WorldWideScience

Sample records for al primer huevo

  1. Alérgenos del huevo: digestión gastrointestinal, inmunorreactividad y mecanismos de desensibilización

    OpenAIRE

    Martos, Gustavo

    2012-01-01

    La alergia al huevo es una de las causas más frecuentes de hipersensibilidad inmediata a los alimentos en los países industrializados, sobre todo durante la infancia. La ubicuidad del huevo en los alimentos supone un gran riesgo de ingestión accidental para las personas alérgicas, que deben llevar una dieta muy restringida. En la presente Tesis Doctoral, se estudia la digestibilidad de distintos alérgenos del huevo empleando un modelo in vitro de digestión gastrointestinal fisiológicamente re...

  2. Puestas "de dos huevos" en la Pardela Grande" (Calonectris diomedea )

    OpenAIRE

    Mougin, Jean Louis

    2001-01-01

    Las puestas "de dos huevos" representaron el 0.52% del número total de puestas en la población de la Pardela Grande (Calonectris diomedea) de Selvagem Grande. Las puestas "de dos huevos" se encontraron principalmente en nidos atractivos ocupados por parejas reproductivas de poca experiencia. El primer huevo pareció haber sido puesto mayormente por hembras solitarias que, aprovechando el éxodo pre-postura, entran al nido temporariamente vacío de una pareja joven y de poca experiencia. Estas he...

  3. Huevos enriquecidos con omega 3

    OpenAIRE

    Viteri, Evelyn

    2013-01-01

    El presente trabajo es una contribución al estudio de usos de ingredientes no tradicionales; harina de algas, Macrocystis pyrifera, y la inclusión en raciones para aves de postura destinado a aumentar la concentración de omega 3 del huevo. Objetivo: Evaluar en la alimentación de la gallina la inclusión de harina de alga marina Macrocystis pyrifera con el fin de aumentar el valor de omega 3 en el huevo, y el grado de aceptación de un producto elaborado con el mismo en estudiante...

  4. Detección de alérgenos de huevo en fideos secos por método de elisa Detection of egg allergens in dried pasta using elisa method

    Directory of Open Access Journals (Sweden)

    María Julieta Binaghi

    2012-06-01

    Full Text Available Debido a la inminente incorporación al Código Alimentario Argentino del artículo 235 séptimo que contempla la rotulación de alérgenos en alimentos, resulta necesario realizar el control de productos comerciales para detectar la posible presencia de proteínas alergénicas. En la elaboración de fideos secos y de productos a base de harina de trigo pan y/o sémola de trigo candeal es probable la presencia de alérgenos de huevo por contaminación cruzada. El objetivo del presente trabajo fue determinar por un método de ELISA la posible contaminación con proteínas de huevo en productos elaborados con harina de trigo pan y/o sémola de trigo candeal provistos por una industria para verificar una posible contaminación con proteínas de huevo y analizar muestras comerciales con leyendas precautorias. Se analizaron diecinueve productos a base de harina de trigo pan y/o sémola de trigo candeal provistos por una industria y nueve muestras de fideos secos comerciales. El alérgeno huevo se analizó con kit de huevo de la marca r-biopharm. Las muestras se analizaron por duplicado siguiendo el protocolo de trabajo del kit. Entre las muestras provistas por la industria había: productos elaborados en línea cercana a elaboración de pastas con huevo en los que se obtuvieron valores por debajo del límite de cuantificación del kit; productos elaborados con bajo porcentaje de productos molidos que pudieron elaborarse con huevo, en los que se obtuvieron cantidades muy bajas de alérgeno huevo (menores a 5 ppm y productos elaborados con alto porcentaje de productos molidos que pudieron haberse elaborado con huevo en los que se obtuvieron concentraciones mayores de huevo (mayores a 5 ppm de huevo en polvo. En las muestras comerciales hubo cinco que presentaron concentraciones por debajo o igual al límite de cuantificación mientras que en las otras cuatro se obtuvieron concentraciones entre 5 y 12 ppm de huevo en polvo con el kit de r-biopharm. De

  5. Conocimientos, opiniones y prácticas respecto al huevo de gallina en familias de comunidades urbana-rural, Costa Rica Knowledge, opinions and practices related to chicken eggs in families of urban-rural communities, Costa Rica

    Directory of Open Access Journals (Sweden)

    Marcela Peña Vázquez

    2011-06-01

    Full Text Available Objetivo: Indagar sobre los conocimientos, opiniones y prácticas de la población respecto al consumo de huevo de gallina, con el objetivo de poder orientar los mensajes que se dirigen a la población en general, para mejorar el uso del mismo en los hogares. Materiales y método: Estudio descriptivo que aplica técnicas cualitativas y se apoya en variables cuantitativas. La población está compuesta por familias que residen en los distritos Central de Alajuela o Piedades de Santa Ana. Se empleó una muestra, seleccionada a conveniencia, 23 familias de Alajuela Centro y 29 de Piedades de Santa Ana. Además se trabajó con el personal de salud que labora en los Equipos Básicos de Atención en Salud. Resultados: Con respecto a conocimientos, las participantes conocen que el huevo es fuente de proteínas y vitaminas. Prefieren los huevos caseros y de cáscara de color oscuro; sin embargo consumen más los huevos industriales. Las razones de consumir huevo son la costumbre, buen sabor, versatilidad, rapidez y facilidad para prepararlo, además de un precio accesible. A nivel nutricional comparan el huevo con el aguacate y con alimentos pertenecientes al grupo de las carnes. Respecto a las prácticas, el huevo se consume en todos los tiempos de comida y principalmente en frituras. Discusión: no existen diferencias marcadas entre los conocimientos, prácticas y opiniones, entre población urbana y rural estudiada. Los conocimientos relacionados con el huevo tanto en las comunidades y el personal de salud son generales y difieren entre sí, dejando entrever una falta de información en ambos gruposObjective: To inquire into the knowledge, views and practices of the population regarding the consumption of chicken eggs, in order to target messages that go to the general population, to improve the use of the same household. Materials and Methods: A descriptive study applies techniques based on qualitative and quantitative variables. The population

  6. EFECTO DE DENSIDAD POBLACIONAL DE HUEVOS SOBRE VIABILIDAD Y TIEMPO DE DESARROLLO DE Drosophila melanogaster (DROSOPHILIDAE

    Directory of Open Access Journals (Sweden)

    OSORIO JULIO

    2008-08-01

    Full Text Available Para estimar el efecto de la densidad poblacional de huevos sobre la viabilidad huevoadulto de Drosophila melanogaster se realizaron tres tratamientos en frascos con medio de cultivo agar-banano: a densidad de 10, 50 y 90 huevos. La variable de respuesta fue la proporción de individuos adultos emergidos desde la aparición del primer imago hasta 15 días después de la siembra. Las viabilidades huevo-adulto promedio fueron 0,320, 0,338 y 0,328 para las densidades de 10, 50 y 90 huevos respectivamente. No se evidenciaron diferencias significativas entre los tres tratamientos (p>0.05. Por lo tanto, no se detectó en este estudio influencia de la densidad poblacional de huevos sobre la viabilidad huevo-adulto. Probablemente debido a que la proporción entre el número de huevos y la cantidad de medio fue suficientemente alta para no generar competencia en otros estadios del desarrollo huevo/adulto.

  7. Oferta y demanda de servicios de salud en Manizales. Primer semestre 1995 al primer semestre 1997.

    Directory of Open Access Journals (Sweden)

    Alba Lucía Vélez Arango

    2009-10-01

    Full Text Available Se analizó el comportamiento de los indicadores de cobertura de afiliación al Sistema de Seguridad Social en Salud (SSSS, capacidad instalada de las instituciones del sector en términos de recursos físicos y humano, extensión e intensidad de uso de la consulta externa médica general, consulta odontológica y consulta de urgencia, al igual que la utilización de los servicios hospitalarios en términos de porcentaje ocupacional y productividad, en el período comprendido entre enero, 1995 y diciembre, 1996. En el período de estudio se observó en Manizales un aumento en la afiliación al SSSS en el régimen contributivo, pasando de 262,858 afiliados en 1995 a 311,901 a diciembre de 1996, lo cual representó un aumento de 18% con una cobertura aproximada de 80% del total de la población objetivo. En relación con la cobertura de afiliación en el Régimen Subsidiado a finales de 1996 se informó un total de 37,177 afiliados al SSSS en la ciudad de Manizales, representando una cobertura de 80% de la población identificada mediante el Sistema de Identificación de Población (SISBEN. En lo que tiene que ver con la extensión de uso se observó un aumento en la consulta odontológica, consulta externa médica general y consulta de urgencias durante el período 1995-1997. En relación con la intensidad de uso no se observó una variación significativa en la consulta externa médica general y de urgencias, mientras que la consulta odontológica presentó un ligero aumento en 1997. En cuanto a la utilización de los servicios de hospitalización se observaron diferencias apreciables entre las distintas Empresas Sociales del Estado existentes en la ciudad. Por último, los resultados encontrados en relación con la utilización de los servicios de hospitalización durante el período 1995-1997 tienen gran importancia para el análisis de la oportunidad y calidad de la atención en salud y en la planeación de la infraestructura de servicios

  8. Phosphatizing of Mg particles to improve the protective performance of Mg-rich primer on A2024 Al alloy

    Science.gov (United States)

    Wang, Jianguo; Zuo, Yu; Tang, Yuming; Lu, Xiangyu

    2014-02-01

    Mg-rich primer as a new type protective coating provides cathodic protection for Al alloy. In this paper, a kind of phosphatizing surface treatment on Mg particles was studied in order to improve the protective performance of Mg-rich primer. After treated with phosphoric acid, a protective magnesium phosphate layer was formed on the surface of Mg particles, which had no negative influence on the cathodic protection of the Mg-rich primer for Al alloy. The coating resistance of the treated Mg-rich primer was bigger than that of untreated primer, meanwhile the coating capacitance of the treated Mg-rich primer was smaller than that of untreated primer, suggesting that the barrier effect of the primer was improved and the lifetime was extended. The magnesium phosphate layer could reduce the consumption rate of Mg particles. Meanwhile, the phosphate radicals transported to Al alloy substrate to form a product layer composed of magnesium phosphate and aluminum phosphate on the substrate surface, which decreased the corrosion rate of Al alloy and improved the protective performance of the primer.

  9. Respuesta productiva de gallinas semipesadas inducidas al descanso ovárico en diferentes edades

    Directory of Open Access Journals (Sweden)

    Luis Galeano V.

    2012-12-01

    Full Text Available Objetivo. Evaluar el efecto de la inducción al descanso ovárico (DO a diferentes edades sobre la respuesta productiva en aves semipesadas productoras de huevo comercial. Materiales y método. Se usaron 840 aves de la línea Hy Line Brown con 64 semanas de edad, distribuidas en 10 tratamientos, consistentes en tres edades (65, 70 y 75 semanas con la aplicación de tres períodos de ayuno (5, 10 y 15 días y un control (sin DO. El análisis estadístico utilizó un modelo completamente aleatorizado, anidado, efecto fijo y balanceado. Se evaluó consumo de calcio durante el ayuno (g/ave/día, consumo de alimento (g/ave/día, porcentaje de producción, peso del huevo (g, conversión por masa de huevo y huevos por ave alojada (HAA. Resultados. La edad presentó efecto significativo (p<0.05 sobre las variables consumo de alimento, día del primer huevo postmuda, días sin producción, día postmuda de retorno al 50% de producción, peso del huevo, número de huevos, masa huevos, conversión y porcentaje de producción (p<0.01. Al comparar con el control, el tratamiento 75-5 presentó efecto significativo (p<0.05 para las variables: consumo de alimento, número de huevos promedio, masa huevos y conversión. Conclusiones. Las aves con mayor período de ayuno presentaron mayor período improductivo postmuda, grandes pérdidas de peso y alto consumo de alimento, lo que genera alta conversión e ineficiencia productiva. En comparación con reportes de literatura sobre DO en aves livianas, las aves semipesadas llegan al cese de producción en menos días y su período improductivo es menor.

  10. El alga Sargassum spp. como alternativa para reducir el contenido de colesterol en el huevo

    OpenAIRE

    Silvia Carrillo; Bahena, A.; Casas, M.; M.E. Carranco; C.C. Calvo; E. Ávila; F. Pérez-Gil

    2012-01-01

    Para determinar el efecto que tiene en el contenido de colesterol del huevo la adición del alga marina (AM) Sargassum spp. en la dieta de gallinas ponedoras, se utilizaron 225 gallinas Leghorn, de 19 semanas de edad, distribuidas al azar en cinco tratamientos (0, 2, 4, 6 y 8 % del alga marina). El experimento tuvo una duración de cinco semanas, durante las que se registraron las variables productivas. La calidad física se evaluó en 75 huevos por tratamiento. Se tomaron 35 piezas de cada trata...

  11. huevo de tortuga lora (lepidochelys olivacea

    Directory of Open Access Journals (Sweden)

    M\\u00F3nica Pereira-Zamora

    2007-01-01

    Full Text Available Penetración de Vibrio mimicus a través de la cáscara del huevo de tortuga lora (Lepidochelys olivacea. El objetivo de esta investigación consistió en determinar la capacidad de penetración del Vibrio mimicus a través de la cáscara del huevo. La investigación se realizó en el Centro Nacional de Ciencia y Tecnología de Alimentos en el año 2000. Se inoculó la superfi cie de la cáscara con la bacteria y se procedió a incubar las muestras por 72 horas a 25ºC. Después de este período se observaron las muestras bajo el microscopio electrónico. Los resultados obtenidos demuestran que el Vibrio mimicus se reproduce en la superfi cie externa de la cáscara del huevo de tortuga lora, y no es capaz de penetrarla después de las 72 horas de incubación a 25ºC. Por lo tanto, cualquier tratamiento que se aplique con el fi n de reducir la contaminación con el vibrio y mejorar la inocuidad de los huevos, debe aplicarse en su exterior.

  12. Luis López-Ballesteros: primer traductor de las obras completas de Freud al castellano

    OpenAIRE

    Juan Manuel Martín Arias; Lorenzo Gallego Borghini

    2011-01-01

    El castellano fue el primer idioma al que se tradujeron las obras completas de Sigmund Freud. A ello contribuyeron diversos factores, entre los que se destaca la figura de Luis López-Ballesteros, a quien le encargó la traducción la editorial Biblioteca Nueva. En este artículo se esbozan someramente la recepción del psicoanálisis en España y las traducciones de Freud al español y se ofrece una breve semblanza de Luis López-Ballesteros. --------------------------------------------- Luis López-B...

  13. Congelación de semen de carnero en pellets con los diluyentes Tris-glucosa-yema de huevo o Lactosa-yema de huevo

    Directory of Open Access Journals (Sweden)

    F. I. Brito

    2004-01-01

    Full Text Available El objetivo del trabajo fue comparar la recuperación de la motilidad al descongelar el semen congelado en pellets utilizando el diluyente Tris glucosa-yema de huevo o Lactosa-yema de huevo. Se obtuvieron 30 eyaculados de nueve carneros por medio de una vagina artificial y se evaluó el volumen, la motilidad progresiva, la concentración y la morfología espermática. Cada eyaculado se dividió en dos partes, una de ellas se diluyó con Tris-glucosa yema de huevo y la otra con Lactosa yema de huevo, de manera que la dilución final contuviera 100 x 106 de espermatozoides en 0.1 ml. Los pellets se prepararon goteando 0.1 ml del semen diluido en perforaciones realizadas en hielo seco. Se evaluó la motilidad inicial, después de diluir y al descongelado. Se evaluó la motilidad de cinco pellets de cada eyaculado preparado con cada diluyente (300 en total. Los datos se analizaron estadísticamente mediante análisis de varianza, considerando la motilidad progresiva como variable dependiente y transformando al arcoseno los valores expresados en porcentaje. No se encontraron diferencias en la motilidad inicial de los eyaculados diluidos con tris o Lactosa (P>0.05. La motilidad espermática al descongelar fue significativamente mayor (P<0.05 en el semen diluido con Lactosa-yema (45.8%, que con Tris-glucosa-yema (40.2%

  14. Los huevos en La Colmena

    Directory of Open Access Journals (Sweden)

    José Molina

    2014-10-01

    Full Text Available Las lenguas proponen interesantes juegos de recepción. En el español de nuestro país, por ejemplo, con la palabra ‘huevos’ nos referimos a los genitales masculinos, mientras que en italiano se trata del título del libro de poemas de Elisa Biagini (Florencia, Italia, 1970. Lo interesante surge cuando nos enteramos de que ‘huevo’ en italiano es masculino al singular y femenino al plural. El poemario de Biagini juega con esa transición de géneros. En el tantas veces atacado ‘horizonte masculino’ de la poesía italiana nace esta voz que llena de intenciones las imágenes. No hay referencias directas, sino el gesto hábil que sólo la poesía puede producir en el juego de la palabra. Biagini propone combatir la discursividad masculina de su tradición desde la dispersión de su voz: elabora figuras femeninas que aman hombres y mujeres, que son niñas, amantes y madres, sin necesidad de renunciar a la perversidad y al humor. El ejemplo más claro de esto es el poema “Feminist icon”, donde la misma mano que acaba de masturbarse hace la señal de la cruz entre el cuerpo y un burro de planchar. Biagini ha publicado tres libros de poemas: Questi nodi (Florencia, Gazebo, 1993, Uova (Génova, Zona, 1999 y l’ospite (Torino, Einaudi, 2004. Los poemas aquí traducidos fueron tomados de una antología personal.

  15. NIVELES DE MERCURIO EN HUEVOS, EMBRIONES Y NEONATOS DE Trachemys callirostris (TESTUDINES, EMYDIDAE

    Directory of Open Access Journals (Sweden)

    BEATRIZ RENDÓN-VALENCIA

    2014-01-01

    Full Text Available Cuantificamos la concentración total de mercurio en cáscaras, yemas y embriones de 16 nidos de hicotea (Trachemys callirostris. Los nidos fueron colectados en diferentes estadios de desarrollo embrionario. No hubo una correlación entre el tiempo estimado desde el desove y los niveles de mercurio en los huevos, sugiriendo que el metal no fue absorbido del substrato, sino que probablemente éste fue transferido a los huevos durante el proceso de foliculogénesis en las hembras reproductivas, las cuales bioacumularon el mercurio de fuentes ambientales. La concentración promedio de mercurio fue mayor en los embriones que en las cáscaras o yemas, indicando que los embriones también bioacumulan el metal presente en otros tejidos del huevo. La variación de la concentración de mercurio dentro de una misma nidada fue relativamente alta. Las concentraciones de mercurio en las yemas no estuvieron asociadas con ninguna de las medidas de fitness que fueron evaluadas (éxito de eclosión, tamaño inicial de los neonatos y tasas de crecimiento de los juveniles en el primer mes. Después de cinco meses de mantenimiento en cautiverio, en un ambiente libre de mercurio, 86 % de los juveniles había eliminado completamente este metal de sus tejidos.

  16. El movimiento estudiantil reformista frente al primer episodio de la 'laica o libre' [mayo de 1956

    Directory of Open Access Journals (Sweden)

    Juan Sebastián Califa

    2009-11-01

    Full Text Available En mayo de 1956 se libró en la Argentina el primer episodio del conflicto "laica o libre". Así se llamó al enfrentamiento entre reformistas, contrarios al artículo 28 del decreto-ley 6.403 que permitía a las universidades privadas otorgar títulos habilitantes, y católicos favorables al mismo. En este contexto, se registró un ascendente proceso de tomas estudiantiles de secundarios y universidades. El conflicto le costó el cargo al católico ministro de Educación nacional Atilio Dell'Oro Maini y a los rectores de las universidades de Buenos Aires [UBA] y de Córdoba [UNC]. No obstante las tensas implicancias que el mismo deparó dentro del gobierno de la autoproclamada "Revolución Libertadora", poco se conoce sobre él. En este artículo iniciaré su estudio. Para ello reconstruiré los hechos a través de los diarios La Nación y La Prensa, entre otras fuentes y bibliografía. Particularmente concentraré mi atención en el estudiantado reformista de la UBA

  17. "El Pablote" : una nueva mirada al primer corrido dedicado a un traficante de drogas

    OpenAIRE

    Ramirez Pimienta, Juan Carlos

    2016-01-01

    Si bien la narcocultura se asocia con el México de finales del siglo xx e inicios del xxi, este fenómeno cultural tiene sus raíces en las primeras décadas del siglo xx. El presente ensayo explora los origines de la narcocultura haciendo una revisión del que probablemente sea el primer narcocorrido. “El Pablote”, fue grabado en 1931 y dedicado al narcotraficante de Ciudad Juárez Pablo González, conocido como Pablote así como el rey de la morfina en Ciudad Juárez. Si bé la narcocultura s’ass...

  18. Modificación en la composición de ácidos grasos del huevo al incluir aceite de sardina y ácido linoleico conjugado en dietas para gallinas ponedoras Modulation in egg fatty acids composition when laying hens diets are supplemented with sardine oil and conjugated linoleic acid

    Directory of Open Access Journals (Sweden)

    S Carrillo

    2012-01-01

    Full Text Available Actualmente el consumo regular de ácidos grasos omega 3 (C18:3 ALA, C20:5 EPA, C22:6 DHA y de ácido linoleico conjugado (C18:2 CLA es recomendado debido a la importancia que estos compuestos bioactivos tienen en la prevención y control de enfermedades cardiovasculares, diabetes y diferentes tipos de cáncer. El objetivo de este estudio fue determinar el efecto sobre la composición en ácidos grasos del huevo cuando la dieta de las gallinas es suplementada con aceite de sardina y CLA. 240 gallinas Bovans White fueron distribuidas aleatoriamente en cuatro tratamientos con cinco réplicas de 12 aves cada una. Los tratamientos fueron: testigo (T1 con una dieta basal, la misma que T1 más 2,5% de aceite de sardina (T2, la misma que T2 pero adicionando 1% y 2% de CLA (T3 y T4 respectivamente. El ensayo experimental tuvo una duración de cuatro semanas. Al final de este período, 50 huevos de cada tratamiento fueron tomados para realizar la determinación de ácidos grasos por cromatografía de gases. Con respecto al tratamiento testigo, los resultados mostraron un incremento en la concentración total de ácidos grasos omega 3 (1,6% vs 6,0% del total de ácidos grasos y de CLA (0,7% vs 3-5% del total de ácidos grasos en el huevo de los tratamientos T3, T4 y T5 en conjunto, y una relación n6:n3 de 11:1 vs 1.3:1 (P The regular intake of omega 3 fatty acids (C18:3 ALA, C20:5 EPA, C22:6 DHA and conjugated linoleic acid (C18:2 CLA is currently recommended due to their importance in the prevention and control of cardiovascular diseases, diabetes and several types of cancer. The aim of this study was to determine the effect of supplementing laying hens diets with sardine oil and CLA on egg fatty acid composition. 240 Bovans White hens were randomly distributed into four treatments with 5 replicates of 12 hens each one. The treatments consisted in a control diet (T1, T1 plus 2.5% of sardine oil (T2, and T2 padded with 1% and 2% of CLA (T3 and T4

  19. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    JULIANA GARCÍA

    2011-01-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de huevos/hembra/día con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.

  20. EDAD AL PRIMER PARTO EN VACAS HOLSTEIN DE LECHERÍA ESPECIALIZADA EN COSTA RICA

    Directory of Open Access Journals (Sweden)

    Mauren Salazar-Carranza

    2013-01-01

    Full Text Available El objetivo de este trabajo fue determinar la edad al primer parto (EPP en vacas Holstein pu- ras en lecherías especializadas de Costa Rica. Se realizó un es- tudio longitudinal prospectivo histórico con 46 029 animales de raza Holstein pura de lechería especializada de Costa Rica, durante el periodo comprendido entre los años 2000 y 2010. Se incluyeron los datos de vacas que contaban con registros completos para todas las variables del estudio, registrados en el programa VAMPP Bovino 3.0. Se calculó la EPP por las variables de zona ecológica, la época de nacimiento, el año de parto, el índice de endogamia, el número de lactancias de la madre y el tipo de parto que dio origen al animal en estudio. Los datos fueron analizados por medio de estadística descrip- tiva (porcentajes, promedios, desviación estándar [DE] y el cálculo de intervalos de confianza (IC95%. La EPP prome- dio fue 30,7 meses (D.E: 6,8; IC 95%: 30,6 – 30,8. Durante el periodo, el promedio de la EPP varió entre los 30 y 31 meses; sin embargo, en los años 2006 y 2007 mostró una tendencia a disminuir. La EPP presentó diferencias significativas entre estratos según la época de nacimiento, el número de lactancia de la madre, la zona ecológica, el año de nacimiento, el tipo de parto de la madre y el coeficiente de endogamia de la vaca. Al igual que las tendencias mundiales, mostró tendencia a decrecer en Costa Rica; y las variables de animal, tiempo y ambiente mostraron un efecto sobre la EPP. Excepto el coefi- ciente de endogamia (a mediano y largo plazo, esos factores no son modificables en condiciones de pastoreo, que son los imperantes en la gran mayoría de fincas estudiadas.

  1. Actividad in vitro de los venenos de Lachesis muta y Bothrops atrox sobre la viabilidad y desarrollo embrionario de los huevos de Ascaris suum

    Directory of Open Access Journals (Sweden)

    Claudia Paredes

    2014-06-01

    Full Text Available Los venenos de serpientes son concentrados polienzimáticos cuya actividad biológica sobre algunas bacterias y protozoos ha sido comprobada. El objetivo principal del presente trabajo fue estudiar la actividad in vitro de los venenos totales de las serpientes Lachesis muta y Bothrops atrox sobre la viabilidad y el desarrollo embrionario de los huevos de Ascaris suum. Se emplearon los venenos totales en concentraciones de 2, 4, 8 y 16 mg/mL sobre huevos no embrionados y larvados in vitro. Se comparó la actividad de los venenos con la de otras sustancias como el hipoclorito de sodio al 5,25%, Albendazol (solución comercial y solución salina. Ambos venenos, en concentraciones de 4, 8 y 16 mg/mL, inhibieron la blastulación de estos huevos; hasta el sexto día de incubación; en cambio en concentración de 2 mg/mL la inhibición se dio hasta el cuarto día. Posteriormente iniciaron un proceso de embrionación aparentemente normal hasta la formación del estadio infectante. El veneno de B. atrox fue el que presentó el mayor efecto inhibitorio en concentración de 16 mg/mL. El hipoclorito de sodio destruyó el 100% de los huevos, mientras el albendazol ocasionó que los huevos iniciaran un proceso de segmentación anormal que originó su degeneración. Se concluye que los venenos de L. muta y B. atrox muestran actividad inhibitoria al inicio de la blastulación de los huevos de A. suum y no ejercen ningún efecto en los huevos larvados.

  2. EFECTO DE LA EDAD AL PRIMER PARTO SOBRE PARÁMETROS PRODUCTIVOS EN VACAS JERSEY DE COSTA RICA

    OpenAIRE

    Gloriana Castillo-Badilla; Mauren Salazar-Carranza; Jaime Murillo-Herrera; Juan Jos\\u00E9 Romero-Z\\u00FA\\u00F1iga

    2013-01-01

    El objetivo del presente trabajo fue determinar el efecto de la edad al primer parto (EPP) sobre la producción láctea en vacas Jersey. Se analizaron los registros de 28 367 vacas pertenecientes a 545 hatos, registrados en el programa VAMPP Bovino 3.0 entre enero del año 2000 a diciembre del 2010. Se empleó estadística descriptiva y modelos lineales mixtos. La EPP promedio fue 29,35 meses (DE: 6,77), con una tendencia al incremento durante el periodo estudio. Se observó un efecto significativo...

  3. EFECTO DE DENSIDAD POBLACIONAL DE HUEVOS SOBRE VIABILIDAD Y TIEMPO DE DESARROLLO DE Drosophila melanogaster (DROSOPHILIDAE Effect Of Eggs Population Density On Viability And Time Of Development Of Drosophila melanogaster (Drosophilidae

    Directory of Open Access Journals (Sweden)

    CRISTIAN FONG

    Full Text Available Para estimar el efecto de la densidad poblacional de huevos sobre la viabilidad huevoadulto de Drosophila melanogaster se realizaron tres tratamientos en frascos con medio de cultivo agar-banano: a densidad de 10, 50 y 90 huevos. La variable de respuesta fue la proporción de individuos adultos emergidos desde la aparición del primer imago hasta 15 días después de la siembra. Las viabilidades huevo-adulto promedio fueron 0,320, 0,338 y 0,328 para las densidades de 10, 50 y 90 huevos respectivamente. No se evidenciaron diferencias significativas entre los tres tratamientos (p>0.05. Por lo tanto, no se detectó en este estudio influencia de la densidad poblacional de huevos sobre la viabilidad huevo-adulto. Probablemente debido a que la proporción entre el número de huevos y la cantidad de medio fue suficientemente alta para no generar competencia en otros estadios del desarrollo huevo/adulto.For estimating the effect from population density of eggs over viability egg-adult in Drosophila melanogaster, it was made three treatments in flasks with agar-banana culture media: densities of 10, 50 and 90 eggs. The effect evaluated was the adult’s proportion that emerged after 15 days of planting. The mean proportions of viability egg-adult were 0.32, 0.338 and 0.328 for the density of 10, 50 and 90 eggs respectively. Significant differences in viability were not evident (p>0.05. Consequently, it was not found effects from the eggs densities in the present study over egg-adult viability. These results probably were due to that the relation among number of eggs and quantity of culture media was not enough of a high for generate competition at another stadiums through the egg-adult development.

  4. Primer caso de resistencia al amitraz en la garrapata del ganado Boophilus microplus en México

    OpenAIRE

    Noé Soberanes Céspedes; Minerva Santamaría Vargas; Hugo Fragoso Sánchez; Zeferino García Vázquez

    2002-01-01

    El objetivo de este estudio fue documentar el primer caso de la resistencia de la garrapata B. microplus al Amitraz, en México. Se obtuvo una muestra de garrapatas B. microplus del municipio de Emiliano Zapata, Tabasco, con reportes de fallas de control con este acaricida. La cepa de garrapatas fue denominada “San Alfonso” y se utilizaron larvas (F1) provenientes de la generación parental de hembras repletas, éstas se probaron con dosis discriminate de Amitraz 0.0002 %, (Taktic®) en formulaci...

  5. Edad al primer casamiento en el Uruguay del siglo XIX y primeras décadas del XX

    Directory of Open Access Journals (Sweden)

    Egaña, Ana

    2003-01-01

    Full Text Available La edad al primer casamiento es un dato importante a la hora de determinar el comienzo de la vida reproductiva real de las mujeres. La duración del período reproductivo útil y el número potencial de hijos a ser procreados depende de esto último. La información para este estudio se extrajo de archivos parroquiales tanto de la capital como de otras ciudades del país. Se analiza el cambio de pautas en el transcurrir del tiempo, así como los diferentes comportamientos según el origen en el caso de inmigrantes. Por último los datos obtenidos son interpretados en función del contexto sociohistórico del lugar.

  6. EFECTO DE LA EDAD AL PRIMER PARTO SOBRE PARÁMETROS PRODUCTIVOS EN VACAS JERSEY DE COSTA RICA

    Directory of Open Access Journals (Sweden)

    Gloriana Castillo-Badilla

    2013-01-01

    Full Text Available El objetivo del presente trabajo fue determinar el efecto de la edad al primer parto (EPP sobre la producción láctea en vacas Jersey. Se analizaron los registros de 28 367 vacas pertenecientes a 545 hatos, registrados en el programa VAMPP Bovino 3.0 entre enero del año 2000 a diciembre del 2010. Se empleó estadística descriptiva y modelos lineales mixtos. La EPP promedio fue 29,35 meses (DE: 6,77, con una tendencia al incremento durante el periodo estudio. Se observó un efecto significativo de la EPP sobre la producción (kg/305 d en las dos primeras lactancias (P41 meses. Las vacas sin retención de placenta (RMF produjeron +450 kg/305 días (P = 0,0022 que con RMF; mientras, el índice de endogamia y el tipo de parto no tuvieron efecto sobre la producción. En la segunda lactancia, las variables de estudio afectaron la producción de forma similar a la primera; sin embargo, la edad al segundo parto no afectó la producción subsecuente. Hubo un efecto lineal de la EPP sobre la producción de leche de la primera y la segunda lactancia; así, la EPP, parece tener un efecto no solo sobre la primera lactancia sino, también, en el rendimiento productivo posterior.

  7. Hábitos higiénico-dietéticos respecto al consumo de alimentos ricos en yodo durante el primer trimestre de la gestación

    OpenAIRE

    Francés Ribera, Lidia; Torres Costa, Mª T.; Falguera, Gemma; Prieto de Lamo, Gemma; Gallardo, Vicenta; Forn, Rosa; Costa, Yolanda

    2008-01-01

    Objetivo: Conocer los hábitos higiénico-dietéticos de las mujeres embarazadas respecto al consumo de alimentos ricos en yodo durante el primer trimestre de la gestación. Material y método: Estudio observacional, descriptivo, transversal y multicéntrico. Se estudiaron las mujeres embarazadas en el primer trimestre de la gestación que acudieron a la consulta de control del embarazo del programa de atención a la salud sexual y reproductiva (ASSIR) de la Región Sanitaria del Ámbito Centro del Ins...

  8. El consumo de huevos podría prevenir la aparición de deficiencia de vitamina D en escolares

    Directory of Open Access Journals (Sweden)

    Elena Rodríguez-Rodríguez

    2013-06-01

    Full Text Available Introducción: La vitamina D es esencial para la prevención de diversas enfermedades crónicas. Aunque se puede sintetizar a nivel cutáneo, esta fuente no es siempre suficiente para cubrir sus necesidades, por lo que el consumo de alimentos ricos en la misma, como el huevo, podría ser muy beneficioso en individuos que están en riesgo de presentar deficiencia. Objetivo: Estudiar la relación entre el estatus en vitamina D y el consumo diario de huevos en un colectivo de escolares. Metodología: Se incluyeron 564 escolares (9 a 12 años de la Comunidad de Madrid. La ingesta de alimentos, de energía y nutrientes (incluidos el huevo y la vitamina D, se determinó empleando un registro del consumo de alimentos durante 3 días. Se calculó el Índice de Masa Corporal a través del peso corporal y la talla. Se valoró el colesterol total, lipoproteínas, triglicéridos y vitamina D sérica. Resultados: El consumo medio de huevos fue de 32,7 ± 20,9 g/día (inferior a 0,5 huevo/día recomendados en el 36,3% de los escolares. Se dividió a los escolares en función de que tuvieran un consumo > o < 0,5 huevo/día (grupos SH e IH, respectivamente. La ingesta y los niveles séricos de vitamina D fueron significativamente superiores en el grupo SH que en el IH. Además, los primeros tuvieron menor riesgo de presentar deficiencia moderada de vitamina D (< 50 nmol/L (OR = 0,41 (0,19-0,88; p = 0,022. No se observaron diferencias significativas entre los grupos en relación con las cifras de colesterol total y triglicéridos. Conclusión: Es recomendable fomentar el consumo de al menos 0,5 huevo/día entre la población infantil debido a su alto contenido en vitamina D, lo que podría evitar la aparición de problemas de salud.

  9. Apgar bajo al nacer y convulsiones neonatales. Desarrollo motor grueso en el primer año de vida.

    Directory of Open Access Journals (Sweden)

    Carlos Armando Echandía

    2009-11-01

    Full Text Available Objetivo: Determinar si haber tenido un Apgar bajo a los cinco minutos y/o convulsiones neonatales aumenta el riesgo de trastornos del desarrollo motor grueso, que se identifican como resultado anormal de Infanib al año de edad. Diseño: Cohorte histórica. Escenario: Programa de seguimiento de recién nacidos de riesgo en un hospital de nivel 1 de complejidad, con una población de estrato socioeconómico bajo de Cali entre 1989 y 1997. Población: Se incluyeron 287 lactantes que completaron un año de seguimiento en el programa. Intervenciones: No aplica. Desenlaces principales: Frecuencia de compromiso neuromotor estimado mediante la prueba de Infanib. Resultados: Al año se evaluaron 80% de los niños que eran parte del programa. En 39 (13.6% hubo un Apgar anormal a los 5 minutos. En 36 (12.5% presentaron convulsiones neonatales, asociadas principalmente con asfixia perinatal severa e hipoglicemia. La prueba de Infanib fue anormal en 47 niños para una incidencia acumulada de 16.4% y una densidad de incidencia de 1.3 casos nuevos por 100 lactantes-año. La presencia de convulsiones se asoció con un Infanib anormal (RR crudo = 2.39 IC 95% 1.37-4.16. No hay modificación de efecto entre Apgar bajo y convulsiones. De los potenciales modificadores de efecto sólo el antecedente de meningitis bacteriana confundió el estimativo de la asociación entre convulsiones y un Infanib anormal. Conclusiones: Tanto las convulsiones neonatales como la meningitis bacteriana se asociaron independientemente con un Infanib anormal al año. Las convulsiones son un factor de riesgo importante (RR ajustado = 2.51 IC 95% 1.10-5.72 y fácil de reconocer que permite al clínico identificar pacientes con alto riesgo de compromiso neuromotor durante el primer año de vida.

  10. Apgar bajo al nacer y convulsiones neonatales. Desarrollo motor grueso en el primer año de vida

    Directory of Open Access Journals (Sweden)

    Juan Gabriel Ruiz

    2006-03-01

    Full Text Available Objetivo: Determinar si haber tenido un Apgar bajo a los cinco minutos y/o convulsiones neonatales aumenta el riesgo de trastornos del desarrollo motor grueso, que se identifican como resultado anormal de Infanib al año de edad. Diseño: Cohorte histórica. Escenario: Programa de seguimiento de recién nacidos de riesgo en un hospital de nivel 1 de complejidad, con una población de estrato socioeconómico bajo de Cali entre 1989 y 1997. Población: Se incluyeron 287 lactantes que completaron un año de seguimiento en el programa. Intervenciones: No aplica. Desenlaces principales: Frecuencia de compromiso neuromotor estimado mediante la prueba de Infanib. Resultados: Al año se evaluaron 80% de los niños que eran parte del programa. En 39 (13.6% hubo un Apgar anormal a los 5 minutos. En 36 (12.5% presentaron convulsiones neonatales, asociadas principalmente con asfixia perinatal severa e hipoglicemia. La prueba de Infanib fue anormal en 47 niños para una incidencia acumulada de 16.4% y una densidad de incidencia de 1.3 casos nuevos por 100 lactantes-año. La presencia de convulsiones se asoció con un Infanib anormal (RR crudo = 2.39 IC 95% 1.37-4.16. No hay modificación de efecto entre Apgar bajo y convulsiones. De los potenciales modificadores de efecto sólo el antecedente de meningitis bacteriana confundió el estimativo de la asociación entre convulsiones y un Infanib anormal. Conclusiones: Tanto las convulsiones neonatales como la meningitis bacteriana se asociaron independientemente con un Infanib anormal al año. Las convulsiones son un factor de riesgo importante (RR ajustado = 2.51 IC 95% 1.10-5.72 y fácil de reconocer que permite al clínico identificar pacientes con alto riesgo de compromiso neuromotor durante el primer año de vida.

  11. Mecanismos de tribalización en la patagonia: desde la gran crisis al primer gobierno peronista.

    Directory of Open Access Journals (Sweden)

    Walter Delrio

    2005-12-01

    Full Text Available En 1937 el gobierno argentino decide desalojar y trasladar a la tribu Nahuelpán bajo acusaciones de extranjería e in-civilización. Luego de seis años, la medida es revisada y se inicia un proceso de restitución parcial de las tierras involucradas seleccionándose desde el estado a quienes se continuaría reconociendo como "tribu" Nahuelpán. A partir de este caso enmarcado en el contexto de las relaciones establecidas por las comunidades indígenas del territorio nacional de Chubut con las autoridades nacionales y las redes locales de poder, se propone un análisis del proceso de construcción del espacio social para los pueblos originarios en la matriz estado-nación-territorio en el período que va de la gran crisis del '30 al primer gobierno peronista. Se abordan en particular los mecanismos de tribalización en la interfase entre políticas oficiales y agencia aborigen.In 1937, the Argentine government decided to displace and remove the Nahuelpán tribe accused of foreign and uncivilized behavior. Six years later this measure was reviewed starting a process of partial land restitution in which the state selected who will continue to be considered as member of the above mentioned tribe. Focusing in that case, framed by the relationship established between indigenous communities of the national territory of Chubut and state authorities or local nets of power, this article analyzes the process leading to the construction of a social space in the state-nation-territory matrix since the 1930' great crisis until the first period of President Juan Perón.

  12. l aceite de atún como fuente de ácidos grasos ω-3 en el huevo de gallina

    Directory of Open Access Journals (Sweden)

    Vázquez-Valladolid, J. L.

    2005-06-01

    Full Text Available Fish oils are a source of polyunsaturated omega 3 fatty acids (AG ω3, mainly eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA, which supply many benefits to human health. Tuna oil was used as a source of marine 3ω FA to enrich eggs by supplementing the diet of egg-laying hens with tuna oil. One hundred and twenty White Leghorn hens of 90 weeks old were allocated on three treatments with four replicates each, on a completely random design. Treatments consisted of adding 1 % and 2 % of tuna oil to the diets. The total lipids and ω3FA of the eggs were determined. The egg-laying hen dietary tuna oil supplement (1 and 2 % enriched eggs with 300 % more EPA (0.40, 1.37, 1.54 mg/g lipids and DHA (7.90, 24.67, 24.50 mg/g lipids versus the control egg . The ω6:ω3 ratio decreased ( 11.4:1, 3.8:1, 3.0:1 as dietary tuna oil increased. There were no differences (p>0.05 among treatments in productive performance and egg quality, except egg weight which decreased with the tuna oil.Los aceites de pescado son una fuente de lípidos poliinsaturados de origen animal, principalmente de los ácidos grasos omega-3 (AG ω-3, eicosapentaenoico (EPA y docosahexaenoico (DHA, beneficiosos para la salud. En este trabajo se utilizó el aceite de atún como fuente de estos nutrientes en el huevo para consumo. Se utilizaron 120 gallinas blancas Leghorn Isa-Babcock B-300 de 90 semanas de edad, distribuidas al azar en tres tratamientos, con cuatro réplicas cada uno. Los tratamientos consistieron en adicionar 1% y 2% de aceite de atún en la dieta de las gallinas ponedoras. Se determinaron los lípidos totales y AG ω-3 en el huevo, obteniéndose 300 % más de EPA (0,40, 1,37, 1,54 mg/g lípidos y DHA (7,90, 24,67, 24,50 mg/g lípidos al adicionar 1 y 2% de aceite de atún en la dieta de las aves, que en el grupo testigo. La relación ω-6: ω-3 en el huevo disminuyó con el suplemento dietético de aceite de atún (11,4:1, 3,8:1, 3:1, lo mismo ocurri

  13. Evaluación sensorial de huevos de codorniz en conserva y composición nutricional

    OpenAIRE

    José Fernando González Sánchez; Aideé Hernández Unzón

    2011-01-01

    El objetivo de este estudio fue evaluar la aceptabilidad de los huevos de codorniz en escabeche y determinar la composición nutricional de huevo de codorniz. Se emplearon cinco soluciones diferentes para conservar los huevos de codorniz y se aplico una prueba de aceptabilidad a los posibles consumidores. Se empleo una escala hedónica de siete puntos para evaluar la aceptación de los huevos: de excelente (+3) a detestable (-3). Se utilizaron un total de 200 jueces no calificados divididos en 4...

