WorldWideScience

Sample records for al primer huevo

  1. Huevo, larva en primer estadio y aparato genital femenino de la mariposa Chabuata castanea (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Marcela A Rodríguez

    2007-06-01

    Full Text Available Se describe el huevo, larva de primer estadio y aparato genital de la hembra de Chabuata castanea con material proveniente de Talcahuano, VIII región, Chile y de huevos obtenidos en laboratorio. Se fotografiaron los huevos con microscopia electrónica de barrido para analizar las variaciones entre micropila, celdas primarias y secundarias, concluyéndose que las diferencias permiten una identificación al nivel de especie.Egg, first larval stage and female genitalia of the moth Chabuata castanea (Lepidoptera: Noctuidae. Egg, first larval stage, and female genitalia of the widely distributed moth Chabuata castanea are described, based on material from Talcahuano, VIII region, Chile. Egg microestructures are illustrated with scannig electron microscope images which show that egg morphology allows identification to species level. Rev. Biol. Trop. 55 (2: 659-664. Epub 2007 June, 29.

  2. Alérgenos del huevo: digestión gastrointestinal, inmunorreactividad y mecanismos de desensibilización

    OpenAIRE

    Martos, Gustavo

    2012-01-01

    La alergia al huevo es una de las causas más frecuentes de hipersensibilidad inmediata a los alimentos en los países industrializados, sobre todo durante la infancia. La ubicuidad del huevo en los alimentos supone un gran riesgo de ingestión accidental para las personas alérgicas, que deben llevar una dieta muy restringida. En la presente Tesis Doctoral, se estudia la digestibilidad de distintos alérgenos del huevo empleando un modelo in vitro de digestión gastrointestinal fisiológicamente re...

  3. Reproducción y ultraestructura del huevo y larva de primer estadio de Gyriosomus kingi (Coleoptera: Tenebrionidae del desierto de Atacama

    Directory of Open Access Journals (Sweden)

    Jaime Pizarro-Araya

    2007-06-01

    Full Text Available Gyriosomus es un importante género chileno de Tenebrionidae, habitante del desierto costero del país. En este ambiente, las especies de Gyriosomus son un componente erémico y endémico de la entomofauna epígea. A pesar de la importancia ecológica que estas especies tienen en el desierto chileno, poco se conoce respecto de la morfología de los estados preimaginales. En este trabajo se describe la morfología del huevo y de la larva de primer estadio de G. kingi Reed, 1873, y se entregan algunos antecedentes acerca de la bionomía de la hembra. Los huevos y las larvas fueron obtenidos a partir de parejas mantenidas en condiciones de laboratorio. Los adultos fueron capturados durante la primavera del año 2002, en sitios costeros del Parque Nacional Llanos de Challe, localizado en la frontera sur del Desierto de Atacama (28°01’S; 71°03’W. El primer tercio del corión del huevo presenta celdas subhexagonales sin aeropilas. La larva es oligópoda y elongada. Su cápsula cefálica está fuertemente quitinizada y sus patas protorácicas son más largas y más gruesas que las restantes. Según observaciones de laboratorio, cada ovipostura incluye de siete a diez huevos cada vez, con un máximo de seis oviposturas por hembra. Los huevos son enterrados en el suelo, recubiertos con un mucílago que genera una película de arena-arcilla adherida al corión.Reproduction and ultrastructure of egg and first instar larvae of Gyriosomus kingi (Coleoptera: Tenebrionidae from the desert of Atacama. Gyriosomus is an important Chilean genus of Tenebrionidae, inhabiting the coastal desert of this country. in this environment, the Gyriosomus-species are both eremic and endemic components of the epigean entomofauna. Despite the ecological importance of these species in the Chilean desert, there is a lack of knowledge on the preimaginal stages of them. in this paper we describe the egg and first instar larval morphology of G. kingi Reed, 1873, along with

  4. Los alérgenos del huevo: cómo son y cómo se comportan

    OpenAIRE

    Molina, Elena; López-Expósito, Iván; Reche, Marta; López-Fandiño, Rosina

    2015-01-01

    A pesar de la gran diversidad de la dieta humana, son pocos los alimentos responsables de la mayoría de las alergias alimentarias. En los niños, por ejemplo, el 80% de los casos se deben a la leche, al huevo y a los cacahuetes. De hecho, ocho tipos de alimentos (leche, huevo, pescado, crustáceos, cacahuetes, otros frutos secos, soja y cereales que contienen gluten) son responsables de más del 90% de las alergias alimentarias mundiales, aunque, al menos, otros 160 alimentos pueden causar aler...

  5. Alergia a la leche y al huevo: diagnóstico, manejo e implicaciones en América Latina

    Directory of Open Access Journals (Sweden)

    Jorge Sánchez

    2014-03-01

    En el presente artículo presentamos una revisión del manejo de la alergia alimentaria a la leche y al huevo útil para el personal de salud de todos los niveles, así como algunas consideraciones de los factores presentes en los países latinoamericanos.

  6. Huevos enriquecidos con omega 3

    OpenAIRE

    Viteri, Evelyn

    2013-01-01

    El presente trabajo es una contribución al estudio de usos de ingredientes no tradicionales; harina de algas, Macrocystis pyrifera, y la inclusión en raciones para aves de postura destinado a aumentar la concentración de omega 3 del huevo. Objetivo: Evaluar en la alimentación de la gallina la inclusión de harina de alga marina Macrocystis pyrifera con el fin de aumentar el valor de omega 3 en el huevo, y el grado de aceptación de un producto elaborado con el mismo en estudiante...

  7. Producción de huevo, calidad del cascarón y rentabilidad en gallinas de primer ciclo con niveles de calcio y fósforo disponible

    Directory of Open Access Journals (Sweden)

    Víctor Manuel Valdés Narváez

    2011-01-01

    Full Text Available Para evaluar el efecto del calcio y fósforo en la calidad del cascarón del huevo se realizó un experimento con 480 gallinas Hy- Line W-36. Se usaron tres niveles de calcio (Ca (3.2, 4.2 y 5.2 % y cuatro de fósforo disponible (Pd (0.15, 0.20, 0.25 y 0.30 %. Se encontró interacción (P<0.05 del Ca y Pd en consumo de alimento (CAL y masa de huevo (MH. Con el nivel de Ca de 5.2 % y de Pd (0.15 % disminuyó el CAL (96.7 g y MH (48.7 g. El porcentaje de postura y MH fueron menores (P<0.05 con 0.15 % que con 0.3 % de Pd. La conversión alimenticia se afectó (P<0.05 por el nivel de Pd, obteniendo la mejor con 0.3 % (1.94, seguida por 0.20 % (1.96, 0.15 % (1.98, y 0.25 % (1.99. El peso del huevo fue mayor (P<0.05 en 0.7 y 0.8 g con 3.2 % que con 4.2 y 5.2 % de Ca, respectivamente. La gravedad específica se mejoró (P<0.05 al incrementar el calcio (1.080 vs 1.081 y 1.082 en la dieta. Se concluye que para buena calidad del cascarón es necesario 4.2 % de Ca, pero se debe incrementar de manera proporcional el fósforo disponible. El nivel de 0.15 % de fósforo disponible no es suficiente para obtener buena producción de huevo y conversión alimenticia.

  8. EFECTO DE DENSIDAD POBLACIONAL DE HUEVOS SOBRE VIABILIDAD Y TIEMPO DE DESARROLLO DE Drosophila melanogaster (DROSOPHILIDAE

    Directory of Open Access Journals (Sweden)

    CRISTIAN FONG

    2008-05-01

    Full Text Available Para estimar el efecto de la densidad poblacional de huevos sobre la viabilidad huevoadulto de Drosophila melanogaster se realizaron tres tratamientos en frascos con medio de cultivo agar-banano: a densidad de 10, 50 y 90 huevos. La variable de respuesta fue la proporción de individuos adultos emergidos desde la aparición del primer imago hasta 15 días después de la siembra. Las viabilidades huevo-adulto promedio fueron 0,320, 0,338 y 0,328 para las densidades de 10, 50 y 90 huevos respectivamente. No se evidenciaron diferencias significativas entre los tres tratamientos (p>0.05. Por lo tanto, no se detectó en este estudio influencia de la densidad poblacional de huevos sobre la viabilidad huevo-adulto. Probablemente debido a que la proporción entre el número de huevos y la cantidad de medio fue suficientemente alta para no generar competencia en otros estadios del desarrollo huevo/adulto.

  9. FACTORES AMBIENTALES QUE AFECTAN LA EDAD AL PRIMER PARTO Y PRIMER INTERVALO DE PARTOS EN VACAS DEL SISTEMA DOBLE PROPOSITO

    Directory of Open Access Journals (Sweden)

    Caty Martínez B

    2009-04-01

    Full Text Available Objetivo. Determinar los factores que influyen en la edad al primer parto (AFC y primer intervalo de parto (PIDP en hembras bovinas bajo el sistema de doble propósito, en la finca “El Rodeo”, municipio de Magangué, Bolívar - Colombia. Materiales y métodos. Se analizaron 379 datos provenientes de los registros productivos entre los años 1993 hasta 2002, usando el programa estadístico GLM del Statistical Analysis System, donde se obtuvieron la media y el error estándar de cada fuente de variación. En el análisis se consideraron los efectos de año de parto, época de parto, edad al primer parto (no se consideró para EPP, sexo de la cría, grupo racial y peso a los 24 meses. Resultados. La media para la EPP y PIDP fue de 38.9 ± 3.9 meses y 469.2 ± 9 días, respectivamente, donde el efecto época de parto, fue significativo para la duración del PIDP. Los efectos sexo de la cría, peso a los 24 meses y época, no fueron significativos sobre la EPP. Los efectos año de parto, edad al primer parto, sexo de la cría, peso a los 24 meses no fueron significativos sobre el PIDP. Conclusiones. La EPP y PIDP fueron afectados por el año y la época de parto, respectivamente.

  10. PATATAS Y HUEVOS OSMÓTICOS

    Directory of Open Access Journals (Sweden)

    Josep Corominas

    2010-01-01

    Full Text Available Para ilustrar el fenómeno de la ósmosis se presentan dos experiencias sencillas que pueden realizarse con materiales cotidianos (patatas, huevos, agua, sal, vinagre..., tanto a nivel cualitativo como cuantitativo.

  11. Respuesta productiva de gallinas semipesadas inducidas al descanso ovárico en diferentes edades

    Directory of Open Access Journals (Sweden)

    Luis Galeano V.

    2012-12-01

    Full Text Available Objetivo. Evaluar el efecto de la inducción al descanso ovárico (DO a diferentes edades sobre la respuesta productiva en aves semipesadas productoras de huevo comercial. Materiales y método. Se usaron 840 aves de la línea Hy Line Brown con 64 semanas de edad, distribuidas en 10 tratamientos, consistentes en tres edades (65, 70 y 75 semanas con la aplicación de tres períodos de ayuno (5, 10 y 15 días y un control (sin DO. El análisis estadístico utilizó un modelo completamente aleatorizado, anidado, efecto fijo y balanceado. Se evaluó consumo de calcio durante el ayuno (g/ave/día, consumo de alimento (g/ave/día, porcentaje de producción, peso del huevo (g, conversión por masa de huevo y huevos por ave alojada (HAA. Resultados. La edad presentó efecto significativo (p<0.05 sobre las variables consumo de alimento, día del primer huevo postmuda, días sin producción, día postmuda de retorno al 50% de producción, peso del huevo, número de huevos, masa huevos, conversión y porcentaje de producción (p<0.01. Al comparar con el control, el tratamiento 75-5 presentó efecto significativo (p<0.05 para las variables: consumo de alimento, número de huevos promedio, masa huevos y conversión. Conclusiones. Las aves con mayor período de ayuno presentaron mayor período improductivo postmuda, grandes pérdidas de peso y alto consumo de alimento, lo que genera alta conversión e ineficiencia productiva. En comparación con reportes de literatura sobre DO en aves livianas, las aves semipesadas llegan al cese de producción en menos días y su período improductivo es menor.

  12. huevo de tortuga lora (lepidochelys olivacea

    Directory of Open Access Journals (Sweden)

    M\\u00F3nica Pereira-Zamora

    2007-01-01

    Full Text Available Penetración de Vibrio mimicus a través de la cáscara del huevo de tortuga lora (Lepidochelys olivacea. El objetivo de esta investigación consistió en determinar la capacidad de penetración del Vibrio mimicus a través de la cáscara del huevo. La investigación se realizó en el Centro Nacional de Ciencia y Tecnología de Alimentos en el año 2000. Se inoculó la superfi cie de la cáscara con la bacteria y se procedió a incubar las muestras por 72 horas a 25ºC. Después de este período se observaron las muestras bajo el microscopio electrónico. Los resultados obtenidos demuestran que el Vibrio mimicus se reproduce en la superfi cie externa de la cáscara del huevo de tortuga lora, y no es capaz de penetrarla después de las 72 horas de incubación a 25ºC. Por lo tanto, cualquier tratamiento que se aplique con el fi n de reducir la contaminación con el vibrio y mejorar la inocuidad de los huevos, debe aplicarse en su exterior.

  13. APLIKASI ANIMASI INTERAKTIF PENCAMPURAN TIGA WARNA PRIMER DAN PENGENALAN BENTUK GEOMETRI PADA PAUD AL-MUSLIMUN

    Directory of Open Access Journals (Sweden)

    Mayya Nurbayanti Shobary

    2016-03-01

    Full Text Available Abstract - The development of Interactive animation application mixing three colors and introduction of geometric shapes for early childhood, aims to increase learning tool for parents and teachers to attract the attention of children to learn about colors and shapes using interactive animation application. Application built using the concept of PAUD Al-Muslimun in educating early childhood in knowing the result of mixing three primary colors and geometric shapes. The development of application take an example of how theachers in educating early childhood that began with the introduction of color and shapes, and practice how to mix the primary three colors, by showing interisting picture related to colors and shapes are introduced. Data collection methods used for this study is the direct observation of the teaching and learning activities from the perspective of teachers, children and parents to get an idea of the optimal design of an application built on. The development of Interactive animation application mixing three primary colors and introduction of geometric shapes for early childhood for early childhood through the five steps, analyzing, designing, implemeting, testing, and revision errors or shortfall. In this application there are learning processes knowing the primary color and introduction of geometric shapes with support interactive buttons, interesting picture and audio to enhance the absorption of early childhood to the contents of the material, learning and display concerned and to help parents or teachers role in educating children once more creative . Keywords: Applications, Animation, Interactive, Early Childhood Abstrak - Pembangunan aplikasi animasi interaktif pencampuran tiga warna primer dan pengenalan bentuk geometri untuk anak usia dini, bertujuan untuk menambah sarana pembelajaran untuk orang tua dan guru dalam menarik perhatian anak untuk belajar mengenal warna dan bentuk dengan menggunakan aplikasi animasi interaktif

  14. Congelación de semen de carnero en pellets con los diluyentes Tris-glucosa-yema de huevo o Lactosa-yema de huevo

    Directory of Open Access Journals (Sweden)

    F. I. Brito

    2004-01-01

    Full Text Available El objetivo del trabajo fue comparar la recuperación de la motilidad al descongelar el semen congelado en pellets utilizando el diluyente Tris glucosa-yema de huevo o Lactosa-yema de huevo. Se obtuvieron 30 eyaculados de nueve carneros por medio de una vagina artificial y se evaluó el volumen, la motilidad progresiva, la concentración y la morfología espermática. Cada eyaculado se dividió en dos partes, una de ellas se diluyó con Tris-glucosa yema de huevo y la otra con Lactosa yema de huevo, de manera que la dilución final contuviera 100 x 106 de espermatozoides en 0.1 ml. Los pellets se prepararon goteando 0.1 ml del semen diluido en perforaciones realizadas en hielo seco. Se evaluó la motilidad inicial, después de diluir y al descongelado. Se evaluó la motilidad de cinco pellets de cada eyaculado preparado con cada diluyente (300 en total. Los datos se analizaron estadísticamente mediante análisis de varianza, considerando la motilidad progresiva como variable dependiente y transformando al arcoseno los valores expresados en porcentaje. No se encontraron diferencias en la motilidad inicial de los eyaculados diluidos con tris o Lactosa (P>0.05. La motilidad espermática al descongelar fue significativamente mayor (P<0.05 en el semen diluido con Lactosa-yema (45.8%, que con Tris-glucosa-yema (40.2%

  15. Los huevos en La Colmena

    Directory of Open Access Journals (Sweden)

    José Molina

    2014-10-01

    Full Text Available Las lenguas proponen interesantes juegos de recepción. En el español de nuestro país, por ejemplo, con la palabra ‘huevos’ nos referimos a los genitales masculinos, mientras que en italiano se trata del título del libro de poemas de Elisa Biagini (Florencia, Italia, 1970. Lo interesante surge cuando nos enteramos de que ‘huevo’ en italiano es masculino al singular y femenino al plural. El poemario de Biagini juega con esa transición de géneros. En el tantas veces atacado ‘horizonte masculino’ de la poesía italiana nace esta voz que llena de intenciones las imágenes. No hay referencias directas, sino el gesto hábil que sólo la poesía puede producir en el juego de la palabra. Biagini propone combatir la discursividad masculina de su tradición desde la dispersión de su voz: elabora figuras femeninas que aman hombres y mujeres, que son niñas, amantes y madres, sin necesidad de renunciar a la perversidad y al humor. El ejemplo más claro de esto es el poema “Feminist icon”, donde la misma mano que acaba de masturbarse hace la señal de la cruz entre el cuerpo y un burro de planchar. Biagini ha publicado tres libros de poemas: Questi nodi (Florencia, Gazebo, 1993, Uova (Génova, Zona, 1999 y l’ospite (Torino, Einaudi, 2004. Los poemas aquí traducidos fueron tomados de una antología personal.

  16. NIVELES DE MERCURIO EN HUEVOS, EMBRIONES Y NEONATOS DE Trachemys callirostris (TESTUDINES, EMYDIDAE

    Directory of Open Access Journals (Sweden)

    Beatriz Rendón-Valencia

    2014-09-01

    Full Text Available Cuantificamos la concentración total de mercurio en cáscaras, yemas y embriones de 16 nidos de hicotea (Trachemys callirostris. Los nidos fueron colectados en diferentes estadios de desarrollo embrionario. No hubo una correlación entre el tiempo estimado desde el desove y los niveles de mercurio en los huevos, sugiriendo que el metal no fue absorbido del substrato, sino que probablemente éste fue transferido a los huevos durante el proceso de foliculogénesis en las hembras reproductivas, las cuales bioacumularon el mercurio de fuentes ambientales. La concentración promedio de mercurio fue mayor en los embriones que en las cáscaras o yemas, indicando que los embriones también bioacumulan el metal presente en otros tejidos del huevo. La variación de la concentración de mercurio dentro de una misma nidada fue relativamente alta. Las concentraciones de mercurio en las yemas no estuvieron asociadas con ninguna de las medidas de fitness que fueron evaluadas (éxito de eclosión, tamaño inicial de los neonatos y tasas de crecimiento de los juveniles en el primer mes. Después de cinco meses de mantenimiento en cautiverio, en un ambiente libre de mercurio, 86 % de los juveniles había eliminado completamente este metal de sus tejidos.

  17. Inducción rápida de tolerancia oral a huevo en pacientes alérgicos mayores de 5 años y su seguimiento clínico e inmunológico durante 2 años

    OpenAIRE

    García Rodríguez, Rosa

    2014-01-01

    El huevo es un alimento muy consumido en la mayoría de las culturas por ser una excelente fuente de proteínas de alto valor biológico, de vitaminas y de minerales, y por su coste relativamente bajo con respecto a otros alimentos de contenido proteico similar. Además de ingerirse como tal, el huevo se encuentra frecuentemente formando parte de muchos platos culinarios o como alimento oculto o en pequeñas cantidades en innumerables productos elaborados. Este elevado consumo de huevo hace que, j...

  18. EDAD AL PRIMER PARTO EN VACAS HOLSTEIN DE LECHERÍA ESPECIALIZADA EN COSTA RICA

    Directory of Open Access Journals (Sweden)

    Mauren Salazar-Carranza

    2013-01-01

    Full Text Available El objetivo de este trabajo fue determinar la edad al primer parto (EPP en vacas Holstein pu- ras en lecherías especializadas de Costa Rica. Se realizó un es- tudio longitudinal prospectivo histórico con 46 029 animales de raza Holstein pura de lechería especializada de Costa Rica, durante el periodo comprendido entre los años 2000 y 2010. Se incluyeron los datos de vacas que contaban con registros completos para todas las variables del estudio, registrados en el programa VAMPP Bovino 3.0. Se calculó la EPP por las variables de zona ecológica, la época de nacimiento, el año de parto, el índice de endogamia, el número de lactancias de la madre y el tipo de parto que dio origen al animal en estudio. Los datos fueron analizados por medio de estadística descrip- tiva (porcentajes, promedios, desviación estándar [DE] y el cálculo de intervalos de confianza (IC95%. La EPP prome- dio fue 30,7 meses (D.E: 6,8; IC 95%: 30,6 – 30,8. Durante el periodo, el promedio de la EPP varió entre los 30 y 31 meses; sin embargo, en los años 2006 y 2007 mostró una tendencia a disminuir. La EPP presentó diferencias significativas entre estratos según la época de nacimiento, el número de lactancia de la madre, la zona ecológica, el año de nacimiento, el tipo de parto de la madre y el coeficiente de endogamia de la vaca. Al igual que las tendencias mundiales, mostró tendencia a decrecer en Costa Rica; y las variables de animal, tiempo y ambiente mostraron un efecto sobre la EPP. Excepto el coefi- ciente de endogamia (a mediano y largo plazo, esos factores no son modificables en condiciones de pastoreo, que son los imperantes en la gran mayoría de fincas estudiadas.

  19. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    JULIANA GARCÍA

    2011-01-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de huevos/hembra/día con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.

  20. Bajo peso al nacer, crecimiento y desarrollo en el primer año de vida

    Directory of Open Access Journals (Sweden)

    Elia Rosa Lemus Lago

    1997-04-01

    Full Text Available Se efectuó un estudio descriptivo, longitudinal y retrospectivo en el área de salud del Policlínico Docente "19 de Abril" con los niños nacidos con peso inferior a los 2 500 g, en el año 1994, y se siguió su evolución clínica durante el primer año de vida, que correspondió a una muestra de 23 infantes. Los datos fueron recogidos de las historias clínicas individuales de los niños y de la embarazada. Se analizaron los parámetros peso, talla, circunsferencia cefálica, valoración nutricional y desarrollo psicomotor. Predominó el bajo peso para la edad gestacional con un 65,2 y el 34,7 % correspondió a los nacidos antes del término de la gestación. El 100 % de los pretérmino al año de vida tuvieron una valoración nutricional normal. No se comportaron de igual forma los de bajo peso para la edad gestacional en los que el 20 % quedaron por debajo del 3er. percentil.A descriptive, longitudinal and retrospective study was conducted at the health area of the "19 de Abril" Teaching Polyclinic. 23 infants who were born in 1994 with a birth weight < 2 500 g were included in the sample. Their clinical evolution was followed during the first year of life. The data were obtained from the individual medical histories of the children and of the pregnant women. The following parameters were analyzed: weight, size, cephalic perimeter, nutritional assessment and psychomotor development. Low weight prevailed for the gestational age with 65.2 %, whereas 34.7 % corresponded to preterm deliveries. 100 % of the preterm infants had a normal nutritional assessment after the first year of life. However, 20 % of those with low weight at the gestational age remained under the third percentile.

