WorldWideScience

Sample records for al primer huevo

  1. Reproducción y ultraestructura del huevo y larva de primer estadio de Gyriosomus kingi (Coleoptera: Tenebrionidae del desierto de Atacama

    Directory of Open Access Journals (Sweden)

    Jaime Pizarro-Araya

    2007-06-01

    Full Text Available Gyriosomus es un importante género chileno de Tenebrionidae, habitante del desierto costero del país. En este ambiente, las especies de Gyriosomus son un componente erémico y endémico de la entomofauna epígea. A pesar de la importancia ecológica que estas especies tienen en el desierto chileno, poco se conoce respecto de la morfología de los estados preimaginales. En este trabajo se describe la morfología del huevo y de la larva de primer estadio de G. kingi Reed, 1873, y se entregan algunos antecedentes acerca de la bionomía de la hembra. Los huevos y las larvas fueron obtenidos a partir de parejas mantenidas en condiciones de laboratorio. Los adultos fueron capturados durante la primavera del año 2002, en sitios costeros del Parque Nacional Llanos de Challe, localizado en la frontera sur del Desierto de Atacama (28°01’S; 71°03’W. El primer tercio del corión del huevo presenta celdas subhexagonales sin aeropilas. La larva es oligópoda y elongada. Su cápsula cefálica está fuertemente quitinizada y sus patas protorácicas son más largas y más gruesas que las restantes. Según observaciones de laboratorio, cada ovipostura incluye de siete a diez huevos cada vez, con un máximo de seis oviposturas por hembra. Los huevos son enterrados en el suelo, recubiertos con un mucílago que genera una película de arena-arcilla adherida al corión.Reproduction and ultrastructure of egg and first instar larvae of Gyriosomus kingi (Coleoptera: Tenebrionidae from the desert of Atacama. Gyriosomus is an important Chilean genus of Tenebrionidae, inhabiting the coastal desert of this country. in this environment, the Gyriosomus-species are both eremic and endemic components of the epigean entomofauna. Despite the ecological importance of these species in the Chilean desert, there is a lack of knowledge on the preimaginal stages of them. in this paper we describe the egg and first instar larval morphology of G. kingi Reed, 1873, along with

  2. Alergia a la leche y al huevo: diagnóstico, manejo e implicaciones en América Latina

    Directory of Open Access Journals (Sweden)

    Jorge Sánchez

    2014-03-01

    En el presente artículo presentamos una revisión del manejo de la alergia alimentaria a la leche y al huevo útil para el personal de salud de todos los niveles, así como algunas consideraciones de los factores presentes en los países latinoamericanos.

  3. Determinación del esfuerzo de muestreo requerido para el estimado de procucción de huevos de anchoveta Engraulis ringens, frente al Perú

    OpenAIRE

    Santander, Haydeé; Smith, Paul E.; Alheit, Juergen

    1982-01-01

    Para obtener una primera aproximación del número de muestras requerido para un determinado nivel de precisión del estimado de producción de huevos de anchoveta por unidad de área superficial del mar, se han utilizado datos existentes de muestras de huevos provenientes de exploraciones efectuadas frente al Perú en los últimos 20 años. La anchoveta parece desovar en cardúmenes, produciendo una gran can­ tidad de huevos, de los que las muestras toman una pequeña proporción. Aproximadamente e...

  4. Producción de huevo, calidad del cascarón y rentabilidad en gallinas de primer ciclo con niveles de calcio y fósforo disponible

    Directory of Open Access Journals (Sweden)

    Víctor Manuel Valdés Narváez

    2011-01-01

    Full Text Available Para evaluar el efecto del calcio y fósforo en la calidad del cascarón del huevo se realizó un experimento con 480 gallinas Hy- Line W-36. Se usaron tres niveles de calcio (Ca (3.2, 4.2 y 5.2 % y cuatro de fósforo disponible (Pd (0.15, 0.20, 0.25 y 0.30 %. Se encontró interacción (P<0.05 del Ca y Pd en consumo de alimento (CAL y masa de huevo (MH. Con el nivel de Ca de 5.2 % y de Pd (0.15 % disminuyó el CAL (96.7 g y MH (48.7 g. El porcentaje de postura y MH fueron menores (P<0.05 con 0.15 % que con 0.3 % de Pd. La conversión alimenticia se afectó (P<0.05 por el nivel de Pd, obteniendo la mejor con 0.3 % (1.94, seguida por 0.20 % (1.96, 0.15 % (1.98, y 0.25 % (1.99. El peso del huevo fue mayor (P<0.05 en 0.7 y 0.8 g con 3.2 % que con 4.2 y 5.2 % de Ca, respectivamente. La gravedad específica se mejoró (P<0.05 al incrementar el calcio (1.080 vs 1.081 y 1.082 en la dieta. Se concluye que para buena calidad del cascarón es necesario 4.2 % de Ca, pero se debe incrementar de manera proporcional el fósforo disponible. El nivel de 0.15 % de fósforo disponible no es suficiente para obtener buena producción de huevo y conversión alimenticia.

  5. Respuesta productiva de gallinas semipesadas inducidas al descanso ovárico en diferentes edades

    Directory of Open Access Journals (Sweden)

    Luis Galeano V.

    2012-12-01

    Full Text Available Objetivo. Evaluar el efecto de la inducción al descanso ovárico (DO a diferentes edades sobre la respuesta productiva en aves semipesadas productoras de huevo comercial. Materiales y método. Se usaron 840 aves de la línea Hy Line Brown con 64 semanas de edad, distribuidas en 10 tratamientos, consistentes en tres edades (65, 70 y 75 semanas con la aplicación de tres períodos de ayuno (5, 10 y 15 días y un control (sin DO. El análisis estadístico utilizó un modelo completamente aleatorizado, anidado, efecto fijo y balanceado. Se evaluó consumo de calcio durante el ayuno (g/ave/día, consumo de alimento (g/ave/día, porcentaje de producción, peso del huevo (g, conversión por masa de huevo y huevos por ave alojada (HAA. Resultados. La edad presentó efecto significativo (p<0.05 sobre las variables consumo de alimento, día del primer huevo postmuda, días sin producción, día postmuda de retorno al 50% de producción, peso del huevo, número de huevos, masa huevos, conversión y porcentaje de producción (p<0.01. Al comparar con el control, el tratamiento 75-5 presentó efecto significativo (p<0.05 para las variables: consumo de alimento, número de huevos promedio, masa huevos y conversión. Conclusiones. Las aves con mayor período de ayuno presentaron mayor período improductivo postmuda, grandes pérdidas de peso y alto consumo de alimento, lo que genera alta conversión e ineficiencia productiva. En comparación con reportes de literatura sobre DO en aves livianas, las aves semipesadas llegan al cese de producción en menos días y su período improductivo es menor.

  6. huevo de tortuga lora (lepidochelys olivacea

    Directory of Open Access Journals (Sweden)

    M\\u00F3nica Pereira-Zamora

    2007-01-01

    Full Text Available Penetración de Vibrio mimicus a través de la cáscara del huevo de tortuga lora (Lepidochelys olivacea. El objetivo de esta investigación consistió en determinar la capacidad de penetración del Vibrio mimicus a través de la cáscara del huevo. La investigación se realizó en el Centro Nacional de Ciencia y Tecnología de Alimentos en el año 2000. Se inoculó la superfi cie de la cáscara con la bacteria y se procedió a incubar las muestras por 72 horas a 25ºC. Después de este período se observaron las muestras bajo el microscopio electrónico. Los resultados obtenidos demuestran que el Vibrio mimicus se reproduce en la superfi cie externa de la cáscara del huevo de tortuga lora, y no es capaz de penetrarla después de las 72 horas de incubación a 25ºC. Por lo tanto, cualquier tratamiento que se aplique con el fi n de reducir la contaminación con el vibrio y mejorar la inocuidad de los huevos, debe aplicarse en su exterior.

  7. FACTORES AMBIENTALES Y GENÉTICOS QUE INFLUYEN SOBRE LA EDAD AL PRIMER PARTO EN HEMBRAS DE LA RAZA ROMOSINUANO

    Directory of Open Access Journals (Sweden)

    Marco Suárez

    2006-05-01

    Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.

  8. Congelación de semen de carnero en pellets con los diluyentes Tris-glucosa-yema de huevo o Lactosa-yema de huevo

    Directory of Open Access Journals (Sweden)

    F. I. Brito

    2004-01-01

    Full Text Available El objetivo del trabajo fue comparar la recuperación de la motilidad al descongelar el semen congelado en pellets utilizando el diluyente Tris glucosa-yema de huevo o Lactosa-yema de huevo. Se obtuvieron 30 eyaculados de nueve carneros por medio de una vagina artificial y se evaluó el volumen, la motilidad progresiva, la concentración y la morfología espermática. Cada eyaculado se dividió en dos partes, una de ellas se diluyó con Tris-glucosa yema de huevo y la otra con Lactosa yema de huevo, de manera que la dilución final contuviera 100 x 106 de espermatozoides en 0.1 ml. Los pellets se prepararon goteando 0.1 ml del semen diluido en perforaciones realizadas en hielo seco. Se evaluó la motilidad inicial, después de diluir y al descongelado. Se evaluó la motilidad de cinco pellets de cada eyaculado preparado con cada diluyente (300 en total. Los datos se analizaron estadísticamente mediante análisis de varianza, considerando la motilidad progresiva como variable dependiente y transformando al arcoseno los valores expresados en porcentaje. No se encontraron diferencias en la motilidad inicial de los eyaculados diluidos con tris o Lactosa (P>0.05. La motilidad espermática al descongelar fue significativamente mayor (P<0.05 en el semen diluido con Lactosa-yema (45.8%, que con Tris-glucosa-yema (40.2%

  9. Los huevos en La Colmena

    Directory of Open Access Journals (Sweden)

    José Molina

    2014-10-01

    Full Text Available Las lenguas proponen interesantes juegos de recepción. En el español de nuestro país, por ejemplo, con la palabra ‘huevos’ nos referimos a los genitales masculinos, mientras que en italiano se trata del título del libro de poemas de Elisa Biagini (Florencia, Italia, 1970. Lo interesante surge cuando nos enteramos de que ‘huevo’ en italiano es masculino al singular y femenino al plural. El poemario de Biagini juega con esa transición de géneros. En el tantas veces atacado ‘horizonte masculino’ de la poesía italiana nace esta voz que llena de intenciones las imágenes. No hay referencias directas, sino el gesto hábil que sólo la poesía puede producir en el juego de la palabra. Biagini propone combatir la discursividad masculina de su tradición desde la dispersión de su voz: elabora figuras femeninas que aman hombres y mujeres, que son niñas, amantes y madres, sin necesidad de renunciar a la perversidad y al humor. El ejemplo más claro de esto es el poema “Feminist icon”, donde la misma mano que acaba de masturbarse hace la señal de la cruz entre el cuerpo y un burro de planchar. Biagini ha publicado tres libros de poemas: Questi nodi (Florencia, Gazebo, 1993, Uova (Génova, Zona, 1999 y l’ospite (Torino, Einaudi, 2004. Los poemas aquí traducidos fueron tomados de una antología personal.

  10. NIVELES DE MERCURIO EN HUEVOS, EMBRIONES Y NEONATOS DE Trachemys callirostris (TESTUDINES, EMYDIDAE

    Directory of Open Access Journals (Sweden)

    Beatriz Rendón-Valencia

    2014-09-01

    Full Text Available Cuantificamos la concentración total de mercurio en cáscaras, yemas y embriones de 16 nidos de hicotea (Trachemys callirostris. Los nidos fueron colectados en diferentes estadios de desarrollo embrionario. No hubo una correlación entre el tiempo estimado desde el desove y los niveles de mercurio en los huevos, sugiriendo que el metal no fue absorbido del substrato, sino que probablemente éste fue transferido a los huevos durante el proceso de foliculogénesis en las hembras reproductivas, las cuales bioacumularon el mercurio de fuentes ambientales. La concentración promedio de mercurio fue mayor en los embriones que en las cáscaras o yemas, indicando que los embriones también bioacumulan el metal presente en otros tejidos del huevo. La variación de la concentración de mercurio dentro de una misma nidada fue relativamente alta. Las concentraciones de mercurio en las yemas no estuvieron asociadas con ninguna de las medidas de fitness que fueron evaluadas (éxito de eclosión, tamaño inicial de los neonatos y tasas de crecimiento de los juveniles en el primer mes. Después de cinco meses de mantenimiento en cautiverio, en un ambiente libre de mercurio, 86 % de los juveniles había eliminado completamente este metal de sus tejidos.

  11. APLIKASI ANIMASI INTERAKTIF PENCAMPURAN TIGA WARNA PRIMER DAN PENGENALAN BENTUK GEOMETRI PADA PAUD AL-MUSLIMUN

    Directory of Open Access Journals (Sweden)

    Mayya Nurbayanti Shobary

    2016-03-01

    Full Text Available Abstract - The development of Interactive animation application mixing three colors and introduction of geometric shapes for early childhood, aims to increase learning tool for parents and teachers to attract the attention of children to learn about colors and shapes using interactive animation application. Application built using the concept of PAUD Al-Muslimun in educating early childhood in knowing the result of mixing three primary colors and geometric shapes. The development of application take an example of how theachers in educating early childhood that began with the introduction of color and shapes, and practice how to mix the primary three colors, by showing interisting picture related to colors and shapes are introduced. Data collection methods used for this study is the direct observation of the teaching and learning activities from the perspective of teachers, children and parents to get an idea of the optimal design of an application built on. The development of Interactive animation application mixing three primary colors and introduction of geometric shapes for early childhood for early childhood through the five steps, analyzing, designing, implemeting, testing, and revision errors or shortfall. In this application there are learning processes knowing the primary color and introduction of geometric shapes with support interactive buttons, interesting picture and audio to enhance the absorption of early childhood to the contents of the material, learning and display concerned and to help parents or teachers role in educating children once more creative . Keywords: Applications, Animation, Interactive, Early Childhood Abstrak - Pembangunan aplikasi animasi interaktif pencampuran tiga warna primer dan pengenalan bentuk geometri untuk anak usia dini, bertujuan untuk menambah sarana pembelajaran untuk orang tua dan guru dalam menarik perhatian anak untuk belajar mengenal warna dan bentuk dengan menggunakan aplikasi animasi interaktif

  12. EDAD AL PRIMER PARTO EN VACAS HOLSTEIN DE LECHERÍA ESPECIALIZADA EN COSTA RICA

    Directory of Open Access Journals (Sweden)

    Mauren Salazar-Carranza

    2013-01-01

    Full Text Available El objetivo de este trabajo fue determinar la edad al primer parto (EPP en vacas Holstein pu- ras en lecherías especializadas de Costa Rica. Se realizó un es- tudio longitudinal prospectivo histórico con 46 029 animales de raza Holstein pura de lechería especializada de Costa Rica, durante el periodo comprendido entre los años 2000 y 2010. Se incluyeron los datos de vacas que contaban con registros completos para todas las variables del estudio, registrados en el programa VAMPP Bovino 3.0. Se calculó la EPP por las variables de zona ecológica, la época de nacimiento, el año de parto, el índice de endogamia, el número de lactancias de la madre y el tipo de parto que dio origen al animal en estudio. Los datos fueron analizados por medio de estadística descrip- tiva (porcentajes, promedios, desviación estándar [DE] y el cálculo de intervalos de confianza (IC95%. La EPP prome- dio fue 30,7 meses (D.E: 6,8; IC 95%: 30,6 – 30,8. Durante el periodo, el promedio de la EPP varió entre los 30 y 31 meses; sin embargo, en los años 2006 y 2007 mostró una tendencia a disminuir. La EPP presentó diferencias significativas entre estratos según la época de nacimiento, el número de lactancia de la madre, la zona ecológica, el año de nacimiento, el tipo de parto de la madre y el coeficiente de endogamia de la vaca. Al igual que las tendencias mundiales, mostró tendencia a decrecer en Costa Rica; y las variables de animal, tiempo y ambiente mostraron un efecto sobre la EPP. Excepto el coefi- ciente de endogamia (a mediano y largo plazo, esos factores no son modificables en condiciones de pastoreo, que son los imperantes en la gran mayoría de fincas estudiadas.

  13. Titulación académica y posibilidades de acceso al primer empleo

    Directory of Open Access Journals (Sweden)

    ET. OTROS

    2009-11-01

    Full Text Available RESUMEN: El presente artículo realiza una revisión sobre el estado de la cuestión de la temática focalizada y recoge una investigación de carácter cualitativo. La técnica de recogida de información utilizada ha sido la entrevista. La investigación abordada versa sobre un estudio de caso, acerca de la titulación académica de los empleados de una empresa del sector del comercio en España y sus posibilidades de acceso al primer empleo.De la investigación se desprende que existe una estrecha relación entre la formación y el empleo llegando a convertirse en uno de los mayores condicionantes para la consecución y mantenimiento de éste. Los titulados medios y universitarios no encuentran dificultades para optar al primer empleo en el sector del comercio en España, debido a que todos presentan un nivel de estudios superior al solicitado para el trabajo que realizan en los primeros años de su vida laboral. A pesar de que el nivel de estudios no asegura la obtención del primer empleo coloca a las personas en una situación privilegiada para lograrlo, así la formación ofrece una predisposición para conseguirlo. Con todo, es recomendable desarrollar procedimientos para ofrecer una educación inicial más adaptada al contexto laboral de cada titulación académica que propicien un grado de exigencia coherente con la capacitación profesional.ABSTRACT: The present article is a review on the state of art of the topic starting from a qualitative approach. The technique Lised to collect data was the interview. This is a case study about the academic degrees of the employees of a company in the business sector in Spain and their possibilities of obtaining their first job.One conclusión is the cióse relationship between training and employment and how the former is one of the greatest conditioners in attaining and maintaining the latter. Persons with secondary diplomas and university degrees have no difficulties in gaining their first job

  14. Bajo peso al nacer, crecimiento y desarrollo en el primer año de vida

    Directory of Open Access Journals (Sweden)

    Elia Rosa Lemus Lago

    1997-04-01

    Full Text Available Se efectuó un estudio descriptivo, longitudinal y retrospectivo en el área de salud del Policlínico Docente "19 de Abril" con los niños nacidos con peso inferior a los 2 500 g, en el año 1994, y se siguió su evolución clínica durante el primer año de vida, que correspondió a una muestra de 23 infantes. Los datos fueron recogidos de las historias clínicas individuales de los niños y de la embarazada. Se analizaron los parámetros peso, talla, circunsferencia cefálica, valoración nutricional y desarrollo psicomotor. Predominó el bajo peso para la edad gestacional con un 65,2 y el 34,7 % correspondió a los nacidos antes del término de la gestación. El 100 % de los pretérmino al año de vida tuvieron una valoración nutricional normal. No se comportaron de igual forma los de bajo peso para la edad gestacional en los que el 20 % quedaron por debajo del 3er. percentil.A descriptive, longitudinal and retrospective study was conducted at the health area of the "19 de Abril" Teaching Polyclinic. 23 infants who were born in 1994 with a birth weight < 2 500 g were included in the sample. Their clinical evolution was followed during the first year of life. The data were obtained from the individual medical histories of the children and of the pregnant women. The following parameters were analyzed: weight, size, cephalic perimeter, nutritional assessment and psychomotor development. Low weight prevailed for the gestational age with 65.2 %, whereas 34.7 % corresponded to preterm deliveries. 100 % of the preterm infants had a normal nutritional assessment after the first year of life. However, 20 % of those with low weight at the gestational age remained under the third percentile.

  15. Actividad in vitro de los venenos de Lachesis muta y Bothrops atrox sobre la viabilidad y desarrollo embrionario de los huevos de Ascaris suum

    Directory of Open Access Journals (Sweden)

    Claudia Paredes

    2014-06-01

    Full Text Available Los venenos de serpientes son concentrados polienzimáticos cuya actividad biológica sobre algunas bacterias y protozoos ha sido comprobada. El objetivo principal del presente trabajo fue estudiar la actividad in vitro de los venenos totales de las serpientes Lachesis muta y Bothrops atrox sobre la viabilidad y el desarrollo embrionario de los huevos de Ascaris suum. Se emplearon los venenos totales en concentraciones de 2, 4, 8 y 16 mg/mL sobre huevos no embrionados y larvados in vitro. Se comparó la actividad de los venenos con la de otras sustancias como el hipoclorito de sodio al 5,25%, Albendazol (solución comercial y solución salina. Ambos venenos, en concentraciones de 4, 8 y 16 mg/mL, inhibieron la blastulación de estos huevos; hasta el sexto día de incubación; en cambio en concentración de 2 mg/mL la inhibición se dio hasta el cuarto día. Posteriormente iniciaron un proceso de embrionación aparentemente normal hasta la formación del estadio infectante. El veneno de B. atrox fue el que presentó el mayor efecto inhibitorio en concentración de 16 mg/mL. El hipoclorito de sodio destruyó el 100% de los huevos, mientras el albendazol ocasionó que los huevos iniciaran un proceso de segmentación anormal que originó su degeneración. Se concluye que los venenos de L. muta y B. atrox muestran actividad inhibitoria al inicio de la blastulación de los huevos de A. suum y no ejercen ningún efecto en los huevos larvados.

  16. Demo 94. Campana de vacío : hinchar un globo sin soplar y cocer un huevo en el Everest

    OpenAIRE

    Garro Martínez, Núria

    2013-01-01

    Objetivo: a) Hinchar un globo sin soplar: Experimentar la relación entre el volumen y la presión de los gases. Demostrar que es posible hinchar un globo sin insuflar aire en su interior, reduciendo la presión (atmosférica). b) Cocer un huevo en el Everest: Comprobar la disminución del punto de ebullición del agua al reducir la presión (atmosférica)

  17. Ultraestructura de la cáscara de huevos eclosionados y no eclosionados de Kinosternon angustipons (Testudinata: Kinosternidae

    Directory of Open Access Journals (Sweden)

    R. Acuña-Mesén

    2001-12-01

    Full Text Available Se describe la ultraestructura de la cáscara de los huevos de Kinosternon angustipons y se compara con la de K. leucostomum y K. scorpioides. Esta investigación se realizó con cuatro huevos provenientes de tortugas en cautiverio, para una muestra de 30 secciones analizadas en el Microscopio Electrónico de Barrido. Está constituida por tres capas: la cutícula o externa, la calcárea o intermedia y la testácea o interna. La comparación entre huevos eclosionados y no eclosionados de K. angustipons muestra similitudes en cuanto a su superficie externa que es plana, unidades abanicadas y fibras proteicas superpuestas al azar. Los huevos no eclosionados se diferencian por la presencia de estructuras esponjoides y mayor porosidad externa. Los espacios con forma de punta de lanza y el adelgazamiento de las fibras proteicas son típicos en la capa calcárea y membrana testácea de los huevos eclosionados. La evidencia ultraestructural muestra que durante el desarrollo embrionario disminuye el grosor de la cáscara y, además que, la de los huevos no eclosionados de K. angustipons es más gruesa que la de los otros dos kinostérnidos costarricensesThe ultrastructure of eggshells of Kinosternon angustipons is described and compared with the ones of K. leucostomum and K. scorpioides. Four eggs from captive turtles (30 sections were studied with Scanning Electron Microscopy (SEM. The shell has three layers: cuticle or external, calcareous or intermediate and testacean or internal. Hatched and non hatched eggs have similar characteristics in their external surface: fanned units and proteic fibers superposed at random. They differ in the presence of spongelike structures and more external porosity in non hatched eggs. The intermediate and testacean layers of the hatched eggs have lance point like spaces and are thin in the proteic fibers. The ultrastructural evidence shows that during the embryonic development the thickness of the peel decreases. Non

  18. Biología y ecología de Telenomus sp.(Hymenoptera: scelionidae) parasitoide de huevos de Opsiphanes cassina felder (Lepidoptera: nymphalidae: brassolinae) / Biological and ecology of Telenomus sp. (hymenoptera: scelionidae) parasitoid of eggs of Opsiphanes cassina felder. (Lepidoptera: nymphalidae: brassolinae)

    OpenAIRE

    Guarin Campo, Arnulfo

    2010-01-01

    En la zona palmera del municipio de Puerto Wilches, departamento de Santander, Colombia, 60–80% de humedad relativa, 2200 horas de brillo solar y 27.4 ºC de temperatura; se estudiaron los principales aspectos biológicos y ecológicos de Telenomus sp., parasitoide de huevos de Opsiphanes cassina Felder, (su fauna y flora asociada). Los resultados demostraron que Telenomus sp. parasita huevos de insectos de la familia Nymphalidae relacionados al cultivo de la palma de aceite y huevos de Alcaeor...

  19. Relación entre colesterol dietario, consumo de huevo y perfil lipídico en adultos aparentemente sanos, según grupos de edad

    Directory of Open Access Journals (Sweden)

    Rosa Lorenza Oriondo Gates

    2013-01-01

    Full Text Available Objetivos: Evaluar la relación entre el colesterol dietario, consumo de huevo y el perfíl lipídico en adultos aparentemente sanos, según grupo etario. Diseño: Estudio descriptivo, de asociación cruzada. Institución: Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Perú. Participantes: Adultos aparentemente sanos. Intervenciones: En 50 adultos aparentemente sanos se determinó el consumo de colesterol dietario, huevo y perfil lipídico. Resultados: Trece participantes consumían menos de 3 huevos/semana, 19 de 3 a 4 huevos/semana y 18 más de 4 huevos/semana. En relación al consumo de colesterol dietario, el grupo de 20 a 29 años presentó un promedio de ingesta (358,9±152,5 mg/dL significativamente superior (p<0,05 al grupo de 30 a 39 años (223 ± 82,8 mg/dL. El colesterol (col total de los tres grupos según consumo de huevo fue 179,8 ± 52, 168,8 ± 44 y 164,3 ± 62 mg/dL, respectivamente; para el HDL-col se obtuvo 38,9 ± 15, 28,0 ± 15 y 35,2 ± 14 mg/dL, respectivamente; para el LDL-col, 118,1±41, 112,5 ± 39 y 100,4 ± 47,9 mg/dL, respectivamente; para los triglicéridos, 199,2 ± 169, 152,8 ± 108 y 124,2 ± 92 mg/dL, respectivamente. Conclusiones: El consumo de colesterol dietario y huevo en la muestra estudiada no tuvo relación con el perfil lipídico.

  20. FACTORES AMBIENTALES Y PROPORCIÓN RACIAL QUE INFLUYEN EN EL PESO AL NACIMIENTO, AL DESTETE Y EDAD AL PRIMER PARTO EN BOVINOS SUIZO PARDO EN MÉXICO

    Directory of Open Access Journals (Sweden)

    Ricardo del Carmen Chin Colli

    2012-01-01

    Full Text Available Se evaluaron los efectos de algunos factores ambientales y proporción racial en el peso al nacimiento (PN, peso al destete ajustado a 240 (PD240 días de edad y edad al primer parto (EPP en bovinos Suizo Pardo. El modelo estadístico utilizado para analizar las variables dependientes, después de eliminar factores e interacciones de primer orden no significativos (P>0.05, incluyó los efectos de rancho como efecto aleatorio anidado dentro de región y los efectos fijos de año (A y época (E de nacimiento, sexo de la cría (para PN y PD240, grado de pureza, la interacción AxE, así como las covariables edad de la vaca al parto en su función lineal y cuadrática (para PN y PD240. Los análisis se realizaron utilizando modelos de efectos mixtos. Las medias para PN, PD240 y EPP fueron 37.7 ± 5.1, 233.8 ± 46.9 kg y 1209.6 ± 338.0 días, respectivamente. Todos los efectos principales fueron significativos (P

  1. Los huevos falsos (SAGs facilitan el comportamiento social de emergencia en las crías de la tortuga laúd Dermochelys coriacea (Testudines: Dermochelyidae

    Directory of Open Access Journals (Sweden)

    Juan Patiño-Martinez

    2010-09-01

    Full Text Available La emergencia de las crías de tortuga laúd eclosionadas en los nidos profundos desde la arena hasta la superficie de la playa ocurre sin ayuda parental y es el primer gran desafío de supervivencia en su ciclo de vida. Este estudio, desarrollado en la costa Caribe colombiana, describe el comportamiento social de emergencia de neonatos y evalúa el efecto de la traslocación de los nidos en los patrones temporales de emergencia. Se propone por primera vez que el espacio liberado por la deshidratación de falsos huevos (SAGs en la nidada, representa una ventaja reproductiva al facilitar el agrupamiento de los neonatos en un espacio muy limitado y favorecer la sincronía de la emergencia. El tiempo medio registrado para la emergencia en grupo fue de 3.3 días, variando entre uno y seis días. La traslocación de los nidos no afectó el patrón temporal de emergencia que fue predominantemente nocturno (77.77% en nidos naturales y 81.65% en trasladados. Los picos máximos de emergencias a la superficie coincidieron con los periodos de menor temperatura ambiental exterior (22:00h-06:00h. La ventaja selectiva de este patrón temporal y de la emergencia sincrónica está probablemente relacionada con las mayores tasas de depredación y mortalidad por hipertermia observadas durante el día.

  2. Impedance evaluation of permeability and corrosion of Al-2024 aluminum alloy coated with a chromate free primer

    NARCIS (Netherlands)

    Foyet, A; Wu, T.H.; Kodentsov, A.; Ven, van der L.G.J.; With, de G.; Benthem, van R.A.T.M.

    2009-01-01

    The corrosion of AA-2024 aluminum alloy protected with a chromate free primer is investigated afterimmersion in a 0.5MNaCl aqueous solution. Thewater uptake by the coating increases continuouslywhenthe film, applied on an aluminum AA-2024 substrate, is placed in the 0.5MNaCl solution. This increase

  3. Aplicación de las funciones elípticas de Fourier para la descripción de la forma de los huevos de las aves

    Directory of Open Access Journals (Sweden)

    Dennis Denis Ávila

    2014-12-01

    Full Text Available La forma de los huevos es difícil de cuantificar por la ausencia de fórmulas exactas que describan su geometría. Se describe un algoritmo para la caracterización y comparación de estas formas, basado en la aplicación de las funciones de Fourier. Estas permiten delinear cualquier tipo de contorno cerrado y han sido aplicadas efectivamente al análisis de varias formas biológicas. Se describen los pasos para la toma de datos, su procesamiento y el empleo del programa SHAPE para la obtención de los descriptores, a partir de un estudio de caso. En este se comparan las formas de los huevos de tres especies de aves que representan tres estrategias reproductivas bien diferentes: el Catey (Aratinga euops, la Gaviota Real (Thalasseus maximus y el Totí (Dives atroviolaceus. A partir de 73 fotografías digitales a huevos depositados en colecciones, se calcularon los coeficientes de las funciones para 4, 6, 8, 16 y 20 armónicos, y se redujeron por medio de un Análisis de Componentes Principales. Los puntajes de los componentes que describen hasta el 90 % de la variabilidad fueron empleados en un Análisis de Función Discriminante Lineal para analizar la posibilidad de separar los huevos según sus formas. Con solo cuatro armónicos los primeros cinco componentes explicaron 97% de la varianza en formas. Más armónicos disminuyen la varianza explicada, requiriéndose hasta ocho componentes para explicar la misma cantidad. Los polígonos convexos en el espacio discriminante muestran una clara distinción entre especies sugiriendo la posible discriminación (errores de clasificación entre 7-15%. Los errores en las clasificaciones estuvieron relacionados a diferencias específicas en la forma entre especies. En el estudio de caso, los huevos de A. euops fueron perfectamente clasificados pero en las otras especies los errores fueron entre 5 y 29%, con este número de armónicos y componentes empleados. El algoritmo propuesto a pesar de su

  4. l aceite de atún como fuente de ácidos grasos ω-3 en el huevo de gallina

    Directory of Open Access Journals (Sweden)

    Vázquez-Valladolid, J. L.