  14. El papel del capital social en la ayuda al desarrollo : un primer análisis para la OCDE

    OpenAIRE

    Portela, Marta; Neira, Isabel

    2012-01-01

    En este trabajo se analiza la relación entre el nivel de capital social de un país y su aportación en la ayuda al desarrollo. Varios trabajos han demostrado que esa ayuda sí puede influir en el nivel de capital social en un país y menos los que se han centrado en el papel de los donantes y su nivel de capital social para ver si están relacionados de alguna forma. Dado que el capital social se define como redes, confianza y normas que ayudan a la cooperación cabría esperar qu...

  15. Tecnología de las inmunoglobulinas de yema de huevo

    OpenAIRE

    Terzolo, Horacio Raúl

    2009-01-01

    El objetivo de esta presentación es introducir una nueva tecnología basada en la utilización de las inmunoglobulinas o anticuerpos de yema de huevo. Trabajo galardonado con el Premio "Fundación Dr. Alfredo Manzullo", versión 2007 Academia Nacional de Agronomía y Veterinaria

  16. Extracción y aplicaciones alimentarias de membranas de cáscaras de huevo

    OpenAIRE

    2015-01-01

    Caracterización físico-química de la membrana de la cáscara de huevo, seguida del estudio y desarollo de posibles aplicaciones de la membrana en diversos campos, entre los que destaca la formación de geles y la retención de cobre y proteínas.

  17. La calcárea phosphórica en el mejoramiento de la calidad de la cáscara del huevo en gallinas ponedoras (Phosphoric calcarea on the impruvement of egg shell thickness quality in eggs laying hens

    Directory of Open Access Journals (Sweden)

    Estrada, C., Osmaida; Larrent, N., Marroquin, T. Angelita; Cos, D. Yusell, Bárzaga, G.

    2008-03-01

    Full Text Available ResumenEl presente trabajo se realizó en una granja de ponedora comercial raza White Leghorn (L33 en baterías. Con el objetivo de evaluar la utilización de la Calcárea phosphórica como estimulante para mejorar la calidad de la cáscara del huevo, se escogieron al azar un total de 50 jaulas con 4 gallinas por jaula, por un total de 200 animales; se establecieron dos grupos de estudio de 100 aves cada uno, control y experimental al que se le suministró: Calcárea phosphorica 12CH en solución hidroalcohólica, evaluando los siguientes indicadores: grosor de la cáscara, % huevos cascados, % de huevos rotos, y como indicador complementario, producción de huevos. Para el procesamiento estadístico de los datos se utilizó la prueba de hipótesis para dos proporciones, mediante el paquete estadístico Statistic versión 6.0 para Windows. Se pudo evidenciar que la producción total de huevos, grosor de la cáscara y % de huevos rotos y cascados tuvo mejores resultados en el grupo experimental. Se concluye que la aplicación de la Calcárea phosphorica influye positivamente sobre los indicadores previamente mencionados.Abstract This work was done at the layer farm, the breed exploited being the White Leghorn (L33 in battery.With the objective to evaluate the homeopathic remedy “Calcárea Phosphorica” 12CH in hydro alcoholic solution was applied at a dose of 5 drops or 0.25ml per animal in drinking water. 50 cages with 4 animals per cage were selected randomly, giving a total of 200 animals, 25 control cages and 25 subject cages. The following indicators were observed and monitored: egg shell thickness, cracked egg shell percentage, broken egg shell percentage, the final eggs production, % of broken eggs, Statistic package version 6.0 was used for statistical processing Hypothesis test was made for two proportions. Were observed better results in the experimental group with relation of egg shell thickness, cracked egg shell percentage, broken

  18. Evolución de huevos de Fasciola hepatica en el medio ambiente en Temuco,IX Región de Chile Development of Fasciola hepaticaeggs in outdoor temperatures in Temuco, southern Chile

    Directory of Open Access Journals (Sweden)

    G. VALENZUELA

    1998-01-01

    Full Text Available Se realizó un estudio de desarrollo de huevos de Fasciola hepatica en el medio ambiente en Temuco, Novena Región de Chile (38-41S y 72-25W. Las observaciones se realizaron desde abril de 1988 hasta junio de 1990. Los huevos obtenidos de vesículas de bovinos infectados con el parásito fueron colocados una vez al mes en vasos con agua destilada, en un sistema flotante. El sistema flotante se mantuvo en canales, en hábitat del parásito. Las muestras ueron examinadas una vez al mes hasta obtener el 50% de los huevos eclosionados. El tiempo de desarrollo más largo fue de 249 días en las muestras colocadas en abril de 1988 y el más corto, de 37 días, en las colocadas en enero de 1990. Los huevos colocados en el ambiente en marzo no eclosionaron hasta después del invierno, en octubre o noviembre. Se comprobó que los huevos no tienen un desarrollo paralelo. Se concluye que el desarrollo en el medio ambiente es influenciado por la temperatura ambiental, que varía de acuerdo a la latitud geográfica del hábitat, y que no hay eclosión de huevos a temperaturas medias inferiores a 10° C.A two-year study on the development of Fasciola hepatica eggs under outdoor conditions was carried out in Temuco, southern Chile (38-41S,72-25W. Eggs obtained from bile of infected cattle were placed in buckets in a medium of distilled water once a month, and examined at monthly intervals, until 50% had hatched. The shortest period of development was 37 days in eggs placed outside in January, 1990. The longest period required for development was 249 days for eggs placed outside in April 1988. Eggs placed outside in March failed to hatch in autumn and remained viable throughout the winter; most of them hatched in October or November. It was proved that liver fluke eggs do not have a parallel development and that the time taken to hatch vary within each sample. The hatching stage only occurred when the mean temperature was more than 10° C. It can be concluded

  19. Las genealogías de cAbd al-Mu'min, primer califa almohade

    Directory of Open Access Journals (Sweden)

    Fierro, Maribel

    2003-06-01

    Full Text Available The Almohad caliphs claimed that agnatically they belonged to the Arab tribe of Quraysh. Qays cAylān does not include the tribe of Qurayš, with which the Mu'minids claimed to be linked cognatically. According to the classical doctrine of the caliphate, to be found for example in Ibn Hazm, the caliphs should belong to Quraysh through their paternal lineage. In this article, the advantages of a Qaysi genealogy (with a long tradition among the Berber populations of North Africa for the Mu'minid caliphs are analyzed. Among those advantages there are the links that such genealogy established with the Arab tribes of Sulaym and Hilāl, crucial elements in the Mu'minid army, and with the pre-Islamic Arab Prophet Khālid b. Sinīn al-cAbsī (descendants of whom appear in connection with the episode of the Berber rebellion of the Kāhina.

    Los califas almohades afirmaron pertenecer a la tribu árabe de Qays cAylān por descendencia agnática. Qays cAylān no incluye a la tribu de Qurayš, con la que los mu'miníes afirmaban estar emparentados por línea materna. Según la doctrina clásica del califato, recogida por ejemplo por Ibn Hazm, los califas deben ser qurayšíes por línea paterna. En este artículo se analizan las ventajas que ofrecía a los califas mu'miníes esa ascendencia qaysí, de larga tradición entre las poblaciones beréberes del Norte de África. Entre esas ventajas se cuentan la vinculación de parentesco con las tribus árabes de Sulaym y Hilāl, elementos fundamentales del ejército mu'miní, y con el profeta árabe pre-islámico Jālid b. Sinān al-cAbsī (descendientes de este último aparecen en estrecha relación con el episodio de la rebelión beréber de la Kāhina.

  20. El secreto del huevo azul, de Catalina González Vilar. Estudio narratológico

    Directory of Open Access Journals (Sweden)

    Miguel Sánchez-García

    2013-01-01

    Full Text Available Este trabajo aborda el estudio narratológico de la obra El secreto del huevo azul , de la escritora Catalina González Vilar, que obtuvo el Premio El Barco de Vapor en el año 2012. Examina los diferentes elementos constitutivos del texto (el enfoque del tema, la caracterización de los personajes, la estructura sintáctica, el tratamiento del lenguaje, la técnica narrativa utilizada... y su aporte al desarrollo de la historia con la finalidad de descubrir los valores estéticos y literarios que aporta a la fábula. Pretende demostrar el adecuado uso de todos ellos dado que favorecen un texto rico en matices, llamativo, sugerente. Cualidades, todas ellas, de gran importancia tanto en creaciones destinadas al público adulto como al infantil y juvenil pues enriquece el valor final de la obra, y por extensión, el bagaje cultural de sus lectores.

  1. Determinación de huevos de Toxocara canis en suelo de tres parques públicos de Duitama (Boyacá

    Directory of Open Access Journals (Sweden)

    Camilo Ernesto Guarín-Patarroyo

    2016-01-01

    Full Text Available Toxocara canis es un nemátodo frecuente en el intestino delgado de los perros, que se infestan a través de migración transplacentaria, vía galactógena o por ingestión de huevos embrionados; infecta también a las personas, principalmente a menores de cinco años, produciendo la toxocariasis humana, zoonosis catalogada como desatendida; se adquiere especialmente por ingesta de tierra contaminada y verduras sin adecuado manejo sanitario, y causa enfermedades como el Síndrome de Larva Migrans visceral y cutánea y Toxocariasis ocular. Este estudio tuvo como objetivo determinar, mediante la técnica de Sloss, la presencia de huevos de Toxocara canis en suelos de tres parques públicos de Duitama, y, además, identificar los mecanismos de trasmisión de la Toxocara canis en la población que acude a estos parques. Para ello se colectaron 76 muestras de suelo de 10 cm de largo por 10 cm de ancho y 3 de profundidad, las cuales fueron repartidas en dos estratos y almacenadas en bolsas plásticas herméticas para su posterior estudio en el laboratorio. Los resultados obtenidos indican que los huevos del parásito se encontraron en el 34.7% de las muestras recolectadas, señalando un nivel de riesgo para la población. De acuerdo con las variables pH, humedad y estratos, no se obtuvo asociación entre estas y la identificación del huevo. La presencia de T. canis en los parques indica que la población de la ciudad de Duitama está expuesta al riesgo potencial de adquirir el parásito.

  2. Curvas de eliminación de huevos por gramo de materia fecal de parásitos gastrointestinales en Búfalos de agua (Bubalus bubalis del Magdalena Medio Colombiano

    Directory of Open Access Journals (Sweden)

    German Alonso Prada Sanmiguel

    2010-06-01

    Full Text Available El presente estudio fue realizado en la hacienda bufalera La Suiza, municipio de Puerto Nare Antioquia en el Magdalena Medio Colombiano. El objetivo del estudio fue determinar las variaciones en la eliminación de huevos por gramo (hpg de materia fecal de parásitos gastrointestinales durante los meses de enero a diciembre a un total de 150 Búfalos de agua (Bubalus bubalis, los cuales fueron divididos en tres grupos de cincuenta animales: menores de 12 meses de edad, de 13 a 36 meses de edad y mayores a 37 meses de edad seleccionados al azar de un inventario total de 4.200 Búfalos. La materia fecal se recolectó directamente del recto mes a mes durante un año, luego fue procesada mediante la técnica de Mc-Master modificada por Scmidht para el respectivo conteo de huevos. Se utilizó el programa Statistix para calcular la estadística descriptiva, la correlación entre las variables climáticas (Temperatura, Brillo Solar y Precipitación, y cada grupo de parásito; el análisis de varianza fue calculado en Microsoft Excel. Se establecieron las curvas de eliminación anual de huevos por gramo de materia fecal del orden Strongylida y los géneros Strongyloides, Toxocara y Eimeria. En el grupo de animales menores de 12 meses de edad los huevos de parásitos más constantes durante todo el año fueron Strongyloides spp. y ooquistes de Eimeria spp; en los grupos de 13 a 36 meses de edad y mayores de 37 meses, los parásitos más constantes fueron del orden Strongylida y del género Eimeria spp, siendo los huevos de Trichuris spp. Los huevos de menor eliminación; en cuanto a la eliminación de hpg de Toxocara vitulorum, sólo se encontró en el grupo menor de 12 meses de edad con una única presentación en los meses de enero, junio y agosto.

  3. Datos biológicos de Doru luteipes (Dermaptera: Forficulidae en plantaciones de caña de azúcar y consumo de huevos de Diatraea saccharalis (Lepidoptera: Crambidae en condiciones de laboratorio

    Directory of Open Access Journals (Sweden)

    Gladys M. ROMERO SUELDO

    2009-01-01

    Full Text Available Diatraea saccharalis (Fabr. es considerada la principal plaga de la caña de azúcar en el noroeste argentino. El dermáptero Doru luteipes (Scudder desarrolla importantes poblaciones en dicho cultivo y ha sido descrito como predador de plagas en maíz, algodón y coles. El objetivo de este trabajo fue brindar información sobre algunos aspectos biológicos y estimar la capacidad de predación de las ninfas de Doru luteipes, a través de la tasa de consumo de huevos de Diatraea saccharalis. Se realizaron observaciones de campo y ensayos de laboratorio, en estos últimos se colocaron individualmente en tubos de ensayo, 50 ninfas de D. luteipes recién eclosionadas y se les ofrecía diariamente cien huevos de la plaga. La proporción de sexos de D. luteipes en campo fue de aproximadamente 1:1 y sus posturas presentaron una media de 31 huevos, con una tasa de emergencia cercana al 95%. El período de incubación se prolongó entre 6 y 10 días y el desarrollo de los estadios ninfales promedió los 37,6 días. Las ninfas pasaron por cuatro estadios y consumieron una media de 591,3 huevos de D. saccharalis. Estos resultados sugieren que D. luteipes desempeña un papel importante en el control natural de las poblaciones de D. saccharalis, por lo tanto, su presencia debería tenerse en cuenta al diseñar estrategias para controlar esta plaga.

  4. El Tratado de Versalles y el huevo de la serpiente

    OpenAIRE

    Cruset, María Eugenia

    2009-01-01

    Si algo enseña la historia es que no hay verdadero y pacífico desarrollo sin verdad, justicia y reparación. O, dicho en sentido negativo, nada hay más explosivo y destructivo para cualquier país que las arbitrariedades e inequidades. Este año se cumplen 90 años de uno de los episodios más gráficos de lo que estamos diciendo: el Tratado de Versalles, que firmado el 28 de junio de 1919 significó el fin de la Primer Guerra Mundial con la humillante derrota de Alemania. Flagrante situación de arb...

  5. RATMAC PRIMER

    Energy Technology Data Exchange (ETDEWEB)

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine

    1980-10-01

    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  6. Reología de derivados de la yema de huevo deshidratada

    Directory of Open Access Journals (Sweden)

    Partal, Pedro

    2000-08-01

    Full Text Available The emulsification process, as weIl as and the emulsion rheology and stability, greatly depends on the rheological properties of the continuous phase, the most important ingredient of which is yolk. However, since native yolk is not microbiologically stable, processing of yolk, such as spray-drying, is necessary for food applications. The influence of processing by spray-drying on the microstructure and rheological properties of yolk was investigated using oscillatory, creep and steady state flow measurements. The spray-drying process produces denaturation of proteins giving rise to a dramatic change from a fluid-like behaviour, as corresponds to the native yolk, to a gel-like behaviour corresponding to the reconstituted dried yolk (45% solids. Temperature exerts a slight influence on the linear viscoelastic properties of processed yolk.Tanto el proceso de emulsificación como las propiedades reológicas y la estabilidad de una emulsión alimentaria, tipo mayonesa, dependen en gran medida de la microestructura y la reología de la fase continua acuosa, cuyo ingrediente principal es la yema de huevo. Debido a la inestabilidad microbiológica de ésta se hacen necesarios procesos de deshidratación por atomización para conservarla con fines alimentarios. En este trabajo se trata de determinar la influencia que ejerce la deshidratación sobre la microestructura analizando las propiedades reológicas de la yema mediante ensayos reológicos de cizalla oscilatoria, de flujo en estado estacionario y de fluencia viscosa. Se llegó a la conclusión de que la deshidratación produce la desnaturalización de las proteínas provocando un cambio desde un comportamiento tipo fluido (yema nativa a un comportamiento tipo gel (yema deshidratada reconstituida al 45% en sólidos. Por otro lado, se ha observado una escasa variación de las propiedades viscoelásticas lineales de la yema deshidratada con la temperatura.

  7. Estudios sobre el manejo e incubación de huevos del pargo flamenco Lutjanus guttatus (Pisces, Lutjanidae Studies in egg handling and incubation in the spotted rose snapper Lutjanus guttatus (Pisces Lutjanidae

    Directory of Open Access Journals (Sweden)

    Leonardo Ibarra-Castro

    2012-04-01

    Full Text Available La manipulación y la incubación de huevos de peces son procedimientos simples pero importantes en las tecnologías de producción de juveniles. Para determinar prácticas apropiadas de manejo y de incubación de los huevos del pargo flamenco Lutjanus guttatus (Steindachner, 1869, se realizaron tres experimentos en tanques cilindro-cónicos de fibra de vidrio de 100 L. Los huevos fueron incubados con y sin flujo de agua (30%/h, a dos densidades (250 huevos/L y 1000 huevos/L y con o sin tratamiento profiláctico de formalina 10 ppm por una hora previo a la incubación. Los porcentajes de eclosión total y larvas vivas normales (larvas viables al momento de la eclosión no fueron diferentes significativamente entre los tratamientos con flujo y sin flujo. Mientras que los porcentajes de larvas viables al momento de la eclosión y a las 48 h post-eclosión mostraron significativamente mejores resultados en el tratamiento sin flujo de agua. En la incubación a dos densidades todos los índices analizados fueron significativamente mejores en la densidad de 250 huevos/L, excepto en larvas viables a las 48 h post-eclosión. Los huevos con y sin tratamiento profiláctico, no presentaron diferencias significativas para todas las variables de supervivencia al momento de la eclosión y a las 48 h post-eclosión. La longitud total de larvas fue diferente significativamente entre cada uno de los tratamientos al momento de la eclosión y a las 48 h, excepto en la incubación sin flujo de agua. Las larvas de mayor tamaño se obtuvieron en el experimento con sobre tratamiento profiláctico.Egg handling and incubation are short but important procedures in juvenile fish production technologies. To determine appropriate practices for egg handling and incubation in the spotted rose snapper Lutjanus guttatus (Steindachner, 1969, three experiments were carried out in 100-L fiberglass conical cylinder tanks. Eggs were incubated with and without water flow (30% volume

  8. Tu eres gallo… pero la de los huevos soy yo

    OpenAIRE

    Pine, Adrienne

    2011-01-01

    En Honduras, la industria maquiladora con sus prácticas disciplinarias y modernas, es vista por muchas personas como una fuerza protectora contra la violencia extrema de las maras y de las calles que es el enfoque principal del discurso diario hondureño. Sin embargo, la industria maquiladora, y las políticas militares y neoliberales (implementados por el fmi y el Banco Mundial) de las cuáles se aprovecha directamente, están estrechamente ligados con las prácticas de violencia asociadas al gén...

  9. Primer diagnóstico de resistencia a levamisol y lactonas macrocíclicas en nemátodos gastrointestinales parásitos de ovinos en Nicaragua

    Directory of Open Access Journals (Sweden)

    Rimbaud E., Zúniga P., Doña M., Pineda N., Luna L., Rivera G., Molina L., Gutiérrez J., y Vanegas J.

    2005-05-01

    Full Text Available Resumen.-En Diciembre de 2004, fue reportado una parasitosis persistente en ovinos de la región de trópico seco del pacifico (Ciudad de Granada a tratamientos implementados con levamisol e ivermectina. Se realizó un test de reducción del contaje de huevos por gramo (h.p.g. en el hato ovino, para lo que se utilizaron 40 borregos de 5 a 8 meses de edad seleccionados en la base que tenían un promedio de h.p.g. superior a 500. Los borregos fueron divididos en cuatro grupos (1-4. Los borregos de los grupos 1 a 3 fueron tratados respectivamente con inyección subcutánea de ivermectina (200 mcg/kg, levamisol (7.5 mg/kg y al tercer grupo dosificación oral de albendazole al 10%, mientras que el grupo 4 permaneció como control sin tratamiento. El contaje de reducción de huevos por gramo llevado a cabo diez días mas tarde mostró una reducción del 31.25% en los corderos tratados con ivermectina y un 87.5% en los tratados con levamisol, en los tratados con albendazole la reducción fue del 100%. El cultivo de larvas realizado posteriormente mostró crecimiento de Haemonchus sp. en las heces de los corderos tratados con ivermectina y levamisol. Este es el primer reporte de un caso de Haemonchus sp. parasitando ovinos resistente a ivermectina y levamisol.

  10. Características técnico-sanitarias de expendios de carnes, pescados, aves y huevos de la ciudad de Tunja 2003

    Directory of Open Access Journals (Sweden)

    Fred Gustavo Manrique-Abril

    2011-02-01

    Full Text Available Se presenta una caracterización epidemiológica de los expendios de carnes, pescado y aves de Tunja en el año 2003, resultado del diagnóstico sanitario del municipio y las visitas adelantadas por la unidad de saneamiento. Al partir del compromiso que el sector salud tiene en el componente de ambiente, surge la necesidad de crear un sistema de vigilancia epidemiológica ambiental, cuya metodología y estrategia esté orientada hacia el conocimiento de los factores de riesgo ambientales a que están expuestos los grupos humanos, con el fin de determinar prioridades y orientar los recursos de salud disponibles en el desarrollo de intervenciones; es por eso que se implantó en Tunja la vigilancia de factores de riesgo del consumo en esta estrategia, la cual, incluye la de expendios decarnes y derivados, aves huevos y pescado; entonces, se usaron las actas de inspección sanitaria y se tabuló en EPIINFO 2002 para su análisis con SPSS 11,5. Así se realizó un análisis descriptivo a 173 establecimientos y se encontró que existen condiciones diversas de sanidad respecto de la estructura física, los procesos productivos y el producto para la venta; también hay un incumplimiento de normas técnico-sanitarias, en diferentes sectores de la ciudad, que se priorizan para el control por parte de la autoridad sanitaria. Al 75% de los establecimientos no cumplen con las condiciones higiénico sanitarias en cárnicos; el 66,6% no cuenta con las condiciones en establecimiento de venta de pescados ý el 52,5% delos establecimientos de venta de aves y huevos, no cumplen con las condiciones higiénico sanitarias para tal fin.

  11. Evaluación sensorial de huevos de codorniz en conserva y composición nutricional (Sensory evaluation of pickled quail eggs and nutritional composition)

    OpenAIRE

    González Sánchez José Fernando; Hernández Unzón Aideé

    2011-01-01

    ResumenEl objetivo de este estudio fue evaluar la aceptabilidad de los huevos de codorniz en escabeche y determinar la composición nutricional de huevo de codorniz.SummaryThe aim of this study was to evaluate the acceptability of pickled quail eggs and determine the nutritional composition of quail egg

  12. Evaluación sensorial de huevos de codorniz en conserva y composición nutricional (Sensory evaluation of pickled quail eggs and nutritional composition

    Directory of Open Access Journals (Sweden)

    González Sánchez José Fernando

    2011-08-01

    Full Text Available ResumenEl objetivo de este estudio fue evaluar la aceptabilidad de los huevos de codorniz en escabeche y determinar la composición nutricional de huevo de codorniz.SummaryThe aim of this study was to evaluate the acceptability of pickled quail eggs and determine the nutritional composition of quail egg

  13. Uso de un aditivo a base de cantaxantina y extracto de achiote en dietas de gallinas de postura y su efecto sobre la coloración de la yema y la vida de anaquel del huevo

    Directory of Open Access Journals (Sweden)

    Víctor Rojas V.

    2015-01-01

    Full Text Available El objetivo del presente trabajo fue evaluar el uso de un aditivo a base de cantaxantina y extracto de achiote (Bixa orellana L. en dietas de gallinas de postura y su efecto sobre la coloración de la yema y la vida de anaquel del huevo. Se utilizaron 864 gallinas postura de 34 a 45 semanas de edad, distribuidas en un diseño completamente al azar con 6 repeticiones por tratamiento. Los tratamientos fueron T0 (dieta control, T1 (T0 + 30 g de cantaxantina y extracto de achiote y T2 (T0 + 60 g de cantaxantina y extracto de achiote. Los resultados obtenidos fueron de 88,6; 91,9 y 90,8 % para porcentaje de postura; 60,5; 61,6 y 61,5 g para peso de huevo; 53,6; 56,4 y 55,7 g para masa de huevo. La coloración de yema a temperatura de 7 °C para escala roche fue de 6, 9 y 12 por colorimétrico Minolta para “L” 42,10; 40,24 y 39,65; para “a” de 0,07; 3,68 y 6,44 y para “b” de 19,35; 18,36 y 18,18. La vida de anaquel a temperatura de 7 °C fue de 81, 86 y 90 UH. La peroxidación lipídica fue de 0,10; 0,07 y 0,05 μmol MDA.g-1 de yema; para T0, T1 y T2 respectivamente. En todas las variables indicadas se encontraron diferencias estadísticas significativas entre tratamientos (p < 0,05. El consumo de alimento fue de 103,9; 109,2 y 107,5 g y la conversión alimenticia de 1,94; 1,93 y 1,92. Se concluye que la adición de cantaxantina y extracto de achiote a 30 y 60 g t-1 de alimento respecto al testigo, mejoró los parámetros de rendimiento, coloración de yema y la vida de anaquel del huevo.

  14. RETENCIÓN DE HUEVOS EN HEMBRA DE JABOTÍ-PIRANGA (Geochelone carbonaria - Spix, 1824 EN CAUTIVERIO

    Directory of Open Access Journals (Sweden)

    Fabiana Rodrigues da Silbeira, M.V

    2009-12-01

    Full Text Available Un Jabotí-Piranga adulto (Geochelone carbonaria, hembra, con peso de 3.5 kg ingresó por consulta en la escuela clínica “Dr. Cataldi Luiz de Souza”, del “Centro Universitário Serra dos Órgãos - Teresopolis, Río de Janeiro”, con historia de retención de huevos. En la evaluación clínica y radiológica, se encontró tres huevos en posiciones normales. Teniendo en cuenta la temporada de reproducción, se aconsejó la observación del animal. Después de un año, dicho animal regresó a la clínica por no haber todavía expulsado los huevos. Tras nuevo examen radiográfico se observó que los 3 huevos continuaban en la misma posición. A continuación, se aplicó 0.03 ml de oxitocina por vía subcutanea (10 UI x ml, en el apéndice anterior del animal. Tres horas después de la aplicación de la hormona, el animal expulsó los huevos naturalmente, sin la necesidad de una intervención quirúrgica, con lo que se puede sospechar de la eficacia de la aplicación de oxitocina para este procedimiento en jabotí Piranga.

  15. El regalismo borbónico frente al poder Vaticano: acerca del estado de la iglesia en el Perú durante el primer tercio del siglo XVIII

    Directory of Open Access Journals (Sweden)

    Moreno Cebrián, Alfredo

    2003-04-01

    Full Text Available This article studies some aspects of the difficult relations betwen Philip V and the Papacy through a double analysis: verifying the credibility of certain affirmations in a document previous to the «Noticias Secretas de América» as regards the irregular life of the Peruvian colonial clergy, and contextualizing both the author and contents of the said document in the early 18th Century.

    La comprobación de la verosimilitud de las afirmaciones contenidas en un documento anterior a las Noticias Secretas de América sobre el desorden en que vivía el clero colonial peruano, así como la contextualización de este testimonio y de su autor en el primer tercio del XVIII, sirven para analizar las dificultades que marcaron las difíciles relaciones entre Felipe V y el Papado.

  16. Epidemiologia del primer episodio de luxación anterior de hombro traumática en pacientes atendidos en el Hospital El Tunal del 2003 al 2013

    OpenAIRE

    González Osorio, Eduardo Alejandro

    2015-01-01

    Introducción: El hombro es la articulación que más se luxa, su pronóstico y tratamiento ha sido ampliamente estudiado, sin embargo la incidencia de luxación traumática no ha sido bien definida. El propósito del estudio es describir las características epidemiológicas de los pacientes con primer episodio de luxación anterior de hombro traumática en una población colombiana y elucidar los factores de riesgo demográficos para esta lesión. Materiales y métodos: Estudio epidemiol...

  17. A reappraisal of immunoglobulin variable gene primers and its impact on assessing clonal relationships between PB B cells and BM plasma cells in AL amyloidosis.

    Science.gov (United States)

    Katoh, Nagaaki; Poshusta, Tanya L; Manske, Michelle K; Dispenzieri, Angela; Gertz, Morie A; Abraham, Roshini S; Ramirez-Alvarado, Marina

    2011-12-01

    Monoclonal tumor plasma cells as well as non-terminally differentiated B cells having a clonal relationship to the tumor cells have been detected in the peripheral blood (PB) of some multiple myeloma (MM) patients but rarely in light chain (primary systemic) amyloidosis (AL) patients. Previously, our group found these peripheral clonotypic B cells in three AL patients. Here, we report detailed analysis of a larger cohort of AL patients to validate the prior findings and to investigate the effect of this cell population on clinical outcome. Fourteen AL patients were selected from a clinical prospective trial, and the relationship between immunoglobulin light chain variable gene (V(L)) representation in PB B cells and the clonal population in the bone marrow (BM) was investigated. A clonal relationship was not detected, and the present study provides important insights into the disparity with the earlier data, including clinical history of the patients and methodological analysis.

  18. Herramienta de educación nutricional para alergicos a huevo y proteína de leche de vaca de edad pediátrica®

    Directory of Open Access Journals (Sweden)

    Ismael San Mauro Martín

    2014-05-01

    Full Text Available Introducción: La alergia alimentaria afecta a gran parte de la población y sus cifras siguen aumentando. Aunque, se esta avanzando en el conocimiento de la patología, los alérgicos encuentran grandes dificultades para llevar una vida normal, especialmente en lo relativo a su alimentación. Hasta ahora el colectivo no contaba con herramientas prácticas que les ayudasen en la elaboración diaria de una dieta equilibrada, como existen para la población en general, en forma de pirámides y guías alimentarias. Con este trabajo se ha cubierto esta necesidad para dos de las alergias más prevalentes en los primeros años de vida. Objetivos: Recopilar información sobre la alergia a la proteína de leche de vaca (APLV y huevo, para diseñar una pirámide alimenticia para estos pacientes, basada en los consensos, recomendaciones y guías científicas. Resultados: Tras comprobar la inexistencia de un trabajo similar, se diseñaron pirámides alimenticias para alérgicos a huevo y APLV, adaptadas a cada uno de ellos, así como una pirámide conjunta a ambas alergias. Además se incluyeron recomendaciones basicas para la alimentación saludable en general y, en particular, con interés especial para el colectivo (higiene alimentaria, aditivos alimentarios, productos de cosmética, medicamentos, etc. Conclusiones: Debido a la importancia que la nutrición adquiere en la infancia y las dificultades subyacentes a este colectivo, poder planificar adecuadamente la alimentación es muy importante pues puede prevenir accidentes y carencias nutricionales a largo plazo. Por ello, facilitar herramientas gráficas y prácticas para este fin, es de gran importancia comunitaria y medico-científico, y es el resultado de este trabajo.

  19. Aceptabilidad de empanizados enriquecidos con harina de pota (Dosidicus gigas), huevo de codorniz (Coturnix coturnix) y pimiento amarillo (Capsicum annuum)

    OpenAIRE

    Guerrero Hurtado, Emma Del Rosario; Palomino Pezzutti, Ricardo Ramiro; Tamariz Grados, Nelly Norma; Cajaleón Asencios, Delia Haydee; Dextre Mendoza, Rodolfo Willian; Carreño Mundo, Humberto

    2015-01-01

    Objetivo: Evaluar la aceptabilidad de empanizados enriquecidos con harina de pota (Dosidicus gigas), huevo de codorniz (Coturnix coturnix) y pimiento amarillo (Capsicum annuum). Métodos: Optimizar una formulación de alimento listo para el consumo humano, conforme a requisitos: NTP NDECOPI: Harina de trigo, NTP 205. 027. 1996, NTP-CODEX STAN 166:2014 -Barritas, Porciones y Filetes de pescado empanizados o rebozados congelados. Resultados: El aroma, color y textura de los empanizados formula...

  20. El jugo de naranja agria como estimulante de la producción de huevos en ponedoras comerciales (Sour orange juice as stimulant on the eggs production in egg laying hens

    Directory of Open Access Journals (Sweden)

    Rodríguez-Hidalgo, Richar

    2007-11-01

    Full Text Available Resumen El trabajo se realizó en una granja de ponedora comercial en batería piramidales; se seleccionaron mediante un diseño completamente aleatorizado, 168 gallinas White Leghor, línea L33 de 32 semanas de edad con el mismo índice de postura. Se conformaron dos grupos (A y B de 84 animales con 7 réplicas de 12 gallinas cada uno. Cada grupo fue ubicado dentro de la misma nave en hileros de 7 jaulas a razón de 4 gallinas por huecos. El grupo(A sirvió como control, mientras que el grupo (B se le aplicó jugo de naranja agria en el pienso a razón de 10 ml por animal en dos dosis diarias por animal. El manejo fue el mismo para los dos grupos, durante el experimento. Se evaluaron los indicadores producción final de huevos, huevos por gallinas, índice de postura, % de huevos rotos, cascados, sucios y en fárfara. Para el procesamiento de la información se utilizó el paquete estadístico Statistic versión 6.0 realizándose una prueba de hipótesis para dos medias y una prueba de hipótesis para dos proporciones. Se obtuvo diferencia significativa para p<0.05, en cuanto al porcentaje de la postura, porcentaje de huevos rotos, cascados y sucios, así como la viabilidad del grupo experimental con relación al control. Se concluye que la utilización del jugo de naranja agria constituye un estimulante en la producción de huevos de gallinas ponedoras White Leghorn. Abstract The work was in the interprice commercial eggs laying hen in pyramidal battery. 168 hens White Leghorn line L 33 from 32 weeks have the same in laying index were selected using a completely randomized do sing. Two group were formed having 84 animals each group with 7 replies of 12 hens each. Each group was located in the same housing in cage of 7 cage, 4 hens for cage. Group A was a control and group B was experimental. To wich sour orange juice on the feed was applied using a ration of 10 ml per ration per animal into daily dosages during 28 days. The management was the

  1. Birth weight and obesity risk at first grade in a cohort of Chilean children Peso al nacer y riesgo de obesidad en primer grado en una cohorte de niños chilenos

    Directory of Open Access Journals (Sweden)

    S. Loaiza

    2011-02-01

    Full Text Available The purpose of the study was to determine the association of birth weight as a risk factor for obesity at first grade in a cohort of elementary school Chilean children. Height and weight at birth and follow up measurements at first grade were analyzed from a national cohort of 119,070 new borns. Subjects were classified by anthropometric characteristics: new born weight in kilograms, Ponderal Index, (birth weight/height³ x 100, and gestational age (physical maturity categories at birth. The study tested the hypothesis that a macrocosomic newborn (> 4,000 g or > 8.8 pounds or Large for Gestational Age , would be at higher risk to be obese at first grade. A positive relationship between birth weight > 4,000 g, (O.R. =1.55, (p 120% of reference value, the obesity risk was 20 times higher (p Objetivo: determinar la asociación entre el peso al nacer y el riesgo de obesidad en escolares de primer año de enseñanza Metodología: se analizó el peso y talla al nacer y las mismas variables al ingresar a la escuela en una cohorte de 119.070 recién nacidos chilenos. El peso al nacer fue categorizado: en Kg (; 4.000 g, según edad gestacional (pequeño, adecuado y grande y según el índice ponderal (peso al nacer g/ talla al nacer cm³ * 100: bajo 3,17. El estado nutricional en los escolares fue clasificado según IMC (peso/talla² de acuerdo a la referencia del CDC. Se consideró obesidad un valor > percentilo 95. Resultados: Un incremento de peso entre el nacimiento y el ingreso a la escuela > 120% de la referencia determinó un alto riesgo de obesidad: OR 20,5 95% IC 19,7-21,4. Se observó también una relación directa y estadísticamente significativa entre un peso al nacer > 4.000 g (OR 1,55 95% IC 1,48-1,61, grande para la edad gestacional (OR 1,51 95% IC 1,45-1,57 y alto índice ponderal (OR 1,39 95% IC 1,31-1,47 con la obesidad en primer grado, controlando el efecto de variables perinatales de confusión (p < 0,001. El bajo peso al nacer fue

  2. El primer congreso constituyente mexicano

    OpenAIRE

    José Luis Soberanes Fernández

    2012-01-01

    En el presente trabajo se describe uno de los momentos más difíciles de la historia constitucional de México, por no decir el más difícil, que va desde la Consumación de la Independencia Nacional del 27 de septiembre de 1821 al 30 de noviembre de 1823 en que clausuró sus sesiones el Primer Congreso Constituyente. Fue cuando se erigió el Imperio de Iturbide y su ocaso, en consecuencia triunfó la república y se planteó seriamente el federalismo. Se eligió ese primer constituyente, se clausuró, ...

  3. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the

  4. La cultura organizacional en centros de primer nivel de atención de salud pública de zona 5-Guayas : diseño de un manual administrativo orientado al mejoramiento de atención al usuario, en gestión de medicina preventiva.

    OpenAIRE

    Veloz Pinoargote, Paola Vanessa

    2015-01-01

    El propósito del presente estudio es recoger toda la información pertinente y diseñar un manual administrativo, incluyendo temas conceptuales, legales, procedimentales y estructurales, relacionados con la gestión de medicina preventiva en los centros de atención de primer nivel, que faciliten el desarrollo y mejoramiento de una cultura organizacional de excelencia en el servicio al usuario. La investigación realizada para llegar a este diseño tuvo un enfoque cuanti-cualitativo, de tipo no exp...

  5. El primer texto relativo al salvamento acuático en España = The first text on aquatic lifesaving in Spain

    Directory of Open Access Journals (Sweden)

    Gonzalo Ramírez Macías

    2013-03-01

    Full Text Available Subtítulo: Instrucción sobre el modo y medios de socorrer a los que se ahogaren, o hallaren en peligro, en el río de Sevilla (1773La finalidad de esta investigación es describir el contenido de la Instrucción sobre el modo y medios de socorrer a los que se ahogaren, o hallaren en peligro, en el río de Sevilla (1773. La introducción está dedicada a justificar y fundamentar la investigación, así como a caracterizar la fuente utilizada. En segundo lugar se contextualiza temporal y espacialmente el estudio. Posteriormente se muestran y analizan los resultados, que destacan por la organización de los profesionales implicados en el dispositivo de salvamento acuático y la distribución de funciones entre éstos. Al respecto hay que subrayar la figura de los llamados buzos, antecedentes directos de los socorristas acuáticos. Por último se exponen las conclusiones, entre las que destacan la necesidad de investigar otras fuentes primarias relacionadas, los escasos conocimientos que se tenían sobre maniobras propias del salvamento acuático y las mejorables condiciones laborales de los buzos.---------------------------------------------------------------------------- Subtitle: Instruction on the way and means of succorring those who are drowning, or in danger, in the river of Seville (1773The aim of this research is to describe the content of the Instrucción sobre el modo y medios de socorrer a los que se ahogaren, o hallaren en peligro, en el río de Sevilla (1773. The introduction is dedicated to its justification and foundation, as well as to describe the source used. Secondly, the research is contextualised, both in time and space. Subsequently, the results are shown and analysed; such results outstand by the organization of the professionals involved in lifesaving and the distribution of tasks among them. The divers’ role has to be emphasised as direct predecessors of lifeguards. Finally, the conclusions are presented, stressing

  6. Perfil cognitivo y prevalencia de depresión, desesperanza y riesgo suicida en jóvenes vinculados al primer nivel de formación en una escuela militar colombiana

    Directory of Open Access Journals (Sweden)

    Daniella Abello Luque

    2016-01-01

    Full Text Available Este estudio evaluó el perfil cognitivo y los niveles de desesperanza, depresión y riesgo suicida en un grupo de jóvenes vinculados al proceso de formación de una escuela militar colombiana. En total participaron 114 sujetos, militares regulares de primer año (MR-1A, que representan la totalidad de un contingente particular; todos ellos hombres, con edades entre los diecisiete y los veintidós años, provenientes de hogares ubicados en la región Caribe (41% y el centro del país (12%, sin ningún tipo de diagnóstico médico o mental relevante. Los resultados indican relaciones lineales y directamente promocionales entre todas las variables, con magnitudes significativas en lo referente a las relaciones depresión-desesperanza (rs= 0,295; ρ= 0,01 y depresión-riesgo suicida (rs= 0,478; ρ= 0,01, siendo esta ultima el reporte más elevado.

  7. TERMORRESISTENCIA DE CEPAS DE SALMONELLA NATIVAS EN ALBÚMINA DE HUEVO DESHIDRATADA Y PASTEURIZADA. EFECTO DE LA ACTIVIDAD DE AGUA Y DEL CHOQUE TÉRMICO.

    OpenAIRE

    LOUND, LILIANA HAYDEE

    2014-01-01

    La albúmina de huevo es una compleja mezcla de proteínas que contiene todos los aminoácidos esenciales. Se utiliza como suplemento alimenticio, por sí solo o mezclado con otros componentes. La industria de productos de huevo elabora, según la temperatura de pasteurización que utilice, un producto con buenas propiedades de batido obtenido por tratamiento térmico del polvo a 72°C y otro con excelentes propiedades de formación de gel que se obtiene cuando se aplica 82°C, ambos procesos por un ti...

  8. OBTENCIÓN DE ANTICUERPOS POLICLONALES IgY ANTIPARVOVIRUS CANINO A PARTIR DE YEMA DE HUEVO DE GALLINA

    Directory of Open Access Journals (Sweden)

    Pinto, J.

    2005-06-01

    Full Text Available Inmunizando un grupo de diez gallinas de postura raza Lohmann de 16 semanas de edad con parvovirus canino (CPV cepa vacunal, se obtuvieron anticuerpos IgY policlonales contra CPV en yema de huevo.En la extracción de los anticuerpos de la yema se requirieron dos pasos, el primero para la remoción de lípidos y el segundo para la precipitación de proteínas. Para la remoción de lípidos se usó el método PBS:Cloroformo y para la precipitación de los anticuerpos solubles (Inmunoglobulinas-IgY se usó el método de salting-out con sulfato de amonio ((NH42SO4. La evaluación del proceso se efectuó empleando el método comercial estándar “EGGstract IgY Purification System®” de PROMEGA.La metodología empleada permitió la obtención de anticuerpos IgY policlonales contra CPV a partir de yema de huevo de gallina en concentraciones altas por mililitro de yema, con una pureza aceptable y títulos altos; los resultados fueron comparables con el método comercial.

  9. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  10. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  11. ALGUNAS CONSIDERACIONES CONTEXTUALES EN TORNO AL PRIMER VIAJE A JAPÓN DE JACQUES LACAN (1963 Contextual considerations on the subject of lacan’s first trip to japan (1963

    Directory of Open Access Journals (Sweden)

    Mercè Altimir

    2012-07-01

    Full Text Available Nuestro propósito es dar a conocer la importancia y el influjo de la cultura y el pensamiento oriental y Japón en la obra de Lacan, para cuya tarea hemos tomado el eje del viaje que realizó al archipiélago en la primavera de A partir de esta coordenada de tiempo hemos retrocedido hasta la presencia del país oriental en la obra de Sigmund Freud y hemos referido la mención del mikado y de los ainus en Tótem y tabú. En cuanto al budismo, centro del interés de Lacan en este primer viaje a las islas, Freud se mostró cauto, reticente, incluso hostil. Lacan, en cambio, se entusiasma por oriente y se interesa por el budismo, en especial por el zen. Hemos seleccionado los comentarios que hizo a su regreso de Japón. En los mismos, el psicoanalista francés pone el dedo en la llaga y nos habla del escamoteo que sufre la sexualidad femenina en el budismo, lo que le sirve de aviso para orientar la práctica del psicoanálisis.My aim in this paper is to make known the importance and influence of Eastern culture and thought and of Japan on Lacan’s works. I have taken as a starting point the trip he made to this country during the spring of 1963. After this I have gone backwards to consider the presence of Japan in Sigmund Freud’s works, calling attention to his mention of the Mikado and the Ainu in Totem and Taboo. Towards Buddhism, which was the focus of Lacan’s interest in this first trip to the archipelago, Freud was cautious, reticent and even hostile. Lacan, on the other hand, was enthusiastic about Orient and interested in Buddhism, especially in Zen. I have made a selection of the comments he made on his return from Japan, in which he pointed out weaknesses and commented on how feminine sexuality is eschewed in Buddhism, which he took note of in order to direct his practice in psychoanalysis accordingly.