  1. Actividad in vitro de los venenos de Lachesis muta y Bothrops atrox sobre la viabilidad y desarrollo embrionario de los huevos de Ascaris suum

    Directory of Open Access Journals (Sweden)

    Claudia Paredes

    2014-06-01

    Full Text Available Los venenos de serpientes son concentrados polienzimáticos cuya actividad biológica sobre algunas bacterias y protozoos ha sido comprobada. El objetivo principal del presente trabajo fue estudiar la actividad in vitro de los venenos totales de las serpientes Lachesis muta y Bothrops atrox sobre la viabilidad y el desarrollo embrionario de los huevos de Ascaris suum. Se emplearon los venenos totales en concentraciones de 2, 4, 8 y 16 mg/mL sobre huevos no embrionados y larvados in vitro. Se comparó la actividad de los venenos con la de otras sustancias como el hipoclorito de sodio al 5,25%, Albendazol (solución comercial y solución salina. Ambos venenos, en concentraciones de 4, 8 y 16 mg/mL, inhibieron la blastulación de estos huevos; hasta el sexto día de incubación; en cambio en concentración de 2 mg/mL la inhibición se dio hasta el cuarto día. Posteriormente iniciaron un proceso de embrionación aparentemente normal hasta la formación del estadio infectante. El veneno de B. atrox fue el que presentó el mayor efecto inhibitorio en concentración de 16 mg/mL. El hipoclorito de sodio destruyó el 100% de los huevos, mientras el albendazol ocasionó que los huevos iniciaran un proceso de segmentación anormal que originó su degeneración. Se concluye que los venenos de L. muta y B. atrox muestran actividad inhibitoria al inicio de la blastulación de los huevos de A. suum y no ejercen ningún efecto en los huevos larvados.

  2. Demo 94. Campana de vacío : hinchar un globo sin soplar y cocer un huevo en el Everest

    OpenAIRE

    Garro Martínez, Núria

    2013-01-01

    Objetivo: a) Hinchar un globo sin soplar: Experimentar la relación entre el volumen y la presión de los gases. Demostrar que es posible hinchar un globo sin insuflar aire en su interior, reduciendo la presión (atmosférica). b) Cocer un huevo en el Everest: Comprobar la disminución del punto de ebullición del agua al reducir la presión (atmosférica)

  3. Ultraestructura de la cáscara de huevos eclosionados y no eclosionados de Kinosternon angustipons (Testudinata: Kinosternidae

    Directory of Open Access Journals (Sweden)

    R. Acuña-Mesén

    2001-12-01

    Full Text Available Se describe la ultraestructura de la cáscara de los huevos de Kinosternon angustipons y se compara con la de K. leucostomum y K. scorpioides. Esta investigación se realizó con cuatro huevos provenientes de tortugas en cautiverio, para una muestra de 30 secciones analizadas en el Microscopio Electrónico de Barrido. Está constituida por tres capas: la cutícula o externa, la calcárea o intermedia y la testácea o interna. La comparación entre huevos eclosionados y no eclosionados de K. angustipons muestra similitudes en cuanto a su superficie externa que es plana, unidades abanicadas y fibras proteicas superpuestas al azar. Los huevos no eclosionados se diferencian por la presencia de estructuras esponjoides y mayor porosidad externa. Los espacios con forma de punta de lanza y el adelgazamiento de las fibras proteicas son típicos en la capa calcárea y membrana testácea de los huevos eclosionados. La evidencia ultraestructural muestra que durante el desarrollo embrionario disminuye el grosor de la cáscara y, además que, la de los huevos no eclosionados de K. angustipons es más gruesa que la de los otros dos kinostérnidos costarricensesThe ultrastructure of eggshells of Kinosternon angustipons is described and compared with the ones of K. leucostomum and K. scorpioides. Four eggs from captive turtles (30 sections were studied with Scanning Electron Microscopy (SEM. The shell has three layers: cuticle or external, calcareous or intermediate and testacean or internal. Hatched and non hatched eggs have similar characteristics in their external surface: fanned units and proteic fibers superposed at random. They differ in the presence of spongelike structures and more external porosity in non hatched eggs. The intermediate and testacean layers of the hatched eggs have lance point like spaces and are thin in the proteic fibers. The ultrastructural evidence shows that during the embryonic development the thickness of the peel decreases. Non

  4. Mecanismos de tribalización en la patagonia: desde la gran crisis al primer gobierno peronista.

    Directory of Open Access Journals (Sweden)

    Walter Delrio

    2005-12-01

    Full Text Available En 1937 el gobierno argentino decide desalojar y trasladar a la tribu Nahuelpán bajo acusaciones de extranjería e in-civilización. Luego de seis años, la medida es revisada y se inicia un proceso de restitución parcial de las tierras involucradas seleccionándose desde el estado a quienes se continuaría reconociendo como "tribu" Nahuelpán. A partir de este caso enmarcado en el contexto de las relaciones establecidas por las comunidades indígenas del territorio nacional de Chubut con las autoridades nacionales y las redes locales de poder, se propone un análisis del proceso de construcción del espacio social para los pueblos originarios en la matriz estado-nación-territorio en el período que va de la gran crisis del '30 al primer gobierno peronista. Se abordan en particular los mecanismos de tribalización en la interfase entre políticas oficiales y agencia aborigen.In 1937, the Argentine government decided to displace and remove the Nahuelpán tribe accused of foreign and uncivilized behavior. Six years later this measure was reviewed starting a process of partial land restitution in which the state selected who will continue to be considered as member of the above mentioned tribe. Focusing in that case, framed by the relationship established between indigenous communities of the national territory of Chubut and state authorities or local nets of power, this article analyzes the process leading to the construction of a social space in the state-nation-territory matrix since the 1930' great crisis until the first period of President Juan Perón.

  5. Relación entre colesterol dietario, consumo de huevo y perfil lipídico en adultos aparentemente sanos, según grupos de edad

    Directory of Open Access Journals (Sweden)

    Rosa Lorenza Oriondo Gates

    2013-01-01

    Full Text Available Objetivos: Evaluar la relación entre el colesterol dietario, consumo de huevo y el perfíl lipídico en adultos aparentemente sanos, según grupo etario. Diseño: Estudio descriptivo, de asociación cruzada. Institución: Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Perú. Participantes: Adultos aparentemente sanos. Intervenciones: En 50 adultos aparentemente sanos se determinó el consumo de colesterol dietario, huevo y perfil lipídico. Resultados: Trece participantes consumían menos de 3 huevos/semana, 19 de 3 a 4 huevos/semana y 18 más de 4 huevos/semana. En relación al consumo de colesterol dietario, el grupo de 20 a 29 años presentó un promedio de ingesta (358,9±152,5 mg/dL significativamente superior (p<0,05 al grupo de 30 a 39 años (223 ± 82,8 mg/dL. El colesterol (col total de los tres grupos según consumo de huevo fue 179,8 ± 52, 168,8 ± 44 y 164,3 ± 62 mg/dL, respectivamente; para el HDL-col se obtuvo 38,9 ± 15, 28,0 ± 15 y 35,2 ± 14 mg/dL, respectivamente; para el LDL-col, 118,1±41, 112,5 ± 39 y 100,4 ± 47,9 mg/dL, respectivamente; para los triglicéridos, 199,2 ± 169, 152,8 ± 108 y 124,2 ± 92 mg/dL, respectivamente. Conclusiones: El consumo de colesterol dietario y huevo en la muestra estudiada no tuvo relación con el perfil lipídico.

  6. Salamandras de la Familia Plethodontidas: Hallazgo de los huevos de Bolitoglossa adspersa (Peters

    Directory of Open Access Journals (Sweden)

    Nicéforo María Hermano

    1960-06-01

    Full Text Available La ovoviviparidad en las salamandras del género Bolitoglossa (2 (Oedipus ha sido registrada solamente para las formas que habitanen las montañas de Colombia. Al referirse a «Oedipus adspersus», que fue colectada en las bromelias de las montañas de Santa Marta, Ruthven (3 dice simplemente que ella es una especie vivípara.  Es muy probable que el autor apoya su información sobre la de Peters, quien encontró huevos de 3 mm. en el ovario de la salamandra «Oedipus adspersus» y afirmó que el animal era vivíparo.

  7. Los huevos falsos (SAGs facilitan el comportamiento social de emergencia en las crías de la tortuga laúd Dermochelys coriacea (Testudines: Dermochelyidae

    Directory of Open Access Journals (Sweden)

    Juan Patiño-Martinez

    2010-09-01

    Full Text Available La emergencia de las crías de tortuga laúd eclosionadas en los nidos profundos desde la arena hasta la superficie de la playa ocurre sin ayuda parental y es el primer gran desafío de supervivencia en su ciclo de vida. Este estudio, desarrollado en la costa Caribe colombiana, describe el comportamiento social de emergencia de neonatos y evalúa el efecto de la traslocación de los nidos en los patrones temporales de emergencia. Se propone por primera vez que el espacio liberado por la deshidratación de falsos huevos (SAGs en la nidada, representa una ventaja reproductiva al facilitar el agrupamiento de los neonatos en un espacio muy limitado y favorecer la sincronía de la emergencia. El tiempo medio registrado para la emergencia en grupo fue de 3.3 días, variando entre uno y seis días. La traslocación de los nidos no afectó el patrón temporal de emergencia que fue predominantemente nocturno (77.77% en nidos naturales y 81.65% en trasladados. Los picos máximos de emergencias a la superficie coincidieron con los periodos de menor temperatura ambiental exterior (22:00h-06:00h. La ventaja selectiva de este patrón temporal y de la emergencia sincrónica está probablemente relacionada con las mayores tasas de depredación y mortalidad por hipertermia observadas durante el día.

  8. Aplicación de las funciones elípticas de Fourier para la descripción de la forma de los huevos de las aves

    Directory of Open Access Journals (Sweden)

    Dennis Denis Ávila

    2014-12-01

    Full Text Available La forma de los huevos es difícil de cuantificar por la ausencia de fórmulas exactas que describan su geometría. Se describe un algoritmo para la caracterización y comparación de estas formas, basado en la aplicación de las funciones de Fourier. Estas permiten delinear cualquier tipo de contorno cerrado y han sido aplicadas efectivamente al análisis de varias formas biológicas. Se describen los pasos para la toma de datos, su procesamiento y el empleo del programa SHAPE para la obtención de los descriptores, a partir de un estudio de caso. En este se comparan las formas de los huevos de tres especies de aves que representan tres estrategias reproductivas bien diferentes: el Catey (Aratinga euops, la Gaviota Real (Thalasseus maximus y el Totí (Dives atroviolaceus. A partir de 73 fotografías digitales a huevos depositados en colecciones, se calcularon los coeficientes de las funciones para 4, 6, 8, 16 y 20 armónicos, y se redujeron por medio de un Análisis de Componentes Principales. Los puntajes de los componentes que describen hasta el 90 % de la variabilidad fueron empleados en un Análisis de Función Discriminante Lineal para analizar la posibilidad de separar los huevos según sus formas. Con solo cuatro armónicos los primeros cinco componentes explicaron 97% de la varianza en formas. Más armónicos disminuyen la varianza explicada, requiriéndose hasta ocho componentes para explicar la misma cantidad. Los polígonos convexos en el espacio discriminante muestran una clara distinción entre especies sugiriendo la posible discriminación (errores de clasificación entre 7-15%. Los errores en las clasificaciones estuvieron relacionados a diferencias específicas en la forma entre especies. En el estudio de caso, los huevos de A. euops fueron perfectamente clasificados pero en las otras especies los errores fueron entre 5 y 29%, con este número de armónicos y componentes empleados. El algoritmo propuesto a pesar de su

  9. Ultraestructura de la cáscara del huevo de la tortuga Pseudemys scripta (Testudines: Emnydidae).

    OpenAIRE

    Acuña-Mesén, Rafael Arturo

    2016-01-01

    La cáscara del huevo de Pseudemys scripta consta de una capa externa de sales de calcio y una membrana proteica. La primera está formada por unidades estructurales que tienen muy variadas formas y tamaños según su número de subunidades. Entre cada unidad estructural se localizan grietas que sustituyen en su función a los poros observados en huevos de otras especies y que facilitan la expansión del huevo cuando está turgente; superficial y radialmente, éstas están compuestas por series de lame...

  10. l aceite de atún como fuente de ácidos grasos ω-3 en el huevo de gallina

    Directory of Open Access Journals (Sweden)

    Vázquez-Valladolid, J. L.

    2005-06-01

    Full Text Available Fish oils are a source of polyunsaturated omega 3 fatty acids (AG ω3, mainly eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA, which supply many benefits to human health. Tuna oil was used as a source of marine 3ω FA to enrich eggs by supplementing the diet of egg-laying hens with tuna oil. One hundred and twenty White Leghorn hens of 90 weeks old were allocated on three treatments with four replicates each, on a completely random design. Treatments consisted of adding 1 % and 2 % of tuna oil to the diets. The total lipids and ω3FA of the eggs were determined. The egg-laying hen dietary tuna oil supplement (1 and 2 % enriched eggs with 300 % more EPA (0.40, 1.37, 1.54 mg/g lipids and DHA (7.90, 24.67, 24.50 mg/g lipids versus the control egg . The ω6:ω3 ratio decreased ( 11.4:1, 3.8:1, 3.0:1 as dietary tuna oil increased. There were no differences (p>0.05 among treatments in productive performance and egg quality, except egg weight which decreased with the tuna oil.Los aceites de pescado son una fuente de lípidos poliinsaturados de origen animal, principalmente de los ácidos grasos omega-3 (AG ω-3, eicosapentaenoico (EPA y docosahexaenoico (DHA, beneficiosos para la salud. En este trabajo se utilizó el aceite de atún como fuente de estos nutrientes en el huevo para consumo. Se utilizaron 120 gallinas blancas Leghorn Isa-Babcock B-300 de 90 semanas de edad, distribuidas al azar en tres tratamientos, con cuatro réplicas cada uno. Los tratamientos consistieron en adicionar 1% y 2% de aceite de atún en la dieta de las gallinas ponedoras. Se determinaron los lípidos totales y AG ω-3 en el huevo, obteniéndose 300 % más de EPA (0,40, 1,37, 1,54 mg/g lípidos y DHA (7,90, 24,67, 24,50 mg/g lípidos al adicionar 1 y 2% de aceite de atún en la dieta de las aves, que en el grupo testigo. La relación ω-6: ω-3 en el huevo disminuyó con el suplemento dietético de aceite de atún (11,4:1, 3,8:1, 3:1, lo mismo ocurri

  11. SOBREVIVENCIA DE Vibrio mimicus EN LA CLARA Y EN LA YEMA DEL HUEVO DE TORTUGA LORA (Lepidochelys olivacea)

    OpenAIRE

    M\\u00F3nica Pereira-Zamora; Eric Wong-Gonz\\u00E1lez

    2008-01-01

    En el año 2000, en el Centro Nacional de Ciencia y Tecnología de Alimentos de la Universidad de Costa Rica, se estudió la sobrevivencia de Vibrio mimicus en la clara y yema del huevo de tortuga lora. Se inocularon muestras de clara o yema con el vibrio (aproximadamente 2,5 x 104 UFC/g) y se determinó la carga inicial y final al cabo de 18 horas de incubación a 25°C. De forma análoga se trabajó una muestra control en agua peptonada alcalina(APA) como medio óptimimo de crecimiento para el vibri...

  12. Estrategia para mejorar el acceso al tratamiento etiológico para la enfermedad de Chagas en el primer nivel de atención en Argentina

    Directory of Open Access Journals (Sweden)

    Karen Klein

    2017-05-01

    Full Text Available RESUMEN Objetivo Mejorar la distribución del tratamiento etiológico para la enfermedad de Chagas mediante la identificación de barreras para su descentralización al primer nivel de atención en Argentina. Métodos Se llevó a cabo un estudio cualitativo, de carácter exploratorio y descriptivo, en base a entrevistas semiestructuradas a actores clave pertenecientes al Programa Nacional de Chagas y miembros de los equipos de salud del primer nivel de atención con el objetivo de identificar barreras para el diagnóstico y tratamiento de la enfermedad de Chagas en diferentes niveles (administrativo, efectores de salud y comunidad que podrían afectar una estrategia descentralizada de distribución. Además, se implementó un piloto de descentralización en diez centros de atención primaria en una provincia argentina. Resultados Se realizaron 22 entrevistas semiestructuradas con responsables de programas y profesionales de la salud. Los principales obstáculos hallados fueron la falta de búsqueda sistemática de casos, la poca articulación entre los niveles de atención y los actores del sistema de salud, la falta de capacitación del equipo de salud respecto al tratamiento, el seguimiento de los pacientes y las barreras asociadas a los pacientes. Se llevó a cabo un programa piloto de descentralización y se evaluaron estrategias para optimizar la intervención a gran escala. Conclusiones Los resultados permitieron mejorar la implementación del plan de descentralización del tratamiento a través de una mejor articulación interprogramática, la capitalización de herramientas de monitoreo y de comunicación ya existentes, y la sensibilización de los equipos de salud. Además, se formularon recomendaciones tendientes a mejorar el diagnóstico y el tratamiento de la enfermedad de Chagas.

  13. Una mirada tecnopolítica al primer año de Podemos. Seis hipótesis

    Directory of Open Access Journals (Sweden)

    Javier Toret Medina

    2015-04-01

    Full Text Available La irrupción de Podemos en las elecciones europeas de mayo de 2014 ha transformado radicalmente la escena política española. El impacto de Podemos se enmarca en un contexto de crisis económica, creciente intolerancia contra la corrupción y una paisaje cultural en transformación tras los múltiples efectos del movimiento-red 15M. En este breve ensayo se trata de poner de relieve algunos aspectos y dar fuerza a miradas que muestran a Podemos atendiendo a su conexión con los Adn del 15M y latinoamericano, como su estratégica de ocupación de los medios de comunicación de masas como el de las redes sociales digitales. Atendemos al crecimiento exponencial y una mirada que muestra elementos determinantes menos visibles en la emergencia política y comunicativa de Podemos.

  14. Las genealogías de cAbd al-Mu'min, primer califa almohade

    Directory of Open Access Journals (Sweden)

    Fierro, Maribel

    2003-06-01

    Full Text Available The Almohad caliphs claimed that agnatically they belonged to the Arab tribe of Quraysh. Qays cAylān does not include the tribe of Qurayš, with which the Mu'minids claimed to be linked cognatically. According to the classical doctrine of the caliphate, to be found for example in Ibn Hazm, the caliphs should belong to Quraysh through their paternal lineage. In this article, the advantages of a Qaysi genealogy (with a long tradition among the Berber populations of North Africa for the Mu'minid caliphs are analyzed. Among those advantages there are the links that such genealogy established with the Arab tribes of Sulaym and Hilāl, crucial elements in the Mu'minid army, and with the pre-Islamic Arab Prophet Khālid b. Sinīn al-cAbsī (descendants of whom appear in connection with the episode of the Berber rebellion of the Kāhina.

    Los califas almohades afirmaron pertenecer a la tribu árabe de Qays cAylān por descendencia agnática. Qays cAylān no incluye a la tribu de Qurayš, con la que los mu'miníes afirmaban estar emparentados por línea materna. Según la doctrina clásica del califato, recogida por ejemplo por Ibn Hazm, los califas deben ser qurayšíes por línea paterna. En este artículo se analizan las ventajas que ofrecía a los califas mu'miníes esa ascendencia qaysí, de larga tradición entre las poblaciones beréberes del Norte de África. Entre esas ventajas se cuentan la vinculación de parentesco con las tribus árabes de Sulaym y Hilāl, elementos fundamentales del ejército mu'miní, y con el profeta árabe pre-islámico Jālid b. Sinān al-cAbsī (descendientes de este último aparecen en estrecha relación con el episodio de la rebelión beréber de la Kāhina.

  15. Afasia motora congénita (informe preliminar presentado al Primer Congreso Colombiano de Neurología

    Directory of Open Access Journals (Sweden)

    Juan Antonio Gómez

    1966-01-01

    Full Text Available El estudio del lenguaje, antes de que exista, es un campo bastante confuso de la neurología. No sólo participa de la caótica interpretación que diferentes escuelas actuales dan al fenómeno clínico de afasia sino que linda con el problema mismo de la evolución y creación del lenguaje, base de la cultura. De nuestro material clínico hemos escogido un grupo de 23 niños con afasia de la llamada "congénita", entre los cuales había 11 casos de afasia motora. Nueve se estudiaron bajo el punto de vista neurológico, psicológico, psicométrico, pedagógico y social. Todos fueron examinados radiológicamente, audiométricamente y electroencefalográficamente. El objeto del presente trabajo es presentar las manifestaciones neurológicas de los niños con afasia motora congénita principalmente, y discutir algunos puntos del diagnóstico diferencial y del posible mecanismo neurológico que ha impedido el desarrollo del lenguaje.

  16. Estudios Taxonómicos, Ontogenéticos, Ecológicos y Etológicos sobre los Ostrácodos de agua dulce en Colombia -II. Contribución al conocimiento del desarrollo embrionario tardío y de los procesos de la eclosión del huevo de Heterocypris Bogotensis Roessler Estudios Taxonómicos, Ontogenéticos, Ecológicos y Etológicos sobre los Ostrácodos de agua dulce en Colombia - I. Contribución al conocimiento del desarrollo embrionario tardío y de los procesos de la eclosión del huevo de Heterocypris Bogotensis Roessler Estudios Taxonómicos, Ontogenéticos, Ecológicos y Etológicos sobre los Ostrácodos de agua dulce en Colombia - I. Contribución al conocimiento del desarrollo embrionario tardío y de los procesos de la eclosión del huevo de Heterocypris Bogotensis Roessler

    Directory of Open Access Journals (Sweden)

    Roessler Ewald W.

    1982-04-01

    Full Text Available El presente estudio da una breve descripción del huevo de Heterocypris bogotensis Roessler con énfasis en la estructura de las capas del huevo y su papel ecológico. Se presenta una etapa ontogenética hasta la fecha desconocida, la cual se destaca por la formación de un tronco relativamente grande que se reduce despues de la secreción de una cutícula iniciandose una mudaembrionaria compleja. Se muestra el papel del exoesqueleto embrionario en los sucesos durante la salida de las capas del huevo. Se discuten brevemente cuestiones filogenéticas.The present study gives a short description of the egg off Heterocypris bogotensis Roessler with special consideration of the structure of the eggshell and its ecological importance. An up to date unknown embriological stage is presented that sticks out by the formation of a trunk that will be reduced after the secretion of a cuticula within the iniciation of an embriological molting process. The role of the embriological exoskeleton during hatching is described and phylogenetic questions are shortly discussed.In der vorliegenden Studie wird eine kurze Beschreibung des Eies von Heterocypris bogotensis Roessler gegeben unter Beruecksichtigung der Struktur der Eihuellen und ihrer oekologischen Bedeutung. Es wird auf die Entwick lung eines bisher  unbekannten embryonalen Stadiums eingegangen, dassich durch die Ausbildung eines Rumpfes auszeichnet, der nach Abscheidung einer Kutikula und Einleitung einer embryonalen Haeutung wieder rueckgebildet wird. Die Bedeutung des abgeschiedenen Exoskeletts waehrend des Schlupfprozesses wird aufgezeigt, der Schlupfvorgang beschrieben. Auf phylogenetischeFragestellungen wird kurz eingegangen.

