGA.La metodología empleada permitió la obtención de anticuerpos IgY policlonales contra CPV a partir de yema de huevo de gallina en concentraciones altas por mililitro de yema, con una pureza aceptable y títulos altos; los resultados fueron comparables con el método comercial.

  18. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  19. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  20. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  1. Solarium primer. [Monograph

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    Solaria can be used to collect solar energy for space heating and provide an open environment. This primer introduces the basic concepts of an energy-efficient solarium and provides information on the practical aspects of siting, design, and construction. The horticultural use of a solarium as a greenhouse is not dealt with except in explaining the influence this may have on its design and operation. The book shows the characteristics of different types of solaria, their advantages as well as their limitations. It also explains the prerequisite of a successful addition to an existing home. Design and construction details accompany the text. 73 references, 2 tables.

  2. Response of first attack of inflammatory bowel disease requiring hospital admission to steroid therapy Respuesta al tratamiento esteroideo del primer brote de enfermedad inflamatoria intestinal que requiere ingreso hospitalario

    Directory of Open Access Journals (Sweden)

    M. Abu-Suboh Abadía

    2004-08-01

    Full Text Available Introduction: corticoid administration is the usual treatment of Crohn' disease (CD and ulcerative colitis (UC attacks. How-ever, information available on response rates and their predictive factors is scarce. Objective: to establish response to steroidal treatment in an homogeneous group of patients with CD or UC during their first admission to hospital. Methods: restrospective analysis of 86 patients who received systemic steroidal treatment for a severe flare-up during their first hospital admission between 1995 and 2000. Patients were treated per protocol with fluid therapy, absolute diet, IV 6-methyl-prednisolone 1 mg/kg/day, and enoxaparin at prophylactic doses. Clinical response at 30 days was considered good in case of complete remission, and poor in case of partial or absent remission. Univariate and multivariate analyses according to non-parametric statistics were performed for sociodemographic and biologic variables. Results: 45 patients with CD and 41 with UC were included. Good response rates were 64.4% for CD and 60.9% for UC. The univariate analysis showed that patients with good response have shorter evolution times and fewer previous flare-ups (p Introducción: la administración de corticoides constituye el tratamiento habitual de los brotes de enfermedad de Crohn (EC y colitis ulcerosa (CU. Sin embargo, existe poca información sobre las tasas de respuesta y los factores que puedan predecirla. Objetivo: determinar la respuesta al tratamiento esteroideo en un grupo homogéneo de pacientes de EC y CU que ingresan por primera vez en el hospital. Métodos: análisis retrospectivo de 86 pacientes que en su primer ingreso hospitalario recibieron tratamiento esteroideo sistémico por brote grave de EC o CU entre 1995 y 2000. Fueron tratados de forma protocolizada con sueroterapia, dieta absoluta, 6-metil-prednisolona 1 mg/kg/día IV y enoxaparina a dosis profilácticas. Se ha considerado la respuesta clínica a los 30 días como

  3. Arreglo de los polígonos del exocorion de huevos eclosionados de algunas especies de los géneros Triatoma Laporte, Meccus Stal y Nesotriatoma Usinger (Heteroptera: Reduviidae.

    Directory of Open Access Journals (Sweden)

    Glauco López

    2009-12-01

    Full Text Available Resumen. En este trabajo se estudiaron estructural y cuantitativamente las celdas exocoriales de huevos eclosionados de Triatoma infestans (Klug, Triatoma lenti Sherlock & Serafim, Triatoma maculata (Erichson, Triatoma sordida (Stal, Meccus picturatus (Usinger, Meccus longipennis (Usinger, Meccus pallidipennis (Stal and Nesotriatoma flavida (Neiva. Los huevos se analizaron por regiones: caudal, media y cefálica. Se encontró que el hexágono fue el polígono más abundante en todas las regiones del huevo y en todas las especies, seguido del pentágono y del heptágono; se encontraron diferencias estadísticamente significativas en el número tanto de hexágonos y pentágonos entre regiones de una misma especie y entre la misma región de las diferentes especies, sin embargo, el número promedio de heptágonos no varió al comparar la región media entre las diferentes especies y al comparar las diferentes regiones en una misma especie. No se encontraron diferencias estadísticamente significativas en el promedio de polígonos, segmentos totales, heptágonos, hexágonos y pentágonos, al comparar las especies examinadas del género Meccus. Se propone un protocolo de identificación y análisis de teselaciones, con el cual se encontró que en 108 campos examinados de 385.000 µm2 cada uno, se identificaron teselaciones compartidas en los 108 campos observados con determinadas combinaciones de heptágonos, hexágonos y pentágonos, y se observaron teselaciones no compartidas en la totalidad de los campos, con combinaciones de polígonos de cuatro a nueve lados, y cada teselación se representó por un grafo. Se discuten las implicaciones taxonómicas, funcionales, filogenéticas y construccionales de los arreglos poligonales descritos.Arragement of exochorial polygons of hatched eggs in several species of the genera Triatoma Laporte, Meccus Stal y Nesotriatoma Usinger (Heteroptera: Reduviidae. Abstract. In this study a structural and quantitative

  4. APROXIMACIÓN AL CONCEPTO DE ESCALA EN EL PRIMER CICLO DE EDUCACIÓN PRIMARIA. PRESENTACIÓN DE UN JUEGO PARA SU TRATAMIENTO DESDE LA ENSEÑANZA ACTIVA

    Directory of Open Access Journals (Sweden)

    María Jesús Marrón Gaite

    2012-12-01

    Full Text Available Resumen:El objetivo esencial del presente artículo es presentar un juego didáctico que hemos diseñado para facilitar al alumnado del primer ciclo de Educación Primaria la comprensión del concepto básico de escala, con el objetivo de prepararle cognitivamente para la correcta interpretación, en cursos superiores, de este convencionalismo en planos y mapas. La investigación empírica que del mismo hemos realizado, experimentándolo en centros educativos de la ciudad de Madrid, ha puesto de manifiesto su alto grado de utilidad para la enseñanza-aprendizaje del tema. Su empleo en el aula ha supuesto el tratamiento del mismo desde la enseñanza activa, que concede un papel esencial a la metodología lúdica, y ha permitido la consecución de aprendizajes significativos por parte de los escolares a partir de sus ideas y representaciones conceptuales previas.Palabras clave:Convencionalismos cartográficos, escala, enseñanza activa, metodología lúdica, aprendizaje significativo.Abstract:The main objective of the present paper is to introduce a didactic play designed in order to help the students of early years of primary education the understanding of the concept of scale. The understanding of this concept prepare them to the correct interpretation, in further years, of this conventionalism in plans and maps. Empirical research we have conducted on the effectiveness of this material, testing in schools in the city of Madrid, has shown a high degree of usefulness for teaching and learning the subject. The use of this material in the classroom has been done from active teaching, giving a central role to the ludic methodology, and has allowed the achievement of meaningful learning by the students from their previous ideas and conceptual representations.Key words:Cartographic conventionalisms, scale, active teaching, ludic methodology, meaningful learning.Résumé:Le présent article a comme objectif principal, présenter un jéu didactique que

  5. La atención hospitalaria al paciente con ictus en Cataluña: Resultados del «Primer Audit Clínic de l'Ictus. Catalunya, 2005/2006» In-hospital stroke care in Catalonia [Spain]: Results of the «First Clinical Audit of Stroke. Catalonia, 2005/2006»

    OpenAIRE

    Sònia Abilleira; Aida Ribera; Emília Sánchez; Jaume Roquer; Esther Duarte; Ricard Tresserras; Miquel Gallofré

    2008-01-01

    Objetivo: Analizar la calidad de la atención hospitalaria al paciente con ictus en los hospitales públicos catalanes antes de la difusión de la Guía de Práctica Clínica (GPC) del ictus, estudiando el grado de adhesión a determinadas recomendaciones de la GPC. Métodos: Mediante revisión retrospectiva de historias clínicas de pacientes con ictus definidos mediante los códigos CIE-9 431, 433.x1, 434.x1, 436, e ingresados consecutivamente en 48 hospitales públicos catalanes en el primer semestre ...

  6. El huevo de la serpiente al sur del mundo: desarrollo y supervivencia de la ciencia nazi en Chile (1908 -1951

    Directory of Open Access Journals (Sweden)

    Leyton, César

    2014-12-01

    Full Text Available The paper presents, mainly through the figure of Dr. Max Westenhoffer and in a work of Drs. Barrientos and Schirmer (1937, the connections between the development of medicine and anthropology in Chile with the development of the biological determinist thought and racism in Europe. Chilean Physicians and anthropologists as Otto Aichel, Aureliano Oyarzún, Edgardo Schirmer and Juvenal Barrientos indicate the direct relationship of the Chilean scientific program of the early twentieth century with the hereditarian and racist program, which reached its climax with the Nazi eugenics.El trabajo aborda, principalmente a partir de la figura del Dr. Max Westenhoffer y de un trabajo de los Drs. Barrientos y Schirmer de 1937, las conexiones que presenta el desarrollo de la medicina y la antropología en Chile con el pensamiento determinista biológico y racista en Europa. Médicos y antropólogos chilenos como Otto Aichel, Aureliano Oyarzún, Edgardo Schirmer y Juvenal Barrientos dan cuenta de la relación directa de una parte del programa científico chileno de la primera mitad del siglo XX con el programa hereditarista y racista, que alcanzó su punto cúlmine con la eugenesia y la antropología nazi.

  7. Cuantificacion de huevo en fideos secos según metodo electroforético (SDS PAGUE Quantification of egg in dried noodles by electrophoretic methods (SDS PAGE

    Directory of Open Access Journals (Sweden)

    LB López

    2011-06-01

    Full Text Available La cuantificación de huevo en fideos secos elaborados con harina y agregado de huevo. Se analizaron 6 sistemas modelos (SM de fideos que contenían 0,0; 1,0; 2,5; 4,0; 6,0 y 8,0% de huevo en polvo. Se extrajeron proteínas totales con un buffer que contiene dodecilsulfato de sodio (SDS y 2-Mercaptoetanol y se realizó electroforesis en gel de poliacrilamida con SDS. Se establecieron las relaciones de las áreas de los picos de los densitogramas (de huevo y de trigo que permiten una correcta cuantificación del porcentaje de huevo agregado. Se analizaron 11 muestras comerciales en las cuales se realizó la cuantificación de huevo, obteniéndose valores comprendidos entre The objective of this work was to use the SDS-PAGE method for the quantification of egg in dry noodles made with flour and added egg. 6 model systems (MS of noodles containing 0.0, 1.0, 2.5, 4.0, 6.0 and 8.0% of egg powder were analyzed. Total proteins with a buffer containing sodium dodecyl sulfate (SDS and 2-mercaptoethanol were extracted and electrophoresis with SDS polyacrylamide gel was carried out. The relationships of the peak areas of the densitograms (egg and wheat that allow a proper quantification of the percentage of egg added were established. 11 commercial samples in which quantification of egg was carried out were analyzed, with values ranging between <1.0% and 8.8% of egg powder. In the analyzed MS and in the commercial samples the cholesterol content (enzymatic method was also determined and the egg content was determined by the method ELISA. Cholesterol values in the MS increased with the increase of the added egg powder, while in the samples, low levels of cholesterol were found for the lowest egg levels and high values for the highest egg levels. With the ELISA method a correct quantification of egg up to 4.0% was achieved, but low results were obtained in the higher systems (6.0 and 8.0%. This could be due to the significant dilution that must be made from

  8. Influencia del tamaño del pubis y el peso de la ponedora en el tamaño y peso de sus huevos

    Directory of Open Access Journals (Sweden)

    Lamazares María del Carmen

    2006-10-01

    Full Text Available RESUMENEl objetivo del presente trabajo fueevaluar el efecto del tamaño del pubis y elpeso de la ponedora en el tamaño y elpeso de sus huevos. Con este fin seagruparon 64 gallinas L33 en 4 gruposutilizándose como criterio deagrupamiento el tamaño del pubis y elpeso de la ponedora por encima o pordebajo de la media general para cadaindicador. Los datos obtenidos fueronanalizados por un programa estadísticodonde se calcularon los coeficientes decorrelación y los coeficientes de regresión.Con los valores de los coeficientes decorrelación se calcularon los coeficientesde determinación. Estos últimos mostraronvalores entre 0.0049 y 0.1369 entre elpeso de la gallina y las características delhuevo. En cuanto al pubis, los valoresvariaron entre 0.01 y 0.0576. Losresultados muestran que la influencia queejerce el peso de la gallina y el tamaño delpubis sobre el peso y el tamaño de sushuevos es proporcional.ABSTRACTThe objective of the present work was toevaluate the effect of the size of the pubisand the corporal weight of the laying hensin the size and the peso of their eggs.They with this end formed a group 64 henL33 in 4 groups utilizing it like criterion ofgroup the size of the pubis and thecorporal weight of the laying hens forabove or below the general hose for eachindicator. The gotten facts were analyzedfor a statistical program where they werecalculated the coefficient of correlation andthe coefficient of regression. With thevalue of the coefficient of correlation thecoefficient of determination werecalculated. These last showed securitybetween 0.0049 0.1369 between thecorporal weight of the hen and thecharacteristics of the egg. As for the pubis.The value them vary between 0.01 0.0576.The result show that the influence thatexercises the corporal weight of the henand the size of the pubis on the corporalweight and the size of their eggs isproportional.

  9. Rendimiento reproductivo en cruzamientos entre razas tradicionales de aves productoras de huevo y carne Reproductive output in laying hen and meat type breed crosses

    Directory of Open Access Journals (Sweden)

    F Revidatti

    2005-12-01

    Full Text Available En el presente trabajo se evaluaron distintas variables que se relacionan con el rendimiento reproductivo en dos tipos de aves de líneas tradicionales, una semi-pesada, seleccionada para la producción de huevos para consumo (Negra y Rubia INTA y otra pesada, cuya progenie se destina a la producción de carne aviar (Campero INTA. Se hallaron diferencias significativas en el número de huevos incubables (191 y 110 huevos por ave/año, en los porcentajes de fertilidad (93 y 88%, incubabilidad (88 y 83% y en el número de pollitos por ave por año (158 y 82 entre las aves semi-pesadas y pesadas, respectivamente. Dicho comportamiento coincide con lo referido por la bibliografía con relación a la aptitud reproductiva de razas productoras de huevo para consumo y razas productoras de carne.In this work we evaluate different variables in relation with the reproductive output in two traditional breed chicken types one of them semi-heavy for egg production (Negra and Rubia INTA and the other one heavy whose offsprings are destined to meat chicken production (Campero INTA. We found significative differences in the settables egg number (191 and 110 eggs per hen per year in the fertility percent (93 and 88 in the hatchability (88 and 83 and in the chick number per hen per year (158 and 82 between semi-heavy an heavy chickens respectively. These results agree with the references in relation with reproductive fitness in laying and meat type chickens.

  10. Presencia de huevos de parásitos con potencial zoonótico en parques y plazas públicas de la ciudad de Temuco, Región de La Araucanía, Chile Presence of parasite eggs with zoonotic potential in parks and public squares of the city of Temuco, Araucanía Region, Chile

    Directory of Open Access Journals (Sweden)

    WA Armstrong

    2011-01-01

    Full Text Available Muchas infecciones parasitarias del perro pueden ser transmitidas al hombre, lo cual constituye un riesgo para la salud pública a nivel mundial. El objetivo de este estudio fue detectar la presencia de huevos de parásitos en muestras del suelo en 87 parques y plazas públicas distribuidas en seis sectores de la ciudad de Temuco localizada entre los 37° 24’ y 39° 34’ lat. Sur, Región de La Araucanía, Chile. Se tomaron 193 muestras de suelo, obteniendo 70 muestras positivas (36,3% mediante el método Fonrouge modificado. En el 48,3% de los parques se encontraron huevos de los géneros Toxocara sp. (12,4%, Taenia sp. (11,4% y huevos de Trichuris sp. (4,7%. También se identificó un conjunto de huevos tipo estrongílido correspondiente a un 9,3%, no pudiendo determinar si se trataba de helmintos parásitos o de vida libre. Además, el 2,8% de las muestras presentó poliparasitismo. Según el test exacto de Fisher, no hubo asociación estadística entre el tipo de superficie de los parques y la contaminación presente, tampoco se detectaron diferencias para riesgo de contagio entre los sectores estudiados. Los resultados permiten concluir que los parques y plazas públicas de Temuco están contaminados con huevos de parásitos asociados principalmente a perros, lo que es potencialmente riesgoso para la salud humana.Many parasitic infections can be transmitted from dog to man, which constitutes a risk to public health worldwide. The aim of this study was to report any presence of parasite eggs in soil samples from 87 parks and public places in 6 areas of the city of Temuco, located between 37° 24’ and 39° 34’; latitude South, Region of Araucania, Chile. 193 three soil samples were collected, and 70 positive samples (36.3% were obtained by using the modified method of Fonrouge. In 48.3% of the parks, the eggs found corresponded to the genders Toxocara sp. (12.4%, Taenia sp. (11.4% and eggs of Trichuris sp. (4.7%. Also, a set of eggs

  11. Producción de plantas transgénicas de Solanum phureja variedad yema de huevo clon 1 mediada por Agrobacteriun tumefaciens

    Directory of Open Access Journals (Sweden)

    Chaparro Giraldo Alejandro

    2006-12-01

    Full Text Available El objetivo general de este proyecto fue la producción de plantas transformadas genéticamente de S. phureja
    variedad Yema de Huevo Clon 1 que sean potencialmente tolerantes a insectos, rasgo conferido por la inserción
    en su genoma del gen mirl2 derivado del pomelo (Citrus paradisi que codifica para un inhibidor de proteasas de
    tipo Serina. Se trabajó con el sistema de transformación mediado por Agrobacterium tumefaciens utilizando la cepa
    LBA4404 que contiene el plásmido residente pAL4404 y el vector binario pNOV022 el cual contiene el gen de interés mirl2. Se utilizaron como explantes entrenudos con una longitud de 0,5 a 1 cm provenientes de material in
    vitro entre cuatro a cinco semanas de edad, los cuales fueron co-cultivados en una concentración bacteriana de
    1/50, para posteriormente ser colocados en medio de regeneración sin agente de selección. Se encontró que el
    medio de regeneración más apropiado esta compuesto por Zeatina Ribósido (ZR 2 mg/L, ácido naftalenacético
    (ANA 0,04 mg/L y ácido giberélico (AG3 0,1 mg/L en el cual se logró obtener un 87,6% de callogénesis y un
    48,6% de regeneración. Posteriormente se estableció una población de individuos potencialmente transgénicos,
    a partir de los cuales se realizó una extracción de DNA, organizando los extractos en pools de diez individuos,
    obteniéndose un total de 52 pools, a partir de 520 individuos. Se utilizaron cuatro diferentes cantidades de DNA para un volumen final de 50 μl en la PCR: 150 ng; 300 ng; 600 ng; 1.200 ng y se realizó PCR para los dos genes mirl2 (IP y manA (PMI. Tras el análisis por electrofóresis de los resultados de la PCR para cada uno de los pools no se observó la señal de amplificación específica de los genes de interés, en tanto que se observó la señal para los genes endógenos de control. Finalmente se analizaron 62 clones provenientes de un segundo ensayo de transformaci

  12. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  13. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    Science.gov (United States)

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  14. Caracterización parcial de inmunoglobulinas G (IGy específicas contra la lectina de Salvia bogotensis a partir de huevos de gallina (Gallus domesticus

    Directory of Open Access Journals (Sweden)

    Pérez Gerardo

    2004-12-01

    Full Text Available Partiendo de yemas de huevos de gallinas inoculadas con la lectina presente en Salvia bogotensis, se ensayaron seis métodos de delipidación y extracción de anticuerpos de gallina (IgY. Se escogió la metodología por dilución con agua para continuar con la purificación de anticuerpos,
    debido a la remoción total de los lípidos de la yema y la alta actividad de las IgY contra la lectina de S. bogotensis. Para la purificación de anticuerpos se utilizaron diferentes métodos cromatográficos: cromatografía de intercambio iónico (DEAE Sephacel, hidrofóbica (Fenil Sepharosa 4B, exclusión molecular (Sephacryl S-200 y S-500, tiofílica (T-gel. Se escogió la cromatografía tiofílica ya que permitió la purificación de anticuerpos, para luego continuar con la caracterización de estos (peso molecular de las IgY y sus subunidades, cantidad de carbohidratos totales, punto isoeléctrico, interacción de las IgY con diferentes lectinas de leguminosas. Los valores de peso molecular del anticuerpo y sus subunidades concordaron con los reportes de la literatura. También se determinó el título de la población de IgY con un valor bastante alto en comparación al título de anticuerpos específicos dirigidos contra otro tipo de antígeno. Debido al bajo rendimiento de la cromatografía tiofílica se realizó una cromatografía de afinidad indirecta sobre aMSB Sepharosa 4B con el fin de purificar IgY específicos y continuar con los ensayos de caracterización. Aunque se obtuvieron fracciones eluídas de esta columna no se detectó proteína. Como alternativa para la purificación de anticuerpos se utilizó un soporte de Sephacryl S-200 a alta fuerza iónica. De esta cromatografía se obtuvieron anticuerpos parcialmente puros. Con
    esta fracción de anticuerpo se determinó la cantidad de carbohidratos totales, valor que se encontróalgo alejado al reportado en literatura, mientras el punto isoeléctrico de las IgY se encontró en los

  15. El secreto del huevo azul, de Catalina González Vilar. Estudio narratológico. The secret of the blue egg, by Catalina González Vilar. Narratological study

    Directory of Open Access Journals (Sweden)

    Miguel Sánchez-García

    2013-11-01

    Full Text Available This article discusses a narratological study of the literary work The secret of the blue egg, by the writer Catalina Gonzalez Vilar, that won El Barco de Vapor prize in 2012. It examines the different constitutive elements of the text (topic approach, prominent figures, syntactic structure, narrative technique… and his contribution to the development of the story with the purpose of discovering the aesthetic and literary values that contribute to the fable. It aims at demonstrating the proper use of them all as they shape a text rich in nuances, striking, suggestive. All these qualities of great importance both in creations aimed at adults as well as at children and young people because they enrich the final value of the work, and by extension, the cultural background of their readers.Este trabajo aborda el estudio narratológico de la obra El secreto del huevo azul, de la escritora Catalina González Vilar, que obtuvo el Premio El Barco de Vapor en el año 2012. Examina los diferentes elementos constitutivos del texto (el enfoque del tema, la caracterización de los personajes, la estructura sintáctica, el tratamiento del lenguaje, la técnica narrativa utilizada… y su aporte al desarrollo de la historia con la finalidad de descubrir los valores estéticos y literarios que aporta a la fábula. Pretende demostrar el adecuado uso de todos ellos dado que favorecen un texto rico en matices, llamativo, sugerente. Cualidades, todas ellas, de gran importancia tanto en creaciones destinadas al público adulto como al infantil y juvenil pues enriquece el valor final de la obra, y por extensión, el bagaje cultural de sus lectores.

  16. Intervención de los EOE especializados en atención temprana. Elaboración de una guía para profesionales que atienden al alumnado TEA en el primer ciclo de educación infantil

    OpenAIRE

    Rodríguez Somodevilla, Sonia

    2013-01-01

    Desde el curso escolar 2009-10 la Consejería de Educación de la Junta de Andalucía asumió las competencias educativas en el primer ciclo de Educación Infantil lo que llevó al EOEE en Atención Temprana de Málaga a plantearse la necesidad de elaborar una guía para proporcionar a todos los profesionales que atienden a los niños y niñas con Trastorno del Espectro Autista dentro de las Escuelas Infantiles, una información básica sobre qué es el Trastorno, la detección con las señales ...

  17. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads;

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  18. A Primer on Multilevel Modeling

    Science.gov (United States)

    Hayes, Andrew F.

    2006-01-01

    Multilevel modeling (MLM) is growing in use throughout the social sciences. Although daunting from a mathematical perspective, MLM is relatively easy to employ once some basic concepts are understood. In this article, I present a primer on MLM, describing some of these principles and applying them to the analysis of a multilevel data set on…

  19. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  20. A classical primer for QCD

    International Nuclear Information System (INIS)

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  1. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  2. ‘BURLEY PINAR 2010’: PRIMER CULTIVAR CUBANO DE TABACO BURLEY RESISTENTE AL MARCHITAMIENTO POR FUSARIUM (Fusarium oxysporumY A OTRAS ENFERMEDADES DE IMPORTANCIA EN EL CULTIVO

    Directory of Open Access Journals (Sweden)

    Vivaldo García

    2015-01-01

    Full Text Available Con el objetivo de obtener un cultivar de tabaco burley resistente al marchitamiento por fusarium, al moho azul (Peronospora hyocyami de Bary y a la pata prieta (Phytophthora parasitica Dast. var. Nicotianae Breda de Haan se hizo un cruzamiento en la Estación Experimental del Tabaco de San Juan y Martínez, Pinar del Río, durante la campaña tabacalera 2004-2005 entre los cultivares `NC 1151 ́ y `Ky 910 ́. La primera resistente al moho azul y al marchitamiento por fusarium, la segunda resistente a la pata prieta. Después de cinco generaciones de autofecundación y selección por el método genealógico se obtuvo la `Burley Pinar 2010 ́ que mostró resistencia al fusarium, al moho azul y a la pata prieta. En suelo infectado por fusarium la `Burley Pinar 2010 ́ superó a `Burley Habana 13 ́ en rendimiento

  3. ENRIQUECIMIENTO DE HUEVOS CON ÁCIDOS GRASOS OMEGA-3 MEDIANTE LA SUPLEMENTACIÓN CON SEMILLA DE LINO (Linum usitatissimum EN LA DIETA

    Directory of Open Access Journals (Sweden)

    Gonzalo Díaz

    2009-04-01

    Full Text Available Objetivo. Enriquecer los huevos de gallina con ácidos grasos omega-3 (n-3 mediante la inclusión de semillas de lino en la dieta. Materiales y métodos. La dieta de las aves fue formulada con niveles de 0 (L0, 10 (L10, 15 (L15 y 20% (L20 de linaza. Se determinó la composición de ácidos grasos por cromatografía de gases y se evaluó la producción y calidad del huevo. Resultados. El porcentaje de producción de huevo fue superior en los grupos L0 y L15 (p<0.05 con 93,0 y 91,5% de producción comparada con 86,0 % en los grupos L10 y L20. La mejor conversión de alimento se presentó también en los grupos L0 y L15. Con la inclusión de semilla de lino, se incrementó el contenido de ácidos grasos n-3 desde 3,0 % en el grupo L0 hasta 12,6 % en el grupo L20, siendo los ácidos grasos n-3 á-linolénico (C18:3, n-3 y docosahexahenóico (DHA, C22:6, n-3 los hallados en mayor concentración. Con la inclusión de linaza en la dieta de las gallinas ponedoras se redujo el contenido de acido linoleico (C18:2n-6, lo cual resultó en una disminución en la relación n-6: n-3. Conclusiones. Con base en la evaluación económica se concluye que es posible enriquecer la yema de huevo de gallina hasta con un 10,1 % de ácidos grasos n-3 mediante la inclusión de un 15 % de linaza en la dieta de las gallinas, sin embargo, esto representó un sobrecosto de producción del 12%.

  4. Harina de crustáceos en raciones de gallinas ponedoras. Efecto en las variables productivas y evaluación sensorial de huevos almacenados en diferentes condiciones

    OpenAIRE

    M. Elena Carranco; C.C. Calvo; D.S. Carrillo; C.R. Ramírez; B.E. Morales; G.L. Sanginés; M.B. Fuente; G.E. Ávila; R.F. Pérez-Gil

    2011-01-01

    Se evaluó el efecto en las variables productivas de la inclusión de harina de camarón (HC) y harina de langostilla (HL) en dietas para gallinas ponedoras. Se hizo una evaluación sensorial del huevo fresco y almacenado en diferentes condiciones. Se distribuyeron 135 gallinas en tres tratamientos: testigo, HC (20 %) y HL (4 %). Los resultados se analizaron por ANDEVA y Friedman. Se demostró que variables productivas, como la evaluación sensorial, no mostraron diferencias significativas (P 0.05...

  5. Coloración y tamaño de los huevos de urraca (pica pica) en relación con la parasitación con el críalo (Clamator glandarius)

    OpenAIRE

    Hita Sánchez, Alejandro

    2016-01-01

    El estudio del parasitismo de incubación, en el marco de la hipótesis de la "carrera de armamentos", ha mostrado evidencias de procesos coevolutivos entre hospedador y parásito. El comportamiento de los hospedadores se ha visto claramente marcado por una evolución hacia el reconocimiento de los huevos, a la par que el mimetismo ha ido aumentando en la puesta de los parásitos. En este estudio, medimos características de color y tamaño de huevos de urraca (Pica pica) de dos zonas, una de ellas ...

  6. Suplementación de dietas de gallinas de postura comercial con aceites de pescado de diferentes grados de refinación: Efectos productivos en las aves y en la calidad organoléptica de los huevos Supplementation of commercial layer diets with different refined fish oils: Effects on layer performance and sensory egg quality

    Directory of Open Access Journals (Sweden)

    S Cornejo

    2008-01-01

    Full Text Available Se evaluó el efecto sobre: porcentaje de postura (PP, consumo (CA, peso vivo (PV, peso del huevo (PH, masa de huevo (MH, conversión alimentaria (ECA, mortalidad (M, margen bruto (MB y costo alimentario (Cali del empleo de: harina de pescado: HP; oleina: O; aceite crudo de pescado: ACP y aceite de pescado refinado: ALKITOL-R-15®: ALK, en dietas de gallinas ponedoras comerciales. Además, se efectuó una evaluación sensorial de los huevos incluyendo: aroma, sabor, aceptabilidad y preferencia. Se utilizaron 216 gallinas Leghorn Shaver, durante 8 semanas, distribuidas en cuatro tratamientos: TI = 0% HP y aceites, T2 = 4% HP + 3% O; T3 = 4% HP + 6% ACP; T4 = 4% HP + 6% ALK. El índice de peróxidos (IP fue de 1,5; 7,5 y 21,7 meq 0(2/kg para O, ACP y ALK, respectivamente. La HP "prime" presentó un IP de 3,6. Las dietas mostraron porcentajes de EPA + DHA de 0,00 - 0,83 - 1,16 y 0,87, desde TI a T4, respectivamente. Los indicadores PP, CA, PV, PH, ECA y MH fueron semejantes entre T2, T3 y T4 (P > 0,05 siendo superiores, en general (P 0,05 entre los tratamientos para ambas preparaciones. Se concluye que la incorporación de lípidos marinos no afecta el rendimiento productivo de las aves ni provoca efectos sensoriales adversos en los huevos y ofrecería ventajas económicas al productorThe performance of 216 Leghorn layers and the sensory evaluation of their eggs were studied as a result of using different marine lipid sources (fish meal, oleine, crude fish oil and a refined fish oil, Alkitol-R-15®, in their diets. The birds were distributed randomly in 4 treatments: Tl= control, soy bean meal based diet; T2 = 4% fish meal plus 3% oleine; T3 = 4% fish meal plus 6% crude fish oil and T4 = 4% fish meal plus 6% of refined fish oil concentrate ALKITOL-R-15®. Food and water were supplied ad libitum. The evaluated variables controlled were: laying percentage (LP, food consumption (FC, live weight (LW, egg weight (EW, egg mass (EM, feed conversion

  7. Estudio mediante encuesta del primer eslabón del canal de distribución de la carne de cabrito en España: del ganado al entrador

    OpenAIRE

    Panea, B.; Ripoll, G.; Sañudo, C.; Teixeira, A; Horcada, A.; Alcalde, M.J.

    2010-01-01

    Se preguntó a 350 ganaderos de Andalucía, Aragón, Extremadura y castilla-La Mancha y a 350 entradores de Andalucía, Aragón, Madrid, Cataluña y Comunidad Valenciana, acerca de la manera de comprar y vender cabritos o su carne. Las zonas de producción no coinciden con las de comercialización y consumo y existen grandes diferencias entre regiones en cuanto al tamaño de las explotaciones. La distancia más frecuente entre explotación y matadero fue de 300 Km. En general, los ganaderos ...