  12. El huevo de la serpiente al sur del mundo: desarrollo y supervivencia de la ciencia nazi en Chile (1908 -1951

    Directory of Open Access Journals (Sweden)

    Leyton, César

    2014-12-01

    Full Text Available The paper presents, mainly through the figure of Dr. Max Westenhoffer and in a work of Drs. Barrientos and Schirmer (1937, the connections between the development of medicine and anthropology in Chile with the development of the biological determinist thought and racism in Europe. Chilean Physicians and anthropologists as Otto Aichel, Aureliano Oyarzún, Edgardo Schirmer and Juvenal Barrientos indicate the direct relationship of the Chilean scientific program of the early twentieth century with the hereditarian and racist program, which reached its climax with the Nazi eugenics.El trabajo aborda, principalmente a partir de la figura del Dr. Max Westenhoffer y de un trabajo de los Drs. Barrientos y Schirmer de 1937, las conexiones que presenta el desarrollo de la medicina y la antropología en Chile con el pensamiento determinista biológico y racista en Europa. Médicos y antropólogos chilenos como Otto Aichel, Aureliano Oyarzún, Edgardo Schirmer y Juvenal Barrientos dan cuenta de la relación directa de una parte del programa científico chileno de la primera mitad del siglo XX con el programa hereditarista y racista, que alcanzó su punto cúlmine con la eugenesia y la antropología nazi.

  13. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  14. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  15. OBTENCIÓN DE ANTICUERPOS POLICLONALES IgY ANTIPARVOVIRUS CANINO A PARTIR DE YEMA DE HUEVO DE GALLINA

    OpenAIRE

    Pinto, J.; Barco, M.; Afanador, M.C.; Merchán, A.M.*;; Montañez, M.F.; Andrade, F; Torres, O.

    2005-01-01

    Inmunizando un grupo de diez gallinas de postura raza Lohmann de 16 semanas de edad con parvovirus canino (CPV) cepa vacunal, se obtuvieron anticuerpos IgY policlonales contra CPV en yema de huevo.En la extracción de los anticuerpos de la yema se requirieron dos pasos, el primero para la remoción de lípidos y el segundo para la precipitación de proteínas. Para la remoción de lípidos se usó el método PBS:Cloroformo y para la precipitación de los anticuerpos solubles (Inmunoglobulinas-IgY) se u...

  16. Influence of phytoplankton diets on the ingestion rate and egg production of Acartia clausi and A. lilljeborgii (Copepoda: Calanoida from Bahía de La Paz, Gulf of California Influencia de dietas de fitoplancton en la tasa de ingesta y producción de huevos de Acartia clausi y A. lilljeborgii (Copepoda: Calanoida de la Bahía de La Paz, Golfo de California

    Directory of Open Access Journals (Sweden)

    Christine Johanna Band-Schmidt

    2008-08-01

    (Scrippsiella sp., Gyrodinium sp., Prorocentrum micans y P. rhathymum y una rafidofita (Chattonella sp.. Después de 24 h de incubación en oscuridad a 24 °C, la supervivencia con las diversas dietas fue mayor a 91%. Sólo al alimentar a A. clausi con Gyrodinium sp. la supervivencia fue baja (44.5%. Con las dietas de dinoflagelados se obtuvo la mayor producción de huevos. A. clausi presentó una mayor producción de huevos al alimentarse con P. rhathymum, P. micans, Gyrodinium sp., Scrippsiella sp. y Chattonella sp. A. lilljeborgii presentó una mayor producción de huevos con Scrippsiella sp., P. micans, Gyrodinium sp. y Chaetoceros sp. La tasa de ingesta en ambas especies de Acartia fue mayor con dos dietas de diatomeas (O. longicruris y Chaetoceros sp., P. rhathymum y Chattonella sp. Estos resultados sugieren que ambas especies de Acartia responden en un lapso corto de tiempo a la calidad nutricional del fitoplancton. Las mayores tasas de ingesta no necesariamente resultaron en una mayor producción de huevos, sugiriendo que la relación entre la tasa de ingesta y la producción de huevos pudiera estar relacionada con la calidad alimenticia, más que con la cantidad ingerida. La respuesta en la producción de huevos en ambos copépodos parece ser específica para cada especie, sin embargo en general, las dietas de dinoflagelados parecen tener una mayor calidad nutricional comparadas con las diatomeas con la excepción de Chaetoceros sp.

  17. Arreglo de los polígonos del exocorion de huevos eclosionados de algunas especies de los géneros Triatoma Laporte, Meccus Stal y Nesotriatoma Usinger (Heteroptera: Reduviidae.

    Directory of Open Access Journals (Sweden)

    Glauco López

    2009-12-01

    Full Text Available Resumen. En este trabajo se estudiaron estructural y cuantitativamente las celdas exocoriales de huevos eclosionados de Triatoma infestans (Klug, Triatoma lenti Sherlock & Serafim, Triatoma maculata (Erichson, Triatoma sordida (Stal, Meccus picturatus (Usinger, Meccus longipennis (Usinger, Meccus pallidipennis (Stal and Nesotriatoma flavida (Neiva. Los huevos se analizaron por regiones: caudal, media y cefálica. Se encontró que el hexágono fue el polígono más abundante en todas las regiones del huevo y en todas las especies, seguido del pentágono y del heptágono; se encontraron diferencias estadísticamente significativas en el número tanto de hexágonos y pentágonos entre regiones de una misma especie y entre la misma región de las diferentes especies, sin embargo, el número promedio de heptágonos no varió al comparar la región media entre las diferentes especies y al comparar las diferentes regiones en una misma especie. No se encontraron diferencias estadísticamente significativas en el promedio de polígonos, segmentos totales, heptágonos, hexágonos y pentágonos, al comparar las especies examinadas del género Meccus. Se propone un protocolo de identificación y análisis de teselaciones, con el cual se encontró que en 108 campos examinados de 385.000 µm2 cada uno, se identificaron teselaciones compartidas en los 108 campos observados con determinadas combinaciones de heptágonos, hexágonos y pentágonos, y se observaron teselaciones no compartidas en la totalidad de los campos, con combinaciones de polígonos de cuatro a nueve lados, y cada teselación se representó por un grafo. Se discuten las implicaciones taxonómicas, funcionales, filogenéticas y construccionales de los arreglos poligonales descritos.Arragement of exochorial polygons of hatched eggs in several species of the genera Triatoma Laporte, Meccus Stal y Nesotriatoma Usinger (Heteroptera: Reduviidae. Abstract. In this study a structural and quantitative

  18. Response of first attack of inflammatory bowel disease requiring hospital admission to steroid therapy Respuesta al tratamiento esteroideo del primer brote de enfermedad inflamatoria intestinal que requiere ingreso hospitalario

    Directory of Open Access Journals (Sweden)

    M. Abu-Suboh Abadía

    2004-08-01

    Full Text Available Introduction: corticoid administration is the usual treatment of Crohn' disease (CD and ulcerative colitis (UC attacks. How-ever, information available on response rates and their predictive factors is scarce. Objective: to establish response to steroidal treatment in an homogeneous group of patients with CD or UC during their first admission to hospital. Methods: restrospective analysis of 86 patients who received systemic steroidal treatment for a severe flare-up during their first hospital admission between 1995 and 2000. Patients were treated per protocol with fluid therapy, absolute diet, IV 6-methyl-prednisolone 1 mg/kg/day, and enoxaparin at prophylactic doses. Clinical response at 30 days was considered good in case of complete remission, and poor in case of partial or absent remission. Univariate and multivariate analyses according to non-parametric statistics were performed for sociodemographic and biologic variables. Results: 45 patients with CD and 41 with UC were included. Good response rates were 64.4% for CD and 60.9% for UC. The univariate analysis showed that patients with good response have shorter evolution times and fewer previous flare-ups (p Introducción: la administración de corticoides constituye el tratamiento habitual de los brotes de enfermedad de Crohn (EC y colitis ulcerosa (CU. Sin embargo, existe poca información sobre las tasas de respuesta y los factores que puedan predecirla. Objetivo: determinar la respuesta al tratamiento esteroideo en un grupo homogéneo de pacientes de EC y CU que ingresan por primera vez en el hospital. Métodos: análisis retrospectivo de 86 pacientes que en su primer ingreso hospitalario recibieron tratamiento esteroideo sistémico por brote grave de EC o CU entre 1995 y 2000. Fueron tratados de forma protocolizada con sueroterapia, dieta absoluta, 6-metil-prednisolona 1 mg/kg/día IV y enoxaparina a dosis profilácticas. Se ha considerado la respuesta clínica a los 30 días como

  19. Cuantificacion de huevo en fideos secos según metodo electroforético (SDS PAGUE Quantification of egg in dried noodles by electrophoretic methods (SDS PAGE

    Directory of Open Access Journals (Sweden)

    LB López

    2011-06-01

    Full Text Available La cuantificación de huevo en fideos secos elaborados con harina y agregado de huevo. Se analizaron 6 sistemas modelos (SM de fideos que contenían 0,0; 1,0; 2,5; 4,0; 6,0 y 8,0% de huevo en polvo. Se extrajeron proteínas totales con un buffer que contiene dodecilsulfato de sodio (SDS y 2-Mercaptoetanol y se realizó electroforesis en gel de poliacrilamida con SDS. Se establecieron las relaciones de las áreas de los picos de los densitogramas (de huevo y de trigo que permiten una correcta cuantificación del porcentaje de huevo agregado. Se analizaron 11 muestras comerciales en las cuales se realizó la cuantificación de huevo, obteniéndose valores comprendidos entre The objective of this work was to use the SDS-PAGE method for the quantification of egg in dry noodles made with flour and added egg. 6 model systems (MS of noodles containing 0.0, 1.0, 2.5, 4.0, 6.0 and 8.0% of egg powder were analyzed. Total proteins with a buffer containing sodium dodecyl sulfate (SDS and 2-mercaptoethanol were extracted and electrophoresis with SDS polyacrylamide gel was carried out. The relationships of the peak areas of the densitograms (egg and wheat that allow a proper quantification of the percentage of egg added were established. 11 commercial samples in which quantification of egg was carried out were analyzed, with values ranging between <1.0% and 8.8% of egg powder. In the analyzed MS and in the commercial samples the cholesterol content (enzymatic method was also determined and the egg content was determined by the method ELISA. Cholesterol values in the MS increased with the increase of the added egg powder, while in the samples, low levels of cholesterol were found for the lowest egg levels and high values for the highest egg levels. With the ELISA method a correct quantification of egg up to 4.0% was achieved, but low results were obtained in the higher systems (6.0 and 8.0%. This could be due to the significant dilution that must be made from

  20. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  1. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  2. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  3. Lead Free Electric Primer

    Science.gov (United States)

    2011-10-06

    The 2% weight loss was due to the dehydration of the MoO3 hydrate. The monoclinic phase of MoO3 was also found to readily absorb water to form the...aluminum was treated with methyltrichlorosilane (CH3SiCl3) to place a protective coating on the Al. Samples of untreated and silane coated Al were placed in...hours, the untreated Al powder had completely reacted. In contrast, after 24 hours there was no evidence of reaction between the silane coated Al and

  4. Influencia del tamaño del pubis y el peso de la ponedora en el tamaño y peso de sus huevos

    Directory of Open Access Journals (Sweden)

    Lamazares María del Carmen

    2006-10-01

    Full Text Available RESUMENEl objetivo del presente trabajo fueevaluar el efecto del tamaño del pubis y elpeso de la ponedora en el tamaño y elpeso de sus huevos. Con este fin seagruparon 64 gallinas L33 en 4 gruposutilizándose como criterio deagrupamiento el tamaño del pubis y elpeso de la ponedora por encima o pordebajo de la media general para cadaindicador. Los datos obtenidos fueronanalizados por un programa estadísticodonde se calcularon los coeficientes decorrelación y los coeficientes de regresión.Con los valores de los coeficientes decorrelación se calcularon los coeficientesde determinación. Estos últimos mostraronvalores entre 0.0049 y 0.1369 entre elpeso de la gallina y las características delhuevo. En cuanto al pubis, los valoresvariaron entre 0.01 y 0.0576. Losresultados muestran que la influencia queejerce el peso de la gallina y el tamaño delpubis sobre el peso y el tamaño de sushuevos es proporcional.ABSTRACTThe objective of the present work was toevaluate the effect of the size of the pubisand the corporal weight of the laying hensin the size and the peso of their eggs.They with this end formed a group 64 henL33 in 4 groups utilizing it like criterion ofgroup the size of the pubis and thecorporal weight of the laying hens forabove or below the general hose for eachindicator. The gotten facts were analyzedfor a statistical program where they werecalculated the coefficient of correlation andthe coefficient of regression. With thevalue of the coefficient of correlation thecoefficient of determination werecalculated. These last showed securitybetween 0.0049 0.1369 between thecorporal weight of the hen and thecharacteristics of the egg. As for the pubis.The value them vary between 0.01 0.0576.The result show that the influence thatexercises the corporal weight of the henand the size of the pubis on the corporalweight and the size of their eggs isproportional.

  5. Rendimiento reproductivo en cruzamientos entre razas tradicionales de aves productoras de huevo y carne Reproductive output in laying hen and meat type breed crosses

    Directory of Open Access Journals (Sweden)

    F Revidatti

    2005-12-01

    Full Text Available En el presente trabajo se evaluaron distintas variables que se relacionan con el rendimiento reproductivo en dos tipos de aves de líneas tradicionales, una semi-pesada, seleccionada para la producción de huevos para consumo (Negra y Rubia INTA y otra pesada, cuya progenie se destina a la producción de carne aviar (Campero INTA. Se hallaron diferencias significativas en el número de huevos incubables (191 y 110 huevos por ave/año, en los porcentajes de fertilidad (93 y 88%, incubabilidad (88 y 83% y en el número de pollitos por ave por año (158 y 82 entre las aves semi-pesadas y pesadas, respectivamente. Dicho comportamiento coincide con lo referido por la bibliografía con relación a la aptitud reproductiva de razas productoras de huevo para consumo y razas productoras de carne.In this work we evaluate different variables in relation with the reproductive output in two traditional breed chicken types one of them semi-heavy for egg production (Negra and Rubia INTA and the other one heavy whose offsprings are destined to meat chicken production (Campero INTA. We found significative differences in the settables egg number (191 and 110 eggs per hen per year in the fertility percent (93 and 88 in the hatchability (88 and 83 and in the chick number per hen per year (158 and 82 between semi-heavy an heavy chickens respectively. These results agree with the references in relation with reproductive fitness in laying and meat type chickens.

  6. Propuesta de un plan de gestión de administración en el primer nivel de atención como puerta de entrada obligatoria al Sistema Nacional de Salud Cantón Balzar año 2014.

    OpenAIRE

    Ayala Bustillos, Helen Yadira

    2015-01-01

    El primer nivel de atención de salud es la piedra angular del Sistema de Salud de todos los países del mundo, lograr que la operatividad de la misma sea efectiva resulta ser un desafío, disminuir las autoreferencias es el objetivo para que sea la puerta de entrada al Sistema Nacional de Salud. Se realizó una investigación de campo, exploratoria y descriptiva, se utilizó el método histórico lógico la muestra intencional de 41 usuarios a quienes se les realizaron encuestas de campo, con el ...

  7. Producción de plantas transgénicas de Solanum phureja variedad yema de huevo clon 1 mediada por Agrobacteriun tumefaciens

    Directory of Open Access Journals (Sweden)

    Chaparro Giraldo Alejandro

    2006-12-01

    Full Text Available El objetivo general de este proyecto fue la producción de plantas transformadas genéticamente de S. phureja
    variedad Yema de Huevo Clon 1 que sean potencialmente tolerantes a insectos, rasgo conferido por la inserción
    en su genoma del gen mirl2 derivado del pomelo (Citrus paradisi que codifica para un inhibidor de proteasas de
    tipo Serina. Se trabajó con el sistema de transformación mediado por Agrobacterium tumefaciens utilizando la cepa
    LBA4404 que contiene el plásmido residente pAL4404 y el vector binario pNOV022 el cual contiene el gen de interés mirl2. Se utilizaron como explantes entrenudos con una longitud de 0,5 a 1 cm provenientes de material in
    vitro entre cuatro a cinco semanas de edad, los cuales fueron co-cultivados en una concentración bacteriana de
    1/50, para posteriormente ser colocados en medio de regeneración sin agente de selección. Se encontró que el
    medio de regeneración más apropiado esta compuesto por Zeatina Ribósido (ZR 2 mg/L, ácido naftalenacético
    (ANA 0,04 mg/L y ácido giberélico (AG3 0,1 mg/L en el cual se logró obtener un 87,6% de callogénesis y un
    48,6% de regeneración. Posteriormente se estableció una población de individuos potencialmente transgénicos,
    a partir de los cuales se realizó una extracción de DNA, organizando los extractos en pools de diez individuos,
    obteniéndose un total de 52 pools, a partir de 520 individuos. Se utilizaron cuatro diferentes cantidades de DNA para un volumen final de 50 μl en la PCR: 150 ng; 300 ng; 600 ng; 1.200 ng y se realizó PCR para los dos genes mirl2 (IP y manA (PMI. Tras el análisis por electrofóresis de los resultados de la PCR para cada uno de los pools no se observó la señal de amplificación específica de los genes de interés, en tanto que se observó la señal para los genes endógenos de control. Finalmente se analizaron 62 clones provenientes de un segundo ensayo de transformaci

  8. Estudio comparativo de tres variantes del ensayo de la membrana corioalantoidea del huevo de la gallina para la evaluación de la irritación ocular

    Directory of Open Access Journals (Sweden)

    G. Murillo

    2003-01-01

    Full Text Available Durante los últimos años se han desarrollado variasalternativas con el objetivo de reemplazar la prueba de irritaciónocular en el conejo. El objetivo de este trabajo fue comparar lautilidad de tres protocolos diferentes de la prueba de la mem-brana corioalantoidea del huevo de gallina, descrita en una basede datos establecida de técnicas de Toxicología in vitro, eva-luando la irritación potencial de diez sustancias químicas y for-mulaciones. Se compararon los datos con aquellos obtenidos enla prueba animal tradicional. Se halló una buena correlación conlos datos del test in vivopara dos de los protocolos usados, enque tres sustancias fueron clasificadas como no irritantes y sietecomo irritantes en alguna magnitud. Sin embargo, se encontra-ron seis falsos negativos con la tercera prueba usada. Se discu-ten posibles causas para estos resultados. De las tres técnicasestudiadas la mejor es la que se basa en la utilización de azul detripano ya que se trata de una técnica más rápida, de más fácilrealización y con un resultado más fiable al evaluar los dañosocasionados en la membrana corioalantoidea de una forma obje-tiva y cuantificable

  9. Caracterización parcial de inmunoglobulinas G (IGy específicas contra la lectina de Salvia bogotensis a partir de huevos de gallina (Gallus domesticus

    Directory of Open Access Journals (Sweden)

    Pérez Gerardo

    2004-12-01

    Full Text Available Partiendo de yemas de huevos de gallinas inoculadas con la lectina presente en Salvia bogotensis, se ensayaron seis métodos de delipidación y extracción de anticuerpos de gallina (IgY. Se escogió la metodología por dilución con agua para continuar con la purificación de anticuerpos,
    debido a la remoción total de los lípidos de la yema y la alta actividad de las IgY contra la lectina de S. bogotensis. Para la purificación de anticuerpos se utilizaron diferentes métodos cromatográficos: cromatografía de intercambio iónico (DEAE Sephacel, hidrofóbica (Fenil Sepharosa 4B, exclusión molecular (Sephacryl S-200 y S-500, tiofílica (T-gel. Se escogió la cromatografía tiofílica ya que permitió la purificación de anticuerpos, para luego continuar con la caracterización de estos (peso molecular de las IgY y sus subunidades, cantidad de carbohidratos totales, punto isoeléctrico, interacción de las IgY con diferentes lectinas de leguminosas. Los valores de peso molecular del anticuerpo y sus subunidades concordaron con los reportes de la literatura. También se determinó el título de la población de IgY con un valor bastante alto en comparación al título de anticuerpos específicos dirigidos contra otro tipo de antígeno. Debido al bajo rendimiento de la cromatografía tiofílica se realizó una cromatografía de afinidad indirecta sobre aMSB Sepharosa 4B con el fin de purificar IgY específicos y continuar con los ensayos de caracterización. Aunque se obtuvieron fracciones eluídas de esta columna no se detectó proteína. Como alternativa para la purificación de anticuerpos se utilizó un soporte de Sephacryl S-200 a alta fuerza iónica. De esta cromatografía se obtuvieron anticuerpos parcialmente puros. Con
    esta fracción de anticuerpo se determinó la cantidad de carbohidratos totales, valor que se encontróalgo alejado al reportado en literatura, mientras el punto isoeléctrico de las IgY se encontró en los

  10. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  11. El secreto del huevo azul, de Catalina González Vilar. Estudio narratológico. The secret of the blue egg, by Catalina González Vilar. Narratological study

    Directory of Open Access Journals (Sweden)

    Miguel Sánchez-García

    2013-11-01

    Full Text Available This article discusses a narratological study of the literary work The secret of the blue egg, by the writer Catalina Gonzalez Vilar, that won El Barco de Vapor prize in 2012. It examines the different constitutive elements of the text (topic approach, prominent figures, syntactic structure, narrative technique… and his contribution to the development of the story with the purpose of discovering the aesthetic and literary values that contribute to the fable. It aims at demonstrating the proper use of them all as they shape a text rich in nuances, striking, suggestive. All these qualities of great importance both in creations aimed at adults as well as at children and young people because they enrich the final value of the work, and by extension, the cultural background of their readers.Este trabajo aborda el estudio narratológico de la obra El secreto del huevo azul, de la escritora Catalina González Vilar, que obtuvo el Premio El Barco de Vapor en el año 2012. Examina los diferentes elementos constitutivos del texto (el enfoque del tema, la caracterización de los personajes, la estructura sintáctica, el tratamiento del lenguaje, la técnica narrativa utilizada… y su aporte al desarrollo de la historia con la finalidad de descubrir los valores estéticos y literarios que aporta a la fábula. Pretende demostrar el adecuado uso de todos ellos dado que favorecen un texto rico en matices, llamativo, sugerente. Cualidades, todas ellas, de gran importancia tanto en creaciones destinadas al público adulto como al infantil y juvenil pues enriquece el valor final de la obra, y por extensión, el bagaje cultural de sus lectores.

  12. ENRIQUECIMIENTO DE HUEVOS CON ÁCIDOS GRASOS OMEGA-3 MEDIANTE LA SUPLEMENTACIÓN CON SEMILLA DE LINO (Linum usitatissimum EN LA DIETA

    Directory of Open Access Journals (Sweden)

    Gonzalo Díaz

    2009-04-01

    Full Text Available Objetivo. Enriquecer los huevos de gallina con ácidos grasos omega-3 (n-3 mediante la inclusión de semillas de lino en la dieta. Materiales y métodos. La dieta de las aves fue formulada con niveles de 0 (L0, 10 (L10, 15 (L15 y 20% (L20 de linaza. Se determinó la composición de ácidos grasos por cromatografía de gases y se evaluó la producción y calidad del huevo. Resultados. El porcentaje de producción de huevo fue superior en los grupos L0 y L15 (p<0.05 con 93,0 y 91,5% de producción comparada con 86,0 % en los grupos L10 y L20. La mejor conversión de alimento se presentó también en los grupos L0 y L15. Con la inclusión de semilla de lino, se incrementó el contenido de ácidos grasos n-3 desde 3,0 % en el grupo L0 hasta 12,6 % en el grupo L20, siendo los ácidos grasos n-3 á-linolénico (C18:3, n-3 y docosahexahenóico (DHA, C22:6, n-3 los hallados en mayor concentración. Con la inclusión de linaza en la dieta de las gallinas ponedoras se redujo el contenido de acido linoleico (C18:2n-6, lo cual resultó en una disminución en la relación n-6: n-3. Conclusiones. Con base en la evaluación económica se concluye que es posible enriquecer la yema de huevo de gallina hasta con un 10,1 % de ácidos grasos n-3 mediante la inclusión de un 15 % de linaza en la dieta de las gallinas, sin embargo, esto representó un sobrecosto de producción del 12%.

  13. Harina de crustáceos en raciones de gallinas ponedoras. Efecto en las variables productivas y evaluación sensorial de huevos almacenados en diferentes condiciones

    OpenAIRE

    M. Elena Carranco; C.C. Calvo; D.S. Carrillo; C.R. Ramírez; Morales, B. E.; G.L. Sanginés; M.B. Fuente; Ávila, G.E.; R.F. Pérez-Gil

    2011-01-01

    Se evaluó el efecto en las variables productivas de la inclusión de harina de camarón (HC) y harina de langostilla (HL) en dietas para gallinas ponedoras. Se hizo una evaluación sensorial del huevo fresco y almacenado en diferentes condiciones. Se distribuyeron 135 gallinas en tres tratamientos: testigo, HC (20 %) y HL (4 %). Los resultados se analizaron por ANDEVA y Friedman. Se demostró que variables productivas, como la evaluación sensorial, no mostraron diferencias significativas (P 0.05...

  14. AU-18 Space Primer

    Science.gov (United States)

    2009-09-01

    Canal is to ocean transportation”).36 Cole reported that...llit e in m ils at co m ʼs pr ot ec te d se gm en t C on tra ct fo rW id eb an d G ap fil le rS ys te m SI C R AL ,I ta lia n m ilit ar y co m m un ic... fil le r ©ILS U.S.NationalArchives U FO 8 w ith G BS pa yl oa d; fir st of 3 G BS la un ch es Es tim at ed M ob ile U se r O bj ec tiv e Sy st em la

  15. Datos biológicos de Doru luteipes (Dermaptera: Forficulidae en plantaciones de caña de azúcar y consumo de huevos de Diatraea saccharalis (Lepidoptera: Crambidae en condiciones de laboratorio Biological traits of Doru luteipes (Dermaptera: Forficulidae in sugar-cane crops, and consumption rates against Diatraea saccharalis eggs (Lepidoptera: Crambidae under laboratory conditions

    Directory of Open Access Journals (Sweden)

    Gladys M Romero Sueldo

    2009-12-01

    Full Text Available Diatraea saccharalis (Fabr. es considerada la principal plaga de la caña de azúcar en el noroeste argentino. El dermáptero Doru luteipes (Scudder desarrolla importantes poblaciones en dicho cultivo y ha sido descrito como predador de plagas en maíz, algodón y coles. El objetivo de este trabajo fue brindar información sobre algunos aspectos biológicos y estimar la capacidad de predación de las ninfas de Doru luteipes, a través de la tasa de consumo de huevos de Diatraea saccharalis. Se realizaron observaciones de campo y ensayos de laboratorio, en estos últimos se colocaron individualmente en tubos de ensayo, 50 ninfas de D. luteipes recién eclosionadas y se les ofrecía diariamente cien huevos de la plaga. La proporción de sexos de D. luteipes en campo fue de aproximadamente 1:1 y sus posturas presentaron una media de 31 huevos, con una tasa de emergencia cercana al 95%. El período de incubación se prolongó entre 6 y 10 días y el desarrollo de los estadios ninfales promedió los 37,6 días. Las ninfas pasaron por cuatro estadios y consumieron una media de 591,3 huevos de D. saccharalis. Estos resultados sugieren que D. luteipes desempeña un papel importante en el control natural de las poblaciones de D. saccharalis, por lo tanto, su presencia debería tenerse en cuenta al diseñar estrategias para controlar esta plaga.Diatraea saccharalis (Fabr. is considered the key pest of sugarcane crops in the Argentine northwest. The earwig Doru luteipes (Scudder develops high populations on sugarcane, and in other regions it was depicted as a significant predator of diverse pest in corn, cotton, and cabbage crops. The aim of this contribution is to inform about different biological parameters of this Dermaptera, and to assess the predatory capacity of its nymphs by means of the estimation of consumption rates using Diatraea saccharalis eggs. Both field and laboratory observations were carried out. In the latter, 50 neonate nymphs were

  16. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    Science.gov (United States)

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  17. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  18. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  19. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  20. Alternative Teacher Compensation: A Primer

    Science.gov (United States)

    Koppich, Julia E.; Rigby, Jessica

    2009-01-01

    This policy primer is designed to provide base-line information about new forms of teacher pay that are emerging around the country, to support the local conversations and negotiations that will lead to the development of innovative compensation systems. It identifies reasons why teacher compensation is high on local, state, and federal policy…

  1. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  2. Creencias de las profesoras de la Fundación Íntegramente. Un primer acercamiento al contexto sociocultural de la enseñanza de castellano a los inmigrantes de Santa Coloma de Gramenet

    Directory of Open Access Journals (Sweden)

    Hermes Diáz Ceniceros

    2010-06-01

    Full Text Available La constante llegada de inmigrantes a Cataluña provenientes de diferentes partes de África, Medio Oriente y Asia ha llevado a la creación de centros de acogida en los cuales se les ayuda a estos a integrarse socialmente. Uno de los centros en la mancha urbana de Barcelona es la Fundación Integramenet en Santa Coloma de Gramenet. En este apareció la necesidad de dar clases de castellano a los inmigrantes con el apoyo de profesores voluntarios. En este trabajo conoceremos los sistemas de creencias de los profesores con el objetivo de tener un primer acercamiento a las aulas de esta fundación. El método de investigación que utilizamos es el etnográfico y la herramienta con la cual recogimos los datos fue la entrevista semiabierta. Estas entrevistas las obtuvimos de cuatro informantes que llamamos Zafo, Helena, Sofía y Tere. Cada una de las entrevistas estuvo estructurada en torno a los temas de: cómo la profesión del profesor voluntario se relaciona con el sistema de creencias del profesor; cómo la previa experiencia de aprendizaje de una L2 sirve para preparar las clases; cómo se valora la multiculturalidad, y cómo los profesores se identifican con los problemas de los alumnos. En las entrevistas encontramos que los sistemas de creencias de los profesores se ven determinados en gran medida por la profesión. En cuanto a la experiencia de aprender una L2 encontramos que esta se aprovecha cuando las creencias profesionales lo permiten. De esta manera concluimos señalando la importancia de continuar nuestros estudios etnográficos sobre las creencias de los profesores y alumnos, con el propósito de poder en un futuro crear material de apoyo adecuado para esta clase de aulas.--------------------------------------------------------The continuous arrival of immigrants to Catalonia, coming from different parts of Africa, Middle East and Asia, has led to the creation of reception centres (welcome centres to help new arrivals integrate

  3. Geology of the epithermal Ag-Au Huevos Verdes vein system and San José district, Deseado massif, Patagonia, Argentina

    Science.gov (United States)

    Dietrich, Andreas; Gutierrez, Ronald; Nelson, Eric P.; Layer, Paul W.

    2012-03-01

    The San José district is located in the northwest part of the Deseado massif and hosts a number of epithermal Ag-Au quartz veins of intermediate sulfidation style, including the Huevos Verdes vein system. Veins are hosted by andesitic rocks of the Bajo Pobre Formation and locally by rhyodacitic pyroclastic rocks of the Chon Aike Formation. New 40Ar/39Ar constraints on the age of host rocks and mineralization define Late Jurassic ages of 151.3 ± 0.7 Ma to 144.7 ± 0.1 Ma for volcanic rocks of the Bajo Pobre Formation and of 147.6 ± 1.1 Ma for the Chon Aike Formation. Illite ages of the Huevos Verdes vein system of 140.8 ± 0.2 and 140.5 ± 0.3 Ma are 4 m.y. younger than the volcanic host rock unit. These age dates are among the youngest reported for Jurassic volcanism in the Deseado massif and correlate well with the regional context of magmatic and hydrothermal activity. The Huevos Verdes vein system has a strike length of 2,000 m, with several ore shoots along strike. The vein consists of a pre-ore stage and three main ore stages. Early barren quartz and chalcedony are followed by a mottled quartz stage of coarse saccharoidal quartz with irregular streaks and discontinuous bands of sulfide-rich material. The banded quartz-sulfide stage consists of sulfide-rich bands alternating with bands of quartz and bands of chlorite ± illite. Late-stage sulfide-rich veinlets are associated with kaolinite gangue. Ore minerals are argentite and electrum, together with pyrite, sphalerite, galena, chalcopyrite, minor bornite, covellite, and ruby silver. Wall rock alteration is characterized by narrow (220°C. Kaolinite occurring with the late sulfide-rich veinlet stage indicates pH 315°, whereas strike directions of <315° are predicted with an induced dextral strike-slip movement. The components of the structural model appear to be present on a regional scale and are not restricted to the San José district.

  4. The development, characterization and testing of magnesium-rich primers

    Science.gov (United States)

    Battocchi, Dante

    Aluminum alloys are widely used in aircraft industry for their strength and light weight. Those alloys that are hardened by precipitation, especially the Copper-rich of the 2000 series, are prone to corrosion and are protected against it using chromate containing coatings. The primary component of these coating systems is Chromium 6+ (CrVI) that has been found to be very toxic in the environment and carcinogenic, toxic and mutagenic in humans. The Mg-rich primer development is the result of a successful multi-year project funded by the US Air-force with its objective the replacement of coatings based on CrVI with a class of coatings less toxic and with comparable protective performances. The Mg rich primer fulfilled the USAF requirements and it is currently undergoing commercial and military qualifications testing. The use of Mg as one of the active pigments in coatings allows the primer to protect the underlying Al sacrificially, not considered possible for this substrate until now. Mg is anodic to most of the other structural metals and when particulate Mg became available commercially, the concept of the primer was first developed by analogy to Zn-rich coatings for steel. When Mg and Al are in contact and immersed in a corrosive environment, magnesium corrodes preferentially and protects the aluminum.

  5. La fenomenología del espíritu y su posibilidad de acceso al reino de la ética. Un primer acercamiento a la Filosofía del derecho de G. W. F. Hegel

    OpenAIRE

    Ávila Martínez, Alexánder; Universidad de San Buenaventura, Bogotá

    2014-01-01

    El presente artículo quiere mostrar una primera aproximación ala filosofía del derecho de G. W. F. Hegel. La aproximación se realiza através de la Fenomenología del espíritu y tiene como objetivo mostrar que el mundo de la ética se origina en el espíritu subjetivo. Al interior de tal proceso, se abordan siguiendo la dialéctica tres momentos: en el primero se estudia la dialéctica de mutuo reconocimiento entre autoconciencias, en el segundo se muestra la dialéctica del amo y del esclavo y sus ...

  6. Environmental Acceptable Medium Caliber Ammunition Percussion Primers

    Science.gov (United States)

    2008-05-01

    percussion primers typically consist of lead styphnate and antimony sulfide. Although highly effective, these heavy material compounds were identified under...Percussion primers, including those used in medium caliber ammunition, typically contain lead styphnate and antimony sulfide along with other constituents...Furthermore, current percussion primer compositions also contain barium nitrate. Although not negatively categorized by the Environmental Protection

  7. Relevamiento y evaluación de parasitoides de huevo para el control de Cydia pomonella (Lepidoptera: Tortricidae y Grapholita molesta (Lepidotera: Tortricideae

    Directory of Open Access Journals (Sweden)

    Oscar E. TORTOSA

    2014-01-01

    Full Text Available Desde el mes de octubre hasta el mes de abril de los años 2005-2006 y 2006-2007 realizamos la búsqueda e identificación de parasitoides de huevo de Cydia pomonella (L. (Lepidoptera: Tortricidae y Grapholita molesta (Busck (Lepi - doptera: Tortricidae en tres sitios de Mendoza, Argentina. Trichogramma cacoe - ciae Marchal (Hymenoptera: Trichogrammatidae fue colectado en huevos de las dos especies plagas, en todos los sitios del relevamiento, durante los dos ciclos de colecta. Se encontró Trichogramma pretiosum Riley (Hymenoptera: Trichogram - matidae solo en un sitio en el mes de diciembre de 2005. En los años 2008 y 2009 T. cacoeciae fue criado, liberado y evaluada su eficiencia en el control de C. pomonella y G. molesta a través del daño en los frutos. Realizamos dos ensayos de evaluación a campo en dos cultivos de peral orgánicos, en uno de ellos el daño promedio en frutos por C. pomonella y G. molesta fue de 5,07% ± 0,82 (testigo sin liberación 15,60% ± 4,73 y en el otro ensayo el daño promedio de ambas plagas fue de 1,92% ± 0,50 (testigo sin liberación 11,34 % ± 1,13. En ambos casos existi - eron diferencias estadísticamente significativas entre tratamiento y testigo.

  8. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  9. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  10. Loop quantum geometry: a primer

    Energy Technology Data Exchange (ETDEWEB)

    Corichi, Alejandro [Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, A. Postal 70-543, Mexico D.F. 04510 (Mexico)

    2005-01-15

    This is the written version of a lecture given at the 'VI Mexican School of Gravitation and Mathematical Physics' (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-experts interested in learning the basics of the subject.

  11. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  12. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  13. Single-primer fluorescent sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.; Grone, D.L.; Brumbaugh, J.A.

    1987-05-01

    Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal and temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.

  14. Estudio anual de la eliminación de huevos y ooquistes de parásitos gastrointestinales y larvas de nemátodos pulmonares en ovinos de una estancia en Magallanes, Chile Annual study of the of egg and oocyst outputs of gastrointestinal parasites and lungworm larvae in a sheep station of Magallanes, Chile

    Directory of Open Access Journals (Sweden)

    G. SIEVERS

    2002-01-01

    Full Text Available Con el fin de recabar antecedentes epidemiológicos sobre las endoparasitosis del ovino en Magallanes, XIIª Región de Chile, se trabajó en la estancia "Entre Vientos", comuna de Río Verde, durante un año (septiembre de 1999 a agosto del 2000. A partir de animales de 3 categorías de edad mantenidos bajo un sistema de explotación extensiva, compuestos por 9.800 corderos (nacidos durante la primavera de 1999, 1.800 borregas (1 año de edad y 13.500 ovejas (2 o más años de edad, se determinaron las tendencias de eliminación de huevos, ooquistes y larvas de parásitos gastrointestinales y pulmonares. Cada 14 días se obtuvo materia fecal desde el recto de 25 animales pertenecientes a cada grupo de edad, muestreados al azar, para realizar recuentos de huevos y diferenciación de larvas de nemátodos gastrointestinales, recuentos de huevos de cestodos, determinación de animales positivos a ooquistes de protozoos intestinales y detección de larvas de nemátodos pulmonares. Los corderos presentaron las mayores eliminaciones de huevos de nemátodos gastrointestinales durante el verano, con predominancia de los géneros Nematodirus y Ostertagia. En borregas y ovejas, las mayores eliminaciones de Ostertagia y Trichostrongylus se produjeron en primavera, coincidiendo con el alza de la temperatura ambiental. La categoría más contaminante fue la de las ovejas en primavera, mientras que los corderos lo fueron en el verano. Durante la primavera, la mayor parte de los animales eliminó ooquistes de Eimeria spp., pero fueron los corderos los mayores contaminantes. La mayor oviposición de huevos de Moniezia expansa se registró en corderos y borregas, durante el verano y primavera respectivamente. Larvas de Dictyocaulus filaria se detectaron principalmente en corderos durante el otoño e invierno. No se diagnosticaron casos de parasitosis clínicas durante los meses del estudio, lo que se puede explicar dado el sistema de crianza extensivo y al

  15. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  16. A Practical Primer on Geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  17. Péptidos antihipertensivos derivados de proteínas de leche y huevo Peptides with antihypertensive activity from milk and egg proteins

    Directory of Open Access Journals (Sweden)

    A. Aleixandre

    2008-08-01

    Full Text Available Algunos fragmentos de proteínas alimentarias, una vez liberados mediante hidrólisis, pueden producir un descenso del tono arterial. Son importantes los hidrolizados y péptidos provenientes de proteínas lácteas. Destacan los hidrolizados de caseína con tripsina, y los productos antihipertensivos obtenidos por fermentación de la leche con Lactobacillus helveticus. Estos productos contienen secuencias como Val-Pro-Pro (VPP e Ile-Pro-Pro (IPP, que inhiben la enzima convertidora de la angiotensina (ECA. Algunas cepas de Enterococcus faecalis también producen péptidos antihipertensivos inhibidores de la ECA. Entre estos péptidos destaca la secuencia LHLPLP. Existen asimismo péptidos e hidrolizados antihipertensivos derivados de proteínas de huevo. Podemos citar las secuencias FRADHPFL (ovokinina y RADHPF (ovokinina 2-7 con actividad vasodilatadora endotelio-dependiente, y algunos hidrolizados de clara de huevo que inhiben la ECA. Los productos mencionados podrían utilizarse como ingredientes en alimentos funcionales. Algunos han probado ya su eficacia y seguridad en pacientes hipertensos.Antihypertensive hydrolysates and peptides have been isolated from food proteins. Among them, there are of particular interest the antihypertensive casein hydrolysates, and some antihypertensive products obtained when milk was fermented by Lactobacillus helveticus. The sequences Val-Pro-Pro (VPP and Ile-Pro-Pro (IPP, with angiotensin-converting enzyme (ACE inhibitory activity, have been isolated from these fermented products. Selected Enterococcus faecalis strains can also produce milk derived peptides with ACE inhibitory and antihypertensive activities. The main of them is the sequence LHLPLP. Some studies also describe the production of antihypertensive hydrolysates and peptides from egg proteins. The sequences FRADHPFL (ovokinin and RADHPFL (ovokinin 2-7, that have shown endothelium-dependent vasodilator activity, were obtained at first. Some egg white

  18. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    Science.gov (United States)

    O'Halloran, Damien M

    2016-02-08

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  19. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  20. SBE primer : multiplexing minisequencing-based genotyping

    Energy Technology Data Exchange (ETDEWEB)

    Kaderali, L. (Lars); Deshpande, A. (Alina); Uribe-Romeo, F. J. (Francisco J.); Schliep, A.; Torney, D. C. (David C.)

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  1. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads;

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software......, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  2. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  3. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast

  4. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  5. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... in the News Press Room Assistance Society Overview Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  6. Mi Primer Concepto de Turismo

    Directory of Open Access Journals (Sweden)

    María Alejandra Cortés Gutiérrez

    2008-11-01

    Full Text Available El turismo es un hecho social al integrar al humano, pero también es producto de unos efectos económicos y culturales, es decir, el turismo es un hecho integrador y, por lo tanto, el turismo debe ser visto como hecho sociocultural y económico, debido a que el hombre se manifiesta dentro de unos espacios determinados. Además, es un hecho social porque puede ser entendido y analizado desde el exterior y porque está en constante cambio. Por lo tanto, el turismo debe ser visto holísticamente, ya que integra varios elementos; visto como totalidad, como complejidad, como sistema. El turismo también es generador de impactos negativos y positivos sobre las comunidades, unas veces integra, otras destruye, aísla, daña.

  7. Determinación cuantitativa de vitamina C y pigmentos y procesamiento de la papa criolla, variedad yema de huevo (Solanum phureja Juz et Buck

    Directory of Open Access Journals (Sweden)

    Isabel Alvarez G.