    2005-06-01

    Full Text Available Fish oils are a source of polyunsaturated omega 3 fatty acids (AG ω3, mainly eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA, which supply many benefits to human health. Tuna oil was used as a source of marine 3ω FA to enrich eggs by supplementing the diet of egg-laying hens with tuna oil. One hundred and twenty White Leghorn hens of 90 weeks old were allocated on three treatments with four replicates each, on a completely random design. Treatments consisted of adding 1 % and 2 % of tuna oil to the diets. The total lipids and ω3FA of the eggs were determined. The egg-laying hen dietary tuna oil supplement (1 and 2 % enriched eggs with 300 % more EPA (0.40, 1.37, 1.54 mg/g lipids and DHA (7.90, 24.67, 24.50 mg/g lipids versus the control egg . The ω6:ω3 ratio decreased ( 11.4:1, 3.8:1, 3.0:1 as dietary tuna oil increased. There were no differences (p>0.05 among treatments in productive performance and egg quality, except egg weight which decreased with the tuna oil.Los aceites de pescado son una fuente de lípidos poliinsaturados de origen animal, principalmente de los ácidos grasos omega-3 (AG ω-3, eicosapentaenoico (EPA y docosahexaenoico (DHA, beneficiosos para la salud. En este trabajo se utilizó el aceite de atún como fuente de estos nutrientes en el huevo para consumo. Se utilizaron 120 gallinas blancas Leghorn Isa-Babcock B-300 de 90 semanas de edad, distribuidas al azar en tres tratamientos, con cuatro réplicas cada uno. Los tratamientos consistieron en adicionar 1% y 2% de aceite de atún en la dieta de las gallinas ponedoras. Se determinaron los lípidos totales y AG ω-3 en el huevo, obteniéndose 300 % más de EPA (0,40, 1,37, 1,54 mg/g lípidos y DHA (7,90, 24,67, 24,50 mg/g lípidos al adicionar 1 y 2% de aceite de atún en la dieta de las aves, que en el grupo testigo. La relación ω-6: ω-3 en el huevo disminuyó con el suplemento dietético de aceite de atún (11,4:1, 3,8:1, 3:1, lo mismo ocurri

  5. Optimización de una metodología para el aislamiento y detección molecular de huevos de Toxocara canis en muestras de suelo

    OpenAIRE

    Mendoza Meza, Dary Luz; Maldonado Santana, Humberto

    2015-01-01

    La toxocariasis es una zoonosis común en países en desarrollo, como Colombia. La ingesta accidental de huevos de Toxocara sp representa la principal vía de transmisión al humano, por tanto, la vigilancia de la contaminación ambiental es una de las principales estrategias en la prevención de la toxocariasis. El objetivo fue optimizar una metodología para evaluar la contaminación del suelo porhuevos de Toxocara canis. Las muestras de suelo se colectaron en un parque público en la ciudad de Barr...

  6. Influencia del bajo peso al nacer en el estado de salud durante el primer año

    Directory of Open Access Journals (Sweden)

    Orlando Ortiz Silva

    1997-08-01

    Full Text Available Se realizó un trabajo descriptivo-retrospectivo sobre la influencia del bajo peso al nacer en el estado de salud al año de edad en el municipio Jaruco, desde el 1ro. de enero de 1994 hasta el 31 de diciembre de 1995. Se estudiaron 2 grupos de niños: grupo 1: formado por 55 niños con peso menor de 2 500 g en el período estudiado y grupo 2: escogidos del resto de nacidos con peso superior a los 2 500 g, numéricamente similar. Se concluye que los niños con bajo peso al nacer no muestran diferencias en el desarrollo físico al año de edad, pero sí aumento en los índices de morbilidad ambulatoria y hospitalaria por infecciones respiratorias agudas, enfermedades diarreicas agudas, sepsis urinaria y anemia, así como un peso importante en la mortalidad infantil. Se recomiendan actividades de promoción y prevención para disminuir el bajo peso al nacer.A descriptive and retrospective study about the influence of low birth weight on the health status during the first year of life was conducted in the municipality of Jaruco from January 1, 1994, to december, 1995. Two gruops of children were analyzed: the first group was composed of 55 infants with less than 2 500 g in the studied period, and in the second group there was a similar amount of infants selected from the rest of those who were born with more than 2 500 g. It is concluded that infants with low birth weight show no differences in their physical development, but that there is an increase in the indexes of ambulatory and hospital morbidity resulting from respiratory tract infections, acute diarrheal diseases, urinary sepsis and anemia. It is also demonstrated the importance of promotion and prevention to reduce low birth weight.

  7. Estrategia para mejorar el acceso al tratamiento etiológico para la enfermedad de Chagas en el primer nivel de atención en Argentina

    Directory of Open Access Journals (Sweden)

    Karen Klein

    2017-05-01

    Full Text Available RESUMEN Objetivo Mejorar la distribución del tratamiento etiológico para la enfermedad de Chagas mediante la identificación de barreras para su descentralización al primer nivel de atención en Argentina. Métodos Se llevó a cabo un estudio cualitativo, de carácter exploratorio y descriptivo, en base a entrevistas semiestructuradas a actores clave pertenecientes al Programa Nacional de Chagas y miembros de los equipos de salud del primer nivel de atención con el objetivo de identificar barreras para el diagnóstico y tratamiento de la enfermedad de Chagas en diferentes niveles (administrativo, efectores de salud y comunidad que podrían afectar una estrategia descentralizada de distribución. Además, se implementó un piloto de descentralización en diez centros de atención primaria en una provincia argentina. Resultados Se realizaron 22 entrevistas semiestructuradas con responsables de programas y profesionales de la salud. Los principales obstáculos hallados fueron la falta de búsqueda sistemática de casos, la poca articulación entre los niveles de atención y los actores del sistema de salud, la falta de capacitación del equipo de salud respecto al tratamiento, el seguimiento de los pacientes y las barreras asociadas a los pacientes. Se llevó a cabo un programa piloto de descentralización y se evaluaron estrategias para optimizar la intervención a gran escala. Conclusiones Los resultados permitieron mejorar la implementación del plan de descentralización del tratamiento a través de una mejor articulación interprogramática, la capitalización de herramientas de monitoreo y de comunicación ya existentes, y la sensibilización de los equipos de salud. Además, se formularon recomendaciones tendientes a mejorar el diagnóstico y el tratamiento de la enfermedad de Chagas.

  8. Estudios Taxonómicos, Ontogenéticos, Ecológicos y Etológicos sobre los Ostrácodos de agua dulce en Colombia -II. Contribución al conocimiento del desarrollo embrionario tardío y de los procesos de la eclosión del huevo de Heterocypris Bogotensis Roessler Estudios Taxonómicos, Ontogenéticos, Ecológicos y Etológicos sobre los Ostrácodos de agua dulce en Colombia - I. Contribución al conocimiento del desarrollo embrionario tardío y de los procesos de la eclosión del huevo de Heterocypris Bogotensis Roessler Estudios Taxonómicos, Ontogenéticos, Ecológicos y Etológicos sobre los Ostrácodos de agua dulce en Colombia - I. Contribución al conocimiento del desarrollo embrionario tardío y de los procesos de la eclosión del huevo de Heterocypris Bogotensis Roessler

    Directory of Open Access Journals (Sweden)

    Roessler Ewald W.

    1982-04-01

    Full Text Available El presente estudio da una breve descripción del huevo de Heterocypris bogotensis Roessler con énfasis en la estructura de las capas del huevo y su papel ecológico. Se presenta una etapa ontogenética hasta la fecha desconocida, la cual se destaca por la formación de un tronco relativamente grande que se reduce despues de la secreción de una cutícula iniciandose una mudaembrionaria compleja. Se muestra el papel del exoesqueleto embrionario en los sucesos durante la salida de las capas del huevo. Se discuten brevemente cuestiones filogenéticas.The present study gives a short description of the egg off Heterocypris bogotensis Roessler with special consideration of the structure of the eggshell and its ecological importance. An up to date unknown embriological stage is presented that sticks out by the formation of a trunk that will be reduced after the secretion of a cuticula within the iniciation of an embriological molting process. The role of the embriological exoskeleton during hatching is described and phylogenetic questions are shortly discussed.In der vorliegenden Studie wird eine kurze Beschreibung des Eies von Heterocypris bogotensis Roessler gegeben unter Beruecksichtigung der Struktur der Eihuellen und ihrer oekologischen Bedeutung. Es wird auf die Entwick lung eines bisher  unbekannten embryonalen Stadiums eingegangen, dassich durch die Ausbildung eines Rumpfes auszeichnet, der nach Abscheidung einer Kutikula und Einleitung einer embryonalen Haeutung wieder rueckgebildet wird. Die Bedeutung des abgeschiedenen Exoskeletts waehrend des Schlupfprozesses wird aufgezeigt, der Schlupfvorgang beschrieben. Auf phylogenetischeFragestellungen wird kurz eingegangen.

  9. Desarrollo de un método analítico para la determinación de selenio en huevos fortificados de gallinas (Isa Brown) por espectroscopia de absorción atómica con generación de hidruros

    OpenAIRE

    Gutiérrez Peña, Luís Vicente; Carrero, Pablo E; Delgado C, Yelitza J; Picón, David; Paz, Luis A; Vielma, José R; Quintero, Arlenis Y; Gutiérrez, Ever O; Gutiérrez, Iserslis A

    2014-01-01

    El huevo es una fuente proteica de uso masivo, en consideración a su bajo costo, es consumido con mayor frecuencia por toda la población. Por esta razón, es de gran interés introducir al mercado un tipo de huevo "saludable", que disminuya los riesgos ligados a enfermedades cardiovasculares y que actúe como antioxidante. Por ello, se evaluó la incorporación del Selenio Orgánico (Sel-Plex®, Alltech Inc) en el programa de alimentación de gallinas ponedoras comerciales raza isa brown con el objet...

  10. Una mirada tecnopolítica al primer año de Podemos. Seis hipótesis

    Directory of Open Access Journals (Sweden)

    Javier Toret Medina

    2015-04-01

    Full Text Available La irrupción de Podemos en las elecciones europeas de mayo de 2014 ha transformado radicalmente la escena política española. El impacto de Podemos se enmarca en un contexto de crisis económica, creciente intolerancia contra la corrupción y una paisaje cultural en transformación tras los múltiples efectos del movimiento-red 15M. En este breve ensayo se trata de poner de relieve algunos aspectos y dar fuerza a miradas que muestran a Podemos atendiendo a su conexión con los Adn del 15M y latinoamericano, como su estratégica de ocupación de los medios de comunicación de masas como el de las redes sociales digitales. Atendemos al crecimiento exponencial y una mirada que muestra elementos determinantes menos visibles en la emergencia política y comunicativa de Podemos.

  11. Extracción y aplicaciones alimentarias de membranas de cáscaras de huevo

    OpenAIRE

    García Campos, Tania

    2015-01-01

    Caracterización físico-química de la membrana de la cáscara de huevo, seguida del estudio y desarollo de posibles aplicaciones de la membrana en diversos campos, entre los que destaca la formación de geles y la retención de cobre y proteínas.

  12. Afasia motora congénita (informe preliminar presentado al Primer Congreso Colombiano de Neurología

    Directory of Open Access Journals (Sweden)

    Juan Antonio Gómez

    1966-01-01

    Full Text Available El estudio del lenguaje, antes de que exista, es un campo bastante confuso de la neurología. No sólo participa de la caótica interpretación que diferentes escuelas actuales dan al fenómeno clínico de afasia sino que linda con el problema mismo de la evolución y creación del lenguaje, base de la cultura. De nuestro material clínico hemos escogido un grupo de 23 niños con afasia de la llamada "congénita", entre los cuales había 11 casos de afasia motora. Nueve se estudiaron bajo el punto de vista neurológico, psicológico, psicométrico, pedagógico y social. Todos fueron examinados radiológicamente, audiométricamente y electroencefalográficamente. El objeto del presente trabajo es presentar las manifestaciones neurológicas de los niños con afasia motora congénita principalmente, y discutir algunos puntos del diagnóstico diferencial y del posible mecanismo neurológico que ha impedido el desarrollo del lenguaje.

  13. El secreto del huevo azul, de Catalina González Vilar. Estudio narratológico

    Directory of Open Access Journals (Sweden)

    Miguel Sánchez-García

    2013-01-01

    Full Text Available Este trabajo aborda el estudio narratológico de la obra El secreto del huevo azul , de la escritora Catalina González Vilar, que obtuvo el Premio El Barco de Vapor en el año 2012. Examina los diferentes elementos constitutivos del texto (el enfoque del tema, la caracterización de los personajes, la estructura sintáctica, el tratamiento del lenguaje, la técnica narrativa utilizada... y su aporte al desarrollo de la historia con la finalidad de descubrir los valores estéticos y literarios que aporta a la fábula. Pretende demostrar el adecuado uso de todos ellos dado que favorecen un texto rico en matices, llamativo, sugerente. Cualidades, todas ellas, de gran importancia tanto en creaciones destinadas al público adulto como al infantil y juvenil pues enriquece el valor final de la obra, y por extensión, el bagaje cultural de sus lectores.

  14. El Tratado de Versalles y el huevo de la serpiente

    OpenAIRE

    Cruset, María Eugenia

    2009-01-01

    Si algo enseña la historia es que no hay verdadero y pacífico desarrollo sin verdad, justicia y reparación. O, dicho en sentido negativo, nada hay más explosivo y destructivo para cualquier país que las arbitrariedades e inequidades. Este año se cumplen 90 años de uno de los episodios más gráficos de lo que estamos diciendo: el Tratado de Versalles, que firmado el 28 de junio de 1919 significó el fin de la Primer Guerra Mundial con la humillante derrota de Alemania. Flagrante situación de arb...

  15. Ingesta de huevo y factores de riesgo cardiovascular en adolescentes; papel de la actividad física: Estudio HELENA

    OpenAIRE

    A. Soriano-Maldonado; M. Cuenca-García; L. A. Moreno; M. González-Gross; C. Leclercq; O. Androutsos; E. J. Guerra-Hernández; M. J. Castillo; J. R. Ruiz

    2013-01-01

    Introducci??n: Las enfermedades cardiovasculares (ECVs) suponen la principal causa de morbi-mortalidad en los pa??ses occidentales. El incremento del colesterol plasm??tico se ha relacionado con el desarrollo de ECV. El huevo, por su alto contenido en colesterol, ha sido indirectamente relacionado con el riesgo de desarrollar ECVs. Objetivo: Examinar la asociaci??n entre ingesta de huevo y factores de riesgo cardiovascular en adolescentes, estudiando si dicha relaci??n est?? influenciada por ...

  16. Reología de derivados de la yema de huevo deshidratada

    Directory of Open Access Journals (Sweden)

    Partal, Pedro

    2000-08-01

    Full Text Available The emulsification process, as weIl as and the emulsion rheology and stability, greatly depends on the rheological properties of the continuous phase, the most important ingredient of which is yolk. However, since native yolk is not microbiologically stable, processing of yolk, such as spray-drying, is necessary for food applications. The influence of processing by spray-drying on the microstructure and rheological properties of yolk was investigated using oscillatory, creep and steady state flow measurements. The spray-drying process produces denaturation of proteins giving rise to a dramatic change from a fluid-like behaviour, as corresponds to the native yolk, to a gel-like behaviour corresponding to the reconstituted dried yolk (45% solids. Temperature exerts a slight influence on the linear viscoelastic properties of processed yolk.Tanto el proceso de emulsificación como las propiedades reológicas y la estabilidad de una emulsión alimentaria, tipo mayonesa, dependen en gran medida de la microestructura y la reología de la fase continua acuosa, cuyo ingrediente principal es la yema de huevo. Debido a la inestabilidad microbiológica de ésta se hacen necesarios procesos de deshidratación por atomización para conservarla con fines alimentarios. En este trabajo se trata de determinar la influencia que ejerce la deshidratación sobre la microestructura analizando las propiedades reológicas de la yema mediante ensayos reológicos de cizalla oscilatoria, de flujo en estado estacionario y de fluencia viscosa. Se llegó a la conclusión de que la deshidratación produce la desnaturalización de las proteínas provocando un cambio desde un comportamiento tipo fluido (yema nativa a un comportamiento tipo gel (yema deshidratada reconstituida al 45% en sólidos. Por otro lado, se ha observado una escasa variación de las propiedades viscoelásticas lineales de la yema deshidratada con la temperatura.

  17. Desarrollo embrionario-larval del pez tropical Hemirhamphus brasiliensis (Beloniformes: Hemirhamphidae a partir de huevos recolectados del medio natural

    Directory of Open Access Journals (Sweden)

    Jesús Rosas

    2008-09-01

    Full Text Available Se describe la formación del embrión y el desarrollo larval del pez Hemirhamphus brasiliensis Linnaeus, 1758, a partir de huevos en estado de mórula, recolectados en el alga parda Sargassum sp. Los huevos eran esféricos con un diámetro de 1923.54 ±72.35 µm, con numerosos filamentos coriónicos y estrías en su superficie. Durante las primeras 48 h, el embrión desarrolló la vesícula cefálica, los miomeros y el corazón, el cual se ubicó en el exterior de cuerpo impulsando sangre incolora, la cual se pigmentó de rojo posteriormente. Antes de la eclosión se desarrollaron el riñón, estómago, hígado y la vesícula biliar, las aletas pectorales, cuatro pares de arcos branquiales y la boca. Las larvas eclosionaron a la 114 h, presentando el cuerpo robusto en forma de torpedo, verde-amarillo con melanoforos dendriformes. Al nacer ingirieron metanauplios de Artemia. A las 72 h después de la eclosión se observó el esbozo de la aleta pélvica y a las 240 h se completó la metamorfosis.Embrionary-larval development of the tropical fish Hemirhamphus brasiliensis (Beloniformes: Hemirhamphidae from eggs collected in the wild. The embryo formation and larval development of Hemirhamphus brasiliensis Linnaeus, 1758 (Pisces: Hemirhamphidae is described from morula stage eggs collected on Sargassum sp. Thalii in the field (10°50’55.2" N y 64°09’467" W. The eggs were spherical, 1 923.54 ±72.35 µm diameter with several corionic filaments, and are striated. During the first 48 h the embryo developed cephalic vesicle, miomers, and a heart located on the external body surface, beating strongly and circulating colorless blood which became pigmented red later. Before hatching, the larva developed kidney, gut tract, liver and biliar vesicle, pectoral fins, four pairs of gill arches and the mouth. The larva hatched at 114 h, the body was torpedo-shaped, yellow-green, with several dendriform melanophores; the pelvic fin was observed 72 h post

  18. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  19. Cuantificacion de huevo en fideos secos según metodo electroforético (SDS PAGUE) Quantification of egg in dried noodles by electrophoretic methods (SDS PAGE)

    OpenAIRE

    LB López; K Cellerino; MJ Binaghi; MS Giacomino; ME Valencia

    2011-01-01

    La cuantificación de huevo en fideos secos elaborados con harina y agregado de huevo. Se analizaron 6 sistemas modelos (SM) de fideos que contenían 0,0; 1,0; 2,5; 4,0; 6,0 y 8,0% de huevo en polvo. Se extrajeron proteínas totales con un buffer que contiene dodecilsulfato de sodio (SDS) y 2-Mercaptoetanol y se realizó electroforesis en gel de poliacrilamida con SDS. Se establecieron las relaciones de las áreas de los picos de los densitogramas (de huevo y de trigo) que permiten una correcta cu...

  20. Los huevos falsos (SAGs facilitan el comportamiento social de emergencia en las crías de la tortuga laúd Dermochelys coriacea (Testudines: Dermochelyidae

    Directory of Open Access Journals (Sweden)

    Juan Patiño-Martinez

    2010-09-01

    Full Text Available La emergencia de las crías de tortuga laúd eclosionadas en los nidos profundos desde la arena hasta la superficie de la playa ocurre sin ayuda parental y es el primer gran desafío de supervivencia en su ciclo de vida. Este estudio, desarrollado en la costa Caribe colombiana, describe el comportamiento social de emergencia de neonatos y evalúa el efecto de la traslocación de los nidos en los patrones temporales de emergencia. Se propone por primera vez que el espacio liberado por la deshidratación de falsos huevos (SAGs en la nidada, representa una ventaja reproductiva al facilitar el agrupamiento de los neonatos en un espacio muy limitado y favorecer la sincronía de la emergencia. El tiempo medio registrado para la emergencia en grupo fue de 3.3 días, variando entre uno y seis días. La traslocación de los nidos no afectó el patrón temporal de emergencia que fue predominantemente nocturno (77.77% en nidos naturales y 81.65% en trasladados. Los picos máximos de emergencias a la superficie coincidieron con los periodos de menor temperatura ambiental exterior (22:00h-06:00h. La ventaja selectiva de este patrón temporal y de la emergencia sincrónica está probablemente relacionada con las mayores tasas de depredación y mortalidad por hipertermia observadas durante el día.False eggs (SAGs facilitate social post-hatching emergence behaviour in Leatherback turtles Dermochelys coriacea (Testudines: Dermochelyidae nests. Hatchling emergence to the beach surface from deep sand nests occurs without parental care. Social behaviour among siblings is crucial to overcome this first challenge in sea turtles life. This study, carried out at the Caribbean coast of Colombia, describes the emergence social behaviour of hatchlings from eight nests, and assess the nests translocation effects on temporal patterns of emergence. For the first time, we propose that space released by dehydration of shelled albumen globes (SAGs at the top of the clutch

  1. Efecto de la proporción de genes Bos indicus x Bos taurus sobre peso al destete y edad a primer parto en una población multirracial

    Directory of Open Access Journals (Sweden)

    Hugo O. Toledo Alvarado

    2015-01-01

    Full Text Available Se analizaron 1,289 registros de hembras de primer parto con diversas proporciones de genes Bos indicus y Bos taurus (Charolais, Suizo, Simmental, Holstein Friesian y Salers. Tanto animales puros y cruzados de un hato comercial, ubicado en el municipio de Hueytamalco, Puebla, nacidas entre 1966 a 2006, con el objetivo de estimar la combinación óptima de genes Cebú y la retención de heterosis (RVH sobre las características de peso al destete ajustado a 270 días (PD y edad a primer parto (EPP. A partir de modelos de regresión múltiple se identificó la proporción de Cebú con el mejor comportamiento para las dos características de acuerdo al coeficiente de determinación (R 2 y al estadístico de Mallow (CP. La mejor respuesta para PD se encontró en el rango de 42 a 70 % de genes Bos indicus ; mientras que las menores EPP se establecieron entre 27 al 40 % de proporción Cebú. La retención de heterosis que mostró mayor potencial para PD fue de 76 a 78 % y para EPP de 79 a 92 %. Estos resultados manifiestan la importancia de los efectos no aditivos en ambas características, así como la necesidad de realizar cruzamientos dirigidos.

  2. Características técnico-sanitarias de expendios de carnes, pescados, aves y huevos de la ciudad de Tunja 2003

    Directory of Open Access Journals (Sweden)

    Fred Gustavo Manrique-Abril

    2011-02-01

    Full Text Available Se presenta una caracterización epidemiológica de los expendios de carnes, pescado y aves de Tunja en el año 2003, resultado del diagnóstico sanitario del municipio y las visitas adelantadas por la unidad de saneamiento. Al partir del compromiso que el sector salud tiene en el componente de ambiente, surge la necesidad de crear un sistema de vigilancia epidemiológica ambiental, cuya metodología y estrategia esté orientada hacia el conocimiento de los factores de riesgo ambientales a que están expuestos los grupos humanos, con el fin de determinar prioridades y orientar los recursos de salud disponibles en el desarrollo de intervenciones; es por eso que se implantó en Tunja la vigilancia de factores de riesgo del consumo en esta estrategia, la cual, incluye la de expendios decarnes y derivados, aves huevos y pescado; entonces, se usaron las actas de inspección sanitaria y se tabuló en EPIINFO 2002 para su análisis con SPSS 11,5. Así se realizó un análisis descriptivo a 173 establecimientos y se encontró que existen condiciones diversas de sanidad respecto de la estructura física, los procesos productivos y el producto para la venta; también hay un incumplimiento de normas técnico-sanitarias, en diferentes sectores de la ciudad, que se priorizan para el control por parte de la autoridad sanitaria. Al 75% de los establecimientos no cumplen con las condiciones higiénico sanitarias en cárnicos; el 66,6% no cuenta con las condiciones en establecimiento de venta de pescados ý el 52,5% delos establecimientos de venta de aves y huevos, no cumplen con las condiciones higiénico sanitarias para tal fin.

  3. ÁCIDO ACÉTICO EN HUEVO DE TORTUGA (Lepidochelys olivacea

    Directory of Open Access Journals (Sweden)

    M\\u00F3nica Pereira-Zamora

    2010-01-01

    Full Text Available Este estudio se realizó en el Ce ntro Na cional de Cie ncia y Tecnología de Alimentos en el año 2000, con el fin de determinar la reducción de Vibrio mimicus en huevo de tortuga lora utilizando calor o ácido acético. Para ellos se determinó el tiempo de coagulación a diferentes temperaturas o niveles de pH con el fin de seleccionar los que podían utilizarse para la reducción del patógeno sin afectar las cualidades sensoriales del huevo crudo. Los huevos inoculados con Vibrio mimicus con cargas superiores a 6,0 log10UFC/g, fueron tratados con las diferentes alternativas de inmersión en agua caliente o soluciones de ácido acético por un tiempo determinado. Los tratamientos con calor (45, 55 ó 65ºC por 20 minutos lograron reducciones entre 1,4 y > 6,0 log10UFC/g, mientras que la inmersión en ácido acético (pH 3,0; 3,5; 4,0 ó 4;5 por una hora sólo logró reducciones entre 0,2 y 1,5 log10UFC/g causadas probablemente por la neutralización observada del pH en el tiempo.

  4. Embriodiagnosis y ovoscopia. Análisis y control de calidad de los huevos incubables

    OpenAIRE

    Sandra Lisette Ricaurte Galindo. M.V.Z.

    2005-01-01

    El examén de los huevos claros o con embriones muertos durante el período de incubación con la ayuda de un Ovoscopio, puede resultar una herramienta útil es para el encargado de sala de incubación. Indudablemente para el Medico Veterinario Zootecnista se deben controlar los numerosos parámetros en la incubadora, asegurando así las necesidades que requiere el proceso de incubación para obtener el éxito. Estos parámetros incluyen por ejemplo, la temperatura apropiada de almacenamiento de los hu...

  5. Productividad y calidad del huevo de gallinas con niveles crecientes de harina de semilla de calabaza (Cucurbita maxima

    Directory of Open Access Journals (Sweden)

    Yordan Martínez Aguilar

    2012-01-01

    Full Text Available Un total de 160 gallinas ponedoras White Leghorn (Híbrido L-33 en pleno pico de potura, se ubicaron durante 91 días según diseño completamente aleatorizado, para evaluar el comportamiento productivo y la calidad del huevo. Se utilizaron cuatro tratamientos 0, 33, 66 y 100 g/kg de harina de semilla de calabaza, sustituyendo totalmente el aceite vegetal y parcial la torta de soya. Se tuvieron 20 repeticiones por tratamiento. No se evidenció morbilidad y mortalidad en las gallinas ponedoras con la inclusión de la semilla en las dietas. Además no se detectaron diferencias significativas (P>0.05 entre tratamientos para la producción de huevos, viabilidad, consumo de energía metabolizable y nutrientes (excepto para fibra cruda y extracto etéreo, peso del huevo, altura de la clara densa, altura de la yema, grosor de la cáscara, huevos no aptos y calidad sensorial del huevo (sabor, olor y textura. Para los tratamientos con 66 y 100 g/kg de harina de semilla de calabaza se observó un aumento en el peso final de las gallinas en 61 y 66 g, respectivamente en comparación con el tratamiento testigo. Los resultados obtenidos permiten recomendar la inclusión de hasta 100 g/kg de harina de semilla de calabaza en las dietas de gallinas ponedoras, sin alterar el comportamiento productivo y la calidad del huevo.

  6. Metodo para montaje permanente de huevos de helmintos enteroparasitos Definitive preservation of helminthic eggs

    Directory of Open Access Journals (Sweden)

    Victor Muñoz

    1990-04-01

    Full Text Available Se comunican resultados obtenidos empleando Medio de Hoyer para el montaje de huevos de helmintos enteroparásitos, destinado a preparaciones para colecciones docentes y/o de investigación. La utilización de esta técnica en muestras fecales conteniendo huevos de A. lumbricoides, T. trichiura, Uncinaria sp., Taenia sp., Diphyllobothrium sp., H. nana, H. diminuta y F. hepática, permitió la correcta observación de ellos en lecturas iniciadas a las 24 horas y mantenidas hasta 180 días después.The results using the Hoyer method for examining eggs of helminths enteroparasites are presented. This method is particularly swited for teaching and on research purposes. Using this technique in fecal sample containing eggs of A.lumbricoides, T. trichiura, Uncinaria sp., Taenia sp., Diphyllobothrium sp., H. nana, H. diminuta and F. hepática allowed the correct identification of then after 24 hours up to 180 days after the samples were obtained.

  7. Uso de un aditivo a base de cantaxantina y extracto de achiote en dietas de gallinas de postura y su efecto sobre la coloración de la yema y la vida de anaquel del huevo

    Directory of Open Access Journals (Sweden)

    Víctor Rojas V.