  17. Eficiencia técnica de la atención al paciente con diabetes en el primer nivel Technical efficiency in primary care for patients with diabetes

    Directory of Open Access Journals (Sweden)

    Ana María Salinas-Martínez

    2009-02-01

    Full Text Available OBJETIVO: Cuantificar en un primer nivel la eficiencia técnica de la atención al paciente con diabetes y distinguir la provisión de servicios y los resultados en salud, además de reconocer las fuentes potenciales de variación. MATERIAL Y MÉTODOS: Se incluyeron insumos, actividades clínicas y resultados en salud de 47 clínicas familiares del IMSS Nuevo León. La medida de la eficiencia se realizó mediante el análisis envolvente de datos y se aplicaron modelos de regresión de Tobit. RESULTADOS: Siete clínicas fueron eficientes en cuanto a la provisión de servicios y nueve en salud; dos coincidieron en ambos aspectos. La localización metropolitana y el total de consultas favorecieron la eficiencia en relación con la provisión de servicios, cualesquiera que fueran los atributos del paciente; y la edad del médico, la eficiencia de los resultados en salud. CONCLUSIONES: El desempeño varió en una misma unidad y entre una y otra; algunas fueron eficientes para suministrar servicios y otras para mejorar la salud. Las fuentes de variación también difirieron. Se recomienda incluir ambos productos en el estudio de la eficiencia en diabetes en el primer nivel.OBJECTIVE: To quantify the technical efficiency of diabetes care in family practice settings, characterize the provision of services and health results, and recognize potential sources of variation. MATERIAL AND METHODS: We used data envelopment analysis with inputs and outputs for diabetes care from 47 family units within a social security agency in Nuevo Leon. Tobit regression models were also used. RESULTS: Seven units were technically efficient in providing services and nine in achieving health goals. Only two achieved both outcomes. The metropolitan location and the total number of consultations favored efficiency in the provision of services regardless of patient attributes; and the age of the doctor, the efficiency of health results. CONCLUSIONS: Performance varied within and

  18. Tecnología de las inmunoglobulinas de yema de huevo

    OpenAIRE

    Terzolo, Horacio Raúl

    2009-01-01

    El objetivo de esta presentación es introducir una nueva tecnología basada en la utilización de las inmunoglobulinas o anticuerpos de yema de huevo. Trabajo galardonado con el Premio "Fundación Dr. Alfredo Manzullo", versión 2007 Academia Nacional de Agronomía y Veterinaria

  19. Extracción y aplicaciones alimentarias de membranas de cáscaras de huevo

    OpenAIRE

    García Campos, Tania

    2015-01-01

    Caracterización físico-química de la membrana de la cáscara de huevo, seguida del estudio y desarollo de posibles aplicaciones de la membrana en diversos campos, entre los que destaca la formación de geles y la retención de cobre y proteínas.

  20. Salinas primer.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  1. El secreto del huevo azul, de Catalina González Vilar. Estudio narratológico

    Directory of Open Access Journals (Sweden)

    Miguel Sánchez-García

    2013-01-01

    Full Text Available Este trabajo aborda el estudio narratológico de la obra El secreto del huevo azul , de la escritora Catalina González Vilar, que obtuvo el Premio El Barco de Vapor en el año 2012. Examina los diferentes elementos constitutivos del texto (el enfoque del tema, la caracterización de los personajes, la estructura sintáctica, el tratamiento del lenguaje, la técnica narrativa utilizada... y su aporte al desarrollo de la historia con la finalidad de descubrir los valores estéticos y literarios que aporta a la fábula. Pretende demostrar el adecuado uso de todos ellos dado que favorecen un texto rico en matices, llamativo, sugerente. Cualidades, todas ellas, de gran importancia tanto en creaciones destinadas al público adulto como al infantil y juvenil pues enriquece el valor final de la obra, y por extensión, el bagaje cultural de sus lectores.

  2. Ingesta de huevo y factores de riesgo cardiovascular en adolescentes; papel de la actividad física: Estudio HELENA

    OpenAIRE

    A. Soriano-Maldonado; M. Cuenca-García; L. A. Moreno; M. González-Gross; C. Leclercq; O. Androutsos; E. J. Guerra-Hernández; M. J. Castillo; J. R. Ruiz

    2013-01-01

    Introducci??n: Las enfermedades cardiovasculares (ECVs) suponen la principal causa de morbi-mortalidad en los pa??ses occidentales. El incremento del colesterol plasm??tico se ha relacionado con el desarrollo de ECV. El huevo, por su alto contenido en colesterol, ha sido indirectamente relacionado con el riesgo de desarrollar ECVs. Objetivo: Examinar la asociaci??n entre ingesta de huevo y factores de riesgo cardiovascular en adolescentes, estudiando si dicha relaci??n est?? influenciada por ...

  3. Reología de derivados de la yema de huevo deshidratada

    Directory of Open Access Journals (Sweden)

    Partal, Pedro

    2000-08-01

    Full Text Available The emulsification process, as weIl as and the emulsion rheology and stability, greatly depends on the rheological properties of the continuous phase, the most important ingredient of which is yolk. However, since native yolk is not microbiologically stable, processing of yolk, such as spray-drying, is necessary for food applications. The influence of processing by spray-drying on the microstructure and rheological properties of yolk was investigated using oscillatory, creep and steady state flow measurements. The spray-drying process produces denaturation of proteins giving rise to a dramatic change from a fluid-like behaviour, as corresponds to the native yolk, to a gel-like behaviour corresponding to the reconstituted dried yolk (45% solids. Temperature exerts a slight influence on the linear viscoelastic properties of processed yolk.Tanto el proceso de emulsificación como las propiedades reológicas y la estabilidad de una emulsión alimentaria, tipo mayonesa, dependen en gran medida de la microestructura y la reología de la fase continua acuosa, cuyo ingrediente principal es la yema de huevo. Debido a la inestabilidad microbiológica de ésta se hacen necesarios procesos de deshidratación por atomización para conservarla con fines alimentarios. En este trabajo se trata de determinar la influencia que ejerce la deshidratación sobre la microestructura analizando las propiedades reológicas de la yema mediante ensayos reológicos de cizalla oscilatoria, de flujo en estado estacionario y de fluencia viscosa. Se llegó a la conclusión de que la deshidratación produce la desnaturalización de las proteínas provocando un cambio desde un comportamiento tipo fluido (yema nativa a un comportamiento tipo gel (yema deshidratada reconstituida al 45% en sólidos. Por otro lado, se ha observado una escasa variación de las propiedades viscoelásticas lineales de la yema deshidratada con la temperatura.

  4. La calcárea phosphórica en el mejoramiento de la calidad de la cáscara del huevo en gallinas ponedoras (Phosphoric calcarea on the impruvement of egg shell thickness quality in eggs laying hens)

    OpenAIRE

    Estrada, C., Osmaida; Larrent, N., Marroquin, T. Angelita; Cos, D. Yusell, Bárzaga, G.; Osmaida .; Larrent, N.; Marroquin, T.; Angelita; Cos, D.; Yusell; Bárzaga, G.

    2008-01-01

    ResumenEl presente trabajo se realizó en una granja de ponedora comercial raza White Leghorn (L33) en baterías. Con el objetivo de evaluar la utilización de la Calcárea phosphórica como estimulante para mejorar la calidad de la cáscara del huevo, se escogieron al azar un total de 50 jaulas con 4 gallinas por jaula, por un total de 200 animales; se establecieron dos grupos de estudio de 100 aves cada uno, control y experimental al que se le suministró: Calcárea phosphorica 12CH en soluc...

  5. Desarrollo embrionario-larval del pez tropical Hemirhamphus brasiliensis (Beloniformes: Hemirhamphidae a partir de huevos recolectados del medio natural

    Directory of Open Access Journals (Sweden)

    Jesús Rosas

    2008-09-01

    Full Text Available Se describe la formación del embrión y el desarrollo larval del pez Hemirhamphus brasiliensis Linnaeus, 1758, a partir de huevos en estado de mórula, recolectados en el alga parda Sargassum sp. Los huevos eran esféricos con un diámetro de 1923.54 ±72.35 µm, con numerosos filamentos coriónicos y estrías en su superficie. Durante las primeras 48 h, el embrión desarrolló la vesícula cefálica, los miomeros y el corazón, el cual se ubicó en el exterior de cuerpo impulsando sangre incolora, la cual se pigmentó de rojo posteriormente. Antes de la eclosión se desarrollaron el riñón, estómago, hígado y la vesícula biliar, las aletas pectorales, cuatro pares de arcos branquiales y la boca. Las larvas eclosionaron a la 114 h, presentando el cuerpo robusto en forma de torpedo, verde-amarillo con melanoforos dendriformes. Al nacer ingirieron metanauplios de Artemia. A las 72 h después de la eclosión se observó el esbozo de la aleta pélvica y a las 240 h se completó la metamorfosis.Embrionary-larval development of the tropical fish Hemirhamphus brasiliensis (Beloniformes: Hemirhamphidae from eggs collected in the wild. The embryo formation and larval development of Hemirhamphus brasiliensis Linnaeus, 1758 (Pisces: Hemirhamphidae is described from morula stage eggs collected on Sargassum sp. Thalii in the field (10°50’55.2" N y 64°09’467" W. The eggs were spherical, 1 923.54 ±72.35 µm diameter with several corionic filaments, and are striated. During the first 48 h the embryo developed cephalic vesicle, miomers, and a heart located on the external body surface, beating strongly and circulating colorless blood which became pigmented red later. Before hatching, the larva developed kidney, gut tract, liver and biliar vesicle, pectoral fins, four pairs of gill arches and the mouth. The larva hatched at 114 h, the body was torpedo-shaped, yellow-green, with several dendriform melanophores; the pelvic fin was observed 72 h post

  6. Cuantificacion de huevo en fideos secos según metodo electroforético (SDS PAGUE) Quantification of egg in dried noodles by electrophoretic methods (SDS PAGE)

    OpenAIRE

    LB López; K Cellerino; MJ Binaghi; MS Giacomino; ME Valencia

    2011-01-01

    La cuantificación de huevo en fideos secos elaborados con harina y agregado de huevo. Se analizaron 6 sistemas modelos (SM) de fideos que contenían 0,0; 1,0; 2,5; 4,0; 6,0 y 8,0% de huevo en polvo. Se extrajeron proteínas totales con un buffer que contiene dodecilsulfato de sodio (SDS) y 2-Mercaptoetanol y se realizó electroforesis en gel de poliacrilamida con SDS. Se establecieron las relaciones de las áreas de los picos de los densitogramas (de huevo y de trigo) que permiten una correcta cu...

  7. Tu eres gallo… pero la de los huevos soy yo

    OpenAIRE

    Pine, Adrienne

    2011-01-01

    En Honduras, la industria maquiladora con sus prácticas disciplinarias y modernas, es vista por muchas personas como una fuerza protectora contra la violencia extrema de las maras y de las calles que es el enfoque principal del discurso diario hondureño. Sin embargo, la industria maquiladora, y las políticas militares y neoliberales (implementados por el fmi y el Banco Mundial) de las cuáles se aprovecha directamente, están estrechamente ligados con las prácticas de violencia asociadas al gén...

  8. Características técnico-sanitarias de expendios de carnes, pescados, aves y huevos de la ciudad de Tunja 2003

    Directory of Open Access Journals (Sweden)

    Fred Gustavo Manrique-Abril

    2011-02-01

    Full Text Available Se presenta una caracterización epidemiológica de los expendios de carnes, pescado y aves de Tunja en el año 2003, resultado del diagnóstico sanitario del municipio y las visitas adelantadas por la unidad de saneamiento. Al partir del compromiso que el sector salud tiene en el componente de ambiente, surge la necesidad de crear un sistema de vigilancia epidemiológica ambiental, cuya metodología y estrategia esté orientada hacia el conocimiento de los factores de riesgo ambientales a que están expuestos los grupos humanos, con el fin de determinar prioridades y orientar los recursos de salud disponibles en el desarrollo de intervenciones; es por eso que se implantó en Tunja la vigilancia de factores de riesgo del consumo en esta estrategia, la cual, incluye la de expendios decarnes y derivados, aves huevos y pescado; entonces, se usaron las actas de inspección sanitaria y se tabuló en EPIINFO 2002 para su análisis con SPSS 11,5. Así se realizó un análisis descriptivo a 173 establecimientos y se encontró que existen condiciones diversas de sanidad respecto de la estructura física, los procesos productivos y el producto para la venta; también hay un incumplimiento de normas técnico-sanitarias, en diferentes sectores de la ciudad, que se priorizan para el control por parte de la autoridad sanitaria. Al 75% de los establecimientos no cumplen con las condiciones higiénico sanitarias en cárnicos; el 66,6% no cuenta con las condiciones en establecimiento de venta de pescados ý el 52,5% delos establecimientos de venta de aves y huevos, no cumplen con las condiciones higiénico sanitarias para tal fin.

  9. Algunas consideraciones contextuales en torno al primer viaje a Japón de Jacques Lacan (1963) / Contextual considerations on the subject of Laca'ns first trip to Japan (1963)

    OpenAIRE

    Altimir, Mercè

    2012-01-01

    Nuestro propósito es dar a conocer la importancia y el influjo de la cultura y el pensamiento oriental y Japón en la obra de Lacan, para cuya tarea hemos tomado el eje del viaje que realizó al archipiélago en la primavera de A partir de esta coordenada de tiempo hemos retrocedido hasta la presencia del país oriental en la obra de Sigmund Freud y hemos referido la mención del mikado y de los ainus en Tótem y tabú. En cuanto al budismo, centro del interés de Lacan en este primer viaje a las isl...

  10. ALGUNAS CONSIDERACIONES CONTEXTUALES EN TORNO AL PRIMER VIAJE A JAPÓN DE JACQUES LACAN (1963) Contextual considerations on the subject of lacan’s first trip to japan (1963)

    OpenAIRE

    Mercè Altimir

    2012-01-01

    Nuestro propósito es dar a conocer la importancia y el influjo de la cultura y el pensamiento oriental y Japón en la obra de Lacan, para cuya tarea hemos tomado el eje del viaje que realizó al archipiélago en la primavera de A partir de esta coordenada de tiempo hemos retrocedido hasta la presencia del país oriental en la obra de Sigmund Freud y hemos referido la mención del mikado y de los ainus en Tótem y tabú. En cuanto al budismo, centro del interés de Lacan en este primer viaje a las isl...

  11. ÁCIDO ACÉTICO EN HUEVO DE TORTUGA (Lepidochelys olivacea

    Directory of Open Access Journals (Sweden)

    M\\u00F3nica Pereira-Zamora

    2010-01-01

    Full Text Available Este estudio se realizó en el Ce ntro Na cional de Cie ncia y Tecnología de Alimentos en el año 2000, con el fin de determinar la reducción de Vibrio mimicus en huevo de tortuga lora utilizando calor o ácido acético. Para ellos se determinó el tiempo de coagulación a diferentes temperaturas o niveles de pH con el fin de seleccionar los que podían utilizarse para la reducción del patógeno sin afectar las cualidades sensoriales del huevo crudo. Los huevos inoculados con Vibrio mimicus con cargas superiores a 6,0 log10UFC/g, fueron tratados con las diferentes alternativas de inmersión en agua caliente o soluciones de ácido acético por un tiempo determinado. Los tratamientos con calor (45, 55 ó 65ºC por 20 minutos lograron reducciones entre 1,4 y > 6,0 log10UFC/g, mientras que la inmersión en ácido acético (pH 3,0; 3,5; 4,0 ó 4;5 por una hora sólo logró reducciones entre 0,2 y 1,5 log10UFC/g causadas probablemente por la neutralización observada del pH en el tiempo.

  12. CARACTERIZACION FISICO-QUIMICA DEL HUEVO DEL CAIMAN LLANERO, CROCODYLUS INTERMADIUS, GRAVES 1819

    OpenAIRE

    Morales-Arango, Julián; Duarte-Guerrero, Marcela; Zúñiga, Herly

    2007-01-01

    Se determina algunas características físico-químicas del huevo Crocodylus intermedius tales como peso, morfometría, gravedad especifica, grosor de la cascara, calidad y cantidad del álbumen denso, concentración del calcio y fosforo inorgánico de la cascara, porcentaje de humedad en vitelo y albumen denso, contenido de proteína y contenido de grasa cruda. Los resultados obtenidos fueron peso (121.33 g), diámetro mayor longitudinal (84.12 mm), diámetro mayor transversal (51.64 mm), longitud per...

  13. Estudio del mercado del huevo como materia prima para la elaboración de ovoproductos

    OpenAIRE

    Zuluaga Duque, Diana María; Fernández Sierra, Pilar

    2014-01-01

    En este estudio se realiza una descripción de la industria de los ovoproductos en el departamento de Antioquia, abordado desde dos posiciones: aceptación del consumidor (ama de casa) y producción -- Para lograr este propósito, se realizó un estudio descriptivo con revisión de información de la industria del huevo y los ovoproductos tanto a nivel mundial como nacional y, lógicamente, en el departamento en cuestión -- Así mismo se realizaron entrevistas a un grupo de avicultores, y encuestas a ...

  14. Embriodiagnosis y ovoscopia. Análisis y control de calidad de los huevos incubables

    OpenAIRE

    Sandra Lisette Ricaurte Galindo. M.V.Z.

    2005-01-01

    El examén de los huevos claros o con embriones muertos durante el período de incubación con la ayuda de un Ovoscopio, puede resultar una herramienta útil es para el encargado de sala de incubación. Indudablemente para el Medico Veterinario Zootecnista se deben controlar los numerosos parámetros en la incubadora, asegurando así las necesidades que requiere el proceso de incubación para obtener el éxito. Estos parámetros incluyen por ejemplo, la temperatura apropiada de almacenamiento de los hu...

  15. Productividad y calidad del huevo de gallinas con niveles crecientes de harina de semilla de calabaza (Cucurbita maxima

    Directory of Open Access Journals (Sweden)

    Yordan Martínez Aguilar

    2012-01-01

    Full Text Available Un total de 160 gallinas ponedoras White Leghorn (Híbrido L-33 en pleno pico de potura, se ubicaron durante 91 días según diseño completamente aleatorizado, para evaluar el comportamiento productivo y la calidad del huevo. Se utilizaron cuatro tratamientos 0, 33, 66 y 100 g/kg de harina de semilla de calabaza, sustituyendo totalmente el aceite vegetal y parcial la torta de soya. Se tuvieron 20 repeticiones por tratamiento. No se evidenció morbilidad y mortalidad en las gallinas ponedoras con la inclusión de la semilla en las dietas. Además no se detectaron diferencias significativas (P>0.05 entre tratamientos para la producción de huevos, viabilidad, consumo de energía metabolizable y nutrientes (excepto para fibra cruda y extracto etéreo, peso del huevo, altura de la clara densa, altura de la yema, grosor de la cáscara, huevos no aptos y calidad sensorial del huevo (sabor, olor y textura. Para los tratamientos con 66 y 100 g/kg de harina de semilla de calabaza se observó un aumento en el peso final de las gallinas en 61 y 66 g, respectivamente en comparación con el tratamiento testigo. Los resultados obtenidos permiten recomendar la inclusión de hasta 100 g/kg de harina de semilla de calabaza en las dietas de gallinas ponedoras, sin alterar el comportamiento productivo y la calidad del huevo.

  16. Metodo para montaje permanente de huevos de helmintos enteroparasitos Definitive preservation of helminthic eggs

    Directory of Open Access Journals (Sweden)

    Victor Muñoz

    1990-04-01

    Full Text Available Se comunican resultados obtenidos empleando Medio de Hoyer para el montaje de huevos de helmintos enteroparásitos, destinado a preparaciones para colecciones docentes y/o de investigación. La utilización de esta técnica en muestras fecales conteniendo huevos de A. lumbricoides, T. trichiura, Uncinaria sp., Taenia sp., Diphyllobothrium sp., H. nana, H. diminuta y F. hepática, permitió la correcta observación de ellos en lecturas iniciadas a las 24 horas y mantenidas hasta 180 días después.The results using the Hoyer method for examining eggs of helminths enteroparasites are presented. This method is particularly swited for teaching and on research purposes. Using this technique in fecal sample containing eggs of A.lumbricoides, T. trichiura, Uncinaria sp., Taenia sp., Diphyllobothrium sp., H. nana, H. diminuta and F. hepática allowed the correct identification of then after 24 hours up to 180 days after the samples were obtained.

  17. Uso de un aditivo a base de cantaxantina y extracto de achiote en dietas de gallinas de postura y su efecto sobre la coloración de la yema y la vida de anaquel del huevo

    Directory of Open Access Journals (Sweden)

    Víctor Rojas V.

    2015-01-01

    Full Text Available El objetivo del presente trabajo fue evaluar el uso de un aditivo a base de cantaxantina y extracto de achiote (Bixa orellana L. en dietas de gallinas de postura y su efecto sobre la coloración de la yema y la vida de anaquel del huevo. Se utilizaron 864 gallinas postura de 34 a 45 semanas de edad, distribuidas en un diseño completamente al azar con 6 repeticiones por tratamiento. Los tratamientos fueron T0 (dieta control, T1 (T0 + 30 g de cantaxantina y extracto de achiote y T2 (T0 + 60 g de cantaxantina y extracto de achiote. Los resultados obtenidos fueron de 88,6; 91,9 y 90,8 % para porcentaje de postura; 60,5; 61,6 y 61,5 g para peso de huevo; 53,6; 56,4 y 55,7 g para masa de huevo. La coloración de yema a temperatura de 7 °C para escala roche fue de 6, 9 y 12 por colorimétrico Minolta para “L” 42,10; 40,24 y 39,65; para “a” de 0,07; 3,68 y 6,44 y para “b” de 19,35; 18,36 y 18,18. La vida de anaquel a temperatura de 7 °C fue de 81, 86 y 90 UH. La peroxidación lipídica fue de 0,10; 0,07 y 0,05 μmol MDA.g-1 de yema; para T0, T1 y T2 respectivamente. En todas las variables indicadas se encontraron diferencias estadísticas significativas entre tratamientos (p < 0,05. El consumo de alimento fue de 103,9; 109,2 y 107,5 g y la conversión alimenticia de 1,94; 1,93 y 1,92. Se concluye que la adición de cantaxantina y extracto de achiote a 30 y 60 g t-1 de alimento respecto al testigo, mejoró los parámetros de rendimiento, coloración de yema y la vida de anaquel del huevo.

  18. RETENCIÓN DE HUEVOS EN HEMBRA DE JABOTÍ-PIRANGA (Geochelone carbonaria - Spix, 1824 EN CAUTIVERIO

    Directory of Open Access Journals (Sweden)

    Fabiana Rodrigues da Silbeira, M.V

    2009-12-01

    Full Text Available Un Jabotí-Piranga adulto (Geochelone carbonaria, hembra, con peso de 3.5 kg ingresó por consulta en la escuela clínica “Dr. Cataldi Luiz de Souza”, del “Centro Universitário Serra dos Órgãos - Teresopolis, Río de Janeiro”, con historia de retención de huevos. En la evaluación clínica y radiológica, se encontró tres huevos en posiciones normales. Teniendo en cuenta la temporada de reproducción, se aconsejó la observación del animal. Después de un año, dicho animal regresó a la clínica por no haber todavía expulsado los huevos. Tras nuevo examen radiográfico se observó que los 3 huevos continuaban en la misma posición. A continuación, se aplicó 0.03 ml de oxitocina por vía subcutanea (10 UI x ml, en el apéndice anterior del animal. Tres horas después de la aplicación de la hormona, el animal expulsó los huevos naturalmente, sin la necesidad de una intervención quirúrgica, con lo que se puede sospechar de la eficacia de la aplicación de oxitocina para este procedimiento en jabotí Piranga.

  19. Evaluación del impacto de la intervención educativa-motivacional "Como Jugando" para prevenir la obesidad en escolares del Cercado de Lima: resultados al primer año

    Directory of Open Access Journals (Sweden)

    Juan Pablo Aparco

    Full Text Available RESUMEN Objetivo. Determinar el impacto, al primer año, de la intervención educativa-motivacional "Como Jugando" sobre el índice de masa corporal (IMC, conocimientos en alimentación, niveles de actividad física y patrones de consumo alimentario en escolares del 1.° al 4.° grado de primaria, de cuatro instituciones educativas (IE del Cercado de Lima. Materiales y métodos. Estudio cuasiexperimental, controlado. Se evaluó el IMC, conocimientos en nutrición, frecuencia de consumo de alimentos y nivel de actividad física. "Como Jugando" incluyó actividades lúdicas y vivenciales para escolares e involucró a docentes y padres. El impacto se estimó aplicando la prueba de McNemar para muestras relacionadas y modelos de regresión de diferencias en diferencias ajustados por variables relativas al escolar y la madre. Resultados. El estudio incluyó a 696 escolares de 2 IE de intervención y 2 IE de control, el puntaje Z de IMC y las prevalencias de obesidad no variaron durante el periodo de estudio. La intervención mostró impacto en mejorar los conocimientos en nutrición (OR: 1,46; IC95%: 1,17-1,81 redujo el riesgo de tener un nivel malo de actividad física (OR: 0,63; IC95%: 0,46-0,87 y mejoró los patrones de consumo de todos los alimentos, salvo verduras (grupo intervención. Conclusiones. La intervención "Como Jugando", al primer año de implementación, no redujo el Puntaje Z del IMC, sin embargo, tuvo impacto sobre los conocimientos en nutrición, redujo la probabilidad de tener un nivel malo de actividad física y mantuvo o aumentó la frecuencia adecuada del consumo de frutas, agua sin azúcar, jugos envasados y galletas dulces y saladas. Es necesario continuar evaluando la intervención "Como Jugando" para estimar el impacto sobre indicadores biológicos.