    2009-07-01

    Full Text Available Empleando papa pardo'pastusa (Solanum tuberosum como control, se determinó el contenido de Vitamina C total en la papa criolla, variedad Yema de Huevo (Solanum phureja, Juz et Buck y se evaluaron las pérdidas durante la cocción y el freído. Se utilizaron los métodos colorimétrico y densitométrico: el primero dio resultados altos debido a sustancias interferentes; el segundo reportó los siguientes valores: criolla 21 mg/100 g, pardo-pastusa 18 mg/100 g (para muestra fresca. Las pérdidas de Vitamina C de papa criolla con piel fueron durante la cocción {92°C durante 25' de 1 9 % y en el freído (175°C por 3' de 30%. También se analizaron los carotenos y xantofilas dando: carotenos en papa criolla, 1.5 mg/100 g, en pardo-pastusa 0.5 mg/100 g (muestra fresca y xantofilas en papa criolla 0.6 mg/100 g, en pardo-pastusa 0.13 mg/100 g. Se procesó en las siguientes formas no tradicionales: en harinas compuestas aceptadas por ios consumidores, en una sustitución del 2 0% con puré; frita en tajadas con piel y pasabocas de puré. El tiempo de vida fue para frita tres semanas a 16°C V más de una semana a 25°C; para pasabocas cinco semanas y media a 16 C y un mes a 30°C.

  8. DNA sequencing by synthesis with degenerate primers

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The degenerate primer-based sequencing Was developed by a synthesis method(DP-SBS)for high-throughput DNA sequencing,in which a set of degenerate primers are hybridized on the arrayed DNA templates and extended by DNA polymerase on microarrays.In this method,adifferent set of degenerate primers containing a give nnumber(n)of degenerate nucleotides at the 3'-ends were annealed to the sequenced templates that were immobilized on the solid surface.The nucleotides(n+1)on the template sequences were determined by detecting the incorporation of fluorescent labeled nucleotides.The fluorescent labeled nucleotide was incorporated into the primer in a base-specific manner after the enzymatic primer extension reactions and nine-base length were read out accurately.The main advanmge of the DP-SBS is that the method only uses very conventional biochemical reagents and avoids the complicated special chemical reagents for removing the labeled nucleotides and reactivating the primer for further extension.From the present study,it is found that the DP-SBS method is reliable,simple,and cost-effective for laboratory-sequencing a large amount of short DNA fragments.

  9. Reproducción en cautividad del lenguado senegalés (Solea senegalensis): inducción hormonal a la ovulación y obtención de huevos para la fecundación artificial

    OpenAIRE

    Rasines Pérez, Inmaculada

    2013-01-01

    El éxito del cultivo del lenguado senegalés, Solea senegalensis, está limitado por las disfunciones reproductivas de los ejemplares nacidos y criados en cautividad o de primera generación (F1). La presente tesis está dirigida a establecer un protocolo de inducción hormonal a la ovulación con análogos sintéticos de la hormona liberadora de gonadotropinas (GnRHa) y de extracción de los huevos por masaje abdominal para posteriormente, mediante fecundación artificial, obtener larvas de segunda ge...

  10. Beam shaping for laser initiated optical primers

    Science.gov (United States)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  11. Historia del primer templo mayor de Tunja, nombrado de Nuestra Señora de Guadalupe

    Directory of Open Access Journals (Sweden)

    Ernesto Porras Collantes

    2004-01-01

    Full Text Available Gonzalo Suárez Rendón Sarmiento, fundador de Tunja, bautizó con el nombrede Nuestra Señora de Guadalupe al primer templo mayor de la ciudad. Elcarpintero Gregorio López estuvo a cargo de la construcción de la obra, desdefebrero hasta la navidad del año de

  12. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  13. CME Ensemble Forecasting - A Primer

    Science.gov (United States)

    Pizzo, V. J.; de Koning, C. A.; Cash, M. D.; Millward, G. H.; Biesecker, D. A.; Codrescu, M.; Puga, L.; Odstrcil, D.

    2014-12-01

    SWPC has been evaluating various approaches for ensemble forecasting of Earth-directed CMEs. We have developed the software infrastructure needed to support broad-ranging CME ensemble modeling, including composing, interpreting, and making intelligent use of ensemble simulations. The first step is to determine whether the physics of the interplanetary propagation of CMEs is better described as chaotic (like terrestrial weather) or deterministic (as in tsunami propagation). This is important, since different ensemble strategies are to be pursued under the two scenarios. We present the findings of a comprehensive study of CME ensembles in uniform and structured backgrounds that reveals systematic relationships between input cone parameters and ambient flow states and resulting transit times and velocity/density amplitudes at Earth. These results clearly indicate that the propagation of single CMEs to 1 AU is a deterministic process. Thus, the accuracy with which one can forecast the gross properties (such as arrival time) of CMEs at 1 AU is determined primarily by the accuracy of the inputs. This is no tautology - it means specifically that efforts to improve forecast accuracy should focus upon obtaining better inputs, as opposed to developing better propagation models. In a companion paper (deKoning et al., this conference), we compare in situ solar wind data with forecast events in the SWPC operational archive to show how the qualitative and quantitative findings presented here are entirely consistent with the observations and may lead to improved forecasts of arrival time at Earth.

  14. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  15. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  16. Caracterización de la composición en proteína, lípidos, energía y perfiles de ácidos grasos en huevos de tilapia roja (Oreochromis spp.

    Directory of Open Access Journals (Sweden)

    Rubén Darío Valbuena-Villarreal

    2013-06-01

    Full Text Available Luego de considerar el significado de las tilapias en el escenario piscícola nacional, la posibilidad de mejorar los índices de producción es un imperativo técnico y, dentro de estos, focalizar esfuerzos experimentales en la semilla resulta ser una opción estratégica. Con el fin de establecer un referente de base se utilizaron las puestas individuales de 50 hembras de tilapia roja (Oreochromis spp. para determinar los contenidos en los huevos de proteína (% MS, extracto etéreo (% MS, energía (cal g-1 y los perfiles de ácidos grasos (%, con algunas relaciones de interés analítico. Salvo ciertas variaciones menores, los valores encontrados se ajustan a los registros disponibles para la especie en diferentes estudios, lo que sugiere que las dietas ofrecidas a los reproductores experimentales contienen los mínimos necesarios para asegurar una provisión de nutrientes y energía suficientes para los embriones y las larvas en formación. Se analiza que, como punto de partida, esta serie de datos tiene utilidad para el desarrollo de trabajos destinados a mejorar los estándares de producción de alevinos, considerando que las variaciones en la composición, que pueden ser determinadas sobre los huevos, se pueden utilizar y tienen validez como un indicativo directo de su calidad.

  17. Alteraciones del primer radio en el plano sagital. Tratamiento ortopodológico

    OpenAIRE

    Prats Climent, Baldiri; Alcorisa Rodero, Olga; Verdaguer Sanmartí, Josefina; Vázquez Amela, F. Xavier (Francesc Xavier); Vergés Salas, Carles; Vila Espinalt, Rosa M.

    2004-01-01

    Las alteraciones posicionales del primer radio en un plano sagital, dorsiflexionado o plantarflexionado, son causas de alteraciones en el funcionamiento de la articulación subastragalina y en consecuencia de la posición resultado del retropié. Esta relación causa-efecto depende de la movilidad (flexible, semiflexible o rígido) y de la adaptación del primer radio al suelo en la fase de apoyo total durante la marcha. Dependiendo de ello el tratamiento ortopodólogico será diferente, ...

  18. La atención hospitalaria al paciente con ictus en Cataluña: Resultados del «Primer Audit Clínic de l'Ictus. Catalunya, 2005/2006» In-hospital stroke care in Catalonia [Spain]: Results of the «First Clinical Audit of Stroke. Catalonia, 2005/2006»

    Directory of Open Access Journals (Sweden)

    Sònia Abilleira

    2008-12-01

    Full Text Available Objetivo: Analizar la calidad de la atención hospitalaria al paciente con ictus en los hospitales públicos catalanes antes de la difusión de la Guía de Práctica Clínica (GPC del ictus, estudiando el grado de adhesión a determinadas recomendaciones de la GPC. Métodos: Mediante revisión retrospectiva de historias clínicas de pacientes con ictus definidos mediante los códigos CIE-9 431, 433.x1, 434.x1, 436, e ingresados consecutivamente en 48 hospitales públicos catalanes en el primer semestre de 2005, se recogió información sobre distintos indicadores del proceso asistencial al ictus seleccionados según su evidencia científica o su importancia clínica. Los hospitales participantes reclutaron 20, 40 o 60 casos, según el número de ingresos/año. Se llevó a cabo una auditoría externa en el 9,3% de los casos reclutados en cada centro, tras selección aleatoria, para determinar la calidad de los datos recogidos. Los indicadores se agruparon en 6 perfiles relacionados con diferentes aspectos de la práctica clínica. Resultados: Se incluyeron 1.791 casos, un 53,9% hombres, con una media (desviación estándar de edad de 75,6 (12,4 años. La concordancia global entre observadores fue de 0,7. El cumplimiento de los perfiles asistenciales (porcentaje medio [intervalo de confianza del 95%] fue: calidad de la historia clínica, 78,5% (77,5-79,4; estándares de atención básica, 92,4% (91,5-93,2; evaluación neurológica, 38,3% (37,3-39,3; medidas iniciales del tratamiento rehabilitador, 44,9% (43,2-46,7; prevención y manejo de complicaciones, 68,4% (66,9-70, y medidas preventivas iniciales, 78,9% (77,3-80,4. Conclusiones: En 2005 la atención hospitalaria al ictus era mejorable, sobre todo los aspectos relacionados con la evaluación y el seguimiento neurológico del paciente y la rehabilitación.Objective: To determine the quality of in-hospital stroke care in public acute care hospitals in Catalonia before the implementation of a

  19. Issues Primer. EEE708 Negotiated Study Program.

    Science.gov (United States)

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  20. Environmentally Acceptable Medium Caliber Ammunition Percussion Primers

    Science.gov (United States)

    2007-10-31

    typically contain lead styphnate and antimony sulfide along with other constituents. Although highly effective, these heavy metal compounds have been...contain barium nitrate. Although not negatively categorized by the EPA itself, barium compounds are generally regarded as toxic and likewise should...contains the lead styphnate based FA956 composition2 which is a typical formulation of conventional military ammunition percussion primers. The

  1. A Primer on Policies for Jobs

    OpenAIRE

    Nallari, Raj; Griffith, Breda; Wang, Yidan; Andriamananjara, Soamiely; Derek H. C. Chen; Bhattacharya, Rwitwika

    2012-01-01

    A primer on policies for jobs is based on materials and input provided during the labor market courses conducted during the past 10 years. Its objective is to provide government policy makers, researchers, and labor market practitioners and other specialists with a practical guide on how to strengthen labor market institutions, especially in light of the global financial crisis. This prime...

  2. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  3. Primer design using Primer Express® for SYBR Green-based quantitative PCR.

    Science.gov (United States)

    Singh, Amarjeet; Pandey, Girdhar K

    2015-01-01

    To quantitate the gene expression, real-time RT-PCR or quantitative PCR (qPCR) is one of the most sensitive, reliable, and commonly used methods in molecular biology. The reliability and success of a real-time PCR assay depend on the optimal experiment design. Primers are the most important constituents of real-time PCR experiments such as in SYBR Green-based detection assays. Designing of an appropriate and specific primer pair is extremely crucial for correct estimation of transcript abundance of any gene in a given sample. Here, we are presenting a quick, easy, and reliable method for designing target-specific primers using Primer Express(®) software for real-time PCR (qPCR) experiments.

  4. Nutrición y desarrollo psicomotor durante el primer semestre de vida

    Directory of Open Access Journals (Sweden)

    CHÁVEZ ADOLFO

    1998-01-01

    Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.

  5. Christiaan Barnard: 40 años del primer transplante de corazón humano

    OpenAIRE

    Jorge Reynolds; Juan Fernando Cediel; César Payán

    2007-01-01

    Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Chris...

  6. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR

    Science.gov (United States)

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-lin; Korbie, Darren; Trau, Matt

    2017-01-01

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com). PMID:28117430

  7. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    Science.gov (United States)

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  8. Aplicación del análisis estadístico implicativo al estudio del rendimiento académico de estudiantes de primer año de las carreras de matemática y ciencia de la computación

    OpenAIRE

    Larisa Zamora Matamoros; Jorge Díaz Silvera

    2014-01-01

    El objetivo del presente trabajo de investigación es revelar posibles relaciones de similaridad, implicación y cohesión entre el rendimiento académico de estudiantes provenientes de preuniversitarios que ingresan a las carreras de Matemática y Ciencia de la Computación y el rendimiento que muestran en las asignaturas de corte matemático y de Programación que reciben en el primer año de las mencionadas carreras. El rendimiento fue analizado a través del índice de ingreso a la Educación Superio...

  9. Non increased neuron-specific enolase concentration in cerebrospinal fluid during first febrile seizures and a year follow-up in pediatric patients No incrementos en la concentración de enolasa específica de neurona en el líquido cefalorraquídeo durante el primer ataque febril y al año en pacientes pediátricos

    Directory of Open Access Journals (Sweden)

    ALBERTO J. DORTA-CONTRERAS

    1998-09-01

    Full Text Available Febrile seizures are the commonest acute neurological disorder of early childhood. Studies suggested that febrile seizures are previous acute events from a more serious neurological problem. Due to neuron-specific enolase is generally accepted as a marker for neuropathological processes in the brain, 16 pediatric patients were studied during their first seizures and a year after it. Neuron-specific enolase in cerebrospinal fluid and blood were analysed by an immune enzyme assay. Non pathological neuron-specific enolase values were obtained in both periods in the group of patients. There were no significative differences when paired series statistics test was performed with 95% of confidence. Neuron-specific enolase appears not to be a marker for febrile seizures because its concentration not be increased in cerebrospinal fluid in this group of patients.Los ataques febriles constituyen el trastorno neurológico agudo más común en la infancia temprana. Existen estudios que sugieren que los ataques febriles son eventos agudos previos a problemas neurológicos más severos. Debido a que la enolasa específica de neurona está aceptada generalmente como marcador de procesos neuropatológicos en el cerebro, se estudiaran 16 pacientes pediátricos durante su primer ataque y al año de este. La enolasa específica de neurona en el líquido cefalorraquídeo y sangre fue analizada por una prueba inmunoenzimática. No se obtuvieron valores patológicos de enolasa específica de neurona en ambos períodos en el grupo de pacientes. No hubo diferencias significativas al aplicar el test de series apareadas con un 95% de confianza. La enolasa específica de neurona parece no ser un marcador para ataques febriles porque su concentración no se incrementa en este grupo de pacientes.

  10. Genetics and health communication: a primer.

    Science.gov (United States)

    Greenberg, Marisa S

    2015-01-01

    The progress of genetic knowledge has been swift and steadfast. As we move forward in the genomic era, post Human Genome Project, and continue to explore how one's genes interact with one's environment, it becomes increasingly important for all audiences to have a firm grasp of the vocabulary used in this health context. This primer is intended to be used as a reference and to introduce and/or make more clear concepts related to genetics to increase understanding.

  11. Status of NC Primer Demonstration & Transition

    Science.gov (United States)

    2014-11-20

    skid coating – Navy facilities- plan to assess as alternative to zinc -rich primers – General: internal funding in place through at least 2019 to...anodized aluminum, magnesium, high-strength steel with cadmium, aluminum and zinc - nickel , composites • Stress corrosion cracking and corrosion...this data, NAVAIR authorizes the use of PPG, Inc. – Deft 02-GN-084 over conversion coatings qualified to MIL-DTL-81706, Type I, Class 1A when used

  12. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  13. Contaminación y viabilidad de huevos de Toxocara spp. en suelo y heces colectadas en parques públicos, calles y perros en Toluca, México

    OpenAIRE

    Camilo Romero-Núñez; Selene Yañez-Arteaga; Germán David Mendoza-Martínez; Lilia Patricia Bustamante-Montes; Ninfa Ramírez-Durán

    2013-01-01

    Se realizó un estudio de contaminación y viabilidad de huevos de Toxocara spp, parásito zoonótico en la ciudad de Toluca, México, para lo cual se colectaron 2374 muestras de suelos de siete parques, 350 de suelo de jardines de casas, 199 heces de perros con propietario y 199 heces obtenidas de la vía pública en las áreas cercanas a los parques. En los parques, la conta- minación con Toxocara fue de 24,7% y la viabilidad de 73,3%, siendo menor en los jardines de casa (13,9 y 40,3%, respe...

  14. Platigástridos (Hymenoptera: Platygastridae parasitoides de Pentatomidae en Córdoba. Caracterización de las masas de huevos parasitoidizadas y aspectos biológicos

    Directory of Open Access Journals (Sweden)

    Norma LA PORTA

    2013-01-01

    Full Text Available Se caracterizan las masas de huevos parasitoidizadas de pentatómidos per - tenecientes a cinco especies, cuatro fitófagas y una depredadora. Además, se analizan aspectos biológicos de esas oviposturas (abundancia y parasitoidismo y de sus para - sitoides (proporción sexual y emergencia: cinco especies de microhimenópteros plati - gástridos pertenecientes a los géneros Trissolcus Ashmead, Telenomus Haliday y Gryon Haliday . El análisis de las masas de huevos de pentatómidos en el campo apor ta indi - cadores exomorfológicos para determinar si están o no parasitoidizadas y, en algunos casos, conocer la especie de parasitoide emergente. Los altos niveles de parasitoidismo registrados en ambos sitios muestreados –Marcos Juárez y zona periurbana de Córdoba, sugieren que los parasitoides oófagos inciden de manera importante en las poblaciones de hemípteros presentes en el cultivo de soja. Las especies parasitoides mostraron una proporción de sexos marcadamente sesgada hacia las hembras, con un comportamiento similar respecto a cada huésped con el que interactuaron. Los porcentajes de emergencia resultaron más variables dependiendo de la especie parasitoide, del huésped y del sitio. El multiparasitoidismo fue registrado en todas las especies con excepción de Nezara viridula L. Telenomus podisi Ashmead fue el parasitoide común en las combinaciones observadas, resultando T. podisi-Trissolcus urichi Crawford la más frecuente.

  15. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  16. CRISPR Primer Designer:Design primers for knockout and chromosome imaging CRISPR-Cas system

    Institute of Scientific and Technical Information of China (English)

    Meng Yan; Shi-Rong Zhou; Hong-Wei Xue

    2015-01-01

    The clustered regularly interspaced short palin-dromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especial y the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran local y and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were stil no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs local y and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  17. Avulsión de canino y subluxación del primer premolar superiores derechos

    OpenAIRE

    1996-01-01

    Se presenta un caso clínico de avulsión de canino y subluxación del primer remolar, superiores derechos, secundario a traumatismo por piedra lanzada al aire. El tiempo extraoral fue de cuatro horas en medio seco. Se trató con reimplante, ferulización y tratamiento endodóncico. Los controles posteriores a los cuatro años del tratamiento mostraron la evolución favorable del caso.

  18. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  19. Spectrophotometric determination of tetrazene in primers and primer mixes by use of resorcinol.

    Science.gov (United States)

    Norwitz, G; Keliher, P N

    1979-06-01

    A spectrophotometric method is proposed for the determination of tetrazene (tetracene) in primers and primer mixes that involves treatment of the tetrazene with resorcinol solution and measurement of the intensity of the yellow colour of the diazo-dye produced. In the application of the method, lead styphnate and barium nitrate are first removed by extraction with ammonium acetate solution and then nitrocellulose and PETN are removed by extraction with acetone. The insoluble matter containing the tetrazene is boiled with resorcinol reagent, the solution filtered, and the absorbance measured at 400 nm. Conditions for optimum colour development are studied and the nature of the reaction is considered.

  20. Sequence-modified primers for the differential RT-PCR detection of Andean potato latent and Andean potato mild mosaic viruses in quarantine tests.

    Science.gov (United States)

    Koenig, Renate; Ziebell, Heiko

    2014-05-01

    To enable the differential PCR detection of Andean potato latent virus (APLV) and Andean potato mild mosaic virus (APMMV) strains, sense primers were designed that correspond to regions directly upstream of the coat protein genes. Their differentiating power was increased by A->C or T->C replacements in their 3'-terminal parts. Together with the broad-specificity antisense primer EM3, primer AL-a-mod3C detected all APLV strains tested, but none of the APMMV strains. Primer AM-a-mod4C yielded PCR products with all APMMV preparations, but also with some APLV preparations. Sequence analysis revealed that this was not due to a lack of primer specificity, but to the sensitive detection of contaminating APMMV in some of our APLV preparations.

  1. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  2. Emulsion primers, their contribution to bonding

    OpenAIRE

    González Sburlati, Rubén Osmar; Sapei, José

    2014-01-01

    Asphalt irrigation in its various types, performs specific functions in the structure of a road during the construction phase or their service life. In particular, the so-called "Irrigation Primer " is used in underlying layers, in order to generate a transition surface with the new asphalt layer; thus the tack or prime coat will be placed on a surface to ensure a good bond with the overlying layer. For a long time Diluted Asphalts (Cut Back mediums) where used, but have been discontinued for...

  3. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  4. An engineering primer on extreme value statistics

    Energy Technology Data Exchange (ETDEWEB)

    Novog, D.R.; Hoppe, F. [McMaster Univ., Hamilton, Ontario (Canada); Nainer, O. [Bruce Power, Tiverton, Ontario (Canada); Phan, B. [Ontario Power Generation, Toronto, Ontario (Canada)

    2009-07-01

    This primer is intended for individuals interested in gaining an understanding of Extreme Value Statistics (EVS). This work provides an explanation of EVS at a level that can be accessible to most people with an engineering or science background. While this work represents a simplification of the discussions from Reference 1, it is hoped that the authors will forgive any liberties taken in this paper. Some of the simplifications presented here may not be rigorous in all aspects, but the sacrifice in rigour is intended to aid the fundamental understanding of the EVS formulation and basic application. (author)

  5. Precedentes musulmanes y primer arte cristiano

    OpenAIRE

    Cabañero Subiza, Bernabé

    2006-01-01

    La comarca de las Cinco Villas en la que en los siglos X y XI no existió ningún centro artístico de primer orden en el que se crearan concepciones espaciales y soluciones formales propias. Por eso los monumentos de esta comarca pertenecientes a dichas centurias constituyen en casi todos los casos manifestaciones periféricas de corrientes artísticas creadas y desarrolladas fuera de sus confines. Esta llegada de soluciones formales foráneas a las Cinco Villas es tanto más explicable si...

  6. Corrosion Studies of 2195 Al-Li Alloy and 2219 Al Alloy with Differing Surface Treatments

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.

    1998-01-01

    Corrosion studies of 2195 Al-Li and 2219 Al alloys have been conducted using the scanning reference electrode technique (SRET) and the polarization resistance (PR) technique. The SRET was used to study corrosion mechanisms, while corrosion rate measurements were studied with the PR technique. Plates of Al203 blasted, soda blasted and conversion coated 2219 Al were coated with Deft primer and the corrosion rates studied with the EIS technique. Results from all of these studies are presented.

  7. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  8. Christiaan Barnard: 40 años del primer transplante de corazón humano.

    Directory of Open Access Journals (Sweden)

    Jorge Reynolds

    2009-11-01

    Full Text Available «El sábado, yo era un cirujano en Sudáfrica, poco conocido.El lunes, yo era una celebridad mundial» Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano.

  9. El primer caso de herejía en el Nuevo Mundo

    Directory of Open Access Journals (Sweden)

    Szászdi, István

    2001-12-01

    Full Text Available This article tries to identify the self-styled heretic from among the 39 Spaniards that remained in Fortress of Nativity when Christopher Columbus came back to Spain after his first journey to the New World.

    Intento de identificar al supuesto hereje entre los 39 españoles que se quedan en el Fuerte de la Navidad cuando Cristóbal Colón vuelve a España después de su primer viaje al Nuevo Mundo.

  10. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  11. GENOMEMASKER package for designing unique genomic PCR primers

    Directory of Open Access Journals (Sweden)

    Kaplinski Lauris

    2006-03-01

    Full Text Available Abstract Background The design of oligonucleotides and PCR primers for studying large genomes is complicated by the redundancy of sequences. The eukaryotic genomes are particularly difficult to study due to abundant repeats. The speed of most existing primer evaluation programs is not sufficient for large-scale experiments. Results In order to improve the efficiency and success rate of automatic primer/oligo design, we created a novel method which allows rapid masking of repeats in large sequence files, for example in eukaryotic genomes. It also allows the detection of all alternative binding sites of PCR primers and the prediction of PCR products. The new method was implemented in a collection of efficient programs, the GENOMEMASKER package. The performance of the programs was compared to other similar programs. We also modified the PRIMER3 program, to be able to design primers from lowercase-masked sequences. Conclusion The GENOMEMASKER package is able to mask the entire human genome for non-unique primers within 6 hours and find locations of all binding sites for 10 000 designed primer pairs within 10 minutes. Additionally, it predicts all alternative PCR products from large genomes for given primer pairs.

  12. High universality of matK primers for barcoding gymnosperms

    Institute of Scientific and Technical Information of China (English)

    Yan LI; Lian-Ming GAO; RAM C.POUDEL; De-Zhu Li; Alan FORREST

    2011-01-01

    DNA barcoding is a tool to provide rapid and accurate taxonomic identification using a standard DNA region. A two-marker combination of rnatK+rbcL was formally proposed as the core barcode for land plants by the Consortium for the Barcode of Life Plant Working Group. However, there are currently no barcoding primers for matK showing high universality in gymnosperms. We used 57 gymnosperm species representing 40 genera, 11families and four subclasses to evaluate the universality of nine candidate matK primers and one rbcL primer in this study. Primer (1F/724R) of rbcL is proposed here as a universal primer for gymnosperms due to high universality. One of the nine candidate matK primers (Gym_F1A/Gym_R1A) is proposed as the best "universal" matK primer for gynnosperms because of high polymerase chain reaction success and routine generation of high quality bidirectional sequences. A specific matK primer for Ephedra was newly designed in this study, which performed well on the sampled species. The primers proposed here for rbcL and matK can be easily and successfully amplified for most gymnosperms.

  13. Effects of continuous drought and immersion on hatchability of Ochlerotatus albifasciatus (Diptera: Culicidae eggs stored at low temperature Efecto de la sequía continua y la inmersión sobre la respuesta de eclosión de los huevos de Ochlerotatus albifasciatus (Diptera: Culicidae almacenados a baja temperatura

    Directory of Open Access Journals (Sweden)

    Raúl E Campos

    2007-07-01

    Full Text Available The role of environmental factors on the hatching response of O. albifasciatus (Macquart eggs is studied by simulating winter conditions in the laboratory. The hypothesis tested was that hatching response is affected by: (1 time that eggs remain at low temperature, (2 storage conditions, and (3 acclimatization time. Eggs were stored at 5ºC in drought and immersion conditions during 7, 21, 35, 90 and 146 days, immediately after, they were acclimatized at 22ºC during 24, 72, and 168 hours, and then eggs were flooded to induce hatching. Percent of hatched eggs was analyzed with a Generalized Lineal Model with a binomial distribution. Results show that: (1 a long storage period at cold temperature and long acclimatization periods improve the hatching response; (2 storage conditions have a moderate effect on hatching, being more evident in eggs stored dry; (3 a long time of acclimatization favors the hatching response in submerged eggs more than in eggs stored dry; (4 long time at cold favors the hatching response in eggs stored dry more than in submerged eggs; (5 the hatching response of eggs that remain for a long time at low temperature is higher when the time of acclimatization is long.Se estudió el rol de los factores ambientales sobre la eclosión de los huevos de O. albifasciatus (Macquart, simulando condiciones de invierno. La hipótesis planteada fue que la respuesta de eclosión de los huevos depende de: (1 tiempo de permanencia a baja temperatura, (2 condiciones de almacenamiento, y (3 tiempo de aclimatación. Los huevos fueron almacenados a 5º C en condiciones de sequía y sumergidos durante 7, 21, 35, 90 y 146 días; luego fueron aclimatados a 22º C durante 24, 72, y 168 horas y posteriormente inundados para inducir la eclosión. El porcentaje de huevos eclosionados se analizó con un Modelo Lineal Generalizado con distribución binomial. Los resultados mostraron que: (1 largos períodos de almacenamiento en frío y largos tiempos

  14. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  15. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  16. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  17. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  18. Primer diagnóstico de resistencia a ricobendazole y albendazole en nemátodos gastrointestinales parásitos de ovinos en Nicaragua.

    Directory of Open Access Journals (Sweden)

    Rimbaud E., Pineda N., Soto J.L., Luna L., Morales X., Rivera G., Picado L.;

    2006-10-01

    Full Text Available ResumenEn Diciembre de 2005, fue reportado unaparasitosis persistente en ovinos de laregión de trópico seco del pacifico (Ciudadde Rivas a tratamientos implementadoscon albendazole. Se realizó un test dereducción del contaje de huevos porgramo (h.p.g. en el hato ovino, para loque se utilizaron 45 borregos de 5 a 8meses de edad seleccionados en la baseque tenían un promedio de h.p.g. superiora 500. Los borregos fueron divididos encinco grupos (1-5. Los borregos de losgrupos 1 a 4 fueron tratadosrespectivamente con inyección subcutáneade ivermectina (200 mcg/kg, levamisol(7.5 mg/kg y ricobendazole (3.75 mg/kgy al cuarto grupo dosificación oral dealbendazole al 10%, mientras que el grupo5 permaneció como control sintratamiento. El contaje de reducción dehuevos por gramo llevado a cabo diez díasmas tarde mostró una reducción del92.73% en los corderos tratados conivermectina, un 94.84% en los tratadoscon levamisol, y en los tratados conalbendazole y ricobendazole la reducciónfue del 69.22%. El cultivo de larvasrealizado posteriormente mostrócrecimiento de Haemonchus sp. en lasheces de los corderos tratados. Este es elprimer reporte en Nicaragua de un caso deHaemonchus sp. parasitando ovinosresistente a albendazole y ricobendazole.

  19. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix].

    Science.gov (United States)

    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh

    1994-01-01

    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  20. El impacto y la recepción del Concilio Ecuménico Vaticano II en Navarra. Una aproximación al primer posconcilio marcado por la figura del prelado Mons. Enrique Delgado Gómez (1965-1968

    Directory of Open Access Journals (Sweden)

    Edurne Yániz Berrio

    2015-03-01

    Full Text Available Los estudios sobre el Concilio Ecuménico Vaticano II están viviendo un nuevo impulso con la aparición de una línea de investigación que sitúa a las iglesias locales como sujeto y objeto vivo/activo del propio Concilio. Este artículo se inscribe en esta línea, centrando nuestra atención en el impacto y la recepción del Concilio en la diócesis de Pamplona-Tudela, y más concretamente durante el primer post-concilio (1965-1968 a través del comporta-miento de dos figuras claves en el proceso de recepción conciliar: la figura del prelado y la comunidad eclesial local.   Palabras clave: Iglesia local, postconcilio, prelado, comunidad eclesial local. _______________Abstract: Studies about Council Vatican II have recently boosted with the arrival of a new investigation line which reveals local churches as a living/active subject and object within the council itself. This is the place where this article should be placed. Indeed, it draws all attention to the impact and the way the council was em-braced in the Pamplona-Tudela diocese, especially during the first post council period (1965-1968, through the figure of the prelate and the local church community.    Keywords: Local church, post council period, prelate, local church community. 

  1. Aplicación del análisis estadístico implicativo al estudio del rendimiento académico de estudiantes de primer año de las carreras de matemática y ciencia de la computación

    Directory of Open Access Journals (Sweden)

    Larisa Zamora Matamoros

    2014-08-01

    Full Text Available El objetivo del presente trabajo de investigación es revelar posibles relaciones de similaridad, implicación y cohesión entre el rendimiento académico de estudiantes provenientes de preuniversitarios que ingresan a las carreras de Matemática y Ciencia de la Computación y el rendimiento que muestran en las asignaturas de corte matemático y de Programación que reciben en el primer año de las mencionadas carreras. El rendimiento fue analizado a través del índice de ingreso a la Educación Superior, el promedio en las asignaturas de Matemática de los tres últimos grados de la enseñanza preuniversitaria (10mo, 11no y 12mo grado, la nota del curso introductorio y las notas obtenidas en el 1er año de la carrera en Análisis Matemático I y II, Álgebra I y II, Programación, y Lógica para los estudiantes de la carrera de Ciencia de la Computación y Geometría para los de Matemática. Se consideraron algunas variables suplementarias como el sexo, la carrera, la provincia de residencia del estudiante, si era externo o becado, la vía de ingreso a la Educación Superior y la procedencia (Preuniversitario, Orden 18 o Enseñanza Técnica Profesional, con el objetivo de determinar si estas variables podrían estar ejerciendo influencia en las relaciones que se obtuviesen.

  2. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  3. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  4. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  5. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  6. Uncoupling primer and releaser responses to pheromone in honey bees

    Science.gov (United States)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  7. High-speed measurement of firearm primer blast waves

    CERN Document Server

    Courtney, Michael; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast pressure of 8.2-25.0%. 3) Combined with smaller blast waves, these large variations in peak blast pressure of DDNP-based primers led to delayed ignition and failure to fire in brief field tests.

  8. DNA sequencing technology, walking with modular primers. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Ulanovsky, L.

    1996-12-31

    The success of the Human Genome Project depends on the development of adequate technology for rapid and inexpensive DNA sequencing, which will also benefit biomedical research in general. The authors are working on DNA technologies that eliminate primer synthesis, the main bottleneck in sequencing by primer walking. They have developed modular primers that are assembled from three 5-mer, 6-mer or 7-mer modules selected from a presynthesized library of as few as 1,000 oligonucleotides ({double_bond}4, {double_bond}5, {double_bond}7). The three modules anneal contiguously at the selected template site and prime there uniquely, even though each is not unique for the most part when used alone. This technique is expected to speed up primer walking 30 to 50 fold, and reduce the sequencing cost by a factor of 5 to 15. Time and expensive will be saved on primer synthesis itself and even more so due to closed-loop automation of primer walking, made possible by the instant availability of primers. Apart from saving time and cost, closed-loop automation would also minimize the errors and complications associated with human intervention between the walks. The author has also developed two additional approaches to primer-library based sequencing. One involves a branched structure of modular primers which has a distinctly different mechanism of achieving priming specificity. The other introduces the concept of ``Differential Extension with Nucleotide Subsets`` as an approach increasing priming specificity, priming strength and allowing cycle sequencing. These approaches are expected to be more robust than the original version of the modular primer technique.

  9. Política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi

    Directory of Open Access Journals (Sweden)

    Mario Antolinez

    2013-11-01

    Full Text Available El artículo examina la política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi. Para tal fin utiliza como marco conceptual los modelos de análisis de política exterior formulados por Robert Putnam y Kenneth Waltz. La premisa principal es que al inicio de su gobierno Koizumi intentó revitalizar las relaciones exteriores de su país imprimiendo una nueva dinámica en la toma de decisiones que se ajustaba a su estilo personal de hacer política y que, al mismo tiempo, se distanciaba de manera sustancial del proceso tradicional imperante durante años. Esta iniciativa se vio entorpecida, sin embargo, no solo por los problemas en Gaimusho –la entidad encargada de llevar a la práctica la diplomacia nipona–, sino también por el escenario geopolítico externo y por factores de política interna propios del momento histórico en consideración.

  10. PrimerSeq:Design and Visualization of RT-PCR Primers for Alternative Splicing Using RNA-seq Data

    Institute of Scientific and Technical Information of China (English)

    Collin Tokheim; Juw Won Park; Yi Xing

    2014-01-01

    The vast majority of multi-exon genes in higher eukaryotes are alternatively spliced and changes in alternative splicing (AS) can impact gene function or cause disease. High-throughput RNA sequencing (RNA-seq) has become a powerful technology for transcriptome-wide analysis of AS, but RT-PCR still remains the gold-standard approach for quantifying and validating exon splicing levels. We have developed PrimerSeq, a user-friendly software for systematic design and visualization of RT-PCR primers using RNA-seq data. PrimerSeq incorporates user-provided tran-scriptome profiles (i.e., RNA-seq data) in the design process, and is particularly useful for large-scale quantitative analysis of AS events discovered from RNA-seq experiments. PrimerSeq features a graphical user interface (GUI) that displays the RNA-seq data juxtaposed with the expected RT-PCR results. To enable primer design and visualization on user-provided RNA-seq data and transcript annotations, we have developed PrimerSeq as a stand-alone software that runs on local computers. PrimerSeq is freely available for Windows and Mac OS X along with source code at http://primerseq.sourceforge.net/. With the growing popularity of RNA-seq for transcriptome stud-ies, we expect PrimerSeq to help bridge the gap between high-throughput RNA-seq discovery of AS events and molecular analysis of candidate events by RT-PCR.

  11. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  12. Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys.

    Science.gov (United States)

    Geller, J; Meyer, C; Parker, M; Hawk, H

    2013-09-01

    DNA barcoding is a powerful tool for species detection, identification and discovery. Metazoan DNA barcoding is primarily based upon a specific region of the cytochrome c oxidase subunit I gene that is PCR amplified by primers HCO2198 and LCO1490 ('Folmer primers') designed by Folmer et al. (Molecular Marine Biology and Biotechnology, 3, 1994, 294). Analysis of sequences published since 1994 has revealed mismatches in the Folmer primers to many metazoans. These sequences also show that an extremely high level of degeneracy would be necessary in updated Folmer primers to maintain broad taxonomic utility. In primers jgHCO2198 and jgLCO1490, we replaced most fully degenerated sites with inosine nucleotides that complement all four natural nucleotides and modified other sites to better match major marine invertebrate groups. The modified primers were used to amplify and sequence cytochrome c oxidase subunit I from 9105 specimens from Moorea, French Polynesia and San Francisco Bay, California, USA representing 23 phyla, 42 classes and 121 orders. The new primers, jgHCO2198 and jgLCO1490, are well suited for routine DNA barcoding, all-taxon surveys and metazoan metagenomics.

  13. La gallina de los huevos de oro de nuevo está en peligro. Imágenes, posibilidades y viabilidades de la inteligencia colectiva

    Directory of Open Access Journals (Sweden)

    Jaime Alejandro Rodríguez Ruiz

    2007-01-01

    Full Text Available Dos proyectos wiki de ficción colaborativa, uno que fracasa y otro que se desarrolla con éxito, sirven como pretexto en este artículo para desplegar una reflexión sobre los nuevos modos de pensamiento y de vínculo social, favorecidos hoy por las nuevas tecnologías de la información y la comunicación: el proyecto de la inteligencia colectiva. Cuatro autores fundamentan esta reflexión: Pierre Lévy, Derrick de Kerckhove, Howard Rheingold y David Casacuberta. Después de mostrar las posibilidades del ejercicio de la inteligencia colectiva, el artículo concluye al afirmar que el espacio del conocimiento se constituye, irreversiblemente, en un nuevo espacio antropológico: el de la inteligencia colectiva, al que todos estamos llamados a construir.

  14. Una experiencia con QSB+ en Matemáticas de primer curso

    Directory of Open Access Journals (Sweden)

    Ordás Amo, Pilar

    2001-01-01

    Full Text Available Nuestro objetivo con este trabajo es presentar una experiencia que hemos llevado a cabo con los alumnos de primer curso, en la asignatura de Matemáticas, de las Licenciaturas en Ciencias Económicas y Administración y Dirección de Empresas, durante los cursos 1999/2000 y 2000/2001. El propósito de la experiencia es que los alumnos de primer curso vean una parte de la optimización matemática, como es la programación lineal, y el método del Símplex, a través de un software informático sencillo como es el QSB+, en el aula de ordenadores. Para llevar a cabo la experiencia, se añadió una hora lectiva al horario de los alumnos implicados y de los profesores de Matemáticas de primer curso, con plan nuevo (plan 99, durante el segundo semestre, de forma totalmente voluntaria para los alumnos, aunque la materia explicada en estas clases “extras” formaba parte del examen final de la asignatura. El nombre oficial de la experiencia fue Seminario de Programación Lineal, y tuvo una duración aproximada de quince horas lectivas.

  15. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  16. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  17. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    Energy Technology Data Exchange (ETDEWEB)

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  18. A physicists guide to The Los Alamos Primer

    Science.gov (United States)

    Reed, B. Cameron

    2016-11-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  19. Study on gene sensor based on primer extension

    Institute of Scientific and Technical Information of China (English)

    陈誉华; 宋今丹; 李大为

    1997-01-01

    Based on the fact that the resonant frequency of a piezoelectric crystal is the function of its surface deposit, and that the primer extends after it hybridizes with the template, the primer extension gene sensor technique was developed. The prominent feature of the technique is that fast and sensitive frequency signals are used as the monitoring system of gene hybridization and primer strand extension. Results show that this technique may be used in homologous analysis of nucleic acid, trace DNA detection, and determining the integration of DNA. It may also be used for isolation of target gene, gene mutation analysis, and predicting the location of a gene in its genome.

  20. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  1. ANÁLISIS TRANSITORIO DE CIRCUITOS DE PRIMER ORDEN USANDO EL OPERADOR D

    OpenAIRE

    Retana R., Ismael

    2011-01-01

    Este trabajo describe cómo usar las ecuaciones diferenciales para resolver problemas relativos a circuitos eléctircos que operan en régimen transitorio. Se ocupa de la respuesta de circuitos de primer orden tanto bajo excitación variable como bajo excitación constante. Se usa el operador D con el fin de obtener el modelo matemñatico del sistema. Se presenta además el fenómeno del dualismo en los circuitos. el artículo también introduce al estudiante en la terminología y los conceptos propios ...

  2. Las bibliotecas públicas durante el primer franquismo: entre la continuidad y la ruptura

    OpenAIRE

    Rodrigo Echalecu, Ana María

    2009-01-01

    En esta Memoria se analiza el concepto de biblioteca pública durante el primer franquismo, así como la organización bibliotecaria, los Centros Coordinadores de Bibliotecas, los diferentes tipos de bibliotecas públicas, así como el personal que las gestionó y sus instalaciones. Especial atención han recibido las bibliotecas municipales al estudiar el marco jurídico y su localización a través de una cartografía inédita.

  3. Apuntes sobre el Primer Congreso Internacional de Economía Social

    OpenAIRE

    Acosta, María Cristina

    2009-01-01

    El Primer Congreso Internacional de Economía Social, organizado por el Museo Social Argentino, fue auspiciado por el Superior Gobierno de la Nación y tuvo lugar en la Ciudad de Buenos Aires entre el 26 de octubre y el 4 de noviembre de 1924. En un principio la convocatoria al Congreso proponía discutir cuestiones fundamentales de la política social aunque finalmente, externdió los contenidos de la proyectada reunión a fin de abarcar las diferentes ramas de la economía social. En el Congreso p...

  4. Adición de Portulaca oleracea L. a la alimentación de gallinas murcianas para la obtención de huevos enriquecidos

    OpenAIRE

    Martínez Martínez, Paloma

    2015-01-01

    Ante el creciente interés de los consumidores por cuidar su salud a través de mejoras en sus hábitos alimenticios, cada vez más industrias alimentarias han incluido en su cartera de productos alimentos que cumplen una función adicional a la nutritiva al tener un efecto beneficioso o preventivo sobre la salud. Es por esto que el consumo de alimentos funcionales se ha disparado durante la última década, ofreciendo nuevas oportunidades a los productores del sector primario y secundario. La in...