  8. Creencias de las profesoras de la Fundación Íntegramente. Un primer acercamiento al contexto sociocultural de la enseñanza de castellano a los inmigrantes de Santa Coloma de Gramenet

    Directory of Open Access Journals (Sweden)

    Hermes Diáz Ceniceros

    2010-06-01

    Full Text Available La constante llegada de inmigrantes a Cataluña provenientes de diferentes partes de África, Medio Oriente y Asia ha llevado a la creación de centros de acogida en los cuales se les ayuda a estos a integrarse socialmente. Uno de los centros en la mancha urbana de Barcelona es la Fundación Integramenet en Santa Coloma de Gramenet. En este apareció la necesidad de dar clases de castellano a los inmigrantes con el apoyo de profesores voluntarios. En este trabajo conoceremos los sistemas de creencias de los profesores con el objetivo de tener un primer acercamiento a las aulas de esta fundación. El método de investigación que utilizamos es el etnográfico y la herramienta con la cual recogimos los datos fue la entrevista semiabierta. Estas entrevistas las obtuvimos de cuatro informantes que llamamos Zafo, Helena, Sofía y Tere. Cada una de las entrevistas estuvo estructurada en torno a los temas de: cómo la profesión del profesor voluntario se relaciona con el sistema de creencias del profesor; cómo la previa experiencia de aprendizaje de una L2 sirve para preparar las clases; cómo se valora la multiculturalidad, y cómo los profesores se identifican con los problemas de los alumnos. En las entrevistas encontramos que los sistemas de creencias de los profesores se ven determinados en gran medida por la profesión. En cuanto a la experiencia de aprender una L2 encontramos que esta se aprovecha cuando las creencias profesionales lo permiten. De esta manera concluimos señalando la importancia de continuar nuestros estudios etnográficos sobre las creencias de los profesores y alumnos, con el propósito de poder en un futuro crear material de apoyo adecuado para esta clase de aulas.--------------------------------------------------------The continuous arrival of immigrants to Catalonia, coming from different parts of Africa, Middle East and Asia, has led to the creation of reception centres (welcome centres to help new arrivals integrate

  9. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  10. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes.

    Science.gov (United States)

    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  11. Loop Quantum Geometry: A primer

    CERN Document Server

    Corichi, A

    2005-01-01

    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-experts interested in learning the basics of the subject.

  12. Sample Return Primer and Handbook

    Science.gov (United States)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  13. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  14. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  15. Loop Quantum Geometry: A primer

    OpenAIRE

    Corichi, Alejandro

    2005-01-01

    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-expert...

  16. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  17. Estudio mediante encuesta del primer eslabón del canal de distribución de la carne de cabrito en España: del ganadero al entrador

    OpenAIRE

    Panea Doblado, Begoña; Ripoll García, Guillermo; Sañudo Astiz, Carlos; Teixeira, Alfredo; Horcada Ibáñez, Alberto; Alcalde Aldea, Mª Jesús

    2010-01-01

    Se preguntó a 350 ganaderos de Andalucía, Aragón, Extremadura y Castilla-La Mancha y a 350 entradores de Andalucía, Aragón, Madrid, Cataluña y Comunidad Valenciana, acerca de la manera de comprar y vender cabritos o su carne. Las zonas de producción no coinciden con las de comercialización y consumo y existen grandes diferencias entre regiones en cuanto al tamaño de las explotaciones. La distancia más frecuente entre explotación y matadero fue de 300 Km. En general, los ganaderos venden más ...

  18. Algorithms and Software for PCR Primer Design

    OpenAIRE

    Huang, Yu-ting

    2015-01-01

    Polymerase Chain Reaction (PCR) is a widely used technology in molecular bi-ology for DNA amplification. To generate multiple copies of a DNA molecule, a pair ofprimers (two synthesized DNA sequences with a total length of 15-30 bases) are annealedto the boundaries of the targeted DNA molecule. Then, the new replicated DNA fragmentelongates from one primer to the other.Though primers always hybridize to their respective complements within DNAsequences, primer pairs for targeted DNA sequences ...

  19. Suplementación de dietas de gallinas de postura comercial con aceites de pescado de diferentes grados de refinación: Efectos productivos en las aves y en la calidad organoléptica de los huevos Supplementation of commercial layer diets with different refined fish oils: Effects on layer performance and sensory egg quality

    OpenAIRE

    S. Cornejo; H. Hidalgo; Araya, J.; J. Pokniak

    2008-01-01

    Se evaluó el efecto sobre: porcentaje de postura (PP), consumo (CA), peso vivo (PV), peso del huevo (PH), masa de huevo (MH), conversión alimentaria (ECA), mortalidad (M), margen bruto (MB) y costo alimentario (Cali) del empleo de: harina de pescado: HP; oleina: O; aceite crudo de pescado: ACP y aceite de pescado refinado: ALKITOL-R-15®: ALK, en dietas de gallinas ponedoras comerciales. Además, se efectuó una evaluación sensorial de los huevos incluyendo: aroma, sabor, aceptabilidad y prefere...

  20. Geology of the epithermal Ag-Au Huevos Verdes vein system and San José district, Deseado massif, Patagonia, Argentina

    Science.gov (United States)

    Dietrich, Andreas; Gutierrez, Ronald; Nelson, Eric P.; Layer, Paul W.

    2012-03-01

    The San José district is located in the northwest part of the Deseado massif and hosts a number of epithermal Ag-Au quartz veins of intermediate sulfidation style, including the Huevos Verdes vein system. Veins are hosted by andesitic rocks of the Bajo Pobre Formation and locally by rhyodacitic pyroclastic rocks of the Chon Aike Formation. New 40Ar/39Ar constraints on the age of host rocks and mineralization define Late Jurassic ages of 151.3 ± 0.7 Ma to 144.7 ± 0.1 Ma for volcanic rocks of the Bajo Pobre Formation and of 147.6 ± 1.1 Ma for the Chon Aike Formation. Illite ages of the Huevos Verdes vein system of 140.8 ± 0.2 and 140.5 ± 0.3 Ma are 4 m.y. younger than the volcanic host rock unit. These age dates are among the youngest reported for Jurassic volcanism in the Deseado massif and correlate well with the regional context of magmatic and hydrothermal activity. The Huevos Verdes vein system has a strike length of 2,000 m, with several ore shoots along strike. The vein consists of a pre-ore stage and three main ore stages. Early barren quartz and chalcedony are followed by a mottled quartz stage of coarse saccharoidal quartz with irregular streaks and discontinuous bands of sulfide-rich material. The banded quartz-sulfide stage consists of sulfide-rich bands alternating with bands of quartz and bands of chlorite ± illite. Late-stage sulfide-rich veinlets are associated with kaolinite gangue. Ore minerals are argentite and electrum, together with pyrite, sphalerite, galena, chalcopyrite, minor bornite, covellite, and ruby silver. Wall rock alteration is characterized by narrow (Gangue minerals are dominantly massive quartz intergrown with minor to accessory adularia. Epidote, illite, illite/smectite, and, preferentially at deeper levels, Fe-chlorite gangue indicate near-neutral pH hydrothermal fluids at temperatures of >220°C. Kaolinite occurring with the late sulfide-rich veinlet stage indicates pH 315°, whereas strike directions of <315° are

  1. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  2. URPD: a specific product primer design tool

    Science.gov (United States)

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  3. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    Science.gov (United States)

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  4. A Practical Primer on Geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  5. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  6. Efecto de la harina de semilla de calabaza (Cucurbita maxima) en el colesterol total y ácidos grasos de los huevos de gallinas ponedoras

    OpenAIRE

    Y. Martínez; M. Valdivié; Solano, G.; Mirna Estarrón; Martínez, O; J. Córdova

    2012-01-01

    Para evaluar el efecto de cuatro niveles de inclusión (0, 3.3, 6.6 y 10 %) de harina de semilla de calabaza (Cucurbita maxima) en el colesterol total y ácidos grasos de huevos de gallinas ponedoras, se ubicaron en pleno pico de puesta 160 gallinas White Leghorn (Híbrido L-33) durante 91 d, según diseño completamente aleatorizado. Se aplicó análisis de varianza de clasificación simple, excepto para la concentración de extracto etéreo, donde se utilizó el análisis factorial con cuatro tratamien...

  7. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  8. SBE primer : multiplexing minisequencing-based genotyping

    Energy Technology Data Exchange (ETDEWEB)

    Kaderali, L. (Lars); Deshpande, A. (Alina); Uribe-Romeo, F. J. (Francisco J.); Schliep, A.; Torney, D. C. (David C.)

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  9. Estudio anual de la eliminación de huevos y ooquistes de parásitos gastrointestinales y larvas de nemátodos pulmonares en ovinos de una estancia en Magallanes, Chile Annual study of the of egg and oocyst outputs of gastrointestinal parasites and lungworm larvae in a sheep station of Magallanes, Chile

    Directory of Open Access Journals (Sweden)

    G. SIEVERS

    2002-01-01

    Full Text Available Con el fin de recabar antecedentes epidemiológicos sobre las endoparasitosis del ovino en Magallanes, XIIª Región de Chile, se trabajó en la estancia "Entre Vientos", comuna de Río Verde, durante un año (septiembre de 1999 a agosto del 2000. A partir de animales de 3 categorías de edad mantenidos bajo un sistema de explotación extensiva, compuestos por 9.800 corderos (nacidos durante la primavera de 1999, 1.800 borregas (1 año de edad y 13.500 ovejas (2 o más años de edad, se determinaron las tendencias de eliminación de huevos, ooquistes y larvas de parásitos gastrointestinales y pulmonares. Cada 14 días se obtuvo materia fecal desde el recto de 25 animales pertenecientes a cada grupo de edad, muestreados al azar, para realizar recuentos de huevos y diferenciación de larvas de nemátodos gastrointestinales, recuentos de huevos de cestodos, determinación de animales positivos a ooquistes de protozoos intestinales y detección de larvas de nemátodos pulmonares. Los corderos presentaron las mayores eliminaciones de huevos de nemátodos gastrointestinales durante el verano, con predominancia de los géneros Nematodirus y Ostertagia. En borregas y ovejas, las mayores eliminaciones de Ostertagia y Trichostrongylus se produjeron en primavera, coincidiendo con el alza de la temperatura ambiental. La categoría más contaminante fue la de las ovejas en primavera, mientras que los corderos lo fueron en el verano. Durante la primavera, la mayor parte de los animales eliminó ooquistes de Eimeria spp., pero fueron los corderos los mayores contaminantes. La mayor oviposición de huevos de Moniezia expansa se registró en corderos y borregas, durante el verano y primavera respectivamente. Larvas de Dictyocaulus filaria se detectaron principalmente en corderos durante el otoño e invierno. No se diagnosticaron casos de parasitosis clínicas durante los meses del estudio, lo que se puede explicar dado el sistema de crianza extensivo y al

  10. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  11. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  12. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads;

    2011-01-01

    are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly......Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software......, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid...

  13. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    OpenAIRE

    Nomin Batnyam; Jimin Lee; Jungnam Lee; Seung Bok Hong; Sejong Oh; Kyudong Han

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR-...

  14. DNA sequencing by synthesis with degenerate primers

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The degenerate primer-based sequencing Was developed by a synthesis method(DP-SBS)for high-throughput DNA sequencing,in which a set of degenerate primers are hybridized on the arrayed DNA templates and extended by DNA polymerase on microarrays.In this method,adifferent set of degenerate primers containing a give nnumber(n)of degenerate nucleotides at the 3'-ends were annealed to the sequenced templates that were immobilized on the solid surface.The nucleotides(n+1)on the template sequences were determined by detecting the incorporation of fluorescent labeled nucleotides.The fluorescent labeled nucleotide was incorporated into the primer in a base-specific manner after the enzymatic primer extension reactions and nine-base length were read out accurately.The main advanmge of the DP-SBS is that the method only uses very conventional biochemical reagents and avoids the complicated special chemical reagents for removing the labeled nucleotides and reactivating the primer for further extension.From the present study,it is found that the DP-SBS method is reliable,simple,and cost-effective for laboratory-sequencing a large amount of short DNA fragments.

  15. Efecto de grupo racial y edad al primer parto sobre el número de partos durante la vida útil de vacas cebú Effect of breed group and age at first calving on the number of calvings during the lifetime of Zebu cows

    Directory of Open Access Journals (Sweden)

    JC Segura-Correa

    2013-01-01

    Full Text Available El objetivo del estudio fue determinar el efecto de grupo racial (GG y grupo de edad al primer parto (EPP sobre el número de partos de por vida de las vacas de un sistema de producción localizado en el estado de Yucatán, México. Los datos incluyeron los registros de 765 vacas de los grupos raciales Brahman (Br, n=313, Nelore (Ne, n = 184 y Cebú comercial (CC, cruzas indefinidas de Suizo pardo y Cebú (n = 268, nacidas de 1981 a 2002. Del total de vacas, 391 habían sido desechadas y 374 aún permanecían en el predio (datos censurados. La permanencia (número de partos de las vacas en el hato se evaluó por GG y EPP utilizando la metodología de Kaplan Meier. La curva de sobrevivencia del CC tuvo una declinación más rápida, lo que indica una mayor tasa de desecho para este grupo en comparación con las razas Ne y Br. Las curvas de sobrevivencia de las vacas que tuvieron su primer parto antes de los 2,5 años, y entre 2,5 y 3 años de edad, muestran que ellas tuvieron menores posibilidades de desecho. En conclusión, el GG y la EPP afectaron (P The objective of the study was to determine the effect of breed group (BG and age group at first calving (AFC on the number of calvings during the lifetime of the cows in a production system localised in the state of Yucatan, Mexico. Data included information gathered from 65 cows of the Brahman (Br, n = 313 and Nellore (Ne, n = 184 breeds, and commercial Zebu (CZ, undefined crosses of Brown Swiss and Zebu (n = 268 born from 1981 to 2002. Out of the total number of cows, 391 had been culled and 374 remained in the ranch (censured data. The stayability (number of calvings of the cows in the herd was evaluated by BG and AFC using Kaplan Meier methodology. The survival curve for CZ had the fastest decline, which suggests a greater culling rate for this group in comparison with the Ne and Br cows. The survival curves for the cows that had their first calving before 2.5 years and between 2.5 and 3 years

  16. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  17. Mi Primer Concepto de Turismo

    Directory of Open Access Journals (Sweden)

    María Alejandra Cortés Gutiérrez

    2008-11-01

    Full Text Available El turismo es un hecho social al integrar al humano, pero también es producto de unos efectos económicos y culturales, es decir, el turismo es un hecho integrador y, por lo tanto, el turismo debe ser visto como hecho sociocultural y económico, debido a que el hombre se manifiesta dentro de unos espacios determinados. Además, es un hecho social porque puede ser entendido y analizado desde el exterior y porque está en constante cambio. Por lo tanto, el turismo debe ser visto holísticamente, ya que integra varios elementos; visto como totalidad, como complejidad, como sistema. El turismo también es generador de impactos negativos y positivos sobre las comunidades, unas veces integra, otras destruye, aísla, daña.

  18. Historia del primer templo mayor de Tunja, nombrado de Nuestra Señora de Guadalupe

    Directory of Open Access Journals (Sweden)

    Ernesto Porras Collantes

    2004-01-01

    Full Text Available Gonzalo Suárez Rendón Sarmiento, fundador de Tunja, bautizó con el nombrede Nuestra Señora de Guadalupe al primer templo mayor de la ciudad. Elcarpintero Gregorio López estuvo a cargo de la construcción de la obra, desdefebrero hasta la navidad del año de

  19. Péptidos antihipertensivos derivados de proteínas de leche y huevo Peptides with antihypertensive activity from milk and egg proteins

    Directory of Open Access Journals (Sweden)

    A. Aleixandre

    2008-08-01

    Full Text Available Algunos fragmentos de proteínas alimentarias, una vez liberados mediante hidrólisis, pueden producir un descenso del tono arterial. Son importantes los hidrolizados y péptidos provenientes de proteínas lácteas. Destacan los hidrolizados de caseína con tripsina, y los productos antihipertensivos obtenidos por fermentación de la leche con Lactobacillus helveticus. Estos productos contienen secuencias como Val-Pro-Pro (VPP e Ile-Pro-Pro (IPP, que inhiben la enzima convertidora de la angiotensina (ECA. Algunas cepas de Enterococcus faecalis también producen péptidos antihipertensivos inhibidores de la ECA. Entre estos péptidos destaca la secuencia LHLPLP. Existen asimismo péptidos e hidrolizados antihipertensivos derivados de proteínas de huevo. Podemos citar las secuencias FRADHPFL (ovokinina y RADHPF (ovokinina 2-7 con actividad vasodilatadora endotelio-dependiente, y algunos hidrolizados de clara de huevo que inhiben la ECA. Los productos mencionados podrían utilizarse como ingredientes en alimentos funcionales. Algunos han probado ya su eficacia y seguridad en pacientes hipertensos.Antihypertensive hydrolysates and peptides have been isolated from food proteins. Among them, there are of particular interest the antihypertensive casein hydrolysates, and some antihypertensive products obtained when milk was fermented by Lactobacillus helveticus. The sequences Val-Pro-Pro (VPP and Ile-Pro-Pro (IPP, with angiotensin-converting enzyme (ACE inhibitory activity, have been isolated from these fermented products. Selected Enterococcus faecalis strains can also produce milk derived peptides with ACE inhibitory and antihypertensive activities. The main of them is the sequence LHLPLP. Some studies also describe the production of antihypertensive hydrolysates and peptides from egg proteins. The sequences FRADHPFL (ovokinin and RADHPFL (ovokinin 2-7, that have shown endothelium-dependent vasodilator activity, were obtained at first. Some egg white

  20. Beam shaping for laser initiated optical primers

    Science.gov (United States)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  1. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-06-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects. PMID:26580230

  2. Development of Specific Primer for Tricholoma matsutake

    OpenAIRE

    Kim, Jang-Han; Han, Yeong-Hwan

    2009-01-01

    In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'-GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used ...

  3. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  4. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  5. Primer Design Assistant (PDA): a web-based primer design tool

    OpenAIRE

    Chen, S. H.; Lin, C. Y.; Cho, C.S.; Lo, C.Z.; Hsiung, C. A.

    2003-01-01

    Primer Design Assistant (PDA) is a web interface primer design service combined with thermodynamic theory to evaluate the fitness of primers. It runs in a Linux–Apache–MySQL–PHP structure on a PC equipped with dual CPU (Intel Pentium III 1.4 GHz) and 512 Mb of RAM. A succinct user interface of PDA is accomplished by built-in parameters setting. Advanced options on 5′ GC content, 3′ GC content, dimer check and hairpin check are available. The option of covered region constrains the PCR product...

  6. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  7. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  8. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420. ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.712, year: 2014

  9. Loop-Mediated Amplification Accelerated by Stem Primers

    Directory of Open Access Journals (Sweden)

    Laurence Tisi

    2011-12-01

    Full Text Available Isothermal nucleic acid amplifications (iNAATs have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility.

  10. Loop-mediated amplification accelerated by stem primers.

    Science.gov (United States)

    Gandelman, Olga; Jackson, Rebecca; Kiddle, Guy; Tisi, Laurence

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility. PMID:22272122

  11. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  12. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  13. Caries inhibition by fluoride-releasing primers.

    Science.gov (United States)

    Kerber, L J; Donly, K J

    1993-10-01

    This study evaluated the caries inhibition of dentin primers with the addition of fluoride. Two standardized Class V preparations were placed in 20 molars, the gingival margin placed below the cementoenamel junction and the occlusal margin placed in enamel. Two dentin primers (Syntac and ScotchPrep) were placed in equal numbers of 20 preparations, according to manufacturer's instructions. Ammonium fluoride (10% by weight) was then added to these primers and they were placed in the remaining 20 preparations, opposing the non-fluoridated primer of the same system. All teeth were then restored with a non-fluoridated resin composite. All teeth were subjected to an artificial caries challenge (pH 4.2) for 5 days. Sections of 100 microns were obtained, photographed under polarized light microscopy, then demineralized areas were quantitated by digitization. Results demonstrated the mean areas (mm2 +/- S.D.) demineralization at 0.25 mm, 0.5 mm and 1.0 mm from the restoration margin to be: Syntac/fluoride (1.44 +/- 0.49, 1.68 +/- 0.54, 3.72 +/- 0.74); Syntac (1.99 +/- 0.58, 1.50 +/- 0.35, 2.98 +/- 1.26); ScotchPrep/fluoride (1.23 +/- 0.68, 1.55 +/- 0.64, 3.08 +/- 1.16); ScotchPrep (1.90 +/- 0.83, 1.71 +/- .038, 3.36 +/- 0.62). A paired t-test indicated primers with fluoride to demonstrate significantly less demineralization 0.25 mm from the restoration margin (P < 0.07). PMID:7880460

  14. Christiaan Barnard: 40 años del primer transplante de corazón humano

    OpenAIRE

    Jorge Reynolds; Juan Fernando Cediel; César Payán

    2007-01-01

    Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Chris...

  15. Efectos de la suplementación con membrana de cáscara de huevo sobre alteraciones tendinopáticas, articulares y variables mecánicas del tendón de Aquiles en deportistas de crossfit.

    OpenAIRE

    Jauregui Bidegain, Lucas

    2016-01-01

    Introducción: En la patología del tendón de aquiles es determinante el análisis de los factores mecánicos que ayudan a explicar el comportamiento del tendón, siendo de los más estudiados el stiffness lineal. No existe actualmente evidencia acerca de los efectos de la suplementación con membrana de cáscara de huevo en el stiffness. Únicamente se ha examinado mediante escalas de valoración subjetiva, por lo que la medición mediante ecografía del stiffness tendinoso como variable direc...

  16. Bioecología de huevos y larvas de peces Cetengraulis mysticetus (Chuhueco), Opisthonema sp. (Pinchagua) y Anchoas en la reserva ecológica manglares Cayapas-Mataje - Ecuador

    OpenAIRE

    Luzuriaga de Cruz, M.; Solano Ch., F.; Cevallos, D.

    2007-01-01

    La presente investigación es parte del Convenio de Cooperación Técnica entre el Fondo Ecuatoriano Populorum Pregressio (FEPP) y el Instituto Nacional de Pesca (INP) y tiene como fin principal el estudio de huevos y larvas de chuhueco (Cetengraulis mysticetus), anchoas (Anchoa sp., Anchovia sp. y Engraulis) y pinchagua (Opisthonema sp.) en relación con abundancia y distribución de la microfauna zooplanctónica presente en los esteros durante el período comprendido entre abril del 2000 y diciemb...

  17. Inducción de la muda de gallinas ponedoras mediante el uso de alimentos bajos en energía y proteína: efectos en la producción y en la calidad del huevo postmuda

    OpenAIRE

    Callejo Ramos, Antonio; Nicodemus Martin, Nuria; Buxade Carbo, Carlos

    2012-01-01

    La inducción de la muda en gallinas ponedoras mediante la supresión total del alimento sólido está prohibida en la UE por perjudicar el bienestar de la gallina y su sistema inmunitario. Por ello, es necesario estudiar alternativas (sin ayuno) que logren una adecuada pérdida de peso vivo para que la puesta cese rápidamente, su tract o reproductor se “rejuvenezca”, y la producción de huevos se reanude rápida y satisfactoriamente, con una mínima mo...

  18. MPprimer: a program for reliable multiplex PCR primer design

    OpenAIRE

    Wang Xiaolei; Hang Xingyi; Li Zhifeng; Wu Yonghong; Lu Yiming; Wang Wen; Qu Wubin; Shen Zhiyong; Zhao Dongsheng; Zhang Chenggang

    2010-01-01

    Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nons...

  19. La atención hospitalaria al paciente con ictus en Cataluña: Resultados del «Primer Audit Clínic de l'Ictus. Catalunya, 2005/2006» In-hospital stroke care in Catalonia [Spain]: Results of the «First Clinical Audit of Stroke. Catalonia, 2005/2006»

    Directory of Open Access Journals (Sweden)

    Sònia Abilleira

    2008-12-01

    Full Text Available Objetivo: Analizar la calidad de la atención hospitalaria al paciente con ictus en los hospitales públicos catalanes antes de la difusión de la Guía de Práctica Clínica (GPC del ictus, estudiando el grado de adhesión a determinadas recomendaciones de la GPC. Métodos: Mediante revisión retrospectiva de historias clínicas de pacientes con ictus definidos mediante los códigos CIE-9 431, 433.x1, 434.x1, 436, e ingresados consecutivamente en 48 hospitales públicos catalanes en el primer semestre de 2005, se recogió información sobre distintos indicadores del proceso asistencial al ictus seleccionados según su evidencia científica o su importancia clínica. Los hospitales participantes reclutaron 20, 40 o 60 casos, según el número de ingresos/año. Se llevó a cabo una auditoría externa en el 9,3% de los casos reclutados en cada centro, tras selección aleatoria, para determinar la calidad de los datos recogidos. Los indicadores se agruparon en 6 perfiles relacionados con diferentes aspectos de la práctica clínica. Resultados: Se incluyeron 1.791 casos, un 53,9% hombres, con una media (desviación estándar de edad de 75,6 (12,4 años. La concordancia global entre observadores fue de 0,7. El cumplimiento de los perfiles asistenciales (porcentaje medio [intervalo de confianza del 95%] fue: calidad de la historia clínica, 78,5% (77,5-79,4; estándares de atención básica, 92,4% (91,5-93,2; evaluación neurológica, 38,3% (37,3-39,3; medidas iniciales del tratamiento rehabilitador, 44,9% (43,2-46,7; prevención y manejo de complicaciones, 68,4% (66,9-70, y medidas preventivas iniciales, 78,9% (77,3-80,4. Conclusiones: En 2005 la atención hospitalaria al ictus era mejorable, sobre todo los aspectos relacionados con la evaluación y el seguimiento neurológico del paciente y la rehabilitación.Objective: To determine the quality of in-hospital stroke care in public acute care hospitals in Catalonia before the implementation of a

  20. Estudio de la contaminación con huevos de Toxocara sp. en suelos de espacios públicos de San Martín de los Andes, Provincia del Neuquén. Argentina. (Soil contamination with Toxocara sp. eggs in public parks from San Martín de los Andes, Province of Neuquen, Argentina)

    OpenAIRE

    2005-01-01

    Con el objetivo de determinar la presencia de huevos de Toxocara sp. en suelos de espacios públicos de San Martín de los Andes, Provincia del Neuquén, Argentina, se estudiaron suelos de 12 parques de la localidad entre Abril y Julio de 2005. Se comprobó la presencia de huevos de Toxocara sp. en el 92% de los sitios de muestreados. Se recomienda la implementación de acciones para minimizar los riesgos a la salud pública. The objective being to determine if our soil in parks and publics area...

  1. Selección de Aislamientos de Hongos Entomopatógenos para el Control de Huevos de la Polilla del Tomate, Tuta absoluta Meyrick (Lepidoptera: gelechiidae) Entomopathogenic Fungi Isolates Selection for Egg Control of Tomato Moth Tuta absoluta Meyrick (Lepidoptera: gelechiidae) Eggs

    OpenAIRE

    Marta Rodríguez S.; Marcos Gerding P.; Andrés France

    2006-01-01

    Se realizó un estudio en laboratorio sobre la patogenicidad de 64 aislamientos de Metarhizium anisopliae var. anisopliae y 70 de Beauveria bassiana, en huevos de polilla del tomate Tuta absoluta. La primera evaluación se realizó por aplicación directa de suspensiones de 10(7) conidias mL-1 para cada aislamiento, con el sistema de pulverización de la torre de Potter. La mortalidad y esporulación sobre huevos fueron significativamente mayores con los aislamientos M. anisopliae Qu-M558 y B. bass...

  2. Efecto del aceite esencial de orégano Lippia origanoides Kunth enel desempeño productivo de ponedoras marrón y la peroxidación lipídica de huevos enriquecidos con ácidos grasos poliinsaturados durante su almacenamiento

    OpenAIRE

    Ortiz Cuadros, Ronnal Esneyder

    2014-01-01

    El uso del aceite esencial de orégano (AEO) (Lippia origanoides Kunth) en sistemas de alimentación de ponedoras es poco documentado, por lo tanto, el objetivo de este trabajo consistió en la evaluación del efecto de inclusión del AEO sobre el desempeño productivo de las aves, el perfil de ácidos grasos de los lípidos de la yema del huevo, la estabilidad oxidativa durante el almacenamiento, la calidad sensorial y organoléptica de huevos enriquecidos con AGPI. Se utilizaron 216 ponedoras asigna...

  3. Nutrición y desarrollo psicomotor durante el primer semestre de vida

    Directory of Open Access Journals (Sweden)

    CHÁVEZ ADOLFO

    1998-01-01

    Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.

  4. Monte Carlo primer for health physicists

    International Nuclear Information System (INIS)

    The basic ideas and principles of Monte Carlo calculations are presented in the form of a primer for health physicists. A simple integral with a known answer is evaluated by two different Monte Carlo approaches. Random number, which underlie Monte Carlo work, are discussed, and a sample table of random numbers generated by a hand calculator is presented. Monte Carlo calculations of dose and linear energy transfer (LET) from 100-keV neutrons incident on a tissue slab are discussed. The random-number table is used in a hand calculation of the initial sequence of events for a 100-keV neutron entering the slab. Some pitfalls in Monte Carlo work are described. While this primer addresses mainly the bare bones of Monte Carlo, a final section briefly describes some of the more sophisticated techniques used in practice to reduce variance and computing time

  5. A primer for criticality calculations with DANTSYS

    Energy Technology Data Exchange (ETDEWEB)

    Busch, R.D. [Univ. of New Mexico, Albuquerque, NM (United States). Nuclear Criticality Safety Group

    1997-08-01

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  6. A primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem

  7. Book review: feminist research practice: a primer

    OpenAIRE

    Smith, Emma

    2013-01-01

    The fully revised and updated Second Edition of Feminist Research Practice: A Primer, edited by Sharlene Nagy Hesse-Biber, draws on the expertise of a wide group of interdisciplinary scholars who aim to cover cutting-edge research methods and explore research questions related to the complex and diverse issues that deeply impact women’s lives. Emma Smith finds that it will be valuable for academics already working from or looking to develop their understanding and use of feminist research pra...

  8. Primer for the algebraic geometry of sandpiles

    OpenAIRE

    Perkinson, David; Perlman, Jacob; Wilmes, John

    2011-01-01

    The Abelian Sandpile Model (ASM) is a game played on a graph realizing the dynamics implicit in the discrete Laplacian matrix of the graph. The purpose of this primer is to apply the theory of lattice ideals from algebraic geometry to the Laplacian matrix, drawing out connections with the ASM. An extended summary of the ASM and of the required algebraic geometry is provided. New results include a characterization of graphs whose Laplacian lattice ideals are complete intersection ideals; a new...

  9. Weathered Hydrocarbon Wastes: A Risk Management Primer

    OpenAIRE

    Brassington, Kirsty J.; Hough, Rupert L.; Paton, Graeme I.; Semple, Kirk T.; Risdon, Graeme C.; Crossley, Jane; Hay, I; Askari, K.; Pollard, Simon J. T.

    2007-01-01

    We provide a primer and critical review of the characterization, risk assessment, and bioremediation of weathered hydrocarbons. Historically the remediation of soil contaminated with petroleum hydrocarbons has been expressed in terms of reductions in total petroleum hydrocarbon (TPH) load rather than reductions in risk. There are several techniques by which petroleum hydrocarbons in soils can be characterized. Method development is often driven by the objectives of published...

  10. CRISPR Primer Designer:Design primers for knockout and chromosome imaging CRISPR-Cas system

    Institute of Scientific and Technical Information of China (English)

    Meng Yan; Shi-Rong Zhou; Hong-Wei Xue

    2015-01-01

    The clustered regularly interspaced short palin-dromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especial y the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran local y and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were stil no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs local y and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  11. Avulsión de canino y subluxación del primer premolar superiores derechos

    OpenAIRE

    Berástegui, Esther

    1996-01-01

    Se presenta un caso clínico de avulsión de canino y subluxación del primer remolar, superiores derechos, secundario a traumatismo por piedra lanzada al aire. El tiempo extraoral fue de cuatro horas en medio seco. Se trató con reimplante, ferulización y tratamiento endodóncico. Los controles posteriores a los cuatro años del tratamiento mostraron la evolución favorable del caso.

  12. Non increased neuron-specific enolase concentration in cerebrospinal fluid during first febrile seizures and a year follow-up in pediatric patients No incrementos en la concentración de enolasa específica de neurona en el líquido cefalorraquídeo durante el primer ataque febril y al año en pacientes pediátricos

    Directory of Open Access Journals (Sweden)

    ALBERTO J. DORTA-CONTRERAS

    1998-09-01

    Full Text Available Febrile seizures are the commonest acute neurological disorder of early childhood. Studies suggested that febrile seizures are previous acute events from a more serious neurological problem. Due to neuron-specific enolase is generally accepted as a marker for neuropathological processes in the brain, 16 pediatric patients were studied during their first seizures and a year after it. Neuron-specific enolase in cerebrospinal fluid and blood were analysed by an immune enzyme assay. Non pathological neuron-specific enolase values were obtained in both periods in the group of patients. There were no significative differences when paired series statistics test was performed with 95% of confidence. Neuron-specific enolase appears not to be a marker for febrile seizures because its concentration not be increased in cerebrospinal fluid in this group of patients.Los ataques febriles constituyen el trastorno neurológico agudo más común en la infancia temprana. Existen estudios que sugieren que los ataques febriles son eventos agudos previos a problemas neurológicos más severos. Debido a que la enolasa específica de neurona está aceptada generalmente como marcador de procesos neuropatológicos en el cerebro, se estudiaran 16 pacientes pediátricos durante su primer ataque y al año de este. La enolasa específica de neurona en el líquido cefalorraquídeo y sangre fue analizada por una prueba inmunoenzimática. No se obtuvieron valores patológicos de enolasa específica de neurona en ambos períodos en el grupo de pacientes. No hubo diferencias significativas al aplicar el test de series apareadas con un 95% de confianza. La enolasa específica de neurona parece no ser un marcador para ataques febriles porque su concentración no se incrementa en este grupo de pacientes.