  20. CAUSAS DE MORTALIDAD EMBRIONARIA EN LA INCUBACION NATURAL Y ARTIFICIAL DE HUEVOS DE PATA CRIOLLA (Cairina moschata doméstica L.)

    OpenAIRE

    Ortiz Chavez, Hilario Hildebrando; Universidad Nacional Agraria La Molina (Perú).; Cumpa Gavidia, Marcial Estanislao

    2016-01-01

    como en incubación artificial de los huevos de pata Criolla. Para ello, se incubaron en total 900 huevos, de los cuales 778 fueron fértiles. Los resultados mostraron que el almacenamiento de los huevos en el nido hasta por tres semanas permitió una mayor viabilidad de los embriones, en comparación con el almacenamiento en sala para incubación artificial. Las causas principales de mortalidad embrionaria, tanto en incubación natural como en la artificial son consecuencia de la contaminación de ...

  1. Efecto de la edad al primer parto y los días abiertos en un bovino doble propósito sobre la huella hídrica y de carbono

    Directory of Open Access Journals (Sweden)

    Raúl Andrés Molina Benavides

    2016-12-01

    Full Text Available La actividad ganadera contribuye con la emisión de gases de efecto invernadero (EGEI y el consumo de agua fresca (CA. Por ende, el objetivo de esta investigación fue estimar el efecto de la edad al primer parto (EPP y los días abiertos (DA en un bovino doble propósito en pastoreo, trópico bajo colombiano, sobre las EGEI y el CA. Esta estimación se logró integrando 4 metodologías existentes: Dinámica de Sistemas, Large Ruminal Nutrition System, Huella de carbono y Huella hídrica. Durante toda su vida, 91 meses, desde el nacimiento hasta el sacrificio, la vaca produjo 5.879 kg de leche -4 lactancias-, emitió 16.066 kg CO2eq y consumió 12.804.569 L de agua. Al disminuir la EPP en un mes, el CA y  las EGEI se redujeron en 123.156 l y 155 kg CO2eq, respectivamente. Cuando se  mermaron los DA en 21, las EGEI bajaron 647 kg CO2eq y el CA se redujo en 455.455 L. Parámetros reproductivos como la EPP y los DA tienen una fuerte influencia sobre la dinámica del animal en el hato,  afectando su productividad, emisiones de gases de efecto invernadero y consumo de agua. 

  2. Efecto de la zona de vida y la altitud en la mortalidad y adaptabilidad al primer ano de especies forest ales en la cordillera volcanica central, Costa Rica

    Directory of Open Access Journals (Sweden)

    Yorleny Badilla

    2002-01-01

    Full Text Available Se presenta los resultados de la mortalidad y adaptabilidad a los 6 y 12 meses de edad, de las especies forestales cipres (Cupressus lusitanica, eucalipto de altura (Eucalyptus globulus, pino patula (Pinus patula, pino radiata (Pinus radia- fa, roble encino (Quercus coopeyensis,jaul (Al- nus acuminata, cedro dulce (Cedrela tonduzii y tirra (Ulmus mexicana. De cada especie fueron plantadas 4 repeticiones dentro de cada una de las 3 zonas de vida de mayor representatividade la Cordillera Volcanica Central de Costa Rica, predesde los 1000 a los 2000 m de altitud. Se regis- tro una tendencia de mayor mortalidad conforme aumento la pluviosidad. Las 3 especies confferas mostraron desde los 6 meses la menor mortalidad «15% y mayor estabilidad en todas las zonas de pluvida; presentaron un alto potencial de reforesta- cion en toda la Cordillera Volcanica Central. Las especies cella dulce, tirra y jaul conformaron un grupo de especies con una mortalidad elevada, que se estabiliz6 hasta el ano de plantadas. Las especies eucalipto de altura y fable conformaron el grupo de mayor mortalidad (>50% y de adap- tabilidad mas lenta. Sin embargo, el eucalipto de altura mostro un buen crecimiento en sitios plu- viales. Un mayor cuidado de la calidad del mate- adaptrial de reforestaci6n y el empleo de tecnicas de plantaci6n como los camellones, la aporca y el drenaje, son esenciales para poder reforestar en nurszonas de altura con una elevada pluviosidad.

  3. Perfil cognitivo y prevalencia de depresión, desesperanza y riesgo suicida en jóvenes vinculados al primer nivel de formación en una escuela militar colombiana

    Directory of Open Access Journals (Sweden)

    Daniella Abello Luque

    2016-01-01

    Full Text Available Este estudio evaluó el perfil cognitivo y los niveles de desesperanza, depresión y riesgo suicida en un grupo de jóvenes vinculados al proceso de formación de una escuela militar colombiana. En total participaron 114 sujetos, militares regulares de primer año (MR-1A, que representan la totalidad de un contingente particular; todos ellos hombres, con edades entre los diecisiete y los veintidós años, provenientes de hogares ubicados en la región Caribe (41% y el centro del país (12%, sin ningún tipo de diagnóstico médico o mental relevante. Los resultados indican relaciones lineales y directamente promocionales entre todas las variables, con magnitudes significativas en lo referente a las relaciones depresión-desesperanza (rs= 0,295; ρ= 0,01 y depresión-riesgo suicida (rs= 0,478; ρ= 0,01, siendo esta ultima el reporte más elevado.

  4. Asset management primer

    Science.gov (United States)

    1999-12-01

    According to this primer, asset management is a systematic process of maintaining, upgrading, and operating physical assets cost-effectively. It combines engineering principles with sound business practices and economic theory, and it provides tools ...

  5. Características físicas del huevo incubable y pollitos nacidos de reproductores pesados cobb 500 en incubadoras con diferente humedad relativa

    Directory of Open Access Journals (Sweden)

    BAKKER, M.

    2013-12-01

    Full Text Available Las características físicas del huevo incubable (peso –PH–, calidad de cáscara –C– y pérdida de humedad–H– y pollitos nacidos (peso –PP– y porcentaje de nacimientos –N– de reproductores pesados Cobb 500 deentre 28 y 65 semanas de edad, fueron evaluadas en tres incubadoras con diferente humedad relativa (HRy comparados con los valores estándares para la línea genética. En todas las semanas de edad el PH (56,7-73,2 g fue 0,9 y 6,5% mayor (p<0,05 que el estándar (56,2-68,4 g, posiblemente vinculado al manejo del lote fuera de estación y en galpones abiertos; en consecuencia, el PP (49±3 g y la relación PP/PH (71±0,01%fueron mayores (p<0,05 que el estándar (34-46 g y 66-68%, respectivamente.

  6. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the

  7. Evaluation in white mice of the infectivity of egs of Lagochilascaris minor (Nematoda: ascarididae, incubated by decortication with sodium hypochlorite (NaOCl Evaluación en ratones albinos de la infectividad de huevos de Lagochilascaris minor (Nematoma: ascarididae, incubados con substancias preservadoras de uso frecuente. Incremento por el descortezamiento con Hipoclorito de Sodio

    Directory of Open Access Journals (Sweden)

    Gregorio S. Volcán

    1993-04-01

    Full Text Available White mice were used to study the infectivity of the eggs of Lagochilascaris minor Leiper, 1909 after incubation in liquid media, with or without preservative substances. Potassium bichromate (K2Cr2O7 at 1% restrict hatching, while 1% formalin gave a greater larval yield. Incubation of eggs in distilled water, in Roux or Falcon flasks gave a good yield, whether the eggs were obtained from human feces or from experimentally infected cats. Treatment of eggs with Sodium hypochlorite (NaOCl at 5.25% for 2 min prior to inoculation, produced a notable increment of the larval yield in the infections.Fue realizado un estudio para determinar las variaciones en la infectividad de huevos de Lagochilascaris minor Leiper, 1909, cuando son incubados en medios líquidos con o sin substancias preservadoras, usándose como modelo experimental al ratón blanco. El agregado de Bicromato de Potasio (K2Cr2O7 al 1% en el medio de incubación, restringe la eclosión de los huevos del parásito, mientras que el uso de Formalina al 1% produce un mayor rendimiento. La incubación de huevo del parásito en agua destilada usando recipientes tipo Roux o modelo Falcón, se mostró con un buen rendimiento, aún cuando estas experiencias se realizaron c|n heces humanas, o de gatos experimentalmente infectados. El uso de Hipoclorito de Sodio (NaOCl al 5,25% por 2 minutos, antes de la inoculación en los ratones albinos, produjo un notable incremento del rendimiento en las infecciones.

  8. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  9. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  10. Accidentes laborales asociados al desánimo de médicos SERUMS para laborar en el primer nivel de atención de Lima, Perú

    Science.gov (United States)

    Mejia, Christian R.; Valladares-Garrido, Mario J.; Romero, Brian M.; Valladares-Garrido, Danai; Linares-Reyes, Edgardo

    2018-01-01

    Introducción la retención laboral es un tema de suma importancia, porque se requiere de profesionales en el primer nivel de atención (PNA). El objetivo fue determinar si los accidentes laborales se asociaron al desánimo de los médicos para trabajar en el PNA de Lima, Perú. Métodos estudio transversal analítico de datos secundarios de una base de datos generada de una encuesta a médicos que realizaron su Servicio Rural y Urbano-Marginal en Salud (SERUMS). Se incluyó solo a los médicos que manifestaron al inicio del SERUMS que podían trabajar en el PNA de Lima. Se definió como cambio de intención de trabajo en el PNA a los que finalizando el SERUMS refirieron que ya no deseaban laborar en Lima. Esto se asoció según si tuvieron un accidente laboral y se ajustó por otras variables. Resultados de los 124 médicos el 63% fueron hombres (78). La mediana de edad fue de 26 años (rango intercuartílico: 25-27 años). Después de su SERUMS, el 12% (15) manifestó que cambió su interés y que deseaba trabajar en la capital. En el análisis multivariado, haber tenido un accidente laboral disminuyó la frecuencia del cambio de intención de trabajo en el PNA (RPa: 0.28, IC 95%: 0.14-0.54, p accidentes laborales disminuyeron la frecuencia de trabajar en provincias, pero nuestro estudio dice lo contrario, posiblemente por la percepción de que un trabajo en la capital del país permite estar más cerca de los servicios para ser atendido en caso de cualquier emergencia. PMID:29190859

  11. Primer on Water Quality

    Science.gov (United States)

    ... fs-027-01.pdf--665KB A Primer on Water Quality What is in the water? Is it safe for drinking? Can fish and ... affect water quality. What do we mean by "water quality"? Water quality can be thought of as ...

  12. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  13. Variables ambientales y abundancia de los huevos de Anchoa mitchilli (Pisces: Engraulidae en la laguna de Tamiahua, México

    Directory of Open Access Journals (Sweden)

    Carlos Díaz-Avalos

    2003-06-01

    Full Text Available Se estudió la abundancia de huevos de Anchoa mitchilli (Cuvier y Valenciennes 1848 en la laguna de Tamiahua, Ver. durante tres ciclos anuales (84-85, 85-86 y 86-87, para determinar zonas y épocas de alta concentración de huevos y su posible asociación con variables como temperatura, salinidad, transparencia y profundidad, así como con factores espacio-temporales como posición geográfica, época climática y el ciclo anual de recolecta. Para probar estadísticamente la asociación de la abundancia de huevos con dichos factores y variables se ajusto un Modelo Lineal Generalizado (MLG con error tipo Gamma. Los resultados del modelo ajustado sugieren que no todas las variables tienen un efecto significativo sobre la abundancia de huevos (t de Student, p >0.05. Las variables que resultaron estadísticamente significativas indican la presencia de un componente estacional y que la salinidad tiene un efecto condicional a la localidad. Las mayores abundancias promedio durante los tres ciclos de recolecta ocurrieron siempre durante el verano. Asimismo, debido a la presencia de interacciones significativas (t de Student, pEgg abundance of Anchoa mitchilli was studied in Laguna de Tamiahua, Veracruz during three annual cycles (84-85, 85-86 and 86-87. Our goal was to detect areas and seasons with high egg abundance and the possible association of such areas and seasons with covariates such as temperature, salinity, transparency, depth, location, season and year. The association was tested statistically using a Generalized Linear Model (GLM with Gamma type error. The results suggest that not all the covariates considered have a significant effect on egg abundance (Student’s T, p>0.005. The significant effects show the presence of a seasonal component and that the effect of salinity on egg abundance is conditional to location. High average egg abundances for the three annual cycles were observed during summer. The presence of significant interactions

  14. ENRIQUECIMIENTO DE HUEVOS CON ÁCIDOS GRASOS OMEGA-3 MEDIANTE LA SUPLEMENTACIÓN CON SEMILLA DE LINO (Linum usitatissimum) EN LA DIETA

    OpenAIRE

    Betancour t, Liliana; Díaz, Gonzalo

    2009-01-01

    Objetivo. Enriquecer los huevos de gallina con ácidos grasos omega-3 (n-3) mediante la inclusión de semillas de lino en la dieta. Materiales y métodos. La dieta de las aves fue formulada con niveles de 0 (L0), 10 (L10), 15 (L15) y 20% (L20) de linaza. Se determinó la composición de ácidos grasos por cromatografía de gases y se evaluó la producción y calidad del huevo. Resultados. El porcentaje de producción de huevo fue superior en los grupos L0 y L15 (p

  15. Infección inducida en el roedor selvático Dasyprocta leporina (Rodentia: Dasyproctidae), con huevos larvados de Lagochilascaris minor (Nematoda: Ascarididae)

    OpenAIRE

    Gregorio,S.; Volcán,G.; Clemencia,E.; Medrano,P.

    1990-01-01

    Ejemplares de Dasyprocta leporina Linnaeus, 1758 fueron criados alejados de su ambiente natural. A los 3 ó 4 meses de edad, se los inoculó por vía oral con huevos de Lagochilascaris minor Leiper, 1909 obtenidos de una paciente nativa. Los huevos se los incubó por más de 80 dias, para que de ellos fuese posible obtener por compresión mecánica, larvas que se mantuviesen vivas en medio acuoso por 48 horas o más. Sacrificados los animales a los 14 ó 46 dias posteriores a la infección, se hallaron...

  16. Relación entre colesterol dietario, consumo de huevo y perfil lipídico en adultos aparentemente sanos, según grupos de edad

    OpenAIRE

    Oriondo Gates, Rosa Lorenza; Bernui Leo, Ivonne; Valdivieso Izquierdo, Lázaro Rubén; Estrada Menacho, Enriqueta

    2013-01-01

    Objetivos: Evaluar la relación entre el colesterol dietario, consumo de huevo y el perfíl lipídico en adultos aparentemente sanos, según grupo etario. Diseño: Estudio descriptivo, de asociación cruzada. Institución: Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Perú. Participantes: Adultos aparentemente sanos. Intervenciones: En 50 adultos aparentemente sanos se determinó el consumo de colesterol dietario, huevo y perf...

  17. OBTENCIÓN DE ANTICUERPOS POLICLONALES IgY ANTIPARVOVIRUS CANINO A PARTIR DE YEMA DE HUEVO DE GALLINA

    Directory of Open Access Journals (Sweden)

    Pinto, J.

    2005-06-01

    Full Text Available Inmunizando un grupo de diez gallinas de postura raza Lohmann de 16 semanas de edad con parvovirus canino (CPV cepa vacunal, se obtuvieron anticuerpos IgY policlonales contra CPV en yema de huevo.En la extracción de los anticuerpos de la yema se requirieron dos pasos, el primero para la remoción de lípidos y el segundo para la precipitación de proteínas. Para la remoción de lípidos se usó el método PBS:Cloroformo y para la precipitación de los anticuerpos solubles (Inmunoglobulinas-IgY se usó el método de salting-out con sulfato de amonio ((NH42SO4. La evaluación del proceso se efectuó empleando el método comercial estándar “EGGstract IgY Purification System®” de PROMEGA.La metodología empleada permitió la obtención de anticuerpos IgY policlonales contra CPV a partir de yema de huevo de gallina en concentraciones altas por mililitro de yema, con una pureza aceptable y títulos altos; los resultados fueron comparables con el método comercial.

  18. Ultraestructura de los huevos de dos mariposas nocturnas de Chile: Ormiscodes socialis y Polythysana cinerascens (Lepidoptera: Saturniidae

    Directory of Open Access Journals (Sweden)

    Alfonso Benítez-Mora

    2006-12-01

    Full Text Available Se describe la estructura y ultraestructura de los huevos de las especies Ormiscodes socialis (Feisthamel y Polythysana cinerascens (Philippi, considerando la forma, tamaño, color, tipo de ovipostura, y aeropilas (cantidad, distribución y proporción en el área micropilar, entre otros. La ultraestructura es mostrada a través de las celdas primarias, celdas secundarias, aeropilas y micropilas; además se incluye a la especie ya descrita Adetomeris microphthalma (Philippi y se confecciona un cuadro comparativo para los huevos de estas especies. Se registra como nuevo hospedero de P. Cinerascens a Myoschilos oblonga Ruiz y Pavón (Santalaceae.Egg ultrastructure in two Chilean moths: Ormiscodes socialis y Polythysana cinerascens (Lepidoptera: Saturniidae. The structure and ultra-structure of the eggs from Ormiscodes socialis (Feisthamel and Polythysana cinerascens (Philippi are described, considering shape, size, coloring when recently laid, oviposition type nd aeropiles (quantity, distribution and proportion in the micropilar area, among others. The ultra-structure is shown for primary cells, secondary cells, aeropiles and icropiles. A comparative table of the eggs of these species is presented and includes the previously described eggs of Adetomeris microphthalma (Philippi. Myoschilos oblonga Ruiz y Pavón (Santalaceae is recorded as a new host for P. cinerascens. Rev. Biol. Trop. 54 (4: 1085-1091. Epub 2006 Dec. 15.

  19. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  20. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  1. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  2. Response of first attack of inflammatory bowel disease requiring hospital admission to steroid therapy Respuesta al tratamiento esteroideo del primer brote de enfermedad inflamatoria intestinal que requiere ingreso hospitalario

    Directory of Open Access Journals (Sweden)

    M. Abu-Suboh Abadía

    2004-08-01

    Full Text Available Introduction: corticoid administration is the usual treatment of Crohn' disease (CD and ulcerative colitis (UC attacks. How-ever, information available on response rates and their predictive factors is scarce. Objective: to establish response to steroidal treatment in an homogeneous group of patients with CD or UC during their first admission to hospital. Methods: restrospective analysis of 86 patients who received systemic steroidal treatment for a severe flare-up during their first hospital admission between 1995 and 2000. Patients were treated per protocol with fluid therapy, absolute diet, IV 6-methyl-prednisolone 1 mg/kg/day, and enoxaparin at prophylactic doses. Clinical response at 30 days was considered good in case of complete remission, and poor in case of partial or absent remission. Univariate and multivariate analyses according to non-parametric statistics were performed for sociodemographic and biologic variables. Results: 45 patients with CD and 41 with UC were included. Good response rates were 64.4% for CD and 60.9% for UC. The univariate analysis showed that patients with good response have shorter evolution times and fewer previous flare-ups (p Introducción: la administración de corticoides constituye el tratamiento habitual de los brotes de enfermedad de Crohn (EC y colitis ulcerosa (CU. Sin embargo, existe poca información sobre las tasas de respuesta y los factores que puedan predecirla. Objetivo: determinar la respuesta al tratamiento esteroideo en un grupo homogéneo de pacientes de EC y CU que ingresan por primera vez en el hospital. Métodos: análisis retrospectivo de 86 pacientes que en su primer ingreso hospitalario recibieron tratamiento esteroideo sistémico por brote grave de EC o CU entre 1995 y 2000. Fueron tratados de forma protocolizada con sueroterapia, dieta absoluta, 6-metil-prednisolona 1 mg/kg/día IV y enoxaparina a dosis profilácticas. Se ha considerado la respuesta clínica a los 30 días como

  3. El huevo de la serpiente al sur del mundo: desarrollo y supervivencia de la ciencia nazi en Chile (1908 -1951

    Directory of Open Access Journals (Sweden)

    Leyton, César

    2014-12-01

    Full Text Available The paper presents, mainly through the figure of Dr. Max Westenhoffer and in a work of Drs. Barrientos and Schirmer (1937, the connections between the development of medicine and anthropology in Chile with the development of the biological determinist thought and racism in Europe. Chilean Physicians and anthropologists as Otto Aichel, Aureliano Oyarzún, Edgardo Schirmer and Juvenal Barrientos indicate the direct relationship of the Chilean scientific program of the early twentieth century with the hereditarian and racist program, which reached its climax with the Nazi eugenics.El trabajo aborda, principalmente a partir de la figura del Dr. Max Westenhoffer y de un trabajo de los Drs. Barrientos y Schirmer de 1937, las conexiones que presenta el desarrollo de la medicina y la antropología en Chile con el pensamiento determinista biológico y racista en Europa. Médicos y antropólogos chilenos como Otto Aichel, Aureliano Oyarzún, Edgardo Schirmer y Juvenal Barrientos dan cuenta de la relación directa de una parte del programa científico chileno de la primera mitad del siglo XX con el programa hereditarista y racista, que alcanzó su punto cúlmine con la eugenesia y la antropología nazi.

  4. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  5. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  6. Una nueva técnica para el estudio microscópico de los huevos de Anopheles Una nueva técnica para el estudio microscópico de los huevos de Anopheles

    Directory of Open Access Journals (Sweden)

    Osorno-Mesa Ernesto

    1947-12-01

    Full Text Available A new method is described for dissection and mounting of the exochorion of Anopheles eggs, for microscopic study, which has advantages over previous methods. The possible taxocomic importance of the morphology of the micropyle, clearly seen by this method, is noted. Se describe una técnica original para el estudio microscópico de los huevos de Anopheles, fundamentada en la disección del exocorion, indicando las grandes ventajas que tiene. Se anota la importancia taxonómica que pueda tener la morfología del micrópilo. / Abstract. A new method is described for dissection and mounting of the exochorion of Anopheles eggs, for microscopic study, which has advantages over previous methods. The possible taxocomic importance of the morphology of the micropyle, clearly seen by this method, is noted.

  7. APROXIMACIÓN AL CONCEPTO DE ESCALA EN EL PRIMER CICLO DE EDUCACIÓN PRIMARIA. PRESENTACIÓN DE UN JUEGO PARA SU TRATAMIENTO DESDE LA ENSEÑANZA ACTIVA

    Directory of Open Access Journals (Sweden)

    María Jesús Marrón Gaite

    2012-12-01

    Full Text Available Resumen:El objetivo esencial del presente artículo es presentar un juego didáctico que hemos diseñado para facilitar al alumnado del primer ciclo de Educación Primaria la comprensión del concepto básico de escala, con el objetivo de prepararle cognitivamente para la correcta interpretación, en cursos superiores, de este convencionalismo en planos y mapas. La investigación empírica que del mismo hemos realizado, experimentándolo en centros educativos de la ciudad de Madrid, ha puesto de manifiesto su alto grado de utilidad para la enseñanza-aprendizaje del tema. Su empleo en el aula ha supuesto el tratamiento del mismo desde la enseñanza activa, que concede un papel esencial a la metodología lúdica, y ha permitido la consecución de aprendizajes significativos por parte de los escolares a partir de sus ideas y representaciones conceptuales previas.Palabras clave:Convencionalismos cartográficos, escala, enseñanza activa, metodología lúdica, aprendizaje significativo.Abstract:The main objective of the present paper is to introduce a didactic play designed in order to help the students of early years of primary education the understanding of the concept of scale. The understanding of this concept prepare them to the correct interpretation, in further years, of this conventionalism in plans and maps. Empirical research we have conducted on the effectiveness of this material, testing in schools in the city of Madrid, has shown a high degree of usefulness for teaching and learning the subject. The use of this material in the classroom has been done from active teaching, giving a central role to the ludic methodology, and has allowed the achievement of meaningful learning by the students from their previous ideas and conceptual representations.Key words:Cartographic conventionalisms, scale, active teaching, ludic methodology, meaningful learning.Résumé:Le présent article a comme objectif principal, présenter un jéu didactique que

  8. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... were used, for the screening of the transformed plants (Pietsch et al., 1997). To verify the amplification of extracted DNAs, a pair of primers CDC(a).F/CDC(a).R targeting the cell division control gene was used (Gimenez et al., 2011). The primers were synthetized using Polyplex machine (Gene machine, ...