  5. Indicadores de producción de huevo de gallinas Criollas en el trópico de México

    OpenAIRE

    J.C. Segura Correa; M.P. Jerez Salas; L. Sarmiento Franco; R. Santos Ricalde

    2007-01-01

    El objetivo de este estudio fue obtener indicadores productivos y determinar el efecto del genotipo de las gallinas Criollas sobre esos indicadores. El estudio se realizó en Mérida, Yucatán, México, de clima cálido subhúmedo con lluvias en verano. Las aves experimentales (n=308) pertenecían a los genotipos cuello desnudo homocigoto, cuello desnudo heterocigoto y homocigóticos al gen de emplume, obtenidos por inseminación artificial de una población de aves Criollas. Las aves se confinaron ind...

  6. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  7. MultiPLX: automatic grouping and evaluation of PCR primers.

    Science.gov (United States)

    Kaplinski, Lauris; Remm, Maido

    2015-01-01

    In this chapter we describe MultiPLX-a tool for automatic grouping of PCR primers for multiplexed PCR. Both generic working principle and step-by-step practical procedures with examples are presented. MultiPLX performs grouping by calculating many important interaction levels between the different primer pairs and then distributes primer pairs to groups so that the strength of unwanted interactions is kept below user-defined compatibility level. In addition it can be used to select optimal primer pairs for multiplexing from list of candidates. MultiPLX can be downloaded from http://bioinfo.ut.ee/?page_id=167. Graphical web-based interface to most functions of MultiPLX is available at http://bioinfo.ut.ee/multiplx/.

  8. Electrocoat Process for Non-Chromate Primers in DOD Manufacturing

    Science.gov (United States)

    2012-08-29

    Performance Benefits of Electrocoat Environmental, Health, and Safety Considerations • Aqueous based • Minimal waste discharge- closed loop...Electrocoat has larger area of blistering ; all surface corrosion • Spray primers have more localized, but deeper corrosion Scribe near fastener

  9. A Pollen Primer | NIH MedlinePlus the Magazine

    Science.gov (United States)

    ... please turn Javascript on. Feature: Managing Allergies A Pollen Primer Past Issues / Summer 2011 Table of Contents ... National Institute of Environmental Health Sciences (NIEHS) . Plant Pollen Ragweed and other weeds, such as curly dock, ...

  10. US Army War College Information Operations Primer

    Science.gov (United States)

    2009-11-01

    Steve Iatrou from the Information Operations Center of Excellence, Naval Postgraduate School: Mr. Paul Palmer and COL Mike Dominique USA, both...International Transformation Conference, June 3, 2009). 5 Cebrowski, 7. 6 Magnus Ekman et al., An In-Depth Look at Computer Performance Growth, Technical...Dominique Program Manage/Deputy Mr. Paul Palmer; YC-02 OPERATIONS Chief of Operations Mr. Cameron M. Wesson; YC-02 Information Engagements Ms

  11. Un primer retablo de Alberto de Churriguera

    Directory of Open Access Journals (Sweden)

    Rupérez Almajano, Mª Nieves

    2003-03-01

    Full Text Available Es conocida en lo esencial la actividad desarrollada por Alberto de Churriguera en Salamanca durante su etapa de madurez, como maestro de la Catedral y de la Plaza Mayor y al frente de las obras de los Colegios de Cuenca, de San Bartolomé o del Rey entre otros, así como diversos trabajos en Valladolid, Madrid, Orgaz y otros lugares. Sin embargo, son muy escasas las noticias que tenemos de obras o encargos al comienzo de su carrera profesional, lo que proporciona interés a cualquier dato que pueda ofrecer más luz sobre su dedicación en esos primeros años. Como se sabe Alberto de Churriguera había nacido en Madrid el 7 de agosto de 1676. A la muerte de sus padres quedó al cuidado de su hermano José, que se ocupó de formarlo y transmitirle su misma profesión «con toda eficacia». Se supone que en 1692 acompañó a su hermano a Salamanca para ejecutar el retablo de San Esteban...

  12. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    eliminate the lead styphnate and barium nitrate components in the current 20mm electric primer for the purposes of protecting our troops, production...Lead nitrate is added to the magnesium bis(trinitroresorcinol) to form lead styphnate and magnesium nitrate. The additional ingredient, barium ...conventional lead styphnate primers. On small scale samples, outstanding all-up round action times (AUR-ATs) were obtained for ambient (2.92 ms) and

  13. New universal matK primers for DNA barcoding angiosperms

    Institute of Scientific and Technical Information of China (English)

    Jing YU; Jian-Hua XUE; Shi-Liang ZHOU

    2011-01-01

    The chloroplast maturase K gene (matK) is one of the most variable coding genes of angiosperms and has been suggested to be a "barcode" for land plants. However, matK exhibits low amplification and sequencing rates due to low universality of currently available primers and mononucleotide repeats. To resolve these technical problems, we evaluated the entire matK region to find a region of 600-800 bp that is highly variable, represents the best of all matK regions with priming sites conservative enough to design universal primers, and avoids the mononucleotide repeats. After careful evaluation, a region in the middle was chosen and a pair of primers named natK472F and matK1248R was designed to amplify and sequence the matK fragment of approximately 776 bp. This region encompasses the most variable sites, represents the entire matK region best, and also exhibits high amplification rates and quality of sequences. The universality of this primer pair was tested using 58 species from 47 families of angiosperm plants. The primers showed a strong amplification (93.1%) and sequencing (92.6%)successes in the species tested. We propose that the new primers will solve, in part, the problems encountered when using matK and promote the adoption of matK as a DNA barcode for angiosperms.

  14. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  15. Antimony content of inorganic gunshot residue (IGSR) produced by 0.22 caliber rimfire ammunition having free-antimony primer.

    Science.gov (United States)

    Zeichner, Arie

    2017-01-01

    In a recent paper published in Forensic Science International (FSI), Lucas et al. (2016) claimed that muzzle discharge of 0.22 caliber rimfire ammunition is more likely to incorporate particles from the bullet surface than those retained on the firearm and that characteristic particles containing Pb, Ba and Sb formed from known Sb-free primers are likely to be more prevalent in muzzle discharge. It seems that this claim is not based on sufficient experimental results.

  16. Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular

    Directory of Open Access Journals (Sweden)

    Lucero López-Díaz

    2016-01-01

    Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.

  17. Antonio Roalas. Un pintor del primer tercio del siglo XVII en Madrid

    Directory of Open Access Journals (Sweden)

    Rodríguez Rebollo, Ángel

    2004-03-01

    Full Text Available El conocimiento que actualmente se tiene sobre los pintores del barroco madrileño ha avanzado mucho desde que Ángulo y Pérez Sánchez publicaran los dos volúmenes dedicados al primer y segundo tercio del siglo XVII. Posteriormente han ido viendo la luz estudios más pormenorizados, a veces en forma de exposiciones, que han clarificado aún más la importancia de los artistas que trabajaron en torno a la Corte de los llamados «los Austrias menores»; sin embargo, existen aún hoy un buen número de pintores sólo conocidos a través de contratos o inventarios de la época. La absoluta desinformación que tenemos de ellos, acrecentada por la inexistencia de obras firmadas, no permite a los historiadores dedicarles al menos un estudio parcial de su arte…

  18. Primera comprobación del alza postparto en el contaje de huevos de nemátodos en materia fecal de ovinos en Nicaragua (First report of post-parturient rise in faecal nematode egg count in sheep from Nicaragua

    Directory of Open Access Journals (Sweden)

    Rimbaud E.

    2005-11-01

    Full Text Available Se describe por primera vez en Nicaragua la presencia del fenómeno parasitológico de “alza postparto”, en el contaje de huevos de nemátodos en materia fecal de ovinos. Haemonchus contortus y Trichostrongylus colubriformis se desarrollaron pronunciadamente en hembras a las siete y ocho semanas postparto (P < 0.2 y P < 0.5. The post-parturient rise in the faecal nematode egg count in sheep from Nicaragua was described. Haemonchus contortus and Trichostrongylus colubriformis increase quickly at post partum in ewes seven and eight weeks later (P < 0.2 y P < 0.5.

  19. PENGOLAHAN PRIMER LIMBAH TEKSTIL DENGAN ELEKTROKOAGULASI

    Directory of Open Access Journals (Sweden)

    Lieke Riadi

    2014-12-01

    Full Text Available Limbah industri tekstil di area pinggir kota Surabaya mempunyai karakteristik perbandingan COD dan BOD = 5.57. Limbah jenis ini sulit untuk dibiodegradasi. Studi ini mempelajari tekonologi elektrokoagulasi untuk mengolah limbah tekstil dengan menurunkan intensitas warna, Total Suspended Solid (TSS dan Chemical Oxygen Demand (COD. Percobaan batch pada suhu kamar dilakukan untuk mempelajari pengaruh pH, jarak elektroda terhadap penurunan warna,TSS dan COD dan membandingkan biaya operasinya jika menggunakan pengolahan kimia.Effisiensi penurunan tertinggi untuk warna (91.96%,  TSS (49.17%, dan COD (29.67% terjadi pada pH awal 4.0 dan jarak elektroda 2 cm dengan  elektroda Al/Al. Waktu optimum penurunan intensitas warna dalah 10 menit. Laju penurunan COD adalah : -dC/dt = 0.0053 C +0.056 , dengan C adalah konsentrasi COD. Jumlah sludge yang dihasilkan daripengolahan elektrokoagulasi  3.4 % lebih kecil dibandingkan menggunakan bahan kimia. Biaya yang digunakan untuk pengolahan dengan elektrokoagulasi 52.35 % lebih murah dibandingkan jika menggunakan koagulasi dengan bahan kimia ( tawas. Kata kunci : elektrokoagulasi, penurunan warna, penurunan TSS, laju degradasi COD, imbah tekstil Abstract Waste water from textile industry which is located in one suburb of Surabaya city as characteristic which the ratio of COD to BOD was 5.57. This type of waste water is difficult to be biodegraded. This study investigated elektrokoagulasi technology to treat textile waste water by removing color, total suspended solid, and Chemical Oxygen Demand. Batch experiment at room temperature was carried out to study the effect of pH, electrode distance for color, TSS and COD removal. This study also tried to compare the operation cost between elektrokoagulasi and chemical processes. The best removal efficiencies by Al electrodes was 91.96 % for color, 49.17 % for TSS and 29.67 % for COD which were under initial pH 4.0 and electrodes distance 2 cm. The optimum operation

  20. Electrochemical performance of a localized repair. Effect of applying a primer and a bonding membrane

    Directory of Open Access Journals (Sweden)

    Castro-Borges, P.

    2003-12-01

    Full Text Available It is customary, in the constructions at the North of Yucatán, to employ primers to the rebars as a repair method in reinforced concrete, it has been observed in the literature that using primers alone presents an electrochemical behaviour still under discussion. Under these circumstances, several investigations have focused on the evaluation of the factor against or in favour of using primers as a repair method in a tropical marine environment. In this paper, the effects of applying a bonding membrane and the galvanic effect generated by the repair are also discussed. Small reinforced concrete columns were prepared and exposed under accelerated degradation cycles. After the activation of the rebars, the columns were repaired applying three types of primers, leaving one bar as control. After curing, the columns were exposed again to the same environment and their electrochemical behaviour was monitored. Corrosion potentials, polarization resistance, carbonation and chloride content were measured as a function of time. Conclusions suggest that the bonding membrane reduces the corrosion rates for the conditions and exposure time studied. The galvanic effect was observed after repairing the columns with and without bonding membrane, but with a tendency to reduce with time. The primers applied helped to reduce the galvanic effect of the repair, and to increase the polarization resistance.

    En las construcciones del norte de Yucatán se emplean, por costumbre, las imprimaciones al refuerzo como método de reparación al hormigón armado. Se ha observado en la literatura que la utilización sólo de imprimaciones presenta un comportamiento electroquímico, motivo éste, aún, de amplia discusión. Ante estas situaciones se llevaron a cabo varias investigaciones que tienen como objetivo la evaluación de las situaciones que favorezcan o no la utilización de las imprimaciones como método de reparación en un ambiente tropical marino. En este

  1. Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

    Directory of Open Access Journals (Sweden)

    Julio J. Masquijo

    2014-10-01

    Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

  2. Novel multiple 5'-amino-modified primer for DNA microarrays.

    Science.gov (United States)

    Han, Jing; Lee, Hin; Nguyen, Nga Yen; Beaucage, Serge L; Puri, Raj K

    2005-08-01

    For DNA microarray analysis, total RNA is reverse-transcribed, labeled by incorporating fluorescent dye into the cDNA, and used to hybridize microarray. This protocol requires a minimum of 20 microg of total RNA. To overcome the sample limitation, an RNA amplification technique has been developed. Although it needs less RNA, this amplification technique is relatively expensive, time consuming, and, unfortunately, has been found to introduce bias. In this study, we designed a novel 5'-amino-modified primer and used it for priming cDNA synthesis. The novel primer has a special structure that contains four Uni-Link molecules with two nucleotide (thymine) residues inserted between them as spacers. This novel primer is used in the reverse-transcription reaction for cDNA synthesis. Using the novel 5'-modified primer combined with indirect labeling method, cDNA probes can be prepared with much less total RNA (5 microg or less) without amplification producing optimal results after hybridization of arrays. This primer can also be used to label nucleotides for other purposes.

  3. Friction Stir Welding of Shipbuilding Steel with Primer

    Directory of Open Access Journals (Sweden)

    José Azevedo

    2016-03-01

    Full Text Available Abstract Friction Stir Welding has proven its merits for welding of aluminium alloys and is focused in expanding its material database to steel and titanium and also to assess new joint configurations. The use of welded structures in shipbuilding industry has a long tradition and continuously seeks for innovation in terms of materials and processes maintaining, or even, reducing costs. Several studies have been performed in the past years on FSW of steel. However, just recently were reported defect-free welds, free of martensite with stable parameters in steel without Primer. FSW of steel with primer has not been addressed. This work aims to fulfil a knowledge gap related to the use of friction stir for welding shipbuilding steel by analysing the effect of welding parameters on the metallurgical characteristics and mechanical properties of welds obtained with an innovative FSW tool in joining steel plates with a primer. Welds were performed in 4mm thick GL-A36 steel plates painted with a zinc based primer followed by a detailed microscopic, chemical and mechanical analysis. The results that matching fatigue properties are obtained using this technique, in FSW of shipbuilding steel with Primer.

  4. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1997-01-01

    Reverse transcription of retroviral genomes is primed by a tRNA annealed to an 18-nucleotide primer binding site. Here, we present a primer complementation system to study molecular interaction of the replication machinery with the primer and primer binding site in vivo. Introduction of eight base......, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... substitutions into the primer binding site of a murine leukemia virus-based vector allowed efficient RNA encapsidation but resulted in severely reduced vector replication capacity. Replication was restored upon complementation with a synthetic gene designed to encode a complementary tRNA-like primer...

  5. Studies on the Primers Screening for AFLP Fingerprints of Rice Cultivars

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun-qing; JIA Ji-zeng

    2002-01-01

    AFLP(amplified fragment length polymorphism) is a very powerful fingerprinting technology.The key of making variety fingerprints is to select specific powerful primers for each crop. A quick and effective procedure for selecting AFLP primers for rice variety fingerprinting was established as the following: (1)Choose 3 or more group materials that have close genetic relations. (2) Select potential polymorphic primers from primer pairs that are 2 + 2 primer crosses and same at two ends. (3) Recombine the selected potential polymorphic primers and choosing more polymorphic primers. (4) Add one selecting base at one end to become 2 + 3 or 3 + 2primers and further selecting more polymorphic primers. Some primers were selected with this procedure, such as M21Ps7 and M73P17, with which the fingerprints had more polymorphism and high quality.

  6. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1993-01-01

    can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site.......(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus......Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching tRNA...

  7. La mediación pedagógica utilizada por docentes de niños de primer grado que ya saben leer y escribir: una herramienta para abordar sus necesidades e intereses y fortalecer su aprendizaje

    OpenAIRE

    Barrantes Bermúdez, Marianela

    2014-01-01

    El presente trabajo investigativo, titulado “La mediación pedagógica utilizada por docentes de niños de primer grado que ya saben leer y escribir: una herramienta para abordar sus necesidades e intereses y fortalecer su aprendizaje”, se realizó con el fin de conocer cuáles eran las estrategias desarrolladas por una docente de primer grado en el área de Español con aquellos estudiantes con un mayor avance en lecto escritura, al cursar primer grado de Educación Básica y cómo e...

  8. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  9. A High Temperature Hermetic Primer and a Variable Spring Tester

    Energy Technology Data Exchange (ETDEWEB)

    Begeal, D.R.

    1994-05-01

    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  10. New cyt b gene universal primer set for forensic analysis.

    Science.gov (United States)

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  11. Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.

    Science.gov (United States)

    Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan

    2008-01-01

    In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera.

  12. A primer on wavelets and their scientific applications

    CERN Document Server

    Walker, James S

    2008-01-01

    In the first edition of his seminal introduction to wavelets, James S. Walker informed us that the potential applications for wavelets were virtually unlimited. Since that time thousands of published papers have proven him true, while also necessitating the creation of a new edition of his bestselling primer. Updated and fully revised to include the latest developments, this second edition of A Primer on Wavelets and Their Scientific Applications guides readers through the main ideas of wavelet analysis in order to develop a thorough appreciation of wavelet applications. Ingeniously relying o

  13. Coordinación y evaluación de la implantación del primer curso de Ingeniería Robótica

    OpenAIRE

    Sirvent-Llamas, Alejandro; Heredia Ávalos, Santiago; Beltrán, M.I.; Esclapés Jover, Francisco Javier; Pujol, Francisco A.; Corbí Bellot, Antonio Miguel; Torres, Fernando; Torrejon, Jose M.; Reyes Perales, José Antonio; Cazorla, Miguel

    2016-01-01

    En el curso 2015-16 se ha implantado la nueva titulación de grado en Ingeniería Robótica en la Universidad de Alicante. Este grado es el primero en el territorio nacional de estas características. El perfil de los estudiantes es una combinación entre un ingeniero industrial y uno informático, perfil muy demandado por las empresas. La principal cuestión que nos planteamos en este estudio es la implantación del primer curso de este novedoso grado. Al ser el primer grado de estas características...

  14. PCR Primer Design for 16S rRNAs for Experimental Horizontal Gene Transfer Test in Escherichia coli

    Science.gov (United States)

    Miyazaki, Kentaro; Sato, Mitsuharu; Tsukuda, Miyuki

    2017-01-01

    We recently demonstrated that the Escherichia coli ribosome is robust enough to accommodate foreign 16S rRNAs from diverse gamma- and betaproteobacteria bacteria (Kitahara et al., 2012). Therein, we used the common universal primers Bac8f and UN1541r to obtain a nearly full-length gene. However, we noticed that these primers overlap variable sites at 19[A/C] and 1527[U/C] in Bac8f and UN1541r, respectively, and thus, the amplicon could contain mutations. This is problematic, particularly for the former site, because the 19th nucleotide pairs with the 916th nucleotide, which is a part of the “central pseudoknot” and is critical for function. Therefore, we mutationally investigated the role of the base pair using several 16S rRNAs from gamma- and betaproteobacteria. We found that both the native base pairs (gammaproteobacterial 19A–916U and betaproteobacterial 19C–916G) and the non-native 19A–916G pair retained function, whereas the non-native 19C–916U was defective 16S rRNAs. We next designed a new primer set, Bac1f and UN1542r, so that they do not overlap the potential mismatch sites. 16S rRNA amplicons obtained from the environmental metagenome using the new primer set were dominated by proteobacterial species (~85%). Subsequent functional screening identified various 16S rRNAs from proteobacteria, all of which contained native 19A–916U or 19C–916G base pairs. The primers developed in this study are thus advantageous for functional characterization of foreign 16S rRNA in E. coli with no artifacts.

  15. Estudio de la contaminación con huevos de Toxocara sp. en suelos de espacios públicos de San Martín de los Andes, Provincia del Neuquén. Argentina. (Soil contamination with Toxocara sp. eggs in public parks from San Martín de los Andes, Province of Neuquen, Argentina

    Directory of Open Access Journals (Sweden)

    Brusoni, Claudio: Medico Veterinario,

    2005-10-01

    Full Text Available Con el objetivo de determinar la presencia de huevos de Toxocara sp. en suelos de espacios públicos de San Martín de los Andes, Provincia del Neuquén, Argentina, se estudiaron suelos de 12 parques de la localidad entre Abril y Julio de 2005. Se comprobó la presencia de huevos de Toxocara sp. en el 92% de los sitios de muestreados. Se recomienda la implementación de acciones para minimizar los riesgos a la salud pública. The objective being to determine if our soil in parks and publics areas were contaminated with Toxocara sp. eggs, we surveyed 12 different places in the area of San Martín de los Andes, Province of Neuquén from April to July, 2005. The presence of Toxocara sp. Eggs was confirmed in 92% of the places studied. In order to minimize the risk for our public health, we recommended the implementation of safety measures.

  16. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

    Directory of Open Access Journals (Sweden)

    Harold Castañeda-Peña

    2010-01-01

    Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.

  17. El primer equipo interdisciplinario de Costa Rica

    Directory of Open Access Journals (Sweden)

    Pablo David Navarro Villalobos

    2008-03-01

    Full Text Available El abuso sexual es un conjunto de actitudes de un sujeto que realiza en detrimento de otro, generalmente menor, para su autosatisfacción. Las estadísticas de los diferentes países apuntan a que se está convirtiendo en una epidemia que nos está asfixiando. La prevención de la revictimización, una política establecida en el Poder Judicial de Costa Rica desde hace más de diez años, dio como fruto la conformación de los equipos interdisciplinarios. Al inicio, estos abarcaron una serie de disciplinas tan disímiles entre sí, que comprendían tanto el derecho, como la medicina, la psicología, el trabajo social y la psiquiatría. Con el paso de los años los equipos se fueron reduciendo hasta quedar conformados por el psicólogo, el trabajador social y el médico forense, que asiste a una reunión semanal con ellos y en donde se discuten las diferentes conclusiones de las tres disciplinas. Hoy en día son equipos establecidos prácticamente en todas las cabeceras de provincia de nuestro país con funciones periciales muy específicas en el tratamiento legal de las causas de los delitos sexuales.Sexual Abuse is series of actitudes of a subject, Which he realize in detriment of other, usually younger, for his self satisfaction. The statistics of differents countries shows that this issue is torning into epidemics amounts ant its suffocating us. Prevention in revictimation is a policy established in Costa Rica for over a decade and for this we has had form interdisciplinary teams. In early times those temas had a lot of uncompatible disciplines soch as team is formed by only three members: the forensic doctor, the psychologist and the social worker, ehom attent to a weekly metting to analize the different conclusions of each especiallist. Actually there are teams established in almost all head of province in our country with percial function well established in the legal treatment of the causes of these crimes.

  18. Specific primers for the detection of the black-yeast fungus associated with lethargic crab disease (LCD).

    Science.gov (United States)

    Pie, Marcio R; Boeger, Walter A; Patella, Luciana; Vicente, Vânia A; Ribeiro, Raphael O; Ostrensky, Antonio

    2011-03-16

    Lethargic crab disease (LCD) is an emerging infirmity that has been causing extensive mortalities in populations of the mangrove land crab Ucides cordatus (Ocypodidae) along the Atlantic coast of Brazil. Previous studies have indicated that LCD is associated with a dematiaceous fungus, Exophiala cancerae de Hoog et al. In the present study, we sequenced the internal transcribed spacer (ITS) of the rDNA region of this black yeast species and developed species-specific PCR primers. Sensitivity tests indicated that the developed protocol is capable of detecting very small amounts of target DNA. Also, the application of the protocol to a variety of other dematiaceous fungi did not generate any false positives. The specific primers provided in the present study represent an important tool for rapidly surveying a large number of crab individuals, as well as environmental samples. Such knowledge will be instrumental in understanding the epidemiological dynamics of LCD.

  19. Musculatura asociada al primer y segundo arco visceral de algunos anuros leptodactílidos

    Directory of Open Access Journals (Sweden)

    Palavecino, Patricia Mónica

    1999-01-01

    Full Text Available Se describe y compara la musculatura mandibular e hioidea de larvas de cuatro especies de anuros leptodactílidos presentes en el noroeste argentino. Las características miológicas observadas en Odontophrynus lavillai y Telmato-bius sp. son muy semejantes a las descriptas para otras larvas de anuros. Por el contrario, Ceratophrys cranwelli y Lepidobatrachus llanensis, muestran particularidades en éstos caracteres que los diferencian notablemente entre sí y con el resto de las especies descriptas. Tales particularidades parecen estar relacionadas con su modo de alimentación. Para la larva de Ceratophrys cranwelli se nomina un nuevo músculo, intermandibularis medio superficial. The jaw and hyoid musculature are described and compared for species of anuran tadpoles from the argentinean northwest. The myological characteristics observed in Odontophrynus lavillai and Telmatobius sp. are very similar when compared with other anuran tadpoles. In the contrast, Ceratophrys cranwelli and Lepidobatrachus llanensis show special muscular features which point out difference between each other and with all described species. These different characteristics appear to be related with their feeding habits. A new muscle found in Ceratophrys cranwelli, intermandibularis medio superficial, is desbribed and named.

  20. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  1. Barcoded Primers Used in Multiplex Amplicon Pyrosequencing Bias Amplification

    OpenAIRE

    2012-01-01

    “Barcode-tagged” PCR primers used for multiplex amplicon sequencing generate a thus-far-overlooked amplification bias that produces variable terminal restriction fragment length polymorphism (T-RFLP) and pyrosequencing data from the same environmental DNA template. We propose a simple two-step PCR approach that increases reproducibility and consistently recovers higher genetic diversity in pyrosequencing libraries.

  2. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  3. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  4. STITCHER 2.0: primer design for overlapping PCR applications.

    Science.gov (United States)

    O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-03-30

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.

  5. STITCHER 2.0: primer design for overlapping PCR applications

    Science.gov (United States)

    O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-01-01

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011

  6. Primer hallazgo de Aedes albopictus Skuse en el Gran Área Metropolitana de Costa Rica

    Directory of Open Access Journals (Sweden)

    Rodrigo Marín Rodríguez

    2014-06-01

    Full Text Available Objetivo: Informar sobre el primer hallazgo de Aedes albopictus en el Gran Área Metropolitana de Costa Rica. Métodos: Formas inmaduras de mosquitos colectadas en la Ciudadela La Carpio, Distrito Uruca, San José, como parte de una barrida epidemiológica fueron diagnosticadas preliminarmente como Ae. albopictus. Dicho material se fijó en alcohol al 70 %, se aclaró en lactofenol y se evaluó taxonómicamente mediante claves dicotómicas especializadas. Resultados: Las formas inmaduras evaluadas procedieron de dos criaderos, un tarro y un balde. Las características de las larvas y pupas permitieron identificarlas taxonómicamente como Ae. albopictus. Este es el primer reporte sobre la presencia de dicho vector en Costa Rica. Discusión: La presencia de Ae. albopictus en la Gran Área Metropolitana ocurre como parte del proceso de expansión que está teniendo dicho vector por el territorio nacional. Su presencia debe ser motivo de estudio para determinar su eventual papel en la transmisión del dengue. Por otro lado la presencia de este vector complica la gestión de la vigilancia entomológica de dengue que ha estado dirigida fundamentalmente a la identificación y control del Aedes aegypti.

  7. Por mano propia. La justicia policial de la provincia de Buenos Aires en el primer peronismo

    Directory of Open Access Journals (Sweden)

    Osvaldo Barreneche

    2009-11-01

    Full Text Available La sanción del Código Penal Policial fue una pieza importante en el andamiaje jurídico por el cual el primer gobierno peronista procuró afianzar la profesionalización y disciplinamiento de las fuerzas de seguridad en las distintas jurisdicciones del país. Así, se organizó y se puso en marcha una nueva rama de la justicia bonaerense, paralela a la ordinaria, integrada completamente por policías retirados y en actividad, que se ocupó de los casos penales donde estuviesen implicados uno o más policías. Este trabajo analiza dicha experiencia, basándose en los casos sumariados y resueltos por la Justicia Policial mientras existió. En primer lugar se pone en contexto los fundamentos y propósitos que guiaron al peronismo para impulsar una justicia 'uniformada' que se ocupase de los excesos y falta a los deberes de los funcionarios policiales a nivel penal y administrativo. Luego se estudia su aplicación concreta en la provincia de Buenos Aires, indagando sobre los casos juzgados, su tratamiento, los actores, los fallos y los fines políticos perseguidos por esta justicia por y para policías

  8. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  9. Al clamor de les vuvuzeles

    Directory of Open Access Journals (Sweden)

    Javier Olivera Betrán

    2010-09-01

    Full Text Available El Mundial de Futbol de Sud-àfrica ha situat l’Àfrica al mapa mundial i ha mostrat al món el triomf de l’estil de futbol d’Espanya basat en la col·lectivitat, l’esperit d’equip, la humilitat, la cohesió interna i el joc bonic. L’organització africana, seriosa i eficaç, ha sabut mobilitzar i il·lusionar la població del país que ha participat en el mundial des de l’orgull de ser africà, amb l’esperit alegre, festiu i també reivindicatiu de la gent de l’Àfrica. Aquest esdeveniment suposa el llançament de la marca “Sud-àfrica” al món amb un avís clar d’optar a l’organització d’uns primers Jocs Olímpics a Àfrica (potser els de 2020. S’obre una finestra d’esperança al segle xxi per al continent perdut de la mà de l’esport espectacle tan universal, massiu, emocional i mercantil que també es juga a la canxa de la política i de l’economia.

  10. Shewanella algae en un paciente con diarrea crónica. Primer caso en Costa Rica

    Directory of Open Access Journals (Sweden)

    Erick Molina- Guevara

    2009-09-01

    Full Text Available Se presenta el caso de un paciente masculino, vecino de Pavas-San José, con historia de diarrea crónica. En el coprocultivo se identificó Shewanella algae. Casos de infección en humanos por esta bacteria son raros y se han encontrado, predominantemente localizadas, en piel, oídos y tejidos blandos con o sin bacteremia, en la mayoría de los cuales existe el antecedente de contacto con ambientes marinos. Shewanella algae es sensible a aminoglicósidos, carbapenemes, eritromicina y quinolonas, pero resistente a penicilinas. La sensibilidad a ampicilina y cefalosporinas es variable. Nuestro paciente fue tratado con cefalexina y tuvo una respuesta satisfactoria al mismo, con cese de los síntomas. De acuerdo con nuestro conocimiento este el primer caso documentado, en Costa Rica, de infección gastrointestinal por esta bacteria.

  11. Bolívar, primer diplomático de la libertad americana

    Directory of Open Access Journals (Sweden)

    Rafael Gómez Hoyos

    1969-03-01

    Full Text Available Don Miguel Luis Amunátegui, primer biógrafo de don Andrés Bello, recopilador y comentarista meritorio de sus obras, nos dejó una falsa visión de Bolívar como diplomático de la libertad. Basado en los recuerdos del anciano humanista, cuando ya le flaqueaba la memoria, o gracias a un error suyo de apreciación, al comentar los incidentes de la misión encomendada ante el gobierno británico por la Junta Suprema de Caracas, nos relata increíble falta de tacto y descuido imperdonable en Simón Bolívar, Jefe de la Misión.

  12. Review of The Atheist’s Primer and Atheism for Beginners

    Directory of Open Access Journals (Sweden)

    Andrew J Bissette

    2014-05-01

    Full Text Available The New Atheists are occasionally accused of lacking nuance and sophistication, or of existing in an intellectual vacuum. To some it may seem that Dawkins 'et al'. are naïve logical positivists; this perspective may be reinforced by recent authors’ explicit rejection of the value of philosophy and other non-scientific approaches to knowledge (cf. Lawrence Krauss, Stephen Hawking. Into the fray steps Michael Palmer, offering his attempt to popularise a version of atheism that is underpinned by a long tradition of philosophical inquiry. 'The Atheist’s Primer', a condensed version of Palmer’s previous work, is aptly named: it is a crash course on the history and major arguments of atheism from a firmly philosophical angle. Its companion text, 'Atheism For Beginners', is a coursebook aimed at tutors seeking to teach this material.

  13. INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN

    Directory of Open Access Journals (Sweden)

    Orzuza, Gloria Beatriz

    2013-01-01

    Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.

  14. White primer permits a corrosion-resistant coating of minimum weight

    Science.gov (United States)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.

    1966-01-01

    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  15. Eficacia experimental de anticuerpos IgY producidos en huevos, contra el veneno de la serpiente peruana Bothrops atrox Experimental efficacy of IgY antibodies produced in eggs against the venom of the Peruvian snake Bothrops atrox

    Directory of Open Access Journals (Sweden)

    Julio C. Mendoza

    2012-03-01

    Full Text Available Objetivos. Desarrollar un protocolo de inmunización para producir inmunoglobulinas IgY de origen aviar contra el veneno de la serpiente peruana Bothrops atrox y evaluar la capacidad neutralizante. Materiales y métodos. Se inmunizaron seis gallinas de postura de la raza hy line brown con 500 μg/dosis de veneno de B. atrox en un periodo de dos meses. Cada semana, los huevos fueron colectados para el aislamiento de inmunoglobulinas IgY a partir de la yema, usando dos pasos consecutivos con αcido caprνlico y sulfato de amonio. La detecciσn de anticuerpos se realizσ por inmunodifusiσn doble mientras que el tνtulo y reactividad cruzada se determinaron por las técnicas de ELISA y Western blot. El cálculo de DL50 y de la DE50 del antiveneno IgY producido se realizó utilizando el método de Probits. Resultados. La masa de anticuerpos aislados fue de 8,5 ± 1,35 mg de IgY/mL de yema. Asimismo, la DE50 del antiveneno aviar fue calculada en 575 μL de antiveneno/mg de veneno. Adicionalmente, los ensayos de reactividad cruzada mostraron que el veneno de B. atrox comparte mas epνtopes comunes con el veneno de B. brazili (47% que con otros veneno del mismo género, en tanto que los venenos de Lachesis muta (19% y Crotalus durissus (12% mostraron una baja reactividad cruzada. Conclusiones. Se ha obtenido IgY purificada contra el veneno de B. atrox con capacidad neutralizante y se ha demostrado su utilidad como herramienta inmunoanalítica para evaluar la reactividad cruzada con venenos de otras especies.Objectives. To develop an immunization protocol in order to produce avian IgY immunoglobulins against Bothrops atrox Peruvian snake venom and to evaluate its neutralizing capacity. Materials and methods. Six Hy Line Brown hens were immunized each two weeks using 500μg/doses of B. atrox venom in a period of two months. Each week, eggs were collected for IgY isolation from yolk using two consecutive steps with caprilic acid and ammonium sulfate

  16. Generation of polymerase chain reaction-specific probes for library screening using single degenerate primers.

    Science.gov (United States)

    Hommes, N G; Arp, D J; Sayavedra-Soto, L A

    1995-03-01

    Degenerate oligonucleotide primers were made to peptide sequences from hydroxylamine oxidoreductase (HAO) from Nitrosomonas europaea. The primers were used singly in PCR reactions to amplify portions of the gene for HAO from genomic DNA. Southern hybridizations using fragments amplified with each primer showed that they labeled the same genomic DNA fragments. The PCR-amplified fragments were successfully used to screen a gene library for clones containing the HAO gene. The method of isolating genes by PCR with single primers has general utility.

  17. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  18. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  19. Microsatellite Primers for the Pacific Northwest Conifer Callitropsis nootkatensis (Cupressaceae

    Directory of Open Access Journals (Sweden)

    Tara N. Jennings

    2013-09-01

    Full Text Available Premise of the study: Microsatellite primers were developed for Nootka cypress (Callitropsis nootkatensis to provide quantitative measures for gene conservation that can assist in guiding management decisions for a species experiencing climate-induced decline. Methods and Results: Using multiplexed massively parallel sequencing, we identified 136,785 microsatellite-containing sequences from 489,625 Illumina paired-end 80-bp reads. After stringent filtering, we selected 144 primer pairs and screened variation at these loci in five populations of C. nootkatensis. Loci show between three and 36 dinucleotide repeats per locus, with an average of 13. Screening of these markers in the Pacific Northwest relative Chamaecyparis lawsoniana demonstrated no marker transferability. This finding highlights the narrow taxonomic utility of microsatellite markers in Callitropsis. Conclusions: These microsatellites show high polymorphism and can be used for routine screening of natural variation in Callitropsis nootkatensis, and will be particularly helpful in identifying clones and inbred relatives at the stand-level.

  20. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  1. Primer on Molecular Genetics; DOE Human Genome Program

    Science.gov (United States)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  2. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  3. Development of a Nonchromate Structural Adhesive Bond Primer

    Science.gov (United States)

    2014-11-01

    Prevent corrosion of base metal • Applied to porous anodized surface • Overcoated with non- inhibited epoxy adhesive • High adhesive bond strength...primers •Long-running surveillance of chromate-free alternatives by UTC companies shows weak corrosion inhibition • (A) strontium chromate... corrosion inhibiter achieved Electrokinetic Confirmation of Active Inhibition in Coatings 7 Schematic of defect production and samples for salt

  4. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  5. Two generic PCR primer sets for the detection of members of the genus Torradovirus

    NARCIS (Netherlands)

    Verbeek, M.; Tang, J.; Ward, L.

    2012-01-01

    Two degenerate primer pairs were designed for the universal detection of members of the genus Torradovirus. Primer pair Torrado-1F/Torrado-1R was designed based on the RNA-dependent RNA polymerase region located in RNA1 and primer pair Torrado-2F/Torrado-2R based on a region overlapping the two firs

  6. Design of primers and probes for quantitative real-time PCR methods.

    Science.gov (United States)

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  7. Wash Primer Replacement Based on the Superprimer Technology

    Science.gov (United States)

    2011-09-01

    DoD­P­15328D wash primer. Figure 51. FTIR  spectra  of ECO­008 and ECO5­1. viii Figure 52. FTIR  spectra  of ECO5­1 with different drying conditions. Figure 53...MIL­ PRF­85582 primers, in which  strontium  chromate is used as the major corrosion inhibitor.  The MIL­DTL­53030B primer contains zinc phosphate as...is obtained through the use of the silane. 5.2.5. FTIR characterization FTIR  spectra  of DoD­P­15328D, ECO­008 and ECO5­1 are shown in Figures 50­52

  8. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  9. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  10. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  11. Los orígenes del teatro (Nyopatti). Traducción anotada del primer libro del Nyastra

    OpenAIRE

    Óscar Figueroa Castro

    2014-01-01

    Se ofrece aquí una primera traducción al castellano, ricamente anotada, del primer libro del Nyastra, el gran tratado sobre dramaturgia sánscrita fechado hacia los siglos ii-iv de nuestra era. Titulado Los orígenes del teatro (Nyopatti), el libro narra en clave mítica las circunstancias, razones y sucesos que llevaron a la creación del arte teatral. Entre otros as-pectos, el texto destaca por la gran cantidad de tradiciones que en él conver-gen, así como ...

  12. Primer registro de infestación en un reptil por larvas de Amblyomma parvitarsum (Acari: Ixodidae en Argentina

    Directory of Open Access Journals (Sweden)

    Gabriel Natalio Castillo

    2015-05-01

    Full Text Available Amblyomma parvitarsum es una garrapata endémica del Altiplano Andino de Argentina, Bolivia, Chile y Perú. En la provincia de San Juan adultos de esta garrapata fueron encontrados en el Parque Nacional San Guillermo sobre Vicugna vicugna. En Argentina también existen citas de adultos de A. parvitarsum sobre bovinos, ovinos y el ñandú . El primer caso de parasitismo de larvas de A. parvitarsum en Liolaemus fue realizado en Chile. El presente trabajo menciona por primera vez para Argentina la presencia de larvas de A. parvitarsum parasitando al lagarto Liolaemus eleodori.

  13. El olvido de un sistema de cálculo de costes andalusí (primer tercio del siglo XIII

    Directory of Open Access Journals (Sweden)

    Jesús D. López Manjón

    2016-07-01

    Full Text Available Este trabajo da a conocer una parte del patrimonio histórico contable de Al-Andalus analizando los procedimientos de cálculo de costes incluidos en el Kitab fi Adab Al-Hisba (Libro de Buen Gobierno del Zoco, sus antecedentes y su posible transferencia a otros reinos. Dicho libro fue escrito en el primer tercio del siglo XIII por Al-Saqati. Estos cálculos se utilizaron para fijar precios al por menor. El estudio proporciona evidencia sobre el olvido de estos cálculos de costes en la Edad Media y analiza las causas de la no transmisión de este conocimiento a los reinos cristianos de la Península Ibérica. El trabajo pretende aportar tanto al conocimiento de la Historia de la Contabilidad en un contexto espacial y temporal poco estudiado como es Al-Andalus en el siglo XIII, como al de los mecanismos de transferencia de tecnologías contables. Se presenta un caso en el que los factores señalados en la literatura como inhibidores de dichos mecanismos inciden en la mayor dificultad para la transmisión de los conceptos contables.

  14. Preliminary Evaluation of the Acute Toxicity of Desensitized Primer Compounds and Primer Waste Effluents to Representative Aquatic Organisims

    Science.gov (United States)

    1975-11-01

    daphnids, with 48-hour LC50 values for these two materials being several orders of magnitude lower than those observed for lead styphnate , PETN and... styphnate (PoTNR), tetracene (= tetrazene), pentaerythritol tetranitrate (PETN), .and FA 956 priming mixture. The FA 956 mixture is composed of: 37...PbTNR, 4% tetracene, 5% PETN, 32% barium nitrate, 15% antimony sulfide and 7% aluminum (Small and Rosenblatt, 1974). Each of these primer components was

  15. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    Directory of Open Access Journals (Sweden)

    Oh Hyun-Woo

    2010-07-01

    Full Text Available Abstract Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1 to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups.

  16. Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies.

    Directory of Open Access Journals (Sweden)

    Michiel Op De Beeck

    Full Text Available Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS region in the ribosomal RNA (rRNA operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4 and a primer pair (ITS86F/ITS4 that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding.

  17. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    Directory of Open Access Journals (Sweden)

    Martin Andrew P

    2009-12-01

    Full Text Available Abstract Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of

  18. PHQ-2 COMO PRIMER INSTRUMENTO DE CRIBADO DE LA DEPRESIÓN PRENATAL

    Directory of Open Access Journals (Sweden)

    María de la Fe Rodríguez-Muñoz

    2017-01-01

    Full Text Available La depresión prenatal es un importante problema de salud pública que apenas recibe tratamiento. La depresión durante este período está asociada con consecuencias negativas tanto para la madre como para el bebé. Por ello, es importante realizar un cribado adecuado en mujeres embarazadas. El objetivo del presente estudio fue conocer la capacidad discriminativa y el punto de corte del cuestionario PHQ-2 como primer instrumento de cribado para identificar la depresión en mujeres embarazadas que viven en España. Método: Participaron voluntariamente 1.019 mujeres, de edad comprendida entre los 19 y los 45 años, que acudieron a revisión obstétrica en el primer trimestre del embarazo. Las participantes completaron un cuestionario sociodemográfico y los cuestionarios PHQ9 y PHQ2. La investigación fue desarrollada en dos hospitales públicos de dos comunidades autónomas diferentes. Se llevó a cabo entre los años 2014 y 2016. Se realizó un análisis con curva ROC para determinar la capacidad discriminativa y el punto de corte del PHQ-2. Resultados: De las 1.019 participantes el 11,1% fueron diagnosticadas de depresión. El área bajo la curva del PHQ2 fue de 0,84 p<0,001. Con el punto de corte de 2 la sensibilidad y especificidad fueron de 85,4% y 79,5% respectivamente. Conclusiones: La puntuación de corte ≥2 es adecuada para la discriminación de la depresión durante el embarazo mediante el cuestionario PHQ2 y podría servir como cribado previo al PHQ-9.