  13. Caracterización de la composición en proteína, lípidos, energía y perfiles de ácidos grasos en huevos de tilapia roja (Oreochromis spp.

    Directory of Open Access Journals (Sweden)

    Rubén Darío Valbuena-Villarreal

    2013-06-01

    Full Text Available Luego de considerar el significado de las tilapias en el escenario piscícola nacional, la posibilidad de mejorar los índices de producción es un imperativo técnico y, dentro de estos, focalizar esfuerzos experimentales en la semilla resulta ser una opción estratégica. Con el fin de establecer un referente de base se utilizaron las puestas individuales de 50 hembras de tilapia roja (Oreochromis spp. para determinar los contenidos en los huevos de proteína (% MS, extracto etéreo (% MS, energía (cal g-1 y los perfiles de ácidos grasos (%, con algunas relaciones de interés analítico. Salvo ciertas variaciones menores, los valores encontrados se ajustan a los registros disponibles para la especie en diferentes estudios, lo que sugiere que las dietas ofrecidas a los reproductores experimentales contienen los mínimos necesarios para asegurar una provisión de nutrientes y energía suficientes para los embriones y las larvas en formación. Se analiza que, como punto de partida, esta serie de datos tiene utilidad para el desarrollo de trabajos destinados a mejorar los estándares de producción de alevinos, considerando que las variaciones en la composición, que pueden ser determinadas sobre los huevos, se pueden utilizar y tienen validez como un indicativo directo de su calidad.

  14. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  15. Aplicación del análisis estadístico implicativo al estudio del rendimiento académico de estudiantes de primer año de las carreras de matemática y ciencia de la computación

    OpenAIRE

    Larisa Zamora Matamoros; Jorge Díaz Silvera

    2014-01-01

    El objetivo del presente trabajo de investigación es revelar posibles relaciones de similaridad, implicación y cohesión entre el rendimiento académico de estudiantes provenientes de preuniversitarios que ingresan a las carreras de Matemática y Ciencia de la Computación y el rendimiento que muestran en las asignaturas de corte matemático y de Programación que reciben en el primer año de las mencionadas carreras. El rendimiento fue analizado a través del índice de ingreso a la Educación Superio...

  16. A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.

  17. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  18. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  19. Primer izpeljave analize besedila v kvalitativni raziskavi

    OpenAIRE

    Roblek, Vasja

    2013-01-01

    V članku na podlagi kvalitativne raziskave prikazujemo primer načina analize in razlage besedila. V prvem delu se osredotočimo na teoretično opredelitev analitičnega orodja ter značilnosti analize in interpretacije besedil znotraj kvalitativne raziskave. V nadaljevanju na podlagi izsledkov (polstrukturiranih intervjujev in osebnih zapisov, opazovanja delovanja dveh mrež) prikažemo možnost analize in interpretacije dobljenih podatkov z uporabo analitičnega orodja tematske mreže.

  20. Primer izpeljave analize besedila v kvalitativni raziskavi:

    OpenAIRE

    Roblek, Vasja

    2009-01-01

    V članku na podlagi kvalitativne raziskave prikazujemo primer načina analize in razlage besedila. V prvem delu se osredotočimo na teoretično opredelitev analitičnega orodja ter značilnosti analize in interpretacije besedil znotraj kvalitativne raziskave. V nadaljevanju na podlagi izsledkov (polstrukturiranih intervjujev in osebnih zapisov, opazovanja delovanja dveh mrež) prikažemo možnost analize in interpretacije dobljenih podatkov z uporabo analitičnega orodja tematske mreže.

  1. Primer premio del I Concurso de monólogos científicos de la Facultad de Ciencias del Mar y Ambientales. Un ratito placentero. La fecundación

    OpenAIRE

    Outón Porras, Javier; Cabrera Castro, Remedios; López López, José Antonio; Albendín García, Gemma

    2015-01-01

    El monólogo que presentaré al simposio tratará sobre la fecundación. La fecundación es el proceso mediante el cual una célula reproductora masculina se une a una célula reproductora femenina para dar lugar a una célula huevo, que también puede recibir el nombre de cigoto. En dicho proceso, dos células haploides (n) se unen para dar lugar a una célula diploide (2n) para que la cantidad de información genética permanezca constante en todas las células. La célula reproductora masculina s...

  2. El primer caso de herejía en el Nuevo Mundo

    OpenAIRE

    Szászdi, István

    2001-01-01

    This article tries to identify the self-styled heretic from among the 39 Spaniards that remained in Fortress of Nativity when Christopher Columbus came back to Spain after his first journey to the New World.

    Intento de identificar al supuesto hereje entre los 39 españoles que se quedan en el Fuerte de la Navidad cuando Cristóbal Colón vuelve a España después de su primer viaje al Nuevo Mundo.

  3. El primer caso de herejía en el Nuevo Mundo

    Directory of Open Access Journals (Sweden)

    Szászdi, István

    2001-12-01

    Full Text Available This article tries to identify the self-styled heretic from among the 39 Spaniards that remained in Fortress of Nativity when Christopher Columbus came back to Spain after his first journey to the New World.

    Intento de identificar al supuesto hereje entre los 39 españoles que se quedan en el Fuerte de la Navidad cuando Cristóbal Colón vuelve a España después de su primer viaje al Nuevo Mundo.

  4. Christiaan Barnard: 40 años del primer transplante de corazón humano.

    Directory of Open Access Journals (Sweden)

    Jorge Reynolds

    2009-11-01

    Full Text Available «El sábado, yo era un cirujano en Sudáfrica, poco conocido.El lunes, yo era una celebridad mundial» Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano.

  5. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  6. pmoA Primers for Detection of Anaerobic Methanotrophs▿

    OpenAIRE

    Luesken, F.A.; Zhu, B.; Alen, T.A. van; Butler, M.K.; Diaz, M. R.; Song, B.; Op den Camp, H.J.M.; M. S. M. Jetten; Ettwig, K.F.

    2011-01-01

    Published pmoA primers do not match the pmoA sequence of “Candidatus Methylomirabilis oxyfera,” a bacterium that performs nitrite-dependent anaerobic methane oxidation. Therefore, new pmoA primers for the detection of “Ca. Methylomirabilis oxyfera”-like methanotrophs were developed and successfully tested on freshwater samples from different habitats. These primers expand existing molecular tools for the study of methanotrophs in the environment.

  7. Evaluación de la respuesta de 60 genotipos de solanum phureja (juz. et buk.) al ataque de la polilla guatemalteca (tecia solanivora povolny)

    OpenAIRE

    Cadena, Marleny; Naranjo, Alvaro; Ñústez, Carlos E.

    2010-01-01

    Se evaluó el daño en tubérculo causado por la polilla guatemalteca (Tecia solanivora P.) en 60 genotipos de la especie Solanum phureja bajo condiciones de laboratorio en la Universidad Nacional de Colombia. Se utilizó un diseño completamente al azar con cinco repeticiones, tomando como unidad experimental un tubérculo, sobre el cual se colocaron 20 huevos de T. solanivora. Las variables evaluadas fueron: porcentaje de eclosión, porcentaje de pupamiento y porcentaje de daño. Los resultados obt...

  8. Complejidad del sistema de conductos en la raíz distal de un primer molar mandibular

    OpenAIRE

    Sierra Lorenzo, Alberto; Valencia de Pablo, Oliver

    2012-01-01

    El primer molar inferior es una pieza clave dentro de la arcada dental; sin embargo, de forma frecuente se ve sometido a un tratamiento endodóntico. En tal caso, la apertura cameral ha de tener una forma rectangular, para no omitir la presencia de un posible segundo conducto distal, hecho que ha sido asociado en numerosas ocasiones al fracaso de dicho tratamiento. Pero como bien describió Hess1, ya en 1921, cuando el primer molar mandibular termina la maduración de sus raíces, ...

  9. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    Science.gov (United States)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    high-schools. We are now producing a second edition, which is an entirely new re-write, and we are making the process of producing the primer a development opportunity in its own right, to strengthen the international community of early-career astrobiologists. We have recruited a large team of writers and editors, 45 people from 11 different countries across North and South America, Europe and Australia. By working together on this joint project we are strengthening links between early-career scientists in these countries. In addition, we have a wider group of early-career astrobiologists who we consulted on the content that the primer should include. We have also recruited early-career scientists from this group, and more widely, to act as 'accessibility reviewers' to check that the primer meets its goal of being clear to people who are not experts in the field. We expect that the primer will be published in 2012, in several different languages. It will be freely available online to all who want it. References 1. Mix LM et al (2006) The Astrobiology Primer : An Outline of General Knowledge - Version 1, 2006 Astrobiology 6(5) : 735-813

  10. Corrosion Studies of 2195 Al-Li Alloy and 2219 Al Alloy with Differing Surface Treatments

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.

    1998-01-01

    Corrosion studies of 2195 Al-Li and 2219 Al alloys have been conducted using the scanning reference electrode technique (SRET) and the polarization resistance (PR) technique. The SRET was used to study corrosion mechanisms, while corrosion rate measurements were studied with the PR technique. Plates of Al203 blasted, soda blasted and conversion coated 2219 Al were coated with Deft primer and the corrosion rates studied with the EIS technique. Results from all of these studies are presented.

  11. High universality of matK primers for barcoding gymnosperms

    Institute of Scientific and Technical Information of China (English)

    Yan LI; Lian-Ming GAO; RAM C.POUDEL; De-Zhu Li; Alan FORREST

    2011-01-01

    DNA barcoding is a tool to provide rapid and accurate taxonomic identification using a standard DNA region. A two-marker combination of rnatK+rbcL was formally proposed as the core barcode for land plants by the Consortium for the Barcode of Life Plant Working Group. However, there are currently no barcoding primers for matK showing high universality in gymnosperms. We used 57 gymnosperm species representing 40 genera, 11families and four subclasses to evaluate the universality of nine candidate matK primers and one rbcL primer in this study. Primer (1F/724R) of rbcL is proposed here as a universal primer for gymnosperms due to high universality. One of the nine candidate matK primers (Gym_F1A/Gym_R1A) is proposed as the best "universal" matK primer for gynnosperms because of high polymerase chain reaction success and routine generation of high quality bidirectional sequences. A specific matK primer for Ephedra was newly designed in this study, which performed well on the sampled species. The primers proposed here for rbcL and matK can be easily and successfully amplified for most gymnosperms.

  12. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  13. Coverage evaluation of universal bacterial primers using the metagenomic datasets

    Directory of Open Access Journals (Sweden)

    Mao Dan-Ping

    2012-05-01

    Full Text Available Abstract Background The coverage of universal primers for the bacterial 16S rRNA gene plays a crucial role in the correct understanding of microbial community structure. However, existing studies on primer coverage are limited by the lack of appropriate databases and are restricted to the domain level. Additionally, most studies do not account for the positional effect of single primer-template mismatches. In this study, we used 7 metagenomic datasets as well as the Ribosomal Database Project (RDP to assess the coverage of 8 widely used bacterial primers. Results The coverage rates for bacterial primers were found to be overestimated by previous studies that only investigated the RDP because of PCR amplification bias in the sequence composition of the dataset. In the RDP, the non-coverage rates for all primers except 27F were ≪6%, while in the metagenomic datasets, most were ≫10%. If one considers that a single mismatch near the 3′ end of the primer might greatly reduce PCR efficiency, then some phylum non-coverage rates would change by more than 20%. Primer binding-site sequence variants that could not pair with their corresponding primers are discussed. Conclusions Our study revealed the potential bias introduced by the use of universal bacterial primers in the assessment of microbial communities. With the development of high-throughput, next-generation sequencing techniques, it will become feasible to sequence more of the hypervariable regions of the bacterial 16S rRNA gene. This, in turn, will lead to the more frequent use of the primers discussed here.

  14. Evaluation of conservation programs: a primer

    Energy Technology Data Exchange (ETDEWEB)

    Soderstrom, E.J.; Berry, L.G.; Hirst, E.; Bronfman, B.H.

    1981-07-01

    This primer is an introduction to the field of program evaluation. A considerable amount of information is included about the actual conduct of an evaluation. No specific activity is addressed, but rather an idea is provided of the issues and constraints characteristic of each phase and activity of an evaluation. Examples of how these issues arise and potential solutions are presented. Chapter 1 provides background on the origins and evolution of evaluation, focusing especially on why evaluation is currently receiving increased emphasis. Chapter 2 is an overview of the field of evaluation, especially as it relates to energy conservation. Chapter 3 is a consideration of the steps involved in conducting an evaluation from the planning stage to data analysis. Chapter 4 discusses managerial considerations in conducting an evaluation. Chapter 5 discusses evaluators as people; both in terms of organizational obstacles likely to be encountered by, and personal characteristics found in, good evaluators. An appendix includes suggested further readings.

  15. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  16. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  17. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  18. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  19. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  20. Formaldehyde as hypothetical primer of biohomochirality

    Energy Technology Data Exchange (ETDEWEB)

    Goldanskii, V.I. [N. N. Semenov Institute of Chemical Physics of the Russian Academy of Sciences, Kosygin Street 4, Moscow, 117334 (Russia)

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  1. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (keff). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple keff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  2. Contaminación y viabilidad de huevos de Toxocara spp. en suelo y heces colectadas en parques públicos, calles y perros en Toluca, México

    OpenAIRE

    Camilo Romero-Núñez; Selene Yañez-Arteaga; Germán David Mendoza-Martínez; Lilia Patricia Bustamante-Montes; Ninfa Ramírez-Durán

    2013-01-01

    Se realizó un estudio de contaminación y viabilidad de huevos de Toxocara spp, parásito zoonótico en la ciudad de Toluca, México, para lo cual se colectaron 2374 muestras de suelos de siete parques, 350 de suelo de jardines de casas, 199 heces de perros con propietario y 199 heces obtenidas de la vía pública en las áreas cercanas a los parques. En los parques, la conta- minación con Toxocara fue de 24,7% y la viabilidad de 73,3%, siendo menor en los jardines de casa (13,9 y 40,3%, respe...

  3. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  4. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  5. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  6. Uncoupling primer and releaser responses to pheromone in honey bees

    Science.gov (United States)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  7. UniFrag and GenomePrimer : selection of primers for genome-wide production of unique amplicons

    NARCIS (Netherlands)

    van Hijum, SAFT; de Jong, A; Buist, G; Kok, J; Kuipers, OP

    2003-01-01

    The complementary programs UniFrag and GenomePrimer were developed to provide a reliable high-throughput method to select the most unique regions within genomic DNA sequence(s) and design primers therein, involving minimal user intervention and maximum flexibility.

  8. PrimerSeq:Design and Visualization of RT-PCR Primers for Alternative Splicing Using RNA-seq Data

    Institute of Scientific and Technical Information of China (English)

    Collin Tokheim; Juw Won Park; Yi Xing

    2014-01-01

    The vast majority of multi-exon genes in higher eukaryotes are alternatively spliced and changes in alternative splicing (AS) can impact gene function or cause disease. High-throughput RNA sequencing (RNA-seq) has become a powerful technology for transcriptome-wide analysis of AS, but RT-PCR still remains the gold-standard approach for quantifying and validating exon splicing levels. We have developed PrimerSeq, a user-friendly software for systematic design and visualization of RT-PCR primers using RNA-seq data. PrimerSeq incorporates user-provided tran-scriptome profiles (i.e., RNA-seq data) in the design process, and is particularly useful for large-scale quantitative analysis of AS events discovered from RNA-seq experiments. PrimerSeq features a graphical user interface (GUI) that displays the RNA-seq data juxtaposed with the expected RT-PCR results. To enable primer design and visualization on user-provided RNA-seq data and transcript annotations, we have developed PrimerSeq as a stand-alone software that runs on local computers. PrimerSeq is freely available for Windows and Mac OS X along with source code at http://primerseq.sourceforge.net/. With the growing popularity of RNA-seq for transcriptome stud-ies, we expect PrimerSeq to help bridge the gap between high-throughput RNA-seq discovery of AS events and molecular analysis of candidate events by RT-PCR.

  9. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  10. A primer on climate relevant technology transfer

    International Nuclear Information System (INIS)

    The aim of this primer is to support technology transfer initiatives related to mitigation of emissions of greenhouse gases and adaptation to climate change in developing countries and economies in transition. It is meant to provide guidance to all parties involved in the transfer of climate relevant technologies, micluding government, business organisations and other non-governmental organizations representing all sectors relevant for climate change. The emphasis in this primer is on strategic and organisational issues related to the transfer of climate relevant technologies, in particular with a view to utilise climate-relevant technologies in the development process of developing countries and countries in economic transition. It builds upon insight gained in National Needs Assessments regarding the Transfer of Enviromentally Sound Technologies to developing countries. Chapter 2 deals with the technology transfer process for climate relevant technologies. It provides a framework for co-ordinated action of the stakeholders involved in the technology transfer process, with a view to improve the utilisation of climate relevant technologies in the development process of developing countries. It therefore proposes three main 'pillars' for climate relevant technology transfer, i.e. creating an enabling environment for stakeholders' participation, assessing mitigation and adaptation needs and opportunities, and implementing and evaluating mitigation and adaptation actions. Chapter 3 elaborates on creating an enabling environment for stakeholders' participation. It deals in particular with the selection of priority sectors and obtaining involvement of stakeholders representing these prioritised sectors, in order to start a roundtable process for the preparation of mitigation and adaptation actions. Chapter 4 covers the second pillar 'assessing mitigation and adaptation needs and opportunities'. This encompasses several assessment tasks including: identification and

  11. Kadar Malondialdehid (MDA) Pada Kejadian Dismenore Primer

    OpenAIRE

    Prabudi, M Oky; Nasution, Syamsul A.; M. Fahdhy; Lubis, Rushakim; Edianto, Deri; Yusuf, M.

    2014-01-01

    Objective: To determine differences in MDA levels in menarche age adolescents with and without primary dysmenorrhea Methods: The study used a case control design with comparative analytical approach method and correlative analysis. The analysis carried out in the form of bivariate variables. Subjects were students at the elementary and junior high schools and the Integrated Al-Ulum Al-Washliyah MTsS in Medan. All the girls who have been menstruating for 6 -12 months since menarche and ha...

  12. Una experiencia con QSB+ en Matemáticas de primer curso

    Directory of Open Access Journals (Sweden)

    Ordás Amo, Pilar

    2001-01-01

    Full Text Available Nuestro objetivo con este trabajo es presentar una experiencia que hemos llevado a cabo con los alumnos de primer curso, en la asignatura de Matemáticas, de las Licenciaturas en Ciencias Económicas y Administración y Dirección de Empresas, durante los cursos 1999/2000 y 2000/2001. El propósito de la experiencia es que los alumnos de primer curso vean una parte de la optimización matemática, como es la programación lineal, y el método del Símplex, a través de un software informático sencillo como es el QSB+, en el aula de ordenadores. Para llevar a cabo la experiencia, se añadió una hora lectiva al horario de los alumnos implicados y de los profesores de Matemáticas de primer curso, con plan nuevo (plan 99, durante el segundo semestre, de forma totalmente voluntaria para los alumnos, aunque la materia explicada en estas clases “extras” formaba parte del examen final de la asignatura. El nombre oficial de la experiencia fue Seminario de Programación Lineal, y tuvo una duración aproximada de quince horas lectivas.

  13. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  14. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  15. El impacto y la recepción del Concilio Ecuménico Vaticano II en Navarra. Una aproximación al primer posconcilio marcado por la figura del prelado Mons. Enrique Delgado Gómez (1965-1968

    Directory of Open Access Journals (Sweden)

    Edurne Yániz Berrio

    2015-03-01

    Full Text Available Los estudios sobre el Concilio Ecuménico Vaticano II están viviendo un nuevo impulso con la aparición de una línea de investigación que sitúa a las iglesias locales como sujeto y objeto vivo/activo del propio Concilio. Este artículo se inscribe en esta línea, centrando nuestra atención en el impacto y la recepción del Concilio en la diócesis de Pamplona-Tudela, y más concretamente durante el primer post-concilio (1965-1968 a través del comporta-miento de dos figuras claves en el proceso de recepción conciliar: la figura del prelado y la comunidad eclesial local.   Palabras clave: Iglesia local, postconcilio, prelado, comunidad eclesial local. _______________Abstract: Studies about Council Vatican II have recently boosted with the arrival of a new investigation line which reveals local churches as a living/active subject and object within the council itself. This is the place where this article should be placed. Indeed, it draws all attention to the impact and the way the council was em-braced in the Pamplona-Tudela diocese, especially during the first post council period (1965-1968, through the figure of the prelate and the local church community.    Keywords: Local church, post council period, prelate, local church community. 

  16. Las bibliotecas públicas durante el primer franquismo: entre la continuidad y la ruptura

    OpenAIRE

    Rodrigo Echalecu, Ana María

    2009-01-01

    En esta Memoria se analiza el concepto de biblioteca pública durante el primer franquismo, así como la organización bibliotecaria, los Centros Coordinadores de Bibliotecas, los diferentes tipos de bibliotecas públicas, así como el personal que las gestionó y sus instalaciones. Especial atención han recibido las bibliotecas municipales al estudiar el marco jurídico y su localización a través de una cartografía inédita.

  17. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  18. PRIMER HALLAZGO DE Cyclospora cayetanensis EN CONCEPCION, CHILE 1997

    Directory of Open Access Journals (Sweden)

    NANCY RIVERA

    1997-07-01

    Full Text Available Se describe el hallazgo de Cyclospora cayetanensis en una muestra de deposición, en la cual se observó también formas vacuoladas de Blastocystis hominis y trofozoítos y quistes de Entamoeba coli. La muestra provenía de un paciente de 50 Es importante señalar que la sola observación años de edad, de sexo femenino, quien había visitado Cuba, y que, a los 5 días de regreso a Chile, comenzó con sintomatología. El examen parasitológico seriado de deposición se llevó a cabo 30 días después de su regreso al país. Se realizó observación al fresco de heces preservadas en fijador PAF (fenol, alcohol, formalina con lugol, MIF (merthiolate, lugol, formol, y yodo de D'Antoni; al mismo tiempo se prepararon 3 frotis del sedimento fecal los que fueron teñidos mediante tinción de Ziehl Neelsen modificada, Kinyou y Safranina. Una proporción de los O quistes encontrados fueron medidos. La identificación de C. cayetanensis fue confirmada en esta muestra por el Center for Disease Control and Prevention (CDC Atlanta, Georgia, USA y por el Departamento de Parasitología del Hospital for Tropical Diseases (London UK. Este constituye el primer hallazgo de C. cayetanensis informado en Concepción, ChileThe finding of Cyclospora cayetanensis in a stool sample from a 50 year old Chilean female patient is reported. The patient had recently returned from a visit to Cuba and exhibited diarrhoeal symptons in the fifth day after arriving to Chile. The stool sample was obtained 30 days after her return to the country. Direct microscopic abservation were made in preparations of the stool sample preserved in phenol, alcohol, fonmalin (PAF with iodine, merthiolate, iodine-fonmalin (MIF and iodine de D'Antoni. In addition, three smears of the faecal sedimenl were stained with madified Ziehl-Neelsen, Kinyou, and Safranin. The oocyst sizes were measured. The identification of C. cayetanensis was confinmed in this sample by the Center for Disease control and

  19. Effects of continuous drought and immersion on hatchability of Ochlerotatus albifasciatus (Diptera: Culicidae eggs stored at low temperature Efecto de la sequía continua y la inmersión sobre la respuesta de eclosión de los huevos de Ochlerotatus albifasciatus (Diptera: Culicidae almacenados a baja temperatura

    Directory of Open Access Journals (Sweden)

    Raúl E Campos

    2007-07-01

    Full Text Available The role of environmental factors on the hatching response of O. albifasciatus (Macquart eggs is studied by simulating winter conditions in the laboratory. The hypothesis tested was that hatching response is affected by: (1 time that eggs remain at low temperature, (2 storage conditions, and (3 acclimatization time. Eggs were stored at 5ºC in drought and immersion conditions during 7, 21, 35, 90 and 146 days, immediately after, they were acclimatized at 22ºC during 24, 72, and 168 hours, and then eggs were flooded to induce hatching. Percent of hatched eggs was analyzed with a Generalized Lineal Model with a binomial distribution. Results show that: (1 a long storage period at cold temperature and long acclimatization periods improve the hatching response; (2 storage conditions have a moderate effect on hatching, being more evident in eggs stored dry; (3 a long time of acclimatization favors the hatching response in submerged eggs more than in eggs stored dry; (4 long time at cold favors the hatching response in eggs stored dry more than in submerged eggs; (5 the hatching response of eggs that remain for a long time at low temperature is higher when the time of acclimatization is long.Se estudió el rol de los factores ambientales sobre la eclosión de los huevos de O. albifasciatus (Macquart, simulando condiciones de invierno. La hipótesis planteada fue que la respuesta de eclosión de los huevos depende de: (1 tiempo de permanencia a baja temperatura, (2 condiciones de almacenamiento, y (3 tiempo de aclimatación. Los huevos fueron almacenados a 5º C en condiciones de sequía y sumergidos durante 7, 21, 35, 90 y 146 días; luego fueron aclimatados a 22º C durante 24, 72, y 168 horas y posteriormente inundados para inducir la eclosión. El porcentaje de huevos eclosionados se analizó con un Modelo Lineal Generalizado con distribución binomial. Los resultados mostraron que: (1 largos períodos de almacenamiento en frío y largos tiempos

  20. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  1. PRIMER FOR FINANCIAL ANALYSIS OF POLLUTION PREVENTION PROJECTS

    Science.gov (United States)

    This primer will serve as a basic guide to pollution prevention investment -- specifically, the preparation of financial comparisons and justifications for such expenditures. he emphasis is on the basic analytical techniques needed to justify pollution prevention investments. onc...

  2. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  3. Loop-Mediated Amplification Accelerated by Stem Primers

    OpenAIRE

    Laurence Tisi; Guy Kiddle; Olga Gandelman; Rebecca Jackson

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites ...

  4. PD5: A General Purpose Library for Primer Design Software

    OpenAIRE

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliab...

  5. Estabilidad oxidativa de huevos enriquecidos con ácidos grasos poliinsaturados omega 3, frente a antioxidantes naturales Estabilidade oxidativa de ovos enriquecidos com ácidos graxos poliinsaturados ômega 3, frente a antioxidantes naturais

    Directory of Open Access Journals (Sweden)

    María Elena Bernal Gómez

    2003-12-01

    Full Text Available Fueron alimentadas 192 gallinas ponedoras de 22 semanas de edad, de linaje comercial Babcock, durante 30 días con dietas de 0 (cero y 12,7% de semilla de linaza molida que corresponde a 0 y 5% de aceite de linaza, respectivamente. Fueron definidos 8 tratamientos: 4 grupos con 12,7% de semilla de linaza (control/sin antioxidante; BHA+BHT, 100+100 ppm; orégano, 200 ppm; romero, 200 ppm y 4 grupos sin semilla de linaza, pero utilizando los mismos antioxidantes. Este estudio fue realizado con el objetivo de verificar la eficacia del uso de antioxidantes naturales provenientes del orégano y del romero en la protección contra el deterioro oxidativo de la fracción lipídica de las yemas de los huevos enriquecidos con ácidos grasos poliinsaturados omega 3 (PUFA É-3. El grado de oxidación lipídica fue determinado a través de la prueba TBARS (substancias reactivas con ácido tiobarbitúrico. Según los resultados obtenidos, fue verificada diferencia significativa en la reducción del grado de oxidación lipídica de las yemas de huevo en todos los tratamientos con antioxidantes, cuando se compara con el control. Por lo tanto, los extratos de los condimentos, romero y orégano, pueden ser utilizados satisfactoriamente para obtener huevos enriquecidos con PUFA É-3, mejorando la estabilidad lipídica.Foram alimentadas 192 galinhas poedeiras de 22 semanas de idade da linhagem comercial Babcock, durante 30 dias com dietas constituídas de 0 (zero e 12,7% de semente de linhaça moída correspondente a 0 e 5% de óleo de linhaça, respectivamente. Foram definidos 8 tratamentos: 4 grupos com 5% de óleo de linhaça (controle/sem antioxidante; BHA+BHT, 100+100 ppm; orégano, 200 ppm; alecrim, 200 ppm e 4 grupos sem óleo de linhaça, mas utilizando os mesmos antioxidantes. Este estudo foi realizado com o objetivo de verificar a eficácia do uso de antioxidantes naturais provenientes do orégano e do alecrim, na proteção contra a deteriora

  6. New universal matK primers for DNA barcoding angiosperms

    Institute of Scientific and Technical Information of China (English)

    Jing YU; Jian-Hua XUE; Shi-Liang ZHOU

    2011-01-01

    The chloroplast maturase K gene (matK) is one of the most variable coding genes of angiosperms and has been suggested to be a "barcode" for land plants. However, matK exhibits low amplification and sequencing rates due to low universality of currently available primers and mononucleotide repeats. To resolve these technical problems, we evaluated the entire matK region to find a region of 600-800 bp that is highly variable, represents the best of all matK regions with priming sites conservative enough to design universal primers, and avoids the mononucleotide repeats. After careful evaluation, a region in the middle was chosen and a pair of primers named natK472F and matK1248R was designed to amplify and sequence the matK fragment of approximately 776 bp. This region encompasses the most variable sites, represents the entire matK region best, and also exhibits high amplification rates and quality of sequences. The universality of this primer pair was tested using 58 species from 47 families of angiosperm plants. The primers showed a strong amplification (93.1%) and sequencing (92.6%)successes in the species tested. We propose that the new primers will solve, in part, the problems encountered when using matK and promote the adoption of matK as a DNA barcode for angiosperms.

  7. Influencia del pH y de la fuerza iónica sobre la gelificación térmica de proteínas de la yema de huevo

    Directory of Open Access Journals (Sweden)

    Partal, Pedro

    2007-09-01

    Full Text Available Thermal-induced transitions of egg yolk were studied by using Differential Scanning Calorimetry (DSC and temperature controlled Small Amplitude Oscillatory Shear (SAOS. The influence of composition (pH and electrolyte concentration and type was analyzed. The results obtained under DSC measurements suggest a continuous evolution in protein denaturation which depends on pH and salt content. Slope temperature measured by SAOS allowed the analysis of the evolution of the viscoelasticity functions during the gelification process. Viscoelasticity functions showed a dramatic increase and were affected by the pH, ionic strength and salt type. SAOS was also used to obtain the mechanical spectra of egg yolk dispersions and gels as a function of composition. The influence of pH and ionic strength on line ar viscoelastic properties and microstructure may be explained in terms of the model for the formation of gel networks of globular proteinsEn este trabajo se estudiaron las transiciones térmicas de la yema de huevo usando técnicas de calorimetría diferencial de barrido (DSC y ensayos viscoelásticos lineales, más concretamente, ensayos de cizalla oscilatoria de baja amplitud (SAOS. Se analizó la influencia de la composición (pH, concentración de electrolito y tipo. Los resultados obtenidos mediante calorimetría diferencial de barrido sugieren una continua evolución en el proceso de desnaturalización de la proteína, el cual depende de variables como el pH y la concentración de electrolito. Los ensayos calorimétricos se complementan con los reológicos. Así, la realización de rampas de temperatura usando medidas “in situ” de cizalla oscilatoria, permite determinar la evolución de las funciones viscoelásticas durante el proceso de gelificación, poniéndose de manifiesto un notable incremento de dichas funciones, que va a depender del pH, fuerza iónica y tipo de electrolito. Los ensayos de cizalla oscilatoria fueron igualmente

  8. Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular

    Directory of Open Access Journals (Sweden)

    Lucero López-Díaz

    2016-01-01

    Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.