  9. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  10. Encapsulated Multifunction Corrosion Inhibitive Primer.

    Science.gov (United States)

    1983-11-01

    with the environment of the primer formu- lation. Thus, prior to spray application, the microcapsules would be combined with the epoxy- polyamide primer...loading was not possible. Problems were encountered when the toluene suspensions of microcapsules were blended 302 into the polyamide component. The low...the primer is an epoxy- polyamide , which is applied under the polyurethane top- coat. The polyurea microcapsules are more similar in their chemical pro

  11. OBTENCIÓN DE ANTICUERPOS POLICLONALES IgY ANTIPARVOVIRUS CANINO A PARTIR DE YEMA DE HUEVO DE GALLINA

    OpenAIRE

    Pinto, J.; Unidad de Investigaciones Agropecuarias (UNIDIA) Microbiología Agrícola y Veterinaria Facltad de Ciencias Pontificia Universidad Javeriana, Bogotá; Barco, M.; Unidad de Investigaciones Agropecuarias (UNIDIA) Microbiología Agrícola y Veterinaria Facltad de Ciencias Pontificia Universidad Javeriana, Bogotá; Afanador, M. C.; Unidad de Investigaciones Agropecuarias (UNIDIA) Microbiología Agrícola y Veterinaria Facltad de Ciencias Pontificia Universidad Javeriana, Bogotá; Merchán, A. M.; Unidad de Investigaciones Agropecuarias (UNIDIA) Microbiología Agrícola y Veterinaria Facltad de Ciencias Pontificia Universidad Javeriana, Bogotá; Montañez, M. F.; Purificación y Análisis de Fluidos Ltda. Bogotá,; Andrade, F.; Purificación y Análisis de Fluidos Ltda. Bogotá.; Torres, O.; Unidad de Investigaciones Agropecuarias (UNIDIA) Microbiología Agrícola y Veterinaria Facltad de Ciencias Pontificia Universidad Javeriana, Bogotá

    2005-01-01

    Inmunizando un grupo de diez gallinas de postura raza Lohmann de 16 semanas de edad con parvovirus canino (CPV) cepa vacunal, se obtuvieron anticuerpos IgY policlonales contra CPV en yema de huevo.En la extracción de los anticuerpos de la yema se requirieron dos pasos, el primero para la remoción de lípidos y el segundo para la precipitación de proteínas. Para la remoción de lípidos se usó el método PBS:Cloroformo y para la precipitación de los anticuerpos solubles (Inmunoglobulinas-IgY) se u...

  12. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  13. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  14. Penetración de vibrio mimicus a través de la cáscara del huevo de tortuga lora (lepidochelys olivacea)

    OpenAIRE

    M\\u00F3nica Pereira-Zamora; Francisco Hern\\u00E1ndez-Chavarr\\u00EDa; Eric Wong-Gonz\\u00E1lez

    2007-01-01

    Penetración de Vibrio mimicus a través de la cáscara del huevo de tortuga lora (Lepidochelys olivacea). El objetivo de esta investigación consistió en determinar la capacidad de penetración del Vibrio mimicus a través de la cáscara del huevo. La investigación se realizó en el Centro Nacional de Ciencia y Tecnología de Alimentos en el año 2000. Se inoculó la superfi cie de la cáscara con la bacteria y se procedió a incubar las muestras por 72 horas a 25°C. Después de este período se observaron...

  15. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  16. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Directory of Open Access Journals (Sweden)

    Ma Yaqin

    2008-05-01

    Full Text Available Abstract Background Microsatellite (simple sequence repeat – SSR and single nucleotide polymorphism (SNP markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. Results A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR, as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated

  17. Identificación de Lutzomyia spp. (Diptera: Psychodidae grupo verrucarum por medio de microscopia electrónica de sus huevos

    Directory of Open Access Journals (Sweden)

    Diana Sierra A

    2000-06-01

    Full Text Available En Colombia la microscopia electrónica de huevos de phlebotomineos para determinación de especies es nueva. Debido a la diversidad de especies e importancia médica del grupo verrucarum se estudiaron cuatro de estas especies: Lutzomyia youngi, Lutzomyia evansi, Lutzomyia columbiana y Lutzomyia longiflocosa. El modelo de superficie del huevo es poligonal. Lutzomyia youngi y Lutzomyia columbiana exhibieron un modelo pentagonal o hexagonal, Lutzomyia evansi polígonos elongados y Lutzomyia longiflocosa un modelo poligonal frecuentemente rectangular. La microscopia electrónica de huevos es confiable para identificar especies del grupo verrucarum.The value of Colombian phlebotomine eggs for species determination was studied with a scanning electron microscope. The species diversity and medical importance of the verrucarum group were the bases to select Lutzomyia youngi, Lutzomyia evansi, Lutzomyia columbiana and Lutzomyia longiflocosa. The egg surface was poligonal. Lutzomyia youngi, and Lutzomyia columbiana had pentagonal or hexagonal patterns; Lutzomyia evansi elongated polygons and Lutzomyia longiflocosa irregular polygonal sculpturing, frequently rectangular. Egg scanning electron microscopy is reliable to identify species of the verrucarum group.

  18. Transmisión de Salmonella enterica a través de huevos de gallina y su importancia en salud pública Transmission of Salmonella enterica through chicken eggs and their importance in public health.

    Directory of Open Access Journals (Sweden)

    Diana Paola Rincón Acero

    2011-08-01

    Full Text Available La salmonelosis producida por especies de Salmonella sp. no tíficas, se manifiesta en humanos como una gastroenteritis o enterocolitis aguda de inicio repentino, cuyos síntomas aparecen de 6 a 48 horas después de la ingestión de alimentos o agua contaminada. Salmonella se transmite principalmente por el consumo de productos avícolas contaminados o por contaminación cruzada a través de manipuladores de alimentos o utensilios de cocina. La presente revisión se fundamenta en la interacción de Salmonella con el sistema reproductivo de la gallina y trata importantes aspectos como las formas de trasmisión al huevo, la epidemiología y prevención de este evento. Lo anterior con el fin de destacar la importancia de este patógeno en la generación de enfermedades trasmitidas por alimentos y el impacto que tiene el control de puntos críticos en la cadena de producción de los huevos y la vigilancia epidemiológica como mecanismos de control. Salud UIS 2011; 43 (2: 167-177Salmonellosis caused by non-typhoidal Salmonella species manifests in human like an acute gastroenteritis or enterocolitis that suddenly happens, whose symptoms occur between 6 to 48 hours after ingestion of contaminated food or water. Salmonella is mainly transmitted through consumption of contaminated poultry products, or crossed contamination by food handlers or kitchen utensils. This review is based on the interaction of Salmonella with the hen's reproductive system and presents important aspects such as the routes of transmission to the egg, epidemiology and prevention of this event. This in order to highlight the importance of this pathogen like source of foodborne diseases and the impact of the critical control points in the eggs production and epidemiological surveillance like control mechanisms. Salud UIS 2011; 43 (2: 167-177

  19. Lead Free Electric Primer

    Science.gov (United States)

    2011-10-06

    resulted in a number of accidental ignitions. The true nanocomposite is significantly more ESD sensitive. Normally, a Tesla coil will set off the Al(80nm...Bi2O3 (2 µ) composite at a distance of 2 inches. The nanocomposite ignites when the Tesla coil gets within 10 to 12 inches. While the nanocomposite... valve was placed in the ice chest along with an abundant amount of dry ice. Appropriate plastic hoses were attached to the inlet and outlet fittings

  20. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  1. Intervención de los EOE especializados en atención temprana. Elaboración de una guía para profesionales que atienden al alumnado TEA en el primer ciclo de educación infantil

    OpenAIRE

    Rodríguez Somodevilla, Sonia

    2013-01-01

    Desde el curso escolar 2009-10 la Consejería de Educación de la Junta de Andalucía asumió las competencias educativas en el primer ciclo de Educación Infantil lo que llevó al EOEE en Atención Temprana de Málaga a plantearse la necesidad de elaborar una guía para proporcionar a todos los profesionales que atienden a los niños y niñas con Trastorno del Espectro Autista dentro de las Escuelas Infantiles, una información básica sobre qué es el Trastorno, la detección con las señales ...

  2. El secreto del huevo azul, de Catalina González Vilar. Estudio narratológico. The secret of the blue egg, by Catalina González Vilar. Narratological study

    Directory of Open Access Journals (Sweden)

    Miguel Sánchez-García

    2013-11-01

    Full Text Available This article discusses a narratological study of the literary work The secret of the blue egg, by the writer Catalina Gonzalez Vilar, that won El Barco de Vapor prize in 2012. It examines the different constitutive elements of the text (topic approach, prominent figures, syntactic structure, narrative technique… and his contribution to the development of the story with the purpose of discovering the aesthetic and literary values that contribute to the fable. It aims at demonstrating the proper use of them all as they shape a text rich in nuances, striking, suggestive. All these qualities of great importance both in creations aimed at adults as well as at children and young people because they enrich the final value of the work, and by extension, the cultural background of their readers.Este trabajo aborda el estudio narratológico de la obra El secreto del huevo azul, de la escritora Catalina González Vilar, que obtuvo el Premio El Barco de Vapor en el año 2012. Examina los diferentes elementos constitutivos del texto (el enfoque del tema, la caracterización de los personajes, la estructura sintáctica, el tratamiento del lenguaje, la técnica narrativa utilizada… y su aporte al desarrollo de la historia con la finalidad de descubrir los valores estéticos y literarios que aporta a la fábula. Pretende demostrar el adecuado uso de todos ellos dado que favorecen un texto rico en matices, llamativo, sugerente. Cualidades, todas ellas, de gran importancia tanto en creaciones destinadas al público adulto como al infantil y juvenil pues enriquece el valor final de la obra, y por extensión, el bagaje cultural de sus lectores.

  3. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  4. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omi...

  5. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  6. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  7. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  8. ENRIQUECIMIENTO DE HUEVOS CON ÁCIDOS GRASOS OMEGA-3 MEDIANTE LA SUPLEMENTACIÓN CON SEMILLA DE LINO (Linum usitatissimum EN LA DIETA

    Directory of Open Access Journals (Sweden)

    Gonzalo Díaz

    2009-04-01

    Full Text Available Objetivo. Enriquecer los huevos de gallina con ácidos grasos omega-3 (n-3 mediante la inclusión de semillas de lino en la dieta. Materiales y métodos. La dieta de las aves fue formulada con niveles de 0 (L0, 10 (L10, 15 (L15 y 20% (L20 de linaza. Se determinó la composición de ácidos grasos por cromatografía de gases y se evaluó la producción y calidad del huevo. Resultados. El porcentaje de producción de huevo fue superior en los grupos L0 y L15 (p<0.05 con 93,0 y 91,5% de producción comparada con 86,0 % en los grupos L10 y L20. La mejor conversión de alimento se presentó también en los grupos L0 y L15. Con la inclusión de semilla de lino, se incrementó el contenido de ácidos grasos n-3 desde 3,0 % en el grupo L0 hasta 12,6 % en el grupo L20, siendo los ácidos grasos n-3 á-linolénico (C18:3, n-3 y docosahexahenóico (DHA, C22:6, n-3 los hallados en mayor concentración. Con la inclusión de linaza en la dieta de las gallinas ponedoras se redujo el contenido de acido linoleico (C18:2n-6, lo cual resultó en una disminución en la relación n-6: n-3. Conclusiones. Con base en la evaluación económica se concluye que es posible enriquecer la yema de huevo de gallina hasta con un 10,1 % de ácidos grasos n-3 mediante la inclusión de un 15 % de linaza en la dieta de las gallinas, sin embargo, esto representó un sobrecosto de producción del 12%.

  9. Producción de plantas transgénicas de Solanum phureja variedad yema de huevo clon 1 mediada por Agrobacteriun tumefaciens

    OpenAIRE

    Chaparro Giraldo Alejandro; Díazgranados Daza Elba Cristina

    2006-01-01

    El objetivo general de este proyecto fue la producción de plantas transformadas genéticamente de S. phureja
    variedad Yema de Huevo Clon 1 que sean potencialmente tolerantes a insectos, rasgo conferido por la inserción
    en su genoma del gen mirl2 derivado del pomelo (Citrus paradisi) que codifica para un inhibidor de proteasas de
    tipo Serina. Se trabajó con el sistema de transformación mediado por Agrobacterium tumefaciens utilizando la cepa
    LBA4404 q...

  10. Producción de plantas transgénicas de Solanum phureja variedad yema de huevo clon 1 mediada por Agrobacteriun tumefaciens

    OpenAIRE

    Elba Cristina Díazgranados Daza; Alejandro Chaparro Giraldo

    2006-01-01

    El objetivo general de este proyecto fue la producción de plantas transformadas genéticamente de S. phureja variedad Yema de Huevo Clon 1 que sean potencialmente tolerantes a insectos, rasgo conferido por la inserción en su genoma del gen mirl2 derivado del pomelo (Citrus paradisi) que codifica para un inhibidor de proteasas de tipo Serina. Se trabajó con el sistema de transformación mediado por Agrobacterium tumefaciens utilizando la cepa LBA4404 que contiene el plásmido resident...

  11. Determinación del agente de acoplamiento en composites de bioPE y cáscara de huevo

    OpenAIRE

    Montañés Muñoz, Néstor; Boronat Vitoria, Teodomiro; Fenollar Gimeno, Octavio Ángel; Samper Madrigal, María Dolores; Carbonell Verdú, Alfredo

    2014-01-01

    En este trabajo se ha estudiado que agente de acoplamiento se debe utilizar para desarrollar un nuevo material compuesto de origen totalmente natural. El nuevo material compuesto utiliza como matriz un polietileno de base biológica y como material de refuerzo se ha utilizado cáscara de huevo (CH). Se ha utilizado CH con el fin de reemplazar mineral de carbonato cálcico como carga de polímero, que se utiliza comúnmente. Para mejorar la adhesión entre la matriz y la carga se ha e...

  12. Creencias de las profesoras de la Fundación Íntegramente. Un primer acercamiento al contexto sociocultural de la enseñanza de castellano a los inmigrantes de Santa Coloma de Gramenet

    Directory of Open Access Journals (Sweden)

    Hermes Diáz Ceniceros

    2010-06-01

    Full Text Available La constante llegada de inmigrantes a Cataluña provenientes de diferentes partes de África, Medio Oriente y Asia ha llevado a la creación de centros de acogida en los cuales se les ayuda a estos a integrarse socialmente. Uno de los centros en la mancha urbana de Barcelona es la Fundación Integramenet en Santa Coloma de Gramenet. En este apareció la necesidad de dar clases de castellano a los inmigrantes con el apoyo de profesores voluntarios. En este trabajo conoceremos los sistemas de creencias de los profesores con el objetivo de tener un primer acercamiento a las aulas de esta fundación. El método de investigación que utilizamos es el etnográfico y la herramienta con la cual recogimos los datos fue la entrevista semiabierta. Estas entrevistas las obtuvimos de cuatro informantes que llamamos Zafo, Helena, Sofía y Tere. Cada una de las entrevistas estuvo estructurada en torno a los temas de: cómo la profesión del profesor voluntario se relaciona con el sistema de creencias del profesor; cómo la previa experiencia de aprendizaje de una L2 sirve para preparar las clases; cómo se valora la multiculturalidad, y cómo los profesores se identifican con los problemas de los alumnos. En las entrevistas encontramos que los sistemas de creencias de los profesores se ven determinados en gran medida por la profesión. En cuanto a la experiencia de aprender una L2 encontramos que esta se aprovecha cuando las creencias profesionales lo permiten. De esta manera concluimos señalando la importancia de continuar nuestros estudios etnográficos sobre las creencias de los profesores y alumnos, con el propósito de poder en un futuro crear material de apoyo adecuado para esta clase de aulas.--------------------------------------------------------The continuous arrival of immigrants to Catalonia, coming from different parts of Africa, Middle East and Asia, has led to the creation of reception centres (welcome centres to help new arrivals integrate

  13. Datos biológicos de Doru luteipes (Dermaptera: Forficulidae en plantaciones de caña de azúcar y consumo de huevos de Diatraea saccharalis (Lepidoptera: Crambidae en condiciones de laboratorio Biological traits of Doru luteipes (Dermaptera: Forficulidae in sugar-cane crops, and consumption rates against Diatraea saccharalis eggs (Lepidoptera: Crambidae under laboratory conditions

    Directory of Open Access Journals (Sweden)

    Gladys M Romero Sueldo

    2009-12-01

    Full Text Available Diatraea saccharalis (Fabr. es considerada la principal plaga de la caña de azúcar en el noroeste argentino. El dermáptero Doru luteipes (Scudder desarrolla importantes poblaciones en dicho cultivo y ha sido descrito como predador de plagas en maíz, algodón y coles. El objetivo de este trabajo fue brindar información sobre algunos aspectos biológicos y estimar la capacidad de predación de las ninfas de Doru luteipes, a través de la tasa de consumo de huevos de Diatraea saccharalis. Se realizaron observaciones de campo y ensayos de laboratorio, en estos últimos se colocaron individualmente en tubos de ensayo, 50 ninfas de D. luteipes recién eclosionadas y se les ofrecía diariamente cien huevos de la plaga. La proporción de sexos de D. luteipes en campo fue de aproximadamente 1:1 y sus posturas presentaron una media de 31 huevos, con una tasa de emergencia cercana al 95%. El período de incubación se prolongó entre 6 y 10 días y el desarrollo de los estadios ninfales promedió los 37,6 días. Las ninfas pasaron por cuatro estadios y consumieron una media de 591,3 huevos de D. saccharalis. Estos resultados sugieren que D. luteipes desempeña un papel importante en el control natural de las poblaciones de D. saccharalis, por lo tanto, su presencia debería tenerse en cuenta al diseñar estrategias para controlar esta plaga.Diatraea saccharalis (Fabr. is considered the key pest of sugarcane crops in the Argentine northwest. The earwig Doru luteipes (Scudder develops high populations on sugarcane, and in other regions it was depicted as a significant predator of diverse pest in corn, cotton, and cabbage crops. The aim of this contribution is to inform about different biological parameters of this Dermaptera, and to assess the predatory capacity of its nymphs by means of the estimation of consumption rates using Diatraea saccharalis eggs. Both field and laboratory observations were carried out. In the latter, 50 neonate nymphs were

  14. Establecimiento de una metodología para la producción de semilla prebasica de papa criolla variedad "Yema de huevo" (Solanum phureja Juz et Buk a partir de minituberculos

    Directory of Open Access Journals (Sweden)

    Cotes Jose M.

    1999-12-01

    Full Text Available

    En la actualidad, para la producción de semilla de papa, se utiliza, como herramienta, la técnica de micropropagacion, la cual garantiza, mediante un adecuado proceso. alta sanidad de los tubérculos semilla y una rápida multiplicación. En la papa diploide Solanum phureja cultivar "yema de huevo", la multiplicación "in vitro" fue desarrollada exitosamente y, par lo tanto, el paso siguiente, la producción de minituberculos en casa de malla (Semilla prebasica requiere de los estudios necesarios para optimizar esta fase. El presente trabajo tuvo como objetivo conocer la densidad y el tamaño del minituberculo semilla óptimos para desarrollar la producción de semilla prebasica en condiciones de casa malla. La investigación se realizo bajo un diseño completamente a1 azar, con arreglo factorial (4x3, siendo el primer factor la distancia entre plantas y, el segundo, cl diámetro del minituberculo semilla. El experimento se realizo en casa de malla en la Estación San Jorge del ICA a 2800 msnm y repetido durante dos semestres consecutivos. Se encontró que la distancia de 6 cm entre sitios de siembra optimiza la producción de semilla prebasica y la distancia de 12 cm entre sitios de siembra, la tasa de multiplicaci6n. Los mejores diámetros de minituberculo son los comprendidos entre 0,5 y 2 cm

     

    Palabras claves:

  15. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  16. El Primer Ferrocarril En Colombia

    Directory of Open Access Journals (Sweden)

    Gabriel Poveda

    2002-01-01

    Full Text Available Se presenta la historia de los preparativos, la construcción y el funcionamiento del primer ferrocarril que existió en el territorio de la actual Colombia (sin incluir a Panamá que unió a Barranquilla con el mar Caribe. Se muestra la importancia tecnológica y económica que esta obra tuvo para el país mientras existió (de 1869 a 1941

  17. Morfometría geométrica del borde corial y del collar de huevos de cinco especies del género Rhodnius Stal (Heteroptera, Reduviidae, Triatominae

    Directory of Open Access Journals (Sweden)

    Ximena Páez-Colasante

    2008-12-01

    Full Text Available Resumen. La taxonomía y sistemática de la subfamilia Triatominae (Heteroptera, Reduviidae se basan principalmente en caracteres biométricos y morfológicos de las formas adultas y, en algunos casos, de las ninfas. La Morfometría Geométrica es capaz de descomponer la forma en sus componentes tamaño isométrico y conformación. En el presente trabajo se utilizó laMorfometría Geométrica como herramienta de análisis de la configuración geométrica que resulta de la unión de los extremos del borde corial y del collar (configuración borde corial-collar de los huevos eclosionados de cinco especies del género Rhodnius Stal. Los huevos se observaron por Microscopía Electrónica de Barrido y las imágenes digitalizadas fueron analizadas morfogeométricamente. Estudiando el tamaño geométrico de la configuración borde corial-collar, se halló que no existen diferencias estadísticamente significativas entre las cinco especies deTriatominos. En cuanto a la conformación, se determinaron diferencias entre las especies al ser sometidas a un análisis discriminante. Se encontró además que la variación del tamaño contribuye a la variación en la conformación, es decir, efecto alométrico. Los resultados obtenidos indican que la conformación de la configuración geométrica “borde corial-collar” de los huevos de Rhodnius podría ser utilizada como herramienta taxonómica para este grupo. Morfometria geométrica da borda corial e colarinho de ovos de cinco espécies do Gênero Rhodnius (Heteroptera Reduviidae, Triatominae.Resumo. A taxonomia e sistemática da subfamília Triatominae (Heteroptera Reduviidae esta baseada principalmente em caracteres biométricos e morfológicos das formas adultas, e em alguns casos, das ninfas. A morfometria geométrica é capaz de descompor a forma em seus componentes, tamanho isométrico e conformação. No presente trabalho utilizou-se a morfometria geométrica como ferramenta de análise da configura

  18. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  19. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  20. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  1. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  2. CODEHOP PCR and CODEHOP PCR primer design.