    2015-01-01

    Full Text Available El objetivo del presente trabajo fue evaluar el uso de un aditivo a base de cantaxantina y extracto de achiote (Bixa orellana L. en dietas de gallinas de postura y su efecto sobre la coloración de la yema y la vida de anaquel del huevo. Se utilizaron 864 gallinas postura de 34 a 45 semanas de edad, distribuidas en un diseño completamente al azar con 6 repeticiones por tratamiento. Los tratamientos fueron T0 (dieta control, T1 (T0 + 30 g de cantaxantina y extracto de achiote y T2 (T0 + 60 g de cantaxantina y extracto de achiote. Los resultados obtenidos fueron de 88,6; 91,9 y 90,8 % para porcentaje de postura; 60,5; 61,6 y 61,5 g para peso de huevo; 53,6; 56,4 y 55,7 g para masa de huevo. La coloración de yema a temperatura de 7 °C para escala roche fue de 6, 9 y 12 por colorimétrico Minolta para “L” 42,10; 40,24 y 39,65; para “a” de 0,07; 3,68 y 6,44 y para “b” de 19,35; 18,36 y 18,18. La vida de anaquel a temperatura de 7 °C fue de 81, 86 y 90 UH. La peroxidación lipídica fue de 0,10; 0,07 y 0,05 μmol MDA.g-1 de yema; para T0, T1 y T2 respectivamente. En todas las variables indicadas se encontraron diferencias estadísticas significativas entre tratamientos (p < 0,05. El consumo de alimento fue de 103,9; 109,2 y 107,5 g y la conversión alimenticia de 1,94; 1,93 y 1,92. Se concluye que la adición de cantaxantina y extracto de achiote a 30 y 60 g t-1 de alimento respecto al testigo, mejoró los parámetros de rendimiento, coloración de yema y la vida de anaquel del huevo.

  8. RETENCIÓN DE HUEVOS EN HEMBRA DE JABOTÍ-PIRANGA (Geochelone carbonaria - Spix, 1824 EN CAUTIVERIO

    Directory of Open Access Journals (Sweden)

    Fabiana Rodrigues da Silbeira, M.V

    2009-12-01

    Full Text Available Un Jabotí-Piranga adulto (Geochelone carbonaria, hembra, con peso de 3.5 kg ingresó por consulta en la escuela clínica “Dr. Cataldi Luiz de Souza”, del “Centro Universitário Serra dos Órgãos - Teresopolis, Río de Janeiro”, con historia de retención de huevos. En la evaluación clínica y radiológica, se encontró tres huevos en posiciones normales. Teniendo en cuenta la temporada de reproducción, se aconsejó la observación del animal. Después de un año, dicho animal regresó a la clínica por no haber todavía expulsado los huevos. Tras nuevo examen radiográfico se observó que los 3 huevos continuaban en la misma posición. A continuación, se aplicó 0.03 ml de oxitocina por vía subcutanea (10 UI x ml, en el apéndice anterior del animal. Tres horas después de la aplicación de la hormona, el animal expulsó los huevos naturalmente, sin la necesidad de una intervención quirúrgica, con lo que se puede sospechar de la eficacia de la aplicación de oxitocina para este procedimiento en jabotí Piranga.

  9. CAUSAS DE MORTALIDAD EMBRIONARIA EN LA INCUBACION NATURAL Y ARTIFICIAL DE HUEVOS DE PATA CRIOLLA (Cairina moschata doméstica L.)

    OpenAIRE

    Ortiz Chavez, Hilario Hildebrando; Universidad Nacional Agraria La Molina (Perú).; Cumpa Gavidia, Marcial Estanislao

    2016-01-01

    como en incubación artificial de los huevos de pata Criolla. Para ello, se incubaron en total 900 huevos, de los cuales 778 fueron fértiles. Los resultados mostraron que el almacenamiento de los huevos en el nido hasta por tres semanas permitió una mayor viabilidad de los embriones, en comparación con el almacenamiento en sala para incubación artificial. Las causas principales de mortalidad embrionaria, tanto en incubación natural como en la artificial son consecuencia de la contaminación de ...

  10. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  11. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  12. Identificación de Lutzomyia spp. (Diptera: Psychodidae) grupo verrucarum por medio de microscopia electrónica de sus huevos

    OpenAIRE

    Sierra A, Diana; Vélez B, Iván Darío; Uribe S, Sandra

    2000-01-01

    En Colombia la microscopia electrónica de huevos de phlebotomineos para determinación de especies es nueva. Debido a la diversidad de especies e importancia médica del grupo verrucarum se estudiaron cuatro de estas especies: Lutzomyia youngi, Lutzomyia evansi, Lutzomyia columbiana y Lutzomyia longiflocosa. El modelo de superficie del huevo es poligonal. Lutzomyia youngi y Lutzomyia columbiana exhibieron un modelo pentagonal o hexagonal, Lutzomyia evansi polígonos elongados y Lutzomyia longifl...

  13. Evaluación del impacto de la intervención educativa-motivacional "Como Jugando" para prevenir la obesidad en escolares del Cercado de Lima: resultados al primer año

    Directory of Open Access Journals (Sweden)

    Juan Pablo Aparco

    Full Text Available RESUMEN Objetivo. Determinar el impacto, al primer año, de la intervención educativa-motivacional "Como Jugando" sobre el índice de masa corporal (IMC, conocimientos en alimentación, niveles de actividad física y patrones de consumo alimentario en escolares del 1.° al 4.° grado de primaria, de cuatro instituciones educativas (IE del Cercado de Lima. Materiales y métodos. Estudio cuasiexperimental, controlado. Se evaluó el IMC, conocimientos en nutrición, frecuencia de consumo de alimentos y nivel de actividad física. "Como Jugando" incluyó actividades lúdicas y vivenciales para escolares e involucró a docentes y padres. El impacto se estimó aplicando la prueba de McNemar para muestras relacionadas y modelos de regresión de diferencias en diferencias ajustados por variables relativas al escolar y la madre. Resultados. El estudio incluyó a 696 escolares de 2 IE de intervención y 2 IE de control, el puntaje Z de IMC y las prevalencias de obesidad no variaron durante el periodo de estudio. La intervención mostró impacto en mejorar los conocimientos en nutrición (OR: 1,46; IC95%: 1,17-1,81 redujo el riesgo de tener un nivel malo de actividad física (OR: 0,63; IC95%: 0,46-0,87 y mejoró los patrones de consumo de todos los alimentos, salvo verduras (grupo intervención. Conclusiones. La intervención "Como Jugando", al primer año de implementación, no redujo el Puntaje Z del IMC, sin embargo, tuvo impacto sobre los conocimientos en nutrición, redujo la probabilidad de tener un nivel malo de actividad física y mantuvo o aumentó la frecuencia adecuada del consumo de frutas, agua sin azúcar, jugos envasados y galletas dulces y saladas. Es necesario continuar evaluando la intervención "Como Jugando" para estimar el impacto sobre indicadores biológicos.

  14. Establecimiento de una línea celular primaria a partir de huevos con embrión de Toxocara canis Establishing a primary cell line from Toxocara canis embryonated eggs

    Directory of Open Access Journals (Sweden)

    Fernando Iván Marín

    2011-09-01

    Full Text Available Introducción. Toxocara canis es el segundo nematelminto más prevalente en perros a nivel regional y entre los tres más frecuentes en algunos países de la región. Debido a que la fuente de contaminación es el perro, éste se convierte en un nematodo con gran potencial zoonótico. Por esta razón, consideramos importante disponer de una línea celular de este helminto para el estudio de los aspectos básicos, así como para el desarrollo de técnicas diagnósticas. Objetivo. Obtener una línea celular primaria a partir de huevos con embrión de T. canis. Métodos. Los parásitos se extrajeron del intestino delgado de perros menores de un año. Las células embrionarias se obtuvieron mediante la embriogénesis de los huevos de los nematodos adultos, en cuatro diferentes medios; dos ricos en sustancias nutritivas, el tercero con formol al 1 % y el cuarto con agua destilada. Las células se obtuvieron mediante disociación mecánica de los huevos con embrión mediante la utilización de jeringas 30G. Resultados. El tiempo estimado de obtención de la línea celular fue de 15 días, en los que siete eran utilizados en la embriogénesis de los huevos. Las células respondieron positivamente a los métodos de crioconservación luego de dos días, e inclusive dos meses después, permitiendo fases de replicación de cuatro pases. Conclusiones. Se logró obtener una línea celular de T. canis a partir de huevos con embrión de este helminto. Esta línea celular ayudará al entendimiento de las relaciones patógenas, posibles blancos terapéuticos y para el desarrollo de métodos diagnósticos.Introduction: Toxocara canis is the second most prevalent nemathelminthes in dogs at regional level and among the three most frequent in some countries in the region. Due to the fact that the dog is the contamination source, it becomes a nematode with a high zoonotic potential, so we consider it important to be able to use the cell line of this helminth to study

  15. Efecto de la edad al primer parto y los días abiertos en un bovino doble propósito sobre la huella hídrica y de carbono

    Directory of Open Access Journals (Sweden)

    Raúl Andrés Molina Benavides

    2016-12-01

    Full Text Available La actividad ganadera contribuye con la emisión de gases de efecto invernadero (EGEI y el consumo de agua fresca (CA. Por ende, el objetivo de esta investigación fue estimar el efecto de la edad al primer parto (EPP y los días abiertos (DA en un bovino doble propósito en pastoreo, trópico bajo colombiano, sobre las EGEI y el CA. Esta estimación se logró integrando 4 metodologías existentes: Dinámica de Sistemas, Large Ruminal Nutrition System, Huella de carbono y Huella hídrica. Durante toda su vida, 91 meses, desde el nacimiento hasta el sacrificio, la vaca produjo 5.879 kg de leche -4 lactancias-, emitió 16.066 kg CO2eq y consumió 12.804.569 L de agua. Al disminuir la EPP en un mes, el CA y  las EGEI se redujeron en 123.156 l y 155 kg CO2eq, respectivamente. Cuando se  mermaron los DA en 21, las EGEI bajaron 647 kg CO2eq y el CA se redujo en 455.455 L. Parámetros reproductivos como la EPP y los DA tienen una fuerte influencia sobre la dinámica del animal en el hato,  afectando su productividad, emisiones de gases de efecto invernadero y consumo de agua. 

  16. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the

  17. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  18. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  19. Perfil cognitivo y prevalencia de depresión, desesperanza y riesgo suicida en jóvenes vinculados al primer nivel de formación en una escuela militar colombiana

    Directory of Open Access Journals (Sweden)

    Daniella Abello Luque

    2016-01-01

    Full Text Available Este estudio evaluó el perfil cognitivo y los niveles de desesperanza, depresión y riesgo suicida en un grupo de jóvenes vinculados al proceso de formación de una escuela militar colombiana. En total participaron 114 sujetos, militares regulares de primer año (MR-1A, que representan la totalidad de un contingente particular; todos ellos hombres, con edades entre los diecisiete y los veintidós años, provenientes de hogares ubicados en la región Caribe (41% y el centro del país (12%, sin ningún tipo de diagnóstico médico o mental relevante. Los resultados indican relaciones lineales y directamente promocionales entre todas las variables, con magnitudes significativas en lo referente a las relaciones depresión-desesperanza (rs= 0,295; ρ= 0,01 y depresión-riesgo suicida (rs= 0,478; ρ= 0,01, siendo esta ultima el reporte más elevado.

  20. Accidentes laborales asociados al desánimo de médicos SERUMS para laborar en el primer nivel de atención de Lima, Perú

    Science.gov (United States)

    Mejia, Christian R.; Valladares-Garrido, Mario J.; Romero, Brian M.; Valladares-Garrido, Danai; Linares-Reyes, Edgardo

    2018-01-01

    Introducción la retención laboral es un tema de suma importancia, porque se requiere de profesionales en el primer nivel de atención (PNA). El objetivo fue determinar si los accidentes laborales se asociaron al desánimo de los médicos para trabajar en el PNA de Lima, Perú. Métodos estudio transversal analítico de datos secundarios de una base de datos generada de una encuesta a médicos que realizaron su Servicio Rural y Urbano-Marginal en Salud (SERUMS). Se incluyó solo a los médicos que manifestaron al inicio del SERUMS que podían trabajar en el PNA de Lima. Se definió como cambio de intención de trabajo en el PNA a los que finalizando el SERUMS refirieron que ya no deseaban laborar en Lima. Esto se asoció según si tuvieron un accidente laboral y se ajustó por otras variables. Resultados de los 124 médicos el 63% fueron hombres (78). La mediana de edad fue de 26 años (rango intercuartílico: 25-27 años). Después de su SERUMS, el 12% (15) manifestó que cambió su interés y que deseaba trabajar en la capital. En el análisis multivariado, haber tenido un accidente laboral disminuyó la frecuencia del cambio de intención de trabajo en el PNA (RPa: 0.28, IC 95%: 0.14-0.54, p de trabajar en provincias, pero nuestro estudio dice lo contrario, posiblemente por la percepción de que un trabajo en la capital del país permite estar más cerca de los servicios para ser atendido en caso de cualquier emergencia. PMID:29190859

  1. Variables ambientales y abundancia de los huevos de Anchoa mitchilli (Pisces: Engraulidae en la laguna de Tamiahua, México

    Directory of Open Access Journals (Sweden)

    Carlos Díaz-Avalos

    2003-06-01

    Full Text Available Se estudió la abundancia de huevos de Anchoa mitchilli (Cuvier y Valenciennes 1848 en la laguna de Tamiahua, Ver. durante tres ciclos anuales (84-85, 85-86 y 86-87, para determinar zonas y épocas de alta concentración de huevos y su posible asociación con variables como temperatura, salinidad, transparencia y profundidad, así como con factores espacio-temporales como posición geográfica, época climática y el ciclo anual de recolecta. Para probar estadísticamente la asociación de la abundancia de huevos con dichos factores y variables se ajusto un Modelo Lineal Generalizado (MLG con error tipo Gamma. Los resultados del modelo ajustado sugieren que no todas las variables tienen un efecto significativo sobre la abundancia de huevos (t de Student, p >0.05. Las variables que resultaron estadísticamente significativas indican la presencia de un componente estacional y que la salinidad tiene un efecto condicional a la localidad. Las mayores abundancias promedio durante los tres ciclos de recolecta ocurrieron siempre durante el verano. Asimismo, debido a la presencia de interacciones significativas (t de Student, pEgg abundance of Anchoa mitchilli was studied in Laguna de Tamiahua, Veracruz during three annual cycles (84-85, 85-86 and 86-87. Our goal was to detect areas and seasons with high egg abundance and the possible association of such areas and seasons with covariates such as temperature, salinity, transparency, depth, location, season and year. The association was tested statistically using a Generalized Linear Model (GLM with Gamma type error. The results suggest that not all the covariates considered have a significant effect on egg abundance (Student’s T, p>0.005. The significant effects show the presence of a seasonal component and that the effect of salinity on egg abundance is conditional to location. High average egg abundances for the three annual cycles were observed during summer. The presence of significant interactions

  2. Efecto del aceite esencial de orégano sobre el desempeño productivo de ponedoras y la estabilidad oxidativa de huevos enriquecidos con ácidos grasos poliinsaturados

    Directory of Open Access Journals (Sweden)

    R. E. Ortiz

    2017-01-01

    Full Text Available Este estudio evaluó la inclusión de aceite esencial de orégano (AEO, Lippia origanoides Kunth en dietas enriquecidas con ácidos grasos poliinsaturados (AGPI sobre el desempeño productivo de ponedoras, el perfil lipídico y la estabilidad oxidativa de huevos en almacenamiento. Se distribuyeron 144 ponedoras en uno de cuatro tratamientos con seis replicas, con el objetivo de de evaluar el efecto del tipo de aceite usado en la dieta (palma o pescado y la inclusión de AEO sobre las variables de producción, junto con el extracto etéreo, perfil de lípidos y concentración de malonaldehído (MDA, usando un diseño completamente al azar con arreglo factorial y medidas repetidas en el tiempo por los días de almacenamiento (0, 30 y 60 días a 4°C. Los resultados mostraron que el tipo de aceite y el AEO no afectaron el desempeño productivo de las ponedoras (P > 0,05. La concentración de AGPI se incrementó en 16,8% en dietas con aceite de pescado en las que el DHA (ácido docosahexaenoico también aumentó en un 1,4% (P < 0,05, incrementando la concentración de MDA (malonaldehído en el huevo (41,6 ng MDA/g d yema, mientras que la suplementación de AEO con 100 g/ton mejoró la estabilidad oxidativa durante el almacenamiento (31.1 ng MDA/g de yema. Durante el almacenamiento la concentración de MDA en la yema incremento con el tiempo alcanzando los 38 ng MDA/g de yema a los 60 días. El AEO mostró potencial como antioxidante natural en la dieta de las ponedoras mejorando la estabilidad oxidativa de los huevos almacenados a 4°C hasta por 60 días.

  3. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  4. Comparación reproductiva de vacas holstein, bon y f1 bon x holstein en el centro paysandú, 2. Edad al primer parto, intervalo entre partos, días abiertos y servicios por concepción.

    Directory of Open Access Journals (Sweden)

    Quijano B Jorge H

    2003-06-01

    Full Text Available Se estimaron los porcentajes de heterosis para edad al primer parto, intervalo entre partos, días abiertos y servicios por concepción, en vacas F1 (BON x HOLSTEIN del Centro Paysandú, propiedad de la Universidad Nacional de Colombia, ubicado en la zona ecológica de bosque muy húmedo montano bajo (bmh-MB y situado a 2600 m.s.n.m. con una temperatura promedio de 12,5C, en el corregimiento de Santa Elena, Municipio de Medellín. El modelo usado incluyó los efectos de: Grupo Genético, año de parto, edad al parto sobre las variables edad al primer parto, intervalo entre partos, días abiertos y servicios por concepción. El efecto del grupo genético fue altamente significativo (P0,05, -7,9 (P0,05 para edad al primer parto, intervalo entre partos, días abiertos y servicios por concepción respectivamente.

  5. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  6. Relación entre colesterol dietario, consumo de huevo y perfil lipídico en adultos aparentemente sanos, según grupos de edad

    OpenAIRE

    Oriondo Gates, Rosa Lorenza; Bernui Leo, Ivonne; Valdivieso Izquierdo, Lázaro Rubén; Estrada Menacho, Enriqueta

    2013-01-01

    Objetivos: Evaluar la relación entre el colesterol dietario, consumo de huevo y el perfíl lipídico en adultos aparentemente sanos, según grupo etario. Diseño: Estudio descriptivo, de asociación cruzada. Institución: Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Perú. Participantes: Adultos aparentemente sanos. Intervenciones: En 50 adultos aparentemente sanos se determinó el consumo de colesterol dietario, huevo y perf...

  7. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  8. OBTENCIÓN DE ANTICUERPOS POLICLONALES IgY ANTIPARVOVIRUS CANINO A PARTIR DE YEMA DE HUEVO DE GALLINA

    Directory of Open Access Journals (Sweden)

    Pinto, J.

    2005-06-01

    Full Text Available Inmunizando un grupo de diez gallinas de postura raza Lohmann de 16 semanas de edad con parvovirus canino (CPV cepa vacunal, se obtuvieron anticuerpos IgY policlonales contra CPV en yema de huevo.En la extracción de los anticuerpos de la yema se requirieron dos pasos, el primero para la remoción de lípidos y el segundo para la precipitación de proteínas. Para la remoción de lípidos se usó el método PBS:Cloroformo y para la precipitación de los anticuerpos solubles (Inmunoglobulinas-IgY se usó el método de salting-out con sulfato de amonio ((NH42SO4. La evaluación del proceso se efectuó empleando el método comercial estándar “EGGstract IgY Purification System®” de PROMEGA.La metodología empleada permitió la obtención de anticuerpos IgY policlonales contra CPV a partir de yema de huevo de gallina en concentraciones altas por mililitro de yema, con una pureza aceptable y títulos altos; los resultados fueron comparables con el método comercial.

  9. Ultraestructura de los huevos de dos mariposas nocturnas de Chile: Ormiscodes socialis y Polythysana cinerascens (Lepidoptera: Saturniidae

    Directory of Open Access Journals (Sweden)

    Alfonso Benítez-Mora

    2006-12-01

    Full Text Available Se describe la estructura y ultraestructura de los huevos de las especies Ormiscodes socialis (Feisthamel y Polythysana cinerascens (Philippi, considerando la forma, tamaño, color, tipo de ovipostura, y aeropilas (cantidad, distribución y proporción en el área micropilar, entre otros. La ultraestructura es mostrada a través de las celdas primarias, celdas secundarias, aeropilas y micropilas; además se incluye a la especie ya descrita Adetomeris microphthalma (Philippi y se confecciona un cuadro comparativo para los huevos de estas especies. Se registra como nuevo hospedero de P. Cinerascens a Myoschilos oblonga Ruiz y Pavón (Santalaceae.Egg ultrastructure in two Chilean moths: Ormiscodes socialis y Polythysana cinerascens (Lepidoptera: Saturniidae. The structure and ultra-structure of the eggs from Ormiscodes socialis (Feisthamel and Polythysana cinerascens (Philippi are described, considering shape, size, coloring when recently laid, oviposition type nd aeropiles (quantity, distribution and proportion in the micropilar area, among others. The ultra-structure is shown for primary cells, secondary cells, aeropiles and icropiles. A comparative table of the eggs of these species is presented and includes the previously described eggs of Adetomeris microphthalma (Philippi. Myoschilos oblonga Ruiz y Pavón (Santalaceae is recorded as a new host for P. cinerascens. Rev. Biol. Trop. 54 (4: 1085-1091. Epub 2006 Dec. 15.

  10. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  11. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  12. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  13. Una nueva técnica para el estudio microscópico de los huevos de Anopheles Una nueva técnica para el estudio microscópico de los huevos de Anopheles

    Directory of Open Access Journals (Sweden)

    Osorno-Mesa Ernesto

    1947-12-01

    Full Text Available A new method is described for dissection and mounting of the exochorion of Anopheles eggs, for microscopic study, which has advantages over previous methods. The possible taxocomic importance of the morphology of the micropyle, clearly seen by this method, is noted. Se describe una técnica original para el estudio microscópico de los huevos de Anopheles, fundamentada en la disección del exocorion, indicando las grandes ventajas que tiene. Se anota la importancia taxonómica que pueda tener la morfología del micrópilo. / Abstract. A new method is described for dissection and mounting of the exochorion of Anopheles eggs, for microscopic study, which has advantages over previous methods. The possible taxocomic importance of the morphology of the micropyle, clearly seen by this method, is noted.

  14. La teoría APOE y su aplicación en la traducción de enunciados del lenguaje natural al lenguaje de la lógica de primer orden

    OpenAIRE

    Azcárate, Carmen; Manya, Felipe; Ramírez, José Luis

    2004-01-01

    Este trabajo es de carácter empírico-teórico y en él se describirán algunas de las dificultades observadas en estudiantes de Informática y Sistemas Computacionales, cuando intentan usar el lenguaje de la Lógica de primer orden (LPO) para representar enunciados del lenguaje natural (común), en un primer curso de Lógica. Las dificultades que se observaron, en la población de estudiantes a los que se les aplicó un cuestionario piloto, se relacionan con: enunciados cuantificados, sobre todo aquel...

  15. El huevo de la serpiente al sur del mundo: desarrollo y supervivencia de la ciencia nazi en Chile (1908 -1951

    Directory of Open Access Journals (Sweden)

    Leyton, César

    2014-12-01

    Full Text Available The paper presents, mainly through the figure of Dr. Max Westenhoffer and in a work of Drs. Barrientos and Schirmer (1937, the connections between the development of medicine and anthropology in Chile with the development of the biological determinist thought and racism in Europe. Chilean Physicians and anthropologists as Otto Aichel, Aureliano Oyarzún, Edgardo Schirmer and Juvenal Barrientos indicate the direct relationship of the Chilean scientific program of the early twentieth century with the hereditarian and racist program, which reached its climax with the Nazi eugenics.El trabajo aborda, principalmente a partir de la figura del Dr. Max Westenhoffer y de un trabajo de los Drs. Barrientos y Schirmer de 1937, las conexiones que presenta el desarrollo de la medicina y la antropología en Chile con el pensamiento determinista biológico y racista en Europa. Médicos y antropólogos chilenos como Otto Aichel, Aureliano Oyarzún, Edgardo Schirmer y Juvenal Barrientos dan cuenta de la relación directa de una parte del programa científico chileno de la primera mitad del siglo XX con el programa hereditarista y racista, que alcanzó su punto cúlmine con la eugenesia y la antropología nazi.

  16. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  17. Response of first attack of inflammatory bowel disease requiring hospital admission to steroid therapy Respuesta al tratamiento esteroideo del primer brote de enfermedad inflamatoria intestinal que requiere ingreso hospitalario

    Directory of Open Access Journals (Sweden)

    M. Abu-Suboh Abadía

    2004-08-01

    Full Text Available Introduction: corticoid administration is the usual treatment of Crohn' disease (CD and ulcerative colitis (UC attacks. How-ever, information available on response rates and their predictive factors is scarce. Objective: to establish response to steroidal treatment in an homogeneous group of patients with CD or UC during their first admission to hospital. Methods: restrospective analysis of 86 patients who received systemic steroidal treatment for a severe flare-up during their first hospital admission between 1995 and 2000. Patients were treated per protocol with fluid therapy, absolute diet, IV 6-methyl-prednisolone 1 mg/kg/day, and enoxaparin at prophylactic doses. Clinical response at 30 days was considered good in case of complete remission, and poor in case of partial or absent remission. Univariate and multivariate analyses according to non-parametric statistics were performed for sociodemographic and biologic variables. Results: 45 patients with CD and 41 with UC were included. Good response rates were 64.4% for CD and 60.9% for UC. The univariate analysis showed that patients with good response have shorter evolution times and fewer previous flare-ups (p Introducción: la administración de corticoides constituye el tratamiento habitual de los brotes de enfermedad de Crohn (EC y colitis ulcerosa (CU. Sin embargo, existe poca información sobre las tasas de respuesta y los factores que puedan predecirla. Objetivo: determinar la respuesta al tratamiento esteroideo en un grupo homogéneo de pacientes de EC y CU que ingresan por primera vez en el hospital. Métodos: análisis retrospectivo de 86 pacientes que en su primer ingreso hospitalario recibieron tratamiento esteroideo sistémico por brote grave de EC o CU entre 1995 y 2000. Fueron tratados de forma protocolizada con sueroterapia, dieta absoluta, 6-metil-prednisolona 1 mg/kg/día IV y enoxaparina a dosis profilácticas. Se ha considerado la respuesta clínica a los 30 días como

  18. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  19. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  20. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  1. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  2. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  3. APROXIMACIÓN AL CONCEPTO DE ESCALA EN EL PRIMER CICLO DE EDUCACIÓN PRIMARIA. PRESENTACIÓN DE UN JUEGO PARA SU TRATAMIENTO DESDE LA ENSEÑANZA ACTIVA

    Directory of Open Access Journals (Sweden)

    María Jesús Marrón Gaite

    2012-12-01

    Full Text Available Resumen:El objetivo esencial del presente artículo es presentar un juego didáctico que hemos diseñado para facilitar al alumnado del primer ciclo de Educación Primaria la comprensión del concepto básico de escala, con el objetivo de prepararle cognitivamente para la correcta interpretación, en cursos superiores, de este convencionalismo en planos y mapas. La investigación empírica que del mismo hemos realizado, experimentándolo en centros educativos de la ciudad de Madrid, ha puesto de manifiesto su alto grado de utilidad para la enseñanza-aprendizaje del tema. Su empleo en el aula ha supuesto el tratamiento del mismo desde la enseñanza activa, que concede un papel esencial a la metodología lúdica, y ha permitido la consecución de aprendizajes significativos por parte de los escolares a partir de sus ideas y representaciones conceptuales previas.Palabras clave:Convencionalismos cartográficos, escala, enseñanza activa, metodología lúdica, aprendizaje significativo.Abstract:The main objective of the present paper is to introduce a didactic play designed in order to help the students of early years of primary education the understanding of the concept of scale. The understanding of this concept prepare them to the correct interpretation, in further years, of this conventionalism in plans and maps. Empirical research we have conducted on the effectiveness of this material, testing in schools in the city of Madrid, has shown a high degree of usefulness for teaching and learning the subject. The use of this material in the classroom has been done from active teaching, giving a central role to the ludic methodology, and has allowed the achievement of meaningful learning by the students from their previous ideas and conceptual representations.Key words:Cartographic conventionalisms, scale, active teaching, ludic methodology, meaningful learning.Résumé:Le présent article a comme objectif principal, présenter un jéu didactique que

  4. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  5. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  6. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  8. Identificación de Lutzomyia spp. (Diptera: Psychodidae grupo verrucarum por medio de microscopia electrónica de sus huevos

    Directory of Open Access Journals (Sweden)

    Diana Sierra A

    2000-06-01

    Full Text Available En Colombia la microscopia electrónica de huevos de phlebotomineos para determinación de especies es nueva. Debido a la diversidad de especies e importancia médica del grupo verrucarum se estudiaron cuatro de estas especies: Lutzomyia youngi, Lutzomyia evansi, Lutzomyia columbiana y Lutzomyia longiflocosa. El modelo de superficie del huevo es poligonal. Lutzomyia youngi y Lutzomyia columbiana exhibieron un modelo pentagonal o hexagonal, Lutzomyia evansi polígonos elongados y Lutzomyia longiflocosa un modelo poligonal frecuentemente rectangular. La microscopia electrónica de huevos es confiable para identificar especies del grupo verrucarum.The value of Colombian phlebotomine eggs for species determination was studied with a scanning electron microscope. The species diversity and medical importance of the verrucarum group were the bases to select Lutzomyia youngi, Lutzomyia evansi, Lutzomyia columbiana and Lutzomyia longiflocosa. The egg surface was poligonal. Lutzomyia youngi, and Lutzomyia columbiana had pentagonal or hexagonal patterns; Lutzomyia evansi elongated polygons and Lutzomyia longiflocosa irregular polygonal sculpturing, frequently rectangular. Egg scanning electron microscopy is reliable to identify species of the verrucarum group.

  9. Estudio De La Satisfacción De Los Usuarios Para Evaluar Niveles De Calidad Del Servicio Al Cliente Interno Y Externo En El Instituto Ecuatoriano De Seguridad Social, Hospital IESS Babahoyo, Nivel II., Primer Semestre 2012.

    OpenAIRE

    Rumazo Zúñiga., Hilda Maritza; Vargas Angulo, Ligia Elizabeth

    2012-01-01

    La Seguridad Social como tal nace en Alemania como producto del proceso de industrialización, las fuertes luchas de los trabajadores, la presión de las iglesias, de algunos grupos políticos y sectores académicos de la época. Primeramente los trabajadores se organizaron en asociaciones de autoayuda solidaria, destacando las mutuales de socorro mutuo, las cooperativas de consumo y los sindicatos. Eran los tiempos en que Alemania era gobernada por el Káiser Guillermo II, como primer gran documen...

  10. Transmisión de Salmonella enterica a través de huevos de gallina y su importancia en salud pública Transmission of Salmonella enterica through chicken eggs and their importance in public health.