  9. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    Energy Technology Data Exchange (ETDEWEB)

    Rearden, Bradley T [ORNL; Mueller, Don [ORNL; Bowman, Stephen M [ORNL; Busch, Robert D. [University of New Mexico, Albuquerque; Emerson, Scott [University of New Mexico, Albuquerque

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  10. Antonio Roalas. Un pintor del primer tercio del siglo XVII en Madrid

    Directory of Open Access Journals (Sweden)

    Rodríguez Rebollo, Ángel

    2004-03-01

    Full Text Available El conocimiento que actualmente se tiene sobre los pintores del barroco madrileño ha avanzado mucho desde que Ángulo y Pérez Sánchez publicaran los dos volúmenes dedicados al primer y segundo tercio del siglo XVII. Posteriormente han ido viendo la luz estudios más pormenorizados, a veces en forma de exposiciones, que han clarificado aún más la importancia de los artistas que trabajaron en torno a la Corte de los llamados «los Austrias menores»; sin embargo, existen aún hoy un buen número de pintores sólo conocidos a través de contratos o inventarios de la época. La absoluta desinformación que tenemos de ellos, acrecentada por la inexistencia de obras firmadas, no permite a los historiadores dedicarles al menos un estudio parcial de su arte…

  11. Studies on the Primers Screening for AFLP Fingerprints of Rice Cultivars

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun-qing; JIA Ji-zeng

    2002-01-01

    AFLP(amplified fragment length polymorphism) is a very powerful fingerprinting technology.The key of making variety fingerprints is to select specific powerful primers for each crop. A quick and effective procedure for selecting AFLP primers for rice variety fingerprinting was established as the following: (1)Choose 3 or more group materials that have close genetic relations. (2) Select potential polymorphic primers from primer pairs that are 2 + 2 primer crosses and same at two ends. (3) Recombine the selected potential polymorphic primers and choosing more polymorphic primers. (4) Add one selecting base at one end to become 2 + 3 or 3 + 2primers and further selecting more polymorphic primers. Some primers were selected with this procedure, such as M21Ps7 and M73P17, with which the fingerprints had more polymorphism and high quality.

  12. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  13. El primer año de Canadá en la Organización de Estados Americanos

    OpenAIRE

    Bullis, Clayton

    1991-01-01

    El 27 de octubre de 1989, el Primer Ministro, haciendo uso de la palabra durante asamblea de dirigentes del continente en San José de Costa Rica, anunciaba que las relaciones entre Canadá y América Latina tendrían un punto de partida. En efecto, Canadá había decidido adherirse a la OEA a fin de participar plenamente en el desarrollo de las Américas. Es por ello que había solicitado al observador permanente de Canadá en la OEA informar al Secretario General que Canadá había dispuesto firmar...

  14. Necesidades en salud del diabético usuario del primer nivel de atención

    OpenAIRE

    Salinas-Martínez Ana M.; Muñoz-Moreno Francisco; Barraza de León Alma R.; Villarreal-Ríos Enrique; Núñez-Rocha Georgina M.; Garza-Elizondo María E.

    2001-01-01

    Objetivo. Determinar la magnitud y jerarquizar la necesidad de salud satisfecha del diabético tipo 2, usuario del primer nivel de atención. Material y métodos. Se realizó un estudio transversal comparativo con representatividad rural y urbana, en el Instituto Mexicano del Seguro Social, en Nuevo León, en 1999. Fueron entrevistados, al azar, 256 diabéticos tipo 2 con dos o más años de diagnóstico. La información fue complementada con el expediente clínico y encuesta al proveedor. Se evaluaron ...

  15. PENGOLAHAN PRIMER LIMBAH TEKSTIL DENGAN ELEKTROKOAGULASI

    Directory of Open Access Journals (Sweden)

    Lieke Riadi

    2014-12-01

    Full Text Available Limbah industri tekstil di area pinggir kota Surabaya mempunyai karakteristik perbandingan COD dan BOD = 5.57. Limbah jenis ini sulit untuk dibiodegradasi. Studi ini mempelajari tekonologi elektrokoagulasi untuk mengolah limbah tekstil dengan menurunkan intensitas warna, Total Suspended Solid (TSS dan Chemical Oxygen Demand (COD. Percobaan batch pada suhu kamar dilakukan untuk mempelajari pengaruh pH, jarak elektroda terhadap penurunan warna,TSS dan COD dan membandingkan biaya operasinya jika menggunakan pengolahan kimia.Effisiensi penurunan tertinggi untuk warna (91.96%,  TSS (49.17%, dan COD (29.67% terjadi pada pH awal 4.0 dan jarak elektroda 2 cm dengan  elektroda Al/Al. Waktu optimum penurunan intensitas warna dalah 10 menit. Laju penurunan COD adalah : -dC/dt = 0.0053 C +0.056 , dengan C adalah konsentrasi COD. Jumlah sludge yang dihasilkan daripengolahan elektrokoagulasi  3.4 % lebih kecil dibandingkan menggunakan bahan kimia. Biaya yang digunakan untuk pengolahan dengan elektrokoagulasi 52.35 % lebih murah dibandingkan jika menggunakan koagulasi dengan bahan kimia ( tawas. Kata kunci : elektrokoagulasi, penurunan warna, penurunan TSS, laju degradasi COD, imbah tekstil Abstract Waste water from textile industry which is located in one suburb of Surabaya city as characteristic which the ratio of COD to BOD was 5.57. This type of waste water is difficult to be biodegraded. This study investigated elektrokoagulasi technology to treat textile waste water by removing color, total suspended solid, and Chemical Oxygen Demand. Batch experiment at room temperature was carried out to study the effect of pH, electrode distance for color, TSS and COD removal. This study also tried to compare the operation cost between elektrokoagulasi and chemical processes. The best removal efficiencies by Al electrodes was 91.96 % for color, 49.17 % for TSS and 29.67 % for COD which were under initial pH 4.0 and electrodes distance 2 cm. The optimum operation

  16. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  17. New cyt b gene universal primer set for forensic analysis.

    Science.gov (United States)

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  18. A primer on wavelets and their scientific applications

    CERN Document Server

    Walker, James S

    2008-01-01

    In the first edition of his seminal introduction to wavelets, James S. Walker informed us that the potential applications for wavelets were virtually unlimited. Since that time thousands of published papers have proven him true, while also necessitating the creation of a new edition of his bestselling primer. Updated and fully revised to include the latest developments, this second edition of A Primer on Wavelets and Their Scientific Applications guides readers through the main ideas of wavelet analysis in order to develop a thorough appreciation of wavelet applications. Ingeniously relying o

  19. La gallina de los huevos de oro de nuevo está en peligro. Imágenes, posibilidades y viabilidades de la inteligencia colectiva

    Directory of Open Access Journals (Sweden)

    Jaime Alejandro Rodríguez Ruiz

    2007-01-01

    Full Text Available Dos proyectos wiki de ficción colaborativa, uno que fracasa y otro que se desarrolla con éxito, sirven como pretexto en este artículo para desplegar una reflexión sobre los nuevos modos de pensamiento y de vínculo social, favorecidos hoy por las nuevas tecnologías de la información y la comunicación: el proyecto de la inteligencia colectiva. Cuatro autores fundamentan esta reflexión: Pierre Lévy, Derrick de Kerckhove, Howard Rheingold y David Casacuberta. Después de mostrar las posibilidades del ejercicio de la inteligencia colectiva, el artículo concluye al afirmar que el espacio del conocimiento se constituye, irreversiblemente, en un nuevo espacio antropológico: el de la inteligencia colectiva, al que todos estamos llamados a construir.

  20. ALS Association

    Science.gov (United States)

    ... toward a world without ALS! Walk to Defeat ALS® Walk to Defeat ALS® draws people of all ... We need your help. I Will Advocate National ALS Registry The National ALS Registry is a congressionally ...

  1. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1997-01-01

    Reverse transcription of retroviral genomes is primed by a tRNA annealed to an 18-nucleotide primer binding site. Here, we present a primer complementation system to study molecular interaction of the replication machinery with the primer and primer binding site in vivo. Introduction of eight base...... substitutions into the primer binding site of a murine leukemia virus-based vector allowed efficient RNA encapsidation but resulted in severely reduced vector replication capacity. Replication was restored upon complementation with a synthetic gene designed to encode a complementary tRNA-like primer, but not...... with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather...

  2. Por mano propia. La justicia policial de la provincia de Buenos Aires en el primer peronismo

    Directory of Open Access Journals (Sweden)

    Osvaldo Barreneche

    2009-11-01

    Full Text Available La sanción del Código Penal Policial fue una pieza importante en el andamiaje jurídico por el cual el primer gobierno peronista procuró afianzar la profesionalización y disciplinamiento de las fuerzas de seguridad en las distintas jurisdicciones del país. Así, se organizó y se puso en marcha una nueva rama de la justicia bonaerense, paralela a la ordinaria, integrada completamente por policías retirados y en actividad, que se ocupó de los casos penales donde estuviesen implicados uno o más policías. Este trabajo analiza dicha experiencia, basándose en los casos sumariados y resueltos por la Justicia Policial mientras existió. En primer lugar se pone en contexto los fundamentos y propósitos que guiaron al peronismo para impulsar una justicia 'uniformada' que se ocupase de los excesos y falta a los deberes de los funcionarios policiales a nivel penal y administrativo. Luego se estudia su aplicación concreta en la provincia de Buenos Aires, indagando sobre los casos juzgados, su tratamiento, los actores, los fallos y los fines políticos perseguidos por esta justicia por y para policías

  3. Herramienta de educación nutricional para alergicos a huevo y proteína de leche de vaca de edad pediátrica®

    OpenAIRE

    Ismael San Mauro Martín

    2014-01-01

    Introducción: La alergia alimentaria afecta a gran parte de la población y sus cifras siguen aumentando. Aunque, se esta avanzando en el conocimiento de la patología, los alérgicos encuentran grandes dificultades para llevar una vida normal, especialmente en lo relativo a su alimentación. Hasta ahora el colectivo no contaba con herramientas prácticas que les ayudasen en la elaboración diaria de una dieta equilibrada, como existen para la población en general, en forma de pirámides y guías ali...

  4. Sobre la puesta, incubación de huevos, nacimiento y desarrollo de crías de Philodryas viridissima (Colubridae: Xenodontinae) en cautiverio

    OpenAIRE

    Rivera, Daniela S.; Aguayo, Rodrigo; Alfaro, Fernando D.

    2009-01-01

    El género Philodryas (Wagler, 1830) incluye aproximadamente 21 especies distribuidas en casi toda Sudamérica. Existen reportes sobre la dieta, hábitat y tácticas defensivas de muchas especies del género (Bozinovic y Rosenman, 1988; Marques, 1999; Hartmann y Marques, 2005), pero los datos reproductivos se restringen a pocas especies. El día 10 de noviembre del 2005 se capturó una hembra de Philodryas viridissima oviponiendo en un hormiguero al lado de un sendero en la Reserva privada de Potrer...

  5. Características técnico-sanitarias de expendios de carnes, pescados, aves y huevos de la ciudad de Tunja 2003

    OpenAIRE

    Fred Gustavo Manrique - Abril; Diego Alexander Manrique-Abril; Pablo Fernandez; Elena Patricia Castro-Montaña

    2011-01-01

    Se presenta una caracterización epidemiológica de los expendios de carnes, pescado y aves de Tunja en el año 2003, resultado del diagnóstico sanitario del municipio y las visitas adelantadas por la unidad de saneamiento. Al partir del compromiso que el sector salud tiene en el componente de ambiente, surge la necesidad de crear un sistema de vigilancia epidemiológica ambiental, cuya metodología y estrategia esté orientada hacia el conocimiento de los factores de riesgo ambientales a que están...

  6. Efecto de la densidad de gallinas por jaula y de la estirpe sobre la producción y la calidad del huevo

    OpenAIRE

    Nicodemus Martin, Nuria; Callejo Ramos, Antonio; Blanco Muñoz, Daniel; Buxade Carbo, Carlos

    2012-01-01

    La nueva normativa de la UE referida al bienestar de las gallinas ponedoras exige, en sus alojamientos, una superficie útil (S.U.) por gallina muy superior a la que es habitual fuera de sus fronteras. El objetivo de este trabajo es estudiar la influencia de una S.U. inferior a la indicada en la normativa UE sobre los resultados productivos. La población estudiada fue de 1008 gallinas ponedoras, 504 de estirpe semi pesada y 504 de estirpe ligera, alojadas en 168 jaulas (84 por e...

  7. Criminal Justice in the United States: A Primer

    OpenAIRE

    James B. Jacobs

    2007-01-01

    In this primer on the U.S. criminal justice system, James B. Jacobs, Warren E. Burger Professor of Law at New York University (NYU) and Director of the Center for Research in Crime and Justice at the NYU School of Law, explains the structure and basic jurisprudence of U.S. criminal law and criminal procedure.

  8. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  9. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  10. Detecting Lesch-Nyhan syndrome by solid phase primer extension

    Energy Technology Data Exchange (ETDEWEB)

    Shumaker, J.M.; Caskey, C.T. [Baylor College of Medicine, Houston, TX (United States); Metspalu, A.

    1994-09-01

    A mutation detection method based upon the wild type human HPRT sequence is presented for identification of Lesch Nyhan syndrome. The technique consists of performing a biotinlyated PCR amplification of the region of interest, followed by isolation and purification of single stranded template using magnetic separation. Allele-specific primers are annealed adjacent to the potential mutation site on the template. A terminal fluorescent deoxynucleotide addition is performed with a DNA template-dependent polymerase to distinguish between the mutant and wild-type sequence. The products are purified from unincorporated ddNTPs, eluted and finally analyzed on an ABI 373 to identify the mutation. The length of an extension primer is used as a position signature for mutations. The fidelity of nucleotide incorporation provides an excellent signal-to-noise ratio for the detection of nine HPRT mutations within eight cell lines. This method should detect all types of mutations except for repeated sequences that are longer than the primers. Moreover, the method is being extended to a solid support assay, whereby the extension primers are attached to a two-dimensional glass surface. Following extension, the solid support is analyzed for radioactive incorporation. We have shown the sequence determination of a five base region of a wild-type sequence and two different HPRT mutations. As more dense oligonucleotide arrays are produced, this method could be extended to sequence the complete coding region of HPRT.

  11. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  12. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  13. Evaluación y comparación de la eficiencia de dos sistemas de incubación de huevos de Genypterus chilensis (Guichenot, 1848 Evaluation and comparison of the efficiency of two incubation systems for Genypterus chilensis (Guichenot, 1848 eggs

    Directory of Open Access Journals (Sweden)

    Rolando Vega

    2012-03-01

    Full Text Available Actualmente la tendencia de la acuicultura mundial está orientada hacia la diversificación de los cultivos, principalmente de especies nativas. El congrio colorado Genypterus chilensis es un pez nativo de alta demanda gastronómica y explotación estacional que lo proyecta como candidato para el desarrollo de su tecnología de cultivo. El objetivo de este trabajo fue evaluar la eficiencia de dos sistemas de incubación de masas de huevos de G. chilensis, uno con circuito cerrado de agua (SICC y el otro con circuito abierto (SICA; su eficiencia fue medida por el porcentaje de eclosión de huevos. Dos ensayos fueron realizados midiendo y comparando los porcentajes de fecundación y eclosión de huevos en cuatro réplicas entre los dos sistemas, encontrándose solo diferencias significativas entre los porcentajes de fecundación del bioensayo 2. El bioensayo 1 tuvo un 81% promedio de fecundación de los huevos y el porcentaje promedio de eclosión para el SICC fue 42,9 ± 34,5% y para el SICA fue 0,0 ± 0,0%. El bioensayo 2 tuvo un porcentaje promedio de fecundación de los huevos de 87,3 ± 2,6% para el SICC y 79,8 ± 3,2% para el SICA y el porcentaje promedio de eclosión para el SICC fue 27,9 ± 33,7% y para el SICA fue 4,8 ± 5,6%. Se discuten los parámetros de incubación para obtener una máxima eclosión y se entrega una proposición para mejorar el sistema SICC. El sistema de incubación con circuito cerrado de agua generó mayores sobrevivencias en los huevos de G. chilensis.The current trend in world aquaculture is towards the diversification of cultures, mainly native species. The red cusk eel Genypterus chilensis is a native Chilean species of high gastronomic demand and seasonal exploitation that is projected as a candidate for the development of farming technology. The objective of this study was to test the efficiency of two incubation systems for G. chilensis egg masses, one with a closed water circuit (SICC and the other with an

  14. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  15. Selección de Aislamientos de Hongos Entomopatógenos para el Control de Huevos de la Polilla del Tomate, Tuta absoluta Meyrick (Lepidoptera: gelechiidae Entomopathogenic Fungi Isolates Selection for Egg Control of Tomato Moth Tuta absoluta Meyrick (Lepidoptera: gelechiidae Eggs

    Directory of Open Access Journals (Sweden)

    Marta Rodríguez S.

    2006-06-01

    Full Text Available Se realizó un estudio en laboratorio sobre la patogenicidad de 64 aislamientos de Metarhizium anisopliae var. anisopliae y 70 de Beauveria bassiana, en huevos de polilla del tomate Tuta absoluta. La primera evaluación se realizó por aplicación directa de suspensiones de 10(7 conidias mL-1 para cada aislamiento, con el sistema de pulverización de la torre de Potter. La mortalidad y esporulación sobre huevos fueron significativamente mayores con los aislamientos M. anisopliae Qu-M558 y B. bassiana Qu-B911, Qu-B912 y Qu-B928. Estos aislamientos fueron evaluados nuevamente en suspensiones crecientes de 0 a 10(8 conidias mL-1. Los aislamientos Qu-M558 y Qu-B912, produjeron los mayores porcentajes de mortalidad sobre la base del cálculo del área bajo la curva del progreso de mortalidad de huevos, 80 y 60%, respectivamente.A pathogenicity study of 64 Metarhizium anisopliae var. anisopliae and 70 Beauveria bassiana isolates against tomato moth Tuta absoluta eggs, was carried out under laboratory conditions. The first evaluation was accomplished by spraying suspensions of 10(7 conidias mL-1 of each isolate directly on eggs, through a Potter tower. Mortality and conidia production on the eggs were significantly higher with the isolates M. anisopliae Qu-M558 and B. bassiana Qu-B911, Qu-B912 and Qu-B928. These isolates were newly evaluated using increasing conidia concentrations (0 to 10(8 conidia mL-1 of each of the five selected isolates. The isolates Qu-B912 and Qu-M558 produced the highest mortality percentages based on the area under mortality progress curve for each concentration, 80 and 60%, respectively.

  16. Evaluación y comparación de la eficiencia de dos sistemas de incubación de huevos de Genypterus chilensis (Guichenot, 1848) Evaluation and comparison of the efficiency of two incubation systems for Genypterus chilensis (Guichenot, 1848) eggs

    OpenAIRE

    Rolando Vega; Miguel Pradenas; Juan Manuel Estrada; Diego Ramírez; Iván Valdebenito; Alfonso Mardones; Patricio Dantagnan; Denis Alfaro; Francisco Encina; Cristian Pichara

    2012-01-01

    Actualmente la tendencia de la acuicultura mundial está orientada hacia la diversificación de los cultivos, principalmente de especies nativas. El congrio colorado Genypterus chilensis es un pez nativo de alta demanda gastronómica y explotación estacional que lo proyecta como candidato para el desarrollo de su tecnología de cultivo. El objetivo de este trabajo fue evaluar la eficiencia de dos sistemas de incubación de masas de huevos de G. chilensis, uno con circuito cerrado de agua (SICC) y ...

  17. Primera comprobación del alza postparto en el contaje de huevos de nemátodos en materia fecal de ovinos en Nicaragua (First report of post-parturient rise in faecal nematode egg count in sheep from Nicaragua

    Directory of Open Access Journals (Sweden)

    Rimbaud E.

    2005-11-01

    Full Text Available Se describe por primera vez en Nicaragua la presencia del fenómeno parasitológico de “alza postparto”, en el contaje de huevos de nemátodos en materia fecal de ovinos. Haemonchus contortus y Trichostrongylus colubriformis se desarrollaron pronunciadamente en hembras a las siete y ocho semanas postparto (P < 0.2 y P < 0.5. The post-parturient rise in the faecal nematode egg count in sheep from Nicaragua was described. Haemonchus contortus and Trichostrongylus colubriformis increase quickly at post partum in ewes seven and eight weeks later (P < 0.2 y P < 0.5.

  18. Review of The Atheist’s Primer and Atheism for Beginners

    Directory of Open Access Journals (Sweden)

    Andrew J Bissette

    2014-05-01

    Full Text Available The New Atheists are occasionally accused of lacking nuance and sophistication, or of existing in an intellectual vacuum. To some it may seem that Dawkins 'et al'. are naïve logical positivists; this perspective may be reinforced by recent authors’ explicit rejection of the value of philosophy and other non-scientific approaches to knowledge (cf. Lawrence Krauss, Stephen Hawking. Into the fray steps Michael Palmer, offering his attempt to popularise a version of atheism that is underpinned by a long tradition of philosophical inquiry. 'The Atheist’s Primer', a condensed version of Palmer’s previous work, is aptly named: it is a crash course on the history and major arguments of atheism from a firmly philosophical angle. Its companion text, 'Atheism For Beginners', is a coursebook aimed at tutors seeking to teach this material.

  19. Shewanella algae en un paciente con diarrea crónica. Primer caso en Costa Rica

    Directory of Open Access Journals (Sweden)

    Erick Molina- Guevara

    2009-09-01

    Full Text Available Se presenta el caso de un paciente masculino, vecino de Pavas-San José, con historia de diarrea crónica. En el coprocultivo se identificó Shewanella algae. Casos de infección en humanos por esta bacteria son raros y se han encontrado, predominantemente localizadas, en piel, oídos y tejidos blandos con o sin bacteremia, en la mayoría de los cuales existe el antecedente de contacto con ambientes marinos. Shewanella algae es sensible a aminoglicósidos, carbapenemes, eritromicina y quinolonas, pero resistente a penicilinas. La sensibilidad a ampicilina y cefalosporinas es variable. Nuestro paciente fue tratado con cefalexina y tuvo una respuesta satisfactoria al mismo, con cese de los síntomas. De acuerdo con nuestro conocimiento este el primer caso documentado, en Costa Rica, de infección gastrointestinal por esta bacteria.

  20. INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN

    Directory of Open Access Journals (Sweden)

    Orzuza, Gloria Beatriz

    2013-01-01

    Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.

  1. PriSM: a primer selection and matching tool for amplification and sequencing of viral genomes

    OpenAIRE

    Yu, Qing; Ryan, Elizabeth M; Allen, Todd M.; Birren, Bruce W.; Henn, Matthew R.; Lennon, Niall J.

    2010-01-01

    Summary: PriSM is a set of algorithms designed to select and match degenerate primer pairs for the amplification of viral genomes. The design of panels of hundreds of primer pairs takes just hours using this program, compared with days using a manual approach. PriSM allows for rapid in silico optimization of primers for downstream applications such as sequencing. As a validation, PriSM was used to create an amplification primer panel for human immunodeficiency virus (HIV) Clade B.

  2. Resin bonding of metal brackets to glazed zirconia with a porcelain primer

    OpenAIRE

    Lee, Jung-Hwan; Lee, Milim; Kim, Kyoung-Nam; Hwang, Chung-Ju

    2015-01-01

    Objective The aims of this study were to compare the shear bond strength between orthodontic metal brackets and glazed zirconia using different types of primer before applying resin cement and to determine which primer was more effective. Methods Zirconia blocks were milled and embedded in acrylic resin and randomly assigned to one of four groups: nonglazed zirconia with sandblasting and zirconia primer (NZ); glazed zirconia with sandblasting, etching, and zirconia primer (GZ); glazed zirconi...

  3. Factores y tipología del rendimientos académico en primer curso del Ciencias Empresariales Europeas (E4

    Directory of Open Access Journals (Sweden)

    Antonio Rúa Vieytes

    2002-01-01

    Full Text Available Se buscan factores subyacentes al conjunto de todas las asignaturas cursadas en primer curso de la licenciatura de Ciencias Empresariales Europeas (E4, que resuman la información de los resultados logrados en primera convocatoria en las asignaturas cursadas en dicho primer curso; para ello se lleva a cabo un Análisis Factorial. Previamente y mediante un Análisis de Conglomerados se establece una tipología que permite definir las características de los distintos tipos de alumnos que integran el primer curso de esta licenciatura. Por último, se contrasta si existe asociación entre la pertenencia al programa que recluta al alumno y el grupo o conglomerado al que ha sido asignado a través del procedimiento estadístico aplicado en este trabajo. Palabras Clave: Análisis Factorial, Análisis Cluster, Tipología de rendimiento académico.

  4. SPECT single photon emission computed tomography: A primer

    International Nuclear Information System (INIS)

    This book aims to assist nuclear medicine technologists in expanding their knowledge of nuclear medicine to include SPECT. The text of this primer is written with the assumption that the reader is proficient in most elements of nuclear medicine technology; therefore, the information is limited to data that will answer the basic questions of single-photon emission computed tomography .... The authors' goal is to bring the basics of this material together in a manner that would answer the technologist's fundamental questions. The authors have designed this primer in a generic manner to be used as an extension of the manufacturer's operating manual .... A glossary is included which contains some of the terminology relevant to the specialty, and reading lists are provided at the end of each chapter to direct the reader to more comprehensive text on specific subjects

  5. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  6. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  7. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  8. Teatro y texto en el primer renacimiento español. Del teatro al manuscrito impreso

    OpenAIRE

    San José Lera, Javier

    2013-01-01

    Este trabajo se ha realizado en el marco del proyecto de investigación TESAL16. Documentación, edición, estudio y propuestas de representación del teatro del siglo XVI en Salamanca (Junta de Castilla y León SA155A11-1 y MICINN FFI2011-25582). La consideración de algunas de las circunstancias de la fijación de los textos teatrales en el silencioso mundo del manuscrito o el impreso muestra el proceso de pérdida implicado en la «institucionalización» de un género concebido inicialmente para e...

  9. Musculatura asociada al primer y segundo arco visceral de algunos anuros leptodactílidos

    Directory of Open Access Journals (Sweden)

    Palavecino, Patricia Mónica

    1999-01-01

    Full Text Available Se describe y compara la musculatura mandibular e hioidea de larvas de cuatro especies de anuros leptodactílidos presentes en el noroeste argentino. Las características miológicas observadas en Odontophrynus lavillai y Telmato-bius sp. son muy semejantes a las descriptas para otras larvas de anuros. Por el contrario, Ceratophrys cranwelli y Lepidobatrachus llanensis, muestran particularidades en éstos caracteres que los diferencian notablemente entre sí y con el resto de las especies descriptas. Tales particularidades parecen estar relacionadas con su modo de alimentación. Para la larva de Ceratophrys cranwelli se nomina un nuevo músculo, intermandibularis medio superficial. The jaw and hyoid musculature are described and compared for species of anuran tadpoles from the argentinean northwest. The myological characteristics observed in Odontophrynus lavillai and Telmatobius sp. are very similar when compared with other anuran tadpoles. In the contrast, Ceratophrys cranwelli and Lepidobatrachus llanensis show special muscular features which point out difference between each other and with all described species. These different characteristics appear to be related with their feeding habits. A new muscle found in Ceratophrys cranwelli, intermandibularis medio superficial, is desbribed and named.

  10. MERS-CoV PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of MERS-CoV genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence MERS-CoV genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that MERS-CoV RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed. ...

  11. Primer on Molecular Genetics; DOE Human Genome Program

    Science.gov (United States)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  12. El primer llibre de la Biblioteca de Comunicació

    OpenAIRE

    Moragas Spà, Miquel de,

    2010-01-01

    El primer llibre va ser "El espíritu del tiempo", d'Edgar Morin. Un llibre sobre la cultura de masses i els mitjans de comunicació, mal vist en aquells anys 70 per la sociologia més acadèmica i oficial, però de fet un dels fundadors dels estudis interdisciplinaris de la comunicació

  13. Introduction to Command, Control, and Communications: a primer

    OpenAIRE

    Eidson, Edward H.

    1995-01-01

    This thesis is a primer for students in the Introduction to Command, Control, and Communications Courses at the Naval Postgraduate School. This document provide students a consolidated reference that emphasizes key concepts and ideas presented by the course instructor and required readings. Its organization closely parallels the course outline used for in-class instruction. It supports course objectives by providing an executive overview of a wide variety of C2 topics. These topics include: C...

  14. The Primer for Sports Medicine Professionals on Imaging

    OpenAIRE

    Farshad-Amacker, Nadja A.; Jain Palrecha, Sapna; Farshad, Mazda

    2013-01-01

    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathol...

  15. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  16. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  17. Fundamentals of statistical evidence—a primer for legal professionals

    OpenAIRE

    Aitken, Colin; TARONI, FRANCO

    2008-01-01

    Criminal courts are today frequently confronted with statistical evidence, notably in relation to DNA profiling. Recent experience tends to confirm both widespread perceptions and more systematic research indicating that probability and statistics are not handled confidently, or always competently, by lawyers, judges, jurors or even by forensic scientists. Conceived as a primer for legal professionals, this article reviews basic statistical terminology and its forensic applications, and explo...

  18. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  19. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  20. Sequence-related amplified polymorphism primer screening on Chinese fir (Cunninghamia lanceolata (Lamb.) Hook)

    Institute of Scientific and Technical Information of China (English)

    Huiquan Zheng; Hongjing Duan; Dehuo Hu; Ruping Wei; Yun Li

    2015-01-01

    Chinese fir (Cunninghamia lanceolata (Lamb.) Hook) is one of the most important coniferous tree species used for timber production in China. Here, we conducted a sequence-related amplified polymorphism (SRAP) primer screening assay with a total of 594 primer combinations, using 22 forward and 27 reverse primers on four repre-sentative Chinese fir genotypes. The obtained results indicated that Chinese fir genomic DNA has a notable amplification bias on the employed forward or reverse primer nucleotides (3' selection bases). Out of the tested primer sets, 35 primer combinations with clearly distin-guished bands, stable amplification, and rich polymorphism were selected and identified as optimal primer sets. These optimal primer pairs gave a total of 379 scorable bands, including 265 polymorphic bands, with an average of 10.8 bands and 7.6 polymorphic bands per primer combination. The produced band number for each optimal primer set ranged from 7 to 14 with a percentage of polymorphic bands spanning from 33.3 to 100.0%. These primer combinations could facilitate the next SRAP analysis assays in Chinese fir.

  1. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    Directory of Open Access Journals (Sweden)

    Oh Hyun-Woo

    2010-07-01

    Full Text Available Abstract Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1 to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups.

  2. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S;

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...... approach, first validated in our in vitro HIV-1 reverse transcription system. Annealing of the antisense oligonucleotides to the pre-primer binding site (the upstream region contiguous to the HIV-2 primer binding site) was determined in the presence of native tRNALys3 or synthetic primers. Using natural...... and chemically modified antisense oligonucleotides we found that interactions between the anticodon of tRNALys3 and an A-rich loop of viral RNA led to an important destabilization of the pre-primer binding site; this region became accessible to anti-pre-primer binding site oligonucleotides in a...

  3. Periodistas: el acceso al mercado laboral

    OpenAIRE

    2006-01-01

    El presente estudio analiza la situación profesional de los Licenciados en Periodismo en España. Para ello esta investigación sigue la lógica del proceso de acceso al mercado laboral, es decir, se estudia, en primer lugar, la oferta de egresados y las demandas del sector; a continuación, se analiza la forma en la que un titulado en la Licenciatura de Periodismo accede al mercado laboral y el tiempo que tarda en hacerlo; y por último, se examinan los medios de comunicación en lo...

  4. Evaluation of antibacterial activity of three dentin primers using an in vitro tooth model.

    Science.gov (United States)

    Ohmori, K; Maeda, N; Kohno, A

    1999-01-01

    This study compared the antibacterial activities of three dentin primers and investigated a newly designed experimental system using a bovine tooth model method for evaluating antibacterial activity by comparing this method with a conventional disk diffusion method. The antibacterial activities of SA primer in Clearfil Liner Bond, LB primer in Clearfil Liner Bond II, and ED primer in Panavia 21 were evaluated using the conventional disk diffusion method. The 50 microliters aliquot of each primer was applied to three sterilized paper disks, then placed onto Tryptic Soy agar plates already inoculated with Streptococcus mutans. After anaerobic incubation for 48 hours, the diffusion of antibacterial components was determined using the inhibition zone produced around the paper disk. The diameter of the inhibition zones was measured and the average calculated. Standardized cavities (diameter 5.0 mm, depth 3.0 mm) were prepared on the labial surfaces of bovine teeth and inoculated with S mutans (10(6) CFU/microliter) following sterilization by 60Co gamma rays (50 KGy). The teeth were divided into four groups: SA primer, LB primer, ED primer, and a control group. Except for the control teeth, the cavity preparations were treated with the respective dentin primers, and then firmly sealed with a temporary sealing material. The teeth were placed in bottles containing melted Tryptic Soy agar. Five ml of Tryptic Soy broth was then added to the surface of the hardened Tryptic Soy agar. After 1 week's incubation of the teeth in the bottles at 37 degrees C, the number of bacteria remaining in each cavity was counted, except for eight specimens, which were used for SEM observation. The ED primer showed the widest inhibition zone in the disk diffusion test, which was significantly different from the other primers. Using the bovine tooth model, all dentin primers showed antibacterial activity, with significant differences found among the four groups. The results indicated that ED

  5. Al clamor de les vuvuzeles

    Directory of Open Access Journals (Sweden)

    Javier Olivera Betrán

    2010-09-01

    Full Text Available El Mundial de Futbol de Sud-àfrica ha situat l’Àfrica al mapa mundial i ha mostrat al món el triomf de l’estil de futbol d’Espanya basat en la col·lectivitat, l’esperit d’equip, la humilitat, la cohesió interna i el joc bonic. L’organització africana, seriosa i eficaç, ha sabut mobilitzar i il·lusionar la població del país que ha participat en el mundial des de l’orgull de ser africà, amb l’esperit alegre, festiu i també reivindicatiu de la gent de l’Àfrica. Aquest esdeveniment suposa el llançament de la marca “Sud-àfrica” al món amb un avís clar d’optar a l’organització d’uns primers Jocs Olímpics a Àfrica (potser els de 2020. S’obre una finestra d’esperança al segle xxi per al continent perdut de la mà de l’esport espectacle tan universal, massiu, emocional i mercantil que també es juga a la canxa de la política i de l’economia.