    Science.gov (United States)

    Staheli, Jeannette P; Boyce, Richard; Kovarik, Dina; Rose, Timothy M

    2011-01-01

    While PCR primer design for the amplification of known sequences is usually quite straightforward, the design, and successful application of primers aimed at the detection of as yet unknown genes is often not. The search for genes that are presumed to be distantly related to a known gene sequence, such as homologous genes in different species, paralogs in the same genome, or novel pathogens in diverse hosts, often turns into the proverbial search for the needle in the haystack. PCR-based methods commonly used to address this issue involve the use of either consensus primers or degenerate primers, both of which have significant shortcomings regarding sensitivity and specificity. We have developed a novel primer design approach that diminishes these shortcomings and instead takes advantage of the strengths of both consensus and degenerate primer designs, by combining the two concepts into a Consensus-Degenerate Hybrid Oligonucleotide Primer (CODEHOP) approach. CODEHOP PCR primers contain a relatively short degenerate 3' core and a 5' nondegenerate clamp. The 3' degenerate core consists of a pool of primers containing all possible codons for a 3-4 aminoacid motif that is highly conserved in multiply aligned sequences from known members of a protein family. Each primer in the pool also contains a single 5' nondegenerate nucleotide sequence derived from a codon consensus across the aligned aminoacid sequences flanking the conserved motif. During the initial PCR amplification cycles, the degenerate core is responsible for specific binding to sequences encoding the conserved aminoacid motif. The longer consensus clamp region serves to stabilize the primer and allows the participation of all primers in the pool in the efficient amplification of products during later PCR cycles. We have developed an interactive web site and algorithm (iCODEHOP) for designing CODEHOP PCR primers from multiply aligned protein sequences, which is freely available online. Here, we describe the

  3. Composición química del huevo de Tortuga Golfina Lepidochelys olivacea (Testudines: Cheloniidae y su potencial como recurso alimenticio

    Directory of Open Access Journals (Sweden)

    María Isabel Castro-González

    2011-12-01

    Full Text Available Por su potencial como fuente alimenticia, se analizó la composición química de huevo de Lepidochelys olivácea en La Escobilla, Oaxaca, México. El Instituto de Ciencias del Mar y Limnología de la Universidad Nacional Autónoma de México proporcionó 250 muestras de huevo liofilizado de 25 tortugas, que se analizaron siguiendo métodos oficiales para humedad, cenizas, proteína, grasa, lípidos totales(LT y análisis microbiológicos; además de ácidos grasos(AG por cromatografía de gases, aminoácidos(AA, vitaminas y colesterol(col por HPLC. Los resultados fueron los siguientes: (g/100g humedad(4.7, cenizas(3.8, proteína(53.7 y grasa(47.4. AA esenciales (g aa/100g Proteína: Ile (4.4, Lys(6.6, Leu(7.4, Met+Cys (8.8, Phe+Tyr (10.8; retinol (340μg/100g, colecalciferol (5.9 μg/100g, tocoferol (8.6, tiamina (0.3 y riboflavina (1.1 (mg/100g. Y los de (LT, (AG y (Col se concentraron en tres grupos por peso de tortuga: (LT (44.3-48.7-49.1g/100g, (Col (518.4-522.5-728.7 mg/100g. Entonces se identificaron 17 AGSaturados, 8 AGMonoinsaturados y 11 AGPoliinsaturados. Los AGS más abundantes (mg/100g: C16:0 (485-1263, AGM: C16:1 (456-716, C18:1n-9c (904- 1754 y AGP: C20:4n-6 (105-217, EPA (48-103 y HA (97-189. También, existió diferencia significativa (Fisher, p<0.05 para (Col, AG totales, AGS, AGM, AGP y AG n-3 (EPA+DHA. No se detectó presencia de agentes microbiológicos. El huevo liofilizado de L. olivacea es una opción para el desarrollo de productos alimenticios por su proteína de alto valor biológico y ácidos grasos n-3.

  4. Política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi

    OpenAIRE

    Mario Antolinez

    2013-01-01

    El artículo examina la política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi. Para tal fin utiliza como marco conceptual los modelos de análisis de política exterior formulados por Robert Putnam y Kenneth Waltz. La premisa principal es que al inicio de su gobierno Koizumi intentó revitalizar las relaciones exteriores de su país imprimiendo una nueva dinámica en la toma de decisiones que se ajustaba a su estilo personal de hacer política y que, al m...

  5. Modificación del perfil en ácidos grasos, α-tocoferol y niveles de oxidación en huevos enriquecidos en ácidos grasos poliinsaturados Cû3 tras someterlos a diferentes procesados térmicos.

    OpenAIRE

    Cortinas Hernández, Lucía

    2001-01-01

    Premio a la Investigación 200J del Instituto de Estudios del Huevo. El huevo es un alimento equilibrado de alto valor nutritivo. España es el cuarto país productor de huevos en la Unión Europea, y el undécimo a nivel mundial, a pesar de la disminución de consumo que se ha producido en los últimos años. Uno de los motivos que ha contribuido a esta reducción, ha sido su contenido relativamente elevado de colesterol, nutriente relacionado con la aparición de determinadas patologías cardiovasc...

  6. Características físicas del huevo incubable y pollitos nacidos de reproductores pesados cobb 500 en incubadoras con diferente humedad relativa

    OpenAIRE

    BAKKER, M.; YUÑO, M.; CEPEDA, R.; MARINELLI, C.; MALACALZA, F.

    2013-01-01

    Las características físicas del huevo incubable (peso –PH–, calidad de cáscara –C– y pérdida de humedad–H–) y pollitos nacidos (peso –PP– y porcentaje de nacimientos –N–) de reproductores pesados Cobb 500 deentre 28 y 65 semanas de edad, fueron evaluadas en tres incubadoras con diferente humedad relativa (HR)y comparados con los valores estándares para la línea genética. En todas las semanas de edad el PH (56,7-73,2 g) fue 0,9 y 6,5% mayor (p

  7. Desarrollo de un sistema de regeneración en papa criolla (solanum phureja juz et buck) var. yema de huevo clon 1

    OpenAIRE

    Diazgranados, Cristina; Chaparro, Alejandro

    2010-01-01

    En el presente estudio se obtuvo un 46% de regeneración en explantes sin cocultivo de Solanum phureja (Juzet et Buck) variedad Yema de huevo clon 1 con la utilización del medio CIP-MS suplementado con reguladores de crecimiento (2 mg· L-1 ZR, 0,02 mg· L-1 ANA, 0,02 mg· L-1 AG3). A fin de mejorar los porcentajes de regeneración se modificó la proporción citoquininas:auxinas del CIP-MS obteniéndose un 55% de formación de callo con concentraciones de 2 mg· L -1 ZR y 0,04 mg· L-1 ANA. Posterio...

  8. Relevamiento y evaluación de parasitoides de huevo para el control de Cydia pomonella (Lepidoptera: Tortricidae y Grapholita molesta (Lepidotera: Tortricideae

    Directory of Open Access Journals (Sweden)

    Oscar E. TORTOSA

    2014-01-01

    Full Text Available Desde el mes de octubre hasta el mes de abril de los años 2005-2006 y 2006-2007 realizamos la búsqueda e identificación de parasitoides de huevo de Cydia pomonella (L. (Lepidoptera: Tortricidae y Grapholita molesta (Busck (Lepi - doptera: Tortricidae en tres sitios de Mendoza, Argentina. Trichogramma cacoe - ciae Marchal (Hymenoptera: Trichogrammatidae fue colectado en huevos de las dos especies plagas, en todos los sitios del relevamiento, durante los dos ciclos de colecta. Se encontró Trichogramma pretiosum Riley (Hymenoptera: Trichogram - matidae solo en un sitio en el mes de diciembre de 2005. En los años 2008 y 2009 T. cacoeciae fue criado, liberado y evaluada su eficiencia en el control de C. pomonella y G. molesta a través del daño en los frutos. Realizamos dos ensayos de evaluación a campo en dos cultivos de peral orgánicos, en uno de ellos el daño promedio en frutos por C. pomonella y G. molesta fue de 5,07% ± 0,82 (testigo sin liberación 15,60% ± 4,73 y en el otro ensayo el daño promedio de ambas plagas fue de 1,92% ± 0,50 (testigo sin liberación 11,34 % ± 1,13. En ambos casos existi - eron diferencias estadísticamente significativas entre tratamiento y testigo.

  9. A quest to find good primers for gene expression analysis of Candida albicans from clinical samples.

    Science.gov (United States)

    Alonso, Gabriela C; Pavarina, Ana C; Sousa, Tábata V; Klein, Marlise I

    2018-04-01

    Biofilm production contributes to several human diseases, including oral candidiasis. Among the Candida species, Candida albicans is the most prevalent. The expression of virulence genes is implicated in the pathogenic potential of Candida biofilms. However, the evaluation of microbial gene expression from in vivo biofilm samples is not trivial, specifically, assessment via quantitative PCR (qPCR) can be a challenge because of several species present in clinical samples. Hence, the necessity of primers specificity. The aim of this study was to evaluate through in silico and in vitro analyses the specificity of published primers and newly designed primers for C. albicans virulence genes: ALS1, CAP1, CAT1, EFG1, HWP1, LIP3, PLB1, SAP1, SAP4, SOD1, SOD5 and ACT1 (normalizing gene). In silico analysis was performed through a PubMed search of articles with primer sequences that evaluated gene expression of C. albicans. Then, the sequence similarity of twenty-eight primers was checked through BLASTn and ClustalW2. The analysis of secondary structures was performed using mfold. When the primers did not present satisfactory characteristics (absence of secondary structures, not discrepant Tm of forward and reverse sequences and specificity) following in vitro analysis (i.e., end point PCR), new primers were designed using Beacon Designer™ and sequences obtained from the "Candida Genome Database". The selected primers were tested in vitro by end point PCR using a panel of genomic DNA from five different Candida species (C. albicans, Candida glabrata, Candida dubliniensis, Candida krusei, and Candida tropicalis). The resulting PCR products were visualized on agarose gel. qPCR reactions were performed to determine primers' optimal concentration and PCR efficiency. End point PCR demonstrated that published primers for the SAP1 and HWP1 were specific for C. albicans and the one for SOD1 reacted with C. albicans and C. dubliniensis. The sequence of primers designed for ACT1

  10. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  11. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  12. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  13. Portable microsatellite primers for Ficus (Moraceae).

    Science.gov (United States)

    Garcia, Marjorie; Bain, Anthony; Tzeng, Hsy-Yu; Peng, Yan-Qiong; Chou, Lien-Siang; Kjellberg, Finn

    2012-05-01

    Highly portable microsatellite primers were developed for Ficus to facilitate investigation of genetic structure of complete regional floras using a single set of markers. Pyrosequencing of five species of Ficus produced a library of 5723 potential primers. Potential primers found in at least two species and presenting identical annealing temperatures were tested on a set of five additional Ficus species. A set of 20 primer pairs producing well-defined and easily readable peaks was retained and tests showed their potential utility for analyzing population genetic structure of 24 Ficus species from Taiwan. Numbers of alleles per locus ranged from one to six in the least variable species and from one to 17 in the most variable species. The results indicate that our set of primers can be used to analyze polymorphism and compare levels of polymorphism among Ficus species.

  14. A Phylogenetic Index for Cichlid Microsatellite Primers

    Directory of Open Access Journals (Sweden)

    Robert D. Kunkle

    2010-01-01

    Full Text Available Microsatellites abound in most organisms and have proven useful for a range of genetic and genomic studies. Once primers have been created, they can be applied to populations or taxa that have diverged from the source taxon. We use PCR amplification, in a 96-well format, to determine the presence and absence of 46 microsatellite loci in 13 cichlid species. At least one primer set amplified a product in each species tested, and some products were present in nearly all species. These results are compared to the known phylogenetic relationships among cichlids. While we do not address intraspecies variation, our results present a phylogenetic index for the success of microsatellite PCR primer product amplification, thus providing information regarding a collection of primers that are applicable to wide range of species. Through the use of such a uniform primer panel, the potential impact for cross species would be increased.

  15. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  16. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  17. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-01-19

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/(integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  18. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  19. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  20. Porous Media Primer for Physicists

    Science.gov (United States)

    Hunt, Allen

    During the 1980's physicists (and some geophysicists) devoted considerable efforts to understanding the physical (meaning here not hydraulic) properties of sandstones (Sen et al., 1981; Krohn and Thompson, 1986; Katz and Thompson, 1985; Turcotte, 1986; Thompson et al., 1987; Balberg, 1987; de Gennes, 1985). To a rather large extent this curiosity was driven by the interest in novel materials, such as fractal media, or the prospect of finding novel behavior, such as non-universal scaling of transport properties associated with continuum percolation theory. The latter results were believed exempli- fied by the dependence of the electrical conductivity of natural porous media on the porosity, ø, a dependence which is usually represented as a power law, but had been thought to involve a relatively wide range of experimentally obtained powers. Much of the remaining physics research was driven by the needs of the petroleum industry, and their desire to understand the dynamics of multi-phase flow. But a great deal of information can now be gleaned from the soil physics community, which could not be incorporated into the publications in standard physics journals of that period. In fact a number of soil scientists (Tyler and Wheatcraft, 1990, 1992; Rieu and Sposito, 1991; Bittelli et al., 1999; Bird et al., 2000; Gimenez et al., 1997; Filgueira et al., 1999; Freeman, 1995; Baveye et al., 1998) have now addressed the question of whether natural porous media can be treated practically and consistently using fractal models. Some of these results call aspects of the fractal treatments of the 1980's physics community into question.

  1. Efecto de la harina de cefalotórax de camarón sobre la pigmentación y contenido de colesterol en la yema del huevo

    OpenAIRE

    Chavarría Barrantes, Arlette; Herrera Ramírez, Carlos Hernán; Zumbado Alpízar, Mario Ernesto

    1996-01-01

    Se estudió la variación en la tasa de pigmentación y contenido de colesterol de la yema de los huevos de las gallinas ponedoras (ISA-Babcok B-300), de 42 semanas de edad; alimentadas por 5 semanas con raciones conteniendo 0 (control) y 10% de harina de cefalotórax de camarón (HCC). Se determinó el grado de pigmentación y el contenido de colesterol de la yema de los huevos, cada 3-4 días durante el período de estudio. Los resultados se analizaron estadísticamente (95% de confianza) para detect...

  2. Pequeños estróngilos de los equinos. Eficacia clínica y periodo de reaparición de huevos luego del tratamiento con moxidectina y pirantel

    Directory of Open Access Journals (Sweden)

    ANZIANI OS

    2017-11-01

    Full Text Available El control de los pequeños estróngilos de los equinos (grupo Ciatostoma se basa casi exclusivamente en la aplicación de antihelmínticos. En nuestro país, el desarrollo de resistencia generalizada a los bencimidazoles, está limitando las alternativas químicas disponibles a las lactonas macrocíclicas (ivermectina y moxidectina y al pirantel, consideradas como drogas de larga y corta acción respectivamente. La información actualizada sobre la actividad de estas drogas en el campo es crítica para determinar su eficacia y detectar el desarrollo de fenómenos de resistencia a los antihelmínticos. En los equinos el período de reaparición de huevos (PRH luego del tratamiento es considerado como un indicador temprano de la presencia de resistencia. En el presente trabajo se evaluó la eficacia clínica y el PRH luego de tratamientos con moxidectina y pirantel en equinos adultos de cinco establecimientos de las provincias de Santa Fe y Córdoba naturalmente parasitados por pequeños estróngilos. La eficacia clínica determinada al día 15 pos tratamiento utilizando un test de reducción en el conteo de huevos, osciló entre el 99,8 y el 100% para la moxidectina y entre el 98,9 y el 98,8% para el pirantel. Por su parte en el presente estudio el PRH fue de al menos 100 días para la moxidectina y de 35 días para el pirantel. Estos resultados indican que ambas drogas se muestran activas para el control de estos nematodes y que las poblaciones estudiadas (alguna de ellas resistentes a bencimidazoles permanecen actualmente susceptibles a la moxidectina así como al pirantel. Esta última droga es de uso limitado en nuestro país, pero su inclusión en los programas de control contra los pequeños estróngilos podría reducir la dependencia y la presión de selección sobre las lactonas macrocíclicas y contribuir a mantener la vida útil de las mismas. SUMMARY. Small strongyles in horses. Clinical efficacy and egg reappearance period after

  3. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  4. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  5. Primer on transportation and climate change

    Science.gov (United States)

    2008-04-01

    This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...

  6. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  7. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  8. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  9. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  10. Respuesta productiva de gallinas semipesadas inducidas al descanso ovárico en diferentes edades

    OpenAIRE

    Luis Galeano V.; Mónica Estrada P.; Luis Restrepo B.

    2012-01-01

    Objetivo. Evaluar el efecto de la inducción al descanso ovárico (DO) a diferentes edades sobre la respuesta productiva en aves semipesadas productoras de huevo comercial. Materiales y método. Se usaron 840 aves de la línea Hy Line Brown con 64 semanas de edad, distribuidas en 10 tratamientos, consistentes en tres edades (65, 70 y 75 semanas) con la aplicación de tres períodos de ayuno (5, 10 y 15 días) y un control (sin DO). El análisis estadístico utilizó un modelo completamente aleatorizado...

  11. Respuesta productiva de gallinas semipesadas inducidas al descanso ovárico en diferentes edades

    OpenAIRE

    Galeano V, Luis; Estrada P, Mónica; Restrepo B, Luis; Sorza Z, Juan

    2012-01-01

    RESUMENObjetivo. Evaluar el efecto de la inducción al descanso ovárico (DO) a diferentes edades sobre la respuesta productiva en aves semipesadas productoras de huevo comercial. Materiales y método. Se usaron 840 aves de la línea Hy Line Brown con 64 semanas de edad, distribuidas en 10 tratamientos, consistentes en tres edades (65, 70 y 75 semanas) con la aplicación de tres períodos de ayuno (5, 10 y 15 días) y un control (sin DO). El análisis estadístico utilizó un modelo completamente aleat...

  12. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  13. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  14. Historia del primer templo mayor de Tunja, nombrado de Nuestra Señora de Guadalupe

    Directory of Open Access Journals (Sweden)

    Ernesto Porras Collantes

    2004-01-01

    Full Text Available Gonzalo Suárez Rendón Sarmiento, fundador de Tunja, bautizó con el nombrede Nuestra Señora de Guadalupe al primer templo mayor de la ciudad. Elcarpintero Gregorio López estuvo a cargo de la construcción de la obra, desdefebrero hasta la navidad del año de

  15. Ronda: nuevas noticias sobre el primer y antiguo puente del Tajo

    Directory of Open Access Journals (Sweden)

    Inocencio Cadiñanos Bardeci

    2014-01-01

    Full Text Available Sobre este bello y famoso puente ya se ha escrito su proceso de construcción. Sin embargo, al hablar del primer intento de levantarlo, se exponen unas muy breves noticias que pretendo completar con otras halladas recientemente...

  16. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation.

    Science.gov (United States)

    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades

    2009-12-03

    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  17. Exquisite allele discrimination by toehold hairpin primers

    Science.gov (United States)

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  18. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  19. La atención hospitalaria al paciente con ictus en Cataluña: Resultados del «Primer Audit Clínic de l'Ictus. Catalunya, 2005/2006» In-hospital stroke care in Catalonia [Spain]: Results of the «First Clinical Audit of Stroke. Catalonia, 2005/2006»

    Directory of Open Access Journals (Sweden)

    Sònia Abilleira

    2008-12-01

    Full Text Available Objetivo: Analizar la calidad de la atención hospitalaria al paciente con ictus en los hospitales públicos catalanes antes de la difusión de la Guía de Práctica Clínica (GPC del ictus, estudiando el grado de adhesión a determinadas recomendaciones de la GPC. Métodos: Mediante revisión retrospectiva de historias clínicas de pacientes con ictus definidos mediante los códigos CIE-9 431, 433.x1, 434.x1, 436, e ingresados consecutivamente en 48 hospitales públicos catalanes en el primer semestre de 2005, se recogió información sobre distintos indicadores del proceso asistencial al ictus seleccionados según su evidencia científica o su importancia clínica. Los hospitales participantes reclutaron 20, 40 o 60 casos, según el número de ingresos/año. Se llevó a cabo una auditoría externa en el 9,3% de los casos reclutados en cada centro, tras selección aleatoria, para determinar la calidad de los datos recogidos. Los indicadores se agruparon en 6 perfiles relacionados con diferentes aspectos de la práctica clínica. Resultados: Se incluyeron 1.791 casos, un 53,9% hombres, con una media (desviación estándar de edad de 75,6 (12,4 años. La concordancia global entre observadores fue de 0,7. El cumplimiento de los perfiles asistenciales (porcentaje medio [intervalo de confianza del 95%] fue: calidad de la historia clínica, 78,5% (77,5-79,4; estándares de atención básica, 92,4% (91,5-93,2; evaluación neurológica, 38,3% (37,3-39,3; medidas iniciales del tratamiento rehabilitador, 44,9% (43,2-46,7; prevención y manejo de complicaciones, 68,4% (66,9-70, y medidas preventivas iniciales, 78,9% (77,3-80,4. Conclusiones: En 2005 la atención hospitalaria al ictus era mejorable, sobre todo los aspectos relacionados con la evaluación y el seguimiento neurológico del paciente y la rehabilitación.Objective: To determine the quality of in-hospital stroke care in public acute care hospitals in Catalonia before the implementation of a

  20. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  1. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  2. Determinación cuantitativa de vitamina C y pigmentos y procesamiento de la papa criolla, variedad yema de huevo (Solanum phureja Juz et Buck

    Directory of Open Access Journals (Sweden)

    Isabel Alvarez G.

    2009-07-01

    Full Text Available Empleando papa pardo'pastusa (Solanum tuberosum como control, se determinó el contenido de Vitamina C total en la papa criolla, variedad Yema de Huevo (Solanum phureja, Juz et Buck y se evaluaron las pérdidas durante la cocción y el freído. Se utilizaron los métodos colorimétrico y densitométrico: el primero dio resultados altos debido a sustancias interferentes; el segundo reportó los siguientes valores: criolla 21 mg/100 g, pardo-pastusa 18 mg/100 g (para muestra fresca. Las pérdidas de Vitamina C de papa criolla con piel fueron durante la cocción {92°C durante 25' de 1 9 % y en el freído (175°C por 3' de 30%. También se analizaron los carotenos y xantofilas dando: carotenos en papa criolla, 1.5 mg/100 g, en pardo-pastusa 0.5 mg/100 g (muestra fresca y xantofilas en papa criolla 0.6 mg/100 g, en pardo-pastusa 0.13 mg/100 g. Se procesó en las siguientes formas no tradicionales: en harinas compuestas aceptadas por ios consumidores, en una sustitución del 2 0% con puré; frita en tajadas con piel y pasabocas de puré. El tiempo de vida fue para frita tres semanas a 16°C V más de una semana a 25°C; para pasabocas cinco semanas y media a 16 C y un mes a 30°C.

  3. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  4. Microsatellite primers in the native perennial cycad Cycas taitungensis (Cycadaceae).

    Science.gov (United States)

    Ju, Li-Ping; Kuo, Chia-Chi; Chao, Yi-Shan; Cheng, Yu-Pin; Gong, Xun; Chiang, Yu-Chung

    2011-04-01

    Microsatellite primers were developed for the native perennial cycad Cycas taitungensis to evaluate the genetic variation of this endangered insular species. Using a magnetic bead enrichment method and EST data, 16 primer sets were developed and identified for the native Taiwan cycad C. taitungensis. The primers amplified dinucleotide, trinucleotide, and complex repeats with 1-9 alleles per locus. Most primers also amplified DNA from C. revoluta and C. debaoensis. These results indicate the utility of primers for future studies of the genetic structure of C. taitungensis. In addition, the primers are useful for further phylogeographic studies between C. taitungensis and C. revoluta, which is a closely related species.

  5. Defense Primer: A Guide for New Members

    Science.gov (United States)

    2017-03-03

    2 Regular Military Compensation ...Military Compensation CRS In Focus IF10532, Defense Primer: Regular Military Compensation , by Lawrence Kapp Military Pay Raise CRS In Focus...Specialist on Congress and the Legislative Process vheitshusen@crs.loc.gov, 7-8635 Kristy N. Kamarck Analyst in Military Manpower kkamarck@crs.loc.gov

  6. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  7. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  8. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  9. Efectos de la suplementación con membrana de cáscara de huevo sobre alteraciones tendinopáticas, articulares y variables mecánicas del tendón de Aquiles en deportistas de crossfit.