  19. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  20. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  1. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  2. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  3. PRIMER REPORTE DE LA FAMILIA CHEIRIDIIDAE (ARACHNIDA: PSEUDOSCORPIONIDA EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    Jorge Alexander QUIRÓS-RODRÍGUEZ

    2015-01-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin- Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito, Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.

  4. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  5. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  6. Cribado de aneuploidias de primer trimestre en las gestaciones gemelares

    OpenAIRE

    Prats Rodríguez, Pilar

    2013-01-01

    Esta tesis está basada en dos artículos: Articulo 1: Early first-trimester free-β-hCG and PAPP-A serum distributions in monochorionic and dichorionic twins Objetivo: Examinar la distritución en primer trimestre de los marcadores bioquímicos de aneuploidias en gestaciones gemelares dependiendo de su corionicidad. Métodos: La free-β-human chorionic gonadotropin (hCG) en sangre materna y la pregnancy-associated plasma protein A (PAPP-A) fueron analizadas entre las semanas 8–13 + de ...

  7. Shining On: A primer on solar radiation data

    Energy Technology Data Exchange (ETDEWEB)

    Dunlap, M.A.; Cook, G. (eds.); Marion, B.; Riordan, C.; Renne, D.

    1992-05-01

    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  8. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  9. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  10. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  11. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  12. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  13. AL Amyloidosis

    Directory of Open Access Journals (Sweden)

    Desport Estelle

    2012-08-01

    Full Text Available Abstract Definition of the disease AL amyloidosis results from extra-cellular deposition of fibril-forming monoclonal immunoglobulin (Ig light chains (LC (most commonly of lambda isotype usually secreted by a small plasma cell clone. Most patients have evidence of isolated monoclonal gammopathy or smoldering myeloma, and the occurrence of AL amyloidosis in patients with symptomatic multiple myeloma or other B-cell lymphoproliferative disorders is unusual. The key event in the development of AL amyloidosis is the change in the secondary or tertiary structure of an abnormal monoclonal LC, which results in instable conformation. This conformational change is responsible for abnormal folding of the LC, rich in β leaves, which assemble into monomers that stack together to form amyloid fibrils. Epidemiology AL amyloidosis is the most common type of systemic amyloidois in developed countries with an estimated incidence of 9 cases/million inhabitant/year. The average age of diagnosed patients is 65 years and less than 10% of patients are under 50. Clinical description The clinical presentation is protean, because of the wide number of tissues or organs that may be affected. The most common presenting symptoms are asthenia and dyspnoea, which are poorly specific and may account for delayed diagnosis. Renal manifestations are the most frequent, affecting two thirds of patients at presentation. They are characterized by heavy proteinuria, with nephrotic syndrome and impaired renal function in half of the patients. Heart involvement, which is present at diagnosis in more than 50% of patients, leading to restrictive cardiopathy, is the most serious complication and engages prognosis. Diagnostic methods The diagnosis relies on pathological examination of an involved site showing Congo red-positive amyloid deposits, with typical apple-green birefringence under polarized light, that stain positive with an anti-LC antibody by immunohistochemistry and

  14. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  15. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  16. FullSSR: Microsatellite Finder and Primer Designer

    Science.gov (United States)

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  17. Enseñanza y comprensión del enfoque clásico de la probabilidad en primer grado de secundaria

    OpenAIRE

    Vázquez, Orlando

    2005-01-01

    Esta investigación, de carácter cualitativo (Eisner, 1998), es parte de un proyecto relativo a la comprensión de la probabilidad en primer grado de la educación secundaria. El estudio se constituyó en tres fases. La primera correspondió al análisis documental de la propuesta institucional (SEP, 1993) que rige la enseñanza de la probabilidad. La segunda, desarrollada en estudio dirigido y aula alterna, se orientó al docente y a su práctica en el aula mediada por un libro de texto (Filloy, et a...

  18. Personalidad y tolerancia al dolor

    Directory of Open Access Journals (Sweden)

    JESÚS M.ª CARRILLO

    2005-01-01

    Full Text Available Se examina la relación de algunas variables de personalidad -EPQ-A (Eysenck y Eysenck, 1975, NEO-PI (McCrae y Costa, 1988 y STA -personalidad esquizotípica- y STB -personalidad límite-, de Claridge y Broks (1984, con la tolerancia al dolor experimental inducido mediante agua fría (cold pressor test, según el procedimiento de Staats, Heckmat y Staats (1998 en una muestra filtrada mediante un cuestionario sobre dolor crónico, dolores de cabeza, de espalda, artritis, síndrome de Raynaud, y personas bajo medicación. La tolerancia al dolor experimental se evaluó mediante el Umbral del dolor (tiempo en segundos desde la introducción de la mano en el agua hasta el primer informe de dolor, Mantenimiento del dolor (duración en segundos de la inmersión de la mano desde la aparición del umbral hasta su retirada y Tolerancia al dolor (duración total en segundos de la inmersión de la mano desde su introducción hasta su retirada. Un análisis correlacional, factorial y de regresión por pasos mostraron un efecto cruzado entre medidas de ansiedad (tolerancia negativa al dolor y psicoticismo, siendo psicoticismo junto con control emocional predictores de tolerancia positiva al dolor. En cuanto a psicoticismo, parece que son sus elementos de naturaleza paranoide y de "dureza" los que afectan a una percepción atenuada del dolor.

  19. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Pedersen, F S

    2000-01-01

    . While most of the selected primer binding sites are complementary to the 3'-end of tRNA((Pro)), we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNA(Arg(CCU)), tRNA(Phe(GAA))and a hitherto unknown......Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNA(Pro)molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian...... retro-viruses have revealed evidence of molecular adapt-ation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites...

  20. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    CERN Document Server

    Courtney, Elya; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blast waves, muzzle velocities, and ignition delay are presented after environmental conditioning (150 days) for two lead based and two DDNP based primers under cold and dry (-25 deg C,0% relative humidity), ambient (20 deg C, 50% relative humidity), and hot & humid (50 deg C, 100% relative humidity) conditions in 5.56 mm NATO. Taken together, these results indicate that DDNP based primers are not sufficiently reliable for service use.

  1. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...... settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...

  2. Modelos de aplicación de ecuaciones diferenciales de primer orden con geogebra: actividades para resolver problemas de mezclas

    Directory of Open Access Journals (Sweden)

    Cesar Augusto Hernández-Suarez

    2016-09-01

    Full Text Available El objetivo del estudio es diseñar una actividad para abordar los problemas de mezclas en un curso de ecuaciones diferenciales que permita realizar cambios de representación en los registros gráfico, algebraico y lengua natural mediante la ayuda de software libre Geogebra, esperando así reducir la dificultad que presentan los estudiantes al momento de plantear la ecuación diferencial que modela un problema de mezclas. La actividad se fundamenta en dos marcos, el didáctico y el matemático, los cuales fueron elaborados con los aportes de distintas fuentes consultadas acerca del objeto de investigación. La selección de los participantes fue realizada mediante muestreo intencional y durante el desarrollo de este proceso se eligieron dieciocho (18 estudiantes de un programa académico de Ingeniería Civil de un curso de ecuaciones diferenciales. Se aplicó una encuesta a los estudiantes sobre los modelos de aplicación de ecuaciones diferenciales de primer orden para determinar el modelo a utilizar; los modelos con mayor porcentaje de elección fueron: Mezclas y ley de enfriamiento de Newton, razón por la cual se eligió el modelo de mezclas para el diseño de una actividad tipo test con 3 problemas que para ser resueltos con el Geogebra. Se analizan las respuestas dadas por los estudiantes al resolver una serie de problemas de aplicación de primer orden con el software libre Geogebra. Estos problemas permiten realizar traspasos del registro lenguaje natural al algebraico mediante representaciones ejecutables y preguntas que pretenden orientar al estudiante durante el desarrollo de la misma, con el fin de proporcionar herramientas para plantear la ecuación diferencial que se ajusta a los problemas planteados. Como resultados se obtiene una propuesta del uso del Geogebra como un recurso didáctico para favorecer la resolución de problemas de aplicación de ecuaciones diferenciales de primer orden (problemas de mezclas. Se puede concluir

  3. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  4. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...gun, percussion, electric primer, capacitor 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT UU 18. NUMBER OF PAGES 30 19a. NAME...initial pull of the solenoid, which can be over 50 A. The old linear power supply has large filter capacitors on its output, which does provide the surge

  5. Genus-specific primers for study of Fusarium communities in field samples

    OpenAIRE

    2016-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium- specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+...

  6. Efecto del nivel de la proteína bruta del pienso y del peso inicial de las pollitas sobre los parámetros productivos y la calidad del huevo en gallinas ponedoras rubias

    OpenAIRE

    Jabbour, C.; Perez-Bonilla, A.; Frikha, M; Mirzaie, S.; Berrocoso, J.; Garcia Alonso, Javier; Gonzalez Mateos, Gonzalo

    2011-01-01

    Las aves, al igual que el resto de animales monogástricos no precisan de un nivel de proteína bruta (PB) en el pienso sino de niveles adecuados de aminoácidos (AA) indispensables (Keshavarz and Austic, 2004; Junqueira et al., 2006; Novak et al., 2006). Sin embargo, en la práctica es frecuente que los nutricionistas soliciten niveles de PB en exceso de lo recomendado por el NRC (1999) o FEDNA (2008). De hecho, muchos nutricionistas formulan piensos para inicio de puesta en gallinas rubia...

  7. Use of self-quenched, fluorogenic LUX primers for gene expression profiling.

    Science.gov (United States)

    Kusser, Wolfgang

    2006-01-01

    Application of a real-time detection system based on a novel primer design in gene expression profiling is described. In this system, called LUX (Light Upon eXtension), the generation of signal is based on a single fluorescent dye molecule that is attached to an oligonucleotide close to the 3'-end. A primer design software is available that identifies LUX primer pairs based on a set of rules for optimum signal development. The use of LUX fluorogenic primers to determine the expression patterns of various transcripts during differentiation in the P-19 mouse neuronal model is described.

  8. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  9. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  10. Antibiotic resistance: a primer and call to action.

    Science.gov (United States)

    Smith, Rachel A; M'ikanatha, Nkuchia M; Read, Andrew F

    2015-01-01

    During the past century, discoveries of microorganisms as causes of infections and antibiotics as effective therapeutic agents have contributed to significant gains in public health in many parts of the world. Health agencies worldwide are galvanizing attention toward antibiotic resistance, which is a major threat to public health (Centers for Disease Control and Prevention, 2013; World Health Organization, 2014). Some life scientists believe that we are approaching the post-antibiotic age (Davies & Davies, 2010). The growing threat of antimicrobial resistance is fueled by complex factors with biological, behavioral, and societal aspects. This primer provides an overview of antibiotic resistance and its growing burden on public health, the biological and behavioral mechanisms that increase antibiotic resistance, and examples of where health communication scholars can contribute to efforts to make our current antibiotic drugs last as long as possible. In addition, we identify compelling challenges for current communication theories and practices.

  11. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  12. Microsatellite primers for the rare sedge Lepidosperma bungalbin (Cyperaceae)1

    Science.gov (United States)

    Nevill, Paul G.; Wardell-Johnson, Grant

    2016-01-01

    Premise of the study: Microsatellite markers were developed for the rare sedge Lepidosperma bungalbin (Cyperaceae) to assess genetic variation and its spatial structuring. Methods and Results: We conducted shotgun sequencing on an Illumina MiSeq and produced 6,215,872 sequence reads. The QDD pipeline was used to design 60 primer pairs that were screened using PCR. We developed 17 loci, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. We then screened these loci for variation in individuals from three populations. The number of alleles observed for these 12 loci across the three populations ranged from nine to 19 and expected heterozygosity ranged from 0.41 to 0.89. Conclusions: These markers will enable the quantification of the potential impact of mining on genetic variation within L. bungalbin and establish a baseline for future management of genetic variation of the rare sedge. PMID:27843727

  13. Postpositivism and Accounting Research : A (Personal Primer on Critical Realism

    Directory of Open Access Journals (Sweden)

    Jayne Bisman

    2010-12-01

    Full Text Available This paper presents an overview and primer on the postpositivist philosophy of critical realism. Theexamination of this research paradigm commences with the identification of the underlying motivations thatprompted a personal exploration of critical realism. A brief review of ontology, epistemology andmethodology and the research philosophies and methods popularly applied in accounting is then provided.The meta-theoretical basis of critical realism and the ontological and epistemological assumptions that gotowards establishing the ‘truth’ and validity criteria underpinning this paradigm are detailed, and therelevance and potential applications of critical realism to accounting research are also discussed. The purposeof this discussion is to make a call to diversify the approaches to accounting research, and – specifically – toassist researchers to realise the potential for postpositivist multiple method research designs in accounting.This is aided through an illustration that functions to highlight how and why this approach was applied in areal-world accounting research study.

  14. Soft solids a primer to the theoretical mechanics of materials

    CERN Document Server

    Freed, Alan D

    2014-01-01

    This textbook presents the physical principles pertinent to the mathematical modeling of soft materials used in engineering practice, including both man-made materials and biological tissues. It is intended for seniors and masters-level graduate students in engineering, physics, or applied mathematics. It will also be a valuable resource for researchers working in mechanics, biomechanics, and other fields where the mechanical response of soft solids is relevant.   Soft Solids: A Primer to the Theoretical Mechanics of Materials is divided into two parts. Part I introduces the basic concepts needed to give both Eulerian and Lagrangian descriptions of the mechanical response of soft solids. Part II presents two distinct theories of elasticity and their associated theories of viscoelasticity. Seven boundary-value problems are studied over the course of the book, each pertaining to an experiment used to characterize materials. These problems are discussed at the end of each chapter, giving students the opportunit...

  15. ¿Qué textos leen en primer año los estudiantes de Psicología?

    Directory of Open Access Journals (Sweden)

    María Micaela Villalonga Penna

    Full Text Available Resumen Qué se lee en las universidades es una de las temáticas que han abordado los estudios realizados desde los enfoques de las Alfabetizaciones Académicas y de la Literacidad crítica. En este sentido, nos preguntamos ¿qué textos leen en primer año los estudiantes de psicología? Teniendo en cuenta este interrogante, en este trabajo presentamos el análisis del material bibliográfico del primer año de la carrera de psicología de una universidad estatal. Esta investigación se realizó desde los enfoques cualitativo y cuantitativo de investigación. Analizamos un corpus de 320 textos que corresponden al material bibliográfico de las nueve materias del primer año de la mencionada carrera. Empleamos las categorías de análisis propuestas por Carlino (2005, Padilla (2013 y Padilla, Douglas y López (2007; 2011, entre otras, y tuvimos en cuenta categorías emergentes también. Los hallazgos dieron a conocer el uso de ´cuadernillos´, que incluyen fotocopias del material bibliográfico que pueden o no contar con elementos que ayuden a contextuarlo como copias de la tapa y contratapa, página con datos de edición, índice y referencias completas. El material bibliográfico está constituido por textos académicos derivados de textos científicos, entre los que priman los capítulos de libros y las fichas de cátedra. Además, estos textos son predominantemente expositivos o argumentativos.

  16. Development of a ceramic primer with higher bond durability for resin cement.

    Science.gov (United States)

    Li, Rui

    2010-07-01

    To increase the bond durability of resin to the CAD/CAM ceramic surface, two types of two-bottle type ceramic primers, consisting of Primer A1 or A2 and Primer B, were designed. Primer A1 was prepared by dissolving 25, 50, or 100 mg of gamma-methacryloxypropyltrimethoxysilane in 1 mL of ethanol. Primer A2 was prepared by dissolving 50 mg of mixed silanes, consisting of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane, in 1 mL of ethanol. Mole fractions of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane were 0, 10, 20, 30, 40 and 50 mol%. Primer B was prepared after dissolving 0.01, 0.05 or 0.1 mol L(-1) hydrochloric acid in ethanol by 50 vol%. Ceramic surface was silanated with a mixture of Primers A1 and B or Primers A2 and B for 1 min, and then air-dried. Commercial GC ceramic primer and Porcelain Liner M were utilized. Thereafter, dual-curing type resin cement was bonded to silanated ceramic surface through visible-light irradiation. Shear bond strength of resin to the ceramic surface was measured, before and after thermo-cycling. Addition of 0.01 or 0.05 mol L(-1) hydrochloric acid to the gamma-methacryloxypropyltrimethoxysilane allowed for significant increases in the bond strength. However, thermo-cycling resulted in significant decreases of approximately 5 MPa in the bond strength. Conversely, when the mixed silane, where 30 mol% of 1,2-bis(trimethoxysilyl)ethane dissolved in gamma-methacryloxypropyltrimethoxysilane, was utilized with 0.05 mol L(-1) hydrochloric acid, the reduction in the bond strength decreased to approximately 2 MPa. The designed ceramic primers exhibited higher ceramic bond durability than commercial ceramic primers.

  17. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  18. Selection and development of representative simple sequence repeat primers and multiplex SSR sets for high throughput automated genotyping in maize

    Institute of Scientific and Technical Information of China (English)

    WANG FengGe; ZHAO JiuRan; DAI JingRui; YI HongMei; KUANG Meng; SUN YanMei; YU XinYan; GUO JingLun; WANG Lu

    2007-01-01

    In the current study, 1900 maize simple sequence repeat (SSR) primers published in MaizeGDB were screened utilizing reference literature, 15 representative Chinese maize inbred lines and 15 Chinese maize hybrids from national regional testing. In total, 500 highly polymorphic primers were identified and used to construct a genetic map. 100 evenly distributed primers, 10 primers per chromosome, were further selected as a set of universal SSR core primers, recommended as preferred primers for general studies. These core primers were then redesigned and used to construct a high throughput multiplex PCR system based on a five-color fluorescence capillary detection system. We report here that two sets of ten-plex PCR combinations have been constructed, each consisting of 10 primers, with one primer per chromosome.

  19. Infección inducida en el roedor selvático Dasyprocta leporina (Rodentia: Dasyproctidae, con huevos larvados de Lagochilascaris minor (Nematoda: Ascarididae Induced infection in the wild rodent Dasyprocta leporina (Rodentia: Dasyproctidae with larval eggs of Lagochilascaris minor (Nematoda: Ascarididae

    Directory of Open Access Journals (Sweden)

    S. Gregorio

    1990-12-01

    Full Text Available Ejemplares de Dasyprocta leporina Linnaeus, 1758 fueron criados alejados de su ambiente natural. A los 3 ó 4 meses de edad, se los inoculó por vía oral con huevos de Lagochilascaris minor Leiper, 1909 obtenidos de una paciente nativa. Los huevos se los incubó por más de 80 dias, para que de ellos fuese posible obtener por compresión mecánica, larvas que se mantuviesen vivas en medio acuoso por 48 horas o más. Sacrificados los animales a los 14 ó 46 dias posteriores a la infección, se hallaron en los músculos esqueléticos larvas ovilladas dentro de nódulos inflamatorios, los cuales no presentaban reacción a cuerpo extraño, abscedación o calcificación. El desarollo de los nódulos no parecía afectar la normalidad de los hospedadores. Las larvas obtenidas eran similares a las descritas por SPRENT como de tercer estadio para estos helmintos. Ratones blancos infectados con material similar, no presentaron nódulos en sus músculos ni se pudo recuperar de sus tejidos larva alguna. Por los hallazgos obtenidos con la infección de estos animales, se postula que el helminto no posee ciclo pulmonar y que su desarrollo requiere de un hospedador intermediario.Specimens of Dasyprocta leporina (Linnaeus, 1758 were raised out their natural environment. At three to four months of age they were orally inoculated with Lagochilascaris minor (Leiper, 1909 eggs obtained from a native patient. The eggs were incubated for more than 80 days so that it was possible to obtain, by mechanical compression, larvae that could be maintained alive in liquid medium for 48 hours or more. The animals were sacrificed 14-46 days after infection and tangled larva in inflammatory nodules were found in skeletal muscle without foreign body reaction, abscess formation or calcification. The development of the nodules did not seem to affect the hosts. The larvae obtained were similar to those described by SPRENT as the third stage of these helminths. When white mice were

  20. Bases técnicas para la aplicación del sistema de análisis de peligro y puntos críticos de control (HACCP desde la granja de ponedoras hasta la recepción y distribución de huevos para el consumo

    Directory of Open Access Journals (Sweden)

    Yanetsy Pérez Pérez; Alcides Pérez Bello

    2006-09-01

    Full Text Available Para garantizar alimentos de calidad, ysin riesgos para la salud pública, debenemplearse sistemas de producción dealimentos seguros, "desde el productorhasta el consumidor", lo que reduce loscostos de producción por concepto deinspección y decomiso de productoscontaminados o deteriorados, y elconsiguiente impacto económico, políticoy social. Es con este objetivo que serealiza un estudio de identificación yanálisis de riesgos biológicos, químicos yfísicos en una granja avícola deponedoras y el centro de acopio ydistribución de huevos comerciales de laprovincia Villa Clara; lo que permitió ladeterminación de los riegos, los PuntosCríticos de Control (PCC, suscorrespondientes Límites Críticos (LC ylas posibles desviaciones de estosúltimos, los procedimientos de vigilanciay monitoreo y la propuesta de medidas oacciones correctivas que constituyen lasbases técnicas para la implementacióndel Sistema de Análisis de Peligro yPuntos Críticos de Control (HACCP, en laproducción de huevos comerciales;previa decisión de las autoridadesempresariales correspondientes.Palabras claves: ABSTRACT.The used of Food Safety System "fromproducer to consumer" is to obtainsafety food, reduce the risks of publichealth and the cost of the food. Thereduction of the costs of inspection,forfeiture of contaminated ordeteriorated food is important to reduceeconomical, political and social impact.Our paper is to identify and analyzebiological, chemical and physical risks inthe poultry farm. The reception anddistribution of eggs in Villa Clara wereanalyzed too. The hazards, CriticalControl Points (PCC, Critical Limits (LCand its deviations were identified in theprocess, as well as the monitoryprocedures and correctives actions astechnical basis to implement the HazardAnalysis and Critical Control PointsSystem (HACCP associated with theeggs production. The implementation ofthe system depends on the decision ofthe enterprises authorities.Key words: Hazards

  1. Primer caso clínico de Síndrome de Pai en México

    Directory of Open Access Journals (Sweden)

    L.F. Melloni-Magnelli

    2015-06-01

    Full Text Available Descrito por primera vez en 1987, el Síndrome de Pai se considera una variante rara de la displasia fronto-nasal. Consiste en el fallo del cierre de la línea media y sus signos son encéfalo-cráneo-faciales. Los hallazgos que conforman el síndrome son: la presencia de una variedad de pólipos (intranasal, cutáneos y alveolar del maxilar superior, fisura ósea y labiopalatina en la línea media, lipoma intracraneal y agenesia parcial o total del cuerpo calloso. Su causa es desconocida y su presentación esporádica. La incidencia se estima en 1 de cada 20.000 a 40.000 recién nacidos, siendo el sexo femenino el más afectado. El objetivo de este artículo es presentar el primer caso clínico documentado en México con estas características, y de acuerdo al último caso publicado en 2014 por Mee Hong, es el número 38 de la literatura mundial.

  2. Las Provincias Vascas y la Guerra de la Convención. Primer encuentro con la Revolución

    Directory of Open Access Journals (Sweden)

    José María PORTILLO VALDÉS

    2009-12-01

    Full Text Available Entre 1793 y 1795 en las provincias vascas se produjo el primer encuentro con la Revolución, la que entonces era mayúscula y encarnación misma del espíritu revolucionario. Sería la primera ocasión para que los territorios vascos de la monarquía española experimentaran —en mayor o menor grado— lo que tal revolución podía significar. No se trató únicamente de una escaramuza militar ni de una ocupación territorial. No fue tampoco ante todo —como veremos— ocasión para plantear una posible alternativa a la tradicional vinculación al continente de la monarquía católica. Históricamente aquel primer encuentro hubo de tener una significación bastante más profunda marcando una muy clara línea de evolución en el proceso provincial de tránsito de sistemas y en su relación con el fenómeno revolucionario francés.

  3. A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?

    Science.gov (United States)

    Pine, Daniel S.

    2006-01-01

    This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

  4. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S;

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...

  5. Changes of 5' Terminal Nucleotides of PCR Primers Causing Variable T-A Cloning Efficiency

    Institute of Scientific and Technical Information of China (English)

    Mei-Qin Liu; Xin Shen; Wei-Lun Yin; Cun-Fu Lu

    2007-01-01

    T-A cloning takes advantage of the unpaired adenosyl residue added to the 3' terminus of amplified DNAs by Taq and other thermostable DNA polymerase and uses a linearized plasmid vector with a protruding 3' thymidylate residue at each of its 3' termini to clone polymerase chain reaction (PCR)-derived DNA fragments. It is a simple,reliable, and efficient ligation-dependent cloning method for PCR products, but the drawback of variable cloning efficiency occurs during application. In the present work, the relationship between variable T-A cloning efficiency and the different 5' end nucleotide base of primers used in PCR amplification was studied. The results showed that different cloning efficiency was obtained with different primer pairs containing A, T, C and G at the 5' terminus respectively. The data shows that when the 5' end base of primer pair was adenosyl, more white colonies could be obtained in cloning the corresponding PCR product in comparison with other bases. And the least white colonies were formed when using the primer pair with 5' cytidylate end. The gluanylate end primers resulted in almost the same cloning efficiency in the white colonies amount as the thymidylate end primer did, and this efficiency was much lower than that of adenosyl end primers. This presumably is a consequence of variability in 3'dA addition to PCR products mediated by Taq polymerase. Our results offer instructions for primer design for researchers who choose T-A cloning to clone PCR products.

  6. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners.

    Science.gov (United States)

    Summerfield, Marc R; Feemster, Agnes Ann

    2015-09-01

    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail's ability to meet language standards, enhance the writer's image, and successfully transmit information.

  7. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej;

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  8. Novel computational methods for increasing PCR primer design effectiveness in directed sequencing

    Directory of Open Access Journals (Sweden)

    Busam Dana

    2008-04-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR is used in directed sequencing for the discovery of novel polymorphisms. As the first step in PCR directed sequencing, effective PCR primer design is crucial for obtaining high-quality sequence data for target regions. Since current computational primer design tools are not fully tuned with stable underlying laboratory protocols, researchers may still be forced to iteratively optimize protocols for failed amplifications after the primers have been ordered. Furthermore, potentially identifiable factors which contribute to PCR failures have yet to be elucidated. This inefficient approach to primer design is further intensified in a high-throughput laboratory, where hundreds of genes may be targeted in one experiment. Results We have developed a fully integrated computational PCR primer design pipeline that plays a key role in our high-throughput directed sequencing pipeline. Investigators may specify target regions defined through a rich set of descriptors, such as Ensembl accessions and arbitrary genomic coordinates. Primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the specified target regions. As part of the tiling process, primer pairs are computationally screened to meet the criteria for success with one of two PCR amplification protocols. In the process of improving our sequencing success rate, which currently exceeds 95% for exons, we have discovered novel and accurate computational methods capable of identifying primers that may lead to PCR failures. We reveal the laboratory protocols and their associated, empirically determined computational parameters, as well as describe the novel computational methods which may benefit others in future primer design research. Conclusion The high-throughput PCR primer design pipeline has been very successful in providing the basis for high-quality directed sequencing results and for minimizing

  9. Multi-primer target PCR for rapid identification of bovine DRB3 alleles.

    Science.gov (United States)

    Ledwidge, S A; Mallard, B A; Gibson, J P; Jansen, G B; Jiang, Z H

    2001-08-01

    Multi-primer target polymerase chain reaction (MPT-PCR) is a rapid method for the identification of specific BoLA-DRB3 alleles. In a single PCR reaction, the presence of two alleles associated with increased risk, DRB3.2*23 (DRB3*2701-2703, 2705-2707) and decreased risk, DRB3.2*16 (DRB3*1501, 1502), of mastitis in Canadian Holstein can be detected. Two outer primers amplify exon 2 of DRB3. Simultaneously, two inner, allele-specific primers amplify individual alleles. Initially, 40 cows previously typed by PCR-restriction fragment length polymorphism (PCR-RFLP) were genotyped using the multi-primer approach. An additional 30 cows were first genotyped by multi-primer target PCR, then by PCR-RFLP. All animals were correctly identified and there were no false positives. This technique can readily be modified to identify other BoLA alleles of interest.

  10. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Science.gov (United States)

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  11. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Directory of Open Access Journals (Sweden)

    Kenan Hadziavdic

    Full Text Available High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  12. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  13. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  14. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    2014-12-01

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  15. PRIMER REPORTE DE LA FAMILIA CHEIRIDIIDAE (ARACHNIDA: PSEUDOSCORPIONIDA EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    Jorge Alexander QUIROZ-RODRÍGUEZ

    2015-07-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin-Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito en el departamento de Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.First Report of Family Cheiridiidae (Arachnida: Pseudoscorpionida in ColombiaDuring a study of the arthropod fauna associated with mounds of detritus produced by Atta colombica (Hymenoptera: Formicidae in the Santa Isabel estate, locality of Patio Bonito, Department of Córdoba, were found representatives of the family Cheiridiidae. Therefore, these pseudoscorpions becomes in the first report of the family to Colombia and for the first time is recorded its presence in ant detritus. Also, this report extends its known distribution range in South America.   

  16. Primer of statistics in dental research: Part II.

    Science.gov (United States)

    Shintani, Ayumi

    2014-04-01

    The Part I of Primer of Statistics in Dental Research covered five topics that are often mentioned in statistical check list of many peer-review journals including (1) statistical graph, (2) how to deal with outliers, (3) p-value and confidence interval, (4) testing equivalence, and (5) multiplicity Adjustment. The Part II of the series covers another set of important topics in dental statistics including (1) selecting the proper statistical tests, (2) repeated measures analysis, (3) epidemiological consideration for causal association, and (4) analysis of agreement. First, a guide in selecting the proper statistical tests based on the research question will be laid out in text and with a table so that researchers choose the univariable statistical test by answering five simple questions. Second, the importance of utilizing repeated measures analysis will be illustrated. This is a key component of data analysis as in many dental studies, observations are considered repeated in a single patient (several teeth are measured in a single patient). Third, concepts of confounding and the use of regression analysis are explained by going over a famous observational cohort study. Lastly, the use of proper agreement analysis vs. correlation for study of agreement will be discussed to avoid a common pitfall in dental research.

  17. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  18. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts

    Directory of Open Access Journals (Sweden)

    Rygiewicz Paul T

    2005-05-01

    Full Text Available Abstract Background The Internal Transcribed Spacer (ITS regions of fungal ribosomal DNA (rDNA are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmental samples provide varying degrees of success at discriminating against plant DNA while maintaining a broad range of compatibility. Typically, it has been necessary to use multiple primer sets to accommodate the range of fungi under study, potentially creating artificial distinctions for fungal sequences that amplify with more than one primer set. Results Numerous sequences for PCR primers were tested to develop PCR assays with a wide range of fungal compatibility and high discrimination from plant DNA. A nested set of 4 primers was developed that reflected these criteria and performed well amplifying ITS regions of fungal rDNA. Primers in the 5.8S sequence were also developed that would permit separate amplifications of ITS1 and ITS2. A range of basidiomycete fruiting bodies and ascomycete cultures were analyzed with the nested set of primers and Restriction Fragment Length Polymorphism (RFLP fingerprinting to demonstrate the specificity of the assay. Single ectomycorrhizal root tips were similarly analyzed. These primers have also been successfully applied to Quantitative PCR (QPCR, Length Heterogeneity PCR (LH-PCR and Terminal Restriction Fragment Length Polymorphism (T-RFLP analyses of fungi. A set of wide-range plant-specific primers were developed at positions corresponding to one pair of the fungal primers. These were used to verify that the host plant DNA was not being amplified with the fungal primers. Conclusion These plant primers have been successfully applied to PCR-RFLP analyses of forest plant tissues from above- and below-ground samples and work well at distinguishing a selection of plants to the species level. The complete set of primers was

  19. Annealing to sequences within the primer binding site loop promotes an HIV-1 RNA conformation favoring RNA dimerization and packaging

    OpenAIRE

    Seif, Elias; Niu, Meijuan; Kleiman, Lawrence

    2013-01-01

    Experiments are presented which suggest that the binding of the primer tRNA to the primer binding site of the HIV-1 5′ UTR is involved in the dimerization of the genome, as part of the packaging process.

  20. In vitro short-term bonding performance of zirconia treated with hot acid etching and primer conditioning etching and primer conditioning.

    Science.gov (United States)

    Xie, Haifeng; Chen, Chen; Dai, Wenyong; Chen, Gang; Zhang, Feimin

    2013-01-01

    This study aimed to investigate and compare the resin bond strengths of zirconia conditioned as follows: alumina sandblasting; alumina sandblasting+application of 10-MDP-containing primer; alumina sandblasting+application of Z-Prime Plus or Metal/Zirconia Primer (new zirconia primers); tribochemical silica coating+silanization; hot acid etching in three different combinations [H2SO4/(NH4)2SO4, HF/HNO3, H2SO4/HF/HNO3]+application of 10-MDP-containing primer. Shear bond strengths (SBS) after water storage for 24 h and 40 days were measured to assess resin bonding performance. Surface and chemical properties of conditioned zirconia surfaces and primers were characterized using scanning electron microscopy, energy dispersive X-ray spectrometry, Fourier transform infrared spectroscopy, and atomic force microscopy. Surface roughness ranked in descending order was: hot acid etching > tribochemical silica coating > alumina sandblasting. Combination of tribochemical silica coating and silanization showed the highest initial SBS (12.46±2.13 MPa) (P<0.01). Etching with H2SO4/(NH4)2SO4 (13.15±3.24 MPa) and HF/HNO3 (13.48±2.15 MPa) showed significantly better bond durability (P<0.01). Hot acid etching seemed to be a promising surface roughening treatment to improve resin-zirconia bonding.

  1. Comprehensive primer design for analysis of population genetics in non-sequenced organisms.

    Directory of Open Access Journals (Sweden)

    Ayumi Tezuka

    Full Text Available Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris, anole lizard (Anolis sagrei, guppy (Poecilia reticulata, and fruit fly (Drosophila melanogaster, for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation.

  2. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    Science.gov (United States)

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  3. Design and evaluation of reverse transcription nested PCR primers for the detection of betanodavirus in finfish.

    Science.gov (United States)

    Rajan, J Joseph Sahaya; Praveena, P Ezhil; Bhuvaneswari, T; Jithendran, K P

    2016-06-01

    Viral encephalopathy and retinopathy otherwise known as viral nervous necrosis (VNN) is a neuropathological condition affecting more than 50 fish species worldwide, mostly marine. Different PCR protocols with specific primers were reported from many countries for confirmation of VNN in fishes. In the present study, two pairs of primers were designed and evaluated for the diagnosis of clinical and subclinical cases of infections from field. These primers designated as BARL-F1/BARL-R1 amplified a 902 bp product in the variable region (T4) of the coat protein gene by first step PCR. Nested PCR primers BARL-F2/BARL-R2 amplified a fragment of 313 bp. The results were comparable with other commonly used primer sets such as F2/R3 and RG668f/RG919r primers. These new primers could detect betanodavirus in standard reference samples containing low, moderate and high viral load. Known positive and negative control samples of fish also revealed a predictive value of 100 % by RT-PCR diagnosis.

  4. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  5. MRPrimerV: a database of PCR primers for RNA virus detection

    Science.gov (United States)

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

    2017-01-01

    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  6. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.

    Science.gov (United States)

    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar

    2013-06-01

    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  7. Selective control of primer usage in multiplex one-step reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Paul Natasha

    2009-12-01

    Full Text Available Abstract Background Multiplex RT-PCR is a valuable technique used for pathogen identification, disease detection and relative quantification of gene expression. The simplification of this protocol into a one-step procedure saves time and reagents. However, intensive PCR optimization is often required to overcome competing undesired PCR primer extension during the RT step. Results Herein, we report multiplex one-step RT-PCR experiments in which the PCR primers contain thermolabile phosphotriester modification groups. The presence of these groups minimizes PCR primer extension during the RT step and allows for control of PCR primer extension until the more stringent, elevated temperatures of PCR are reached. Results reveal that the use of primers whose extension can be controlled in a temperature-mediated way provides improved one-step RT-PCR specificity in both singleplex and multiplex reaction formats. Conclusions The need for an accurate and sensitive technique to quantify mRNA expression levels makes the described modified primer technology a promising tool for use in multiplex one-step RT-PCR. A more accurate representation of the abundances in initial template sample is feasible with modified primers, as artifacts of biased PCR are reduced because of greater improvements in reaction specificity.

  8. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    Directory of Open Access Journals (Sweden)

    Shea N. Gardner

    2014-01-01

    Full Text Available Background. Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results. A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions. This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.

  9. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  10. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing.

    Science.gov (United States)

    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter

    2014-09-01

    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow.

  11. Primer containing dimethylaminododecyl methacrylate kills bacteria impregnated in human dentin blocks

    Science.gov (United States)

    Chen, Chen; Cheng, Lei; Weir, Michael D; Lin, Nancy J; Lin-Gibson, Sheng; Zhou, Xue-Dong; Xu, Hockin HK

    2016-01-01

    Antibacterial dimethylaminododecyl methacrylate (DMADDM) was recently synthesized. The objectives of this study were to: (1) investigate antibacterial activity of DMADDM-containing primer on Streptococcus mutans impregnated into dentin blocks for the first time, and (2) compare the antibacterial efficacy of DMADDM with a previous quaternary ammonium dimethacrylate (QADM). Scotchbond Multi-Purpose (SBMP) bonding agent was used. DMADDM and QADM were mixed into SBMP primer. Six primers were tested: SBMP control primer P, P+2.5% DMADDM, P+5% DMADDM, P+7.5% DMADDM, P+10% DMADDM, and P+10% QADM. S. mutans were impregnated into human dentin blocks, and each primer was applied to dentin to test its ability to kill bacteria in dentinal tubules. Bacteria in dentin were collected via a sonication method, and the colony-forming units (CFU) and inhibition zones were measured. The bacterial inhibition zone of P+10% DMADDM was 10 times that of control primer (P0.1). In conclusion, antibacterial DMADDM-containing primer was validated to kill bacteria inside dentin blocks, possessing a much stronger antibacterial potency than the previous QADM. DMADDM-containing bonding agent was effective in eradicating bacteria in dentin, and its efficacy was directly proportional to DMADDM mass fraction. Therefore, DMADDM may be promising for use in bonding agents as well as in other restorative and preventive materials to inhibit bacteria. PMID:27811846

  12. PCR primers for metazoan nuclear 18S and 28S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. METHODOLOGY/PRINCIPAL FINDINGS: Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. CONCLUSIONS/SIGNIFICANCE: The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other

  13. De las relaciones internacionales al diálogo intercultural

    Directory of Open Access Journals (Sweden)

    Ermila Mercedes Pinto Yépez

    2003-09-01

    Full Text Available Este artículo pretende realizar una lectura del Primer Título Legítimo de Francisco de Vitoria denominado La Sociedad y comunicación; así como también sus tres conclusiones: derecho de libre tránsito y residencia, derecho de libre comercio y derecho de dominio y posesión, con el objetivo de visualizar la vigencia de los postulados vitorianos. Esta vigencia se hace evidente al revisar la situación del indígena venezolano con respecto al resto del colectivo social venezolano.

  14. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  15. Robust SNP genotyping by multiplex PCR and arrayed primer extension

    Directory of Open Access Journals (Sweden)

    Podder Mohua

    2008-01-01

    Full Text Available Abstract Background Arrayed primer extension (APEX is a microarray-based rapid minisequencing methodology that may have utility in 'personalized medicine' applications that involve genetic diagnostics of single nucleotide polymorphisms (SNPs. However, to date there have been few reports that objectively evaluate the assay completion rate, call rate and accuracy of APEX. We have further developed robust assay design, chemistry and analysis methodologies, and have sought to determine how effective APEX is in comparison to leading 'gold-standard' genotyping platforms. Our methods have been tested against industry-leading technologies in two blinded experiments based on Coriell DNA samples and SNP genotype data from the International HapMap Project. Results In the first experiment, we genotyped 50 SNPs across the entire 270 HapMap Coriell DNA sample set. For each Coriell sample, DNA template was amplified in a total of 7 multiplex PCRs prior to genotyping. We obtained good results for 41 of the SNPs, with 99.8% genotype concordance with HapMap data, at an automated call rate of 94.9% (not including the 9 failed SNPs. In the second experiment, involving modifications to the initial DNA amplification so that a single 50-plex PCR could be achieved, genotyping of the same 50 SNPs across each of 49 randomly chosen Coriell DNA samples allowed extremely robust 50-plex genotyping from as little as 5 ng of DNA, with 100% assay completion rate, 100% call rate and >99.9% accuracy. Conclusion We have shown our methods to be effective for robust multiplex SNP genotyping using APEX, with 100% call rate and >99.9% accuracy. We believe that such methodology may be useful in future point-of-care clinical diagnostic applications where accuracy and call rate are both paramount.

  16. A primer on incentive regulation for electric utilities

    Energy Technology Data Exchange (ETDEWEB)

    Hill, L.J.

    1995-10-01

    In contemplating a regulatory approach, the challenge for regulators is to develop a model that provides incentives for utilities to engage in socially desirable behavior. In this primer, we provide guidance on this process by discussing (1) various models of economic regulation, (2) problems implementing these models, and (3) the types of incentives that various models of regulation provide electric utilities. We address five regulatory models in depth. They include cost-of-service regulation in which prudently incurred costs are reflected dollar-for-dollar in rates and four performance-based models: (1) price-cap regulation, in which ceilings are placed on the average price that a utility can charge its customers; (2) revenue-cap regulation, in which a ceiling is placed on revenues; (3) rate-of-return bandwidth regulation, in which a utility`s rates are adjusted if earnings fall outside a {open_quotes}band{close_quotes} around equity returns; and (4) targeted incentives, in which a utility is given incentives to improve specific components of its operations. The primary difference between cost-of-service and performance-based approaches is the latter sever the tie between costs and prices. A sixth, {open_quotes}mixed approach{close_quotes} combines two or more of the five basic ones. In the recent past, a common mixed approach has been to combine targeted incentives with cost-of-service regulation. A common example is utilities that are subject to cost-of-service regulation are given added incentives to increase the efficiency of troubled electric-generating units.

  17. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  18. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  19. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    to investigate the potential failure mechanism of a primer applied prior to an intumescent coating. The analysis was carried out using; (1) gas-fired test furnace, (2) a specially designed electrically heated oven, and (3) thermo gravimetric analysis. When tested below an acrylic intumescent coating, exposed...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen...

  20. Design and evaluation of a specific primer pair for the diagnosis and identification of Acanthamoeba polyphaga.

    Science.gov (United States)

    Ortega-Rivas, Antonio; Lorenzo-Morales, Jacob; Martinez-Carretero, Enrique; Villa Lloberas, Mercedes; Valladares Hernández, Basilio; del Castillo-Remiro, Antonio

    2004-05-01

    Random amplified polymorphism DNA (RAPD) is a useful tool for species identification. The obtained band patterns can be used for specific primer pair design that may be useful for species diagnosis. In this study, a distinctive a 962-bp band in A. polyphaga band patterns was found, by using the OPC20 primer (ACTTCGCCAC). The DNA fragment was used to design a specific primer pair that was useful for the identification of different isolates as A. polyphaga species. A case of A. polyphaga in disseminated acanthamoebiasis affecting mesenteric nodes is also reported.