  6. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  7. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  8. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    Directory of Open Access Journals (Sweden)

    Martin Andrew P

    2009-12-01

    Full Text Available Abstract Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of

  9. Bt-CoV HKU3 PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU3 genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU3 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU3 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been perfo...

  10. Bt-CoV HKU5 PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU5 genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU5 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU5 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been perfo...

  11. Debate del primer seminario de investigación

    OpenAIRE

    Ortega, Tomás

    2002-01-01

    Una vez concluidas las intervenciones de los tres ponentes del primer Seminario de Investigación (Dr. Moisés Coriat –U. Granada-, Dr. Alejandro Fernández –U. Valencia y José Carrillo -U. Huelva-), la réplica a sus informes, presentada por la Dra. Joana Brocardo, y la contrarréplica de los ponentes que siguió a la exposición de la Dra. Brocardo, comienza el debate propiamente dicho. en el que intervienen los asistentes presentes en la sala

  12. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  13. The primer for sports medicine professionals on imaging: the shoulder.

    Science.gov (United States)

    Farshad-Amacker, Nadja A; Jain Palrecha, Sapna; Farshad, Mazda

    2013-01-01

    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathologic conditions of the rotator cuff tendons and muscles, the long head of the biceps tendon, shoulder impingement, labral and glenohumeral ligament pathology, MR findings in shoulder instability, adhesive capsulitis, and osteoarthritis. PMID:24381700

  14. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  15. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  16. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  17. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  18. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  19. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  20. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  1. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  2. Necesidades en salud del diabético usuario del primer nivel de atención Health needs of diabetic patients using primary care services

    OpenAIRE

    Ana M. Salinas-Martínez; Francisco Muñoz-Moreno; Alma R. Barraza de León; Enrique Villarreal-Ríos; Georgina M. Núñez-Rocha; María E. Garza-Elizondo

    2001-01-01

    Objetivo. Determinar la magnitud y jerarquizar la necesidad de salud satisfecha del diabético tipo 2, usuario del primer nivel de atención. Material y métodos. Se realizó un estudio transversal comparativo con representatividad rural y urbana, en el Instituto Mexicano del Seguro Social, en Nuevo León, en 1999. Fueron entrevistados, al azar, 256 diabéticos tipo 2 con dos o más años de diagnóstico. La información fue complementada con el expediente clínico y encuesta al proveedor. Se evaluaron ...

  3. Primer for evaluating ecological risk at petroleum release sites.

    Science.gov (United States)

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response. PMID:10189585

  4. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  5. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    CERN Document Server

    Courtney, Elya; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blast waves, muzzle velocities, and ignition delay are presented after environmental conditioning (150 days) for two lead based and two DDNP based primers under cold and dry (-25 deg C,0% relative humidity), ambient (20 deg C, 50% relative humidity), and hot & humid (50 deg C, 100% relative humidity) conditions in 5.56 mm NATO. Taken together, these results indicate that DDNP based primers are not sufficiently reliable for service use.

  6. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could be...... designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision in...

  7. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Pedersen, F S

    2000-01-01

    Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNA(Pro)molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian...... retro-viruses have revealed evidence of molecular adapt-ation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites....... While most of the selected primer binding sites are complementary to the 3'-end of tRNA((Pro)), we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNA(Arg(CCU)), tRNA(Phe(GAA))and a hitherto unknown...

  8. A method for predicting service life of zinc rich primers on carbon steel

    Science.gov (United States)

    Hoppesch, C. W.

    1986-01-01

    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  9. Comparison of shear bond strength of orthodontic brackets using various zirconia primers

    OpenAIRE

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-01-01

    Objective The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. Methods We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). ...

  10. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  11. Predicting the success of primer extension genotyping assays using statistical modeling

    OpenAIRE

    Yuryev, Anton; Huang, Jianping; Pohl, Mark; Patch, Robert; Watson, Felicia; Bell, Peter; Donaldson, Miriam; Phillips, Michael S.; Boyce-Jacino, Michael T.

    2002-01-01

    Using an empirical panel of more than 20 000 single base primer extension (SNP-IT) assays we have developed a set of statistical scores for evaluating and rank ordering various parameters of the SNP-IT reaction to facilitate high-throughput assay primer design with improved likelihood of success. Each score predicts either signal magnitude from primer extension or signal noise caused by mispriming of primers and structure of the PCR product. All scores have been shown to correlate with the su...

  12. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  13. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  14. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    International Nuclear Information System (INIS)

    Research highlights: → Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. → The solvents of the primer are eco-friendly ones. → The primer adheres on galvanized steel and allows top-coating. → The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  15. Selection and development of representative simple sequence repeat primers and multiplex SSR sets for high throughput automated genotyping in maize

    Institute of Scientific and Technical Information of China (English)

    WANG FengGe; ZHAO JiuRan; DAI JingRui; YI HongMei; KUANG Meng; SUN YanMei; YU XinYan; GUO JingLun; WANG Lu

    2007-01-01

    In the current study, 1900 maize simple sequence repeat (SSR) primers published in MaizeGDB were screened utilizing reference literature, 15 representative Chinese maize inbred lines and 15 Chinese maize hybrids from national regional testing. In total, 500 highly polymorphic primers were identified and used to construct a genetic map. 100 evenly distributed primers, 10 primers per chromosome, were further selected as a set of universal SSR core primers, recommended as preferred primers for general studies. These core primers were then redesigned and used to construct a high throughput multiplex PCR system based on a five-color fluorescence capillary detection system. We report here that two sets of ten-plex PCR combinations have been constructed, each consisting of 10 primers, with one primer per chromosome.

  16. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  17. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  18. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  19. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  20. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. PMID:27226047

  1. ParaDiS-FEM dislocation dynamics simulation code primer

    International Nuclear Information System (INIS)

    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  2. ParaDiS-FEM dislocation dynamics simulation code primer

    Energy Technology Data Exchange (ETDEWEB)

    Tang, M; Hommes, G; Aubry, S; Arsenlis, A

    2011-09-27

    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  3. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  4. Next-generation sequencing of 28 ALS-related genes in a Japanese ALS cohort.

    Science.gov (United States)

    Nakamura, Ryoichi; Sone, Jun; Atsuta, Naoki; Tohnai, Genki; Watanabe, Hazuki; Yokoi, Daichi; Nakatochi, Masahiro; Watanabe, Hirohisa; Ito, Mizuki; Senda, Jo; Katsuno, Masahisa; Tanaka, Fumiaki; Li, Yuanzhe; Izumi, Yuishin; Morita, Mitsuya; Taniguchi, Akira; Kano, Osamu; Oda, Masaya; Kuwabara, Satoshi; Abe, Koji; Aiba, Ikuko; Okamoto, Koichi; Mizoguchi, Kouichi; Hasegawa, Kazuko; Aoki, Masashi; Hattori, Nobutaka; Tsuji, Shoji; Nakashima, Kenji; Kaji, Ryuji; Sobue, Gen

    2016-03-01

    We investigated the frequency and contribution of variants of the 28 known amyotrophic lateral sclerosis (ALS)-related genes in Japanese ALS patients. We designed a multiplex, polymerase chain reaction-based primer panel to amplify the coding regions of the 28 ALS-related genes and sequenced DNA samples from 257 Japanese ALS patients using an Ion Torrent PGM sequencer. We also performed exome sequencing and identified variants of the 28 genes in an additional 251 ALS patients using an Illumina HiSeq 2000 platform. We identified the known ALS pathogenic variants and predicted the functional properties of novel nonsynonymous variants in silico. These variants were confirmed by Sanger sequencing. Known pathogenic variants were identified in 19 (48.7%) of the 39 familial ALS patients and 14 (3.0%) of the 469 sporadic ALS patients. Thirty-two sporadic ALS patients (6.8%) harbored 1 or 2 novel nonsynonymous variants of ALS-related genes that might be deleterious. This study reports the first extensive genetic screening of Japanese ALS patients. These findings are useful for developing genetic screening and counseling strategies for such patients. PMID:26742954

  5. Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

    OpenAIRE

    Bedmar Carretero, Cristina

    2012-01-01

    L’objectiu d’aquest estudi va ser valorar el desenvolupament del nen durant el primer any de vida en funció del tipus de lactància realitzada durant el primer semestre y de la dosis de ferro administrada durant el segon semestre. Hem observat que el 75,5% dels nens realitzen lactància materna exclusiva al néixer y el 16,5% la mantenen fins als 6 mesos. El 39,5% tenen alguna mutació en el gen HFE. La prevalença de dèficit de ferro y anèmia ferropènica es del 4,5% y 2,5% als 6 mesos y del 9,2% ...

  6. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik;

    2001-01-01

    Simian immunodeficiency viruses (SIV) harbor primer binding sites (PBS) matching tRNA or tRNA. To study determinants of primer usage in SIV, a SIVmac239-based vector was impaired by mutating the PBS to a sequence (PBS-X2) with no match to any tRNA. By cotransfection of a synthetic gene encoding a t...... could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold......-higher titers than those observed for the x2 primer with the tRNA(Pro) backbone. In summary, our results demonstrate flexibility in PBS and primer usage for SIVmac239, with PBS-primer complementarity being the major determinant, in analogy with previous findings for murine leukemia viruses and human...

  7. Predictores del desempeño en lectura y escritura de niños de primer grado

    Directory of Open Access Journals (Sweden)

    Aldo Bazán R.

    2000-12-01

    Full Text Available Se evaluó el desempeño de 288 niños de primer grado en tareas de lectura y escritura de diferente grado de complejidad. Se tomaron como predictores de los desempeños en las tareas evaluadas variables asociadas con la práctica docente y con antecedentes académicos inmediatos de los niños, así como sus características físicas. Mediante la aplicación de un análisis de regresión múltiple se identificó que las variables de años de experiencia del maestro en primer grado, el juicio que emite respecto a la adquisición de la lectura y la escritura del niño, la presencia de padecimientos de tipo auditivo y/o visual en el niño, y el promedio logrado por los niños en los cursos de español al término del año escolar predicen aproximadamente un 40% del desempeño de los niños en todos los niveles de complejidad de las tareas de lectura y escritura evaluadas. Se discuten los resultados en términos de su implicación en la práctica docente.

  8. La Reforma Fiscal Durante el Primer Año de la Administración Bush

    OpenAIRE

    Crane, R

    1991-01-01

    LA REFORMA FISCAL DURANTE EL PRIMER AÑO DE LA ADMINISTRACIÓN BUSH Randall Crane* RESUMEN Este ensayo analiza las reformas de la política económica de Estados Unidos en el primer año de la administración del  ...

  9. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej;

    2011-01-01

    goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website for...

  10. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X;

    2013-01-01

    NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  11. Changes of 5' Terminal Nucleotides of PCR Primers Causing Variable T-A Cloning Efficiency

    Institute of Scientific and Technical Information of China (English)

    Mei-Qin Liu; Xin Shen; Wei-Lun Yin; Cun-Fu Lu

    2007-01-01

    T-A cloning takes advantage of the unpaired adenosyl residue added to the 3' terminus of amplified DNAs by Taq and other thermostable DNA polymerase and uses a linearized plasmid vector with a protruding 3' thymidylate residue at each of its 3' termini to clone polymerase chain reaction (PCR)-derived DNA fragments. It is a simple,reliable, and efficient ligation-dependent cloning method for PCR products, but the drawback of variable cloning efficiency occurs during application. In the present work, the relationship between variable T-A cloning efficiency and the different 5' end nucleotide base of primers used in PCR amplification was studied. The results showed that different cloning efficiency was obtained with different primer pairs containing A, T, C and G at the 5' terminus respectively. The data shows that when the 5' end base of primer pair was adenosyl, more white colonies could be obtained in cloning the corresponding PCR product in comparison with other bases. And the least white colonies were formed when using the primer pair with 5' cytidylate end. The gluanylate end primers resulted in almost the same cloning efficiency in the white colonies amount as the thymidylate end primer did, and this efficiency was much lower than that of adenosyl end primers. This presumably is a consequence of variability in 3'dA addition to PCR products mediated by Taq polymerase. Our results offer instructions for primer design for researchers who choose T-A cloning to clone PCR products.

  12. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking region

  13. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners.

    Science.gov (United States)

    Summerfield, Marc R; Feemster, Agnes Ann

    2015-09-01

    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail's ability to meet language standards, enhance the writer's image, and successfully transmit information. PMID:26715801

  14. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    Science.gov (United States)

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  15. Demystifying Special Education in Virtual Charter Schools. Special Report. Primers on Special Education in Charter Schools

    Science.gov (United States)

    Rhim, Lauren Morando; Kowal, Julie

    2008-01-01

    This special report is a supplement to a series of special education primers created to inform state officials, authorizers and charter school operators about special education in the charter sector. The primer series also provides tools to help these stakeholders build charter school capacity to provide special education and related services. In…

  16. Degenerative primer design and gene sequencing validation for select turkey genes.

    Science.gov (United States)

    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald

    2016-06-01

    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. PMID:27053625

  17. Cruzando la cordillera por Manizales, al Magdalena

    OpenAIRE

    Duque Escobar, Gonzalo

    2014-01-01

    Corredor logístico propuesto por la UN-SMP, proyecto modulable a futuro que iniciaría con el Ferrocarril Cafetero como tren de montaña y posteriormente desarrollaría La Transversal Cafetera como vía de primer orden, ambos cruzando la cordillera por el Túnel Cumanday (doble). Este sistema de transporte de carga que articula la Región Andina, se financiaría con el carbón andino, al integrar el Altiplano con los mares de Colombia, y el corredor del Cauca con el Magdalena Centro, será el cataliza...

  18. La realidad aumentada aplicada al periodismo impreso

    OpenAIRE

    Picón Masero, Horacio

    2014-01-01

    El presente trabajo de fin de grado se trata de un estudio de casos sobre la realidad aumentada aplicada al periodismo impreso. En un primer lugar, se realiza un repaso de la situación actual del periodismo. Desde un punto de vista histórico se analizan las causas del momento en el que nos encontramos, una situación de crisis del modelo tradicional de empresa periodística por varios factores se enumeran en este estudio. Se incorporan, además, diversos datos estadísticos que arrojan cifras de ...

  19. Personalidad y tolerancia al dolor

    Directory of Open Access Journals (Sweden)

    JESÚS M.ª CARRILLO

    2005-01-01

    Full Text Available Se examina la relación de algunas variables de personalidad -EPQ-A (Eysenck y Eysenck, 1975, NEO-PI (McCrae y Costa, 1988 y STA -personalidad esquizotípica- y STB -personalidad límite-, de Claridge y Broks (1984, con la tolerancia al dolor experimental inducido mediante agua fría (cold pressor test, según el procedimiento de Staats, Heckmat y Staats (1998 en una muestra filtrada mediante un cuestionario sobre dolor crónico, dolores de cabeza, de espalda, artritis, síndrome de Raynaud, y personas bajo medicación. La tolerancia al dolor experimental se evaluó mediante el Umbral del dolor (tiempo en segundos desde la introducción de la mano en el agua hasta el primer informe de dolor, Mantenimiento del dolor (duración en segundos de la inmersión de la mano desde la aparición del umbral hasta su retirada y Tolerancia al dolor (duración total en segundos de la inmersión de la mano desde su introducción hasta su retirada. Un análisis correlacional, factorial y de regresión por pasos mostraron un efecto cruzado entre medidas de ansiedad (tolerancia negativa al dolor y psicoticismo, siendo psicoticismo junto con control emocional predictores de tolerancia positiva al dolor. En cuanto a psicoticismo, parece que son sus elementos de naturaleza paranoide y de "dureza" los que afectan a una percepción atenuada del dolor.

  20. Respuesta de Gallinas Ponedoras a Raciones con Diferentes Niveles de Harina de Hojas de Guandul (CajanusCajan L.

    Directory of Open Access Journals (Sweden)

    Ruíz V. Juan Guillermo

    1969-09-01

    Full Text Available En el presente trabajo se dan los resultados de dos ensayos llevados a cabo en el Centro Nacional de Investigaciones Agropecuarias de Medellín, para estudiar el efecto producido por la harina de hojas de guandul(Cajanuscajan en la coloración de la yema y en la producción de ponedoras. Durante el primer ensayo se trabajó con 120 gallinas Hy-line en postura avanzada, usando 3 raciones con 74%, 70.5% y68.5%de maíz amarillo como material prima básica y niveles de 0%, 6% y 9% de harina de guandul respectivamente. Aunque a medida que se aumentó el nivel de guandul hubo una pequeña baja en la producción de huevos, esta diferencia no fue significativa, como tampoco lo fue el (consumo de alimento y la coloración de la yema. Esta última fue prácticamente igual en los 3 lotes, debido al alto contenido de maíz amarillo en cada una de las raciones. Para el segundo ensayo se trabajó con 160 gallinas de igual raza, pero con 2 -3 meses de postura y 4 tratamientos: 3 en base a sorgo con 0%, 9% Y 12 % de harina de guandul y un cuarto lote con ración comercial, molida para evitar diferencias. La producción de huevos presentó una diferencia significativamente superior, al nivel 0 .05 %, de los lotes 0%y comercial sobre 9% y 12%. En cuanto al consumo de alimento se encontró diferencia altamente significativa del lote comercial sobre los otros 3 lotes. También el comercial fue el de mayor consumo de alimento por docena de huevos producidos. La coloración de la yema del huevo del lote 0% de guandul fue nula obteniendo un producto de difícil mercado. En los lotes 9%, 12% y comercial fue apropiada y muy semejante la pigmentación. El alimento por docena de huevo durante el segundo ensayo fue mayor en el lote con ración comercial, luego 12 %, 9 % y 0% respectivamente. A los siete días se produjo la pigmentación adecuada en la yema del huevo. Huevos almacenados por 25 días no perdieron su grado de coloración, pero sí su

  1. Costo anual per cápita en primer nivel de atención por género

    OpenAIRE

    Enrique Villarreal-Ríos; Maribel Campos Esparza; Liliana Galicia Rodríguez; Lidia Martínez González; Emma Rosa Vargas Daza; Guadalupe Torres Labra; Adolfo Patiño Vega; María Teresa Rivera Martínez; Raúl Aparicio Rojas; Martín Juárez Durán

    2011-01-01

    El objetivo de este artículo es estimar el costo per cápita anual por género en primer nivel de atención. MÉTODOS: estudio de costo realizado en Unidades de Medicina Familiar en México. La información correspondió al año 2004 y el estudio se dividió en perfil de uso y costo de la atención. PERFIL DE USO DE LO SERVICIOS: se estudiaron los registros clínicos de 1,585 pacientes adscritos a unidades de medicina familiar. El perfil de uso se definió mediante el promedio y los motivos de atención p...

  2. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    Energy Technology Data Exchange (ETDEWEB)

    Busch, R.D.

    2003-01-17

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a.

  3. Estudio de las Obras de D. Antonio Rafael Mengs, primer pintor de Cámara del Rey, de D. José Nicolás de Azara: Aportación a la historia del léxico del siglo XVIII

    OpenAIRE

    López Mora, Pilar

    2015-01-01

    A partir del estudio de las Obras de D. Antonio Rafael Mengs, primer pintor de Cámara del Rey, publicadas por D. José Nicolás de Azara a finales del siglo XVIII, la autora de esta investigación realiza, en primer lugar, una caracterización lexicológica de este tratado teórico-artístico, prestando especial atención al léxico propio del género al que pertenece. A continuación, se analizan los neologismos del siglo XVIII encontrados en el texto.

  4. Midwestern High-Level Radioactive Waste Transportation Primer

    International Nuclear Information System (INIS)

    The Midwestern High-level Radioactive Waste Transportation Primer was prepared for the purpose of identifying and analyzing regional issues pertaining to the transportation of high-level radioactive waste and to inform Midwestern state officials with respect to technical issues and regulatory concerns related to waste transportation. The report contains an introduction which presents historical information and a discussion of public opinion regarding nuclear power and its economic competitiveness. Section 1 discusses the Civilian Radioactive Waste Management Program including the need for a waste disposal program, requirements of the Nuclear Waste Policy Act (NWPA) as amended, and obstacles to implementing the NWPA. Section 2 presents the technical program with discussions of waste generators, the monitored retrievable storage facility, the geologic repository, and the transportation system. Section 3 discusses the institutional program with respect to the federal government; states, tribes, and other interested parties; and transportation issues including modal mix, highway routing, rail routing, safeguarding shipments, accident reporting, transporting defense wastes, emergency preparedness and response, training, liability, inspection and enforcement, and state, tribal, and local regulation of transportation. 165 refs., 20 figs., 29 tabs. (MB)

  5. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  6. An ASIC Low Power Primer Analysis, Techniques and Specification

    CERN Document Server

    Chadha, Rakesh

    2013-01-01

    This book provides an invaluable primer on the techniques utilized in the design of low power digital semiconductor devices.  Readers will benefit from the hands-on approach which starts form the ground-up, explaining with basic examples what power is, how it is measured and how it impacts on the design process of application-specific integrated circuits (ASICs).  The authors use both the Unified Power Format (UPF) and Common Power Format (CPF) to describe in detail the power intent for an ASIC and then guide readers through a variety of architectural and implementation techniques that will help meet the power intent.  From analyzing system power consumption, to techniques that can employed in a low power design, to a detailed description of two alternate standards for capturing the power directives at various phases of the design, this book is filled with information that will give ASIC designers a competitive edge in low-power design. Starts from the ground-up and explains what power is, how it is measur...

  7. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    2014-10-01

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  8. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    2014-12-01

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  9. Influence of Ortho Primer Morelli adhesion booster on orthodontic brackets shear bond strength

    Directory of Open Access Journals (Sweden)

    Sabrina de Mendonça Invernici

    2012-06-01

    Full Text Available OBJECTIVE: This work aimed at assessing the bond strength (AS, the site of the flaw and the relation between them and Ortho Primer Morelli® (OPM adhesion optimizer. METHODS: Sixty test specimens, made out of bovine permanent lower incisors, were divided into three groups: TXT Primer (control, in which a conventional adhesive system was applied (primer and paste; OPM, in which TXT primer was replaced by OPM; and TXT without Primer, in which only TXT paste was used. A shear force was applied at a speed of 0,5 mm/min. Failure site was assessed by the Remaining Adhesion Index (RAI. RESULTS: Kruskal-Wallis demonstrated that OPM (8.54 ± 1.86 MPa presented a statistically higher AS (p 0.05 between TXT with or without Primer (6.42 ± 2.12 MPa. Regarding the RAI, the K test demonstrated that TXT Primer and OPM (prevailing scores 2 and 3 showed higher values (p 0.05. CONCLUSION: OPM increases AS and presents the same bond failure location if compared to a conventional adhesive system; the use of the TXT adhesive system paste only was shown to have the same AS if compared to conventional systems, except it does not allow to predict the adhesive failure site; there is no correlation between AS and bond failure location, regardless of the use of any adhesion optimizer.

  10. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  11. Optimization of primer design for the detection of variable genomic lesions in cancer.

    Science.gov (United States)

    Bashir, Ali; Liu, Yu-Tsueng; Raphael, Benjamin J; Carson, Dennis; Bafna, Vineet

    2007-11-01

    Primer approximation multiplex PCR (PAMP) is a new experimental protocol for efficiently assaying structural variation in genomes. PAMP is particularly suited to cancer genomes where the precise breakpoints of alterations such as deletions or translocations vary between patients. The design of PCR primer sets for PAMP is challenging because a large number of primer pairs are required to detect alterations in the hundreds of kilobases range that can occur in cancer. These sets of primers must achieve high coverage of the region of interest, while avoiding primer dimers and satisfying the physico-chemical constraints of good PCR primers. We describe a natural formulation of these constraints as a combinatorial optimization problem. We show that the PAMP primer design problem is NP-hard, and design algorithms based on simulated annealing and integer programming, that provide good solutions to this problem in practice. The algorithms are applied to a test region around the known CDKN2A deletion, which show excellent results even in a 1:49 mixture of mutated:wild-type cells. We use these test results to help set design parameters for larger problems. We can achieve near-optimal designs for regions close to 1 Mb. PMID:17766270

  12. Guidelines for the tetra-primer ARMS-PCR technique development.

    Science.gov (United States)

    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa

    2014-07-01

    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way. PMID:24519268

  13. AL Amyloidosis

    Directory of Open Access Journals (Sweden)

    Desport Estelle

    2012-08-01

    Full Text Available Abstract Definition of the disease AL amyloidosis results from extra-cellular deposition of fibril-forming monoclonal immunoglobulin (Ig light chains (LC (most commonly of lambda isotype usually secreted by a small plasma cell clone. Most patients have evidence of isolated monoclonal gammopathy or smoldering myeloma, and the occurrence of AL amyloidosis in patients with symptomatic multiple myeloma or other B-cell lymphoproliferative disorders is unusual. The key event in the development of AL amyloidosis is the change in the secondary or tertiary structure of an abnormal monoclonal LC, which results in instable conformation. This conformational change is responsible for abnormal folding of the LC, rich in β leaves, which assemble into monomers that stack together to form amyloid fibrils. Epidemiology AL amyloidosis is the most common type of systemic amyloidois in developed countries with an estimated incidence of 9 cases/million inhabitant/year. The average age of diagnosed patients is 65 years and less than 10% of patients are under 50. Clinical description The clinical presentation is protean, because of the wide number of tissues or organs that may be affected. The most common presenting symptoms are asthenia and dyspnoea, which are poorly specific and may account for delayed diagnosis. Renal manifestations are the most frequent, affecting two thirds of patients at presentation. They are characterized by heavy proteinuria, with nephrotic syndrome and impaired renal function in half of the patients. Heart involvement, which is present at diagnosis in more than 50% of patients, leading to restrictive cardiopathy, is the most serious complication and engages prognosis. Diagnostic methods The diagnosis relies on pathological examination of an involved site showing Congo red-positive amyloid deposits, with typical apple-green birefringence under polarized light, that stain positive with an anti-LC antibody by immunohistochemistry and

  14. Hegemonía y polarización en Bolivia. El primer año del gobierno de Evo Morales y el conflicto en Cochabamba

    Directory of Open Access Journals (Sweden)

    Marlene Choque Aldana

    2007-04-01

    Full Text Available Un conflicto sucedido en el departamento de Cochabamba al concluir el primer año de gobierno de Evo Morales evidencia la polarización existente en Bolivia, alrededor del proceso constituyente y la demanda de autonomías departamentales. Si bien el gobierno tuvo varios éxitos de gestión, las oscilaciones entre matrices de acción y discursos no armonizados en el seno del partido oficialista y los movimientos que lo respaldan plantearon desafíos políticos que continúan irresueltos.

  15. ¿Predicen los requisitos de ingreso a odontología el rendimiento académico durante primer año?

    OpenAIRE

    Alejandra Medina; Maritza Flores

    2012-01-01

    RESUMEN Introducción: Al tener claridad respecto de cuáles son los predictores de desempeño académico, se puede mejorar la selección de los estudiantes que ingresan a la universidad asegurando que estén en posesión de las competencias necesarias que garanticen un buen rendimiento. Objetivos: Determinar la capacidad predictiva de los requisitos de ingreso y del proceso PSU, para el rendimiento académico de los alumnos de primer año de la carrera de odontología. Material y Método: Estudio obse...

  16. Influencia de los movimientos sacádicos, memoria y laterali-dad en el rendimiento acadé-mico de los alumnos de primer ciclo de primaria

    OpenAIRE

    Bravo-González, Esther

    2014-01-01

    Introducción: En el día a día es habitual encontrarse con alumnos sin ningún tipo de retraso inte-lectual pero, en cambio, presentan un rendimiento académico por debajo de lo esperable. Objeti-vos: Estudiar si el rendimiento académico de los alumnos del primer ciclo de primaria está relacio-nado con problemas neuropsicológicos de visión, memoria y lateralidad y posteriormente realizar una propuesta de intervención con el objetivo de potenciar al máximo sus posiblidades. Metodolog-ía: Se ha ev...

  17. Hegemonía y polarización en Bolivia. El primer año del gobierno de Evo Morales y el conflicto en Cochabamba

    OpenAIRE

    Marlene Choque Aldana

    2007-01-01

    Un conflicto sucedido en el departamento de Cochabamba al concluir el primer año de gobierno de Evo Morales evidencia la polarización existente en Bolivia, alrededor del proceso constituyente y la demanda de autonomías departamentales. Si bien el gobierno tuvo varios éxitos de gestión, las oscilaciones entre matrices de acción y discursos no armonizados en el seno del partido oficialista y los movimientos que lo respaldan plantearon desafíos políticos que continúan irresueltos.

  18. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  19. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples 1

    OpenAIRE

    Alexandre R. Zuntini; Fonseca, Luiz Henrique M.; Lúcia G. Lohmann

    2013-01-01

    Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The sta...

  20. Detection of Hepatitis B Virus DNA by Duplex Scorpion Primer-based PCR Assay

    Institute of Scientific and Technical Information of China (English)

    KONG De-Ming孔德明; SHEN Han-Xi沈含熙; MI Huai-Feng宓怀风

    2004-01-01

    The application of a new fiuorogenic probe-based PCR assay (PCR duplex scorpion primer assay) to the detection of Hepatitis B virus (HBV) DNA in human sera was described. Duplex scorpion primer is a modified variant of duplex Amplifluor, and the incorporation of a PCR stopper between probe and primer sequences improve the detection specificity and sensitivity. Combined with PCR amplification, this probe can give unambiguous positive results for the reactions initiated with more than 20 HBV molecules. In addition, the particular unimolecular probing mechanism of this probe makes the use of short target-specific probe sequence possible, which will render this probe applicable in some specific systems.

  1. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    OpenAIRE

    Bruce Shiramizu; David Troelstrup; Melissa Agsalda; Ian Kusao

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH) genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer p...

  2. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  3. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  4. Silane primers rather than heat treatment contribute to adhesive bonding between tri-n-butylborane resin and a machinable leucite-reinforced ceramic

    OpenAIRE

    Sakai, Miyuki; Taira, Yohsuke; Sawase, Takashi

    2011-01-01

    The purpose of the present study was to evaluate the effects of silane primers with and without heat treatment on bonding between a resin and a leucite-reinforced ceramic (GN-Ceram). Six dental primers (GC Ceramic Primer, GP; Clearfl Ceramic Primer, CP; RelyX Ceramic Primer, RP; Tokuso Ceramic Primer, TP; Shofu Porcelain Primer, SP; and Porcelain Liner M, PM) and five experimental primers (MDS, MTS, MDES, MTES, and ATS) were evaluated. GN-Ceram specimen was primed, heated at 100°C for 60 min ...

  5. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    OpenAIRE

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; akiyama, Hiroko; Hayatsu, Masahito

    2011-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental sa...

  6. Melioidosis en Costa Rica: Reporte del primer caso

    Directory of Open Access Journals (Sweden)

    Alfredo Messino Julio

    2000-09-01

    Full Text Available Melioidosis es una enfennedad infecciosa causada por la Burkholderia pseudomallef. Esta enfermedad es endémica en áreas tropicales de Asia y Australia y ha habido reportes aislados en Centro y Sur América. Aquí nosotros informamos del primer caso probado de melioidosis en Costa Rica, correspondiendo a un paciente sin historia de viajes a lugares endémicos. El paciente consultó por una bronconeumonía de adquisición comunitaria y sepsis. El hecho que el aislamiento bacteriano sea tan inusual en nuestro país implicó un retraso subsecuente en el inicio del tratamiento antibiótico específico en este caso, lo cual pudo influir en la evolución tan tórpida del paciente. Esto nos plantea el interrogante de si esta enfermedad debe ser incluida en el diagnóstico diferencial de sepsis de adquisición comunitaria en nuestro país.Melioidosis in an infectious disease caused by Burkholderia pseudomallei. This disease is endemie in areas of tropical Asia and Australia; there have been isolated reports of the disease in Central and South America. Here we report the first documented case of Melioidosis in Costa Rica in a patient without a history of traveling lo endemic areas. The patient was seen at the hospital because of sepsis and a community acquired bronchopneumonia. Due lo the rareness of this bacterial isolation in our country the corroboration of the diagnosis was delayed and subsequently the specific antibiotics were started 5 days later after the admission, this could have influenced the torpid evolution the patient had. This case should alert us and points lo the need of including this rare disease in the differential diagnosis of community acquired sepsis in our country.