    Directory of Open Access Journals (Sweden)

    Diana Paola Rincón Acero

    2011-08-01

    Full Text Available La salmonelosis producida por especies de Salmonella sp. no tíficas, se manifiesta en humanos como una gastroenteritis o enterocolitis aguda de inicio repentino, cuyos síntomas aparecen de 6 a 48 horas después de la ingestión de alimentos o agua contaminada. Salmonella se transmite principalmente por el consumo de productos avícolas contaminados o por contaminación cruzada a través de manipuladores de alimentos o utensilios de cocina. La presente revisión se fundamenta en la interacción de Salmonella con el sistema reproductivo de la gallina y trata importantes aspectos como las formas de trasmisión al huevo, la epidemiología y prevención de este evento. Lo anterior con el fin de destacar la importancia de este patógeno en la generación de enfermedades trasmitidas por alimentos y el impacto que tiene el control de puntos críticos en la cadena de producción de los huevos y la vigilancia epidemiológica como mecanismos de control. Salud UIS 2011; 43 (2: 167-177Salmonellosis caused by non-typhoidal Salmonella species manifests in human like an acute gastroenteritis or enterocolitis that suddenly happens, whose symptoms occur between 6 to 48 hours after ingestion of contaminated food or water. Salmonella is mainly transmitted through consumption of contaminated poultry products, or crossed contamination by food handlers or kitchen utensils. This review is based on the interaction of Salmonella with the hen's reproductive system and presents important aspects such as the routes of transmission to the egg, epidemiology and prevention of this event. This in order to highlight the importance of this pathogen like source of foodborne diseases and the impact of the critical control points in the eggs production and epidemiological surveillance like control mechanisms. Salud UIS 2011; 43 (2: 167-177

  11. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  12. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  13. El secreto del huevo azul, de Catalina González Vilar. Estudio narratológico. The secret of the blue egg, by Catalina González Vilar. Narratological study

    Directory of Open Access Journals (Sweden)

    Miguel Sánchez-García

    2013-11-01

    Full Text Available This article discusses a narratological study of the literary work The secret of the blue egg, by the writer Catalina Gonzalez Vilar, that won El Barco de Vapor prize in 2012. It examines the different constitutive elements of the text (topic approach, prominent figures, syntactic structure, narrative technique… and his contribution to the development of the story with the purpose of discovering the aesthetic and literary values that contribute to the fable. It aims at demonstrating the proper use of them all as they shape a text rich in nuances, striking, suggestive. All these qualities of great importance both in creations aimed at adults as well as at children and young people because they enrich the final value of the work, and by extension, the cultural background of their readers.Este trabajo aborda el estudio narratológico de la obra El secreto del huevo azul, de la escritora Catalina González Vilar, que obtuvo el Premio El Barco de Vapor en el año 2012. Examina los diferentes elementos constitutivos del texto (el enfoque del tema, la caracterización de los personajes, la estructura sintáctica, el tratamiento del lenguaje, la técnica narrativa utilizada… y su aporte al desarrollo de la historia con la finalidad de descubrir los valores estéticos y literarios que aporta a la fábula. Pretende demostrar el adecuado uso de todos ellos dado que favorecen un texto rico en matices, llamativo, sugerente. Cualidades, todas ellas, de gran importancia tanto en creaciones destinadas al público adulto como al infantil y juvenil pues enriquece el valor final de la obra, y por extensión, el bagaje cultural de sus lectores.

  14. Intervención de los EOE especializados en atención temprana. Elaboración de una guía para profesionales que atienden al alumnado TEA en el primer ciclo de educación infantil

    OpenAIRE

    Rodríguez Somodevilla, Sonia

    2013-01-01

    Desde el curso escolar 2009-10 la Consejería de Educación de la Junta de Andalucía asumió las competencias educativas en el primer ciclo de Educación Infantil lo que llevó al EOEE en Atención Temprana de Málaga a plantearse la necesidad de elaborar una guía para proporcionar a todos los profesionales que atienden a los niños y niñas con Trastorno del Espectro Autista dentro de las Escuelas Infantiles, una información básica sobre qué es el Trastorno, la detección con las señales ...

  15. ENRIQUECIMIENTO DE HUEVOS CON ÁCIDOS GRASOS OMEGA-3 MEDIANTE LA SUPLEMENTACIÓN CON SEMILLA DE LINO (Linum usitatissimum EN LA DIETA

    Directory of Open Access Journals (Sweden)

    Gonzalo Díaz

    2009-04-01

    Full Text Available Objetivo. Enriquecer los huevos de gallina con ácidos grasos omega-3 (n-3 mediante la inclusión de semillas de lino en la dieta. Materiales y métodos. La dieta de las aves fue formulada con niveles de 0 (L0, 10 (L10, 15 (L15 y 20% (L20 de linaza. Se determinó la composición de ácidos grasos por cromatografía de gases y se evaluó la producción y calidad del huevo. Resultados. El porcentaje de producción de huevo fue superior en los grupos L0 y L15 (p<0.05 con 93,0 y 91,5% de producción comparada con 86,0 % en los grupos L10 y L20. La mejor conversión de alimento se presentó también en los grupos L0 y L15. Con la inclusión de semilla de lino, se incrementó el contenido de ácidos grasos n-3 desde 3,0 % en el grupo L0 hasta 12,6 % en el grupo L20, siendo los ácidos grasos n-3 á-linolénico (C18:3, n-3 y docosahexahenóico (DHA, C22:6, n-3 los hallados en mayor concentración. Con la inclusión de linaza en la dieta de las gallinas ponedoras se redujo el contenido de acido linoleico (C18:2n-6, lo cual resultó en una disminución en la relación n-6: n-3. Conclusiones. Con base en la evaluación económica se concluye que es posible enriquecer la yema de huevo de gallina hasta con un 10,1 % de ácidos grasos n-3 mediante la inclusión de un 15 % de linaza en la dieta de las gallinas, sin embargo, esto representó un sobrecosto de producción del 12%.

  16. Establecimiento de una metodología para la producción de semilla prebasica de papa criolla variedad "Yema de huevo" (Solanum phureja Juz et Buk a partir de minituberculos

    Directory of Open Access Journals (Sweden)

    Cotes Jose M.

    1999-12-01

    Full Text Available

    En la actualidad, para la producción de semilla de papa, se utiliza, como herramienta, la técnica de micropropagacion, la cual garantiza, mediante un adecuado proceso. alta sanidad de los tubérculos semilla y una rápida multiplicación. En la papa diploide Solanum phureja cultivar "yema de huevo", la multiplicación "in vitro" fue desarrollada exitosamente y, par lo tanto, el paso siguiente, la producción de minituberculos en casa de malla (Semilla prebasica requiere de los estudios necesarios para optimizar esta fase. El presente trabajo tuvo como objetivo conocer la densidad y el tamaño del minituberculo semilla óptimos para desarrollar la producción de semilla prebasica en condiciones de casa malla. La investigación se realizo bajo un diseño completamente a1 azar, con arreglo factorial (4x3, siendo el primer factor la distancia entre plantas y, el segundo, cl diámetro del minituberculo semilla. El experimento se realizo en casa de malla en la Estación San Jorge del ICA a 2800 msnm y repetido durante dos semestres consecutivos. Se encontró que la distancia de 6 cm entre sitios de siembra optimiza la producción de semilla prebasica y la distancia de 12 cm entre sitios de siembra, la tasa de multiplicaci6n. Los mejores diámetros de minituberculo son los comprendidos entre 0,5 y 2 cm

     

    Palabras claves:

  17. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

  18. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  19. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  20. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  1. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  2. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  3. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  4. Creencias de las profesoras de la Fundación Íntegramente. Un primer acercamiento al contexto sociocultural de la enseñanza de castellano a los inmigrantes de Santa Coloma de Gramenet

    Directory of Open Access Journals (Sweden)

    Hermes Diáz Ceniceros

    2010-06-01

    Full Text Available La constante llegada de inmigrantes a Cataluña provenientes de diferentes partes de África, Medio Oriente y Asia ha llevado a la creación de centros de acogida en los cuales se les ayuda a estos a integrarse socialmente. Uno de los centros en la mancha urbana de Barcelona es la Fundación Integramenet en Santa Coloma de Gramenet. En este apareció la necesidad de dar clases de castellano a los inmigrantes con el apoyo de profesores voluntarios. En este trabajo conoceremos los sistemas de creencias de los profesores con el objetivo de tener un primer acercamiento a las aulas de esta fundación. El método de investigación que utilizamos es el etnográfico y la herramienta con la cual recogimos los datos fue la entrevista semiabierta. Estas entrevistas las obtuvimos de cuatro informantes que llamamos Zafo, Helena, Sofía y Tere. Cada una de las entrevistas estuvo estructurada en torno a los temas de: cómo la profesión del profesor voluntario se relaciona con el sistema de creencias del profesor; cómo la previa experiencia de aprendizaje de una L2 sirve para preparar las clases; cómo se valora la multiculturalidad, y cómo los profesores se identifican con los problemas de los alumnos. En las entrevistas encontramos que los sistemas de creencias de los profesores se ven determinados en gran medida por la profesión. En cuanto a la experiencia de aprender una L2 encontramos que esta se aprovecha cuando las creencias profesionales lo permiten. De esta manera concluimos señalando la importancia de continuar nuestros estudios etnográficos sobre las creencias de los profesores y alumnos, con el propósito de poder en un futuro crear material de apoyo adecuado para esta clase de aulas.--------------------------------------------------------The continuous arrival of immigrants to Catalonia, coming from different parts of Africa, Middle East and Asia, has led to the creation of reception centres (welcome centres to help new arrivals integrate

  5. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  6. Aplicación de un sistema de demanda casi ideal (AIDS a cortes de carnes de bovino, porcino, pollo, huevo y tortilla en el periodo de 1995-2008

    Directory of Open Access Journals (Sweden)

    Jesús Ramírez Tinoco

    2011-01-01

    Full Text Available En este trabajo se estiman las elasticidades de la demanda Marshallianas y Hicksianas para diferentes productos como: cortes de carne de bovino (bistec y cortes especiales, porcino (bistec, pulpa y molida, pollo entero, huevo y tortilla. Para ello se estimó un Sistema de Demanda Casi Ideal (AIDS, con ecuaciones aparentemente no relacionadas (SUR, por sus siglas en ingles, aplicando el índice de precios Stone. De acuerdo con los resultados de las elasticidades precio propias Marshallianas y Hicksianas, 11 de 12 productos resultaron con elasticidad menores a uno, o sea inelásticos. En el caso de las elasticidades precio cruzadas, las combinaciones que resultan como sustitutos son, bistec de bovino con cortes especiales de bovino, porcino (bistec, pulpa y molida y pollo entero, la otra combinación es cortes especiales con porcino. La tortilla, se visualiza como complementaria con todos los cortes y con el huevo, las elasticidades gasto indican que los cárnicos y el huevo se establecen como bienes normales necesarios. El modelo AIDS es utilizado para pronosticar cambios en la demanda, por lo que, ante un aumento del 10 % en los precios de los productos en estudio, se pronostica una disminución de las cantidades demandadas de bistec (7.4 %, cortes especiales (7.7 % y pollo entero (4.7 %, los productos menos afectados son, porcino (bistec, trozo y molida y el huevo con 2 y 0.2 %, respectivamente.

  7. Geology of the epithermal Ag-Au Huevos Verdes vein system and San José district, Deseado massif, Patagonia, Argentina

    Science.gov (United States)

    Dietrich, Andreas; Gutierrez, Ronald; Nelson, Eric P.; Layer, Paul W.

    2012-03-01

    The San José district is located in the northwest part of the Deseado massif and hosts a number of epithermal Ag-Au quartz veins of intermediate sulfidation style, including the Huevos Verdes vein system. Veins are hosted by andesitic rocks of the Bajo Pobre Formation and locally by rhyodacitic pyroclastic rocks of the Chon Aike Formation. New 40Ar/39Ar constraints on the age of host rocks and mineralization define Late Jurassic ages of 151.3 ± 0.7 Ma to 144.7 ± 0.1 Ma for volcanic rocks of the Bajo Pobre Formation and of 147.6 ± 1.1 Ma for the Chon Aike Formation. Illite ages of the Huevos Verdes vein system of 140.8 ± 0.2 and 140.5 ± 0.3 Ma are 4 m.y. younger than the volcanic host rock unit. These age dates are among the youngest reported for Jurassic volcanism in the Deseado massif and correlate well with the regional context of magmatic and hydrothermal activity. The Huevos Verdes vein system has a strike length of 2,000 m, with several ore shoots along strike. The vein consists of a pre-ore stage and three main ore stages. Early barren quartz and chalcedony are followed by a mottled quartz stage of coarse saccharoidal quartz with irregular streaks and discontinuous bands of sulfide-rich material. The banded quartz-sulfide stage consists of sulfide-rich bands alternating with bands of quartz and bands of chlorite ± illite. Late-stage sulfide-rich veinlets are associated with kaolinite gangue. Ore minerals are argentite and electrum, together with pyrite, sphalerite, galena, chalcopyrite, minor bornite, covellite, and ruby silver. Wall rock alteration is characterized by narrow (propylitic alteration. Gangue minerals are dominantly massive quartz intergrown with minor to accessory adularia. Epidote, illite, illite/smectite, and, preferentially at deeper levels, Fe-chlorite gangue indicate near-neutral pH hydrothermal fluids at temperatures of >220°C. Kaolinite occurring with the late sulfide-rich veinlet stage indicates pH 315°, whereas strike

  8. Composición química del huevo de Tortuga Golfina Lepidochelys olivacea (Testudines: Cheloniidae y su potencial como recurso alimenticio

    Directory of Open Access Journals (Sweden)

    María Isabel Castro-González

    2011-12-01

    Full Text Available Por su potencial como fuente alimenticia, se analizó la composición química de huevo de Lepidochelys olivácea en La Escobilla, Oaxaca, México. El Instituto de Ciencias del Mar y Limnología de la Universidad Nacional Autónoma de México proporcionó 250 muestras de huevo liofilizado de 25 tortugas, que se analizaron siguiendo métodos oficiales para humedad, cenizas, proteína, grasa, lípidos totales(LT y análisis microbiológicos; además de ácidos grasos(AG por cromatografía de gases, aminoácidos(AA, vitaminas y colesterol(col por HPLC. Los resultados fueron los siguientes: (g/100g humedad(4.7, cenizas(3.8, proteína(53.7 y grasa(47.4. AA esenciales (g aa/100g Proteína: Ile (4.4, Lys(6.6, Leu(7.4, Met+Cys (8.8, Phe+Tyr (10.8; retinol (340μg/100g, colecalciferol (5.9 μg/100g, tocoferol (8.6, tiamina (0.3 y riboflavina (1.1 (mg/100g. Y los de (LT, (AG y (Col se concentraron en tres grupos por peso de tortuga: (LT (44.3-48.7-49.1g/100g, (Col (518.4-522.5-728.7 mg/100g. Entonces se identificaron 17 AGSaturados, 8 AGMonoinsaturados y 11 AGPoliinsaturados. Los AGS más abundantes (mg/100g: C16:0 (485-1263, AGM: C16:1 (456-716, C18:1n-9c (904- 1754 y AGP: C20:4n-6 (105-217, EPA (48-103 y HA (97-189. También, existió diferencia significativa (Fisher, p<0.05 para (Col, AG totales, AGS, AGM, AGP y AG n-3 (EPA+DHA. No se detectó presencia de agentes microbiológicos. El huevo liofilizado de L. olivacea es una opción para el desarrollo de productos alimenticios por su proteína de alto valor biológico y ácidos grasos n-3.

  9. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  10. Modificación del perfil en ácidos grasos, α-tocoferol y niveles de oxidación en huevos enriquecidos en ácidos grasos poliinsaturados Cû3 tras someterlos a diferentes procesados térmicos.

    OpenAIRE

    Cortinas Hernández, Lucía

    2001-01-01

    Premio a la Investigación 200J del Instituto de Estudios del Huevo. El huevo es un alimento equilibrado de alto valor nutritivo. España es el cuarto país productor de huevos en la Unión Europea, y el undécimo a nivel mundial, a pesar de la disminución de consumo que se ha producido en los últimos años. Uno de los motivos que ha contribuido a esta reducción, ha sido su contenido relativamente elevado de colesterol, nutriente relacionado con la aparición de determinadas patologías cardiovasc...

  11. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  12. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  13. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  14. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  15. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  16. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  17. Composición química del huevo de tortuga lora (Lepidochelys olivacea) y evaluación de su calidad física y microbiológica durante su almacenamiento

    OpenAIRE

    Mora Castro, Randall; Chaves Quirós, Ana Cecilia

    1997-01-01

    Se determinó la composición química de los huevos de tortuga lora (Lepidochelys olivacea) y se evaluó su calidad física y microbiológica durante el almacenamiento a 5 °C y 25 °C y a una humedad relativa de 92 %. Se encontró que los huevos de tortuga lora tienen una masa promedio de 27,9 g y están constituidos por un 58,0 % de yema, un 38,0 % de clara y un 4,0 % de cáscara. La cáscara contiene un 37,0 % de humedad, un 28,2 % de proteína y un 36,0 % de materia mineral. En la clara el compone...

  18. Efecto de la harina de cefalotórax de camarón sobre la pigmentación y contenido de colesterol en la yema del huevo

    OpenAIRE

    Chavarría Barrantes, Arlette; Herrera Ramírez, Carlos Hernán; Zumbado Alpízar, Mario Ernesto

    1996-01-01

    Se estudió la variación en la tasa de pigmentación y contenido de colesterol de la yema de los huevos de las gallinas ponedoras (ISA-Babcok B-300), de 42 semanas de edad; alimentadas por 5 semanas con raciones conteniendo 0 (control) y 10% de harina de cefalotórax de camarón (HCC). Se determinó el grado de pigmentación y el contenido de colesterol de la yema de los huevos, cada 3-4 días durante el período de estudio. Los resultados se analizaron estadísticamente (95% de confianza) para detect...

  19. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  20. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  1. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  2. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  3. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  4. La polilla Copitarsia decolora: revisión del complejo de especies con base en la morfología genital masculina y de los huevos (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Andrés O Angulo

    2010-06-01

    Full Text Available Copitarsia decolora es una especie polífaga ampliamente distribuida con un gran número de cambios nominales debido a su plasticidad fenotípica. Examinamos 14 machos de México, Colombia, Venezuela, Perú y Chile y revisamos la literatura producida entre 2003 y 2008. Realizamos un análisis del clasper (digitus de los órganos genitales masculinos del complejo de C. decolora mediante una disección estándar. Utilizamos fotografías de microscopio electrónico de barrido (SEM del corion de los huevos como carácter taxonómico. El género Copitarsia queda compuesto por 23 especies. C. corruda se considera un sinónimo de C. decolora (Guenée.The moth Copitarsia decolora: a review of the species complex based on egg and male genital morphology (Lepidoptera: Noctuidae. Copitarsia decolora is a widely distributed polyphagous species with a large number of nominal changes due to phenotypic plasticity. We reviewed 14 males from Mexico, Colombia, Venezuela, Peru and Chile and the literature produced between 2003 and 2008. An analysis of the clasper complex of C. decolora male genitalia was performed by standard dissection. Scanning electron microscope (SEM photographs of eggs structures were used as taxonomic characters. The genus Copitarsia comprises 23 species. C. corruda is considered a synonym of C. decolora. Rev. Biol. Trop. 58 (2: 769-776. Epub 2010 June 02.

  5. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  6. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  7. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  8. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  9. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  10. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  11. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  12. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  13. Afghan Peace Talks: A Primer

    Science.gov (United States)

    2011-01-01

    minimal blood- shed) on an early timetable • preventing Al  Qaeda and other terrorist franchises from using Afghanistan as a sanctuary • preserving...Jordan, and Malaysia . Turkey might also be an acceptable participant, despite its NATO membership and participation in ISAF. None of these coun- tries

  14. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  15. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  16. Determinación cuantitativa de vitamina C y pigmentos y procesamiento de la papa criolla, variedad yema de huevo (Solanum phureja Juz et Buck

    Directory of Open Access Journals (Sweden)

    Isabel Alvarez G.

    2009-07-01

    Full Text Available Empleando papa pardo'pastusa (Solanum tuberosum como control, se determinó el contenido de Vitamina C total en la papa criolla, variedad Yema de Huevo (Solanum phureja, Juz et Buck y se evaluaron las pérdidas durante la cocción y el freído. Se utilizaron los métodos colorimétrico y densitométrico: el primero dio resultados altos debido a sustancias interferentes; el segundo reportó los siguientes valores: criolla 21 mg/100 g, pardo-pastusa 18 mg/100 g (para muestra fresca. Las pérdidas de Vitamina C de papa criolla con piel fueron durante la cocción {92°C durante 25' de 1 9 % y en el freído (175°C por 3' de 30%. También se analizaron los carotenos y xantofilas dando: carotenos en papa criolla, 1.5 mg/100 g, en pardo-pastusa 0.5 mg/100 g (muestra fresca y xantofilas en papa criolla 0.6 mg/100 g, en pardo-pastusa 0.13 mg/100 g. Se procesó en las siguientes formas no tradicionales: en harinas compuestas aceptadas por ios consumidores, en una sustitución del 2 0% con puré; frita en tajadas con piel y pasabocas de puré. El tiempo de vida fue para frita tres semanas a 16°C V más de una semana a 25°C; para pasabocas cinco semanas y media a 16 C y un mes a 30°C.

  17. Hematopoiesis Primer Modeling Combined Injury

    Science.gov (United States)

    2012-05-01

    does impair the oxygen- carrying capacity of the blood (Puchala et al. 1999), and transfusion requirements of both platelets and red cells at Chernobyl ...El-Sonbaty M.A., M.A. El-Otiefy. Haematological change in severely burned patients. Annals of Burns and Fire Disasters 1996; IX(4). Accessed on line...immune system in severely burned patients. Ann Burns Fire Disasters 2009 Sep; 22(3):121-130. Flohé S., S. Lendemans, C. Selbach, C. Waydhas, M. Ackermann

  18. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  19. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  20. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  1. Irradiation of Poultry and Egg Products; Irradiation de la Volaille et des Ceufs et Derives; Obluchenie domashnej ptitsy, yaits i izdelij iz nikh; Irradiacion de Volateria, Huevos y Productos Derivados

    Energy Technology Data Exchange (ETDEWEB)

    Thornley, Margaret J. [Sub-Department of Chemical Microbiology, Department of Biochemistry, University of Cambridge, Cambridge (United Kingdom)

    1966-11-15

    , tout en retardant de 1,5 a 3 fois la corruption microbienne. La conservation sous refrigeration (5 Degree-Sign C ou au-dessous) est necessaire, et cette duree peut etre abregee par l'alteration du gout, de telle sorte que 20 jours a 1 Degree-Sign C est a peu pres le maximum que l'on puisse obtenir sans alteration de la qualite. Le mecanisme de ces changements reste inexplique, mais on sait qu'ils ne sont pas dus a des agents microbiens ni a l'irradiation. La corruption par les microbes de poulets irradies sous refrigeration est due a des bacteries non pathogenes normalement presentes dans la flore corruptrice; toutefois, les proportions des differentes sortes de bacteries peuvent varier, donnant ainsi differentes alterations de l'odeur. L'utilisation de ce procede dans les conditions existant au Royaume-Uni en matiere de production et de distribution des poulets a rotir a ete etudiee, et la Commission de l'energie atomique des Etats-Unis, l'Atomic Energy of Canada Ltd., et les laboratoires de l'United States Army Material Command (Natick) examinent conjointement le probleme. Ces etudes portent sur les besoins et les avantages economiques, l'innocuite, l'elaboration de nouveaux produits, le conditionnement et l'accueil du consommateur. (author) [Spanish] La volaterfa, los huevos y sus derivados pueden someterse eficazmente a diferentes procesos de irradiacion, segun las circunstancias. Cuando el problema consiste en la contaminacion por Salmonella, puede practicarse la ' radicidacion' con dosis del orden de 0,5 Mrad. Esto es particularmente util cuando se trata de productos congelados, tales como huevos enteros y algunas variedades de aves, en particular los patos. Los huevos desecados y sus derivados pueden tambien tratarse por este procedimiento. Otros autores (Ley, Mossel [2,3] ) describen detalladamente esta aplicacion. El tratamiento de aves sacrificadas para poder almacenarlas durante tiempo indefinido (' radappertizacion') puede efectuarse con dosis de 4,5 Mrad

  2. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  3. La atención hospitalaria al paciente con ictus en Cataluña: Resultados del «Primer Audit Clínic de l'Ictus. Catalunya, 2005/2006» In-hospital stroke care in Catalonia [Spain]: Results of the «First Clinical Audit of Stroke. Catalonia, 2005/2006»

    Directory of Open Access Journals (Sweden)

    Sònia Abilleira

    2008-12-01

    Full Text Available Objetivo: Analizar la calidad de la atención hospitalaria al paciente con ictus en los hospitales públicos catalanes antes de la difusión de la Guía de Práctica Clínica (GPC del ictus, estudiando el grado de adhesión a determinadas recomendaciones de la GPC. Métodos: Mediante revisión retrospectiva de historias clínicas de pacientes con ictus definidos mediante los códigos CIE-9 431, 433.x1, 434.x1, 436, e ingresados consecutivamente en 48 hospitales públicos catalanes en el primer semestre de 2005, se recogió información sobre distintos indicadores del proceso asistencial al ictus seleccionados según su evidencia científica o su importancia clínica. Los hospitales participantes reclutaron 20, 40 o 60 casos, según el número de ingresos/año. Se llevó a cabo una auditoría externa en el 9,3% de los casos reclutados en cada centro, tras selección aleatoria, para determinar la calidad de los datos recogidos. Los indicadores se agruparon en 6 perfiles relacionados con diferentes aspectos de la práctica clínica. Resultados: Se incluyeron 1.791 casos, un 53,9% hombres, con una media (desviación estándar de edad de 75,6 (12,4 años. La concordancia global entre observadores fue de 0,7. El cumplimiento de los perfiles asistenciales (porcentaje medio [intervalo de confianza del 95%] fue: calidad de la historia clínica, 78,5% (77,5-79,4; estándares de atención básica, 92,4% (91,5-93,2; evaluación neurológica, 38,3% (37,3-39,3; medidas iniciales del tratamiento rehabilitador, 44,9% (43,2-46,7; prevención y manejo de complicaciones, 68,4% (66,9-70, y medidas preventivas iniciales, 78,9% (77,3-80,4. Conclusiones: En 2005 la atención hospitalaria al ictus era mejorable, sobre todo los aspectos relacionados con la evaluación y el seguimiento neurológico del paciente y la rehabilitación.Objective: To determine the quality of in-hospital stroke care in public acute care hospitals in Catalonia before the implementation of a

  4. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  5. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  6. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  7. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  8. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  9. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  10. Caracterización de la composición en proteína, lípidos, energía y perfiles de ácidos grasos en huevos de tilapia roja (Oreochromis spp.

    Directory of Open Access Journals (Sweden)

    Rubén Darío Valbuena-Villarreal

    2013-06-01

    Full Text Available Luego de considerar el significado de las tilapias en el escenario piscícola nacional, la posibilidad de mejorar los índices de producción es un imperativo técnico y, dentro de estos, focalizar esfuerzos experimentales en la semilla resulta ser una opción estratégica. Con el fin de establecer un referente de base se utilizaron las puestas individuales de 50 hembras de tilapia roja (Oreochromis spp. para determinar los contenidos en los huevos de proteína (% MS, extracto etéreo (% MS, energía (cal g-1 y los perfiles de ácidos grasos (%, con algunas relaciones de interés analítico. Salvo ciertas variaciones menores, los valores encontrados se ajustan a los registros disponibles para la especie en diferentes estudios, lo que sugiere que las dietas ofrecidas a los reproductores experimentales contienen los mínimos necesarios para asegurar una provisión de nutrientes y energía suficientes para los embriones y las larvas en formación. Se analiza que, como punto de partida, esta serie de datos tiene utilidad para el desarrollo de trabajos destinados a mejorar los estándares de producción de alevinos, considerando que las variaciones en la composición, que pueden ser determinadas sobre los huevos, se pueden utilizar y tienen validez como un indicativo directo de su calidad.

  11. Christiaan Barnard: 40 años del primer transplante de corazón humano.

    OpenAIRE

    Jorge Reynolds; Juan Fernando Cediel; César Payán

    2009-01-01

    Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Chris...

  12. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  13. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  14. Composición química del huevo de Tortuga Golfina Lepidochelys olivacea (Testudines: Cheloniidae y su potencial como recurso alimenticio

    Directory of Open Access Journals (Sweden)

    María Isabel Castro-González

    2011-12-01

    Full Text Available Por su potencial como fuente alimenticia, se analizó la composición química de huevo de Lepidochelys olivácea en La Escobilla, Oaxaca, México. El Instituto de Ciencias del Mar y Limnología de la Universidad Nacional Autónoma de México proporcionó 250 muestras de huevo liofilizado de 25 tortugas, que se analizaron siguiendo métodos oficiales para humedad, cenizas, proteína, grasa, lípidos totales(LT y análisis microbiológicos; además de ácidos grasos(AG por cromatografía de gases, aminoácidos(AA, vitaminas y colesterol(col por HPLC. Los resultados fueron los siguientes: (g/100g humedad(4.7, cenizas(3.8, proteína(53.7 y grasa(47.4. AA esenciales (g aa/100g Proteína: Ile (4.4, Lys(6.6, Leu(7.4, Met+Cys (8.8, Phe+Tyr (10.8; retinol (340μg/100g, colecalciferol (5.9 μg/100g, tocoferol (8.6, tiamina (0.3 y riboflavina (1.1 (mg/100g. Y los de (LT, (AG y (Col se concentraron en tres grupos por peso de tortuga: (LT (44.3-48.7-49.1g/100g, (Col (518.4-522.5-728.7 mg/100g. Entonces se identificaron 17 AGSaturados, 8 AGMonoinsaturados y 11 AGPoliinsaturados. Los AGS más abundantes (mg/100g: C16:0 (485-1263, AGM: C16:1 (456-716, C18:1n-9c (904- 1754 y AGP: C20:4n-6 (105-217, EPA (48-103 y HA (97-189. También, existió diferencia significativa (Fisher, pChemical composition of eggs of the Olive Ridley Lepidochelys olivacea (Testudines: Cheloniidae and it’s potential as a food source. The Olive Ridley is a worldwide distributed species with high nesting production per season, and in La Escobilla Oaxaca, México, there is a 70% of non-hatched eggs that are lost. In order to evaluate their potential use as a source for human and animal food products, their chemical composition was analyzed. Lyophilized egg samples from 25 turtles were obtained and were analyzed following the analytical methods for fatty acids, protein, fat, ash, moisture, amino acids, vitamins, cholesterol and microbiological agents. The analytical composition obtained

  15. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  16. Non increased neuron-specific enolase concentration in cerebrospinal fluid during first febrile seizures and a year follow-up in pediatric patients No incrementos en la concentración de enolasa específica de neurona en el líquido cefalorraquídeo durante el primer ataque febril y al año en pacientes pediátricos

    Directory of Open Access Journals (Sweden)

    ALBERTO J. DORTA-CONTRERAS

    1998-09-01

    Full Text Available Febrile seizures are the commonest acute neurological disorder of early childhood. Studies suggested that febrile seizures are previous acute events from a more serious neurological problem. Due to neuron-specific enolase is generally accepted as a marker for neuropathological processes in the brain, 16 pediatric patients were studied during their first seizures and a year after it. Neuron-specific enolase in cerebrospinal fluid and blood were analysed by an immune enzyme assay. Non pathological neuron-specific enolase values were obtained in both periods in the group of patients. There were no significative differences when paired series statistics test was performed with 95% of confidence. Neuron-specific enolase appears not to be a marker for febrile seizures because its concentration not be increased in cerebrospinal fluid in this group of patients.Los ataques febriles constituyen el trastorno neurológico agudo más común en la infancia temprana. Existen estudios que sugieren que los ataques febriles son eventos agudos previos a problemas neurológicos más severos. Debido a que la enolasa específica de neurona está aceptada generalmente como marcador de procesos neuropatológicos en el cerebro, se estudiaran 16 pacientes pediátricos durante su primer ataque y al año de este. La enolasa específica de neurona en el líquido cefalorraquídeo y sangre fue analizada por una prueba inmunoenzimática. No se obtuvieron valores patológicos de enolasa específica de neurona en ambos períodos en el grupo de pacientes. No hubo diferencias significativas al aplicar el test de series apareadas con un 95% de confianza. La enolasa específica de neurona parece no ser un marcador para ataques febriles porque su concentración no se incrementa en este grupo de pacientes.