    OpenAIRE

    Jauregui Bidegain, Lucas

    2016-01-01

    Introducción: En la patología del tendón de aquiles es determinante el análisis de los factores mecánicos que ayudan a explicar el comportamiento del tendón, siendo de los más estudiados el stiffness lineal. No existe actualmente evidencia acerca de los efectos de la suplementación con membrana de cáscara de huevo en el stiffness. Únicamente se ha examinado mediante escalas de valoración subjetiva, por lo que la medición mediante ecografía del stiffness tendinoso como variable direc...

  10. Desarrollo de un sistema de regeneración en Papa criolla (Solanum phureja Juz et Buck) var. Yema de huevo clon 1

    OpenAIRE

    Diazgranados Cristina; Chaparro Alejandro

    2007-01-01

    En el presente estudio se obtuvo un 46% de regeneración en explantes sin cocultivo de Solanum phureja (Juzet et Buck) variedad Yema de huevo clon 1 con la utilización del medio CIP-MS suplementado con reguladores de crecimiento (2 mg· L-1 ZR, 0,02 mg· L-1 ANA, 0,02 mg· L-1 AG3). A fin de mejorar los porcentajes de regeneración se modificó la proporció...

  11. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  12. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  13. Christiaan Barnard: 40 años del primer transplante de corazón humano.

    OpenAIRE

    Jorge Reynolds; Juan Fernando Cediel; César Payán

    2009-01-01

    Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Chris...

  14. Efecto del aceite esencial de orégano Lippia origanoides Kunth enel desempeño productivo de ponedoras marrón y la peroxidación lipídica de huevos enriquecidos con ácidos grasos poliinsaturados durante su almacenamiento

    OpenAIRE

    Ortiz Cuadros, Ronnal Esneyder

    2014-01-01

    El uso del aceite esencial de orégano (AEO) (Lippia origanoides Kunth) en sistemas de alimentación de ponedoras es poco documentado, por lo tanto, el objetivo de este trabajo consistió en la evaluación del efecto de inclusión del AEO sobre el desempeño productivo de las aves, el perfil de ácidos grasos de los lípidos de la yema del huevo, la estabilidad oxidativa durante el almacenamiento, la calidad sensorial y organoléptica de huevos enriquecidos con AGPI. Se utilizaron 216 ponedoras asigna...

  15. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  16. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  17. Evaluation of five primers and two opaque resins for bonding ceria-stabilized zirconia/alumina nanocomposite

    Directory of Open Access Journals (Sweden)

    Kohji Kamada

    2017-03-01

    Full Text Available The purpose of this study was to evaluate the effect of five primers [Super-Bond C&B Monomer (SB, Clearfil Ceramic Primer, Alloy Primer, M.L. Primer, and AZ Primer] and two undercoating opaque resins [Super-Bond C&B (S-opaque and Ceramage Pre-opaque (C-opaque] on the bonding of a resin composite veneering material to a ceria-stabilized tetragonal zirconia polycrystals/alumina nanocomposite (Ce-TZP/Al2O3. Disk-shaped specimens of Ce-TZP/Al2O3 were sandblasted with alumina and primed. The undercoating opaque resins and resin composites were subsequently applied to the specimen, and then light cured. After 5000 thermocycles at 4°C and 60°C, shear bond strengths were determined. Data were analyzed using analysis of variance, Tukey–Kramer honest significant difference test, and Student t test (n = 10, α = 0.05. With the exception of SB/S-opaque, all S-opaque groups exhibited significantly higher bond strengths than C-opaque groups. The use of S-opaque resin is recommended when veneering frameworks made of Ce-TZP/Al2O3.

  18. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  19. Caracterización de la composición en proteína, lípidos, energía y perfiles de ácidos grasos en huevos de tilapia roja (Oreochromis spp.

    Directory of Open Access Journals (Sweden)

    Rubén Darío Valbuena-Villarreal

    2013-06-01

    Full Text Available Luego de considerar el significado de las tilapias en el escenario piscícola nacional, la posibilidad de mejorar los índices de producción es un imperativo técnico y, dentro de estos, focalizar esfuerzos experimentales en la semilla resulta ser una opción estratégica. Con el fin de establecer un referente de base se utilizaron las puestas individuales de 50 hembras de tilapia roja (Oreochromis spp. para determinar los contenidos en los huevos de proteína (% MS, extracto etéreo (% MS, energía (cal g-1 y los perfiles de ácidos grasos (%, con algunas relaciones de interés analítico. Salvo ciertas variaciones menores, los valores encontrados se ajustan a los registros disponibles para la especie en diferentes estudios, lo que sugiere que las dietas ofrecidas a los reproductores experimentales contienen los mínimos necesarios para asegurar una provisión de nutrientes y energía suficientes para los embriones y las larvas en formación. Se analiza que, como punto de partida, esta serie de datos tiene utilidad para el desarrollo de trabajos destinados a mejorar los estándares de producción de alevinos, considerando que las variaciones en la composición, que pueden ser determinadas sobre los huevos, se pueden utilizar y tienen validez como un indicativo directo de su calidad.

  20. Nutrición y desarrollo psicomotor durante el primer semestre de vida

    Directory of Open Access Journals (Sweden)

    CHÁVEZ ADOLFO

    1998-01-01

    Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.

  1. Status of NC Primer Demonstration & Transition

    Science.gov (United States)

    2014-11-20

    skid coating – Navy facilities- plan to assess as alternative to zinc-rich primers – General: internal funding in place through at least 2019 to...Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K... Resistance (Skydrol) 7. Color Matching 8. Solvent Resistance 9. Thickness Tolerance 10. Application Method 11. Packaging 31 Questions?

  2. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. © 2011 Blackwell Publishing Ltd.

  3. Composición química del huevo de Tortuga Golfina Lepidochelys olivacea (Testudines: Cheloniidae y su potencial como recurso alimenticio

    Directory of Open Access Journals (Sweden)

    María Isabel Castro-González

    2011-12-01

    Full Text Available Por su potencial como fuente alimenticia, se analizó la composición química de huevo de Lepidochelys olivácea en La Escobilla, Oaxaca, México. El Instituto de Ciencias del Mar y Limnología de la Universidad Nacional Autónoma de México proporcionó 250 muestras de huevo liofilizado de 25 tortugas, que se analizaron siguiendo métodos oficiales para humedad, cenizas, proteína, grasa, lípidos totales(LT y análisis microbiológicos; además de ácidos grasos(AG por cromatografía de gases, aminoácidos(AA, vitaminas y colesterol(col por HPLC. Los resultados fueron los siguientes: (g/100g humedad(4.7, cenizas(3.8, proteína(53.7 y grasa(47.4. AA esenciales (g aa/100g Proteína: Ile (4.4, Lys(6.6, Leu(7.4, Met+Cys (8.8, Phe+Tyr (10.8; retinol (340μg/100g, colecalciferol (5.9 μg/100g, tocoferol (8.6, tiamina (0.3 y riboflavina (1.1 (mg/100g. Y los de (LT, (AG y (Col se concentraron en tres grupos por peso de tortuga: (LT (44.3-48.7-49.1g/100g, (Col (518.4-522.5-728.7 mg/100g. Entonces se identificaron 17 AGSaturados, 8 AGMonoinsaturados y 11 AGPoliinsaturados. Los AGS más abundantes (mg/100g: C16:0 (485-1263, AGM: C16:1 (456-716, C18:1n-9c (904- 1754 y AGP: C20:4n-6 (105-217, EPA (48-103 y HA (97-189. También, existió diferencia significativa (Fisher, pChemical composition of eggs of the Olive Ridley Lepidochelys olivacea (Testudines: Cheloniidae and it’s potential as a food source. The Olive Ridley is a worldwide distributed species with high nesting production per season, and in La Escobilla Oaxaca, México, there is a 70% of non-hatched eggs that are lost. In order to evaluate their potential use as a source for human and animal food products, their chemical composition was analyzed. Lyophilized egg samples from 25 turtles were obtained and were analyzed following the analytical methods for fatty acids, protein, fat, ash, moisture, amino acids, vitamins, cholesterol and microbiological agents. The analytical composition obtained

  4. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  5. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  6. Detection of cutaneous and genital HPV types in clinical samples by PCR using consensus primers

    NARCIS (Netherlands)

    Tieben, L. M.; ter Schegget, J.; Minnaar, R. P.; Bouwes Bavinck, J. N.; Berkhout, R. J.; Vermeer, B. J.; Jebbink, M. F.; Smits, H. L.

    1993-01-01

    Two sets of consensus PCR primers consisting of a common 3' primer CP-I and two 5'-primers, CP-IIG (primer set A) and CP-IIS (primer set B), in the E1 open reading frame of the human papillomavirus (HPV) genome are presented. These two primer sets enabled the detection of a 188 base pair (bp)

  7. Effect of Metal Primers on Bond Strength of a Composite Resin to Nickel-Chrome Metal Alloy.

    Science.gov (United States)

    Nima, Gabriel; Ferreira, Paulo Vitor Campos; Paula, Andreia Bolzan de; Consani, Simonides; Giannini, Marcelo

    2017-01-01

    This study evaluated the effects of three metal primers and one multi-mode adhesive system on the shear bond strength (SBS) of a flowable composite resin to nickel-chrome metal alloy (Ni-Cr). Ninety plates were cast from Ni-Cr and divided in nine groups (n=10). The surfaces were sandblasted with Al2O3 and primed with three adhesive primers: Alloy Primer (AP), Universal Primer (TP) and RelyX Ceramic Primer (CP), and a multi-mode adhesive (Scotchbond Universal, SU). The Adper Single Bond Plus (SB) and SU adhesives were also combined with adhesive primers. Control group did not have any surface treatment. The groups were: AP, AP+SB, AP+SU, TP+SB, TP+SU, CP+SB, CP+SU and SU. Composite cylinders were built on alloy surface. After 24 h, half the specimens were subjected to SBS and the other half to thermal cycling before testing. Data were analyzed by two-way ANOVA and Tukey's test (a=0.05). Failure modes were assessed by SEM observation. Higher SBS were obtained with AP and TP combined with adhesives at 24 h and the lowest one for control group. Thermocycling reduced SBS for AP, CP+SU and SU. Combination between TP and SU resulted in the highest SBS after the thermocycling. TP groups showed all types of failures and high incidence of mixed failures. The use of AP and UP metal primers before application of SU and SB adhesive systems increased the SBS of composite to Ni-Cr. These combinations between metal primers and adhesives had the highest SBS after thermocycling.

  8. A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.

  9. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  10. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  11. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  12. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  13. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    Science.gov (United States)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    high-schools. We are now producing a second edition, which is an entirely new re-write, and we are making the process of producing the primer a development opportunity in its own right, to strengthen the international community of early-career astrobiologists. We have recruited a large team of writers and editors, 45 people from 11 different countries across North and South America, Europe and Australia. By working together on this joint project we are strengthening links between early-career scientists in these countries. In addition, we have a wider group of early-career astrobiologists who we consulted on the content that the primer should include. We have also recruited early-career scientists from this group, and more widely, to act as 'accessibility reviewers' to check that the primer meets its goal of being clear to people who are not experts in the field. We expect that the primer will be published in 2012, in several different languages. It will be freely available online to all who want it. References 1. Mix LM et al (2006) The Astrobiology Primer : An Outline of General Knowledge - Version 1, 2006 Astrobiology 6(5) : 735-813

  14. Platigástridos (Hymenoptera: Platygastridae parasitoides de Pentatomidae en Córdoba. Caracterización de las masas de huevos parasitoidizadas y aspectos biológicos

    Directory of Open Access Journals (Sweden)

    Norma LA PORTA

    2013-01-01

    Full Text Available Se caracterizan las masas de huevos parasitoidizadas de pentatómidos per - tenecientes a cinco especies, cuatro fitófagas y una depredadora. Además, se analizan aspectos biológicos de esas oviposturas (abundancia y parasitoidismo y de sus para - sitoides (proporción sexual y emergencia: cinco especies de microhimenópteros plati - gástridos pertenecientes a los géneros Trissolcus Ashmead, Telenomus Haliday y Gryon Haliday . El análisis de las masas de huevos de pentatómidos en el campo apor ta indi - cadores exomorfológicos para determinar si están o no parasitoidizadas y, en algunos casos, conocer la especie de parasitoide emergente. Los altos niveles de parasitoidismo registrados en ambos sitios muestreados –Marcos Juárez y zona periurbana de Córdoba, sugieren que los parasitoides oófagos inciden de manera importante en las poblaciones de hemípteros presentes en el cultivo de soja. Las especies parasitoides mostraron una proporción de sexos marcadamente sesgada hacia las hembras, con un comportamiento similar respecto a cada huésped con el que interactuaron. Los porcentajes de emergencia resultaron más variables dependiendo de la especie parasitoide, del huésped y del sitio. El multiparasitoidismo fue registrado en todas las especies con excepción de Nezara viridula L. Telenomus podisi Ashmead fue el parasitoide común en las combinaciones observadas, resultando T. podisi-Trissolcus urichi Crawford la más frecuente.

  15. Acción de las poliaminas en la protección de papa criolla (Solanum phureja ev. "Yema de Huevo" contra las heladas Polyamine aetivity in proteeting 'ereole' potato (So/anum phureja ev. "Yema de Huevo" against frost damage

    Directory of Open Access Journals (Sweden)

    Romero Angulo Hernán Mauricio

    1996-06-01

    Full Text Available En 1992, se realizó un ensayo para determinar el efecto de las poliaminas (PA, putrescina (Put. espermidina (Spd y espermina (Spm en la reversión del daño causado por una helada (-1ºC por 3 hr en un cultivo de papa criolla (Solanum phureja Juz. et Buk. cv. "Yema de Huevo". Los tratamientos
    con las PA revirtieron efectivamente el daño en las plantas de papa criolla, lográndose, en todos los casos, una mayor producción en biomasa de tubérculos, en comparación con el testigo. El mejor tratamiento fue el de Spm 50 μM con el cual se logró mantener la producción normal con 9,85 ton/ha, contra apenas 5,42 ton/ha del testigo. Al parecer, el efecto de esta hormona se presentó por la inducción de la rebrotación de las yemas y en la protección del follaje.In 1992, an experiment was carried out to establish the action of the polyamines (PA putrescine (Put, spermidine (Spd and spermine (Spm in the reversion of frost damage (3 hr at -1ºC in Solanum phureja Juz. et Buk. ("papa criolla" cv. Yema de Huevo. PA treatments reverted damage and potato plants
    reached a higher yield of tuber biomass, compared with controls. The best treatment was Spm 50

  1. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  2. A Practical Primer on Prion Pathology.

    Science.gov (United States)

    Appleby, Brian S; Rhoads, Daniel D; Mente, Karin; Cohen, Mark L

    2018-03-28

    Prion diseases comprise a group of transmissible degenerative encephalopathies resulting from propagation of a misfolded cellular protein of uncertain function. As is generally the case with rare diseases, lack of institutional experience compromises individual familiarity with the varying, and apparently protean, manifestations of prion diseases, both clinically and pathologically. Coupled with the documented transmissibility of these diseases both within and between species, the Centers for Disease Control and Prevention (CDC) has established the National Prion Disease Pathology Surveillance Center to both aid with diagnosis of prion disease and to survey the United States for evidence of zoonotic transmission. We have assembled this primer with the hope that our accumulated experience will enable the neuropathological community to help the CDC "save lives and protect people."

  3. Primer on tritium safe handling practices

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  4. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  5. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  6. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  7. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  8. ALS Association

    Science.gov (United States)

    ... toward a world without ALS! Walk to Defeat ALS® Walk to Defeat ALS® draws people of all ... We need your help. I Will Advocate National ALS Registry The National ALS Registry is a congressionally ...

  9. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Editor(s):. Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Publisher(s):. Tata McGraw-Hill, CRDI.

  10. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    Science.gov (United States)

    2000-05-01

    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  11. Familial ALS

    Science.gov (United States)

    Boylan, Kevin

    2015-01-01

    Synopsis Genes linked to ALS susceptibility are being identified at an increasing rate owing to advances in molecular genetic technology. Genetic mechanisms in ALS pathogenesis appear to exert major effects in ~10% of patients, but genetic factors at some level may be important components of disease risk in most ALS patients. Identification of gene variants associated with ALS has informed concepts of the pathogenesis of ALS, aided the identification of therapeutic targets, facilitated research to develop new ALS biomarkers, and supported the establishment of clinical diagnostic tests for ALS-linked genes. Translation of this knowledge to ALS therapy development is ongoing. PMID:26515623

  12. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  13. Política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi

    Directory of Open Access Journals (Sweden)

    Mario Antolinez

    2013-11-01

    Full Text Available El artículo examina la política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi. Para tal fin utiliza como marco conceptual los modelos de análisis de política exterior formulados por Robert Putnam y Kenneth Waltz. La premisa principal es que al inicio de su gobierno Koizumi intentó revitalizar las relaciones exteriores de su país imprimiendo una nueva dinámica en la toma de decisiones que se ajustaba a su estilo personal de hacer política y que, al mismo tiempo, se distanciaba de manera sustancial del proceso tradicional imperante durante años. Esta iniciativa se vio entorpecida, sin embargo, no solo por los problemas en Gaimusho –la entidad encargada de llevar a la práctica la diplomacia nipona–, sino también por el escenario geopolítico externo y por factores de política interna propios del momento histórico en consideración.

  14. The effect of phosphoric and phosphonic acid primers on bone cement bond strength to total hip stem alloys.

    Science.gov (United States)

    Jakubowitz, Eike; Liehn, Louisa; Jahnke, Alexander; Wöstmann, Bernd; Rickert, Markus; Niem, Thomas

    2017-05-01

    Aseptic loosening at alloy-cement interfaces constitutes a main failure mechanism of cemented total hip replacements (THR). As a potential solution we investigated the effect of metal primers containing phosphoric and phosphonic acid on shear bond strength (SBS) of bone cement to THR alloys (CoCrMo, TiAlNb) and pure tin (Sn) substrates (20×8×3 mm). Metal surfaces were modified by polishing or Al 2 O 3 blasting and primer application. Substrates without primer treatment served as references. Cylindrical cement pins (Ø 5mm) were polymerised onto substrate surfaces and aging (1, 5, 14 and 150 days) was simulated in aqueous NaCl solution (0.9%) before SBS determination and failure mode evaluation. Regardless of surface roughness and aging time, SBS for THR alloys and Sn was always significantly higher with primer treatment. Compared to untreated reference specimens (≤0.2MPa) SBS values increased even up to 350 fold (TiAlNb, 14 days) or 400 fold (CoCrMo, 5 days). In general, the phosphoric acid containing primer revealed significant higher SBS values on THR alloys compared to the phosphonic acid containing one. Al 2 O 3 blasted specimens showed generally higher SBS values than polished ones with the exception of Sn which showed high SBS values in general. With primer treatment on polished Sn a significant reduction of SBS could not be detected even up to 150 days, whereas THR alloys showed only an SBS improvement in the short term (≤14 days). A NaCl-pitting corrosion probably led to an increasing and durable SBS on polished Sn surfaces over time. Compared to modern THR in clinical practice that shows survival rates of 10, 15, 20 or more years, the receivable bond strength enhancements described in this study appeared to be very short. The improved SBS on THR alloys lasted only a few days before it was lost again. In contrast, the phosphoric acid primer treatment of polished Sn appeared to be very promising and may play a key role in further investigations dealing

  15. Relación entre la autoestima y el locus de control en estudiantes del primer semestre de la UNMSM

    OpenAIRE

    Pequeña Constantino, Juan

    1999-01-01

    Determina el grado de relación que existe la autoestima y el locus en estudiantes del primer semestre de las diversas especialidades profesionales de la Universidad Nacional Mayor de San Marcos. Identifica y describe el nivel de autoestima y los tipos de locus, al igual que su distribución en función al sexo y las especialidades. Utiliza una muestra de 403 casos seleccionados al azar y distribuidos de forma representativa en cada facultad de la universidad. Aplica la Escala de Locus de Contro...

  16. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  17. Effects of continuous drought and immersion on hatchability of Ochlerotatus albifasciatus (Diptera: Culicidae eggs stored at low temperature Efecto de la sequía continua y la inmersión sobre la respuesta de eclosión de los huevos de Ochlerotatus albifasciatus (Diptera: Culicidae almacenados a baja temperatura

    Directory of Open Access Journals (Sweden)

    Raúl E Campos

    2007-07-01

    Full Text Available The role of environmental factors on the hatching response of O. albifasciatus (Macquart eggs is studied by simulating winter conditions in the laboratory. The hypothesis tested was that hatching response is affected by: (1 time that eggs remain at low temperature, (2 storage conditions, and (3 acclimatization time. Eggs were stored at 5ºC in drought and immersion conditions during 7, 21, 35, 90 and 146 days, immediately after, they were acclimatized at 22ºC during 24, 72, and 168 hours, and then eggs were flooded to induce hatching. Percent of hatched eggs was analyzed with a Generalized Lineal Model with a binomial distribution. Results show that: (1 a long storage period at cold temperature and long acclimatization periods improve the hatching response; (2 storage conditions have a moderate effect on hatching, being more evident in eggs stored dry; (3 a long time of acclimatization favors the hatching response in submerged eggs more than in eggs stored dry; (4 long time at cold favors the hatching response in eggs stored dry more than in submerged eggs; (5 the hatching response of eggs that remain for a long time at low temperature is higher when the time of acclimatization is long.Se estudió el rol de los factores ambientales sobre la eclosión de los huevos de O. albifasciatus (Macquart, simulando condiciones de invierno. La hipótesis planteada fue que la respuesta de eclosión de los huevos depende de: (1 tiempo de permanencia a baja temperatura, (2 condiciones de almacenamiento, y (3 tiempo de aclimatación. Los huevos fueron almacenados a 5º C en condiciones de sequía y sumergidos durante 7, 21, 35, 90 y 146 días; luego fueron aclimatados a 22º C durante 24, 72, y 168 horas y posteriormente inundados para inducir la eclosión. El porcentaje de huevos eclosionados se analizó con un Modelo Lineal Generalizado con distribución binomial. Los resultados mostraron que: (1 largos períodos de almacenamiento en frío y largos tiempos

  18. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  19. Composite Overwrapped Pressure Vessels, A Primer

    Science.gov (United States)

    McLaughlan, Pat B.; Forth, Scott C.; Grimes-Ledesma, Lorie R.

    2011-01-01

    Due to the extensive amount of detailed information that has been published on composite overwrapped pressure vessels (COPVs), this document has been written to serve as a primer for those who desire an elementary knowledge of COPVs and the factors affecting composite safety. In this application, the word "composite" simply refers to a matrix of continuous fibers contained within a resin and wrapped over a pressure barrier to form a vessel for gas or liquid containment. COPVs are currently used at NASA to contain high pressure fluids in propulsion, science experiments, and life support applications. They have a significant weight advantage over all metal vessels but require unique design, manufacturing, and test requirements. COPVs also involve a much more complex mechanical understanding due to the interplay between the composite overwrap and the inner liner. A metallic liner is typically used in a COPV as a fluid permeation barrier. The liner design concepts and requirements have been borrowed from all-metal vessels. However, application of metallic vessel design standards to a very thin liner is not straightforward. Different failure modes exist for COPVs than for all-metal vessels, and understanding of these failure modes is at a much more rudimentary level than for metal vessels.

  20. Transforming practices: a primer on action research.

    Science.gov (United States)

    Acosta, Sandra; Goltz, Heather Honoré

    2014-07-01

    Action research (AR) is a powerful tool for health education and promotion practitioners who want to focus on improving the quality of their programs and services. In this Tool, we describe the characteristics and controversial aspects of AR, differentiate between traditional and action research, present the benefits of applying AR methods/techniques for investigating problems related to professional practice, and offer a four-phase methodological framework for conducting AR studies. Unlike traditional research, AR is a methodology that links theory, research, and practice; advances new knowledge and understandings via iterative action cycles; employs frontline health practitioners as researchers; and promotes collaborative practitioner-community partnerships. Egalitarian in its approach, AR offers an "insider's perspective" centered on context-specific problems and issues related to health promotion. AR falls into two categories: large-scale community-based research and small-scale practice-based research. Each cycle of the AR framework includes four phases: (a) preplanning/needs assessment, (b) planning/study organization, (c) action and observation/study implementation, and (d) reflection and planning/data analysis and interpretation. Using the AR primer in this Tool has the potential to empower health education/promotion practitioners, encourage collaborative partnerships, enhance practitioners' knowledge base, and promote social change. © 2014 Society for Public Health Education.