  7. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    Science.gov (United States)

    Blackman, Eric G.

    2015-05-01

    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  8. Estandarización y evaluación de dos pruebas de Reacción en Cadena de la Polimerasa para el diagnóstico de Salmonella enterica subespecie enterica en huevos Standardization of two Polymerase Chain Reaction tests for the diagnosis of Salmonella enterica subspecie enterica in eggs

    Directory of Open Access Journals (Sweden)

    CM Pérez

    2008-01-01

    Full Text Available Salmonella infecta animales y humanos, siendo las aves de corral y sus derivados fuentes de transmisión; por lo tanto, la detección de Salmonella es importante para evitar infección. Los cultivos microbiológicos son usados para identificar la bacteria pero presentan limitaciones, por esto se han desarrollado alternativas moleculares como la Reacción en Cadena de la Polimerasa (PCR, para detectar rápida y específicamente Salmonella. El objetivo de este trabajo fue estandarizar en huevos una PCR para el género Salmonella y una PCR múltiple para S. Enteritidis y S. Typhimurium. Se estudiaron 144 muestras de huevos: 36 lavados de cáscara externa, 36 de clara-yema, 36 clara-yema más agua peptonada y 36 lavados de cáscara interna. Adicionalmente, 24 muestras de clara-yema fueron infectadas independientemente con 4 serotipos de Salmonella. A todas las muestras se les realizó extracción de ADN, PCR para el gen hilA y PCR múltiple. Para el inóculo de 10(6 UFC/ml, la PCR para hilA mostró una sensibilidad de 70,83% y una especificidad de 100%. Para la PCR múltiple se obtuvo una sensibilidad de 75% y una especificidad de 98,4%. Ambas pruebas de PCR pueden detectar 0,27 µg/ml de ADN. Estas pruebas presentan gran potencial para detectar y controlar las salmonelosis transmitidas por huevos. Se requieren estudios adicionales para aumentar la sensibilidad y aplicarlas en el campo avícola e industria alimenticia.Salmonella enterica subspecie enterica is an important cause of zoonoses due to its capacity of infecting animals and humans. Poultry and its derivates are sources of transmission, therefore detection becomes an important control measure. Microbiological cultures are currently being used for this purpose but they have sensitivity limitations; molecular alternatives such as PCR allow for a fast and specific detection of Salmonella. The objective of this study was to standardize a PCR for Salmonella in egg samples and a multiplex PCR for

  9. Efecto del nivel de la proteína bruta del pienso y del peso inicial de las pollitas sobre los parámetros productivos y la calidad del huevo en gallinas ponedoras rubias

    OpenAIRE

    Jabbour, C.; Perez-Bonilla, A.; Frikha, M.; Mirzaie, S.; Berrocoso, J.; Garcia Alonso, Javier; Gonzalez Mateos, Gonzalo

    2011-01-01

    Las aves, al igual que el resto de animales monogástricos no precisan de un nivel de proteína bruta (PB) en el pienso sino de niveles adecuados de aminoácidos (AA) indispensables (Keshavarz and Austic, 2004; Junqueira et al., 2006; Novak et al., 2006). Sin embargo, en la práctica es frecuente que los nutricionistas soliciten niveles de PB en exceso de lo recomendado por el NRC (1999) o FEDNA (2008). De hecho, muchos nutricionistas formulan piensos para inicio de puesta en gallinas rubia...

  10. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    Science.gov (United States)

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  11. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;

    2004-01-01

    One of the most promising techniques for typing of multiple single-nucleotide polymorphism (SNP) is detection of single base extension primers (SBE) by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). We present a new MALDI-TOF MS protocol for typing of...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal...... intensities were obtained in the 5500-10 300 m/z mass range by increasing the concentration of the longer SBE primers in the reaction. To validate the technique, 17 Y-chromosome SNPs were analyzed in 200 males. The precision and accuracy of the mass determination were analyzed by parametric statistic, and the...

  12. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere;

    2014-01-01

    Protection of steel structures, using so-called intumescent coatings, is an efficient and space saving way to prolong the time before a building, with load bearing steel constructions, collapses in the event of a fire. In addition to the intumescent coating, application of a primer may be required......, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used to...... investigate the potential failure mechanism of a primer applied prior to an intumescent coating. The analysis was carried out using; (1) gas-fired test furnace, (2) a specially designed electrically heated oven, and (3) thermo gravimetric analysis. When tested below an acrylic intumescent coating, exposed to...

  13. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    Science.gov (United States)

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-01

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs. PMID:26975377

  14. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo

    2014-04-01

    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  15. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Directory of Open Access Journals (Sweden)

    Nina Vidergar

    Full Text Available BACKGROUND: DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1 improving an automated DNA extraction protocol, (2 testing the performance of commonly used primer combinations, and (3 developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. METHODOLOGY: We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. RESULTS: The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198 that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93% matched that of C1-J-2183. CONCLUSIONS: The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  16. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C;

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether t......RNA primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven by...... cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  17. Rice8987Corresponding Table(f_g_primer): g_2411 [

    Lifescience Database Archive (English)

    Full Text Available g_2411 3UTR_2411 CG0194 C26839 C96955 >ATF19H22_3(AL035679|pid:g4539312) Arabidopsis thaliana DN ... 778, T76313, H76773, T76734 are in 3' untranslated region ; EST T42894 covers intron in 5' untranslated regio ...

  18. Rice8987Corresponding Table(f_g_primer): g_2097 [

    Lifescience Database Archive (English)

    Full Text Available g_2097 3UTR_2097 CH2637 AU063540 >SCH5_5(AL035636|pid:g4539560) Streptomyces coelicolor cosmid H ... 89aa has no distinguishing features or significant database ... similarities. Further clues to function may be ind ...

  19. Rice8987Corresponding Table(f_g_primer): g_6215 [

    Lifescience Database Archive (English)

    Full Text Available g_6215 3UTR_6215 EH1840 AU031552 AU031553 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsis thalian ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  20. Rice8987Corresponding Table(f_g_primer): g_6585 [

    Lifescience Database Archive (English)

    Full Text Available g_6585 3UTR_6585 EH0928 AU065261 AU095249 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thalian ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  1. Rice8987Corresponding Table(f_g_primer): g_7023 [

    Lifescience Database Archive (English)

    Full Text Available g_7023 3UTR_7023 RA0369 AU173086 AU173087 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thalian ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  2. POT1–TPP1 enhances telomerase processivity by slowing primer dissociation and aiding translocation

    OpenAIRE

    Latrick, Chrysa M; Cech, Thomas R.

    2010-01-01

    Telomerase contributes to chromosome end replication by synthesizing repeats of telomeric DNA, and the telomeric DNA-binding proteins protection of telomeres (POT1) and TPP1 synergistically increase its repeat addition processivity. To understand the mechanism of increased processivity, we measured the effect of POT1–TPP1 on individual steps in the telomerase reaction cycle. Under conditions where telomerase was actively synthesizing DNA, POT1–TPP1 bound to the primer decreased primer dissoci...

  3. Review of the PCR Primer Eesign Method%PCR引物设计方法综述

    Institute of Scientific and Technical Information of China (English)

    尤超; 赵大球; 梁乘榜; 周春华

    2011-01-01

    In order to obtain an ideal method of PCR primer design, the author completed primer design of target gene, using some databases and software tools for primer design, such as NCBI, Primer Premier 5.0 and so on, combined with the principle of primer design.Then made a research on optimization of conditions for PCR reaction after the designed primer was analyzed through BLAST comparison, comprehensive evaluation and gene retest analysis. The results indicated that primers designed through these databases and softwares could basically meet the requirements of following RTPCR reaction, and could make an in-depth study of molecular biology.%为了获得PCR引物设计的理想方法.笔者运用NCBI等数据库与引物设计软件Primer Premier 5.0等工具,结合引物设计的原则,完成目的基因的引物设计,并对设计后的引物进行BLAST比对、综合评价和基因的重新检测等分析,据此对PCR反应条件进行优化研究。结果表明,通过这些数据库和软件所设计的引物能基本满足后续的RT—PCR反应,可以进行进一步的分子生物学研究。

  4. A Set of 100 Chloroplast DNA Primer Pairs to Study Population Genetics and Phylogeny in Monocotyledons

    OpenAIRE

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A.; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chlo...

  5. PCR primers that allow intergeneric differentiation of ascomycetes and their application to Verticillium spp.

    OpenAIRE

    Li, K N; Rouse, D. I.; German, T L

    1994-01-01

    A pair of conserved PCR primers, designated NMS1 and NMS2, that amplify a region in the mitochondrial small rRNA gene region were designed for fungi belonging to the class Ascomycetes. These primers were tested with members of eight fungal genera (Aspergillus, Fusarium, Magnaporthe, Mycospharella, Neurospora, Saccharomyces, Sclerotinia, Verticillium) and 10 Verticillium species (Verticillium albo-atrum, Verticillium chlamydosporium, Verticillium cinnebarium, Verticillium dahliae, Verticillium...

  6. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  7. Bases técnicas para la aplicación del sistema de análisis de peligro y puntos críticos de control (HACCP desde la granja de ponedoras hasta la recepción y distribución de huevos para el consumo

    Directory of Open Access Journals (Sweden)

    Yanetsy Pérez Pérez; Alcides Pérez Bello

    2006-09-01

    Full Text Available Para garantizar alimentos de calidad, ysin riesgos para la salud pública, debenemplearse sistemas de producción dealimentos seguros, "desde el productorhasta el consumidor", lo que reduce loscostos de producción por concepto deinspección y decomiso de productoscontaminados o deteriorados, y elconsiguiente impacto económico, políticoy social. Es con este objetivo que serealiza un estudio de identificación yanálisis de riesgos biológicos, químicos yfísicos en una granja avícola deponedoras y el centro de acopio ydistribución de huevos comerciales de laprovincia Villa Clara; lo que permitió ladeterminación de los riegos, los PuntosCríticos de Control (PCC, suscorrespondientes Límites Críticos (LC ylas posibles desviaciones de estosúltimos, los procedimientos de vigilanciay monitoreo y la propuesta de medidas oacciones correctivas que constituyen lasbases técnicas para la implementacióndel Sistema de Análisis de Peligro yPuntos Críticos de Control (HACCP, en laproducción de huevos comerciales;previa decisión de las autoridadesempresariales correspondientes.Palabras claves: ABSTRACT.The used of Food Safety System "fromproducer to consumer" is to obtainsafety food, reduce the risks of publichealth and the cost of the food. Thereduction of the costs of inspection,forfeiture of contaminated ordeteriorated food is important to reduceeconomical, political and social impact.Our paper is to identify and analyzebiological, chemical and physical risks inthe poultry farm. The reception anddistribution of eggs in Villa Clara wereanalyzed too. The hazards, CriticalControl Points (PCC, Critical Limits (LCand its deviations were identified in theprocess, as well as the monitoryprocedures and correctives actions astechnical basis to implement the HazardAnalysis and Critical Control PointsSystem (HACCP associated with theeggs production. The implementation ofthe system depends on the decision ofthe enterprises authorities.Key words: Hazards

  8. Infección inducida en el roedor selvático Dasyprocta leporina (Rodentia: Dasyproctidae, con huevos larvados de Lagochilascaris minor (Nematoda: Ascarididae Induced infection in the wild rodent Dasyprocta leporina (Rodentia: Dasyproctidae with larval eggs of Lagochilascaris minor (Nematoda: Ascarididae

    Directory of Open Access Journals (Sweden)

    S. Gregorio

    1990-12-01

    Full Text Available Ejemplares de Dasyprocta leporina Linnaeus, 1758 fueron criados alejados de su ambiente natural. A los 3 ó 4 meses de edad, se los inoculó por vía oral con huevos de Lagochilascaris minor Leiper, 1909 obtenidos de una paciente nativa. Los huevos se los incubó por más de 80 dias, para que de ellos fuese posible obtener por compresión mecánica, larvas que se mantuviesen vivas en medio acuoso por 48 horas o más. Sacrificados los animales a los 14 ó 46 dias posteriores a la infección, se hallaron en los músculos esqueléticos larvas ovilladas dentro de nódulos inflamatorios, los cuales no presentaban reacción a cuerpo extraño, abscedación o calcificación. El desarollo de los nódulos no parecía afectar la normalidad de los hospedadores. Las larvas obtenidas eran similares a las descritas por SPRENT como de tercer estadio para estos helmintos. Ratones blancos infectados con material similar, no presentaron nódulos en sus músculos ni se pudo recuperar de sus tejidos larva alguna. Por los hallazgos obtenidos con la infección de estos animales, se postula que el helminto no posee ciclo pulmonar y que su desarrollo requiere de un hospedador intermediario.Specimens of Dasyprocta leporina (Linnaeus, 1758 were raised out their natural environment. At three to four months of age they were orally inoculated with Lagochilascaris minor (Leiper, 1909 eggs obtained from a native patient. The eggs were incubated for more than 80 days so that it was possible to obtain, by mechanical compression, larvae that could be maintained alive in liquid medium for 48 hours or more. The animals were sacrificed 14-46 days after infection and tangled larva in inflammatory nodules were found in skeletal muscle without foreign body reaction, abscess formation or calcification. The development of the nodules did not seem to affect the hosts. The larvae obtained were similar to those described by SPRENT as the third stage of these helminths. When white mice were

  9. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A;

    1999-01-01

    Retroviral reverse transcription is primed by a cellular tRNA molecule annealed to an 18-bp primer binding site sequence. The sequence of the primer binding site coincides with that of a negatively acting cis element that mediates transcriptional silencing of murine leukemia virus (MLV) in...... undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary to...... findings from cell culture studies of primer binding site-modified human immunodeficiency virus type 1 and avian retroviruses, our findings were that SL3-3 MLV may stably and efficiently replicate with tRNA primers other than tRNAPro. Although lymphoma induction of the SL3-3 Lys3 mutant was significantly...

  10. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    Directory of Open Access Journals (Sweden)

    Wawan Abdullah Setiawan

    2015-04-01

    Full Text Available Whiteleg shrimp (Litopenaeus vannamei is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ640264, flanking the position 133 to 756. This primer pairs were used to identify haemolysin gene in both V. harveyi MR5339 and V. harveyi 275 strain. Sequencing results from each sample showed 99% similarity with haemolysin gene sequence in Genebank. Furthermore, the sequence of V. harveyi MR5339 haemolysin gene was used to design the nested PCR primers. The first primer pairs of nested PCR have successfully amplified the haemolysin gene fragment of all V. harveyi strains samples from position 52 to 405. The second primer pairs of nested PCR have amplified position 204 to 405 where it can detect all of V. harveyi strains used as sample sources in this study. The application of nested PCR technique in this study was able to identify V. harveyi strains at serial dilution of cells density as low as 100 cfu/mL, which is equal to a single cell or at DNA concentration up to 101 fg/µL.

  11. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  12. Rem Koolhaas y la nueva Babel. De la torre metropolitana al monumento al vacío

    OpenAIRE

    José Antonio Tallón

    2015-01-01

    Un primer acercamiento a las reflexiones de Rem Koolhaas en torno a la tipología de torre introduce al rascacielos neoyorquino como la alegoría del “automonumen­to”: una construcción en esencia destinada a reafirmar su sola presencia y que se distingue del resto por medio de su estatura, que la monumentaliza. La torre de Babel, símbolo inquebrantable de la leyenda de la construcción en altura, escenifi­ca una historia de construcción y destrucción que está vinculada ineludiblemente al pensami...

  13. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G.J.; Bekeris, P.A. [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  14. A Primer on Population Health Management and Its Perioperative Application.

    Science.gov (United States)

    Boudreaux, Arthur M; Vetter, Thomas R

    2016-07-01

    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  15. ALS1 and ALS3 gene expression and biofilm formation in Candida albicans isolated from vulvovaginal candidiasis

    Science.gov (United States)

    Roudbarmohammadi, Shahla; Roudbary, Maryam; Bakhshi, Bita; Katiraee, Farzad; Mohammadi, Rasoul; Falahati, Mehraban

    2016-01-01

    Background: A cluster of genes are involved in the pathogenesis and adhesion of Candida albicans to mucosa and epithelial cells in the vagina, the important of which is agglutinin-like sequence (ALS) genes. As well as vaginitis is a significant health problem among women, the antifungal resistance of Candida species is continually increasing. This cross-sectional study investigates the expression of ALS1 and ALS3 genes and biofilm formation in C. albicans isolate isolated from vaginitis. Materials and Methods: Fifty-three recognized isolates of C. albicans were collected from women with recurrent vulvovaginal candidiasis in Iran, cultured on sabouraud dextrose agar, and then examined for gene expression. Total messenger RNA (mRNA) extracted from C. albicans isolates and complementary DNA synthesized using reverse transcriptase enzyme. Reverse transcription-polymerase chain reaction (RT-PCR) using specific primer was used to evaluate the expression of ALS1 and ALS3 through housekeeping (ACT1) genes. 3-(4,5-dimethyl-2-thiazyl)-2,5-diphenyl-2H-tetrazolium bromide assay was performed to assess adherence capacity and biofilm formation in the isolated. Results: Forty isolates (75.8%) expressed ALS1 and 41 isolates (77.7%) expressed ALS3 gene. Moreover, 39 isolates (74%) were positive for both ALS1 and ALS3 mRNA by the RT-PCR. Adherence capability in isolates with ALS1 or ALS3 genes expression was greater than the control group (with any gene expression), besides, it was significantly for the most in the isolates that expressed both ALS1 and ALS3 genes simultaneously. Conclusion: The results attained indicated that there is an association between the expression of ALS1 and ALS3 genes and fluconazole resistance in C. albicans. A considerable percent of the isolates expressing the ALS1 and ALS3 genes may have contributed to their adherence to vagina and biofilm formation. PMID:27376044

  16. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.

    Science.gov (United States)

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A

    2012-01-01

    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength. PMID:22414522

  17. El aprendizaje de distintos dominios notacionales según niños de preescolar y primer grado

    Directory of Open Access Journals (Sweden)

    Nora Scheuer

    2010-10-01

    Full Text Available Se investiga si las concepciones de los niños acerca del aprendizaje adoptan matices diferentes según tres dominios notacionales: dibujo, escritura y notación numérica. Se entrevistó individualmente a 120 alumnos de preescolar (60 y primer grado (60 de escuelas públicas en Argentina. Se aplicó la lexicometría a las transcripciones de sus respuestas completas a tres preguntas referidas a la actividad, dificultades y metas en relación al propio aprendizaje del dibujo, escritura o notación numérica. Los resultados revelan diferencias significativas en cómo los niños refieren el contenido de aprendizaje y a sí mismos como aprendices según el dominio, indicando una teoría interpretativa del aprendizaje en relación al dibujo y la notación numérica, y una teoría directa en relación a la escritura.

  18. Necesidades en salud del diabético usuario del primer nivel de atención

    Directory of Open Access Journals (Sweden)

    Salinas-Martínez Ana M.

    2001-01-01

    Full Text Available Objetivo. Determinar la magnitud y jerarquizar la necesidad de salud satisfecha del diabético tipo 2, usuario del primer nivel de atención. Material y métodos. Se realizó un estudio transversal comparativo con representatividad rural y urbana, en el Instituto Mexicano del Seguro Social, en Nuevo León, en 1999. Fueron entrevistados, al azar, 256 diabéticos tipo 2 con dos o más años de diagnóstico. La información fue complementada con el expediente clínico y encuesta al proveedor. Se evaluaron cinco áreas y cuatro determinantes de salud, con base en estándares de la Norma Oficial Mexicana y la Asociación Americana de Diabetes. El plan de análisis consistió en estadística descriptiva y estimación de puntajes z. Resultados. Se registró una media de satisfacción global de necesidades de salud de 48.8%. En la zona rural la media de satisfacción fue menor que en la urbana (36.8% vs 53.3%, phttp://www.insp.mx/salud/index.html

  19. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    Science.gov (United States)

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes. PMID:21570489

  20. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  1. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    Science.gov (United States)

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments. PMID:26300291

  2. Rice8987Corresponding Table(f_g_primer): g_0544 [

    Lifescience Database Archive (English)

    Full Text Available g_0544 3UTR_0544 CH0320 C97525 C97526 >SCH5_13(AL035636|pid:g4539568) Stre ptomyce s coe licolor co ... smid H5; SCH5.13, possible ... he licase , le n: 815aa; similar to many e g. SW:YPRA_ ... BACSU hypothe tical he licase ... from Bacillus subtilis (749 aa) fast ... a score s; opt: 1616, z-score : 1799.2, E (): 0, (37.7% ide nt ... ity in 735 aa ove rlap). Also similar to TR:O06359 (E MBL:Z95436) hypo ...

  3. Rice8987Corresponding Table(f_g_primer): g_7516 [

    Lifescience Database Archive (English)

    Full Text Available g_7516 3UTR_7516 SA1266 AU057237 AU057238 >SC1C3_2(AL023702|pid:g3169028) Stre ptomyce s coe licolo ... r cosmid 1C3; SC1C3.02, possible ... cationic amino acid transporte r, le n: 503 aa; simi ... lar to many bacte rial me mbrane ... prote ins e .g. M. tube rculosis TR:O058 ... 96 E MBL; Z95121 MTCY20B11.28c (495 aa), fasta score s; o ... pt: 1649 z-score : 2116.1 E (): 0, 52.6% ide ntity in 485 aa ove rlap, ...

  4. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  5. The effect of various primers on shear bond strength of zirconia ceramic and resin composite

    Directory of Open Access Journals (Sweden)

    Sasiwimol Sanohkan

    2013-01-01

    Full Text Available Aims: To determine the in vitro shear bond strengths (SBS of zirconia ceramic to resin composite after various primer treatments. Materials and Methods: Forty zirconia ceramic (Zeno, Wieland Dental specimens (10 mm in diameter and 2 mm thick were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10. Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE, AP (Alloy Primer, Kuraray Medical, and MP (Monobond Plus, Ivoclar Vivadent AG. One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa were analyzed with one-way analysis of variance (ANOVA and the Tukey′s Honestly Significant Difference (HSD test (α = 0.05. Results: Group AP yielded the highest mean and standard deviation (SD value of SBS (16.8 ± 2.5 MPa and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa. The SBS did not differ significantly among the groups (P = 0.079. Conclusions: Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  6. A new tetra-primer ARMS-PCR for genotyping bovine kappa-casein polymorphisms.

    Science.gov (United States)

    Fonseca, P A S; Rosse, I C; Demiranda, M; Machado, M A; Verneque, R S; Peixoto, M G C D; Carvalho, M R S

    2013-01-01

    Kappa-casein (κ-casein) is one of the most abundant milk proteins. Its main function is to avoid the aggregation of casein micelles, keeping them, and therefore calcium phosphate, in pockets in solution. In bovines, a κ-casein functional polymorphism has been associated with fat, calcium, and protein milk contents and faster curd contraction in cheese production. Quicker curd contraction reduces the loss of milk solids, enhancing cheese yield. This polymorphism induces a double amino acid substitution (Thr136Ile and Ala148Asp). The polymorphism is normally detected by PCR-RFLP, which is a laborious method. An interesting methodological alternative is the tetra-primer amplification refractory mutation system PCR (tetra-primer ARMS-PCR). A tetra-primer ARMS-PCR for the detection of this κ-casein polymorphism has been described. However, specificity was not achieved, probably due to problems with primer design. We developed a new tetra-primer ARMS-PCR for the detection of the κ-casein polymorphism. This new method was validated in a double-blind test, by comparison with the results obtained for 50 Guzerá bulls formerly genotyped by PCR-RFLP. This new method achieved 100% sensitivity and specificity. We conclude that this method is a useful, cost-efficient alternative for the detection of functional κ-casein polymorphisms. PMID:24390998

  7. Primer Screening for Dyera costulata (Miq Hook.f Random Amplified Polymorphic DNA Analyses

    Directory of Open Access Journals (Sweden)

    YUYU SURYASARI POERBA

    2009-01-01

    Full Text Available Dyera costulata (Miq. Hook.f (Apocynaceae is a large tree of the lowland tropical rain forest of Southeast Asia, Thailand, Malay Peninsula and Indonesia, especially in Sumatra and Kalimantan (Borneo islands. Its economic value was in its copious latex, used as gum in the manufacture of chewing gum. Today the timber of this species is much sought after for the manufacture of pencils and picture frames. Information on genetic diversity of the species is very limited. Hence studies were initiated to screen primers for RAPD analyses of Dyera costulata for use in genetic variation studies. Seventy one Operon primers (10 mer were used to generate a total of 864 consistent and ambiguous amplification products ranging from 200 bp to 2.0 kb. Rare and genotype specific bands were identified which could be effectively used to distinguish the genotypes. 34 highly polymorphic primers (100% are recorded from 71 primers used. Three primers (OPA-04, OPU-06, and OPU-07 produced highest variable RAPD profiles. The dendrogram separated the 8 genotypes into 2 groups. Genetic dissimilarity ranged from 0.07 to 0.71 %.

  8. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. PMID:21445907

  9. Christiaan Barnard: 40 años del primer transplante de corazón humano

    Directory of Open Access Journals (Sweden)

    Jorge Reynolds

    2007-12-01

    Full Text Available Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Christiaan N. Barnard nació el 8 de noviembre de 1922 en Beaufort West, Sudáfrica, hijo de Adam Barnard y Elizabeth de Sewart. Hizo sus estudios en la Universidad de Cape Town, donde se graduó como médico en 1948. Después de un corto período como médico familiar en Ceres, culminó en 1953 su doctorado en medicina en la misma universidad. En 1956 inició su entrenamiento como cirujano cardiotorácico en la Universidad de Minnesota, Estados Unidos. De regreso a su país natal, al terminar la década, Barnard se desempeñó como jefe del departamento de cirugía cardiotorácica en el hospital Groote Schuur1-3. Mientras ocupaba el cargo de profesor asociado en la Universidad de Cape Town, realizó labores asistenciales, docentes e investigativas. Allí conformó una de las unidades de cirugía cardíaca más sobresalientes en su momento a nivel mundial, lo que le permitió hacer gala de sus extraordinarias destrezas como cirujano. Para completar su formación visitó los laboratorios de transplantes más reconocidos alrededor del mundo. Esto le ayudó a perfilar un nuevo objetivo: efectuar el primer transplante exitoso de un corazón humano. Para alcanzar tan fantástico logro, trabajó con intensidad y en estrecha colaboración con un grupo de médicos investigadores, también pioneros en este campo1,3.El comienzo de la historia de la cirugía cardíaca se remonta a 100 años atrás, cuando el médico Alexis Carrel realizó los primeros experimentos

  10. Evaluación de la terapia larval aplicada a cuatro casos clínicos de animales en Bogotá (Colombia) Evaluation of maggot therapy applied to four clinical cases of animals in Bogota (Colombia)

    OpenAIRE

    MAURICIO REY A; ADRIANA CASTAÑEDA A; JULIANA GONZÁLEZ Z; VÍCTOR ACERO P; ALEXANDRA SEGURA G; FELIO BELLO G

    2010-01-01

    Se evaluó el uso de larvas de Lucilia sericata en el tratamiento de heridas infectadas en cuatro casos de animales. Se emplearon dos bovinos, un caballo y un canino tratados con terapia larval en la clínica veterinaria de la Universidad de La Salle, Bogotá-Colombia. Se desarrolló el protocolo de desinfección de huevos embrionados de L. sericata. Al eclosionar las larvas asépticas de primer estadio se colocaron sobre las úlceras de los animales, cubriéndolas con vendajes. La evaluación macrosc...

  11. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for...... automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the...... propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore...

  12. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  13. New primers for promising single-copy genes in fungal phylogenetics and systematics.

    Science.gov (United States)

    Schmitt, I; Crespo, A; Divakar, P K; Fankhauser, J D; Herman-Sackett, E; Kalb, K; Nelsen, M P; Nelson, N A; Rivas-Plata, E; Shimp, A D; Widhelm, T; Lumbsch, H T

    2009-12-01

    Developing powerful phylogenetic markers is a key concern in fungal phylogenetics. Here we report degenerate primers that amplify the single-copy genes Mcm7 (MS456) and Tsr1 (MS277) across a wide range of Pezizomycotina (Ascomycota). Phylogenetic analyses of 59 taxa belonging to the Eurotiomycetes, Lecanoromycetes, Leotiomycetes, Lichinomycetes and Sordariomycetes, indicate the utility of these loci for fungal phylogenetics at taxonomic levels ranging from genus to class. We also tested the new primers in silico using sequences of Saccharomycotina, Taphrinomycotina and Basidiomycota to predict their potential of amplifying widely across the Fungi. The analyses suggest that the new primers will need no, or only minor sequence modifications to amplify Saccharomycotina, Taphrinomycotina and Basidiomycota. PMID:20198159

  14. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.;

    2011-01-01

    developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted...... most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we...

  15. Analysis of Two Chinese Yak(Bos grunniens) Population Using Bovine Microsatellite Primers

    Institute of Scientific and Technical Information of China (English)

    Wang Minqiang; S.Weigend; A.Barre-Dirie; J.W.Carnwath; Lou Zhonglin; H.Niemann

    2005-01-01

    Two Chinese domestic yak populations representing the Plateau type and the Huanhu Alpine type were analysed with 12 bovine microsatellite primers. All primer pairs functioned in the yak genome and polymorphism was found at all loci. The allele size ranges and frequencies of the two yak populations were similar and there was considerable overlap with the allele size ranges observed in cattle. Data for European cattle breeds was obtained from the Cattle Diversity Database(CaDBase)to interpret the heterozygosity and genetic distance estimates in yak populations. Heterozygosity estimated for the two yak populations was comparable to that of European cattle while Nei's Genetic Distance DA between the two yak populations was less than distances between the most closely related German cattle breeds. Bovine microsatellite primers proved to be a valuable tool for characterization of yak populations.

  16. Microsatellite primers in the weedy annual herb Anacyclus clavatus (Asteraceae) and four closely related species1

    Science.gov (United States)

    Agudo, Alicia; Picó, F. Xavier; Álvarez, Inés

    2013-01-01

    • Premise of the study: Nuclear microsatellite primers were developed for the weedy herb Anacyclus clavatus to study the genetic structure of hybrid zones with closely related taxa in the western Mediterranean Basin, where different floral phenotypes are present. • Methods and Results: We obtained two microsatellite libraries using next-generation sequencing and Sanger sequencing of cloned restriction fragments. A total of 13 polymorphic and 11 monomorphic loci were identified in three Iberian populations of A. clavatus. The primers amplified di- and trinucleotide repeats with 1–8 alleles per locus. Most primers also amplified in A. homogamos, A. monanthos, A. radiatus, and A. valentinus. • Conclusions: These results indicate the utility of these markers in A. clavatus for population genetic and hybridization studies as well as their applicability across the genus. PMID:25202498

  17. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  18. Microsatellite Primers in the Weedy Annual Herb Anacyclus clavatus (Asteraceae and Four Closely Related Species

    Directory of Open Access Journals (Sweden)

    Alicia Agudo

    2013-10-01

    Full Text Available Premise of the study: Nuclear microsatellite primers were developed for the weedy herb Anacyclus clavatus to study the genetic structure of hybrid zones with closely related taxa in the western Mediterranean Basin, where different floral phenotypes are present. Methods and Results: We obtained two microsatellite libraries using next-generation sequencing and Sanger sequencing of cloned restriction fragments. A total of 13 polymorphic and 11 monomorphic loci were identified in three Iberian populations of A. clavatus. The primers amplified di- and trinucleotide repeats with 1–8 alleles per locus. Most primers also amplified in A. homogamos, A. monanthos, A. radiatus, and A. valentinus. Conclusions: These results indicate the utility of these markers in A. clavatus for population genetic and hybridization studies as well as their applicability across the genus.

  19. The effect of dentin primer on the shear bond strength between composite resin and enamel.

    Science.gov (United States)

    Hadavi, F; Hey, J H; Ambrose, E R; Louie, P W; Shinkewski, D J

    1993-01-01

    The purpose of this study was to determine the effect of accidental dentin primer contact with etched enamel on shear bond strength of composite resin to enamel. Four dentin bonding systems were included in this study: GLUMA Dentin Bond, Scotchbond, and Prisma Universal Bond 2 and 3. Eighty extracted human permanent anterior teeth were used and divided in eight test groups. The vestibular surfaces were ground and acid etched. For each dentin bonding system 10 samples were treated with dentin primer prior to placement of resin. Shear bond testing showed that enamel contact with dentin primer in the above two systems decreased the shear bond strength between composite and enamel by 31 to 44%. PMID:8337183

  20. Gobierno Electrónico: información y pobreza, un primer acercamiento al dato-puente

    Directory of Open Access Journals (Sweden)

    Rodrigo Sandoval Almazán

    2005-01-01

    Full Text Available Este trabajo desarrolla la idea que una de las causas de la pobreza es la asimetría de información en los mercados, por lo tanto es necesario precisar qué calidad de información deben recibir los pobres para salir de su condición. A partir de ello se propone el constructo: dato-puente cuya finalidad sea homologar la información con el mercado y ampliar sus alternativas para salir de la pobreza. El trabajo se divide en tres partes: la primera explica el problema de la pobreza y su relación con la información; la segunda desarrolla la idea de asimetría de información en la pobreza y expone una propuesta de cómo mejorar la información que reciben los pobres. La última parte expone algunas ideas sobre investigaciones futuras y conclusiones.