  17. Nutrición y desarrollo psicomotor durante el primer semestre de vida

    Directory of Open Access Journals (Sweden)

    CHÁVEZ ADOLFO

    1998-01-01

    Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.

  18. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  19. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  20. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  1. Acción de las poliaminas en la protección de papa criolla (Solanum phureja ev. "Yema de Huevo" contra las heladas Polyamine aetivity in proteeting 'ereole' potato (So/anum phureja ev. "Yema de Huevo" against frost damage

    Directory of Open Access Journals (Sweden)

    Romero Angulo Hernán Mauricio

    1996-06-01

    Full Text Available En 1992, se realizó un ensayo para determinar el efecto de las poliaminas (PA, putrescina (Put. espermidina (Spd y espermina (Spm en la reversión del daño causado por una helada (-1ºC por 3 hr en un cultivo de papa criolla (Solanum phureja Juz. et Buk. cv. "Yema de Huevo". Los tratamientos
    con las PA revirtieron efectivamente el daño en las plantas de papa criolla, lográndose, en todos los casos, una mayor producción en biomasa de tubérculos, en comparación con el testigo. El mejor tratamiento fue el de Spm 50 μM con el cual se logró mantener la producción normal con 9,85 ton/ha, contra apenas 5,42 ton/ha del testigo. Al parecer, el efecto de esta hormona se presentó por la inducción de la rebrotación de las yemas y en la protección del follaje.In 1992, an experiment was carried out to establish the action of the polyamines (PA putrescine (Put, spermidine (Spd and spermine (Spm in the reversion of frost damage (3 hr at -1ºC in Solanum phureja Juz. et Buk. ("papa criolla" cv. Yema de Huevo. PA treatments reverted damage and potato plants
    reached a higher yield of tuber biomass, compared with controls. The best treatment was Spm 50

  1. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  2. El impacto y la recepción del Concilio Ecuménico Vaticano II en Navarra. Una aproximación al primer posconcilio marcado por la figura del prelado Mons. Enrique Delgado Gómez (1965-1968

    Directory of Open Access Journals (Sweden)

    Edurne Yániz Berrio

    2015-03-01

    Full Text Available Los estudios sobre el Concilio Ecuménico Vaticano II están viviendo un nuevo impulso con la aparición de una línea de investigación que sitúa a las iglesias locales como sujeto y objeto vivo/activo del propio Concilio. Este artículo se inscribe en esta línea, centrando nuestra atención en el impacto y la recepción del Concilio en la diócesis de Pamplona-Tudela, y más concretamente durante el primer post-concilio (1965-1968 a través del comporta-miento de dos figuras claves en el proceso de recepción conciliar: la figura del prelado y la comunidad eclesial local.   Palabras clave: Iglesia local, postconcilio, prelado, comunidad eclesial local. _______________Abstract: Studies about Council Vatican II have recently boosted with the arrival of a new investigation line which reveals local churches as a living/active subject and object within the council itself. This is the place where this article should be placed. Indeed, it draws all attention to the impact and the way the council was em-braced in the Pamplona-Tudela diocese, especially during the first post council period (1965-1968, through the figure of the prelate and the local church community.    Keywords: Local church, post council period, prelate, local church community. 

  3. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  4. Effects of continuous drought and immersion on hatchability of Ochlerotatus albifasciatus (Diptera: Culicidae eggs stored at low temperature Efecto de la sequía continua y la inmersión sobre la respuesta de eclosión de los huevos de Ochlerotatus albifasciatus (Diptera: Culicidae almacenados a baja temperatura

    Directory of Open Access Journals (Sweden)

    Raúl E Campos

    2007-07-01

    Full Text Available The role of environmental factors on the hatching response of O. albifasciatus (Macquart eggs is studied by simulating winter conditions in the laboratory. The hypothesis tested was that hatching response is affected by: (1 time that eggs remain at low temperature, (2 storage conditions, and (3 acclimatization time. Eggs were stored at 5ºC in drought and immersion conditions during 7, 21, 35, 90 and 146 days, immediately after, they were acclimatized at 22ºC during 24, 72, and 168 hours, and then eggs were flooded to induce hatching. Percent of hatched eggs was analyzed with a Generalized Lineal Model with a binomial distribution. Results show that: (1 a long storage period at cold temperature and long acclimatization periods improve the hatching response; (2 storage conditions have a moderate effect on hatching, being more evident in eggs stored dry; (3 a long time of acclimatization favors the hatching response in submerged eggs more than in eggs stored dry; (4 long time at cold favors the hatching response in eggs stored dry more than in submerged eggs; (5 the hatching response of eggs that remain for a long time at low temperature is higher when the time of acclimatization is long.Se estudió el rol de los factores ambientales sobre la eclosión de los huevos de O. albifasciatus (Macquart, simulando condiciones de invierno. La hipótesis planteada fue que la respuesta de eclosión de los huevos depende de: (1 tiempo de permanencia a baja temperatura, (2 condiciones de almacenamiento, y (3 tiempo de aclimatación. Los huevos fueron almacenados a 5º C en condiciones de sequía y sumergidos durante 7, 21, 35, 90 y 146 días; luego fueron aclimatados a 22º C durante 24, 72, y 168 horas y posteriormente inundados para inducir la eclosión. El porcentaje de huevos eclosionados se analizó con un Modelo Lineal Generalizado con distribución binomial. Los resultados mostraron que: (1 largos períodos de almacenamiento en frío y largos tiempos

  5. Estabilidad oxidativa de huevos enriquecidos con ácidos grasos poliinsaturados omega 3, frente a antioxidantes naturales Estabilidade oxidativa de ovos enriquecidos com ácidos graxos poliinsaturados ômega 3, frente a antioxidantes naturais

    Directory of Open Access Journals (Sweden)

    María Elena Bernal Gómez

    2003-12-01

    Full Text Available Fueron alimentadas 192 gallinas ponedoras de 22 semanas de edad, de linaje comercial Babcock, durante 30 días con dietas de 0 (cero y 12,7% de semilla de linaza molida que corresponde a 0 y 5% de aceite de linaza, respectivamente. Fueron definidos 8 tratamientos: 4 grupos con 12,7% de semilla de linaza (control/sin antioxidante; BHA+BHT, 100+100 ppm; orégano, 200 ppm; romero, 200 ppm y 4 grupos sin semilla de linaza, pero utilizando los mismos antioxidantes. Este estudio fue realizado con el objetivo de verificar la eficacia del uso de antioxidantes naturales provenientes del orégano y del romero en la protección contra el deterioro oxidativo de la fracción lipídica de las yemas de los huevos enriquecidos con ácidos grasos poliinsaturados omega 3 (PUFA É-3. El grado de oxidación lipídica fue determinado a través de la prueba TBARS (substancias reactivas con ácido tiobarbitúrico. Según los resultados obtenidos, fue verificada diferencia significativa en la reducción del grado de oxidación lipídica de las yemas de huevo en todos los tratamientos con antioxidantes, cuando se compara con el control. Por lo tanto, los extratos de los condimentos, romero y orégano, pueden ser utilizados satisfactoriamente para obtener huevos enriquecidos con PUFA É-3, mejorando la estabilidad lipídica.Foram alimentadas 192 galinhas poedeiras de 22 semanas de idade da linhagem comercial Babcock, durante 30 dias com dietas constituídas de 0 (zero e 12,7% de semente de linhaça moída correspondente a 0 e 5% de óleo de linhaça, respectivamente. Foram definidos 8 tratamentos: 4 grupos com 5% de óleo de linhaça (controle/sem antioxidante; BHA+BHT, 100+100 ppm; orégano, 200 ppm; alecrim, 200 ppm e 4 grupos sem óleo de linhaça, mas utilizando os mesmos antioxidantes. Este estudo foi realizado com o objetivo de verificar a eficácia do uso de antioxidantes naturais provenientes do orégano e do alecrim, na proteção contra a deteriora

  6. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  7. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  8. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  9. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  10. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  11. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  12. Diferentes niveles de energía metabolizable y aminoácidos azufrados en dietas para gallinas Bovans blancas

    Directory of Open Access Journals (Sweden)

    María de los Ángeles Tepox Pérez

    2012-01-01

    Full Text Available Con el objeto de evaluar el comportamiento productivo de la gallina Bovans blanca de primer ciclo alimentadas con dietas con niveles diferentes de energía metabolizable (EM y de metionina+cistina digestible (AAD, para lograr disminuir el porcentaje de huevo pequeño (<42 g, al inicio de la producción se utilizaron 384 gallinas de 19 semanas de edad. Se usó un diseño completamente al azar, en un arreglo factorial de 4 X 2, donde el primer factor fueron los niveles de EM (2700, 2800, 2900, 3000 Kcal/kg y el segundo factor fue la inclusión de diferentes porcentajes de AAD (0.45, 0.61. Cada tratamiento, contó con cuatro repeticiones de 12 gallinas cada uno. Durante ocho semanas se llevaron registros semanales, del porcentaje de postura, peso promedio del huevo, consumo de alimento; masa de huevo/ave/día y conversión alimenticia; además, se clasificó el huevo de acuerdo al peso. Los resultados obtenidos, no mostraron respuesta a los factores de estudio ni a la interacción entre nivel de EM y AAD, para ninguna de las variables productivas. Se encontró un efecto sobre el consumo de alimento del nivel de energía y aminoácidos azufrados (P<0.05. Se disminuyó el porcentaje de huevo pequeño en los niveles más altos de EM de 2900 y 3000 Kcal/Kg (29.6 y 30.4 % respectivamente. Se incrementó (P<0.05 el porcentaje de huevo grande en 3 % al usar dietas con el nivel de AAD de 0.61 %.

  13. Effectiveness of different adhesive primers on the bond strength between an indirect composite resin and a base metal alloy.

    Science.gov (United States)

    Sarafianou, Aspasia; Seimenis, Ioannis; Papadopoulos, Triantafillos

    2008-05-01

    There is a need for achieving reliable chemical bond strength between veneering composites resins and casting alloys through the use of simplified procedures. The purpose of this study was to examine the shear bond strength of an indirect composite resin to a Ni-Cr alloy, using 4 primers and 2 airborne-particle-abrasion procedures. Fifty-six Ni-Cr (Heraenium NA) discs, 10 mm in diameter and 1.5 mm in height, were fabricated. Twenty-four discs were airborne-particle abraded with 50-microm Al2O3 particles, while another 24 were airborne-particle abraded with 250-microm Al2O3 particles. The following primers were applied on 6 discs of each airborne-particle-abrasion treatment group: Solidex Metal Photo Primer (MPP50, MPP250), Metal Primer II (MPII50, MPII250), SR Link (SRL50, SRL250), and Tender Bond (TB50, TB250). The Rocatec system was used on another 6 discs, airborne-particle abraded according to the manufacturer's recommendations, which served as the control group (R). Two more discs were airborne-particle abraded with 50-microm and 250-microm Al2O3 particles, respectively, to determine the Al content on their surfaces, without any bonding procedure. The indirect composite resin used was Sinfony. Specimens were thermally cycled (5 degrees C and 55 degrees C, 30-second dwell time, 5000 cycles) and tested in shear mode in a universal testing machine. The failure mode was determined with an optical microscope, and selected specimens were subjected to energy dispersive spectroscopy (EDS). Mean bond strength values were analyzed using 2-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05) and compared to the control group using 1-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05). The groups abraded with 50-microm particles exhibited significantly higher bond strength compared to the groups abraded with 250-microm particles. Group MPII50 exhibited the highest mean value (17.4 +/-2 MPa). Groups MPP50, MPP250, and TB50, TB250 showed

  14. Aportes para una vida saludable. Proceso socioeducativo con estudiantes de primer ingreso, Universidad Nacional

    OpenAIRE

    Gonzalez-Soto, L.; Orozco-Morales, A.R.

    2017-01-01

    Propósito: Exponer la experiencia de medir en algún grado el impacto social de un proceso socioeducativo anual, desarrollado con 800 estudiantes de primer ingreso provenientes de diversos lugares del país, con limitadas condiciones socioeconómica y quienes son beneficiarios de beca para sus estudios. El proceso consistió en establecer 4 o 5 eventos anuales y trabajar con metodologías lúdicas temas alusivos a estilos de vida saludables. Material y método: Se aplicó la técnica de grupo focal al...

  15. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  16. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  17. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  18. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  19. Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive.

    Science.gov (United States)

    Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won

    2018-02-01

    The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.

  20. La gallina de los huevos de oro de nuevo está en peligro. Imágenes, posibilidades y viabilidades de la inteligencia colectiva

    Directory of Open Access Journals (Sweden)

    Jaime Alejandro Rodríguez Ruiz

    2007-01-01

    Full Text Available Dos proyectos wiki de ficción colaborativa, uno que fracasa y otro que se desarrolla con éxito, sirven como pretexto en este artículo para desplegar una reflexión sobre los nuevos modos de pensamiento y de vínculo social, favorecidos hoy por las nuevas tecnologías de la información y la comunicación: el proyecto de la inteligencia colectiva. Cuatro autores fundamentan esta reflexión: Pierre Lévy, Derrick de Kerckhove, Howard Rheingold y David Casacuberta. Después de mostrar las posibilidades del ejercicio de la inteligencia colectiva, el artículo concluye al afirmar que el espacio del conocimiento se constituye, irreversiblemente, en un nuevo espacio antropológico: el de la inteligencia colectiva, al que todos estamos llamados a construir.

  1. ALS Association

    Science.gov (United States)

    ... toward a world without ALS! Walk to Defeat ALS® Walk to Defeat ALS® draws people of all ... We need your help. I Will Advocate National ALS Registry The National ALS Registry is a congressionally ...

  2. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  3. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  4. Familial ALS

    Science.gov (United States)

    Boylan, Kevin

    2015-01-01

    Synopsis Genes linked to ALS susceptibility are being identified at an increasing rate owing to advances in molecular genetic technology. Genetic mechanisms in ALS pathogenesis appear to exert major effects in ~10% of patients, but genetic factors at some level may be important components of disease risk in most ALS patients. Identification of gene variants associated with ALS has informed concepts of the pathogenesis of ALS, aided the identification of therapeutic targets, facilitated research to develop new ALS biomarkers, and supported the establishment of clinical diagnostic tests for ALS-linked genes. Translation of this knowledge to ALS therapy development is ongoing. PMID:26515623

  5. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  6. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  7. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  8. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  9. Características técnico-sanitarias de expendios de carnes, pescados, aves y huevos de la ciudad de Tunja 2003

    OpenAIRE

    Fred Gustavo Manrique-Abril; Diego Alexander Manrique-Abril; Pablo Fernandez; Elena Patricia Castro-Montaña

    2011-01-01

    Se presenta una caracterización epidemiológica de los expendios de carnes, pescado y aves de Tunja en el año 2003, resultado del diagnóstico sanitario del municipio y las visitas adelantadas por la unidad de saneamiento. Al partir del compromiso que el sector salud tiene en el componente de ambiente, surge la necesidad de crear un sistema de vigilancia epidemiológica ambiental, cuya metodología y estrategia esté orientada hacia el conocimiento de los factores de riesgo ambientales a que están...

  10. Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular

    Directory of Open Access Journals (Sweden)

    Lucero López-Díaz

    2016-01-01

    Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.

  11. Un primer retablo de Alberto de Churriguera

    Directory of Open Access Journals (Sweden)

    Rupérez Almajano, Mª Nieves

    2003-03-01

    Full Text Available Es conocida en lo esencial la actividad desarrollada por Alberto de Churriguera en Salamanca durante su etapa de madurez, como maestro de la Catedral y de la Plaza Mayor y al frente de las obras de los Colegios de Cuenca, de San Bartolomé o del Rey entre otros, así como diversos trabajos en Valladolid, Madrid, Orgaz y otros lugares. Sin embargo, son muy escasas las noticias que tenemos de obras o encargos al comienzo de su carrera profesional, lo que proporciona interés a cualquier dato que pueda ofrecer más luz sobre su dedicación en esos primeros años. Como se sabe Alberto de Churriguera había nacido en Madrid el 7 de agosto de 1676. A la muerte de sus padres quedó al cuidado de su hermano José, que se ocupó de formarlo y transmitirle su misma profesión «con toda eficacia». Se supone que en 1692 acompañó a su hermano a Salamanca para ejecutar el retablo de San Esteban...

  12. Antonio Roalas. Un pintor del primer tercio del siglo XVII en Madrid

    Directory of Open Access Journals (Sweden)

    Rodríguez Rebollo, Ángel

    2004-03-01

    Full Text Available El conocimiento que actualmente se tiene sobre los pintores del barroco madrileño ha avanzado mucho desde que Ángulo y Pérez Sánchez publicaran los dos volúmenes dedicados al primer y segundo tercio del siglo XVII. Posteriormente han ido viendo la luz estudios más pormenorizados, a veces en forma de exposiciones, que han clarificado aún más la importancia de los artistas que trabajaron en torno a la Corte de los llamados «los Austrias menores»; sin embargo, existen aún hoy un buen número de pintores sólo conocidos a través de contratos o inventarios de la época. La absoluta desinformación que tenemos de ellos, acrecentada por la inexistencia de obras firmadas, no permite a los historiadores dedicarles al menos un estudio parcial de su arte…

  13. Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

    Directory of Open Access Journals (Sweden)

    Julio J. Masquijo

    2014-10-01

    Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

  14. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  15. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  16. El juego y la matemática. Juegos de matemáticas para el alumnado del primer ciclo de E. Primaria.

    OpenAIRE

    Sánchez Esteban, Nerea

    2013-01-01

    Este trabajo tiene como finalidad desarrollar una metodología que ayude a mejorar la adquisición de los conceptos que se estudian en el primer ciclo de Educación Primaria en el área de matemáticas, añadiendo una motivación al alumnado para que cuando se tenga que enfrentar a esta materia tenga una actitud positiva. Para conseguir esto he seleccionado una serie de juegos matemáticos enfocados a aprender de una manera diferente los contenidos que se tiene que trabajar en el citado primer ciclo....

  17. PENGOLAHAN PRIMER LIMBAH TEKSTIL DENGAN ELEKTROKOAGULASI

    Directory of Open Access Journals (Sweden)

    Lieke Riadi

    2014-12-01

    Full Text Available Limbah industri tekstil di area pinggir kota Surabaya mempunyai karakteristik perbandingan COD dan BOD = 5.57. Limbah jenis ini sulit untuk dibiodegradasi. Studi ini mempelajari tekonologi elektrokoagulasi untuk mengolah limbah tekstil dengan menurunkan intensitas warna, Total Suspended Solid (TSS dan Chemical Oxygen Demand (COD. Percobaan batch pada suhu kamar dilakukan untuk mempelajari pengaruh pH, jarak elektroda terhadap penurunan warna,TSS dan COD dan membandingkan biaya operasinya jika menggunakan pengolahan kimia.Effisiensi penurunan tertinggi untuk warna (91.96%,  TSS (49.17%, dan COD (29.67% terjadi pada pH awal 4.0 dan jarak elektroda 2 cm dengan  elektroda Al/Al. Waktu optimum penurunan intensitas warna dalah 10 menit. Laju penurunan COD adalah : -dC/dt = 0.0053 C +0.056 , dengan C adalah konsentrasi COD. Jumlah sludge yang dihasilkan daripengolahan elektrokoagulasi  3.4 % lebih kecil dibandingkan menggunakan bahan kimia. Biaya yang digunakan untuk pengolahan dengan elektrokoagulasi 52.35 % lebih murah dibandingkan jika menggunakan koagulasi dengan bahan kimia ( tawas. Kata kunci : elektrokoagulasi, penurunan warna, penurunan TSS, laju degradasi COD, imbah tekstil Abstract Waste water from textile industry which is located in one suburb of Surabaya city as characteristic which the ratio of COD to BOD was 5.57. This type of waste water is difficult to be biodegraded. This study investigated elektrokoagulasi technology to treat textile waste water by removing color, total suspended solid, and Chemical Oxygen Demand. Batch experiment at room temperature was carried out to study the effect of pH, electrode distance for color, TSS and COD removal. This study also tried to compare the operation cost between elektrokoagulasi and chemical processes. The best removal efficiencies by Al electrodes was 91.96 % for color, 49.17 % for TSS and 29.67 % for COD which were under initial pH 4.0 and electrodes distance 2 cm. The optimum operation

  18. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  19. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

    Directory of Open Access Journals (Sweden)

    Harold Castañeda-Peña

    2010-01-01

    Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.

  20. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  1. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  2. Primer reporte de miasis hospitalaria por Lucilia cuprina (Diptera: Calliphoridae en Costa Rica

    Directory of Open Access Journals (Sweden)

    Lucía Quesada-Lobo

    2012-12-01

    Full Text Available Introducción. Las miasis hospitalarias son entidades con una importancia manifiesta en salud pública. La documentación de este tipo de casos es escasa en la literatura biomédica regional y mundial. Objetivo. Informar un caso de miasis hospitalaria en Costa Rica, donde el agente etiológico implicado fue Lucilia cuprina (Diptera: Calliphoridae. Este caso de miasis hospitalaria figura como el primer informe para Latinoamérica asociado con este agente etiológico. Presentación del caso. Una paciente de 91 años de edad, con signos de inmunosupresión, afectación grave de la función pulmonar y asistencia respiratoria mecánica, presentó larvas en ambas fosas nasales al séptimo día después del ingreso hospitalario. Varios ejemplares fueron recolectados y procesados para su identificación. La identificación taxonómica de los ejemplares recolectados estableció que la especie de los muscomorfos correspondía a L. cuprina. Conclusión. El presente constituye el primer caso de miasis hospitalaria por L. cuprina en la literatura biomédica de Costa Rica y el primero registrado en Latinoamérica.   doi: http://dx.doi.org/10.7705/biomedica.v32i4.690

  3. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  4. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  5. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  6. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  7. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  8. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  9. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  10. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  11. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  12. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  13. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  14. Desarrollo de un sistema de regeneración en Papa criolla (Solanum phureja Juz et Buck var. Yema de huevo clon 1

    Directory of Open Access Journals (Sweden)

    Diazgranados Cristina

    2007-06-01

    Full Text Available

    En el presente estudio se obtuvo un 46% de regeneración en explantes sin cocultivo de Solanum phureja (Juzet et Buck variedad Yema de huevo clon 1 con la utilización del medio CIP-MS suplementado con reguladores de crecimiento (2 mg· L-1 ZR, 0,02 mg· L-1 ANA, 0,02 mg· L-1 AG3. A fin de mejorar los porcentajes de regeneración se modificó la proporción citoquininas:auxinas del CIP-MS obteniéndose un 55% de formación de callo con concentraciones de 2 mg· L -1 ZR y 0,04 mg· L-1 ANA. Posteriormente se evaluó el efecto de tres concentraciones de ácido giberélico (0,02 mg· L-1 , 0,05 mg· L-1 y 0,1 mg· L-1 obteniéndose un 87,6% de callogénesis y un 48,6% de regeneración mediante la utilización de un medio que contenía 2 mg· L-1 ZR, 0,04 mg· L-1 ANA, 0,02 mg· L-1 AG3 en explantes bajo condiciones de cocultivo. Estos resultados fueron corroborados en un segundo ensayo de regeneración bajo condiciones de cocultivo con Agrobacterium tumefaciens cepa LBA4404 transformada mediante el vector binario pNOV022, de lo cual se obtuvieron porcentajes de callogénesis y regeneración muy similares. Previamente se reportó un promedio de 4 ± 3,3 regenerantes por callo utilizando entrenudos de S. phureja mientras en este estudio se obtuvieron 15,2 ± 3 regenerantes por callo.

  15. Al clamor de les vuvuzeles

    Directory of Open Access Journals (Sweden)

    Javier Olivera Betrán

    2010-09-01

    Full Text Available El Mundial de Futbol de Sud-àfrica ha situat l’Àfrica al mapa mundial i ha mostrat al món el triomf de l’estil de futbol d’Espanya basat en la col·lectivitat, l’esperit d’equip, la humilitat, la cohesió interna i el joc bonic. L’organització africana, seriosa i eficaç, ha sabut mobilitzar i il·lusionar la població del país que ha participat en el mundial des de l’orgull de ser africà, amb l’esperit alegre, festiu i també reivindicatiu de la gent de l’Àfrica. Aquest esdeveniment suposa el llançament de la marca “Sud-àfrica” al món amb un avís clar d’optar a l’organització d’uns primers Jocs Olímpics a Àfrica (potser els de 2020. S’obre una finestra d’esperança al segle xxi per al continent perdut de la mà de l’esport espectacle tan universal, massiu, emocional i mercantil que també es juga a la canxa de la política i de l’economia.

  16. Eduardo Krapf (1901-1963: Primer Presidente de la Sociedad Interamericana de Psicología

    Directory of Open Access Journals (Sweden)

    Hugo Klappenbach

    2004-01-01

    Full Text Available El trabajo, de carácter historiográfico, examina la trayectoria de Eduardo Krapf, quien se recibió de médico en Alemania y posteriormente revalidó su titulo en la Argentina. Se analiza su inserción en la Asociación Psicoanalítica Argentina y sus trabajos sobre psiquiatría y psicología al promediar el siglo XX. En particular, se analizan los intereses que condujeron a Eduardo Krapf a vincularse con la psicología y en particular con la Sociedad Interamericana de Psicología, de la que fue Primer Presidente en 1951. Metodológicamente, se han obtenido los datos principalmente de fuentes primarias, particularmente textos y documentos de archivo existentes en la Facultad de Ciencias Médicas de la Universidad de Buenos Aires

  17. Review of The Atheist’s Primer and Atheism for Beginners

    Directory of Open Access Journals (Sweden)

    Andrew J Bissette

    2014-05-01

    Full Text Available The New Atheists are occasionally accused of lacking nuance and sophistication, or of existing in an intellectual vacuum. To some it may seem that Dawkins 'et al'. are naïve logical positivists; this perspective may be reinforced by recent authors’ explicit rejection of the value of philosophy and other non-scientific approaches to knowledge (cf. Lawrence Krauss, Stephen Hawking. Into the fray steps Michael Palmer, offering his attempt to popularise a version of atheism that is underpinned by a long tradition of philosophical inquiry. 'The Atheist’s Primer', a condensed version of Palmer’s previous work, is aptly named: it is a crash course on the history and major arguments of atheism from a firmly philosophical angle. Its companion text, 'Atheism For Beginners', is a coursebook aimed at tutors seeking to teach this material.

  18. Bolívar, primer diplomático de la libertad americana

    Directory of Open Access Journals (Sweden)

    Rafael Gómez Hoyos

    1969-03-01

    Full Text Available Don Miguel Luis Amunátegui, primer biógrafo de don Andrés Bello, recopilador y comentarista meritorio de sus obras, nos dejó una falsa visión de Bolívar como diplomático de la libertad. Basado en los recuerdos del anciano humanista, cuando ya le flaqueaba la memoria, o gracias a un error suyo de apreciación, al comentar los incidentes de la misión encomendada ante el gobierno británico por la Junta Suprema de Caracas, nos relata increíble falta de tacto y descuido imperdonable en Simón Bolívar, Jefe de la Misión.

  19. Ti, Al

    Indian Academy of Sciences (India)

    In the present study, authors report on the effect that substrate bias voltage has on the microstructure and mechanical properties of (Ti, Al)N hard coatings deposited with cathodic arc evaporation (CAE) technique. The coatings were deposited from a Ti0.5Al0.5 powder metallurgical target in a reactive nitrogen atmosphere at ...

  20. INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN

    Directory of Open Access Journals (Sweden)

    Orzuza, Gloria Beatriz

    2013-01-01

    Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.

  1. Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

    Science.gov (United States)

    Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

    2017-08-01

    The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  3. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  4. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  5. Primer registro de infestación en un reptil por larvas de Amblyomma parvitarsum (Acari: Ixodidae en Argentina

    Directory of Open Access Journals (Sweden)

    Gabriel Natalio Castillo

    2015-05-01

    Full Text Available Amblyomma parvitarsum es una garrapata endémica del Altiplano Andino de Argentina, Bolivia, Chile y Perú. En la provincia de San Juan adultos de esta garrapata fueron encontrados en el Parque Nacional San Guillermo sobre Vicugna vicugna. En Argentina también existen citas de adultos de A. parvitarsum sobre bovinos, ovinos y el ñandú . El primer caso de parasitismo de larvas de A. parvitarsum en Liolaemus fue realizado en Chile. El presente trabajo menciona por primera vez para Argentina la presencia de larvas de A. parvitarsum parasitando al lagarto Liolaemus eleodori.

  6. Pràctica 9. El desenvolupament psicomotor del xiquet (primer cicle d'Educació Infantil)

    OpenAIRE

    Gomis Selva, Nieves; Sánchez Colodrero, Vicente; Delgado Domenech, Beatriz

    2013-01-01

    El començament del desenvolupament del xiquet està dominat essencialment per la motricitat. En els primers mesos d’edat del nadó, els moviments són veritables manifestacions del seu desenvolupament psicològic. Aquesta motricitat es desenvoluparà amb més precisió i seguretat si creem un ambient segur i de llibertat per als xiquets, on el rol de l’adult és d’acompanyament no invasiu i testimoni dels seus èxits. Els treballs d’investigació de l’Institut Lóczy i de la doctora Emmi Pikler ens indi...

  7. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  8. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  9. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  10. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  11. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  12. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  13. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  14. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  15. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  16. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  17. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  18. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  19. Reporte del primer caso de enfermedad de Chagas transplacentaria analizado por AP-PCR en Moniquirá, Boyacá

    Directory of Open Access Journals (Sweden)

    Concepción Judith Puerta

    2009-12-01

    Conclusiones. Éste es el primer caso de enfermedad de Chagas transplacentaria reportado en el municipio de Moniquirá, que demuestra que esta forma de transmisión ocurre en el país. La presencia de infección mixta por ambos grupos de T. cruzi en las muestras del recién nacido, sugiere infección mixta en la madre, con mayor prevalencia de T. cruzi I, al menos en el hemocultivo.