  1. Improved COI barcoding primers for Southeast Asian perching birds (Aves: Passeriformes).

    Science.gov (United States)

    Lohman, David J; Prawiradilaga, Dewi M; Meier, Rudolf

    2009-01-01

    The All Birds Barcoding Initiative aims to assemble a DNA barcode database for all bird species, but the 648-bp 'barcoding' region of cytochrome c oxidase subunit I (COI) can be difficult to amplify in Southeast Asian perching birds (Aves: Passeriformes). Using COI sequences from complete mitochondrial genomes, we designed a primer pair that more reliably amplifies and sequences the COI barcoding region of Southeast Asian passerine birds. The 655-bp region amplified with these primers overlaps the COI region amplified with other barcoding primer pairs, enabling direct comparison of sequences with previously published DNA barcodes.

  2. Detection of Hepatitis B Virus DNA by Duplex Scorpion Primer-based PCR Assay

    Institute of Scientific and Technical Information of China (English)

    KONG De-Ming孔德明; SHEN Han-Xi沈含熙; MI Huai-Feng宓怀风

    2004-01-01

    The application of a new fiuorogenic probe-based PCR assay (PCR duplex scorpion primer assay) to the detection of Hepatitis B virus (HBV) DNA in human sera was described. Duplex scorpion primer is a modified variant of duplex Amplifluor, and the incorporation of a PCR stopper between probe and primer sequences improve the detection specificity and sensitivity. Combined with PCR amplification, this probe can give unambiguous positive results for the reactions initiated with more than 20 HBV molecules. In addition, the particular unimolecular probing mechanism of this probe makes the use of short target-specific probe sequence possible, which will render this probe applicable in some specific systems.

  3. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  4. Evaluación de competencias de lectoescritura en alumnos de primer ingreso a la Universidad Autónoma Metropolitana-Xochimilco

    OpenAIRE

    Ma. del Carmen de la Peza; Lilia R. Rodríguez Torres; Iliria Hernández Unzueta; Ricardo Rubio

    2014-01-01

    En México, el fracaso escolar y el analfabetismo funcional, son problemas irresueltos del Sistema Educativo Nacional. Leer críticamente y escribir correctamente es indispensable para quienes logran ingresar al nivel superior. En este artículo, abordamos aspectos cog - nitivos y sociales imbricados en la adquisición y desarrollo de la lectoescritura, a partir de una evaluación diagnóstica aplicada a más del 50% de estudiantes de primer ingreso en la Unidad Xochimilco de la Universidad Autónoma...

  5. Energía gastada en el primer ciclo de histéresis como parámetro de selección de un biomaterial

    OpenAIRE

    2010-01-01

    Veinticuatro muestras de pericardio de ternera estabilizado, material similar al utilizado en la fabricación de velos de bioprótesis cardiacas, fueron sometidas a una prueba de esfuerzo a fatiga. Tras seis bloques de 100 ciclos a 1 MPa de presión máxima se rompieron 12 muestras, el 50%. La energía media gastada en este primer ciclo, en las muestras que sobrevivieron, fue de 0.16J, un valor inferior a la energía gastada en las muestra que terminaron rompiendo, 0.28J (p=0.005). Utiliz...

  6. Progress in the Development of a Multiphase Turbulent Model of the Gas/Particle Flow in a Small-Caliber Ammunition Primer

    Science.gov (United States)

    2006-08-01

    number 41 primer mixture. Name Formula Weight-Percent ± Weight-Percent Deviation Primary Purpose Lead styphnate H3 C6 N3 O9 Pb 37 5...Primary explosive Barium nitrate Ba (N O3)2 32 5 Oxidizer Antimony sulfide Sb2 S3 15 2 Fuel, slow Aluminum powder Al 07 1 Fuel, fast Tetracene H8 C2...Oxidizers are materials with excess oxygen which when liberated can be used by a fuel. 7 The lead styphnate and tetracene are primary explosives

  7. Abu al-Layth al-Libi

    Science.gov (United States)

    2015-02-01

    He has described at length the various methods to which the prisoners were subjected, including sleep depravation, nudity and the use of electrodes...suspects of the Riyadh bombing acknowledge their involvement on television , he was under the impression that they too had been subjugated to this... sleeping , al-Libi, al-Zawi and `Abd al-Karim managed to escape by jumping from the six-meter-tall wall of al-Ruways.38 Their breakout led to a

  8. Mega primer-mediated molecular cloning strategy for chimaeragenesis and long DNA fragment insertion.

    Science.gov (United States)

    Zhang, Hui; Liu, Chang-Jun; Jiang, Hui; Zhou, Lu; Li, Wen-Ying; Zhu, Ling-Yun; Wu, Lei; Meng, Er; Zhang, Dong-Yi

    2017-04-30

    Molecular cloning methods based on primer and overlap-extension PCR are widely used due to their simplicity, reliability, low cost and high efficiency. In this article, an efficient mega primer-mediated (MP) cloning strategy for chimaeragenesis and long DNA fragment insertion is presented. MP cloning is a seamless, restriction/ligation-independent method that requires only three steps: (i) the first PCR for mega primer generation; (ii) the second PCR for exponential amplification mediated by the mega primers and (iii) DpnI digestion and transformation. Most importantly, for chimaeragenesis, genes can be assembled and constructed into the plasmid vector in a single PCR step. By employing this strategy, we successfully inserted four DNA fragments (approximately 500 bp each) into the same vector simultaneously. In conclusion, the strategy proved to be a simple and efficient tool for seamless cloning.

  9. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  10. New Primers for Denaturing Gradient Gel Electrophoresis Analysis of Nitrate-Reducing Bacterial Community in Soil

    Institute of Scientific and Technical Information of China (English)

    R.PASTORELLI; R.PICCOLO; S.SIMONCINI; S.LANDI

    2013-01-01

    The narG gene is frequently used as a molecular marker for bacterial nitrate-reducing community analysis.In this study,a new set of primers targeting the narG gene was designed and applied to semi-nested polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) assay.The potential of the new primers was verified on DNA directly extracted from soils from five different experimental sites distributed in Central and Southern Italy.Specificity of the primers was determined by excision,amplification,and sequencing of bands resolved by DGGE.A phylogenetic analysis showed the correlation between the sequences retrieved from the soils studied and the narG sequences from β and γ-Proteobacteria.These primers expanded the existing molecular tools for ecological study on the size and diversity of nitrate-reducing bacterial community in soil.

  11. Influence of RT-qPCR primer position on EGFR interference efficacy in lung cancer cells

    Directory of Open Access Journals (Sweden)

    Chen Gang

    2011-01-01

    Full Text Available Abstract Background Real-time quantitative RT-PCR (RT-qPCR is a "gold" standard for measuring steady state mRNA levels in RNA interference assays. The knockdown of the epidermal growth factor receptor (EGFR gene with eight individual EGFR small interfering RNAs (siRNAs was estimated by RT-qPCR using three different RT-qPCR primer sets. Results Our results indicate that accurate measurement of siRNA efficacy by RT-qPCR requires careful attention for the selection of the primers used to amplify the target EGFR mRNA. Conclusions We conclude that when assessing siRNA efficacy with RT-qPCR, more than one primer set targeting different regions of the mRNA should be evaluated and at least one of these primer sets should amplify a region encompassing the siRNA recognition sequence.

  12. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  13. Abridged adapter primers increase the target scope of Hi-Plex.

    Science.gov (United States)

    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Pope, Bernard J; Giles, Graham G; Hopper, John L; Southey, Melissa C; Park, Daniel J

    2015-01-01

    Previously, we reported Hi-Plex, an amplicon-based method for targeted massively parallel sequencing capable of generating 60 amplicons simultaneously. In further experiments, however, we found our approach did not scale to higher amplicon numbers. Here, we report a modification to the original Hi-Plex protocol that includes the use of abridged adapter oligonucleotides as universal primers (bridge primers) in the initial PCR mixture. Full-length adapter primers (indexing primers) are included only during latter stages of thermal cycling with concomitant application of elevated annealing temperatures. Using this approach, we demonstrate the application of Hi-Plex across a broad range of amplicon numbers (16-plex, 62-plex, 250-plex, and 1003-plex) while preserving the low amount (25 ng) of input DNA required.

  14. Paralog-specific primers for the amplification of nuclear Loci in tetraploid barbels (barbus: cypriniformes).

    Science.gov (United States)

    Gante, Hugo F; Alves, Maria Judite; Dowling, Thomas E

    2011-01-01

    Thirty paralog-specific primers were developed, following an intron-primed exon-crossing strategy, for S7 and growth hormone genes in Barbus (subgenera Barbus and Luciobarbus). We found that paralog-specific amplification requires the use of only one paralog-specific primer, allowing their simultaneous use with universal exon-primed intron-crossing primers of broad taxonomic applicability. This hybrid annealing strategy guarantees both specificity and generality of amplification reactions and represents a step forward in the amplification of duplicated nuclear loci in polyploid organisms and members of multigene families. Assays of several representative taxa identified high levels of segregating single nucleotide polymorphisms (SNPs) and nucleotide diversity within each of these subgenera. Additionally, several insertions-deletions (indels) that are diagnostic across species are found in intronic regions. Therefore, these primers provide a reliable source of valuable nuclear SNP and indel data for population and species level studies of barbels, such as applied conservation and basic evolutionary studies.

  15. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    Science.gov (United States)

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-06

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs.

  16. Rapid DNA extraction methods and new primers for randomly amplified polymorphic DNA analysis of Giardia duodenalis.

    Science.gov (United States)

    Deng, M Q; Cliver, D O

    1999-08-01

    A randomly amplified polymorphic DNA (RAPD) procedure using simple genomic DNA preparation methods and newly designed primers was optimized for analyzing Giardia duodenalis strains. Genomic DNA was extracted from in vitro cultivated trophozoites by five freezing-thawing cycles or by sonic treatment. Compared to a conventional method involving proteinase K digestion and phenol extraction, both freezing-thawing and sonication were equally efficient, yet with the advantage of being much less time- and labor-intensive. Five of the 10 tested RAPD primers produced reproducible polymorphisms among five human origin G. duodenalis strains, and grouping of these strains based on RAPD profiles was in agreement among these primers. The consistent classification of two standard laboratory reference strains, Portland-1 and WB, in the same group confirmed previous results using other fingerprinting methods, indicating that the reported simple DNA extraction methods and the selected primers are useful in RAPD for molecular characterization of G. duodenalis strains.

  17. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo

    2014-04-01

    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  18. Use of tannin anticorrosive reaction primer to improve traditional coating systems

    Energy Technology Data Exchange (ETDEWEB)

    Matamala, G.; Droguett, G. (Universidad de Concepcion (Chile)); Smeltzer, W. (McMaster Univ., Hamilton, Ontario (Canada). Inst. for Materials Research)

    1994-04-01

    Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showed the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.

  19. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Directory of Open Access Journals (Sweden)

    Nina Vidergar

    Full Text Available BACKGROUND: DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1 improving an automated DNA extraction protocol, (2 testing the performance of commonly used primer combinations, and (3 developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. METHODOLOGY: We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. RESULTS: The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198 that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93% matched that of C1-J-2183. CONCLUSIONS: The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  20. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    Science.gov (United States)

    Zhou, Quan

    2017-01-01

    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  1. Effects of acidic primer/adhesives on primary and permanent dentin

    OpenAIRE

    2009-01-01

    Purpose: To evaluate the quality of primary and permanent dentin by Fourier transformed Raman spectroscopy (FT-Raman), and scanning electron microscopy/energy-dispersive spectroscopy (SEM/EDS). Methods: The middle dentin of crowns was reached by carbide bur abrading providing a uniform smear layer. Self-etching primers were applied in order to simulate the etching of self-etching adhesive systems. The groups were (n = 6): G1 (primary dentin smear layer); G2 (primary dentin etched by primer of...

  2. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    OpenAIRE

    Wawan Abdullah Setiawan; Utut Widyastuti; Munti Yuhana

    2015-01-01

    Whiteleg shrimp (Litopenaeus vannamei) is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ64...

  3. Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture

    Science.gov (United States)

    2015-08-01

    ARL-MR-0896 ●AUG 2015 US Army Research Laboratory Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture...SUBTITLE Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT...Contents List of Figures iv Acknowledgments v 1. Introduction 1 2. Background 1 3. Technical Approach 4 3.1 Hardware Design 4 3.2 Experimental Setup

  4. Eighteen SSR-primers for tetraploid Adansonia digitata and its relatives

    OpenAIRE

    Larsen, Anders Søndergaard; Vaillant, Alexandre; Verhaegen, Daniel; Kjær, Erik Dahl

    2009-01-01

    International audience; Co-dominant markers suitable for molecular ecological studies in the genus Adansonia are highly desirable in order to be able to address a number of interesting research questions related to the special life history traits, gene flow, and distribution dynamics of the Adansonia species. This note presents a set of 18 SSR- primers developed for Adansonia digitata, and tested for cross-amplification on all members of the Adansonia genus. All reported primers were found to a...

  5. Chrome-Free Paint Primer for Zn/Ni Plated High-Strength Steel (Briefing Charts)

    Science.gov (United States)

    2014-11-19

    Approach Primer technology development steps:  Corrosion inhibitor chemistries modeling and high-throughput screening in solution  Promising inhibitor ...95% CI Effectiveness of Corrosion Inhibitors SrCrO4 Low(-) High(+) High(+) High(+) Low(-) Low(-) Ce3+ MoO4 2- WO4 2-B A C Approved for Public Release...Chrome-free Primer TCP LHE= Low Hydrogen Embrittlement CCC= Chromate (Cr6+) Conversion Coating TCP= Trivalent (Cr3+) Chromium Process  Regulatory EHS

  6. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

    Science.gov (United States)

    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

    1994-10-01

    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  7. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G.J.; Bekeris, P.A. [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  8. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  9. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A;

    1999-01-01

    Retroviral reverse transcription is primed by a cellular tRNA molecule annealed to an 18-bp primer binding site sequence. The sequence of the primer binding site coincides with that of a negatively acting cis element that mediates transcriptional silencing of murine leukemia virus (MLV......) in undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary...... to findings from cell culture studies of primer binding site-modified human immunodeficiency virus type 1 and avian retroviruses, our findings were that SL3-3 MLV may stably and efficiently replicate with tRNA primers other than tRNAPro. Although lymphoma induction of the SL3-3 Lys3 mutant was significantly...

  10. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    Directory of Open Access Journals (Sweden)

    Wawan Abdullah Setiawan

    2015-04-01

    Full Text Available Whiteleg shrimp (Litopenaeus vannamei is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ640264, flanking the position 133 to 756. This primer pairs were used to identify haemolysin gene in both V. harveyi MR5339 and V. harveyi 275 strain. Sequencing results from each sample showed 99% similarity with haemolysin gene sequence in Genebank. Furthermore, the sequence of V. harveyi MR5339 haemolysin gene was used to design the nested PCR primers. The first primer pairs of nested PCR have successfully amplified the haemolysin gene fragment of all V. harveyi strains samples from position 52 to 405. The second primer pairs of nested PCR have amplified position 204 to 405 where it can detect all of V. harveyi strains used as sample sources in this study. The application of nested PCR technique in this study was able to identify V. harveyi strains at serial dilution of cells density as low as 100 cfu/mL, which is equal to a single cell or at DNA concentration up to 101 fg/µL.

  11. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  12. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C;

    2002-01-01

    by cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus......Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether tRNA...... primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...

  13. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity...... of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed...

  14. Variación estacional de la producción de huevos del copépodo calanoideo Centropages furcatus (Dana, 1852 en la Bahía de La Paz, México Seasonal variability of egg production rates of calanoid copepod Centropages furcatus (Dana, 1852 in Bahia de La Paz, Mexico

    Directory of Open Access Journals (Sweden)

    Sergio Hernández-Trujillo

    2008-08-01

    Full Text Available Se estimó la tasa de producción de huevos (TPH para Centropages furcatus en la Bahía de la Paz, Baja California Sur, México, durante 2003. Esta especie es una de las más abundantes y frecuentes de los copépodos en la zona. La estimación en carbono de la producción de huevos fue máxima en verano (1.20 ± 0.7 µg C hembra-¹ d-1 y mínima en primavera (0.58 ± 0.42 µg C hembra-1 d-1. La mayor longitud del prosoma (LP fue registrada en verano (1.15 ± 0.05 mm y la menor en otoño (1.01 ± 0.04 mm. No hubo correlación significativa entre LP y TPH con la concentración de clorofila a (Cl a ni con la temperatura superficial del mar (TSM. En invierno, primavera y verano la TSM fue menor a 23.2 °C, a diferencia de otoño que presentó TSM mayores a 27 °C. En relación a la Cl a, tanto en invierno, primavera y otoño los valores fueron menores a 1 mg m-3, mientras que en verano fueron mayores a 3 mg m-3. Aunque la correlación no fue significativa (p >0.05 entre los parámetros biológicos y las variables ambientales, la especie presentó valores altos de LP y TPH en verano cuando la TSM fue baja y la concentración de Cl a fue la más alta.The egg production rate (EPR was estimated for Centropages furcatus in Bahia de La Paz, Baja California Sur, Mexico during 2003. This species is one of the most abundant and frequent copepod in the zone. The highest egg production in carbon estimations for C. furcatus were observed in summer (1.20 ± 0.7 µg C female-1 d-1 and the lowest was found during spring (0.58 ± 0.42 µg C female-1 d-1. The longest prosome length (PL was registered in summer (1.15 ± 0.05 mm and the shorter during autumn (1.01 ± 0.04 mm. No significant correlation was found in a daily base between EPR and PL with chlorophyll a (Chl a concentration neither the sea surface temperature (SST. In temporal scale, in winter, spring and summer the SST was low (27 °C. Chl a was low (3 mg m-3. Although the correlation was non significant

  15. Primer-Dependent and Primer-Independent Initiation of Double Stranded RNA Synthesis by Purified Arabidopsis RNA-Dependent RNA Polymerases RDR2 and RDR6

    Science.gov (United States)

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  16. El caso Glivec®: primer ejemplo de debate global en torno al sistema de patentes de medicamentos

    Directory of Open Access Journals (Sweden)

    Inês Moital

    2014-11-01

    Conclusión: El caso Glivec® ha planteado el debate sobre la adecuación de las normas internacionales, su aplicabilidad en el entorno económico y su adaptación en cada país. Este caso, y otros, deberían contribuir a la reflexión sobre el sistema internacional de patentes a fin de preservar la salud de la población más necesitada de una atención sanitaria adecuada en equilibrio con la protección de la propiedad intelectual y la innovación.

  17. Gobierno Electrónico: información y pobreza, un primer acercamiento al dato-puente

    OpenAIRE

    2005-01-01

    Este trabajo desarrolla la idea que una de las causas de la pobreza es la asimetría de información en los mercados, por lo tanto es necesario precisar qué calidad de información deben recibir los pobres para salir de su condición. A partir de ello se propone el constructo: dato-puente cuya finalidad sea homologar la información con el mercado y ampliar sus alternativas para salir de la pobreza. El trabajo se divide en tres partes: la primera explica el problema de la pobreza y su relación con...

  18. Gobierno Electrónico: información y pobreza, un primer acercamiento al dato-puente

    Directory of Open Access Journals (Sweden)

    Rodrigo Sandoval Almazán

    2005-01-01

    Full Text Available Este trabajo desarrolla la idea que una de las causas de la pobreza es la asimetría de información en los mercados, por lo tanto es necesario precisar qué calidad de información deben recibir los pobres para salir de su condición. A partir de ello se propone el constructo: dato-puente cuya finalidad sea homologar la información con el mercado y ampliar sus alternativas para salir de la pobreza. El trabajo se divide en tres partes: la primera explica el problema de la pobreza y su relación con la información; la segunda desarrolla la idea de asimetría de información en la pobreza y expone una propuesta de cómo mejorar la información que reciben los pobres. La última parte expone algunas ideas sobre investigaciones futuras y conclusiones.

  19. Evolución del peso en pacientes durante el primer año del trasplante renal

    Directory of Open Access Journals (Sweden)

    Pilar López Garrigós

    Full Text Available Durante el primer año de trasplante renal es frecuente una ganancia de peso, debido, entre otros a la dieta, sedentarismo, e inmunosupresores, pudiendo aumentar los factores de riesgo del síndrome metabólico. Objetivos: Conocer la evolución del peso de nuestros pacientes durante el primer año del trasplante, y analizar la influencia con las distintas variables asociadas al paciente, sexo, edad, IMC, tratamiento inmunosupresor entre otras. Determinar la asociación entre la ganancia de peso y la aparición de factores de riesgo, como hipertensión arterial, diabetes y dislipidemia. Material y Método: Estudio retrospectivo y analítico. Se estudiaron 100 pacientes con un año de evolución en el trasplante, del Hospital Virgen de la Salud de Toledo. Sé analizaron datos antropométricos, demográficos y clínicos. La ganancia de peso se distribuyo según a las variables del estudio. Resultados: La ganancia de peso al año del trasplante afecto a 93 pacientes, con una media de 7,21 kg ±5,87. El 44,1% aumento su peso por encima de la media, y el 23,7% gano > 10 kg. La prevalencia de sobrepeso y obesidad antes del trasplante fue 57% y 76% después del trasplante. Los hombres ganaron ligeramente más peso que las mujeres. Los más jóvenes < 49 años ganaron más peso, media 9,3 kg. Mayor incidencia de diabetes, hipertensión y dislipemias en los pacientes con sobrepeso y obesidad. Conclusiones: La mayoría de los pacientes aumentaron significativamente de peso al año del trasplante, asociándose con varios de los factores del síndrome metabólico. - Importante la educación, por parte de la enfermería, del paciente para fomentar hábitos de vida saludable.

  20. FERTILIZACIÓN DEL PLÁTANO CON NITRÓGENO Y POTASIO DURANTE EL PRIMER CICLO PRODUCTIVO

    Directory of Open Access Journals (Sweden)

    Parm\\u00E9nides Furcal-Beriguete

    2014-01-01

    Full Text Available Fertilización del plátano con nitrógeno y potasio durante el primer ciclo productivo. El objetivo de este trabajo fue evaluar la respuesta agronómica a la fertilización con nitrógeno y potasio durante el primer ciclo productivo del plátano (Musa AAB. El experimento se estableció en La Fortuna, San Carlos, Costa Rica, en dos años consecutivos, 2008 y 2009, en suelo del orden inceptisol de fertilidad media, formado por materiales aluviales. Se aplicaron dosis de 0, 100 y 200 kg de N/ha y 0,125, 250 y 375 kg de K2O/ha. La siembra se realizó con cormos del cultivar Curraré semi gigante, a una densidad de 2380 y 2224 plantas por hectárea, en cada año. Se evaluaron las variables circunferencia y altura de pseudotallo, peso del racimo, número de frutos y de manos por racimo, longitud y calibre del fruto central de la segunda mano. Hubo diferencias estadísticas significativas en las dosis de 100 y 200 kg de N/ha para todas las variables, excepto el número de manos por racimo, en los dos períodos, 2008-2009 y 2009-2010, produciéndose mejores resultados en el segundo período. Con la aplicación de K no se detectaron respuestas significativas en el primer período, quizás debido a la aparición de bacteriosis a los cinco meses de edad; sin embargo, en el período 2009-2010 hubo diferencias significativas en longitud y calibre del fruto central de la segunda mano e interacción entre N y K2O en estas dos variables, con mayor longitud (29,13 cm y calibre (63,04; 1/32 pulgada en la combinación de las dosis altas. La absorción de nitrógeno y potasio, al momento de la cosecha, fue de 102,6 kg de N/ha y 227,8 kg de K/ha, respectivamente.

  1. Evaluation of Adhesive Bond Primers for Repair Bonding of Aluminum

    Science.gov (United States)

    2011-11-02

    3M’s EW 5000 (low-VOC, chromated) – 3M’s EW 5000 AS (low-VOC, nonchromated corrosion inhibitor) • Spray Applied Using Conventional Air Gun – Dry film ...Statement A: Approved for Public Release; Distribution is Unlimited. Mins after Air Dry at Ambient Conditions for 30 Mins Materials and Processes (cont...prebond surface preparation • Used in USAF for rework and preparation of repair doublers – Grit Blast/Sol Gel (GBSG)- - • Al2O3 grit-blast followed by

  2. Gorduras em laticínios, ovos, margarinas e óleos: implicações para a aterosclerose Grasas en lácteos, huevos, margarinas y aceites: implicaciones para la aterosclerosis Fat content of dairy products, eggs, margarines and oils: implications for atherosclerosis

    Directory of Open Access Journals (Sweden)

    Carlos Scherr

    2010-07-01

    Full Text Available FUNDAMENTO: Para o aconselhamento adequado de um planejamento alimentar, com vistas à prevenção da cardiopatia isquêmica, é necessário o conhecimento da composição química dos alimentos. ObJETIVO: Analisar a composição de gorduras, ácidos graxos e colesterol de alguns exemplos nacionais de óleos comestíveis, manteigas, margarinas, laticínios e ovos, utilizando os limites de uma dieta para prevenção de doença arterial coronariana. MÉTODOS: Foi analisada a composição de óleos comestíveis, manteigas, margarinas, laticínios e ovos. Os resultados foram empregados de acordo com o recomendado pela American Heart Association para uma dieta de 1.800 calorias. RESULTADOS: Na comparação entre os óleos comestíveis, o de canola apresentou-se como o melhor. Já entre os leites, o desnatado é o mais recomendável, porém não há vantagens em relação ao semidesnatado. No caso do ovo, não existiram diferenças nos tipos encontrados no mercado. Em relação aos queijos, o tipo minas é o que apresentou o menor conteúdo de colesterol e gordura saturada. Na comparação margarina com manteiga, a primeira levou vantagem quando os níveis de gorduras trans que não ultrapassam o recomendado. CONCLUSÃO: A composição de alimentos usados no Brasil indica que dietas com objetivo de prevenção primária e secundária da cardiopatia isquêmica podem priorizar o uso de leite semidesnatado, óleo de girassol, margarinas com baixo teor de gorduras trans e queijo do tipo minas.FUNDAMENTO: Para aconsejar adecuadamente sobre una planificación alimentaria, con vistas a la prevención de la cardiopatía isquémica, es necesario el conocimiento de la composición química de los alimentos. OBJETIVO: Analizar la composición de grasas, ácidos grasos y colesterol de algunos ejemplos nacionales de aceite comestible, mantecas, margarina, lácteos y huevos, utilizando los límites de una dieta para prevención de enfermedad arterial coronaria. M

  3. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.

    Science.gov (United States)

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A

    2012-01-01

    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength.

  4. Necesidades en salud del diabético usuario del primer nivel de atención

    Directory of Open Access Journals (Sweden)

    Salinas-Martínez Ana M.

    2001-01-01

    Full Text Available Objetivo. Determinar la magnitud y jerarquizar la necesidad de salud satisfecha del diabético tipo 2, usuario del primer nivel de atención. Material y métodos. Se realizó un estudio transversal comparativo con representatividad rural y urbana, en el Instituto Mexicano del Seguro Social, en Nuevo León, en 1999. Fueron entrevistados, al azar, 256 diabéticos tipo 2 con dos o más años de diagnóstico. La información fue complementada con el expediente clínico y encuesta al proveedor. Se evaluaron cinco áreas y cuatro determinantes de salud, con base en estándares de la Norma Oficial Mexicana y la Asociación Americana de Diabetes. El plan de análisis consistió en estadística descriptiva y estimación de puntajes z. Resultados. Se registró una media de satisfacción global de necesidades de salud de 48.8%. En la zona rural la media de satisfacción fue menor que en la urbana (36.8% vs 53.3%, phttp://www.insp.mx/salud/index.html

  5. El aprendizaje de distintos dominios notacionales según niños de preescolar y primer grado

    Directory of Open Access Journals (Sweden)

    Nora Scheuer

    2010-10-01

    Full Text Available Se investiga si las concepciones de los niños acerca del aprendizaje adoptan matices diferentes según tres dominios notacionales: dibujo, escritura y notación numérica. Se entrevistó individualmente a 120 alumnos de preescolar (60 y primer grado (60 de escuelas públicas en Argentina. Se aplicó la lexicometría a las transcripciones de sus respuestas completas a tres preguntas referidas a la actividad, dificultades y metas en relación al propio aprendizaje del dibujo, escritura o notación numérica. Los resultados revelan diferencias significativas en cómo los niños refieren el contenido de aprendizaje y a sí mismos como aprendices según el dominio, indicando una teoría interpretativa del aprendizaje en relación al dibujo y la notación numérica, y una teoría directa en relación a la escritura.

  6. Aquí “Canta un guaso”: entre la postulación de una comunidad rioplatense y el primer poema gauchesco

    Directory of Open Access Journals (Sweden)

    Juan Ignacio Pisano

    2017-01-01

    Full Text Available Juan Baltasar Maziel escribió una serie de poemas en honor al virrey Cevallos por su triunfo frente a los portugueses en 1777. Entre ellos sobresale el primer poema gauchesco. A pesar de formar parte de un corpus mayor, el mismo fue leído, cuando se le prestó atención, a partir de la singularidad estética que lo coloca como el primer antecedente de la gauchesca. Esta operación crítica descontextualizó al poema. Restituirlo a su lugar propio, tal como se propone en este texto, abre líneas de lectura obturadas para este género que se piensa tan vinculado a 1810. Juan Baltasar Maziel wrote a series of poems in honor of the viceroy Cevallos for his victory over the Portuguese in 1777. Among them, stands the first gaucho poem. Despite being part of a larger corpus, when it was first noticed, it was read from the perspective of its aesthetic singularity, which places it as the first antecedent of the gauchesco genre. This critical operation ‘descontextualised’ the poem. Restituting it to its proper place, as proposed in this text, will open new reading possibilities for this genre, which is considered to be linked to 1810.

  7. Primer containing dimethylaminododecyl methacrylate kills bacteria impregnated in human dentin blocks

    Institute of Scientific and Technical Information of China (English)

    Chen Chen; Lei Cheng; Michael D Weir; Nancy J Lin; Sheng Lin-Gibson; Xue-Dong Zhou; Hockin HK Xu

    2016-01-01

    Antibacterial dimethylaminododecyl methacrylate (DMADDM) was recently synthesized. The objectives of this study were to:(1) investigate antibacterial activity of DMADDM-containing primer on Streptococcus mutans impregnated into dentin blocks for the first time, and (2) compare the antibacterial efficacy of DMADDM with a previous quaternary ammonium dimethacrylate (QADM). Scotchbond Multi-Purpose (SBMP) bonding agent was used. DMADDM and QADM were mixed into SBMP primer. Six primers were tested:SBMP control primer P, P+2.5%DMADDM, P+5%DMADDM, P+7.5%DMADDM, P+10%DMADDM, and P+10%QADM. S. mutans were impregnated into human dentin blocks, and each primer was applied to dentin to test its ability to kill bacteria in dentinal tubules. Bacteria in dentin were collected via a sonication method, and the colony-forming units (CFU) and inhibition zones were measured. The bacterial inhibition zone of P+10%DMADDM was 10 times that of control primer (Po0.05). CFU in dentin with P+10%DMADDM was reduced by three orders of magnitude, compared with control. DMADDM had a much stronger antibacterial effect than QADM, and antibacterial efficacy increased with increasing DMADDM concentration. Dentin shear bond strengths were similar among all groups (P40.1). In conclusion, antibacterial DMADDM-containing primer was validated to kill bacteria inside dentin blocks, possessing a much stronger antibacterial potency than the previous QADM. DMADDM-containing bonding agent was effective in eradicating bacteria in dentin, and its efficacy was directly proportional to DMADDM mass fraction. Therefore, DMADDM may be promising for use in bonding agents as well as in other restorative and preventive materials to inhibit bacteria.

  8. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  9. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  10. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  11. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

    Science.gov (United States)

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-11-16

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR.

  12. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted of ...

  13. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  14. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Science.gov (United States)

    Sonthiphand, Puntipar; Neufeld, Josh D

    2013-01-01

    Anaerobic ammonia oxidizing (anammox) bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE) fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r) for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r) was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library analysis, A438f/A684r

  15. Multiplex PCR based on a universal biotinylated primer to generate templates for pyrosequencing.

    Science.gov (United States)

    Chen, Zhiyao; Liu, Yunlong; Duan, Wenbang; Ye, Hui; Wu, Haiping; Li, Jinheng; Zhou, Guohua

    2014-06-01

    Pyrosequencing is a powerful tool widely used in genetic analysis, however template preparation prior to pyrosequencing is still costly and time-consuming. To achieve an inexpensive and labor-saving template preparation for pyrosequencing, we have successfully developed a single-tube multiplex PCR including a pre-amplification and a universal amplification. In the process of pre-amplification, a low concentration of target-specific primers tagged with universal ends introduced universal priming regions into amplicons. In the process of universal amplification, a high concentration of universal primers was used for yielding amplicons with various SNPs of interest. As only a universal biotinylated primer and one step of single-stranded DNA preparation were required for typing multiple SNPs located on different sequences, pyrosequencing-based genotyping became time-saving, labor-saving, sample-saving, and cost-saving. By a simple optimization of multiplex PCR condition, only a 4-plex and a 3-plex PCR were required for typing 7 SNPs related to tamoxifen metabolism. Further study showed that pyrosequencing coupled with an improved multiplex PCR protocol allowed around 30% decrease of either typing cost or typing labor. Considering the biotinylated primer and the optimized condition of the multiplex PCR are independent of SNP locus, it is easy to use the same condition and the identical biotinylated primer for typing other SNPs. The preliminary typing results of the 7 SNPs in 11 samples demonstrated that multiplex PCR-based pyrosequencing could be promising in personalized medicine at a low cost.

  16. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    Science.gov (United States)

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  17. The effect of various primers on shear bond strength of zirconia ceramic and resin composite

    Directory of Open Access Journals (Sweden)

    Sasiwimol Sanohkan

    2013-01-01

    Full Text Available Aims: To determine the in vitro shear bond strengths (SBS of zirconia ceramic to resin composite after various primer treatments. Materials and Methods: Forty zirconia ceramic (Zeno, Wieland Dental specimens (10 mm in diameter and 2 mm thick were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10. Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE, AP (Alloy Primer, Kuraray Medical, and MP (Monobond Plus, Ivoclar Vivadent AG. One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa were analyzed with one-way analysis of variance (ANOVA and the Tukey′s Honestly Significant Difference (HSD test (α = 0.05. Results: Group AP yielded the highest mean and standard deviation (SD value of SBS (16.8 ± 2.5 MPa and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa. The SBS did not differ significantly among the groups (P = 0.079. Conclusions: Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  18. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  19. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  20. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode.

  1. Effect of 4-MET- and 10-MDP-based primers on resin bonding to titanium.

    Science.gov (United States)

    Tsuchimoto, Youhei; Yoshida, Yasuhiro; Mine, Atsushi; Nakamura, Mariko; Nishiyama, Norihiro; Van Meerbeek, Bart; Suzuki, Kazuomi; Kuboki, Takuo

    2006-03-01

    The purpose of this study was to investigate the effect of a 4-MET- and 10-MDP-based primer on the bond strength of two resin cements (SuperBond C&B, Sun Medical; Panavia Fluoro Cement, Kuraray) to titanium (Ti). Ti plates were treated with six experimental primers consisting of, respectively, 10-MDP and 4-MET in concentrations of 0.1, 1 and 10wt%, or were kept untreated (control). The highest tensile bond strength of Panavia Fluoro Cement to Ti was obtained when the Ti surface was pre-treated with 10wt% 10-MDP and was significantly higher than that when a lower concentrated 10-MDP-based primer or any 4-MET-based primer was used. On the contrary, no significant difference in tensile bond strength of SuperBond C&B was found for the untreated and six pre-treated Ti surfaces, although pre-treatment with each 10-MDP-based primer resulted in a higher tensile bond strength as compared to any 4-MET pre-treatment. Altogether, the data obtained strongly suggest that 10-MDP is effective to improve the adhesive performance of resin to titanium.

  2. Evaluation of genotypic diversity of Streptococcus mutans using distinct arbitrary primers

    Directory of Open Access Journals (Sweden)

    Cínthia Pereira Machado Tabchoury

    2008-12-01

    Full Text Available Streptococcus mutans has been considered one of the main etiological agents of dental caries and the genotypic diversity rather than its salivary counts may be considered as a virulence factor of this bacterium. For genotyping with polymerase chain reaction (PCR with arbitrary primers, several primers have been used in order to improve complexity and specificity of amplicon patterns. Thus, the aim of this study was to evaluate the degree of agreement of genotypic identification among AP-PCR reactions performed with 5 distinct arbitrary primers of S. mutans isolated from saliva. Stimulated saliva was collected from 11 adult volunteers for isolation of S. mutans, and a total of 88 isolates were genotyped with arbitrary primers OPA 02, 03, 05, 13 and 18. Fourteen distinct genotypes were identified in the saliva samples. Most volunteers (9 out of 11 presented only one genotype. The results of the present study suggest that primers OPA 02, 03, 05 and 13 were suitable for genotypic identification of S. mutans isolates of saliva from adult volunteers.

  3. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin

    Science.gov (United States)

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra

    2015-01-01

    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. RESULTS Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (Pveneer resin to Co-Cr and Au-Ag-Pd alloys. PMID:26576256

  4. Christiaan Barnard: 40 años del primer transplante de corazón humano

    Directory of Open Access Journals (Sweden)

    Jorge Reynolds

    2007-12-01

    Full Text Available Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Christiaan N. Barnard nació el 8 de noviembre de 1922 en Beaufort West, Sudáfrica, hijo de Adam Barnard y Elizabeth de Sewart. Hizo sus estudios en la Universidad de Cape Town, donde se graduó como médico en 1948. Después de un corto período como médico familiar en Ceres, culminó en 1953 su doctorado en medicina en la misma universidad. En 1956 inició su entrenamiento como cirujano cardiotorácico en la Universidad de Minnesota, Estados Unidos. De regreso a su país natal, al terminar la década, Barnard se desempeñó como jefe del departamento de cirugía cardiotorácica en el hospital Groote Schuur1-3. Mientras ocupaba el cargo de profesor asociado en la Universidad de Cape Town, realizó labores asistenciales, docentes e investigativas. Allí conformó una de las unidades de cirugía cardíaca más sobresalientes en su momento a nivel mundial, lo que le permitió hacer gala de sus extraordinarias destrezas como cirujano. Para completar su formación visitó los laboratorios de transplantes más reconocidos alrededor del mundo. Esto le ayudó a perfilar un nuevo objetivo: efectuar el primer transplante exitoso de un corazón humano. Para alcanzar tan fantástico logro, trabajó con intensidad y en estrecha colaboración con un grupo de médicos investigadores, también pioneros en este campo1,3.El comienzo de la historia de la cirugía cardíaca se remonta a 100 años atrás, cuando el médico Alexis Carrel realizó los primeros experimentos

  5. Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

    OpenAIRE

    Pena, S D; Barreto, G.; Vago, A. R.; De Marco, L; Reinach,F. C.; Dias Neto, E; Simpson, A J

    1994-01-01

    Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites wi...

  6. Demonstration and Validation of a Replacement Alternative to the Chromate Wash Primer DOD-P-15328D

    Science.gov (United States)

    2006-04-01

    system. The current wash primer is a low-solids, solvent-based polyvinyl butyral that contains phosphoric acid and zinc chromate that promotes adhesion...prior to the application of an epoxy primer/polyurethane topcoat CARC system. The current wash primer is a low-solids, solvent-based polyvinyl ... butyral that contains phosphoric acid and zinc chromate that promotes adhesion and minimizes corrosion. This coating contains large amounts of volatile

  7. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  8. Molecular Characterization of Atlas 66-Derived Wheat Near-Isogenic Lines Contrasting in Aluminum (Al) Tolerance

    Institute of Scientific and Technical Information of China (English)

    GUO Pei-guo; BAI Gui-hua; LI Rong-hua; Brett Carver; Michael Baum

    2007-01-01

    Aluminum (Al) toxicity is the major limiting factor for wheat growth in acidic soils. Genetic improvement of Al tolerance is one of the most cost-effective solutions to improve wheat productivity. The objective of this study was to characterize near isogenic lines (NILs) contrasting in Al tolerance derived from Atlas 66 in the backgrounds of Al-sensitive cultivars Chisholm and Century using amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR). A total of 200 AFLP and 88 SSR primer pairs were screened and 12 markers (11 AFLPs and one SSR) were associated with Altolerance in NILs of at least one recurrent parental background. Among them, nine were linked to Al tolerance in the Chisholm-derived NILs, seven were associated with Al-tolerance in the Century-derived NILs, and three AFLPs derived from the primer combinations of pAG/mGCAG, pCAG/mAGC and pGTG/mGCG, and one SSR, Xwmc331 on chromosome4D, associated with Al tolerance in NILs of both recurrent parental backgrounds. Those common markers across two backgrounds may be the major marker loci associated with Al-tolerance in Atlas 66 and could be useful for marker-assisted breeding to improve Al tolerance in wheat. In addition, evaluation of Al tolerance among different genotypes using hematoxylin stain and relative root growth revealed that Atlas 66 was more tolerant to Al stress than the NILs, therefore suggested that the Al-tolerant NILs might not carry all Al-tolerance loci from Atlas 66 and inheritance of Al tolerance in Atlas 66 is more likely multigenic.

  9. Effect of primers containing copper salts on bonding of TBB resin to enamel.

    Science.gov (United States)

    Taira, Y; Imai, Y

    1994-12-01

    The effect of primers containing copper salts on adhesion between enamel and stainless steel was studied in a trial to improve durability of TBB type resin cements. Bovine enamel surfaces were treated with 10% phosphoric acid, then with acetone primers containing copper salts, and finally bonded with TBB resins. Tensile strengths of the bonded specimens were measured after thermocycling testing in water and compared with those obtained for commercial composite type resin cements. A combination of a primer containing copper (II) methacryloyloxyethyl succinate and 4-META/MMA-TBB resin was most effective in improving the durability, and superior to the commercial resin cements. The mean and lowest bond strength values of 21 MPa and about 12 MPa, respectively, were retained after 2,000 thermocycles.

  10. Analysis of Two Chinese Yak(Bos grunniens) Population Using Bovine Microsatellite Primers

    Institute of Scientific and Technical Information of China (English)

    Wang Minqiang; S.Weigend; A.Barre-Dirie; J.W.Carnwath; Lou Zhonglin; H.Niemann

    2005-01-01

    Two Chinese domestic yak populations representing the Plateau type and the Huanhu Alpine type were analysed with 12 bovine microsatellite primers. All primer pairs functioned in the yak genome and polymorphism was found at all loci. The allele size ranges and frequencies of the two yak populations were similar and there was considerable overlap with the allele size ranges observed in cattle. Data for European cattle breeds was obtained from the Cattle Diversity Database(CaDBase)to interpret the heterozygosity and genetic distance estimates in yak populations. Heterozygosity estimated for the two yak populations was comparable to that of European cattle while Nei's Genetic Distance DA between the two yak populations was less than distances between the most closely related German cattle breeds. Bovine microsatellite primers proved to be a valuable tool for characterization of yak populations.

  11. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  12. Efficient newly designed primers for the amplification and sequencing of bird mitochondrial genomes.

    Science.gov (United States)

    Amer, Sayed A M; Ahmed, Mohamed Mohamed; Shobrak, Mohammed

    2013-01-01

    In the present study, 27 mitochondrial genomes of diverse avian supra-orders were collected from the Genbank database and their genes were aligned separately. From the alignments, the conserved sequences were selected to design novel conserved primers for amplification and sequencing of the different mitochondrial genes. The reproducibility of these primers was tested in the amplification and sequencing of diverse avian supra-order mitochondrial genomes and was confirmed. This method helped in designing a new set of primers to accelerate both the amplification and the sequencing of bird mitogenomes. It also aids in building mitogenome markers in studying the genetic framework of endemic birds as a preliminary strategy for conservation management of them.