  1. Mecanismos de tribalización en la patagonia: desde la gran crisis al primer gobierno peronista.

    OpenAIRE

    Walter Delrio

    2005-01-01

    En 1937 el gobierno argentino decide desalojar y trasladar a la tribu Nahuelpán bajo acusaciones de extranjería e in-civilización. Luego de seis años, la medida es revisada y se inicia un proceso de restitución parcial de las tierras involucradas seleccionándose desde el estado a quienes se continuaría reconociendo como "tribu" Nahuelpán. A partir de este caso enmarcado en el contexto de las relaciones establecidas por las comunidades indígenas del territorio nacional de Chubut con las autori...

  2. Aproximaciones al primer debate sobre Bentham en Colombia: concepciones antropológicas, disputas educativas, aspiraciones nacionales.

    Directory of Open Access Journals (Sweden)

    Juan David Piñeres.

    2011-04-01

    Full Text Available Through the lens of historical-pedagogical anthropology, this article offers an approach to the first debate on Bentham in nineteenth-century Colombia. It first defines historical-pedagogical anthropology, showing that the field is an antropocritique rather than simply an appendage of either History or Anthropology. Second, it briefly contextualizes the early nineteenth-century debate and outlines an approach to study the topic. Finally, based on primary documents that were part of the debate, the article suggests a framework stretching from morality, that is to say the individual, to the society. In this sense, it argues that moral disagreements between debate participants should also be understood as national disagreements, or different ways of conceiving the nation-state. From this perspective, the analysis of nationalism needs to consider the anthropological conceptions implicit in nationalist movements and which lead them to formulate, perhaps unwittingly, what man, as a citizen, will be.

  3. El caso Glivec®: primer ejemplo de debate global en torno al sistema de patentes de medicamentos

    Directory of Open Access Journals (Sweden)

    Inês Moital

    2014-11-01

    Conclusión: El caso Glivec® ha planteado el debate sobre la adecuación de las normas internacionales, su aplicabilidad en el entorno económico y su adaptación en cada país. Este caso, y otros, deberían contribuir a la reflexión sobre el sistema internacional de patentes a fin de preservar la salud de la población más necesitada de una atención sanitaria adecuada en equilibrio con la protección de la propiedad intelectual y la innovación.

  4. Oligonucleotide primers for targeted amplification of single-copy nuclear genes in apocritan Hymenoptera.

    Directory of Open Access Journals (Sweden)

    Gerrit Hartig

    Full Text Available BACKGROUND: Published nucleotide sequence data from the mega-diverse insect order Hymenoptera (sawflies, bees, wasps, and ants are taxonomically scattered and still inadequate for reconstructing a well-supported phylogenetic tree for the order. The analysis of comprehensive multiple gene data sets obtained via targeted PCR could provide a cost-effective solution to this problem. However, oligonucleotide primers for PCR amplification of nuclear genes across a wide range of hymenopteran species are still scarce. FINDINGS: Here we present a suite of degenerate oligonucleotide primer pairs for PCR amplification of 154 single-copy nuclear protein-coding genes from Hymenoptera. These primers were inferred from genome sequence data from nine Hymenoptera (seven species of ants, the honeybee, and the parasitoid wasp Nasonia vitripennis. We empirically tested a randomly chosen subset of these primer pairs for amplifying target genes from six Hymenoptera, representing the families Chrysididae, Crabronidae, Gasteruptiidae, Leucospidae, Pompilidae, and Stephanidae. Based on our results, we estimate that these primers are suitable for studying a large number of nuclear genes across a wide range of apocritan Hymenoptera (i.e., all hymenopterans with a wasp-waist and of aculeate Hymenoptera in particular (i.e., apocritan wasps with stingers. CONCLUSIONS: The amplified nucleotide sequences are (a with high probability from single-copy genes, (b easily generated at low financial costs, especially when compared to phylogenomic approaches, (c easily sequenced by means of an additionally provided set of sequencing primers, and (d suitable to address a wide range of phylogenetic questions and to aid rapid species identification via barcoding, as many amplicons contain both exonic and fast-evolving intronic nucleotides.

  5. Design and implementation of degenerate microsatellite primers for the mammalian clade.

    Directory of Open Access Journals (Sweden)

    Emmanuel Buschiazzo

    Full Text Available Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1 identify conserved microsatellite loci from a multiple genome alignments, (2 design degenerate primer pairs, with (3 a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ~1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120-160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced.

  6. Establishment of Quantitative Analysis Method for Genetically Modified Maize Using a Reference Plasmid and Novel Primers

    Science.gov (United States)

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-01-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×101~105 copies of pGMmaize and the R2 values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods. PMID:24471096

  7. EL PRIMER TEXTO DE NEFTALÍ REYES Y EL ÚLTIMO POEMA DE PABLO NERUDA

    Directory of Open Access Journals (Sweden)

    Manuel Jofré

    2004-11-01

    Full Text Available Uno de los aspectos menos estudiados de la escritura nerudiana es la producción primera del joven Neruda, quien en esos años se llamaba Neftalí Reyes17. Sus primeros escritos son decisivos para la conformación del ser americano y para la constitución del sistema de referencias míticas de la escritura nerudiana, como asi mismo del proceso de nominación de la madrasta como madre y del yo como sujeto poético. Pablo Neruda publicó más de seis mil páginas en verso y en prosa. El primerísimo texto conservado del joven Neftalí Reyes se contrapone abruptamente al que es, reputadamente, el último poema de Pablo Neruda, escrito, casi con seguridad, después del 11 de septiembre de 1973. "Hastaciel" es un poema único, por la complejidad de sus imágenes, su lenguaje hermético y lo funesto de su visión. Es reconocido que la poesia póstuma de Neruda ha sido también poco explorada. En este caso, más que hacer un estudio comparativo de ambos textos, interesa examinar el comienzo y fin de una escritura, es decir, la apertura y cierre de la palabra poética, sin ignorar la ingente cantidad lírica acumulada entre ambos extremosOne of the least studied aspects of the Nerudian canon is the earliest production of the young poet then named Neftalí Reyes. The early writing of the poet is decisive for the formation of the idea of the American self and for the constitution of a system of mythical references as well as for the process of the nomination of the stepmother as the mother and the self as poetic subjects. In the course of his life, Neruda published more than six thousand pages of prose and verse. The earliest known text by the young Neftalí Reyes is in marked contrast to the poet's last poem, written with certainty after Sept. 11.1973, "Hastaciel" is a unique poem, for the complexity of its imagecy, its hermetic language, and its dark vision. It is well acknowledged that the poet's last work has not been given much study. In this case

  8. La política ferroviaria del primer gobierno radical 1916-1922

    Directory of Open Access Journals (Sweden)

    MARIO JUSTO LÓPEZ

    2013-05-01

    Full Text Available El gobierno argentino adoptó a comienzos del siglo XX un modelo de explotación ferroviaria basado en la actuación de empresas extranjeras, que obtenían su capital en el mercado financiero y que, para ello, debían tener utilidades. Su actuación quedó sometida al control estatal que se ejerció a través de la Dirección General de Ferrocarriles. Con el triunfo electoral de la Unión Cívica Radical en las elecciones presidenciales de 1916 la situación no cambió. El primer presidente radical, Hipólito Yrigoyen, continuó con dicho modelo y en los años difíciles que siguieron a la Primera Guerra Mundial se preocupó en mantener las utilidades de las empresas dándoles sucesivos aumentos de tarifas. La Dirección General de Ferrocarriles continuó siendo el órgano específico de contralor pero ahora con menos autonomía respecto del Presidente de la Nación. El estudio detallado de lo hecho en estos años desmiente la creencia de que el presidente Yrigoyen fue contrario a las empresas ferroviarias extranjeras y llevó adelante acciones en su perjuicio. Abstract At the beginning of the XXth Century, the Argentine Government left the main sections of the railway system in the hands of foreign companies. Those companies managed to obtain their capital from the financial market under the condition of being profitable. All those companies were controlled by the National Railways Board. In 1916, when the Radical Civic Union won the presidential election, nothing changed. Even during the difficult years after the First World War, Hipólito Yrigoyen, the first Radical President allowed fares increases that kept the level of profitability. The National Railways Board went on with the surveillance of the foreign companies, but now under the direct power of the President. A careful study of the first Radical Government railway policy shows that the mythical idea about President Yrigoyen acting against foreign companies is not true.

  9. Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

    International Nuclear Information System (INIS)

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation

  10. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    OpenAIRE

    Wahlberg, Niklas; Peña, Carlos; Ahola,Milla; Wheat, Christopher W; Rota, Jadranka

    2016-01-01

    We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular sy...

  11. El arte de cozina de Diego Granado (1599), primer libro de cocina en lengua castellana

    OpenAIRE

    Redondo Buey, Patricia

    2014-01-01

    El Siglo de Oro es un periodo histórico que abarca desde el Renacimiento del siglo XVI hasta el Barroco del siglo XVII, durante el cual se publicó el primer tratado gastronómico de España. En este trabajo científico haremos un estudio meticuloso y minucioso sobre lo que se considera el primer recetario del Siglo de Oro español y así analizar las fuentes primarias de la cocina española, cosa que nunca se había hecho.

  12. Human DNA polymerase α in binary complex with a DNA:DNA template-primer

    OpenAIRE

    Javier Coloma; Johnson, Robert E.; Louise Prakash; Satya Prakash; Aggarwal, Aneel K.

    2016-01-01

    The Polα/primase complex assembles the short RNA-DNA fragments for priming of lagging and leading strand DNA replication in eukaryotes. As such, the Polα polymerase subunit encounters two types of substrates during primer synthesis: an RNA:DNA helix and a DNA:DNA helix. The engagement of the polymerase subunit with the DNA:DNA helix has been suggested as the of basis for primer termination in eukaryotes. However, there is no structural information on how the Polα polymerase subunit actually e...

  13. Minimal sequence requirements of a functional human immunodeficiency virus type 1 primer binding site.

    OpenAIRE

    Wakefield, J K; Rhim, H; Morrow, C D

    1994-01-01

    The initiation of human immunodeficiency virus type 1 (HIV-1) reverse transcription occurs by the extension of a tRNA(3Lys) primer bound near the 5' end of the genomic RNA at a position termed the primer binding site (PBS). The PBS is an 18-nucleotide sequence of the HIV-1 genome which is complementary to the 3'-terminal 18 nucleotides of the tRNA(3Lys). To investigate the sequence specificity of the interaction between tRNA(3Lys) and the PBS, we have constructed proviral genomes containing m...

  14. Primer Açık Açılı Glokom Olgularında ve Normal Olgularda Serum Trigliserid, Total Kolesterol ve Yüksek Yoğunluklu Lipoprotein Seviyeleri

    OpenAIRE

    Sönmez, Kenan; Mensiz, Ercan; Türker, Hasan Hayati; Bardak, Yavuz; Özertürk, Yusuf

    2009-01-01

    SüleymanDemirel Üniversitesi TIP FAKÜLTESİ DERGİSİ: 1999 Mart; 6(1) Primer Açık Açılı Glokom Olgularında ve Normal Olgularda Serum Trigliserid, Total Kolesterol ve Yüksek Yoğunluklu Lipoprotein Seviyeleri Kenan Sönmez , Ercan Mensiz, Hasan Hayati Türker , Yavuz Bardak, Yusuf Özertürk Özet Bu çalışmada yüksek dansiteli lipoprotein (YDL), total kolesterol (TK) ve trigliserid (TG) düzeylerinin primer açık açılı glokom (PAAG) olgularında risk faktörü olup olmad...

  15. Efecto de quitina y quitosano sobre huevos y juveniles de nemátodos formadores de nódulos radiculares, Nacobbus aberrans y Meloidogyne incognita bajo condiciones de in vitro e in vivo

    OpenAIRE

    Sánchez Portillo, Juan Fernando

    2010-01-01

    El nematodo agallador Meloidogyne incognita Kofoid y White, 1919, Chitwood, 1949, distribuido en 23 de los 32 estados del país y Nacobbus aberrans Thorne 1935, Thorne and Allen, 1944, distribuido en 10 de 32 estados de la República Mexicana, su combate para ambas especies, casi siempre se hace aplicando diferentes agroquímicos, los cuales algunos ya tienen problemas de registro. Se necesita evaluar nuevos productos que sean otra alternativa a su manejo y mas amigables al ambiente. En el prese...

  16. All About ALS

    Science.gov (United States)

    ... please review our exit disclaimer . Subscribe All About ALS Understanding a Devastating Disorder In the summer of ... of research dollars—for a fatal disease called ALS. ALS stands for amyotrophic lateral sclerosis. It’s also ...

  17. Molecular Characterization of Atlas 66-Derived Wheat Near-Isogenic Lines Contrasting in Aluminum (Al) Tolerance

    Institute of Scientific and Technical Information of China (English)

    GUO Pei-guo; BAI Gui-hua; LI Rong-hua; Brett Carver; Michael Baum

    2007-01-01

    Aluminum (Al) toxicity is the major limiting factor for wheat growth in acidic soils. Genetic improvement of Al tolerance is one of the most cost-effective solutions to improve wheat productivity. The objective of this study was to characterize near isogenic lines (NILs) contrasting in Al tolerance derived from Atlas 66 in the backgrounds of Al-sensitive cultivars Chisholm and Century using amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR). A total of 200 AFLP and 88 SSR primer pairs were screened and 12 markers (11 AFLPs and one SSR) were associated with Altolerance in NILs of at least one recurrent parental background. Among them, nine were linked to Al tolerance in the Chisholm-derived NILs, seven were associated with Al-tolerance in the Century-derived NILs, and three AFLPs derived from the primer combinations of pAG/mGCAG, pCAG/mAGC and pGTG/mGCG, and one SSR, Xwmc331 on chromosome4D, associated with Al tolerance in NILs of both recurrent parental backgrounds. Those common markers across two backgrounds may be the major marker loci associated with Al-tolerance in Atlas 66 and could be useful for marker-assisted breeding to improve Al tolerance in wheat. In addition, evaluation of Al tolerance among different genotypes using hematoxylin stain and relative root growth revealed that Atlas 66 was more tolerant to Al stress than the NILs, therefore suggested that the Al-tolerant NILs might not carry all Al-tolerance loci from Atlas 66 and inheritance of Al tolerance in Atlas 66 is more likely multigenic.

  18. Tensiones, genealogías y feminismos en los 80: Un acercamiento a alfonsina, primer periódico para mujeres

    Directory of Open Access Journals (Sweden)

    Tania Diz

    2011-09-01

    Full Text Available En este trabajo se realiza un análisis de la publicación feminista alfonsina que se publicó en el período posdictadura 83-84, en Buenos Aires. En primer lugar, se ubica al periódico diacrónica y sincrónicamente. Es decir que, por un lado, se ubica al periódico en una tradición de publicaciones feministas argentinas que se remonta al siglo XIX. Y, por otro, se analiza la influencia del feminismo de la diferencia en la publicación, así como se destaca que su condición marginal no suponía falta de actualidad intelectual ni política. En segundo lugar, se analiza, respecto al nombre de la publicación, su evidente alusión a la poeta Alfonsina Storni con la hipótesis de que el periódico es absolutamente original porque rescata una faceta no demasiado conocida de la escritora: su posición feminista, con lo cual la publicación contribuye a destruir el mito que ha encorsetado a Storni. Por último, se analiza el uso de ciertas estrategias disruptoras de las subjetividades sexuadas hegemónicas propias de la escritura periodística de Storni en dos periodistas-escritores de la publicación: María Moreno y Néstor Perlongher.

  19. Primer peronismo y subjetividad política en Santiago del Estero. Apuntes para nuevas lecturas extracéntricas

    Directory of Open Access Journals (Sweden)

    Mercedes Vargas

    2013-12-01

    Full Text Available El siguiente trabajo se propone una revisión crítica de algunos antecedentes canónicos sobre el primer peronismo. A partir de estas lecturas nos interesa avanzar en el estudio del proceso de identificación del peronismo en el sujeto popular de la provincia de Santiago del Estero. Para ello, tomaremos algunos aportes que nos permiten hipotetizar cuales fueron los elementos del discurso peronista que jugaron en la fuerte identificación suscitada en sectores populares. A partir de las cartas, poesías y solicitudes enviadas a la presidencia, intentaremos re-pensar algunas dimensiones que, consideramos, intervienen en la configuración de una subjetividad política y que no han sido contempladas hasta ahora por los estudios sobre peronismo. El principal aporte que brinda nuestro trabajo es abrir a nuevos abordajes extracéntricos, que permitan delinear los caminos posibles para una elaboración teórica más rigurosa en torno al sujeto político (peronista considerando que lo anterior implica: por un lado, pensar la subjetividad desde abajo. Por otro lado, requiere considerar la diversidad de aristas que se inscriben en la constitución de una subjetividad política, evitando caer en las clásicas dicotomías que han dominado las lecturas canónicas del peronismo en particular y de las ciencias sociales en general.

  20. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  1. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  2. Virus detection and identification using random multiplex (RT-PCR with 3'-locked random primers

    Directory of Open Access Journals (Sweden)

    Eaton John W

    2007-06-01

    Full Text Available Abstract Background PCR-based detection and identification of viruses assumes a known, relatively stable genome. Unfortunately, high mutation rates may lead to extensive changes in viral nucleic acid sequences making dedicated PCR primer use problematic. Furthermore, in bioterrorism, viral consensus sequences can be genetically modified as a countermeasure to RT-PCR and DNA chip detection. Accordingly, there is a great need for the development of rapid and universal virus detection and identification technologies. Results We report herein that viral genomic DNA or RNA can be separated from host nucleic acids in plasma by filtration and nuclease digestion, and randomly amplified in a single PCR using a mixture of primers designed to be resistant to primer-dimer amplification (5'-VVVVVVVVAA-3', V = A, G or C; 38 or 6561 primers. We have termed this novel PCR method Random Multiplex (RT-PCR since hundreds of overlapping PCR amplifications occur simultaneously. Using this method, we have successfullydetected and partially sequenced 3 separate viruses in human plasma without using virus-specific reagents (i.e., Adenovirus Type 17, Coxsackievirus A7, and Respiratory Syncytial Virus B. The method is sensitive to ~1000 genome equivalents/ml and may represent the fastest means of detection of unknown viruses. Conclusion These studies suggest that the further development of random multiplex (RT-PCR may lead to a diagnostic assay that can universally detect viruses in donated blood products as well as in patients suffering with idiopathic disease states of possible viral etiology.

  3. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  4. A new fungal large subunit ribosomal RNA primer for high-throughput sequencing surveys.

    Science.gov (United States)

    Mueller, Rebecca C; Gallegos-Graves, La Verne; Kuske, Cheryl R

    2016-02-01

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300-400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R-LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Together, these findings show that the LR22R-LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods. PMID:26656064

  5. Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

    Science.gov (United States)

    Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

  6. New primers for promising single-copy genes in fungal phylogenetics and systematics

    NARCIS (Netherlands)

    Schmitt, I.; Crespo, A.; Divakar, P.K.; Fankhauser, J.D.; Herman-Sackett, E.; Kalb, K.; Nelsen, M.P.; Nelson, N.A.; Rivas-Plata, E.; Shimp, A.D.; Widhelm, T.; Lumbsch, H.T.

    2009-01-01

    Developing powerful phylogenetic markers is a key concern in fungal phylogenetics. Here we report degenerate primers that amplify the single-copy genes Mcm7 (MS456) and Tsr1 (MS277) across a wide range of Pezizomycotina (Ascomycota). Phylogenetic analyses of 59 taxa belonging to the Eurotiomycetes,

  7. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  8. Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

    2006-01-01

    Reverse transcription of RNA is an invaluable method for gene expression analysis by real-time PCR or microarray methods. Random primers of varying lengths were compared with respect to their efficiency of priming reverse transcription reactions. The results showed that l5-nucleotide-long random...

  9. Primer Dependent and Independent Forms of Soluble Starch Synthetase from Developing Barley Endosperms

    DEFF Research Database (Denmark)

    Kreis, M.

    1980-01-01

    purified by ammonium sulfate precipitation and DEAE-cellulose chromatography and separated into four fractions. In the absence of an added carbohydrate primer two of the four fractions catalized the synthesis of a methanol-precipitable agr-glucan when high concentrations of sodium citrate and bovine serum...

  10. Screening for the familial defective apolipoprotein B-100 R3500W by mutagenic primers PCR

    Institute of Scientific and Technical Information of China (English)

    冯纪安; 冯铮

    2002-01-01

    Objective A method combining the mutagenic primers PCR and restriction enzyme digestion was designed to facilitate the detection of gene mutation in familial defective apolipoprotein B-1O0 R3500W. Methods A pair of primer was designed and a mismatch nucleotide was introduced in its upstream primer. A segment of target DNA including the possibly mutated nucleotide was amplified by PCR and the products were digested by restriction enzyme Nco 1. To overcome the potential false negative results due to improper digestion conditions, a segment of DNA with Ncol cut size was added as reference.Results The target sequence was successfully amplified by PCR, producing a 144 bp DNA fragment as expected. When incubated with Ncol, the enzyme could digest the DNA, producing a 114 bp segment,only if it was amplified from the mutated gene, but not from the normal allele. This difference in length of DNA could be separated by electrophoresis on a 2 %agarose gel. Thus we successfully detected two carriers of heterozygous FDB R3500W in 162 hypercholesterolemic patients. Conclusions Mutagenic primers PCR can be used to detect the gene mutation of apo B-100 R3500W, two cases were detected among 162patients with hypercholesterolemia. It suggests that this mutation is not rare in mainland China.

  11. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  12. Lives Intertwined: A Primer on the History and Emergence of Minority Serving Institutions

    Science.gov (United States)

    Gasman, Marybeth; Nguyen, Thai-Huy; Conrad, Clifton F.

    2015-01-01

    In this article, we provide an overview--a primer--of the rise of Minority Serving Institutions (MSIs) as context for understanding the contemporary place of these institutions in our broader system of higher education. We also demonstrate how the emergence and the evolution of MSIs stem from our nation's struggle to provide equal educational…

  13. Applicability of random primer R143 for determination of Aspergillus fumigatus DNA

    NARCIS (Netherlands)

    Erjavec, Z; Brinker, M; Apperloo-Renkema, HZ; Arends, Jan P; De Vries-Hospers, HG; Ruiters, MHJ

    1997-01-01

    The specificity of random primer R143 for Aspergillus fumigatus DNA was determined in order to test its usefulness in establishing the presence of A. fumigatus DNA in fungal cultures. When PCR reaction products of these cultures were compared with those of 21 other bacterial and fungal DNA samples,

  14. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  15. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  16. PERMANENT PRIMER/REPLACEABLE TOPCOAT AIRCRAFT COATING SYSTEM WITH MINIMUM VOC AND CHROMIUM EXPOSURE - PHASE I

    Science.gov (United States)

    In Phase I, Foster-Miller, Inc., will develop the permanent primer replacement topcoat (PPRT), produce coated test panels, and analyze test panels for key performance properties. Topcoat stripping also will be demonstrated. The team includes coating experts and an aircraft ...

  17. Primer concurso y exposición interamericana de fotografía digital

    OpenAIRE

    Banco Interamericano de Desarrollo (BID)

    2004-01-01

    Da a conocer el Acta del Jurado del Primer Concurso y Exposición Interamericana de Fotografía Digital organizado por el Centro Cultural del BID y copatrocinado por la División de Tecnología de la Información y Comunicación para el Desarrollo del BID.

  18. A Primer on Energy Efficiency for Municipal Water and Wastewater Utilities

    OpenAIRE

    Liu, Feng; Ouedraogo, Alain; Manghee, Seema; Danilenko, Alexander

    2012-01-01

    This primer is concerned with energy use and efficiency of network-based water supply and wastewater treatment in urban areas. It focuses on the supply side of the municipal water cycle, including the extraction, treatment, and distribution of water, and collection and treatment of wastewater-activities which are directly managed by Water and Wastewater Utilities (WWUs). The main challenge...

  19. Detection of summer truffle (Tuber aestivum Vittad.) in ectomycorrhizae and in soil using specific primers

    Czech Academy of Sciences Publication Activity Database

    Gryndler, Milan; Hršelová, Hana; Soukupová, Lucie; Streiblová, Eva; Valda, S.; Borovička, Jan; Gažo, J.; Miko, M.

    2011-01-01

    Roč. 318, č. 1 (2011), s. 84-91. ISSN 0378-1097 R&D Projects: GA ČR GAP504/10/0382 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z30130516 Keywords : nested PCR * ITS primers * Tuber mesentericum Subject RIV: EE - Microbiology, Virology Impact factor: 2.044, year: 2011

  20. Producció de matèries primeres. Curs 2007-2008

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2007-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2007-2008. Departament de Productes Naturals, Biologia Vegetal i Edafologia.

  1. Producció de matèries primeres. Curs 2008-2009

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2008-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2008-2009. Departament Productes Naturals, Biologia Vegetal i Edafologia.

  2. Producció de matèries primeres. Curs 2006-2007

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2006-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2006-2007. Departaments de Productes Naturals, Biologia Vegetal i Edafologia (UB)/ Ciència animal i dels Aliments (UAB)

  3. Producció de matèries primeres. Curs 2005-2006

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2005-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2005-2006. Departament de Productes Naturals, Biologia Vegetal i Edafologia.

  4. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae) para el Perú

    OpenAIRE

    Gomez-Puerta, Luis A.; Pedro A. Ospina; Ramirez, Mercy G.; Nelly G. Cribillero

    2014-01-01

    Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771). Seis nematodos (2 machos y 4 hembras) fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  5. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  6. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    Increasing evidence of the fungal diversity in deep-sea sediments has come from amplification of environmental DNA with fungal specific or eukaryote primer sets. In order to assess the fungal diversity in deep-sea sediments of the Central Indian...

  7. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  8. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  9. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  10. Nutrición y desarrollo psicomotor durante el primer semestre de vida Nutrition and psichomotor development during the first six months of life

    Directory of Open Access Journals (Sweden)

    ADOLFO CHÁVEZ

    1998-03-01

    Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.Objective. To study the psychomotor development of young infants from a poor and underfed rural community and to correlate this with the nutritional conditions of the mother during pregnancy and the child itself. Material and methods. We studied 82 mother-child pairs from the 5th month of pregnancy to the 6th month of life of the child as to anthropometry and food consumption. The neonatal Brazelton test and the Bayley test at 3 and 6 months were applied to the child. Results. Several of the neonatal psychomotor tests applied to the child correlate positively with the mother

  11. Gorduras em laticínios, ovos, margarinas e óleos: implicações para a aterosclerose Grasas en lácteos, huevos, margarinas y aceites: implicaciones para la aterosclerosis Fat content of dairy products, eggs, margarines and oils: implications for atherosclerosis

    Directory of Open Access Journals (Sweden)

    Carlos Scherr

    2010-07-01

    Full Text Available FUNDAMENTO: Para o aconselhamento adequado de um planejamento alimentar, com vistas à prevenção da cardiopatia isquêmica, é necessário o conhecimento da composição química dos alimentos. ObJETIVO: Analisar a composição de gorduras, ácidos graxos e colesterol de alguns exemplos nacionais de óleos comestíveis, manteigas, margarinas, laticínios e ovos, utilizando os limites de uma dieta para prevenção de doença arterial coronariana. MÉTODOS: Foi analisada a composição de óleos comestíveis, manteigas, margarinas, laticínios e ovos. Os resultados foram empregados de acordo com o recomendado pela American Heart Association para uma dieta de 1.800 calorias. RESULTADOS: Na comparação entre os óleos comestíveis, o de canola apresentou-se como o melhor. Já entre os leites, o desnatado é o mais recomendável, porém não há vantagens em relação ao semidesnatado. No caso do ovo, não existiram diferenças nos tipos encontrados no mercado. Em relação aos queijos, o tipo minas é o que apresentou o menor conteúdo de colesterol e gordura saturada. Na comparação margarina com manteiga, a primeira levou vantagem quando os níveis de gorduras trans que não ultrapassam o recomendado. CONCLUSÃO: A composição de alimentos usados no Brasil indica que dietas com objetivo de prevenção primária e secundária da cardiopatia isquêmica podem priorizar o uso de leite semidesnatado, óleo de girassol, margarinas com baixo teor de gorduras trans e queijo do tipo minas.FUNDAMENTO: Para aconsejar adecuadamente sobre una planificación alimentaria, con vistas a la prevención de la cardiopatía isquémica, es necesario el conocimiento de la composición química de los alimentos. OBJETIVO: Analizar la composición de grasas, ácidos grasos y colesterol de algunos ejemplos nacionales de aceite comestible, mantecas, margarina, lácteos y huevos, utilizando los límites de una dieta para prevención de enfermedad arterial coronaria. M

  12. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  13. Intervención psicoeducativa para disminuir el estrés académico en estudiantes de primer año de Medicina

    OpenAIRE

    Yanet Díaz Martín; Edisleidy Ortigosa Fernández; Arely Díaz Cifuentes; Yanelis Castillo Estrada

    2015-01-01

    Se realizó un estudio de intervención en estudiantes de primer año de la carrera Medicina, en el período de noviembre de 2012 a enero de 2013, con el objetivo de implementar una intervención psicoeducativa para disminuir el estrés académico en ellos. Se utilizó un muestreo intencional puro, donde se escogieron 19 estudiantes del año y carrera referidos, con edades comprendidas entre los 18 y 22 años de edad y que presentaban síntomas y conductas asociadas al padecimiento de estrés académico....

  14. Costo anual per cápita en primer nivel de atención por género Cost per capita in outpatients by gender

    OpenAIRE

    Enrique Villarreal-Ríos; Maribel Campos Esparza; Liliana Galicia Rodríguez; Lidia Martínez González; Emma Rosa Vargas Daza; Guadalupe Torres Labra; Adolfo Patiño Vega; María Teresa Rivera Martínez; Raúl Aparicio Rojas; Martín Juárez Durán

    2011-01-01

    El objetivo de este artículo es estimar el costo per cápita anual por género en primer nivel de atención. MÉTODOS: estudio de costo realizado en Unidades de Medicina Familiar en México. La información correspondió al año 2004 y el estudio se dividió en perfil de uso y costo de la atención. PERFIL DE USO DE LO SERVICIOS: se estudiaron los registros clínicos de 1,585 pacientes adscritos a unidades de medicina familiar. El perfil de uso se definió mediante el promedio y los motivos de atención p...

  15. Bloqueo auriculoventricular transitorio de primer grado en paciente con poliintoxicación por drogas de abuso y etanol: The Holiday Heart Syndrome

    Directory of Open Access Journals (Sweden)

    P Poveda Velázquez

    2014-01-01

    Full Text Available Las intoxicaciones por alcohol y drogas de abuso son una causa frecuente de consulta en los Servicios de Urgencias. Las alteraciones electrocardiográficas y las arritmias debidas a la ingesta de alcohol se conocen como Holiday Heart Syndrome. Este síndrome se define como la presencia de alteraciones del ritmo o de la conducción cardiaca asociadas al consumo de alcohol que revierten tras la intoxicación y que se producen en una persona sin enfermedad cardiaca conocida. La alteración más común es la fibrilación auricular. Se presenta el caso de una paciente joven que ingresa en urgencias por intoxicación por alcohol y diferentes drogas y que presentaba un bloqueo auriculoventricular de primer grado transitorio. Se discute el posible efecto causal de las drogas y del alcohol en los cambios electrocardiográficos observados en esta paciente.

  16. Autonomía y ajuste académico : un estudio con estudiantes portugueses de primer año

    OpenAIRE

    Ana Paula Soares; M. Adelina Guisande; Almeida, Leandro S.

    2007-01-01

    Los niveles de autonomía psicológica de los alumnos desempeñan un papel importante en su ajuste a las presiones y desafíos de la vida universitaria. En este sentido, el presente estudio analiza las relaciones entre los niveles de autonomía de los estudiantes en su entrada en la Enseñanza Superior y la calidad de su ajuste académico al final del primer año. Se aplicó el Iowa Developing Autonomy Inventory (IDAI; Hood y Jackson, 1983) en el inicio del año lectivo, y el Questionário de Vivências ...