  20. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  1. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  2. Eficacia experimental de anticuerpos IgY producidos en huevos, contra el veneno de la serpiente peruana Bothrops atrox Experimental efficacy of IgY antibodies produced in eggs against the venom of the Peruvian snake Bothrops atrox

    Directory of Open Access Journals (Sweden)

    Julio C. Mendoza

    2012-03-01

    Full Text Available Objetivos. Desarrollar un protocolo de inmunización para producir inmunoglobulinas IgY de origen aviar contra el veneno de la serpiente peruana Bothrops atrox y evaluar la capacidad neutralizante. Materiales y métodos. Se inmunizaron seis gallinas de postura de la raza hy line brown con 500 μg/dosis de veneno de B. atrox en un periodo de dos meses. Cada semana, los huevos fueron colectados para el aislamiento de inmunoglobulinas IgY a partir de la yema, usando dos pasos consecutivos con αcido caprνlico y sulfato de amonio. La detecciσn de anticuerpos se realizσ por inmunodifusiσn doble mientras que el tνtulo y reactividad cruzada se determinaron por las técnicas de ELISA y Western blot. El cálculo de DL50 y de la DE50 del antiveneno IgY producido se realizó utilizando el método de Probits. Resultados. La masa de anticuerpos aislados fue de 8,5 ± 1,35 mg de IgY/mL de yema. Asimismo, la DE50 del antiveneno aviar fue calculada en 575 μL de antiveneno/mg de veneno. Adicionalmente, los ensayos de reactividad cruzada mostraron que el veneno de B. atrox comparte mas epνtopes comunes con el veneno de B. brazili (47% que con otros veneno del mismo género, en tanto que los venenos de Lachesis muta (19% y Crotalus durissus (12% mostraron una baja reactividad cruzada. Conclusiones. Se ha obtenido IgY purificada contra el veneno de B. atrox con capacidad neutralizante y se ha demostrado su utilidad como herramienta inmunoanalítica para evaluar la reactividad cruzada con venenos de otras especies.Objectives. To develop an immunization protocol in order to produce avian IgY immunoglobulins against Bothrops atrox Peruvian snake venom and to evaluate its neutralizing capacity. Materials and methods. Six Hy Line Brown hens were immunized each two weeks using 500μg/doses of B. atrox venom in a period of two months. Each week, eggs were collected for IgY isolation from yolk using two consecutive steps with caprilic acid and ammonium sulfate

  3. Effect of saliva contamination and artificial aging on different primer/cement systems bonded to zirconia.

    Science.gov (United States)

    Pitta, João; Branco, Teresa C; Portugal, Jaime

    2018-05-01

    Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermocycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (Pcontamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (Pcontamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by

  4. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  5. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  6. Eficacia del primer tratamiento sistémico con glucocorticoides en la enfermedad inflamatoria intestinal. Revisión sistemática y serie de casos

    OpenAIRE

    López San Román, Antonio

    2009-01-01

    Los glucocorticoides son un fármaco de eficacia alta en pacientes con enfermedad inflamatoria intestinal, consiguiendo inducir respuesta en aproximadamente un 70% de los pacientes, respuesta que perdura a largo plazo en casi la mitad de los casos. La mayor edad al diagnóstico y al inicio del primer tratamiento son los principales factores predoctores de mala respuesta a los glucocorticoides. Una política de inmunosupresión precoz de los pacientes que no se hubieran beneficiado a largo plazo d...

  7. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  8. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  9. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  10. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  11. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  12. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  13. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  14. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  15. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  16. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  17. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  18. Factores asociados al bajo peso al nacer

    Directory of Open Access Journals (Sweden)

    Georgina J Peraza Roque

    2001-10-01

    Full Text Available El bajo peso al nacer (BPN ha constituido un enigma en la ciencia a través de los tiempos. Múltiples son las investigaciones realizadas acerca de las causas que lo producen y las consecuencias que provoca. Su importancia no solo radica en lo que significa en la morbilidad y la mortalidad infantil, sino que estos niños tienen habitualmente múltiples problemas posteriores. El Programa para la Reducción del BPN señala que los niños nacidos con un peso inferior a los 2 500 g presentan riesgo de mortalidad 14 veces mayor durante el primer año de vida, en comparación con los niños que nacen con un peso normal a término. Dentro de los factores de riesgo del BPN se han encontrado con mayor frecuencia en estudios realizados por diferentes autores, los siguientes: el embarazo en la adolescencia, la desnutrición en la madre, el hábito de fumar, la hipertensión arterial durante el embarazo, la sepsis cervicovaginal, la anemia y los embarazos gemelares, entre otros. Es innegable la influencia que el BPN tiene sobre las futuras generaciones, por lo que debe constituir la diana de los esfuerzos que el médico y la enfermera deben desarrollar en su prevención, sobre todo en la comunidadLow birth weight has been an enigma for Science through times. A lot of research works have been carried out about its causes and consequences. The importance of LBW not only lies in its meaning for infant mortality and morbidity but also in the many problems that low birth weight children regularly face in the future. The program for the reduction of LBW points out that newborns weighing under 2500g have during his/her first year of life a mortality risk 14 times higher than newborns with a normal weight at term. Among the low birth weight risk factors, a number of studies by various authors have frequently found the following; pregnancy at adolescence; undernourishment in mothers, smoking, blood hypertension during pregnancy, cervix-vaginal sepsis; anemia, twin

  19. Effect of Surface Treatment on Shear Bond Strength between Resin Cement and Ce-TZP/Al2O3

    Directory of Open Access Journals (Sweden)

    Jong-Eun Kim

    2016-01-01

    Full Text Available Purpose. Although several studies evaluating the mechanical properties of Ce-TZP/Al2O3 have been published, to date, no study has been published investigating the bonding protocol between Ce-TZP/Al2O3 and resin cement. The aim of this study was to evaluate the shear bond strength to air-abraded Ce-TZP/Al2O3 when primers and two different cement types were used. Materials and Methods. Two types of zirconia (Y-TZP and Ce-TZP/Al2O3 specimens were further divided into four subgroups according to primer application and the cement used. Shear bond strength was measured after water storage for 3 days or 5,000 times thermocycling for artificial aging. Results. The Y-TZP block showed significantly higher shear bond strength than the Ce-TZP/Al2O3 block generally. Primer application promoted high bond strength and less effect on bond strength reduction after thermocycling, regardless of the type of cement, zirconia block, or aging time. Conclusions. Depending on the type of the primer or resin cement used after air-abrasion, different wettability of the zirconia surface can be observed. Application of primer affected the values of shear bond strength after the thermocycling procedure. In the case of using the same bonding protocol, Y-TZP could obtain significantly higher bond strength compared with Ce-TZP/Al2O3.

  20. Personalidad y tolerancia al dolor

    Directory of Open Access Journals (Sweden)

    JESÚS M.ª CARRILLO

    2005-01-01

    Full Text Available Se examina la relación de algunas variables de personalidad -EPQ-A (Eysenck y Eysenck, 1975, NEO-PI (McCrae y Costa, 1988 y STA -personalidad esquizotípica- y STB -personalidad límite-, de Claridge y Broks (1984, con la tolerancia al dolor experimental inducido mediante agua fría (cold pressor test, según el procedimiento de Staats, Heckmat y Staats (1998 en una muestra filtrada mediante un cuestionario sobre dolor crónico, dolores de cabeza, de espalda, artritis, síndrome de Raynaud, y personas bajo medicación. La tolerancia al dolor experimental se evaluó mediante el Umbral del dolor (tiempo en segundos desde la introducción de la mano en el agua hasta el primer informe de dolor, Mantenimiento del dolor (duración en segundos de la inmersión de la mano desde la aparición del umbral hasta su retirada y Tolerancia al dolor (duración total en segundos de la inmersión de la mano desde su introducción hasta su retirada. Un análisis correlacional, factorial y de regresión por pasos mostraron un efecto cruzado entre medidas de ansiedad (tolerancia negativa al dolor y psicoticismo, siendo psicoticismo junto con control emocional predictores de tolerancia positiva al dolor. En cuanto a psicoticismo, parece que son sus elementos de naturaleza paranoide y de "dureza" los que afectan a una percepción atenuada del dolor.

  1. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  2. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  3. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  4. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  5. AL Amyloidosis

    Directory of Open Access Journals (Sweden)

    Desport Estelle

    2012-08-01

    Full Text Available Abstract Definition of the disease AL amyloidosis results from extra-cellular deposition of fibril-forming monoclonal immunoglobulin (Ig light chains (LC (most commonly of lambda isotype usually secreted by a small plasma cell clone. Most patients have evidence of isolated monoclonal gammopathy or smoldering myeloma, and the occurrence of AL amyloidosis in patients with symptomatic multiple myeloma or other B-cell lymphoproliferative disorders is unusual. The key event in the development of AL amyloidosis is the change in the secondary or tertiary structure of an abnormal monoclonal LC, which results in instable conformation. This conformational change is responsible for abnormal folding of the LC, rich in β leaves, which assemble into monomers that stack together to form amyloid fibrils. Epidemiology AL amyloidosis is the most common type of systemic amyloidois in developed countries with an estimated incidence of 9 cases/million inhabitant/year. The average age of diagnosed patients is 65 years and less than 10% of patients are under 50. Clinical description The clinical presentation is protean, because of the wide number of tissues or organs that may be affected. The most common presenting symptoms are asthenia and dyspnoea, which are poorly specific and may account for delayed diagnosis. Renal manifestations are the most frequent, affecting two thirds of patients at presentation. They are characterized by heavy proteinuria, with nephrotic syndrome and impaired renal function in half of the patients. Heart involvement, which is present at diagnosis in more than 50% of patients, leading to restrictive cardiopathy, is the most serious complication and engages prognosis. Diagnostic methods The diagnosis relies on pathological examination of an involved site showing Congo red-positive amyloid deposits, with typical apple-green birefringence under polarized light, that stain positive with an anti-LC antibody by immunohistochemistry and

  6. Modelos de aplicación de ecuaciones diferenciales de primer orden con geogebra: actividades para resolver problemas de mezclas

    Directory of Open Access Journals (Sweden)

    Cesar Augusto Hernández-Suarez

    2016-09-01

    Full Text Available El objetivo del estudio es diseñar una actividad para abordar los problemas de mezclas en un curso de ecuaciones diferenciales que permita realizar cambios de representación en los registros gráfico, algebraico y lengua natural mediante la ayuda de software libre Geogebra, esperando así reducir la dificultad que presentan los estudiantes al momento de plantear la ecuación diferencial que modela un problema de mezclas. La actividad se fundamenta en dos marcos, el didáctico y el matemático, los cuales fueron elaborados con los aportes de distintas fuentes consultadas acerca del objeto de investigación. La selección de los participantes fue realizada mediante muestreo intencional y durante el desarrollo de este proceso se eligieron dieciocho (18 estudiantes de un programa académico de Ingeniería Civil de un curso de ecuaciones diferenciales. Se aplicó una encuesta a los estudiantes sobre los modelos de aplicación de ecuaciones diferenciales de primer orden para determinar el modelo a utilizar; los modelos con mayor porcentaje de elección fueron: Mezclas y ley de enfriamiento de Newton, razón por la cual se eligió el modelo de mezclas para el diseño de una actividad tipo test con 3 problemas que para ser resueltos con el Geogebra. Se analizan las respuestas dadas por los estudiantes al resolver una serie de problemas de aplicación de primer orden con el software libre Geogebra. Estos problemas permiten realizar traspasos del registro lenguaje natural al algebraico mediante representaciones ejecutables y preguntas que pretenden orientar al estudiante durante el desarrollo de la misma, con el fin de proporcionar herramientas para plantear la ecuación diferencial que se ajusta a los problemas planteados. Como resultados se obtiene una propuesta del uso del Geogebra como un recurso didáctico para favorecer la resolución de problemas de aplicación de ecuaciones diferenciales de primer orden (problemas de mezclas. Se puede concluir

  7. Estrategia de motivación para estudiantes de primer año de Medicina, Universidad San Sebastián, Concepción, Chile

    Directory of Open Access Journals (Sweden)

    P. Jorquera-Aguayo

    Full Text Available Introducción. En el marco de un nuevo modelo educativo formativo, la Universidad San Sebastián apunta al desarrollo de estrategias pedagógicas que sitúan al estudiante en el centro de las acciones. Es así como surge la necesidad de incrementar la motivación en los jóvenes que ingresan a la carrera de medicina, profesión desde siempre ligada a los valores sociales y el altruismo. Este trabajo explora la relevancia del contacto temprano con el paciente y el hospital como fuentes de motivación en primer año. Sujetos y métodos. Todos los estudiantes de primer año de medicina (n = 115 fueron invitados a visitar voluntariamente un hospital. Allí, los estudiantes recorrieron el establecimiento y sostuvieron una conversación libre con un paciente. Las opiniones se recogieron a través de un escrito libre. Resultados. Se inscribieron 95 estudiantes, de los cuales 68 concurrieron a la visita. Al consultar sobre la vivencia con el paciente, los estudiantes se refirieron positivamente a ésta. La ansiedad al inicio de la conversación fue uno de los aspectos más mencionados, al igual que la importancia de conocer el futuro lugar de trabajo. Conclusiones. La experiencia evidenció un alto interés en participar. Asimismo reveló elementos de la vida afectiva de los estudiantes, pilar fundamental de la educación médica. Finalmente, se aconseja la temprana relación con el paciente y con el hospital como agentes motivacionales en primer año. Se sugiere incorporar tareas y complementar la evaluación con herramientas que permitan obtener información objetiva sobre los aprendizajes adquiridos.

  8. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  9. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  10. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  11. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  12. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  14. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  15. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  16. ¿Qué textos leen en primer año los estudiantes de Psicología?

    Directory of Open Access Journals (Sweden)

    María Micaela Villalonga Penna

    2016-11-01

    Full Text Available Resumen Qué se lee en las universidades es una de las temáticas que han abordado los estudios realizados desde los enfoques de las Alfabetizaciones Académicas y de la Literacidad crítica. En este sentido, nos preguntamos ¿qué textos leen en primer año los estudiantes de psicología? Teniendo en cuenta este interrogante, en este trabajo presentamos el análisis del material bibliográfico del primer año de la carrera de psicología de una universidad estatal. Esta investigación se realizó desde los enfoques cualitativo y cuantitativo de investigación. Analizamos un corpus de 320 textos que corresponden al material bibliográfico de las nueve materias del primer año de la mencionada carrera. Empleamos las categorías de análisis propuestas por Carlino (2005, Padilla (2013 y Padilla, Douglas y López (2007; 2011, entre otras, y tuvimos en cuenta categorías emergentes también. Los hallazgos dieron a conocer el uso de ´cuadernillos´, que incluyen fotocopias del material bibliográfico que pueden o no contar con elementos que ayuden a contextuarlo como copias de la tapa y contratapa, página con datos de edición, índice y referencias completas. El material bibliográfico está constituido por textos académicos derivados de textos científicos, entre los que priman los capítulos de libros y las fichas de cátedra. Además, estos textos son predominantemente expositivos o argumentativos.

  17. ¿Qué textos leen en primer año los estudiantes de Psicología?

    Directory of Open Access Journals (Sweden)

    María Micaela Villalonga Penna

    Full Text Available Resumen Qué se lee en las universidades es una de las temáticas que han abordado los estudios realizados desde los enfoques de las Alfabetizaciones Académicas y de la Literacidad crítica. En este sentido, nos preguntamos ¿qué textos leen en primer año los estudiantes de psicología? Teniendo en cuenta este interrogante, en este trabajo presentamos el análisis del material bibliográfico del primer año de la carrera de psicología de una universidad estatal. Esta investigación se realizó desde los enfoques cualitativo y cuantitativo de investigación. Analizamos un corpus de 320 textos que corresponden al material bibliográfico de las nueve materias del primer año de la mencionada carrera. Empleamos las categorías de análisis propuestas por Carlino (2005, Padilla (2013 y Padilla, Douglas y López (2007; 2011, entre otras, y tuvimos en cuenta categorías emergentes también. Los hallazgos dieron a conocer el uso de ´cuadernillos´, que incluyen fotocopias del material bibliográfico que pueden o no contar con elementos que ayuden a contextuarlo como copias de la tapa y contratapa, página con datos de edición, índice y referencias completas. El material bibliográfico está constituido por textos académicos derivados de textos científicos, entre los que priman los capítulos de libros y las fichas de cátedra. Además, estos textos son predominantemente expositivos o argumentativos.

  18. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  19. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  20. Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

    OpenAIRE

    Bedmar Carretero, Cristina

    2012-01-01

    L’objectiu d’aquest estudi va ser valorar el desenvolupament del nen durant el primer any de vida en funció del tipus de lactància realitzada durant el primer semestre y de la dosis de ferro administrada durant el segon semestre. Hem observat que el 75,5% dels nens realitzen lactància materna exclusiva al néixer y el 16,5% la mantenen fins als 6 mesos. El 39,5% tenen alguna mutació en el gen HFE. La prevalença de dèficit de ferro y anèmia ferropènica es del 4,5% y 2,5% als 6 mesos y del 9,2% ...

  1. Respiratory therapies for amyotrophic lateral sclerosis: a primer.

    Science.gov (United States)

    Gruis, Kirsten L; Lechtzin, Noah

    2012-09-01

    Respiratory complications are a common cause of morbidity and mortality in amyotrophic lateral sclerosis (ALS). Treatment of respiratory insufficiency with noninvasive ventilation (NIV) improves ALS patients' quality of life and survival. Evidence-based practice guidelines for the management of ALS patients recommend treatment of respiratory insufficiency with NIV as well as consideration of insufflation/exsufflation to improve clearance of airway secretions. Despite these recommendations respiratory therapies remain underused. In this review we provide a practical guide for the clinician to prescribe and manage respiratory therapies for the patient with ALS. Copyright © 2012 Wiley Periodicals, Inc.

  2. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  3. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  4. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  5. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  6. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  7. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  8. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  9. Reporte del primer caso humano de infección parasitaria por Mammomonogamus laryngeus en Colombia

    Directory of Open Access Journals (Sweden)

    Jhon Carlos Castaño

    2006-09-01

    Full Text Available Los parásitos del género Mammomonogamus afectan el tracto respiratorio de mamíferos domésticos. La especie M. laryngeus es un nemátodo donde la hembra y el macho están unidos en permanente cópula produciendo una forma distintiva de letra "Y" mayúscula. En el mundo han sido reportados hasta el momento poco más de 100 casos de infección en humanos. Este reporte describe el primer paciente infectado en Colombia (Armenia, Quindío, quien presentó como sintomatología tos crónica productiva de dos meses de duración, con inmediata y total recuperación clínica luego de la expulsión del parásito en el esputo durante un fuerte acceso de tos. Este reporte incluye la descripción morfológica del gusano adulto, así como un breve resumen de la epidemiología y manifestaciones clínicas en humanos. También se presentan las fotografías tomadas al parásito, donde se observan algunos de los detalles morfológicos principales, que sirvieron para su identificación.

  10. Primer registro de la cotorra argentina (Myiopsitta monachus en Chihuahua, México

    Directory of Open Access Journals (Sweden)

    Ricardo Abel Soto-Cruz

    2015-06-01

    Full Text Available Reportamos el primer registro de la cotorra argentina (Myiopsitta monachus en las ciudades de Chihuahua y Delicias en Chihuahua, México. Observamos cinco individuos de esta especie de junio a diciembre de 2011 en las instalaciones de la Facultad de Zootecnia y Ecología de la Universidad Autónoma de Chihuahua; grupos de 2 a 12 individuos en el área urbana de la ciudad de Chihuahua durante 2012, y cuatro individuos en ciudad Delicias, a 80 km al sureste de la ciudad de Chihuahua, en el 2013. Previamente, en enero de 2011, se reportó, en el portal electrónico de aVerAves, el avistamiento de un individuo en el noroeste del estado. Dada la presencia de nidos activos en las ciudades de Chihuahua y Delicias, la especie podría estar ya establecida en esta parte del país. Recomendamos dar seguimiento a las poblaciones existentes de esta especie a fin de documentar los posibles riesgos a los ecosistemas en la región.

  11. Reseña del Primer Encuentro Internacional de Institutos de Medicina Tropical 2013

    Directory of Open Access Journals (Sweden)

    Jorge O Alarcón

    2014-04-01

    Full Text Available El Primer Encuentro Internacional de Institutos de Medicina Tropical, llevado a cabo en Lima, fue la actividad principal del cincuentenario de la fundación del Instituto de Medicina Tropical Daniel A. Carrión (1963-2013, de la Facultad de Medicina de la UNMSM. Participaron en su organización las principales instituciones científicas del país relacionadas a la investigación y atención de los problemas de salud que afectan a las regiones tropicales y subtropicales. Asistieron alrededor de mil personas. Los temas tratados fueron salud infantil en los trópicos, salud internacional, VIH/sida, dengue, malaria, leishmaniosis, tuberculosis, enfermedad de Carrión y enfermedades emergentes y reemergentes. Los representantes de los nueve institutos de Medicina Tropical de la región, asistentes al evento, suscribieron una declaración, en la que acordaron, entre otros puntos, promover en sus países las recomendaciones adoptadas en la Asamblea Mundial de la Salud y Organización Panamericana de la Salud en relación a enfermedades desatendidas, investigación en salud y recursos humanos en salud; desarrollar programas de posgrado regionales en medicina tropical, epidemiología y salud pública; articular las acciones de este encuentro con otras iniciativas regionales y subregionales, y realizar el Segundo Encuentro Internacional de Institutos de Medicina Tropical en dos años.

  12. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  13. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  14. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  15. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  16. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  17. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  18. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  19. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  20. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  1. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  2. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  3. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  4. Primer registro de anidación de Carao (Aramus guarauna en el estado de Nayarit, México

    Directory of Open Access Journals (Sweden)

    David Molina

    2017-04-01

    Full Text Available De 2012 a 2016 registramos la anidación de carao (Aramus guarauna en un humedal suburbano en el Parque Ecológico de Tepic en Nayarit, México, y puede considerarse que permanece en el sitio. Éste es el primer registro de anidación de esta especie en el estado de Nayarit; además, identificamos la ampliación de su intervalo reproductivo hacia el norte del país. Es muy probable que la residencia del carao en este humedal obedezca a la presencia de una población local de caracol manzana (Pomacea y, al parecer, a la ausencia de depredadores y competidores naturales en el sitio.

  5. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  6. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  7. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  8. Infección inducida en el roedor selvático Dasyprocta leporina (Rodentia: Dasyproctidae, con huevos larvados de Lagochilascaris minor (Nematoda: Ascarididae Induced infection in the wild rodent Dasyprocta leporina (Rodentia: Dasyproctidae with larval eggs of Lagochilascaris minor (Nematoda: Ascarididae

    Directory of Open Access Journals (Sweden)

    S. Gregorio

    1990-12-01

    Full Text Available Ejemplares de Dasyprocta leporina Linnaeus, 1758 fueron criados alejados de su ambiente natural. A los 3 ó 4 meses de edad, se los inoculó por vía oral con huevos de Lagochilascaris minor Leiper, 1909 obtenidos de una paciente nativa. Los huevos se los incubó por más de 80 dias, para que de ellos fuese posible obtener por compresión mecánica, larvas que se mantuviesen vivas en medio acuoso por 48 horas o más. Sacrificados los animales a los 14 ó 46 dias posteriores a la infección, se hallaron en los músculos esqueléticos larvas ovilladas dentro de nódulos inflamatorios, los cuales no presentaban reacción a cuerpo extraño, abscedación o calcificación. El desarollo de los nódulos no parecía afectar la normalidad de los hospedadores. Las larvas obtenidas eran similares a las descritas por SPRENT como de tercer estadio para estos helmintos. Ratones blancos infectados con material similar, no presentaron nódulos en sus músculos ni se pudo recuperar de sus tejidos larva alguna. Por los hallazgos obtenidos con la infección de estos animales, se postula que el helminto no posee ciclo pulmonar y que su desarrollo requiere de un hospedador intermediario.Specimens of Dasyprocta leporina (Linnaeus, 1758 were raised out their natural environment. At three to four months of age they were orally inoculated with Lagochilascaris minor (Leiper, 1909 eggs obtained from a native patient. The eggs were incubated for more than 80 days so that it was possible to obtain, by mechanical compression, larvae that could be maintained alive in liquid medium for 48 hours or more. The animals were sacrificed 14-46 days after infection and tangled larva in inflammatory nodules were found in skeletal muscle without foreign body reaction, abscess formation or calcification. The development of the nodules did not seem to affect the hosts. The larvae obtained were similar to those described by SPRENT as the third stage of these helminths. When white mice were

  9. Respuesta de Gallinas Ponedoras a Raciones con Diferentes Niveles de Harina de Hojas de Guandul (CajanusCajan L.

    Directory of Open Access Journals (Sweden)

    Ruíz V. Juan Guillermo

    1969-09-01

    Full Text Available En el presente trabajo se dan los resultados de dos ensayos llevados a cabo en el Centro Nacional de Investigaciones Agropecuarias de Medellín, para estudiar el efecto producido por la harina de hojas de guandul(Cajanuscajan en la coloración de la yema y en la producción de ponedoras. Durante el primer ensayo se trabajó con 120 gallinas Hy-line en postura avanzada, usando 3 raciones con 74%, 70.5% y68.5%de maíz amarillo como material prima básica y niveles de 0%, 6% y 9% de harina de guandul respectivamente. Aunque a medida que se aumentó el nivel de guandul hubo una pequeña baja en la producción de huevos, esta diferencia no fue significativa, como tampoco lo fue el (consumo de alimento y la coloración de la yema. Esta última fue prácticamente igual en los 3 lotes, debido al alto contenido de maíz amarillo en cada una de las raciones. Para el segundo ensayo se trabajó con 160 gallinas de igual raza, pero con 2 -3 meses de postura y 4 tratamientos: 3 en base a sorgo con 0%, 9% Y 12 % de harina de guandul y un cuarto lote con ración comercial, molida para evitar diferencias. La producción de huevos presentó una diferencia significativamente superior, al nivel 0 .05 %, de los lotes 0%y comercial sobre 9% y 12%. En cuanto al consumo de alimento se encontró diferencia altamente significativa del lote comercial sobre los otros 3 lotes. También el comercial fue el de mayor consumo de alimento por docena de huevos producidos. La coloración de la yema del huevo del lote 0% de guandul fue nula obteniendo un producto de difícil mercado. En los lotes 9%, 12% y comercial fue apropiada y muy semejante la pigmentación. El alimento por docena de huevo durante el segundo ensayo fue mayor en el lote con ración comercial, luego 12 %, 9 % y 0% respectivamente. A los siete días se produjo la pigmentación adecuada en la yema del huevo. Huevos almacenados por 25 días no perdieron su grado de coloración, pero sí su

  10. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  11. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  12. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  13. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  14. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  15. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  16. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  17. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  18. Mating and memory: an educational primer for use with "epigenetic control of learning and memory in Drosophila by Tip60 HAT action".

    Science.gov (United States)

    Schmidt, Rebecca L; Sheeley, Sara L

    2015-05-01

    An article by Xu et al. in the December 2014 issue of GENETICS can be used to illustrate epigenetic modification of gene expression, reverse genetic manipulation, genetic/epigenetic influence on behavioral studies, and studies using the Drosophila model organism applied to human disease. This Primer provides background information; technical explanations of genetic, biochemical, and behavioral approaches from the study; and an example of an approach for classroom use with discussion questions to aid in student comprehension of the research article. Copyright © 2015 by the Genetics Society of America.

  19. La estimulación del lenguaje oral a partir de los cuentos en el primer ciclo de educación primaria

    OpenAIRE

    Torres Jaramillo, Ana María

    2014-01-01

    El trabajo que se expone a continuación es una propuesta de intervención para trabajar el lenguaje oral en los alumnos del primer ciclo de Educación Primaria. En él, me he marcado unos objetivos, partiendo de la base legal del currículo de Educación Primaria, de modo que, esta propuesta de trabajo pueda desarrollarse en el aula formando parte del currículo. Contiene aspectos teóricos referidos al lenguaje, destacando la importancia del lenguaje oral y un breve desarrollo del lenguaj...

  20. Análisis de estabilidad del reactor PFTR para una reacción con cinética de primer orden utilizando la funcional de Lyapunov

    OpenAIRE

    Héctor Armando Durán Peralta; Luis Fernando Córdoba C

    2007-01-01

    Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR), en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizando...

  1. Análisis de estabilidad del reactor pftr para una reacción con cinética de primer orden utilizando la funcional de lyapunov

    OpenAIRE

    Durán Peralta, Héctor Armando; Córdoba C, Luis Fernando

    2010-01-01

    Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR), en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizand...

  2. La Construcción de Políticas Turísticas Orientadas a los Sectores Medios Durante el Primer Peronismo: Argentina 1946-1955

    OpenAIRE

    Piglia, Melina; Pastoriza, Elisa

    2017-01-01

    En el marco general de los estudios de las políticas públicas durante el primer peronismo (Argentina 1946-1955), el presente trabajo pretende abordar aspectos descuidados de las políticas turísticas, desde una perspectiva de historia social. El artículo sostiene que, junto a las más conocidas transformaciones producidas en el campo del turismo obrero y el turismo social, se puede advertir durante el período peronista la puesta en marcha de políticas turísticas orientadas al turismo de los sec...

  3. Variación del peso durante el primer mes de vida en recién nacidos de término sanos con lactancia materna exclusiva

    OpenAIRE

    COVAS, MARÍA; ALDA, ERNESTO; VENTURA, SILVIA; BRAUNSTEIN, SILVIA; SERRALUNGA, GABRIELA; YÁÑEZ, LORETO

    2008-01-01

    La variación del peso en recién nacidos sanos resulta de interés clínico, principalmente en aquellos niños con lactancia materna exclusiva. Objetivos. Determinar el cambio relativo del peso al nacer durante el primer mes, en recién nacidos de término sanos, alimentados exclusivamente con pecho. Diseño. Observacional; tipo cohorte. Prospectivo. Población, material y métodos. Recién nacidos asistidos entre septiembre de 2000 y noviembre de 2001. Criterios de elegibilidad: recién nacidos de térm...