  13. Kisspeptin: a new neuronal target of primer pheromones in the control of reproductive function in mammals.

    Science.gov (United States)

    Jouhanneau, Mélanie; Szymanski, Laura; Martini, Mariangela; Ella, Arsène; Keller, Matthieu

    2013-07-01

    Pheromones are known to trigger either short-term behavioral responses, usually referred to as "releaser effects", or more long-term physiological changes, known as "primer effects", which especially affect reproductive function at the level of the gonadotrope axis. The precise mechanisms through which pheromones interact with the gonadotrope axis in the hypothalamus is not fully known. We propose that the neuropeptide Kisspeptin, could be a specific target of primer pheromones, allowing these pheromones to modulate the gonadotrope axis and GnRH activity. This emerging hypothesis is discussed in the context of puberty acceleration in female mice and the male effect in female ungulates (sheep or goat). These examples have been chosen to illustrate the diversity of the reproductive contexts in mammals and potential mechanisms affected by primer effects at the level of the gonadotrope axis.

  14. Novel Primers From Informative Nuclear Loci for Louse Molecular Phylogenetics (Insecta: Phthiraptera).

    Science.gov (United States)

    Sweet, Andrew D; Allen, Julie M; Johnson, Kevin P

    2014-11-01

    While parasitic lice (Insecta: Phthiraptera) have historically been an important model taxon for understanding host-parasite coevolution, very few molecular markers have been developed for phylogenetic analysis. The current markers are insufficient to resolve many of the deeper nodes in this group; therefore, sequences from additional genetic loci are necessary. Here, we design primers targeting several nuclear protein coding genes based on a complete genome and transcriptome of Pediculus humanus L. plus transcriptomes and modest coverage genomic data from five genera of avian feather lice. These primers were tested on 32 genera of avian feather lice (Ischnocera), including multiple species within some genera. All of the new primer combinations produced sequences for the majority of the genera and had similar or higher divergences than the most widely used nuclear protein-coding gene in lice, EF-1α. These results indicate that these new loci will be useful in resolving phylogenetic relationships among parasitic lice.

  15. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;

    2004-01-01

    One of the most promising techniques for typing of multiple single-nucleotide polymorphism (SNP) is detection of single base extension primers (SBE) by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). We present a new MALDI-TOF MS protocol for typing...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal......, and the potential use of MALDI-TOF MS for SNP typing is discussed....

  16. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    Science.gov (United States)

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  17. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  18. Presentación del primer caso humano de parasitismo por Macracanthorhynchus hirudinaceus en el Perú y breve revisión

    OpenAIRE

    María Beltrán F. de Estrada

    1997-01-01

    Se reporta un caso humano portador de Macracanthorhynchus hirudinaceus. Se trata de un varón de 45 años de edad, natural de la provincia de Chota, departamento de Cajamarca, Perú; con molestias digestivas. El diagnóstico se hizo por el hallazgo de huevos de Macracanthorhynchus hirudinaceus en las heces. Además se encontró Trichuris trichiura, Ancylostoma duodenale, Trichostrongylus sp, Blastocystis hominis y Entamoeba coli. Esta es la primera comunicación de un caso humano de M. hirudinaceus ...

  19. La política ferroviaria del primer gobierno radical 1916-1922

    Directory of Open Access Journals (Sweden)

    MARIO JUSTO LÓPEZ

    2013-05-01

    Full Text Available El gobierno argentino adoptó a comienzos del siglo XX un modelo de explotación ferroviaria basado en la actuación de empresas extranjeras, que obtenían su capital en el mercado financiero y que, para ello, debían tener utilidades. Su actuación quedó sometida al control estatal que se ejerció a través de la Dirección General de Ferrocarriles. Con el triunfo electoral de la Unión Cívica Radical en las elecciones presidenciales de 1916 la situación no cambió. El primer presidente radical, Hipólito Yrigoyen, continuó con dicho modelo y en los años difíciles que siguieron a la Primera Guerra Mundial se preocupó en mantener las utilidades de las empresas dándoles sucesivos aumentos de tarifas. La Dirección General de Ferrocarriles continuó siendo el órgano específico de contralor pero ahora con menos autonomía respecto del Presidente de la Nación. El estudio detallado de lo hecho en estos años desmiente la creencia de que el presidente Yrigoyen fue contrario a las empresas ferroviarias extranjeras y llevó adelante acciones en su perjuicio. Abstract At the beginning of the XXth Century, the Argentine Government left the main sections of the railway system in the hands of foreign companies. Those companies managed to obtain their capital from the financial market under the condition of being profitable. All those companies were controlled by the National Railways Board. In 1916, when the Radical Civic Union won the presidential election, nothing changed. Even during the difficult years after the First World War, Hipólito Yrigoyen, the first Radical President allowed fares increases that kept the level of profitability. The National Railways Board went on with the surveillance of the foreign companies, but now under the direct power of the President. A careful study of the first Radical Government railway policy shows that the mythical idea about President Yrigoyen acting against foreign companies is not true.

  20. EL PRIMER TEXTO DE NEFTALÍ REYES Y EL ÚLTIMO POEMA DE PABLO NERUDA

    Directory of Open Access Journals (Sweden)

    Manuel Jofré

    2004-11-01

    Full Text Available Uno de los aspectos menos estudiados de la escritura nerudiana es la producción primera del joven Neruda, quien en esos años se llamaba Neftalí Reyes17. Sus primeros escritos son decisivos para la conformación del ser americano y para la constitución del sistema de referencias míticas de la escritura nerudiana, como asi mismo del proceso de nominación de la madrasta como madre y del yo como sujeto poético. Pablo Neruda publicó más de seis mil páginas en verso y en prosa. El primerísimo texto conservado del joven Neftalí Reyes se contrapone abruptamente al que es, reputadamente, el último poema de Pablo Neruda, escrito, casi con seguridad, después del 11 de septiembre de 1973. "Hastaciel" es un poema único, por la complejidad de sus imágenes, su lenguaje hermético y lo funesto de su visión. Es reconocido que la poesia póstuma de Neruda ha sido también poco explorada. En este caso, más que hacer un estudio comparativo de ambos textos, interesa examinar el comienzo y fin de una escritura, es decir, la apertura y cierre de la palabra poética, sin ignorar la ingente cantidad lírica acumulada entre ambos extremosOne of the least studied aspects of the Nerudian canon is the earliest production of the young poet then named Neftalí Reyes. The early writing of the poet is decisive for the formation of the idea of the American self and for the constitution of a system of mythical references as well as for the process of the nomination of the stepmother as the mother and the self as poetic subjects. In the course of his life, Neruda published more than six thousand pages of prose and verse. The earliest known text by the young Neftalí Reyes is in marked contrast to the poet's last poem, written with certainty after Sept. 11.1973, "Hastaciel" is a unique poem, for the complexity of its imagecy, its hermetic language, and its dark vision. It is well acknowledged that the poet's last work has not been given much study. In this case

  1. /Cu-Al System

    Science.gov (United States)

    Kish, Orel; Froumin, Natalya; Aizenshtein, Michael; Frage, Nachum

    2014-05-01

    Wettability and interfacial interaction of the Ta2O5/Cu-Al system were studied. Pure Cu does not wet the Ta2O5 substrate, and improved spreading is achieved when relatively a high fraction of the active element (~40 at.% Al) was added. The Al2O3 and AlTaO4 phases were observed at the Ta2O5/Cu-Al interface. A thermodynamic evaluation allowed us to suggest that the lack of wetting bellow 40 at.% Al is due to the presence of a native oxide, which covers the drop. The conditions of the native oxide decomposition and the formation of the volatile Al2O suboxide strongly depend on the vacuum level during sessile drop experiments and the composition of the Cu-Al alloy. In our case, Al contents greater than 40% provides thermodynamic conditions for the formation of Al2O (as a result of Al reaction with Al2O3) and the drop spreading. It was suggested that the final contact angle in the Ta2O5/Cu-Al system (50°) is determined by Ta adsorption on the newly formed alumina interlayer.

  2. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik;

    2001-01-01

    Simian immunodeficiency viruses (SIV) harbor primer binding sites (PBS) matching tRNA or tRNA. To study determinants of primer usage in SIV, a SIVmac239-based vector was impaired by mutating the PBS to a sequence (PBS-X2) with no match to any tRNA. By cotransfection of a synthetic gene encoding a tRNA...... could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold......(Pro)-like RNA with a match to PBS-X2, the activity of this vector could be restored to a transduction efficiency slightly lower than that of the wild-type vector. A vector with a PBS matching tRNA(Pro) was functional at a level slightly below that of the wild-type vector, but higher transduction efficiency...

  3. Oligonucleotide primers for targeted amplification of single-copy nuclear genes in apocritan Hymenoptera.

    Directory of Open Access Journals (Sweden)

    Gerrit Hartig

    Full Text Available BACKGROUND: Published nucleotide sequence data from the mega-diverse insect order Hymenoptera (sawflies, bees, wasps, and ants are taxonomically scattered and still inadequate for reconstructing a well-supported phylogenetic tree for the order. The analysis of comprehensive multiple gene data sets obtained via targeted PCR could provide a cost-effective solution to this problem. However, oligonucleotide primers for PCR amplification of nuclear genes across a wide range of hymenopteran species are still scarce. FINDINGS: Here we present a suite of degenerate oligonucleotide primer pairs for PCR amplification of 154 single-copy nuclear protein-coding genes from Hymenoptera. These primers were inferred from genome sequence data from nine Hymenoptera (seven species of ants, the honeybee, and the parasitoid wasp Nasonia vitripennis. We empirically tested a randomly chosen subset of these primer pairs for amplifying target genes from six Hymenoptera, representing the families Chrysididae, Crabronidae, Gasteruptiidae, Leucospidae, Pompilidae, and Stephanidae. Based on our results, we estimate that these primers are suitable for studying a large number of nuclear genes across a wide range of apocritan Hymenoptera (i.e., all hymenopterans with a wasp-waist and of aculeate Hymenoptera in particular (i.e., apocritan wasps with stingers. CONCLUSIONS: The amplified nucleotide sequences are (a with high probability from single-copy genes, (b easily generated at low financial costs, especially when compared to phylogenomic approaches, (c easily sequenced by means of an additionally provided set of sequencing primers, and (d suitable to address a wide range of phylogenetic questions and to aid rapid species identification via barcoding, as many amplicons contain both exonic and fast-evolving intronic nucleotides.

  4. Design and implementation of degenerate microsatellite primers for the mammalian clade.

    Directory of Open Access Journals (Sweden)

    Emmanuel Buschiazzo

    Full Text Available Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1 identify conserved microsatellite loci from a multiple genome alignments, (2 design degenerate primer pairs, with (3 a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ~1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120-160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced.

  5. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  6. Aussprache als motorische Fertigkeit

    DEFF Research Database (Denmark)

    Bonner, Maria

    2013-01-01

    Authentische Aussprache gilt im Fremdsprachenunterricht als schwer erreichbares Ziel, fremdsprachlicher Akzent wird als nahezu unvermeidbar gesehen. Weder die Hypothese einer kritischen Periode für den Erwerb einer authentischen Aussprache noch das Konzept der Fossilierung im Sprachlernprozess...

  7. Amyotrophic Lateral Sclerosis (ALS)

    Science.gov (United States)

    ... ALS Neurons' broken machinery piles up in ALS Esclerosis Lateral Amiotrófica Dormant viral genes may awaken to ... Dementia Information Page Multifocal Motor Neuropathy Information Page Multiple Sclerosis Information Page Muscular Dystrophy Information Page Myasthenia ...

  8. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    OpenAIRE

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka

    2016-01-01

    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera , including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera . We feel that a PCR-based approach still has its place in m...

  9. Joint DoD Demonstration And Validation Of Magnesium-Rich Primer Coating Technology

    Science.gov (United States)

    2012-01-01

    AAC-K16 .. K18 896-AAC-D19 .. D21 896-AAC-X22 .. X24 Deft 02-Y-40 ANAC Aerodur 5000 MEK Wipe Brulin GD815 Butyl Alcohol 35% IPA 25% Phosphoric Acid ...Joint DoD Demonstration and Validation of Magnesium -Rich Primer Coating Technology ESTCP Project WP-0731 Dr. Craig J. Price Rachel M...Validation of Magnesium -Rich Primer Coating Technology 5a. CONTRACT NUMBER 5b. GRANT NUMBER WP-0731 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S

  10. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X;

    2013-01-01

    NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy......The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au...

  11. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.;

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted...

  12. El arte de cozina de Diego Granado (1599), primer libro de cocina en lengua castellana

    OpenAIRE

    Redondo Buey, Patricia

    2014-01-01

    El Siglo de Oro es un periodo histórico que abarca desde el Renacimiento del siglo XVI hasta el Barroco del siglo XVII, durante el cual se publicó el primer tratado gastronómico de España. En este trabajo científico haremos un estudio meticuloso y minucioso sobre lo que se considera el primer recetario del Siglo de Oro español y así analizar las fuentes primarias de la cocina española, cosa que nunca se había hecho.

  13. Development of species-specific primers for detection of Streptococcus mutans in mixed bacterial samples

    OpenAIRE

    Chen, Zhou; Saxena, Deepak; Caufield, Page W.; Ge, Yao; Wang, Minqi; Li, Yihong

    2007-01-01

    Streptococcus mutans is the major microbial pathogen associated with dental caries in children. The objectives of this study were to design and evaluate species-specific primers for the identification of S. mutans. Validation of the best primer set, Sm479F/R, was performed using 7 S. mutans reference strains, 48 ATCC non-S. mutans strains, 92 S. mutans clinical isolates, DNA samples of S. mutans-S. sobrinus or S. mutans-S. sanguinis, and mixed bacterial DNA of saliva samples from 33 18-month-...

  14. Bayesian networks for fMRI: a primer.

    Science.gov (United States)

    Mumford, Jeanette A; Ramsey, Joseph D

    2014-02-01

    Bayesian network analysis is an attractive approach for studying the functional integration of brain networks, as it includes both the locations of connections between regions of the brain (functional connectivity) and more importantly the direction of the causal relationship between the regions (directed functional connectivity). Further, these approaches are more attractive than other functional connectivity analyses in that they can often operate on larger sets of nodes and run searches over a wide range of candidate networks. An important study by Smith et al. (2011) illustrated that many Bayesian network approaches did not perform well in identifying the directionality of connections in simulated single-subject data. Since then, new Bayesian network approaches have been developed that have overcome the failures in the Smith work. Additionally, an important discovery was made that shows a preprocessing step used in the Smith data puts some of the Bayesian network methods at a disadvantage. This work provides a review of Bayesian network analyses, focusing on the methods used in the Smith work as well as methods developed since 2011 that have improved estimation performance. Importantly, only approaches that have been specifically designed for fMRI data perform well, as they have been tailored to meet the challenges of fMRI data. Although this work does not suggest a single best model, it describes the class of models that perform best and highlights the features of these models that allow them to perform well on fMRI data. Specifically, methods that rely on non-Gaussianity to direct causal relationships in the network perform well.

  15. El deber constitucional de contribuir al sostenimiento de los gastos públicos

    OpenAIRE

    Pauner Chulvi, Cristina

    2000-01-01

    La tesis doctoral se consagra al estudio del artículo 31.1 de la Constitución española que establece el deber de todos de contribuir al sostenimiento de los gastos públicos. La obra se estructura en cuatro capítulos. En el primero de ellos, se reflexiona acerca del concepto, naturaleza, eficacia y fundamento de la categoría jurídica del deber constitucional. Tras este primer capítulo, se propone un segundo capítulo consagrado al estudio concreto del deber tributario abordándose la problemátic...

  16. Jim Jarmusch: Del "insomnio americano" al "insomnio universal" (1980-1991)

    OpenAIRE

    Ródenas, G. (Gabri)

    2010-01-01

    El presente texto aborda el tránsito del análisis del “insomnio americano” al estudio del “insomnio universal” dentro del primer período de la filmografía del director norteamericano Jim Jarmusch. El insomnio americano debe ser entendido como la crítica al sueño americano y al American Way of Life tal y como se representó, sobre todo, en el cine hegemónico de los años 80. Jarmusch lleva a cabo dicha crítica tanto en el plano formal como por lo que respecta ...

  17. Egg retention and intrauterine embryonic development in Sceloporus aeneus (Reptilia: Phrynosomatidae: implications for the evolution of viviparity Retención de huevos y avance embrionario intrauterino en Sceloporus aeneus (Reptilia: Phrynosomatidae: implicaciones para la evolución de la viviparidad

    Directory of Open Access Journals (Sweden)

    Rodolfo García-Collazo

    2012-09-01

    Full Text Available Egg retention (ER and intrauterine embryonic development (IED have been considered intermediate steps in the evolution from oviparity to viviparity. Sceloporus aeneus is an oviparous lizard that is closely related to the viviparous species (Sceloporus bicanthalis. The present study addresses the following 2 questions: 1 Are intermediate stages of egg retention (ER and IED present in populations of Sceloporus aeneus? and 2 Are ER and/or IED explained by elevation, precipitation or phylogenetic effects? Results indicate that in S. aeneus, ER differs among populations. ER was negatively related to altitude and pluvial precipitation, whereas average environmental temperature had no effect on ER or IER. In contrast to previous observations of oviparous species related to viviparous species, populations of S. aeneus with advanced IED are associated with environmental factors such as low elevation and aridity instead of high elevation and cold climate, whereas the comparative analysis shows that there are no significative evolutionary changes throughout the phylogeny, which means that the altitude has no effect on the transition to the evolution of viviparity in S. aeneus-S bicanthalis.La retención de huevos (ER y el desarrollo embrionario intrauterino (IED han sido considerados pasos intermedios hacia la viviparidad. Sceloporus aeneus es un lacertilio ovíparo estrechamente relacionado a una especie vivípara (Sceloporus bicanthalis. El presente estudio derivó de las preguntas: ¿El ER y el IED presentes en las poblaciones de S. aeneus son estadios intermedios a la viviparidad? ¿ER y/o IED son explicados por la temperatura, altitud, precipitación pluvial o son un efecto filogenético? En S. aeneus, el ER y el IED fueron diferentes entre poblaciones. Los resultados indicaron que la ER se relacionó negativamente con la altitud y la precipitación pluvial, mientras que no se encontró efecto con la temperatura ambiental. En contraste con

  18. Contribución al Estudio de las Moscas Anastrephas en Colombia.

    Directory of Open Access Journals (Sweden)

    González Mendoza Rafael

    1952-11-01

    como oriunda del Brasil, es decir una especie enteramente tropical. 8. Dentro de los dípteros, las moscas del género Anastrepha se pueden clasificar como suborden Cyclorrapha, serie Schyzophora, sección Myodaria, subsección Acalyptratae, familia Trypetidae. 9. Las moscas Anastrephas cumplen su ciclo biológico al través de 4 estados metamorfósicos que ocurren así: imago en el ambiente aéreo, huevo y larva en la fruta y pupa en el suelo. En cada uno de los estados metamorfósicos, el insecto exhibe las características comunes de los dípteros. 10. Los huevos miden l , mm.; son de forma ovalada y ápices un tanto agudos, de color blancuzco ligeramente cremoso. La incubación demora de 4 a 7 días; el número de huevos por postura es de 3 y hasta l. La incubación de los huevos y la vida de la larva recién nacida son afectados por temperatura, humedad y determinados factores resultantes de la condición de madurez de la fruta. 11. Las larvas son vermiformes, puntiagudas en la cabeza, de color amarillo crema claro en tonalidades diversas hasta blanquecino o cremoso. No poseen patas; no tienen ojos ni antenas. Su tamaño y la duración del período larvario varían con la temperatura, la humedad, y diversas condiciones de la fruta en cuanto a cantidad de material parásito, acidez, estado de madurez, etc. El número de larvas puede ser de 1 a 3 por fruta y hasta cifras muy elevadas como 72, según la población de moscas y la clase de fruta. Las larvas adquieren su desarrollo completo entre tres estadios y dos "écdicis". 12. Las pupas son ovaladas como una barrilito; miden de 3 a 7 mm, de largo x 1 1⁄2 a 21⁄2 de ancho. Son de color castaño claro en tonalidades hasta el tabaco oscuro. La duración del período de pupa, así como diferentes hechos relacionados con el estado, sufren variaciones debidas a temperatura, humedad, acidez, soltura y textura del suelo, que es el medio donde normalmente ocurre el empupamiento. 13. El estado

  19. Nutrición y desarrollo psicomotor durante el primer semestre de vida Nutrition and psichomotor development during the first six months of life

    Directory of Open Access Journals (Sweden)

    ADOLFO CHÁVEZ

    1998-03-01

    Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.Objective. To study the psychomotor development of young infants from a poor and underfed rural community and to correlate this with the nutritional conditions of the mother during pregnancy and the child itself. Material and methods. We studied 82 mother-child pairs from the 5th month of pregnancy to the 6th month of life of the child as to anthropometry and food consumption. The neonatal Brazelton test and the Bayley test at 3 and 6 months were applied to the child. Results. Several of the neonatal psychomotor tests applied to the child correlate positively with the mother

  20. Susceptibilidad de genotipos de Solanum spp. al nematodo causante del nudo radical Meloidogyne spp. (chitwood

    Directory of Open Access Journals (Sweden)

    Gelpud Chaves Cristian

    2011-03-01

    Full Text Available

    El cultivo del lulo (Solanum quitoense L. presenta una disminución en su productividad, debido al ataque de patógenos como el nematodo del nudo radical Meloidogyne  spp., en el Departamento  de Nariño (Colombia, se han reportado incidencias cercanas al 79%, y pérdidas del 50%.   En la presente investigación, se colectaron 45 genotipos de (Solanum quitoense  L. en los Departamentos  de Nariño  y Putumayo  y 4 genotipos  silvestres  (S. mammosum, S. hirtum,       S. marginatum  y S. umbellatum buscando fuentes de resistencia al nematodo. Se inocularon 9 plantas de cada genotipo de dos meses de edad con 10000 huevos de Meloidogyne spp., dejando tres testigos por cada material. Las variables evaluadas fueron: altura de planta, severidad, incidencia, peso fresco (tallo y raíz y especies prevalentes de Meloidogyne spp. Se hizo una clasificación de genotipos mediante escala de resistencia y regresión entre la severidad y las demás variables para establecer el efecto de Meloidogyne spp. sobre los genotipos de planta. Los resultados mostraron 100% de incidencia del nematodo en  todos  los  genotipos,  2.04%  genotipos  resistentes,  34.7%  moderadamente  resistentes, 42.8% moderadamente susceptibles, 18.3% susceptibles, y 2.04% altamente susceptibles. El genotipo SQbr05 resistente, no se vio afectado por la severidad, al contrario SQbc04 genotipo susceptible, mostró reducciones significativas en peso fresco de tallo y raIz, (R2 = 0.71 y 0.98,el genotipo silvestre (S. mammosum es altamente susceptible, Meloidogyne incognita presentó 55.31% de presencia. El genotipo SQbr05 es promisorio para ser evaluado en campo.

  1. Tensiones, genealogías y feminismos en los 80: Un acercamiento a alfonsina, primer periódico para mujeres

    Directory of Open Access Journals (Sweden)

    Tania Diz

    2011-09-01

    Full Text Available En este trabajo se realiza un análisis de la publicación feminista alfonsina que se publicó en el período posdictadura 83-84, en Buenos Aires. En primer lugar, se ubica al periódico diacrónica y sincrónicamente. Es decir que, por un lado, se ubica al periódico en una tradición de publicaciones feministas argentinas que se remonta al siglo XIX. Y, por otro, se analiza la influencia del feminismo de la diferencia en la publicación, así como se destaca que su condición marginal no suponía falta de actualidad intelectual ni política. En segundo lugar, se analiza, respecto al nombre de la publicación, su evidente alusión a la poeta Alfonsina Storni con la hipótesis de que el periódico es absolutamente original porque rescata una faceta no demasiado conocida de la escritora: su posición feminista, con lo cual la publicación contribuye a destruir el mito que ha encorsetado a Storni. Por último, se analiza el uso de ciertas estrategias disruptoras de las subjetividades sexuadas hegemónicas propias de la escritura periodística de Storni en dos periodistas-escritores de la publicación: María Moreno y Néstor Perlongher.

  2. Primer peronismo y subjetividad política en Santiago del Estero. Apuntes para nuevas lecturas extracéntricas

    Directory of Open Access Journals (Sweden)

    Mercedes Vargas

    2013-12-01

    Full Text Available El siguiente trabajo se propone una revisión crítica de algunos antecedentes canónicos sobre el primer peronismo. A partir de estas lecturas nos interesa avanzar en el estudio del proceso de identificación del peronismo en el sujeto popular de la provincia de Santiago del Estero. Para ello, tomaremos algunos aportes que nos permiten hipotetizar cuales fueron los elementos del discurso peronista que jugaron en la fuerte identificación suscitada en sectores populares. A partir de las cartas, poesías y solicitudes enviadas a la presidencia, intentaremos re-pensar algunas dimensiones que, consideramos, intervienen en la configuración de una subjetividad política y que no han sido contempladas hasta ahora por los estudios sobre peronismo. El principal aporte que brinda nuestro trabajo es abrir a nuevos abordajes extracéntricos, que permitan delinear los caminos posibles para una elaboración teórica más rigurosa en torno al sujeto político (peronista considerando que lo anterior implica: por un lado, pensar la subjetividad desde abajo. Por otro lado, requiere considerar la diversidad de aristas que se inscriben en la constitución de una subjetividad política, evitando caer en las clásicas dicotomías que han dominado las lecturas canónicas del peronismo en particular y de las ciencias sociales en general.

  3. En pos del "buen lector" : censura editorial y clases populares durante el primer franquismo (1939-1945

    Directory of Open Access Journals (Sweden)

    Eduardo Ruiz Bautista

    2004-01-01

    Full Text Available El artículo trata de analizar la censura de libros durante el primer franquismo desde un punto de vista sociocultural que apenas ha sido contemplado. Por un lado, se muestra cómo la censura impidió que determinadas obras cultas llegasen al lector popular, dificultando las ediciones asequibles o restringiéndolas directamente a eruditos. Por el otro, da cuenta de la dura represión de las lecturas populares sufrieron en nombre de la infancia, pese a que las motivaciones reales deban buscarse en el enfrentamiento entre lo culto y lo popular.The article tries to analyze the censorship of books during the first franquism from a sociocultural point of view that has been scarcely contemplated. In one hand, it shows how the censorship prevented the popular reader from getting learned works by obstructing cheap editions or by restricting them directly to scholars. In the other one, it shows the hard repression of the popular readings in the ñame of the infancy, although real motivations should be looked in the clash between the educated culture and the popular one.

  4. SCORE TEST PARA EL EFECTO DEL COEFICIENTE DE SOLAPAMIENTO EN MODELOS DE SUPERFICIES DE RESPUESTA DE PRIMER Y SEGUNDO ORDEN

    Directory of Open Access Journals (Sweden)

    ENRIQUE DARGHAN

    2011-01-01

    Full Text Available En este artículo ha sido propuesto un test para el coeficiente de solapamiento para el modelo de Draper y Guttman utilizando modelos de superficies de respuesta de primer y segundo orden. El test está basado en el test de score de Rao y hace uso de la teoría de operadores de proyección perpendicular. El test puede utilizarse en diferentes patrones de vecindad siempre y cuando se considere al vecino más cercano como la unidad experimental directamente afectada por los tratamientos y los modelos de la superficie sean de primero y segundo orden. El método es simple de adoptar y puede implementarse en el campo de la agronomía o en la investigación de mercados, pues su naturaleza asintótica está en concordancia con el gran número de unidades experimentales generalmente presentes en este tipo de investigaciones.

  5. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  6. ANALISIS PRODUCT MAPPING DAYA SAING EKSPOR PRODUK PRIMER INDONESIA DAN CHINA

    Directory of Open Access Journals (Sweden)

    Sulthon Sjahril Sabaruddin

    2015-11-01

    Full Text Available This research attempts to analyze the mapping competition of the Indonesian and Chinese primary products in order to identify and map the strengths and weaknesses of Indonesian products vis-à-vis China. To examine this, the study uses tools such as the SMART Model (Software for Market Analysis and Restrictions on Trade, Social Accounting Matrix 2008 (SAM 2008, Normalized Revealed Comparative Advantage (NRCA and the Product Mapping. The results of the competition analysis found that Indonesia which rely on the export of primary products, in overall it is predicted to win the competition against China as the Indonesian primary products have better competitiveness than China. However, in the future, the competition will be fiercer, therefore, Indonesia should make efforts to improve further the competitiveness of Indonesian exports. Penelitian ini dimaksudkan untuk mengevaluasi peta persaingan produk primer Indonesia dan China guna mengidentifikasi dan memetakan kekuatan dan kelemahan produk Indonesia dalam persaingan dengan produk-produk primer asal China. Guna menelaah studi ini, beberapa perangkat dimanfaatkan yakni SMART Model (Software for Market Analysis and Restrictions on Trade, Sistem Neraca Sosial Ekonomi 2008 (SNSE 2008, Normalized Revealed Comparative Advantage (NRCA dan Product Mapping. Hasil analisis peta persaingan kedua negara, Indonesia yang mengandalkan ekspor produk primer diperkirakan secara keseluruhan unggul dibandingkan produk primer dari China karena Indonesia memiliki daya saing yang lebih baik dibandingkan China. Namun demikian, perlu diperhatikan bahwa persaingan ke depan akan berlangsung semakin ketat, oleh karena itu Indonesia perlu melakukan upaya untuk meningkatkan daya saing ekspor Indonesia.

  7. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  8. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  9. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.

    Science.gov (United States)

    Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I

    2016-09-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.

  10. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  11. Primer registro de Tiaris fuliginosa (Wied, 1830) para la Argentina

    OpenAIRE

    Mazar Barnett, Juan; Herrera, Justo

    1996-01-01

    El primer registro de Argentina de Tiaris fuliginosa , basado en dos pájaros encontrados en el Parque Nacional Iguazú. The first record for Argentina of the Sooty Grassquit ( Tiaris fuliginosa ) is given, based on two birds notted at Iguazú National Park.

  12. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used par

  13. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  14. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    2014-01-01

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future effo

  15. Primer Sets Developed for Functional Genes Reveal Shifts in Functionality of Fungal Community in Soils

    NARCIS (Netherlands)

    Hannula, S.E.; van Veen, J.A.

    2016-01-01

    Phylogenetic diversity of soil microbes is a hot topic at the moment. However, the molecular tools for the assessment of functional diversity in the fungal community are less developed than tools based on genes encoding the ribosomal operon. Here 20 sets of primers targeting genes involved mainly in

  16. Shortening distance of forward and reverse primers for nucleic acid isothermal amplification.

    Science.gov (United States)

    Haitao, Qu; Wenchao, Zhang; Xiaohui, Zhang; Xiujun, Wang; Sulong, Li

    2014-06-01

    Existent nucleic acid isothermal detection techniques for clinical diseases are difficult to promote greatly due to limitations in such aspects as methodology, costs of detection, amplification efficiency and conditions for operation. There is therefore an urgent need for a new isothermal amplification method with the characteristics of high accuracy, easy operation, short time of detection and low costs. We have devised a new method of nucleic acid isothermal amplification using Bst DNA polymerase under isothermal conditions (60-65°C). We call this method of amplification by shortening the distance between forward and reverse primers for nucleic acid isothermal amplification SDAMP. The results demonstrated that this technique is highly sensitive, specific and has short reaction times (40-60 min). Results of sequencing show that the products of SDAMP amplification are mainly polymers formed by series connection of monomers formed through linkage of forward primer and complementary sequences in reverse primer via a few bases. The method is different from current methods of nucleic acid amplification. Our study shows, however, that it is a specific method of nucleic acid isothermal amplification depending on interactions between primers and DNA template.

  17. Ecophysiological, ecological, and soil processes in terrestrial ecosystems: a primer on general concepts and relationships

    NARCIS (Netherlands)

    Kirschbaum, M.U.F.; Bullock, P.; Evans, J.R.; Goulding, K.; Jarvis, P.G.; Noble, I.R.; Rounsevell, M.; Sharkey, T.D.; Austin, M.P.; Brookes, P.; Brown, S.; Bugmann, H.K.M.; Cramer, W.P.; Diaz, S.; Gitay, H.; Hamburg, S.P.; Harris, J.

    1996-01-01

    This ecophysiological primer serves as an introductory chapter on the concepts applied in subsequent chapters reviewing the state of knowledge concerning the effects of climate change on ecological processes that affect impacts on terrestrial ecosystems and some socio-economic systems. Because many

  18. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  19. Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii.

    Science.gov (United States)

    Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon; Lee, Jae-Dong

    2005-06-01

    Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species.

  20. TM7 detection in human microbiome: are PCR primers and FISH probes specific enough?

    Science.gov (United States)

    Sizova, Maria V.; Doerfert, Sebastian N.; Gavrish, Ekaterina; Epstein, Slava S.

    2015-01-01

    TM7 appears important and omnipresent because it is repeatedly detected by molecular techniques in diverse environments. Here we report that most of primers and FISH probes thought to be TM7-specific do hybridize with multiple species from oral and vaginal cavity. This calls for re-examination of TM7 distribution and abundance. PMID:25957511

  1. Experimental Studies of the Number 41 Primer and Ignition 5.56-mm Ammunition

    Science.gov (United States)

    2006-09-01

    caliber primers are lead styphnate , barium nitrate, and antimony sulfide, Sb2S3. Lesser amounts of aluminum powder, tetracene, and...this particle, which apparently did not melt, consists primarily of Barium . ...........................................................14 Figure 17...15 Figure 21. Reference spectrum of barium nitrate (top) compared to a spectrum representative (**splat) of many residual particles from

  2. Sequence alignment status and amplicon size difference affecting EST-SSR primer performance and polymorphism

    Science.gov (United States)

    Little attention has been given to failed, poorly-performing, and non-polymorphic expressed sequence tag (EST) simple sequence repeat (SSR) primers. This is due in part to a lack of interest and value in reporting them but also because of the difficulty in addressing the causes of failure on a prime...

  3. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  4. Facebook targeted advertisement for research recruitment: A primer for nurse researchers.

    Science.gov (United States)

    Carter-Harris, Lisa

    2016-11-01

    Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment.

  5. Screening for the familial defective apolipoprotein B-100 R3500W by mutagenic primers PCR

    Institute of Scientific and Technical Information of China (English)

    冯纪安; 冯铮

    2002-01-01

    Objective A method combining the mutagenic primers PCR and restriction enzyme digestion was designed to facilitate the detection of gene mutation in familial defective apolipoprotein B-1O0 R3500W. Methods A pair of primer was designed and a mismatch nucleotide was introduced in its upstream primer. A segment of target DNA including the possibly mutated nucleotide was amplified by PCR and the products were digested by restriction enzyme Nco 1. To overcome the potential false negative results due to improper digestion conditions, a segment of DNA with Ncol cut size was added as reference.Results The target sequence was successfully amplified by PCR, producing a 144 bp DNA fragment as expected. When incubated with Ncol, the enzyme could digest the DNA, producing a 114 bp segment,only if it was amplified from the mutated gene, but not from the normal allele. This difference in length of DNA could be separated by electrophoresis on a 2 %agarose gel. Thus we successfully detected two carriers of heterozygous FDB R3500W in 162 hypercholesterolemic patients. Conclusions Mutagenic primers PCR can be used to detect the gene mutation of apo B-100 R3500W, two cases were detected among 162patients with hypercholesterolemia. It suggests that this mutation is not rare in mainland China.

  6. Primer Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition

    Science.gov (United States)

    2015-09-01

    ARL-TR-7479 ● SEP 2015 US Army Research Laboratory Primer Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition...Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition by John J Ritter and Richard A Beyer Weapons and Materials Research...

  7. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  8. The astrobiology primer: an outline of general knowledge--version 1, 2006.

    Science.gov (United States)

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  9. Percepción de los estudiantes de enfermería en cuanto al comportamiento de fumar en México

    OpenAIRE

    Francisco Cruz Vazquez; Sandra Cristina Pillon; Maria Teresa Cuamatzi

    2004-01-01

    El estudio tiene como objetivo evaluar el comportamiento de fumar y la percepción de los factores que influeyen en ese comportamiento, entre estudiantes del primer año de Licenciatura en enfermería. Fueron entrevistado 36 alumnos del primer año de graduación en enfermería. Siendo 18 (50%) fumadores, con edad media de 23,5 años; 75% del sexo femenino en cuanto al patron de consumo estos fuman de 2 a 6 cigarrillos al dia, empezaron a fumar en media con 15 años. En cuanto a la per...

  10. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  11. Shear Bond Strength of Al2O3 Sandblasted Y-TZP Ceramic to the Orthodontic Metal Bracket

    Directory of Open Access Journals (Sweden)

    Seon Mi Byeon

    2017-02-01

    Full Text Available As the proportion of adult orthodontic treatment increases, mainly for aesthetic reasons, orthodontic brackets are directly attached to yttria-stabilized tetragonal zirconia polycrystal (Y-TZP restorations. This, study analyzed the shear bond strength (SBS between various surface treated Y-TZP and orthodontic metal brackets. The Y-TZP specimens were conditioned by 110 μm Al2O3 sandblasting, or sandblasting followed by coating with one of the primers (silane, MDP, or an MDP-containing silane primer. After surface treatment, the orthodontic metal bracket was bonded to the specimen using a resin cement, and then 24 h storage in water and thermal cycling (5000 cycles, 5–55 °C, SBS was measured. Surface roughness was analyzed for surface morphology, and X-ray photoelectron spectroscopy (XPS was employed for characterization of the chemical bond between the Y-TZP and the MDP-based primers (MDP, MDP containing silane primer. It was found that after surface treatment, the surface roughness of all groups increased. The groups treated with 110 μm Al2O3 sandblasting and MDP, or MDP-containing silane primer showed the highest SBS values, at 11.92 ± 1.51 MPa and 13.36 ± 2.31 MPa, respectively. The SBS values significantly decreased in all the groups after thermal cycling. Results from XPS analysis demonstrated the presence of chemical bonds between Y-TZP and MDP. Thus, the application of MDP-based primers after Al2O3 sandblasting enhances the resin bond strength between Y-TZP and the orthodontic metal bracket. However, bonding durability of all the surface-treated groups decreased after thermal cycling.

  12. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  13. Design of phylum-specific hybrid primers for DNA barcoding: addressing the need for efficient COI amplification in the Echinodermata.

    Science.gov (United States)

    Hoareau, T B; Boissin, E

    2010-11-01

    Recent research has shown the usefulness of the Folmer region of the cytochrome oxidase I (COI) as a genetic barcode to assist in species delimitation of echinoderms. However, amplification of COI is often challenging in echinoderms (low success or pseudogenes). We present a method that allows the design of phylum-specific hybrid primers, and use this to develop COI primers for the Echinodermata. We aligned COI sequences from 310 echinoderm species and designed all possible primers along the consensus sequence with two methods (standard degenerate and hybrid). We found much lower degeneracy for hybrid primers (4-fold degeneracy) than for standard degenerate primers (≥48-fold degeneracy). We then designed the most conserved hybrid primers to amplify a >500-bp region within COI. These primers successfully amplified this gene region in all tested taxa (123 species across all echinoderm classes). Sequencing of 30 species among these confirmed both the quality of the sequences (>500 bp, no pseudogenes) and their utility as a DNA barcode. This method should be useful for developing primers for other mitochondrial genes and other phyla. The method will also be of interest for the development of future projects involving both community-based genetic assessments on macroorganisms and biodiversity assessment of environmental samples using high-throughput sequencing.

  14. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  15. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    Science.gov (United States)

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  16. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  17. A degenerate pair of primers for simultaneous detection of four alpha- and betanecroviruses.

    Science.gov (United States)

    Varanda, C M R; Cardoso, J M S; Oliveira, M D M; Oliveira, S; Clara, M I E; Félix, M R F

    2014-11-01

    The high infection levels due to Olive latent virus 1 (OLV-1), Olive mild mosaic virus (OMMV) (alphanecrovirus) and Tobacco necrosis virus D (TNV-D) (betanecrovirus) in Portuguese olive orchards prompted us to develop a rapid PCR-based assay for the simultaneous detection of these viruses aimed at the sanitary selection and marketing of plant material in compliance with European Union regulations. A pair of degenerate oligonucleotide primers, parRdRp5' and parCoat3' was designed based on conserved regions located in the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) genes of these viruses and one other alphanecrovirus, Tobacco necrosis virus A. Its use in RT-PCR assays generated a product of ca. 2000 bp for the 4 viral species tested. These primers were compared with virus specific primers in multiplex RT-PCR, and identical results were obtained. Its application to dsRNA extracted from 54 olive field growing trees originated the expected ca. 2000 bp amplicon in 17 trees. The virus identity was determined by sequencing the cloned RT-PCR products. No TNV-A was found. The RT-PCR assay using the degenerate primers described in this study were shown to be reliable in detecting any of the above-mentioned alpha- and betanecroviruses, and it is as sensitive as that which uses virus specific primers in multiplex assays. Therefore, this assay is well suited for the rapid screen of virus-free plant material in selection and improvement crop programmes. Additionally, it has the potential to reveal virus diversity and the presence of new viruses, provided the RT-PCR generated amplicon is further sequenced.

  18. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Institute of Scientific and Technical Information of China (English)

    Jun-Wen Li; Xin-Wei Wang; Chang-Qing Yuan; Jin-Lai Zheng; Min Jin; Nong Song; Xiu-Quan Shi; Fu-Huan Chao

    2002-01-01

    AIM: To develop a rapid detection method ofenteroviruses and Hepatitis A virus (HAV).METHODS: A one-step, single-tube consensus primersmultiplex RT-PCR was developed to simultaneouslydetect Poliovirus, Coxsackie virus, Echovirus and HAV.A general upstream primer and a HAV primer and fourdifferent sets of primers (5 primers) specific forPoliovirus, Coxsacki evirus, Echovirus and HAV cDNAwere mixed in the PCR mixture to reverse transcriptand amplify the target DNA.Four distinct amplified DNAsegments representing Poliovirus, Coxsackie virus,Echovirus and HAV were identified by gelelectrophoresis as 589-,671-, 1084-, and 1128bpsequences, respectively. Semi-nested PCR was used toconfirm the amplified products for each enterovirus andHAV.RESULTS: All four kinds of viral genome RNA weredetected, and producing four bands which could bedifferentiated by the band size on the gel.To confirmthe specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strainstested gave positive results .The detection sensitivityof multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU forCoxsackie virus,60 PFU for Echovirus and 105 TCID50for HAV. The minimum amount of enteric viral RNAdetected by semi-nested PCR was equivalent to 2.4 PFUfor Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU forEchovirus and 10.5 TCID50 for HAV.CONCLUSION: The consensus primers multiplex RT-PCRhas more advantages over monoplex RT-PCR for entericviruses detection, namely, the rapid turnaround timeand cost effectiveness.

  19. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    Science.gov (United States)

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  20. Estudio de las preocupaciones asociadas al embarazo en un grupo de embarazadas primigestas chilenas

    Directory of Open Access Journals (Sweden)

    Chamarrita Farkas

    2008-05-01

    Full Text Available Este artículo se centra en la identificación de las preocupaciones y temores que surgen en el período del primer embarazo. Se utiliza una metodología cualitativa, con un diseño transversal, exploratorio y descriptivo. La muestra se compone de 17 embarazadas primigestas de 19 a 40 años y nivel socio-económico medio, que asistieron a dos talleres de “Promoción del primer vínculo” con una frecuencia semanal durante 6 semanas. A partir de las transcripciones de las sesiones, se identificaron y construyeron categorías de respuesta asociadas a temores y preocupaciones de esta etapa. Los resultados se presentan considerando los temores y preocupaciones asociados al embarazo, al parto y a la primera etapa de la maternidad.