  17. Determinación de vitamina B 12 en una formulación multivitamínica por espectrofotometría de derivada de primer orden

    OpenAIRE

    Sordo Martínez, Lissette; Soto Mulet, Laritza; González Hernández, Rolando

    1999-01-01

    Se desarrolló un método por espectrofotometría de derivadas de primer orden para la determinación de vitamina B12 en una formulación multivitamínica compuesta por vitamina B1, B6 y B12. La amplitud de la señal de la primera derivada se determinó a 378 nm. La validación prospectiva del método demostró que fue lineal (r=0,999), preciso (repetibilidad CV=0 y 132%; reproducibilidad CV=2,7 y 1,67 %), exacto y selectivo (se determinó B12 en presencia de las vitaminas B1, B6 y en presencia de los pr...

  18. The effect of multiple primer-template mismatches on quantitative PCR accuracy and development of a multi-primer set assay for accurate quantification of pcrA gene sequence variants.

    Science.gov (United States)

    Ledeker, Brett M; De Long, Susan K

    2013-09-01

    Quantitative PCR (qPCR) is a critical tool for quantifying the abundance of specific organisms and the level or expression of target genes in medically and environmentally relevant systems. However, often the power of this tool has been limited because primer-template mismatches, due to sequence variations of targeted genes, can lead to inaccuracies in measured gene quantities, detection failures, and spurious conclusions. Currently available primer design guidelines for qPCR were developed for pure culture applications, and available primer design strategies for mixed cultures were developed for detection rather than accurate quantification. Furthermore, past studies examining the impact of mismatches have focused only on single mismatches while instances of multiple mismatches are common. There are currently no appropriate solutions to overcome the challenges posed by sequence variations. Here, we report results that provide a comprehensive, quantitative understanding of the impact of multiple primer-template mismatches on qPCR accuracy and demonstrate a multi-primer set approach to accurately quantify a model gene pcrA (encoding perchlorate reductase) that has substantial sequence variation. Results showed that for multiple mismatches (up to 3 mismatches) in primer regions where mismatches were previously considered tolerable (middle and 5' end), quantification accuracies could be as low as ~0.1%. Furthermore, tests were run using a published pcrA primer set with mixtures of genomic DNA from strains known to harbor the target gene, and for some mixtures quantification accuracy was as low as ~0.8% or was non-detect. To overcome these limitations, a multiple primer set assay including minimal degeneracies was developed for pcrA genes. This assay resulted in nearly 100% accurate detection for all mixed microbial communities tested. The multi-primer set approach demonstrated herein can be broadly applied to other genes with known sequences. PMID:23806694

  19. Contribución al Estudio de las Moscas Anastrephas en Colombia.

    Directory of Open Access Journals (Sweden)

    González Mendoza Rafael

    1952-11-01

    como oriunda del Brasil, es decir una especie enteramente tropical. 8. Dentro de los dípteros, las moscas del género Anastrepha se pueden clasificar como suborden Cyclorrapha, serie Schyzophora, sección Myodaria, subsección Acalyptratae, familia Trypetidae. 9. Las moscas Anastrephas cumplen su ciclo biológico al través de 4 estados metamorfósicos que ocurren así: imago en el ambiente aéreo, huevo y larva en la fruta y pupa en el suelo. En cada uno de los estados metamorfósicos, el insecto exhibe las características comunes de los dípteros. 10. Los huevos miden l , mm.; son de forma ovalada y ápices un tanto agudos, de color blancuzco ligeramente cremoso. La incubación demora de 4 a 7 días; el número de huevos por postura es de 3 y hasta l. La incubación de los huevos y la vida de la larva recién nacida son afectados por temperatura, humedad y determinados factores resultantes de la condición de madurez de la fruta. 11. Las larvas son vermiformes, puntiagudas en la cabeza, de color amarillo crema claro en tonalidades diversas hasta blanquecino o cremoso. No poseen patas; no tienen ojos ni antenas. Su tamaño y la duración del período larvario varían con la temperatura, la humedad, y diversas condiciones de la fruta en cuanto a cantidad de material parásito, acidez, estado de madurez, etc. El número de larvas puede ser de 1 a 3 por fruta y hasta cifras muy elevadas como 72, según la población de moscas y la clase de fruta. Las larvas adquieren su desarrollo completo entre tres estadios y dos "écdicis". 12. Las pupas son ovaladas como una barrilito; miden de 3 a 7 mm, de largo x 1 1⁄2 a 21⁄2 de ancho. Son de color castaño claro en tonalidades hasta el tabaco oscuro. La duración del período de pupa, así como diferentes hechos relacionados con el estado, sufren variaciones debidas a temperatura, humedad, acidez, soltura y textura del suelo, que es el medio donde normalmente ocurre el empupamiento. 13. El estado

  20. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    Science.gov (United States)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  1. Ocio y deporte en el nacimiento de la sociedad de masas. La socialización del deporte como práctica y espectáculo en la España del primer tercio del siglo XX

    OpenAIRE

    Otero Carvajal, Luis Enrique

    2003-01-01

    En el primer tercio del siglo XX la sociedad de masas irrumpió con fuerza en el escenario de los países desarrollados. España no permaneció al margen de las convulsiones que sacudieron a Europa en el nacimiento de la sociedad de masas. La mayor disponibilidad de tiempo libre encontró un nuevo espacio en el deporte. En este complejo entramado, la práctica y la afición por el deporte fue difundiéndose a través de la escala social española, desde las restringidas elites de principios de siglo a ...

  2. Factores relacionados con la deserción en el primer y segundo año de estudio en la carrera de Enseñanza de la Matemática de la Universidad Nacional de Costa Rica

    OpenAIRE

    Paola Michelle Pascua-Cantarero

    2016-01-01

    Recibido 21 de mayo de 2014 • Corregido 15 de setiembre de 2015 • Aceptado 3 de noviembre de 2015El presente artículo da a conocer detalles sobresalientes obtenidos al realizar una investigación que tuvo entre sus objetivos determinar los factores relacionados con deserción de estudiantes, quienes ingresaron en los años 2007, 2008, 2009, durante el primer y segundo año del Bachillerato y Licenciatura en Enseñanza de la Matemática (carrera de Enseñanza de la Matemática) de la Universidad Nacio...

  3. Creació de qüestionaris des de l'entorn moodle per a assignatures de matemàtiques i estadística corresponents a primers cursos de titulacións d'enginyeria

    OpenAIRE

    Ginovart Gisbert, Marta; Blanco Abellán, Mónica; Jarauta, Eusebi; Pelayo Melero, Ignacio Manuel; Estela Carbonell, M. Rosa; Fabregat Fillet, Jaume; Portell Canal, Xavier; Ferrer Closas, Pol

    2010-01-01

    La finalitat del projecte ha estat el disseny i la implementació d’un banc de 1345 preguntes, que permeten generar col•leccions de qüestionaris, utilitzant les prestacions que ofereix l’entorn Moodle. L’àmbit d’aplicació d’aquests qüestionaris han estat les temàtiques bàsiques i comunes que es troben desenvolupades en la major part d’assignatures de matemàtiques i estadística corresponents als primers cursos de titulacions d’enginyeria. S’han incorporat 161 preguntes d’àlgebra lineal, 769 de ...

  4. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard;

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... phylogenetically related species and outputs a list of possibly degenerate primer pairs fulfilling a number of criteria, such that the primers have a maximal probability of amplifying orthologous sequences in other phylogenetically related species. Operating on a genome-wide scale, PriFi automates the first steps...

  5. Mineralogical Transformation and Electrochemical Nature of Magnesium-Rich Primers during Natural Weathering

    Directory of Open Access Journals (Sweden)

    Shashi S. Pathak

    2014-07-01

    Full Text Available Magnesium-rich primers (MgRP have generated great interest as a promising alternative to chromium-based primers for the protection of aluminum substrates but their performance during exterior exposure has not been well documented. This paper focuses on the evaluation of MgRP during natural weathering to gain insight into its mineralogical phase transformation and electrochemical nature. Control studies were conducted on Mg and AA2024-T3 coupons. The results indicate that Mg particles in MgRP transform into a variety of hydroxide, carbonate, and hydroxy carbonates. During natural weathering, CO2 inhibited the dissolution of both Mg and AA2024-T3 as a result of protective carbonate layer formation in the coating.

  6. Una experiencia con QSB+ en Matemáticas de primer curso

    OpenAIRE

    Ordás Amo, Pilar; Ibar Alonso, Raquel; García Centeno, Mª Carmen; Gabriela M. Fernández Barberis; Escribano Ródenas, Mª Carmen; Calvo Martín, M.E.

    2001-01-01

    Nuestro objetivo con este trabajo es presentar una experiencia que hemos llevado a cabo con los alumnos de primer curso, en la asignatura de Matemáticas, de las Licenciaturas en Ciencias Económicas y Administración y Dirección de Empresas, durante los cursos 1999/2000 y 2000/2001. El propósito de la experiencia es que los alumnos de primer curso vean una parte de la optimización matemática, como es la programación lineal, y el método del Símplex, a través de un software informático senc...

  7. Detection of genetic variability in Chrysanthemum (Dendranthema grandiflora T. using ISSR primers

    Directory of Open Access Journals (Sweden)

    P. Lalitha Kameswari, Hameedunnisabegum, M. Pratap, and G.Anuradha

    2015-03-01

    Full Text Available The genetic diversity of 37 genotypes of Chrysanthemum was characterized using inter simple sequence repeats (ISSR technique. A total of 46 primers were screened, of which 10 polymorphic and informative patterns were selected to determine genetic relationships. Among 114 amplified DNA fragments obtained, 107 bands were polymorphic, accounting for 93.86% polymorphism. The percentage of polymorphism exhibited by different ISSR primers ranged from 71.43% (ISSR-825 to 100% (ISSR-808, 810, 812, 840 and 842. The similarity coefficient values ranged from 0.275 to 0.775 with a mean similarity matrix of 0.525. Among the 37 genotypes studied, the closest relationship was scored between Geetanjali and Red Stone with similarity level of 77.5% while, the most distantly related genotypes were Autumn Joy and Flirtation with the lowest similarity index of 0.275. The UPGMA dendrogram revealed that the chrysanthemum genotypes were grouped into ten clusters.

  8. Universal primer PCR with DGGE for rapid detection of bacterial pathogens.

    Science.gov (United States)

    Ji, Niannian; Peng, Bo; Wang, Guizhong; Wang, Sanying; Peng, Xuanxian

    2004-06-01

    A universal primer PCR (UPPCR) combined with denaturing gradient gel electrophoresis (DGGE) was evaluated as a method permitting the rapid detection of pathogens. The results show that this method is efficient at amplifying the conserved regions of bacterial 16S rRNA genes with universal primers and can detect causative bacterial pathogens rapidly. Six species of bacteria from fisheries (Pseudomonas fluorescens, Vibrio anguillarum, Aeromonas hydrophila, Vibrio fluvialis, Providencia rettgeri and Aeromonas sobria) were examined. Our results indicate that the approach we undertook can be adopted not only for axenic bacterial populations but also for mixed communities as well. Furthermore, we were able to achieve the rapid detection of multiple bacteria a single in sample. In addition, UPPCR-DGGE was shown to be better than previously reported UPPCR-single-stranded conformation polymorphism (SSCP)-based methods for the rapid detection of bacterial pathogens. PMID:15134888

  9. The Astrobiology Primer: An Outline of General Knowledge - Version 1, 2006

    CERN Document Server

    Mix, L J; Mandell, A M; Mosier, A C; Raymond, J; Raymond, S N; Stewart, F J; Von Braun, K; Zhaxybayeva, O; Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-01-01

    Astrobiology, the study of life as a planetary phenomenon, aims to understand the fundamental nature of life on earth and the possibility of life elsewhere. To achieve this goal, astrobiologists have initiated unprecedented communication between the disciplines of astronomy, biology, chemistry, and geology. The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Because of the great diversity of material, each section was written by a different author with a different expertise. The Primer was constructed collaboratively. Ninety researchers from around the world contributed information with regard to what they expected from other astrobiologists and what they would like to know themselv...

  10. Differentiation of five tuna species by a multiplex primer-extension assay.

    Science.gov (United States)

    Bottero, Maria Teresa; Dalmasso, Alessandra; Cappelletti, Marco; Secchi, Camillo; Civera, Tiziana

    2007-05-01

    A novel methodology based on analysis of mtDNA-cytb diagnostic sites was performed to discriminate four closely related species of Thunnus (Thunnus alalunga, Thunnus albacares, Thunnus obesus and Thunnus thynnus) and one species of Euthynnus (Katsuwonus pelamis) genus in raw and canned tuna. The primers used in the preliminary PCR designed in well conserved region upstream and downstream of the diagnosis sites successfully amplified a 132bp region from the cytb gene of all the species taken into consideration. The sites of diagnosis have been interrogate simultaneously using a multiplex primer-extension assay (PER) and the results were confirmed by fragment sequencing. The applicability of the multiplex PER assay to commercial canned tuna samples was also demonstrated. The proposed test could be useful for detection of fraud and for seafood traceability. PMID:17353060

  11. Development and characterization of 11 microsatellite primers for the sedge Trichophorum planifolium (Cyperaceae)1

    Science.gov (United States)

    Nowell, Victoria J.; Wang, Song; Smith, Tyler W.

    2015-01-01

    Premise of the study: Microsatellite loci were developed for Trichophorum planifolium (Cyperaceae), an endangered woodland sedge protected under federal and provincial legislation in Canada, to explore patterns of population genetic diversity and differentiation in the species. Methods and Results: Sixty-three primer pairs were evaluated for amplification consistency and screened for polymorphisms in 96 samples collected from 12 populations of T. planifolium distributed through the range of the species. Of these, 11 loci were shown to be polymorphic, displaying two to six alleles. Mean observed heterozygosity across loci ranged from 0.00 to 0.06 among populations tested. Conclusions: The results suggest that the 11 primer pairs developed in this study will be useful for future studies of broad-scale genetic variation in T. planifolium and in guiding management protocols for the species in Canada. PMID:26421254

  12. INFLUENCIA DE LA GUARDERÍA EN EL PRIMER AÑO DE ED. INFANTIL

    OpenAIRE

    Fernández-Galán, Rebeca

    2012-01-01

    En este trabajo se aborda el tema referente a la influencia que tiene la guardería en la incorporación y la evolución del niño en el primer curso de educación infantil. Se pretende analizar en este proyecto cómo influye la guardería en el primer año escolar del niño y las diferencias que existen en el aprendizaje de distintos conceptos entre los niños que han asistido a la guardería y los que no. Para ello se han empleado fichas y cuestionarios, en una muestra realizada en un centro esc...

  13. Anticorrosion characteristics of a Zn-primer coating in a ballast tank under various chloride concentrations

    International Nuclear Information System (INIS)

    At an open-circuit potential, the anodic polarization curves had very similar values, and no significant differences were observed among the conditions. In the cathodic polarization curves, total residual chloride (TRC) reacted with the Zn-primer coating and created a film that had anticorrosion properties. Therefore, the anticorrosion property improved. With an increase in applied potential in the potentiostatic experiment, the observed surface corrosion occurred due to the dissolution reaction. From Tafel analysis, the corrosion current density had the highest value in natural seawater and the lowest value in the 2 ppm solution. Generally, metals corrode faster with increasing TRC concentration, but with the formation of Zn(OH)2, which has anticorrosion properties, the corrosion resistance of a Zn-primer-coated specimen in seawater can be improved.

  14. A primer on Return on Investment and real options for portfolio optimization

    OpenAIRE

    Mun, Johnathan; Housel, Thomas

    2006-01-01

    In this quick primer, advanced quantitative risk-based concepts will be introduced, namely, the hands-on application of Monte Carlo simulation, real options analysis, stochastic forecasting and portfolio optimization, and knowledge value added. These methodologies rely on common metrics and existing techniques (e.g., return on investment, discounted cash flow, cost-based analysis, and so forth), and complements these traditional techniques by pushing the envelope of analytics, and not to rep...

  15. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  16. An improved allele-specific PCR primer design method for SNP marker analysis and its application

    OpenAIRE

    Liu Jing; Huang Shunmou; Sun Meiyu; Liu Shengyi; Liu Yumei; Wang Wanxing; Zhang Xiurong; Wang Hanzhong; Hua Wei

    2012-01-01

    Abstract Background Although Single Nucleotide Polymorphism (SNP) marker is an invaluable tool for positional cloning, association study and evolutionary analysis, low SNP detection efficiency by Allele-Specific PCR (AS-PCR) still restricts its application as molecular marker like other markers such as Simple Sequence Repeat (SSR). To overcome this problem, primers with a single nucleotide artificial mismatch introduced within the three bases closest to the 3’end (SNP site) have been used in ...

  17. The Astrobiology Primer: An Outline of General Knowledge - Version 1, 2006

    OpenAIRE

    Mix, Lucas J; Armstrong, John C; Mandell, Avi M.; Mosier, Annika C.; Raymond, Jason; Raymond, Sean N.; Stewart, Frank J; von Braun, Kaspar; Zhaxybayeva, Olga; Billings, Linda; Cameron, Vyllinniskii; Claire, Mark; Dick, Greg J; Domagal-Goldman, Shawn D.; Javaux, Emmanuelle

    2006-01-01

    Astrobiology, the study of life as a planetary phenomenon, aims to understand the fundamental nature of life on earth and the possibility of life elsewhere. To achieve this goal, astrobiologists have initiated unprecedented communication between the disciplines of astronomy, biology, chemistry, and geology. The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endea...

  18. Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method

    International Nuclear Information System (INIS)

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual

  19. A historical primer on consumer credit reporting systems: A lesson for EU policy makers?

    OpenAIRE

    Ferretti, F

    2007-01-01

    This work investigates the cultural framework through the lens of history of consumer credit reporting in the lender-borrower relationship in order to inform European legislators when setting a future legal framework. It provides an historical primer of consumer credit reporting in the US where it first originated and how the system was transplanted in Europe without following that process of legitimisation and legislative procedure that was so crucial over more than 100 years of American hi...

  20. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    OpenAIRE

    Alex Galanis; Yiannis Kourkoutas; Chrysoula C. Tassou; Nikos Chorianopoulos

    2015-01-01

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers de...

  1. Hot Start PCR with heat-activatable primers: a novel approach for improved PCR performance

    OpenAIRE

    Lebedev, Alexandre V.; Paul, Natasha; Yee, Joyclyn; Timoshchuk, Victor A.; Shum, Jonathan; Miyagi, Kei; Kellum, Jack; Hogrefe, Richard I.; Zon, Gerald

    2008-01-01

    The polymerase chain reaction (PCR) is widely used for applications which require a high level of specificity and reliability, such as genetic testing, clinical diagnostics, blood screening, forensics and biodefense. Great improvements to PCR performance have been achieved by the use of Hot Start activation strategies that aim to prevent DNA polymerase extension until more stringent, higher temperatures are reached. Herein we present a novel Hot Start activation approach in PCR where primers ...

  2. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers

    Czech Academy of Sciences Publication Activity Database

    Kotík, Michael; Faměrová, Veronika

    2012-01-01

    Roč. 88, č. 2 (2012), s. 212-217. ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012

  3. Characterizing contrasting soils and sediments with semispecific actinomycete r-DNA PCR primers

    Czech Academy of Sciences Publication Activity Database

    Hill, P.; Krištůfek, Václav; Caballero, S.; Kroetsch, D. J.; Rauch, Ota

    České Budějovice: Institute of Soil Biology AS CR, 2004, s. 88-92. ISBN 80-86525-03-1. [Present methods for investigation of microbial community biodiversity in soils and substrates. Methodological workshop /9./. České Budějovice (CZ), 02.03.2004-03.03.2004] Institutional research plan: CEZ:AV0Z6066911 Keywords : contrasting soils * sediments * semispecific actinomycete r-DNA PCR primers Subject RIV: EH - Ecology, Behaviour

  4. Single primer amplification reaction methods reveal exotic and indigenous mulberry varieties are similarly diverse

    Indian Academy of Sciences (India)

    Esha Bhattacharya; S B Dandin; Shirish Anand Ranade

    2005-12-01

    Mulberry is the sole food source for mulberry silkworm and a number of indigenous and exotic varieties are used in sericulture. Studies on assessment of genetic diversity have been done amongst a few mulberry varieties using one or at the most two methods. However, no comprehensive study on a large number of varieties has been carried out. In present study, single primer amplification reaction (SPAR) methods have been used for determination of diversity in 27 mulberry varieties (exotic as well as indigenous), using four minisatellite core sequence primers for directed amplification of minisatellite DNA (DAMD), three simple sequence repeat (SSR) motifs as primers for inter simple sequence repeat (ISSR) and 20 arbitrary sequence decamer primers for random amplified polymorphic DNA (RAPD) reactions. The Jaccard coefficients were determined for the DAMD, ISSR and RAPD band data (total of 58, 39 and 235 bands respectively). All three methods revealed wide range of distances supporting a wide range of mulberry genetic diversity. A cumulative analysis of the data generated by three methods resulted in a neighbour-joining (NJ) tree that gave a better reflection of the relatedness and affinities of the varieties to each other. Comparison of the three methods by marker indices and the Mantel test of correlation indicated that though all methods were useful for the assessment of diversity in mulberry, the DAMD method was better. When considered as two groups (10 exotic and 17 indigenous varieties), the mulberry varieties in the exotic group were found to have slightly greater diversity than the indigenous ones. These results support the concept of naturalization of mulberry varieties at locales distant from their origins.

  5. Evaluation of polymeric coatings and primers against chloride ingress in concrete

    OpenAIRE

    Aguiar, J. L. Barroso de; Schueremans, Luc; Moreira, Pedro M.; Camões, Aires; Van Gemert, D.

    2007-01-01

    Nowadays, it is common knowledge that the biggest degradation of concrete is caused by outside to inside actions. Penetration of moisture, active gases and aggressive ions, as well as mechanical, physical and chemical causes frequently act together. A low porosity and low permeability of concrete to penetration of moisture and gases are the first lines of defence against several deterioration mechanisms. One of the possible ways to protect the concrete is using coatings and primers that act a...

  6. PCR differentiation of commercial yeast strains using intron splice site primers.

    OpenAIRE

    de Barros Lopes, M; Soden, A; Henschke, P. A.; Langridge, P

    1996-01-01

    The increased use of pure starter cultures in the wine industry has made it necessary to develop a rapid and simple identification system for yeast strains. A method based upon the PCR using oligonucleotide primers that are complementary to intron splice sites has been developed. Since most introns are not essential for gene function, introns have evolved with minimal constraint. By targeting these highly variable sequences, the PCR has proved to be very effective in uncovering polymorphisms ...

  7. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  8. Primer System for Single Cell Detection of Double Mutation for Tay-Sachs Disease

    OpenAIRE

    Liu, Ming Cheng; Drury, Kenneth C.; Kipersztok, Simon; Zheng, Wenrong; Williams, R. Stan

    2000-01-01

    Purpose: Nearly 100% of infantile Tay-Sachs disease isproduced by two mutations occurring in the alpha chain ofthe lysosomal enzyme beta-N-acetylhexosaminidase (HEXA)in the Ashkenazi Jewish population. Although others havedescribed primer systems used to amplify both sitessimultaneously, few discuss the allele dropout problems inherent inthis test. Our goal was to construct a more robust testenabling stronger signal generation for single cellpreimplantation genetic diagnosis and to investigat...

  9. Optimization of Annealing Temperature To Reduce Bias Caused by a Primer Mismatch in Multitemplate PCR

    OpenAIRE

    Ishii, Kousuke; Fukui, Manabu

    2001-01-01

    To reduce PCR bias derived from a primer mismatch, the effect of the annealing temperature on the product ratio was investigated by denaturing gradient gel electrophoresis analysis of PCR products from a mixture of perfect-match and one-mismatch templates. These templates were generated by PCR from Pediococcus acidilactici for one mismatch and Micrococcus luteus for the perfect match. PCRs showed that the bias was reduced at lower temperatures. An environmental sample was also examined.

  10. Effect of retaining preconsruction primer (PCP) on the quality of high performance protective coatings systems

    International Nuclear Information System (INIS)

    In construction of new ships and large steel bridges in Korea, pre-construction primers (PCP), also known as shop primer, are routinely used and retained as an integral part of the protective coating system. Retention of PCP's can significantly reduce building schedule and cost. Retaining PCP through the so-called 'sweep blasting' procedure eliminates or minimizes the necessity of a second blast operation, thus shortening overall schedule as well as reducing labor cost and hazardous waste disposal cost. This study evaluates the feasibility of retaining PCP as the part of primer for high performance protective coating systems applied to ships' hull, bottom and ballast tanks. Upon proving that the retention of the PCP is a viable option, the process of coating application can be improved significantly in terms of cost and working schedule of new ships and large steel bridges. Results indicate that use of the PCP via sweeping blasting in conjunction with standard high performance protective coating systems does not degrade the overall performance of the coating systems. At the same time, it is also highly recommended that the secondary surface preparation should consist of grit blasting of weld burnt and other damaged areas to SSPC SP-10 grade (Sa 2.5 Gr.), Near White Blast Cleaning with proper application and attention to detail

  11. DNA TYPING FOR HLA - DR ALLELES BY PCR - AMPLIFICATION WITH SEQUENCE- SPECIFIC PRIMERS

    Institute of Scientific and Technical Information of China (English)

    谭建明; 谢桐; 徐琴君

    1999-01-01

    Ohjective To establish a rapid genetyping for HLA- DR alleles by polymerase chain reaction wiht sequence - specifie primers (PCR - SSP) for clinical application. Material and Methods The subjects of study included 69 recipients, 43 unrelated donors and 5 cell lines, Genomic DNA was prepared from peripheral blood leukoeytes by a salting- out method, Thirty primers designed according to the HLA- DRB nucleotide sequences, and synthesized on a 391 DNN synthesizer,Twenty separate PCR reactions were perfomed for each sample, The amplification was accomplished by 34 cycles consisting of denaturation at 94℃ for 30 seconds, annealing at 60℃ for 50 seconds and extension at 72℃ for 40 seconds The specificity of matching was determined by standard DNAs and Southem hybeidization using DIG labeling probes. Results All 112 samples and 5 cell lines were able to be typed by PCR-SSP,No false positive or false negative typing results were obtained. The reproducibility was 100 %,The size of the .specific product was in cnoccrdance with the size of the designed primers. The overall time for genotyping was 4 bours. The typing results were confirned by Southem hybridization.Conelusions Genotyping for HLA- DR by PCR- SSP is a rapid and accurate matching technique suited for clinical application.

  12. Development and characterization of DNA microsatellite primers for buriti (Mauritia flexuosa L.f.).

    Science.gov (United States)

    Menezes, E V; Souto, W F S; Ciampi, A Y; Azevedo, V C R; Valério, H M; Pimenta, M A S

    2012-01-01

    Mauritia flexuosa L. (Arecaceae) is a palm tree species known as buriti that occurs in the Cerrado biome. It is characteristic of the vereda, a typical ecosystem of central Brazil. In this phytophysiognomy, M. flexuosa and other groups of arboreal-herbaceous species develop in open fields with very humid soils. M. flexuosa can be found in forest borders and is a palm tree with a wide distribution in South America (Brazil, Colombia, Venezuela, French Guyana Ecuador, Peru, and Bolivia). The main objectives of this study were to develop simple sequence repeat marker-enriched libraries and to characterize these loci in buriti palm to facilitate future population studies. A total of 40 sequences derived from the microsatellite-enriched libraries were selected for primer design. The optimization results showed that 9 primer pairs could successfully amplify polymorphic target fragments of the expected sizes. The data also show that the described primers can be used in population genetic studies in M. flexuosa to obtain information that will inform conservation and management strategies. PMID:23079977

  13. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotyledons.

    Science.gov (United States)

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted Repeat region (IR). Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae), Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae), Digitaria excilis and Pennisetum glaucum (Poaceae). The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP) while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR). We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies. PMID:21637837

  14. Primer effect in the detection of mtDNA heteroplasmy: insights from horse Cytochrome b gene.

    Science.gov (United States)

    Zhao, Qianjun; Kang, Ye; Pu, Yabin; Niu, Lili; Guan, Weijun; He, Xiaohong; Zhang, Hongping; Lim, Hyuntae; Ma, Yuehui; Zhong, Tao

    2015-04-01

    Heteroplasmy, the presence of bi-allelic mtDNA types within an individual, has been previously detected in the D-loop region and Cytochrome b gene (Cytb) of mitochondrial DNA using PCR-RFLP. However, heteroplasmy was absent in thousands of equine mtDNA sequences deposited in GenBank. To address whether heteroplasmy widely exists in mitochondria of Chinese indigenous horses, we generated the data set of the target sites in Cytb region with Sanger sequencing and PCR-RFLP method as well. In this study, 23 heteroplasmic individuals were detected in 430 Chinese local horses. Both site and length heteroplasmy were identified in horse Cytb, especially in Xinihe and Ujumqin breeds. Our data provide evidence that the forward and reverse primers seem to produce a similar approximation to the proportion of mutation base call. However, locations of primers affected the proper detection of mtDNA heteroplasmy. The data obtained in this study highlight the importance of the primers in the accurate detection of heteroplasmy. PMID:24409928

  15. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  16. New primers for sex identification in the Chinese egret and other ardeid species.

    Science.gov (United States)

    Wang, Zeng; Zhou, Xiaoping; Lin, Qingxian; Fang, Wenzhen; Chen, Xiaolin

    2011-01-01

    Using the universal P2/P8 primers, we were able to obtain the gene segments of chromo-helicase-DNA binding protein (CHD)-Z and CHD-W from ten species of ardeid birds including Chinese egret (Egretta eulophotes), little egret (E. garzetta), eastern reef egret (E. sacra), great egret (Ardea alba), grey heron (A. cinerea), Chinese pond-heron (Ardeola bacchus), cattle egret (Bubulcus ibis), black-crowned night-heron (Nycticorax nycticorax), cinnamon bittern (Ixobrychus cinnamomeus) and yellow bittern (I. sinensis). Based on conserved regions inside the P2/P8-derived sequences, we designed new PCR primers for sex identification in these ardeid species. Using agarose gel electrophoresis, the PCR products showed two bands for females (140 bp derived from CHD-W and the other 250 bp from CHD-ZW), whereas the males showed only the 250 bp band. The results indicated that our new primers could be used for accurate and convenient sex identification in ardeid species. PMID:21429119

  17. Tea stains-inspired initiator primer for surface grafting of antifouling and antimicrobial polymer brush coatings.

    Science.gov (United States)

    Pranantyo, Dicky; Xu, Li Qun; Neoh, Koon-Gee; Kang, En-Tang; Ng, Ying Xian; Teo, Serena Lay-Ming

    2015-03-01

    Inspired by tea stains, plant polyphenolic tannic acid (TA) was beneficially employed as the primer anchor for functional polymer brushes. The brominated TA (TABr) initiator primer was synthesized by partial modification of TA with alkyl bromide functionalities. TABr with trihydroxyphenyl moieties can readily anchor on a wide range of substrates, including metal, metal oxide, polymer, glass, and silicon. Concomitantly, the alkyl bromide terminals serve as initiation sites for atom transfer radical polymerization (ATRP). Cationic [2-(methacryloyloxy)ethyl]trimethylammonium chloride (META) and zwitterionic 2-methacryloyloxyethyl phosphorylcholine (MPC) and N-(3-sulfopropyl)-N-(methacryloxyethyl)-N,N-dimethylammonium betaine (SBMA) were graft-polymerized from the TABr-anchored stainless steel (SS) surface. The cationic polymer brushes on the modified surfaces are bactericidal, while the zwitterionic coatings exhibit resistance against bacterial adhesion. In addition, microalgal attachment (microfouling) and barnacle cyprid settlement (macrofouling) on the functional polymer-grafted surfaces were significantly reduced, in comparison to the pristine SS surface. Thus, the bifunctional TABr initiator primer provides a unique surface anchor for the preparation of functional polymer brushes for inhibiting both microfouling and macrofouling. PMID:25650890

  18. Aussprache als motorische Fertigkeit

    DEFF Research Database (Denmark)

    Bonner, Maria

    2013-01-01

    Authentische Aussprache gilt im Fremdsprachenunterricht als schwer erreichbares Ziel, fremdsprachlicher Akzent wird als nahezu unvermeidbar gesehen. Weder die Hypothese einer kritischen Periode für den Erwerb einer authentischen Aussprache noch das Konzept der Fossilierung im Sprachlernprozess...

  19. Amyotrophic Lateral Sclerosis (ALS)

    Science.gov (United States)

    ... benefit of 16 months before onset of severe respiratory failure. Other treatments are designed to relieve symptoms and ... of ALS. Most people with ALS die from respiratory failure, usually within 3 to 5 years from the ...

  20. Initial Symptoms of ALS

    Science.gov (United States)

    ... Chapters Certified Centers and Clinics Support Groups About ALS About Us Our Research In Your Community Advocate ... Diagnosis En español Symptoms The initial symptoms of ALS can be quite varied in different people. One ...