  4. Expectativas de laborar en el primer nivel de atención de salud de los estudiantes de una facultad de medicina de Lima, Perú

    Directory of Open Access Journals (Sweden)

    Carolina B Tarqui-Mamani

    2015-01-01

    Full Text Available Introducción: La situación sanitaria del Perú requiere que más profesionales de la salud brinden atención en los establecimientos de salud del primer nivel de atención, ubicados principalmente en las zonas periféricas, rurales o más pobres del país. Objetivo: Identificar expectativas laborales y personales de los futuros profesionales de la salud que son formados en una facultad de medicina de Lima, particularmente trabajar en el primer nivel de atención de salud. Diseño: Estudio observacional, descriptivo y exploratorio. Lugar: Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Perú. Participantes: Estudiantes pre internado de las Escuelas Académico Profesionales. Intervenciones: El muestreo fue por conveniencia y se incluyó a 278 estudiantes de las 5 escuelas que conforman la facultad de medicina. Se aplicó un cuestionario ad hoc donde se preguntó aspectos relativos a las expectativas laborales, económicas y visión de los estudiantes como futuros profesionales. Se calculó promedios, desviación estándar, distribución de frecuencias, los intervalos de confianza al 95% con la prueba de Poissón y chi cuadrado. Principales medidas de resultados: Expectativa de laborar en el primer nivel de atención de salud. Resultados: El 50% de los estudiantes manifestó que les gustaría desarrollarse en el área asistencial; solo 14,5% expresó su intención de trabajar en el primer nivel de atención de salud (puestos y centros de salud, 87,1% consideró que estudiar en una universidad emblemática es una fortaleza que favorece su vida profesional y 57,6% que seguirá estudios de posgrado; 58,6% de los estudiantes señaló la intención de trabajar en Lima, 21,9% en provincias y 16,2% en el extranjero. El promedio de expectativa económica mensual fue el equivalente a 1 577 nuevos soles o poco más de 2 sueldos mínimos vitales previstos para el 2012. Conclusiones: La expectativa de los futuros profesionales de la

  5. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  6. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  7. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  8. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  9. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  10. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  11. Las preguntas de los alumnos, análisis de su aportación al aprendizaje de las ciencias

    OpenAIRE

    Roca Tort, M.

    2009-01-01

    La importancia de las preguntas, en la construcción de las ideas científicas y en el proceso comunicativo que favorece su construcción, ha planteado la necesidad de buscar las características que permiten distinguir las preguntas que favorecen este proceso. Se parte de los resultados encontrados al analizar las preguntas planteadas por los alumnos de primer ciclo de ESO al realizar la unidad didáctica sobre el ciclo del agua. En primer lugar se analizó el contenido y la demanda de cada una de...

  12. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  13. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  14. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  15. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  16. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  17. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  18. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  19. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  20. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  1. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  2. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  3. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  4. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  5. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  6. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  7. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  8. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  9. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  10. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  12. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  13. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  14. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  15. Caracterización de la fibrosis quística en el primer año de vida

    Directory of Open Access Journals (Sweden)

    Gladys Fuentes Fernández

    Full Text Available Introducción: la fibrosis quística es una enfermedad multisistémica, genética y letal, con daño pulmonar temprano y progresivo en los casos típicos. Objetivo: caracterizar el diagnóstico de la fibrosis quística en niños menores de un año. Métodos: estudio transversal, descriptivo, a pacientes diagnosticados con fibrosis quística según sospecha clínica, en el primer año de vida, en el Hospital Pediátrico Centro Habana, en el período 1993-2013, según datos obtenidos de los registros clínicos. Resultados: del total de 44 pacientes diagnosticados en el periodo, 35 clasificaron como enfermedad pulmonar típica, de ellos 13 fueron diagnosticados durante el primer año de vida, 7/21 en el periodo 1993-2003 (33,3 % y 6/14 entre 2004-2013 (42,8 %. Cuando se suman las formas clínicas no típicas, el total de niños diagnosticados durante su primer año fue de 16, con edad media al diagnóstico de 4,9 meses; en 11 niños (68,8 % el diagnóstico fue antes de los 6 meses, con predominio de los varones (10-62,5 %. La desnutrición estuvo presente en el 62,5 %. La forma típica con insuficiencia pancreática se evidenció en el 75 % de los menores de un año estudiados, y se aisló Pseudomona aeruginosa en el 68,8 %. Predominaron las manifestaciones respiratorias como la polipnea y el tórax hiperinsuflado (15 niños, 93,8 %, así como el tiraje (14 niños, 87,5 %, mientras que la distensión abdominal (11, 68,8 % y la esteatorrea (10, 62,5 %, fueron las más frecuentes alteraciones digestivas. La radiografía torácica mostró algún grado de alteración en todos los niños. Conclusiones: es importante una alta sospecha clínica para el diagnóstico temprano de las formas típicas de la fibrosis quística.

  16. Evolución del peso en pacientes durante el primer año del trasplante renal

    Directory of Open Access Journals (Sweden)

    Pilar López Garrigós

    Full Text Available Durante el primer año de trasplante renal es frecuente una ganancia de peso, debido, entre otros a la dieta, sedentarismo, e inmunosupresores, pudiendo aumentar los factores de riesgo del síndrome metabólico. Objetivos: Conocer la evolución del peso de nuestros pacientes durante el primer año del trasplante, y analizar la influencia con las distintas variables asociadas al paciente, sexo, edad, IMC, tratamiento inmunosupresor entre otras. Determinar la asociación entre la ganancia de peso y la aparición de factores de riesgo, como hipertensión arterial, diabetes y dislipidemia. Material y Método: Estudio retrospectivo y analítico. Se estudiaron 100 pacientes con un año de evolución en el trasplante, del Hospital Virgen de la Salud de Toledo. Sé analizaron datos antropométricos, demográficos y clínicos. La ganancia de peso se distribuyo según a las variables del estudio. Resultados: La ganancia de peso al año del trasplante afecto a 93 pacientes, con una media de 7,21 kg ±5,87. El 44,1% aumento su peso por encima de la media, y el 23,7% gano > 10 kg. La prevalencia de sobrepeso y obesidad antes del trasplante fue 57% y 76% después del trasplante. Los hombres ganaron ligeramente más peso que las mujeres. Los más jóvenes < 49 años ganaron más peso, media 9,3 kg. Mayor incidencia de diabetes, hipertensión y dislipemias en los pacientes con sobrepeso y obesidad. Conclusiones: La mayoría de los pacientes aumentaron significativamente de peso al año del trasplante, asociándose con varios de los factores del síndrome metabólico. - Importante la educación, por parte de la enfermería, del paciente para fomentar hábitos de vida saludable.

  17. All About ALS

    Science.gov (United States)

    ... Subscribe August 2015 Print this issue All About ALS Understanding a Devastating Disorder En español Send us ... Sports Concussions Wise Choices How Can I Help ALS Research? If you have ALS, join the National ...

  18. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  19. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  20. Primer registro de la familia Morchellaceae (Ascomycota: Pezizales para Colombia

    Directory of Open Access Journals (Sweden)

    César Augusto Pinzón Osorio

    2017-04-01

    Full Text Available Se registra por primera vez al género Morchella Dill. ex Pers. (Ascomycota, Pezizales, único representante de la familia Morchellaceae para la micobiota Colombiana. El ascocarpo fue recolectado en un bosque muy húmedo premontano, en la vereda Santa Helena, municipio de Gachalá, departamento de Cundinamarca. El espécimen es descrito e ilustrado con fotografías y se aporta información sobre su distribución, ecología y sustrato de crecimiento. La identidad taxonómica del ejemplar es discutida de acuerdo al concepto morfológico tradicional establecido en la literatura micológica. Con este reporte, en Colombia el orden Pezizales queda constituido por 17 especies contenidas en 12 géneros y 7 familias.

  1. Development of a Nonchromate Structural Adhesive Bond Primer

    Science.gov (United States)

    2014-11-01

    OH)4(-a) Nothing as good as Cr 6+… 14121086420 2.0 1.5 1.0 0.5 0.0 -0.5 -1.0 -1.5 -2.0 Ce - Mo - W - H2O - System at 25.00 C C:\\HSC5\\EpH\\CeMoW25. iep ...14121086420 1.8 1.3 0.8 0.3 -0.2 -0.7 -1.2 -1.7 -2.2 Ce - Al - Mo - W - H2O - System at 25.00 C C:\\HSC4\\AlCeMoW2. iep pH E(Ag/AgCl) (Volts

  2. Trasplante simultáneo de páncreas y riñón: reporte del primer caso realizado en el Perú

    Directory of Open Access Journals (Sweden)

    José De Vinatea

    2010-04-01

    Full Text Available El trasplante simultáneo de páncreas y riñón es la opción terapéutica ideal para pacientes con diabetes mellitus tipo 1 con insuficiencia renal crónica. Permite recuperar la insulino-independencia y evita la necesidad de diálisis, mejorando notablemente la calidad de vida. Así mismo, la restitución de la euglicemia logra que las complicaciones tardías de la diabetes no progresen e incluso regresionen, prolongando la supervivencia global de estos pacientes. Estos beneficios superan a los riesgos de la cirugía y de la inmunosupresión inherentes al trasplante. A nivel mundial, desde 1966, en que se llevó a cabo el primer trasplante de páncreas en Minnesota (Estados Unidos, se han registrado más de 20 000 trasplantes de páncreas, con resultados cada vez mejores gracias al refinamiento en las técnicas quirúrgicas y a los nuevos esquemas de inmunosupresión. En el presente caso clínico, se reporta y describe la realización del primer trasplante simultáneo de páncreas y riñón en el Perú.

  3. Table 1 Oligonucleotide primers used for SNP verification by Sanger ...

    Indian Academy of Sciences (India)

    charissa

    1 Ao W, Aldous S, Woodruf E, Hicke B, Rea L, Kreiswirth B, Jenison R. Rapid detection of rpoB gene mutations conferring rifampin resistance in Mycobacterium tuberculosis. J Clin Microbiol. 2012; 50: 2433-2440. 2 Bakuła Z, Napiórkowska A, Bielecki J et al. Mutations in the embB gene and their association with ethambutol ...

  4. Discovery and gestation of the self in El Primer Libro and Albricia by Soledad Fariña

    Directory of Open Access Journals (Sweden)

    Ana María Riveros Soto

    2017-11-01

    Full Text Available Este estudio propone una lectura centrada en la configuración del sujeto poético presente en los poemarios El Primer Libro (1985 y Albricia (1988 de Soledad Fariña (1943, bajo la comprensión de un yo en proceso continuo de gestación y nacimiento, acción que opera como mecanismo de reconstitución de una subjetividad desarticulada y extraviada en el marco de las condiciones político-culturales impuestas por la dictadura militar chilena durante las décadas de 1970 y 1980. Por medio de la metáfora del viaje y de la búsqueda de un lenguaje nuevo, el sujeto intenta acceder a su estado primigenio en el encuentro con el yo materno y oponerse a la razón dominante, codificando y configurándose en la palabra "otra" a través del cuerpo-texto femenino. No obstante, tal proceso de gestación y hallazgo es intervenido y truncado por el impulso de la modernidad, lo que da paso a un yo malformado, escindido y descentrado, que busca constituirse en otro opuesto al logos, pugna que transforma el surgimiento del yo en un acto doloroso -un parto- efectuado desde la herida y fisura del cuerpo, en el intento por refundar al sujeto a partir de sus fragmentos, huellas y reminiscencias.

  5. El aprendizaje de distintos dominios notacionales según niños de preescolar y primer grado

    Directory of Open Access Journals (Sweden)

    Nora Scheuer

    2010-10-01

    Full Text Available Se investiga si las concepciones de los niños acerca del aprendizaje adoptan matices diferentes según tres dominios notacionales: dibujo, escritura y notación numérica. Se entrevistó individualmente a 120 alumnos de preescolar (60 y primer grado (60 de escuelas públicas en Argentina. Se aplicó la lexicometría a las transcripciones de sus respuestas completas a tres preguntas referidas a la actividad, dificultades y metas en relación al propio aprendizaje del dibujo, escritura o notación numérica. Los resultados revelan diferencias significativas en cómo los niños refieren el contenido de aprendizaje y a sí mismos como aprendices según el dominio, indicando una teoría interpretativa del aprendizaje en relación al dibujo y la notación numérica, y una teoría directa en relación a la escritura.

  6. El aprendizaje de distintos dominios notacionales según niños de preescolar y primer grado

    Directory of Open Access Journals (Sweden)

    Nora Scheuer

    2010-01-01

    Full Text Available Se investiga si las concepciones de los niños acerca del aprendizaje adoptan matices diferentes según tres dominios notacionales: dibujo, escritura y notación numérica. Se entrevistó individualmente a 120 alumnos de preescolar (60 y primer grado (60 de escuelas públicas en Argentina. Se aplicó la lexicometría a las transcripciones de sus respuestas completas a tres preguntas referidas a la actividad, dificultades y metas en relación al propio aprendizaje del dibujo, escritura o notación numérica. Los resultados revelan diferencias significativas en cómo los niños refieren el contenido de aprendizaje y a sí mismos como aprendices según el dominio, indicando una teoría interpretativa del aprendizaje en relación al dibujo y la notación numérica, y una teoría directa en relación a la escritura.

  7. Necesidades en salud del diabético usuario del primer nivel de atención

    Directory of Open Access Journals (Sweden)

    Salinas-Martínez Ana M.

    2001-01-01

    Full Text Available Objetivo. Determinar la magnitud y jerarquizar la necesidad de salud satisfecha del diabético tipo 2, usuario del primer nivel de atención. Material y métodos. Se realizó un estudio transversal comparativo con representatividad rural y urbana, en el Instituto Mexicano del Seguro Social, en Nuevo León, en 1999. Fueron entrevistados, al azar, 256 diabéticos tipo 2 con dos o más años de diagnóstico. La información fue complementada con el expediente clínico y encuesta al proveedor. Se evaluaron cinco áreas y cuatro determinantes de salud, con base en estándares de la Norma Oficial Mexicana y la Asociación Americana de Diabetes. El plan de análisis consistió en estadística descriptiva y estimación de puntajes z. Resultados. Se registró una media de satisfacción global de necesidades de salud de 48.8%. En la zona rural la media de satisfacción fue menor que en la urbana (36.8% vs 53.3%, phttp://www.insp.mx/salud/index.html

  8. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  9. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  10. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  11. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  12. El caso Glivec®: primer ejemplo de debate global en torno al sistema de patentes de medicamentos

    Directory of Open Access Journals (Sweden)

    Inês Moital

    2014-11-01

    Conclusión: El caso Glivec® ha planteado el debate sobre la adecuación de las normas internacionales, su aplicabilidad en el entorno económico y su adaptación en cada país. Este caso, y otros, deberían contribuir a la reflexión sobre el sistema internacional de patentes a fin de preservar la salud de la población más necesitada de una atención sanitaria adecuada en equilibrio con la protección de la propiedad intelectual y la innovación.

  13. Ensenyar els connectors al primer cicle de l’escola primària / Teaching linking words to primary students

    Directory of Open Access Journals (Sweden)

    Alícia Santolària Òrrios

    2014-10-01

    Full Text Available Resum: L’aprenentatge de la llengua escrita és un procés complex en què interaccionen diversos factors. El punt de partença amb què iniciem aquest article relaciona l’ensenyament d’elements gramaticals, com són els connectors, amb la producció textual d’infants de segon curs d’Educació Primària. En la investigació, que es duu a terme en situació d’aula, s’ha triat com a dispositiu una seqüència didàctica tot tenint en compte el model de l’escola de Ginebra. La mediació elegida demostra, d’una banda, que resulta possible i eficaç introduir aquests sabers gramaticals a l’inici de l’escolarització i, de l’altra, que la intervenció ajuda a millorar els textos dels infants. Abstract: Learning the written language is a complex process in which several factors interact. This article relates the teaching of grammar points -such as linking works- with the written texts of children in their second year of Primary Education. In this research, which was conducted in the classroom, a didactic sequence as a methodological tool has been chosen following the Geneva School. The selected device demonstrates, firstly, that introducing knowledge on grammar is not only possible but efficient at an early age; and, secondly, that the introduction of a didactic sequence helps improve children’s texts.

  14. A Strategic Planning Primer: Model, Methods, and Misunderstandings

    Science.gov (United States)

    1992-06-01

    ý.omfplc\\ social atctivity thai cannot be sirnpl stnlct tired b.\\ rules, of thumb or quaint itatk e procedures. Tb is papel attempt,, to bring to~gether mnan...Planners. 1988, pp. 172-183. Hlack. Gary. Phvswal Planning and Urban Design. in Cantonese and Snyder. Urban Planning, Second Edition, 1988, pp. 187-220...Washington. D.C., 1984. Sn\\ der. James C.. Fise’al Planning amn Budgeting. in Cantonese and Snder. Urban Planning, 1988, ,,p. 140-158. 34 Index A action

  15. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  16. Factores influyentes en el rendimiento académico de estudiantes del primer año de medicina

    Directory of Open Access Journals (Sweden)

    Delia Jara

    2008-09-01

    Full Text Available Introducción: El rendimiento académico dentro de la universidad es el producto de la influencia de múltiples factores, los cuales se ponen de manifiesto desde los primeros años de estudio. Objetivos: Identificar los factores que afectarían el rendimiento académico en los estudiantes de medicina del primer año de estudios. Diseño: Estudio observacional longitudinal. El tipo de muestreo utilizado fue no probabilístico por cuotas. Lugar: Facultad de Medicina de San Fernando, Universidad Nacional Mayor de San Marcos (UNMSM, Lima-Perú. Participantes: Estudiantes de medicina durante el primer año de estudios. Intervenciones: Un cuestionario aplicado a los participantes, examen físico, psicológico y análisis de laboratorio. Principales medidas de resultados: Factores que influyen en el rendimiento académico bajo. Resultados: Se evaluó 40 estudiantes de ambos sexos (14 mujeres y 26 varones, con edades comprendidas entre 18 y 30 años. Procedían de colegio estatal 31 (78% y de colegio privado 9 (23%; en cuanto a hábitos de estudio, 27 (67% refirieron leer las materias propias de la profesión, por lo menos una vez al día, mientras que 13 (33% lo hacía de manera semanal. El número de horas de estudio al día consistió en 1 a 2 horas al día en 10 (25%, 3 a 4 horas de estudio en 18 (45%, 5 a 6 horas de estudio em 10 (25% y 2 de ellos (5% refirieron estudiar solo en fechas de exámenes; 25 alumnos (62% tuvieron como estrategia de estudio solo el uso de la memoria, 7 (18% utilizaron la memoria más los apuntes de clase, 4 de ellos (10%, apuntes más esquemas, y 4 (10%, apuntes más esquemas y textos. El carácter predominante de los alumnos fue alegre en 22 (55% y no alegre en 18 (45%. La autoestima fue considerada alta en 15 de los participantes (37,5%, autoestima moderada en 21 (52,5% y autoestima baja en 4 (10%. El aspecto socioeconómico de los participantes reveló que en 17 de ellos (42,5% el ingreso familiar era igual o menor de

  17. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  18. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  19. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  20. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  1. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  2. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  3. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  5. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  6. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  7. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  8. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  9. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  10. Gorduras em laticínios, ovos, margarinas e óleos: implicações para a aterosclerose Grasas en lácteos, huevos, margarinas y aceites: implicaciones para la aterosclerosis Fat content of dairy products, eggs, margarines and oils: implications for atherosclerosis

    Directory of Open Access Journals (Sweden)

    Carlos Scherr

    2010-07-01

    Full Text Available FUNDAMENTO: Para o aconselhamento adequado de um planejamento alimentar, com vistas à prevenção da cardiopatia isquêmica, é necessário o conhecimento da composição química dos alimentos. ObJETIVO: Analisar a composição de gorduras, ácidos graxos e colesterol de alguns exemplos nacionais de óleos comestíveis, manteigas, margarinas, laticínios e ovos, utilizando os limites de uma dieta para prevenção de doença arterial coronariana. MÉTODOS: Foi analisada a composição de óleos comestíveis, manteigas, margarinas, laticínios e ovos. Os resultados foram empregados de acordo com o recomendado pela American Heart Association para uma dieta de 1.800 calorias. RESULTADOS: Na comparação entre os óleos comestíveis, o de canola apresentou-se como o melhor. Já entre os leites, o desnatado é o mais recomendável, porém não há vantagens em relação ao semidesnatado. No caso do ovo, não existiram diferenças nos tipos encontrados no mercado. Em relação aos queijos, o tipo minas é o que apresentou o menor conteúdo de colesterol e gordura saturada. Na comparação margarina com manteiga, a primeira levou vantagem quando os níveis de gorduras trans que não ultrapassam o recomendado. CONCLUSÃO: A composição de alimentos usados no Brasil indica que dietas com objetivo de prevenção primária e secundária da cardiopatia isquêmica podem priorizar o uso de leite semidesnatado, óleo de girassol, margarinas com baixo teor de gorduras trans e queijo do tipo minas.FUNDAMENTO: Para aconsejar adecuadamente sobre una planificación alimentaria, con vistas a la prevención de la cardiopatía isquémica, es necesario el conocimiento de la composición química de los alimentos. OBJETIVO: Analizar la composición de grasas, ácidos grasos y colesterol de algunos ejemplos nacionales de aceite comestible, mantecas, margarina, lácteos y huevos, utilizando los límites de una dieta para prevención de enfermedad arterial coronaria. M

  11. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  12. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  13. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  14. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  15. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  16. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  17. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  18. La ayuda oficial al desarrollo en el sector agrario

    OpenAIRE

    Areta García, Álvaro; Marín, Gonzalo

    2006-01-01

    El primer Objetivo de Desarrollo del Milenio habla de erradicar la pobreza extrema y el hambre. Por tanto, dado que la mayoría de la gente pobre vive en el medio rural o depende de la agricultura, y que en las naciones más pobres la agricultura prepara el terreno para el desarrollo económico, será imprescindible una gran inversión en el desarrollo rural y, por ende, en uno de sus “pilares” básicos, la agricultura. Sin embargo, el papel de la agricultura en el marco de la Ayuda Oficial al Desa...

  19. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  20. Percepción de los estudiantes de enfermería en cuanto al comportamiento de fumar en México

    OpenAIRE

    Francisco Cruz Vazquez; Sandra Cristina Pillon; Maria Teresa Cuamatzi

    2004-01-01

    El estudio tiene como objetivo evaluar el comportamiento de fumar y la percepción de los factores que influeyen en ese comportamiento, entre estudiantes del primer año de Licenciatura en enfermería. Fueron entrevistado 36 alumnos del primer año de graduación en enfermería. Siendo 18 (50%) fumadores, con edad media de 23,5 años; 75% del sexo femenino en cuanto al patron de consumo estos fuman de 2 a 6 cigarrillos al dia, empezaron a fumar en media con 15 años. En cuanto a la per...

  1. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  2. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  3. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  4. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  5. Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

    OpenAIRE

    Bedmar Carretero, Cristina

    2012-01-01

    El objetivo de este estudio fue valorar el desarrollo del niño durante el primer año de vida en función del tipo de lactancia realizada durante el primer semestre y de la dosis de hierro administrada durante el segundo semestre. El 75,5% realizan lactancia materna exclusiva al nacer y el 16,5% la mantienen hasta los 6 meses. El 39,5%tienen alguna mutación en el gen HFE. La prevalencia de déficit de hierroy anemia ferropénicaes del 4,5% y 2,5% a los 6 meses y del 9,2% y 1,2% a los 12 meses.La ...

  6. Clorhidrorrea congénita:: primer reporte en Cuba Congenital chlorhydria:: first report in Cuba

    Directory of Open Access Journals (Sweden)

    Carlos Ramírez Pérez

    2009-12-01

    Full Text Available En el presente trabajo se exponen los antecedentes prenatales, perinatales y posnatales de un lactante de 6 meses de edad, del sexo masculino, con clorhidrorrea congénita, así como el cuadro clínico, diagnóstico y tratamiento utilizado. Un elemento significativo lo constituyó la expulsión anal de abundante líquido no meconial desde las primeras horas de nacido, así como alcalosis metabólica grave y la presencia de desnutrición rápidamente progresiva. En los exámenes complementarios se constató hipocloremia de un 50 % con respecto a las cifras de referencia y un pH sanguíneo mayor de 7,50. El diagnóstico confirmatorio se obtuvo al comprobar concentraciones de cloro en heces fecales superiores a las de la suma de sodio y potasio. Se proponen indicadores diagnósticos prenatales entre los que tienen gran valor la consanguinidad, el polihidramnios y los resultados del ultrasonido en el tercer trimestre del embarazo. El diagnóstico precoz permitió establecer el tratamiento y evitó el frecuente desenlace fatal. Es el primer caso de esta enfermedad que se informa en el país.In present paper are showed the prenatal, perinatal and postnatal backgrounds from a male breast-fed baby aged 6 months presenting with congenital chlorhydria, as well as the clinical picture, diagnosis and treatment applied. A significant element was the anal expulsion of non-meconium abundant fluid from the first hours of born, as well as a severe metabolic alkalosis and the presence of a quickly progressive malnutrition. In complementary examinations was confirmed a 50% hypochloremia regarding the reference figures and a blood pH over 7,50. Confirmatory diagnosis was achieved verifying the chlorine concentrations in feces higher to that of the sum of sodium and potassium. Prenatal diagnostic indicators are proposed those with higher value including the consanguinity, polyhydramnios and the US results during the third trimester of pregnancy. Early diagnosis

  7. Protagonismo de los alumnos en el aprendizaje: Una experiencia en el primer curso de medicina

    Directory of Open Access Journals (Sweden)

    Agustín Hidalgo

    Full Text Available Objetivo. Presentar y analizar la experiencia realizada en una asignatura del primer curso del Grado de Medicina para abordar competencias formativas en documentación, método científico y humanismo médico. Sujetos y métodos. Participaron 151 alumnos distribuidos en grupos de 5-6 estudiantes para realizar los trabajos propuestos en forma de seminarios y aprendizaje basado en problemas (ABP, utilizando, entre otros materiales, narraciones literarias e imágenes de cuadros pictóricos cuyo análisis y discusión se presentaron oralmente. En las prácticas se inició a los estudiantes en la búsqueda y evaluación de la información. Un ensayo y las clases teóricas completan los métodos utilizados. Todos los materiales a utilizar estuvieron disponibles en el campus virtual. Resultados. La asistencia a prácticas, seminarios y ABP fue próxima al 100%, y a clases teóricas, del 67%. Los alumnos mostraron inquietud intelectual en las tareas. El método ha demostrado una elevada implicación en el proceso de autoaprendizaje, capacidad de autorregulación en el trabajo, trabajo en grupo, grado de adquisición de conceptos y capacidad de redactar documentos. La adecuación de los contenidos a los objetivos ha sido considerada favorable por más del 70% de los alumnos. El grado de adquisición de las competencias fue favorable en un 80% de los casos. Conclusiones. Las características de la asignatura pueden fomentar la inquietud científica y el humanismo médico entre los alumnos. La literatura y la lectura de cuadros pueden contribuir a identificar los aspectos del acto médico y a desarrollar la observación de las características físicas y conductuales en los pacientes.

  8. Etapa familiar que se inicia con el nacimiento del primer hijo

    Directory of Open Access Journals (Sweden)

    Clara Pérez Cárdenas

    2000-02-01

    Full Text Available Las etapas evolutivas de la familia como grupo, son un tema poco abordado en la literatura médica, de ahí que nos entusiasmara la idea de profundizar en aquella que se inicia con el nacimiento del primer hijo, por considerarla un período en la vida familiar y personal de muchas expectativas y tareas nuevas a afrontar. Con carácter descriptivo, longitudinal y retrospectivo evaluamos cuál es el conflicto fundamental que perciben los padres en esta etapa, sentimientos que genera el afrontar ese evento que la define y los intentos de solución, a los problemas de este período. Trabajamos con 2 grupos: 1 que tuviera a su descendiente matriculado en el Círculo Infantil, y otro con niños que se desarrollan únicamente en el ambiente familiar. Entre los resultados encontramos que además de ser hijos deseados, los padres refieren participación en la atención de éstos reconociéndose a la madre como figura fundamental en la toma de decisiones. La afectación económica es el conflicto principal percibido por ambos padres en los 2 grupos estudiados, no encontrándose diferencias importantes entre los 2 grupos de familias que participaron en el estudio, al menos en la mayoría de las variables exploradasAs the evolutive stages of the family as a group are little appoached by medical literature, we decided to deepen in that one that starts with the birth of the first child for considering it as a period of many expectations and new tasks to undertake in the family and personal life. A descriptive, longitudinal and retrospective evaluation of the fundamental conflict perceived by the parents in this stage, of the feelings resulting from facing that event that defines it and of the attempts to solve the problems arising during that period was made. We worked with 2 groups: one with the child enrolled in the day care center and the other with children that developed in the family environment only. Among the results, we found that besides being

  9. La política ferroviaria del primer gobierno radical 1916-1922

    Directory of Open Access Journals (Sweden)

    MARIO JUSTO LÓPEZ

    2013-05-01

    Full Text Available El gobierno argentino adoptó a comienzos del siglo XX un modelo de explotación ferroviaria basado en la actuación de empresas extranjeras, que obtenían su capital en el mercado financiero y que, para ello, debían tener utilidades. Su actuación quedó sometida al control estatal que se ejerció a través de la Dirección General de Ferrocarriles. Con el triunfo electoral de la Unión Cívica Radical en las elecciones presidenciales de 1916 la situación no cambió. El primer presidente radical, Hipólito Yrigoyen, continuó con dicho modelo y en los años difíciles que siguieron a la Primera Guerra Mundial se preocupó en mantener las utilidades de las empresas dándoles sucesivos aumentos de tarifas. La Dirección General de Ferrocarriles continuó siendo el órgano específico de contralor pero ahora con menos autonomía respecto del Presidente de la Nación. El estudio detallado de lo hecho en estos años desmiente la creencia de que el presidente Yrigoyen fue contrario a las empresas ferroviarias extranjeras y llevó adelante acciones en su perjuicio. Abstract At the beginning of the XXth Century, the Argentine Government left the main sections of the railway system in the hands of foreign companies. Those companies managed to obtain their capital from the financial market under the condition of being profitable. All those companies were controlled by the National Railways Board. In 1916, when the Radical Civic Union won the presidential election, nothing changed. Even during the difficult years after the First World War, Hipólito Yrigoyen, the first Radical President allowed fares increases that kept the level of profitability. The National Railways Board went on with the surveillance of the foreign companies, but now under the direct power of the President. A careful study of the first Radical Government railway policy shows that the mythical idea about President Yrigoyen acting against foreign companies is not true.

  10. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  11. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  12. Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

    OpenAIRE

    Johnston, Nessa

    2012-01-01

    Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

  13. Desbalance energético proteico en lactantes durante el primer año de vida*

    Directory of Open Access Journals (Sweden)

    Virginia Díaz-Argüelles Ramírez-Corría

    2004-06-01

    Full Text Available La alimentación de los lactantes durante el primer año de vida tiene gran influencia en el crecimiento y desarrollo posterior, sobre todo en el lactante de muy bajo peso al nacer. El objetivo de este trabajo fue caracterizar el consumo de energía y macronutrientes en un grupo de recién nacidos, con peso inferior a 1 800 g y compararlo con un grupo control de término, para conocer si existía un consumo adecuado durante el primer año de vida. Para ello, se realizó un estudio de cohorte en 25 recién nacidos con peso al nacer menor de 1800 g y 34 semanas de edad gestacional, en el Hospital Ginecoobstétrico "Ramón González Coro", en Ciudad de La Habana, desde enero del 2000 hasta enero del 2001 y en 25 recién nacidos de buen peso a término como grupo control. Se realizó encuesta dietética de registro de 3 días, y a los 4, 6, 9 y 12 meses de edad para evaluar el consumo de macronutrientes. Los datos se procesaron por el Programa para la evaluación del consumo de alimentos (CERES. El consumo de energía fue adecuado, pero con un desequilibrio manifiesto de los macronutrientes en uno y otro grupos, a expensas del consumo de proteínas que fue excesivo (5 g/kg/día durante todo el primer año de vida y una baja densidad energética de la dieta. Se hace necesaria una revisión de la ablactación en los lactantes, del tipo de leche utilizado durante los primeros meses de la lactancia y los hábitos alimentarios de la población, con el objetivo de mejorar su calidad durante los primeros años de la vida.The feeding of infants during the first year of life has a great influence on the further growth and development, mainly on the infant with very low birth weight. The objective of this paper was to characterize the intake of energy and macronutrients in a group of newborn infants with a weight under 1 800 g and to compare it with a term control group to know if there was an adequate consumption during the first year of life. To this end, a

  14. /Cu-Al System

    Science.gov (United States)

    Kish, Orel; Froumin, Natalya; Aizenshtein, Michael; Frage, Nachum

    2014-05-01

    Wettability and interfacial interaction of the Ta2O5/Cu-Al system were studied. Pure Cu does not wet the Ta2O5 substrate, and improved spreading is achieved when relatively a high fraction of the active element (~40 at.% Al) was added. The Al2O3 and AlTaO4 phases were observed at the Ta2O5/Cu-Al interface. A thermodynamic evaluation allowed us to suggest that the lack of wetting bellow 40 at.% Al is due to the presence of a native oxide, which covers the drop. The conditions of the native oxide decomposition and the formation of the volatile Al2O suboxide strongly depend on the vacuum level during sessile drop experiments and the composition of the Cu-Al alloy. In our case, Al contents greater than 40% provides thermodynamic conditions for the formation of Al2O (as a result of Al reaction with Al2O3) and the drop spreading. It was suggested that the final contact angle in the Ta2O5/Cu-Al system (50°) is determined by Ta adsorption on the newly formed alumina interlayer.

  15. Un acercamiento al deporte y al fútbol como negocio y al funcionamiento, problemática y mejora del fútbol peruano

    OpenAIRE

    García Vega, Emilio Humberto

    2015-01-01

    El presente artículo trata de aproximarse al deporte, más específicamente al fútbol, como negocio y acercarse a su realidad, funcionamiento y problemática en el Perú. En esta línea, en primer lugar, se desarrolla un marco teórico general que permite conocer cómo se presenta la transformación del deporte y del fútbol hacia un modelo de negocio rentable, conocer brevemente cómo se da la generación de valor de una institución deportiva; y además, se presentan los factores críticos del éxito de l...

  16. Bankole et al (2)

    African Journals Online (AJOL)

    DELL

    Relationships of Clay-filled Channels on the Delta Flanks (Modified after Doust and Omatsola, 1990 and Lawrence et al., 2002). ... and in the Indo-Malaysian area (Germeraad et al.,. 1968). The genus ..... Upper Cretaceous of British Guiana.

  17. Lou Gehrig's Disease (ALS)

    Science.gov (United States)

    ... disease. Who Gets ALS? Although this disease can strike anyone, ALS is extremely rare in kids. According ... home to provide care that the family cannot handle alone. Living With Lou Gehrig's Disease Living with ...

  18. Aussprache als motorische Fertigkeit

    DEFF Research Database (Denmark)

    Bonner, Maria

    2013-01-01

    Authentische Aussprache gilt im Fremdsprachenunterricht als schwer erreichbares Ziel, fremdsprachlicher Akzent wird als nahezu unvermeidbar gesehen. Weder die Hypothese einer kritischen Periode für den Erwerb einer authentischen Aussprache noch das Konzept der Fossilierung im Sprachlernprozess...

  19. Evaluación de la densidad de siembra y el tamaño del tubérculo semilla en la producción de semilla básica de papa criolla, variedad «yema de huevo» (Solanum phureja Juz. et Buk. Effect of plant density and tuber-seed size in basic seed production of creole potato «yema de huevo» cultivars (Solanum phureja luz. el Buk.

    Directory of Open Access Journals (Sweden)

    Cotes T. Jose M

    2000-12-01

    Full Text Available La producción de semilla básica es fundamental en la cadena de producción de semillas de alta calidad. En Solanum phureja Juz. el Buk., los factores densidad de siembra y tamaño de tubérculo semilla óptimos para su producción no han sido evaluados hasta el momento. El presente trabajo tuvo como objetivo evaluar estos dos factores en condiciones de la Estación Experimental San Jorge JCA. La investigación se realizó bajo un Diseño en Bloques Completos al Azar con arreglo factorial 4 x 3. Se encontró que las distancias entre plantas evaluadas (15; 20; 25 y 30 cm no afectan la producción de semilla por unidad de área y que la utilización de tubérculos-semilla entre 1,27 y 2,00 cm de diámetro es la más recomendada.The production ofbasic seed is a very important factor, for the seed production chain looking for high quality. The sowing density and the tuber size have not been researched for Solanum phureja Juz. el Buk. The evaluation ofthese factors was conducted at Experimental Center San Jorge - JCA. Randomized Complete Block Design with factorial array (4x3 was used in this assay. It was found that the distance among plants (15; 20; 25 and 30 cm did not modify the seed production per unit of area. The tuber diameter between 1,27 to 2,00 cm., is the best choose in production of basic seed.

  20. Presentación del primer caso humano de parasitismo por Macracanthorhynchus hirudinaceus en el Perú y breve revisión

    Directory of Open Access Journals (Sweden)

    María Beltrán F. de Estrada

    1997-07-01

    Full Text Available Se reporta un caso humano portador de Macracanthorhynchus hirudinaceus. Se trata de un varón de 45 años de edad, natural de la provincia de Chota, departamento de Cajamarca, Perú; con molestias digestivas. El diagnóstico se hizo por el hallazgo de huevos de Macracanthorhynchus hirudinaceus en las heces. Además se encontró Trichuris trichiura, Ancylostoma duodenale, Trichostrongylus sp, Blastocystis hominis y Entamoeba coli. Esta es la primera comunicación de un caso humano de M. hirudinaceus para el Perú.

  1. Amyotrophic lateral sclerosis (ALS)

    Science.gov (United States)

    Lou Gehrig disease; ALS; Upper and lower motor neuron disease; Motor neuron disease ... One out of 10 cases of ALS is due to a genetic defect. The cause is unknown in most other cases. In ALS, motor nerve cells (neurons) waste away ...

  2. En pos del "buen lector" : censura editorial y clases populares durante el primer franquismo (1939-1945

    Directory of Open Access Journals (Sweden)

    Eduardo Ruiz Bautista

    2004-01-01

    Full Text Available El artículo trata de analizar la censura de libros durante el primer franquismo desde un punto de vista sociocultural que apenas ha sido contemplado. Por un lado, se muestra cómo la censura impidió que determinadas obras cultas llegasen al lector popular, dificultando las ediciones asequibles o restringiéndolas directamente a eruditos. Por el otro, da cuenta de la dura represión de las lecturas populares sufrieron en nombre de la infancia, pese a que las motivaciones reales deban buscarse en el enfrentamiento entre lo culto y lo popular.The article tries to analyze the censorship of books during the first franquism from a sociocultural point of view that has been scarcely contemplated. In one hand, it shows how the censorship prevented the popular reader from getting learned works by obstructing cheap editions or by restricting them directly to scholars. In the other one, it shows the hard repression of the popular readings in the ñame of the infancy, although real motivations should be looked in the clash between the educated culture and the popular one.

  3. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  4. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  5. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  6. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  7. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  8. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  9. A primer on polymer nomenclature: Structure-based, sourced-based and trade names

    Science.gov (United States)

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

  10. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

  11. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  12. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  13. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

  14. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  15. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  16. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  17. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  18. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  19. A Web-based Adaptive Tutor to Teach PCR Primer Design

    NARCIS (Netherlands)

    Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  20. Primer on theory and operation of linear accelerators in radiation therapy

    International Nuclear Information System (INIS)

    Karzmark, C.J.; Morton, R.J.

    1981-12-01

    This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described

  1. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  2. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  3. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  4. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  5. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  6. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  7. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  8. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  9. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    International Nuclear Information System (INIS)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-01-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  10. Improvement of fragment and primer selection for mutation detection by denaturing gradient gel electrophoresis

    NARCIS (Netherlands)

    Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW

    1998-01-01

    Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest

  11. The astrobiology primer: an outline of general knowledge--version 1, 2006.

    Science.gov (United States)

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  12. Testing of Flame Sprayed Al2O3 Matrix Coatings Containing TiO2

    Directory of Open Access Journals (Sweden)

    Czupryński A.

    2016-09-01

    Full Text Available The paper presents the results of the properties of flame sprayed ceramic coatings using oxide ceramic materials coating of a powdered aluminium oxide (Al2O3 matrix with 3% titanium oxide (TiO2 applied to unalloyed S235JR grade structural steel. A primer consisting of a metallic Ni-Al-Mo based powder has been applied to plates with dimensions of 5×200×300 mm and front surfaces of Ø40×50 mm cylinders. Flame spraying of primer coating was made using a RotoTec 80 torch, and an external coating was made with a CastoDyn DS 8000 torch. Evaluation of the coating properties was conducted using metallographic testing, phase composition research, measurement of microhardness, substrate coating adhesion (acc. to EN 582:1996 standard, erosion wear resistance (acc. to ASTM G76-95 standard, and abrasive wear resistance (acc. to ASTM G65 standard and thermal impact. The testing performed has demonstrated that flame spraying with 97% Al2O3 powder containing 3% TiO2 performed in a range of parameters allows for obtaining high-quality ceramic coatings with thickness up to ca. 500 µm on a steel base. Spray coating possesses a structure consisting mainly of aluminium oxide and a small amount of NiAl10O16 and NiAl32O49 phases. The bonding primer coat sprayed with the Ni-Al-Mo powder to the steel substrate and external coating sprayed with the 97% Al2O3 powder with 3% TiO2 addition demonstrates mechanical bonding characteristics. The coating is characterized by a high adhesion to the base amounting to 6.5 MPa. Average hardness of the external coating is ca. 780 HV. The obtained coatings are characterized by high erosion and abrasive wear resistance and the resistance to effects of cyclic thermal shock.

  13. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  14. Toxicidad de Schinus molle L. (Anacardiaceae) a cuatro controladores biológicos de plagas agrícolas en el Perú

    OpenAIRE

    IANNACONE, José; ALVARIÑO, Lorena

    2010-01-01

    Schinus molle L. (Anacardiaceae) "molle" es una planta de importancia etnobotánica originaria de la zona altoandina y usada artesanalmente como agente insecticida para el control de plagas agrícolas en el Perú. Se evaluó el efecto ecotoxicológico de extractos acuosos de molle sobre cuatro organismos no blanco: Ceraeochrysa cincta (Schneider) (Neuroptera: Chrysopidae) en huevos y larvas de primer estadio, Chrysoperla asoralis (Bank) (Neuroptera: Chrysopidae) en huevos y larvas de primer estadi...

  15. Contribución al Estudio de las Moscas Anastrephas en Colombia.

    Directory of Open Access Journals (Sweden)

    González Mendoza Rafael

    1952-11-01

    como oriunda del Brasil, es decir una especie enteramente tropical. 8. Dentro de los dípteros, las moscas del género Anastrepha se pueden clasificar como suborden Cyclorrapha, serie Schyzophora, sección Myodaria, subsección Acalyptratae, familia Trypetidae. 9. Las moscas Anastrephas cumplen su ciclo biológico al través de 4 estados metamorfósicos que ocurren así: imago en el ambiente aéreo, huevo y larva en la fruta y pupa en el suelo. En cada uno de los estados metamorfósicos, el insecto exhibe las características comunes de los dípteros. 10. Los huevos miden l , mm.; son de forma ovalada y ápices un tanto agudos, de color blancuzco ligeramente cremoso. La incubación demora de 4 a 7 días; el número de huevos por postura es de 3 y hasta l. La incubación de los huevos y la vida de la larva recién nacida son afectados por temperatura, humedad y determinados factores resultantes de la condición de madurez de la fruta. 11. Las larvas son vermiformes, puntiagudas en la cabeza, de color amarillo crema claro en tonalidades diversas hasta blanquecino o cremoso. No poseen patas; no tienen ojos ni antenas. Su tamaño y la duración del período larvario varían con la temperatura, la humedad, y diversas condiciones de la fruta en cuanto a cantidad de material parásito, acidez, estado de madurez, etc. El número de larvas puede ser de 1 a 3 por fruta y hasta cifras muy elevadas como 72, según la población de moscas y la clase de fruta. Las larvas adquieren su desarrollo completo entre tres estadios y dos "écdicis". 12. Las pupas son ovaladas como una barrilito; miden de 3 a 7 mm, de largo x 1 1⁄2 a 21⁄2 de ancho. Son de color castaño claro en tonalidades hasta el tabaco oscuro. La duración del período de pupa, así como diferentes hechos relacionados con el estado, sufren variaciones debidas a temperatura, humedad, acidez, soltura y textura del suelo, que es el medio donde normalmente ocurre el empupamiento. 13. El estado

  16. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  17. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  18. In vivo effect of a self-etching primer on dentin.

    Science.gov (United States)

    Milia, E; Lallai, M R; García-Godoy, F

    1999-08-01

    To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

  19. Nutrición y desarrollo psicomotor durante el primer semestre de vida Nutrition and psichomotor development during the first six months of life

    Directory of Open Access Journals (Sweden)

    ADOLFO CHÁVEZ

    1998-03-01

    Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.Objective. To study the psychomotor development of young infants from a poor and underfed rural community and to correlate this with the nutritional conditions of the mother during pregnancy and the child itself. Material and methods. We studied 82 mother-child pairs from the 5th month of pregnancy to the 6th month of life of the child as to anthropometry and food consumption. The neonatal Brazelton test and the Bayley test at 3 and 6 months were applied to the child. Results. Several of the neonatal psychomotor tests applied to the child correlate positively with the mother

  20. Susceptibilidad de genotipos de Solanum spp. al nematodo causante del nudo radical Meloidogyne spp. (chitwood

    Directory of Open Access Journals (Sweden)

    Gelpud Chaves Cristian

    2011-03-01

    Full Text Available

    El cultivo del lulo (Solanum quitoense L. presenta una disminución en su productividad, debido al ataque de patógenos como el nematodo del nudo radical Meloidogyne  spp., en el Departamento  de Nariño (Colombia, se han reportado incidencias cercanas al 79%, y pérdidas del 50%.   En la presente investigación, se colectaron 45 genotipos de (Solanum quitoense  L. en los Departamentos  de Nariño  y Putumayo  y 4 genotipos  silvestres  (S. mammosum, S. hirtum,       S. marginatum  y S. umbellatum buscando fuentes de resistencia al nematodo. Se inocularon 9 plantas de cada genotipo de dos meses de edad con 10000 huevos de Meloidogyne spp., dejando tres testigos por cada material. Las variables evaluadas fueron: altura de planta, severidad, incidencia, peso fresco (tallo y raíz y especies prevalentes de Meloidogyne spp. Se hizo una clasificación de genotipos mediante escala de resistencia y regresión entre la severidad y las demás variables para establecer el efecto de Meloidogyne spp. sobre los genotipos de planta. Los resultados mostraron 100% de incidencia del nematodo en  todos  los  genotipos,  2.04%  genotipos  resistentes,  34.7%  moderadamente  resistentes, 42.8% moderadamente susceptibles, 18.3% susceptibles, y 2.04% altamente susceptibles. El genotipo SQbr05 resistente, no se vio afectado por la severidad, al contrario SQbc04 genotipo susceptible, mostró reducciones significativas en peso fresco de tallo y raIz, (R2 = 0.71 y 0.98,el genotipo silvestre (S. mammosum es altamente susceptible, Meloidogyne incognita presentó 55.31% de presencia. El genotipo SQbr05 es promisorio para ser evaluado en campo.

  1. Egg retention and intrauterine embryonic development in Sceloporus aeneus (Reptilia: Phrynosomatidae: implications for the evolution of viviparity Retención de huevos y avance embrionario intrauterino en Sceloporus aeneus (Reptilia: Phrynosomatidae: implicaciones para la evolución de la viviparidad

    Directory of Open Access Journals (Sweden)

    Rodolfo García-Collazo

    2012-09-01

    Full Text Available Egg retention (ER and intrauterine embryonic development (IED have been considered intermediate steps in the evolution from oviparity to viviparity. Sceloporus aeneus is an oviparous lizard that is closely related to the viviparous species (Sceloporus bicanthalis. The present study addresses the following 2 questions: 1 Are intermediate stages of egg retention (ER and IED present in populations of Sceloporus aeneus? and 2 Are ER and/or IED explained by elevation, precipitation or phylogenetic effects? Results indicate that in S. aeneus, ER differs among populations. ER was negatively related to altitude and pluvial precipitation, whereas average environmental temperature had no effect on ER or IER. In contrast to previous observations of oviparous species related to viviparous species, populations of S. aeneus with advanced IED are associated with environmental factors such as low elevation and aridity instead of high elevation and cold climate, whereas the comparative analysis shows that there are no significative evolutionary changes throughout the phylogeny, which means that the altitude has no effect on the transition to the evolution of viviparity in S. aeneus-S bicanthalis.La retención de huevos (ER y el desarrollo embrionario intrauterino (IED han sido considerados pasos intermedios hacia la viviparidad. Sceloporus aeneus es un lacertilio ovíparo estrechamente relacionado a una especie vivípara (Sceloporus bicanthalis. El presente estudio derivó de las preguntas: ¿El ER y el IED presentes en las poblaciones de S. aeneus son estadios intermedios a la viviparidad? ¿ER y/o IED son explicados por la temperatura, altitud, precipitación pluvial o son un efecto filogenético? En S. aeneus, el ER y el IED fueron diferentes entre poblaciones. Los resultados indicaron que la ER se relacionó negativamente con la altitud y la precipitación pluvial, mientras que no se encontró efecto con la temperatura ambiental. En contraste con

  2. Innovative Comparison of Transient Ignition Temperature at the Booster Interface, New Stainless Steel Pyrovalve Primer Chamber Assembly "V" (PCA) Design Versus the Current Aluminum "Y" PCA Design

    Science.gov (United States)

    Saulsberry, Regor L.; McDougle, Stephen H.; Garcia,Roberto; Johnson, Kenneth L.; Sipes, William; Rickman, Steven; Hosangadi, Ashvin

    2011-01-01

    An assessment of four spacecraft pyrovalve anomalies that occurred during ground testing was conducted by the NASA Engineering & Safety Center (NESC) in 2008. In all four cases, a common aluminum (Al) primer chamber assembly (PCA) was used with dual NASA Standard Initiators (NSIs) and the nearly simultaneous (separated by less than 80 microseconds) firing of both initiators failed to ignite the booster charge. The results of the assessment and associated test program were reported in AIAA Paper AIAA-2008-4798, NESC Independent Assessment of Pyrovalve Ground Test Anomalies. As a result of the four Al PCA anomalies, and the test results and findings of the NESC assessment, the Mars Science Laboratory (MSL) project team decided to make changes to the PCA. The material for the PCA body was changed from aluminum (Al) to stainless steel (SS) to avoid melting, distortion, and potential leakage of the NSI flow passages when the device functioned. The flow passages, which were interconnected in a Y-shaped configuration (Y-PCA) in the original design, were changed to a V-shaped configuration (V-PCA). The V-shape was used to more efficiently transfer energy from the NSIs to the booster. Development and qualification testing of the new design clearly demonstrated faster booster ignition times compared to the legacy AL Y-PCA design. However, the final NESC assessment report recommended that the SS V-PCA be experimentally characterized and quantitatively compared to the Al Y-PCA design. This data was deemed important for properly evaluating the design options for future NASA projects. This test program has successfully quantified the improvement of the SS V-PCA over the Al Y-PCA. A phase B of the project was also conducted and evaluated the effect of firing command skew and enlargement of flame channels to further assist spacecraft applications.

  3. Construcción de competencias interculturales para el desarrollo de una propuesta de experiencias de aprendizaje para alumnos de primer año de medicina

    Directory of Open Access Journals (Sweden)

    Juan Pablo Murillo

    2015-01-01

    Full Text Available El presente ensayo tiene como objetivo plantear las bases conceptuales y metodológicas que permitieron el diseño de un conjunto de contenidos y experiencias de aprendizaje orientadas al logro de competencias interculturales de base en la formación del estudiante del primer año de estudios en la Escuela de Medicina de la Facultad de Medicina de San Fernando, para el periodo de estudios 2010-2013. Se describe el desarrollo de un conjunto de experiencias de aprendizaje orientadas a lo que denominamos ‘Gestión de la Otredad orientadas a introducir una base general de competencias interculturales. Se analizan las posibilidades y limitaciones de la propuesta en el marco del contexto cultural e institucional actualmente existente y se plantean elementos para un desarrollo futuro de estas competencias en el plan de estudios de medicina.

  4. Construcción de una identidad participativa: socialización en el primer año de estudios universitarios

    Directory of Open Access Journals (Sweden)

    José Luis Suárez Domínguez

    2017-01-01

    Full Text Available Este artículo explora la forma en cómo los estudiantes universitarios construyen una identidad de participación política mediante la socialización que ellos despliegan en el primer año de estudios dentro del área de humanidades en la Universidad Veracruzana. Esta socialización se condensa en la integración de diversos grupos que van complejizándose y cambiando su forma a lo largo del tiempo. Los grupos se articulan, a su vez, mediante un conjunto de prácticas que combinan tiempos, interacciones específicas y orientaciones diversas, generando con ello un sentido de pertenencia a la escuela al definirla bajo ciertos esquemas de legitimidad y reconocerla como un espacio válido desde el cual es posible formar parte de diversas actividades de protesta social.

  5. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  6. 143 - 148_Makeri et al.

    African Journals Online (AJOL)

    USER

    2015-06-01

    Jun 1, 2015 ... Yuan et al., 2003), antimicrobial activity (Sundarrao et al., 1993; Betancur-Galvis et al., 1999; Takashi et al., 2006), anti-parasitic, anti-malarial activities (Alali et al., 1998; Jaramillo et al., 2000; Luna et al.,. 2005). This study evaluates the antibacterial activity of extract of stem –bark and leaf extracts of Annona.

  7. Abu al-Layth al-Libi

    Science.gov (United States)

    2015-02-01

    success. As an Arab participant acknowledged very early on, “the situation was really harsh. All the brothers were tired,” as they lacked food and... glorious battles that occurred during the early Islamic period.133 He stressed the importance of the battlefield as the path to achieve honor and dignity...diaspora in Waziristan. In the words of Walid Othmani, a French jihadi trained by al-Qa`ida in Waziristan in 2008, “[Al-Libi] was someone well-known and

  8. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  9. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  10. Identification of differentially expressed genes induced by energy restriction using annealing control primer system from the liver and adipose tissues of broilers.

    Science.gov (United States)

    Wang, J W; Chen, W; Kang, X T; Huang, Y Q; Tian, Y D; Wang, Y B

    2012-04-01

    Female Arbor Acre broilers were divided into 2 groups at 18 d of age. One group of chickens had free access to feed (AL), and the other group of chickens had 30% energy restriction (ER). Adipose and hepatic RNA samples were collected at 48 d of age. We employed an accurate reverse-transcription (RT) PCR method that involves annealing control primers to identify the differentially expressed genes (DEG) between ER and AL groups. Using 20 annealing control primers, 43 differentially expressed bands (40 downregulated and 3 upregulated in the ER group) were detected from the hepatic tissue, whereas no differentially expressed bands were detected from the adipose tissue. It seems that energy restriction could induce more DEG in hepatic tissue than that in adipose tissue and could result in more gene-expression downregulation in hepatic tissue. Eight DEG (6 known and 2 unknown genes) were gained from hepatic tissue and confirmed by RT-PCR, which were all supported by released expressed sequence tag sequences. Their expressions were all downregulated by energy restriction in hepatic tissues. Six known genes are RPL7, RPLP1, FBXL12, ND1, ANTXR2, and SLC22A18, respectively, which seem to play essential roles in the protein translation, energy metabolism, and tumor inhibition. The alterations of gene expression in 3 selected genes, including ND1 (P < 0.01), FBXL12 (P < 0.01), and RPLP1 (P < 0.05), were supported by real-time quantitative RT-PCR reaction. Our data provide new insights on the metabolic state of broilers changed by energy restriction.

  11. Análisis de estabilidad del reactor PFTR para una reacción con cinética de primer orden utilizando la funcional de Lyapunov

    Directory of Open Access Journals (Sweden)

    Héctor Armando Durán Peralta

    2007-01-01

    Full Text Available Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR, en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizando la funcional de Lyapunov. Se trabaja con una cinética de primer orden pues un objetivo de este artículo es mostrar cómo se aplica la funcional de Lyapunov al análisis de un reactor de parámetros distribuidos, dado que es casi inexistente la literatura sobre el método de la funcional de Lyapunov aplicada a la estabilidad de reactores (técnica usada en el análisis de estabilidad de sistemas en ingeniería eléctrica. El análisis de estabilidad dio como resultado perfiles de temperatura y concentración asintóticamente estables para los casos PFTR isotérmico, no isotérmico con constante cinética independiente de la temperatura y PFTR no isotérmico adiabático. Para el PFTR con retiro de calor el análisis condujo a una región de estabilidad asintótica y a una región incierta donde puede o no haber oscilaciones.

  12. Autonomía y ajuste académico: un estudio con estudiantes portugueses de primer año

    Directory of Open Access Journals (Sweden)

    Ana Paula Soares

    2007-01-01

    Full Text Available Los niveles de autonomía psicológica de los alumnos desempeñan un papel importante en su ajuste a las presiones y desafíos de la vida universitaria. En este sentido, el presente estudio descriptivo analiza las relaciones entre los niveles de autonomía de los estudiantes en su entrada en la Enseñanza Superior y la calidad de su ajuste académico al final del primer año. Se aplicó el Iowa Developing Autonomy Inventory (IDAI en el inicio del año lectivo y el Questionário de Vivências Académicas (QVA al final de ese año a una muestra de 420 alumnos de primer año de la Universidade do Minho. Los resultados revelan que los alumnos poseen percepciones bastante positivas en cuanto a sus niveles de autonomía en las áreas de Gestión del tiempo, Movilidad e Interdependencia, y niveles más bajos en la Gestión del dinero, observándose algunas oscilaciones en función del género. Por otro lado, los alumnos cuya entrada en la Enseñanza Superior no implicó su abandono del hogar familiar, especialmente los de sexo masculino, presentan niveles más elevados de ajuste académico. Finalmente, los resultados sugieren que el ajuste académico se encuentra asociado a los niveles de autonomía de los alumnos, en particular en lo que concierne a la Gestión del tiempo, Independencia emocional de sus compañeros e Interdependencia.

  13. Relación del desempeño académico de estudiantes de primer año de universidad en Chile y los instrumentos de selección para su ingreso

    Directory of Open Access Journals (Sweden)

    Gastón Vergara-Díaz

    2017-01-01

    Full Text Available Si bien el rendimiento académico del estudiantado que ingresa a las universidades chilenas ha sido objeto de múltiples estudios, pocas investigaciones han analizado la relación que tienen los instrumentos de selección de ingreso y el rendimiento académico posterior. En una muestra de 440 estudiantes de Ingeniería Comercial de la Universidad Austral de Chile, pertenecientes a cinco promociones de primer año, se estudiaron los instrumentos de admisión a la carrera, y se determinó cuáles explican mejor el rendimiento académico. Para ello se utilizaron los resultados de las pruebas de selección universitaria (PSU y las notas de enseñanza media (NEM obtenidos por el estudiantado, en relación con el promedio semestral ponderado (PSP del primer año universitario. Se determinó que el promedio de NEM explica mejor el rendimiento académico estudiantil, al presentar la mejor correlación con el rendimiento académico del primer semestre y de manera más fuerte en el segundo.

  14. Pornographie als Metapher

    Directory of Open Access Journals (Sweden)

    Caroline Schubarth

    2010-02-01

    Full Text Available In diesem Artikel werden unterschiedliche metaphorische Verwendungen des Pornografiebegriffs und deren Implikationen untersucht. Während die Existenz von Pornografie der feministischen Anti-Porno-Bewegung als Erklärung für die anhaltende Diskriminierung von Frauen in westlichen Gesellschaften dient, nutzen rechtskonservative Kräfte den Pornografievorwurf als Rechtfertigung für die Zensur von als deviant empfundenen Identitäten und sexuellen Praktiken.

  15. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  16. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  17. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Incidencia del curso de Pre-cálculo en el desempeño en Cálculo I para estudiantes de primer ingreso de la Universidad Tecnológica de Panamá

    OpenAIRE

    Miller, Norma; Hernández, Alejandro

    2011-01-01

    La deficiente preparación matemática de los estudiantes que ingresan a la Universidad Tecnológica de Panamá es uno de los factores que contribuyen al alto porcentaje de estudiantes desaprobados en Cálculo I. A lo largo de los años la Universidad se ha enfrentado a este problema implementando diferentes modalidades de cursos preparatorios. En el verano del 2009 se ofreció por primera vez un curso de Pre-cálculo como nueva alternativa para preparar a los estudiantes de primer ingreso para cálcu...

  19. Ocio y deporte en el nacimiento de la sociedad de masas. La socialización del deporte como práctica y espectáculo en la España del primer tercio del siglo XX

    OpenAIRE

    Otero Carvajal, Luis Enrique

    2003-01-01

    En el primer tercio del siglo XX la sociedad de masas irrumpió con fuerza en el escenario de los países desarrollados. España no permaneció al margen de las convulsiones que sacudieron a Europa en el nacimiento de la sociedad de masas. La mayor disponibilidad de tiempo libre encontró un nuevo espacio en el deporte. En este complejo entramado, la práctica y la afición por el deporte fue difundiéndose a través de la escala social española, desde las restringidas elites de principios de siglo a ...

  20. Aplicaciones de los modelos multinivel al análisis de medidas repetidas en estudios longitudinales

    OpenAIRE

    María Victoria Zunzunegui; María Jesús García de Yébenes; Mathieu Forster; María Dolores Aguilar Conesa; Angel Rodríguez Laso; Ángel Otero

    2004-01-01

    Este trabajo es una introducción al análisis de medidas repetidas en estudios longitudinales. Se utiliza un marco analítico con dos etapas, ajustando modelos jerárquicos lineales con dos niveles. El primer nivel corresponde a la ocasión (tiempo) de medida y el segundo al individuo. Estos modelos estadísticos proceden de las ciencias sociales, en las que se han utilizado durante más de 25 años para analizar datos en organizaciones con múltiples niveles. Su aplicación permi...