  1. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  2. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  3. Una experiencia con QSB+ en Matemáticas de primer curso

    Directory of Open Access Journals (Sweden)

    Ordás Amo, Pilar

    2001-01-01

    Full Text Available Nuestro objetivo con este trabajo es presentar una experiencia que hemos llevado a cabo con los alumnos de primer curso, en la asignatura de Matemáticas, de las Licenciaturas en Ciencias Económicas y Administración y Dirección de Empresas, durante los cursos 1999/2000 y 2000/2001. El propósito de la experiencia es que los alumnos de primer curso vean una parte de la optimización matemática, como es la programación lineal, y el método del Símplex, a través de un software informático sencillo como es el QSB+, en el aula de ordenadores. Para llevar a cabo la experiencia, se añadió una hora lectiva al horario de los alumnos implicados y de los profesores de Matemáticas de primer curso, con plan nuevo (plan 99, durante el segundo semestre, de forma totalmente voluntaria para los alumnos, aunque la materia explicada en estas clases “extras” formaba parte del examen final de la asignatura. El nombre oficial de la experiencia fue Seminario de Programación Lineal, y tuvo una duración aproximada de quince horas lectivas.

  4. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  5. Diferentes niveles de energía metabolizable y aminoácidos azufrados en dietas para gallinas Bovans blancas

    Directory of Open Access Journals (Sweden)

    María de los Ángeles Tepox Pérez

    2012-01-01

    Full Text Available Con el objeto de evaluar el comportamiento productivo de la gallina Bovans blanca de primer ciclo alimentadas con dietas con niveles diferentes de energía metabolizable (EM y de metionina+cistina digestible (AAD, para lograr disminuir el porcentaje de huevo pequeño (<42 g, al inicio de la producción se utilizaron 384 gallinas de 19 semanas de edad. Se usó un diseño completamente al azar, en un arreglo factorial de 4 X 2, donde el primer factor fueron los niveles de EM (2700, 2800, 2900, 3000 Kcal/kg y el segundo factor fue la inclusión de diferentes porcentajes de AAD (0.45, 0.61. Cada tratamiento, contó con cuatro repeticiones de 12 gallinas cada uno. Durante ocho semanas se llevaron registros semanales, del porcentaje de postura, peso promedio del huevo, consumo de alimento; masa de huevo/ave/día y conversión alimenticia; además, se clasificó el huevo de acuerdo al peso. Los resultados obtenidos, no mostraron respuesta a los factores de estudio ni a la interacción entre nivel de EM y AAD, para ninguna de las variables productivas. Se encontró un efecto sobre el consumo de alimento del nivel de energía y aminoácidos azufrados (P<0.05. Se disminuyó el porcentaje de huevo pequeño en los niveles más altos de EM de 2900 y 3000 Kcal/Kg (29.6 y 30.4 % respectivamente. Se incrementó (P<0.05 el porcentaje de huevo grande en 3 % al usar dietas con el nivel de AAD de 0.61 %.

  6. Reflexiones sobre el desarrollo de competencias en alumnos de primer curso

    OpenAIRE

    Gómez Adrián, Jon Ander

    2012-01-01

    Voy a presentar para discusión una serie de cuestiones y reflexiones con objeto de suscitar debate. Debate que verse sobre qué competencias y qué habilidades deben intentar desarrollarse y potenciarse en los alumnos de primer curso. Planteo preguntas como ¿qué ventajas ofrece la enseñanza basada en competencias frente a la basada en contenidos? También pongo en cuestión si la carga docente resultante de la adaptación al EEES es sostenible, pues se ha realizado a cos...

  7. Aportes para una vida saludable. Proceso socioeducativo con estudiantes de primer ingreso, Universidad Nacional

    OpenAIRE

    Gonzalez-Soto, L.; Orozco-Morales, A.R.

    2017-01-01

    Propósito: Exponer la experiencia de medir en algún grado el impacto social de un proceso socioeducativo anual, desarrollado con 800 estudiantes de primer ingreso provenientes de diversos lugares del país, con limitadas condiciones socioeconómica y quienes son beneficiarios de beca para sus estudios. El proceso consistió en establecer 4 o 5 eventos anuales y trabajar con metodologías lúdicas temas alusivos a estilos de vida saludables. Material y método: Se aplicó la técnica de grupo focal al...

  8. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    containing 100 μg ml -1 of ampicillin. White colonies were screened for the presence of insert by single colony lysis PCR with M13 forward and reverse primers. PCR protocol included an initial hot start incubation (5 min at 94 o C) followed by 34 cycles... and ambiguously aligned sequences were removed from the further analyses. A phylogenetic analysis was conducted using distance setting maximum likelihood (ML) in MEGA 5.03 (Kumar et al, 2008) with 1000 bootstrap replicates. Individual phylogenetic trees were...

  9. Estabilidad oxidativa de huevos enriquecidos con ácidos grasos poliinsaturados omega 3, frente a antioxidantes naturales Estabilidade oxidativa de ovos enriquecidos com ácidos graxos poliinsaturados ômega 3, frente a antioxidantes naturais

    Directory of Open Access Journals (Sweden)

    María Elena Bernal Gómez

    2003-12-01

    Full Text Available Fueron alimentadas 192 gallinas ponedoras de 22 semanas de edad, de linaje comercial Babcock, durante 30 días con dietas de 0 (cero y 12,7% de semilla de linaza molida que corresponde a 0 y 5% de aceite de linaza, respectivamente. Fueron definidos 8 tratamientos: 4 grupos con 12,7% de semilla de linaza (control/sin antioxidante; BHA+BHT, 100+100 ppm; orégano, 200 ppm; romero, 200 ppm y 4 grupos sin semilla de linaza, pero utilizando los mismos antioxidantes. Este estudio fue realizado con el objetivo de verificar la eficacia del uso de antioxidantes naturales provenientes del orégano y del romero en la protección contra el deterioro oxidativo de la fracción lipídica de las yemas de los huevos enriquecidos con ácidos grasos poliinsaturados omega 3 (PUFA É-3. El grado de oxidación lipídica fue determinado a través de la prueba TBARS (substancias reactivas con ácido tiobarbitúrico. Según los resultados obtenidos, fue verificada diferencia significativa en la reducción del grado de oxidación lipídica de las yemas de huevo en todos los tratamientos con antioxidantes, cuando se compara con el control. Por lo tanto, los extratos de los condimentos, romero y orégano, pueden ser utilizados satisfactoriamente para obtener huevos enriquecidos con PUFA É-3, mejorando la estabilidad lipídica.Foram alimentadas 192 galinhas poedeiras de 22 semanas de idade da linhagem comercial Babcock, durante 30 dias com dietas constituídas de 0 (zero e 12,7% de semente de linhaça moída correspondente a 0 e 5% de óleo de linhaça, respectivamente. Foram definidos 8 tratamentos: 4 grupos com 5% de óleo de linhaça (controle/sem antioxidante; BHA+BHT, 100+100 ppm; orégano, 200 ppm; alecrim, 200 ppm e 4 grupos sem óleo de linhaça, mas utilizando os mesmos antioxidantes. Este estudo foi realizado com o objetivo de verificar a eficácia do uso de antioxidantes naturais provenientes do orégano e do alecrim, na proteção contra a deteriora

  10. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  11. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  12. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  13. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  14. Relativistic Astrophysics and Cosmology: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Abramowicz, Marek A [Department of Astronomy and Astrophysics, Chalmers University of Technology, 41296 Goeteborg (Sweden)

    2007-10-21

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as

  15. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  16. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    Directory of Open Access Journals (Sweden)

    Beckett Stephanie E

    2006-10-01

    Full Text Available Abstract Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported, we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair, the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC2 = 0.14 and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3% (excluding primers in which dog was an index species were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9% produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion

  17. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  18. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  19. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Mapping of randomly amplified polymorphic DNA primer (RAPD) on chromosome 2A of common wheat. Khamsa Parveen, Inamullah Inamullah, Habib Ahmad, Muhammad Sajjad Iqbal, Fida Muhammad Abbassi, Aziz ud-Din, Abdullah Khan, Imtiaz Ahmad Khan ...

  20. A Primer of Easy Pieces: Teaching through Typical Narrative.

    Science.gov (United States)

    Waldman, Peter

    1982-01-01

    A "Form Primer," developed for and used in an introductory architectural design course at Princeton University, is explained and illustrated. The concept holds that architecture is made up of a typology of pieces that are composed into a whole. (MSE)

  1. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  2. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    additive since it was not commercially available. A replacement was needed. 2) Kel-F, a Polychorotrifluoro ethylene (PCTFE) polymer , which was...primer mixes where scraps fall onto wet floors and by the chemical production of the primer mix. In addition, workers clothing can be easily...preparation of the LFEP are recyclable without re-purification. A second general advantage is the ease of de-militarization of ENC based LFEP. These

  3. Universal PCR primers for ribosomal protein gene introns of fish

    Directory of Open Access Journals (Sweden)

    Seinen Chow

    2016-01-01

    Full Text Available Abstract Human ribosomal protein (RP gene sequences with respect to intron/exon structures and corresponding cDNA or genomic data of fish species were obtained from the GenBank database. Based on conserved exon sequences, 128 primer pairs for 41 genes were designed for exon-primed intron-crossing (EPIC polymerase chain reaction (PCR. In reference to the draft genome sequences of the Pacific bluefin tuna (Thunnus orientalis, 12 primer pairs expected to amplify introns of the bluefin tuna with lengths of 500–1000 bp were selected and applied to six distantly related fish species belonging to the Orders Clupeiformes, Tetraodontiformes, Pleuronectiformes, Perciformes, Scorpaeniformes, and Anguilliformes. PCR amplification was observed for at least four species in each primer pair, and all fragments were larger than those expected for intronless amplification. Single fragment amplification was observed for at least seven primer pairs per species. Fragment sizes of the bluefin tuna for nine primer pairs corresponded to those expected from the genomic data. Thus, our primer pairs are potentially applicable to a wide variety of fish species and serve as an initial step for isolating single-copy nuclear DNA sequences.

  4. Un primer retablo de Alberto de Churriguera

    Directory of Open Access Journals (Sweden)

    Rupérez Almajano, Mª Nieves

    2003-03-01

    Full Text Available Es conocida en lo esencial la actividad desarrollada por Alberto de Churriguera en Salamanca durante su etapa de madurez, como maestro de la Catedral y de la Plaza Mayor y al frente de las obras de los Colegios de Cuenca, de San Bartolomé o del Rey entre otros, así como diversos trabajos en Valladolid, Madrid, Orgaz y otros lugares. Sin embargo, son muy escasas las noticias que tenemos de obras o encargos al comienzo de su carrera profesional, lo que proporciona interés a cualquier dato que pueda ofrecer más luz sobre su dedicación en esos primeros años. Como se sabe Alberto de Churriguera había nacido en Madrid el 7 de agosto de 1676. A la muerte de sus padres quedó al cuidado de su hermano José, que se ocupó de formarlo y transmitirle su misma profesión «con toda eficacia». Se supone que en 1692 acompañó a su hermano a Salamanca para ejecutar el retablo de San Esteban...

  5. Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular

    Directory of Open Access Journals (Sweden)

    Lucero López-Díaz

    2016-01-01

    Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.

  6. Antonio Roalas. Un pintor del primer tercio del siglo XVII en Madrid

    Directory of Open Access Journals (Sweden)

    Rodríguez Rebollo, Ángel

    2004-03-01

    Full Text Available El conocimiento que actualmente se tiene sobre los pintores del barroco madrileño ha avanzado mucho desde que Ángulo y Pérez Sánchez publicaran los dos volúmenes dedicados al primer y segundo tercio del siglo XVII. Posteriormente han ido viendo la luz estudios más pormenorizados, a veces en forma de exposiciones, que han clarificado aún más la importancia de los artistas que trabajaron en torno a la Corte de los llamados «los Austrias menores»; sin embargo, existen aún hoy un buen número de pintores sólo conocidos a través de contratos o inventarios de la época. La absoluta desinformación que tenemos de ellos, acrecentada por la inexistencia de obras firmadas, no permite a los historiadores dedicarles al menos un estudio parcial de su arte…

  7. Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

    Directory of Open Access Journals (Sweden)

    Julio J. Masquijo

    2014-10-01

    Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

  8. Electrochemical performance of a localized repair. Effect of applying a primer and a bonding membrane

    Directory of Open Access Journals (Sweden)

    Castro-Borges, P.

    2003-12-01

    Full Text Available It is customary, in the constructions at the North of Yucatán, to employ primers to the rebars as a repair method in reinforced concrete, it has been observed in the literature that using primers alone presents an electrochemical behaviour still under discussion. Under these circumstances, several investigations have focused on the evaluation of the factor against or in favour of using primers as a repair method in a tropical marine environment. In this paper, the effects of applying a bonding membrane and the galvanic effect generated by the repair are also discussed. Small reinforced concrete columns were prepared and exposed under accelerated degradation cycles. After the activation of the rebars, the columns were repaired applying three types of primers, leaving one bar as control. After curing, the columns were exposed again to the same environment and their electrochemical behaviour was monitored. Corrosion potentials, polarization resistance, carbonation and chloride content were measured as a function of time. Conclusions suggest that the bonding membrane reduces the corrosion rates for the conditions and exposure time studied. The galvanic effect was observed after repairing the columns with and without bonding membrane, but with a tendency to reduce with time. The primers applied helped to reduce the galvanic effect of the repair, and to increase the polarization resistance.

    En las construcciones del norte de Yucatán se emplean, por costumbre, las imprimaciones al refuerzo como método de reparación al hormigón armado. Se ha observado en la literatura que la utilización sólo de imprimaciones presenta un comportamiento electroquímico, motivo éste, aún, de amplia discusión. Ante estas situaciones se llevaron a cabo varias investigaciones que tienen como objetivo la evaluación de las situaciones que favorezcan o no la utilización de las imprimaciones como método de reparación en un ambiente tropical marino. En este

  9. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  10. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  11. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  12. Herramienta de educación nutricional para alergicos a huevo y proteína de leche de vaca de edad pediátrica®

    OpenAIRE

    Ismael San Mauro Martín

    2014-01-01

    Introducción: La alergia alimentaria afecta a gran parte de la población y sus cifras siguen aumentando. Aunque, se esta avanzando en el conocimiento de la patología, los alérgicos encuentran grandes dificultades para llevar una vida normal, especialmente en lo relativo a su alimentación. Hasta ahora el colectivo no contaba con herramientas prácticas que les ayudasen en la elaboración diaria de una dieta equilibrada, como existen para la población en general, en forma de pirámides y guías ali...

  13. PCR primers for metazoan mitochondrial 12S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. METHODOLOGY/PRINCIPAL FINDINGS: A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. CONCLUSIONS/SIGNIFICANCE: Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans.

  14. PENGOLAHAN PRIMER LIMBAH TEKSTIL DENGAN ELEKTROKOAGULASI

    Directory of Open Access Journals (Sweden)

    Lieke Riadi

    2014-12-01

    Full Text Available Limbah industri tekstil di area pinggir kota Surabaya mempunyai karakteristik perbandingan COD dan BOD = 5.57. Limbah jenis ini sulit untuk dibiodegradasi. Studi ini mempelajari tekonologi elektrokoagulasi untuk mengolah limbah tekstil dengan menurunkan intensitas warna, Total Suspended Solid (TSS dan Chemical Oxygen Demand (COD. Percobaan batch pada suhu kamar dilakukan untuk mempelajari pengaruh pH, jarak elektroda terhadap penurunan warna,TSS dan COD dan membandingkan biaya operasinya jika menggunakan pengolahan kimia.Effisiensi penurunan tertinggi untuk warna (91.96%,  TSS (49.17%, dan COD (29.67% terjadi pada pH awal 4.0 dan jarak elektroda 2 cm dengan  elektroda Al/Al. Waktu optimum penurunan intensitas warna dalah 10 menit. Laju penurunan COD adalah : -dC/dt = 0.0053 C +0.056 , dengan C adalah konsentrasi COD. Jumlah sludge yang dihasilkan daripengolahan elektrokoagulasi  3.4 % lebih kecil dibandingkan menggunakan bahan kimia. Biaya yang digunakan untuk pengolahan dengan elektrokoagulasi 52.35 % lebih murah dibandingkan jika menggunakan koagulasi dengan bahan kimia ( tawas. Kata kunci : elektrokoagulasi, penurunan warna, penurunan TSS, laju degradasi COD, imbah tekstil Abstract Waste water from textile industry which is located in one suburb of Surabaya city as characteristic which the ratio of COD to BOD was 5.57. This type of waste water is difficult to be biodegraded. This study investigated elektrokoagulasi technology to treat textile waste water by removing color, total suspended solid, and Chemical Oxygen Demand. Batch experiment at room temperature was carried out to study the effect of pH, electrode distance for color, TSS and COD removal. This study also tried to compare the operation cost between elektrokoagulasi and chemical processes. The best removal efficiencies by Al electrodes was 91.96 % for color, 49.17 % for TSS and 29.67 % for COD which were under initial pH 4.0 and electrodes distance 2 cm. The optimum operation

  15. Ti, Al

    Indian Academy of Sciences (India)

    In the present study, authors report on the effect that substrate bias voltage has on the microstructure and mechanical properties of (Ti, Al)N hard coatings deposited with cathodic arc evaporation (CAE) technique. The coatings were deposited from a Ti0.5Al0.5 powder metallurgical target in a reactive nitrogen atmosphere at ...

  16. Evaluación de sensibilidad antibiótica en urocultivos de pacientes en primer nivel de atención en salud de pereira

    OpenAIRE

    Machado-Alba, Jorge Enrique; Murillo-Muñoz, Maria Monica

    2013-01-01

    Objetivos Las Infecciones de vías urinarias son una causa de consulta muy frecuente en primer nivel de atención en salud. Describir los gérmenes más frecuentemente aislados y los patrones de resistencia a los antibióticos en urocultivos y antibiogramas de pacientes de primer nivel de atención de Pereira.Materiales y Métodos Estudio descriptivo observacional de corte transversal, en una población de 131 608 afiliados al Sistema General de Seguridad Social en Salud entre el 1 de enero de 2010 y...

  17. Çoklu Primer Tümörler - Tek Merkez Deneyimi

    Directory of Open Access Journals (Sweden)

    Gökşen İnanç İmamoğlu

    2017-12-01

    Full Text Available Amaç: Onkolojik hastalıkların erken tanı ve tedavisinde yeni gelişmeler hayatta kalma oranlarının artmasına neden olsa da, artmış sağ kalım oranlarına bağlı olarak gelişen uzun takipler sırasında ikinci primer maligniteler ortaya çıkabilmektedir. İkincil primer tümörlerin gelişimi için birçok faktör vardır. En önemlisi, yaşlı hastalar ın uzun vadede kanserojenlere maruz kalma olasılıkları daha yüksektir. Çoklu primer tümörler, genellikle iki malignite tanısı arasındaki zaman çizelgesine bağlı olarak metakron veya senkron olarak görülür. Senkron hastalıklar sıklıkla benzer karsinojenlere maruz kalma sonucu oluşsa da, metakron olanlar daha çok primer tümörün tedavisine bağlı advers etkilerle ilişkili olabilir. Bu tek merkezli çalışma, Ocak 2007 ile Aralık 2016 arasında multipl primer tümörlü hastaların klinikopatolojik özelliklerini araştırmayı amaçladı ve bunlardan 20'si senkron, 36'sı metakron olarak toplam 56 hasta dahil edildi. En yaygın kanser çiftlerinin erkeklerde kolon-akciğer ve prostat-mesane, kadınlarda meme-kolon ve meme-tiroid olduğu tespit edilmiştir. Yöntemler: Ocak 2007 ile Aralık 2017 tarihleri arasında merkezimizde takip edilen ÇPT’ lü hastaların dosyaları retrospektif olarak incelendi, 56 hastada multiple primer tümör olduğu tespit edildi. Hastaların cinsiyetler, yaşları tespit edildi. Tümörün hangi organlarda oluştuğu, ne zaman geliştiği, bulunabilen etyolojik veriler, sağ kalım oranları araştırıldı. Tüm istatistiksel analizler Package for Social Sciences (SPSS v 15.0, SPSS Inc., Chicago, IL, USA ile yapıldı. Sonuç: Senkron hastalıklar genellikle benzer kanserojenlere maruz kalmanın bir sonucu olarak ortaya çıkarken, metakronöz hastalıkların primer tümörlerin tedavisinin yan etkileri ile ilişkili olması muhtemeldir

  18. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  19. Al clamor de les vuvuzeles

    Directory of Open Access Journals (Sweden)

    Javier Olivera Betrán

    2010-09-01

    Full Text Available El Mundial de Futbol de Sud-àfrica ha situat l’Àfrica al mapa mundial i ha mostrat al món el triomf de l’estil de futbol d’Espanya basat en la col·lectivitat, l’esperit d’equip, la humilitat, la cohesió interna i el joc bonic. L’organització africana, seriosa i eficaç, ha sabut mobilitzar i il·lusionar la població del país que ha participat en el mundial des de l’orgull de ser africà, amb l’esperit alegre, festiu i també reivindicatiu de la gent de l’Àfrica. Aquest esdeveniment suposa el llançament de la marca “Sud-àfrica” al món amb un avís clar d’optar a l’organització d’uns primers Jocs Olímpics a Àfrica (potser els de 2020. S’obre una finestra d’esperança al segle xxi per al continent perdut de la mà de l’esport espectacle tan universal, massiu, emocional i mercantil que també es juga a la canxa de la política i de l’economia.

  20. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

    Directory of Open Access Journals (Sweden)

    Harold Castañeda-Peña

    2010-01-01

    Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.

  1. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  2. Specific primers for the detection of the black-yeast fungus associated with lethargic crab disease (LCD).

    Science.gov (United States)

    Pie, Marcio R; Boeger, Walter A; Patella, Luciana; Vicente, Vânia A; Ribeiro, Raphael O; Ostrensky, Antonio

    2011-03-16

    Lethargic crab disease (LCD) is an emerging infirmity that has been causing extensive mortalities in populations of the mangrove land crab Ucides cordatus (Ocypodidae) along the Atlantic coast of Brazil. Previous studies have indicated that LCD is associated with a dematiaceous fungus, Exophiala cancerae de Hoog et al. In the present study, we sequenced the internal transcribed spacer (ITS) of the rDNA region of this black yeast species and developed species-specific PCR primers. Sensitivity tests indicated that the developed protocol is capable of detecting very small amounts of target DNA. Also, the application of the protocol to a variety of other dematiaceous fungi did not generate any false positives. The specific primers provided in the present study represent an important tool for rapidly surveying a large number of crab individuals, as well as environmental samples. Such knowledge will be instrumental in understanding the epidemiological dynamics of LCD.

  3. al junctions

    African Journals Online (AJOL)

    Preferred Customer

    Bruan and Heeger,. 1991), Schottky barrier devices (Gardner and Tan,. 1989; Bantikassegn Workalemahu and Inganas,. 1997; Granstrom et al., 1998), organic solar cells. (Abay Gadisa and ... the capacitance per unit area of the cell as well as.

  4. Musculatura asociada al primer y segundo arco visceral de algunos anuros leptodactílidos

    Directory of Open Access Journals (Sweden)

    Palavecino, Patricia Mónica

    1999-01-01

    Full Text Available Se describe y compara la musculatura mandibular e hioidea de larvas de cuatro especies de anuros leptodactílidos presentes en el noroeste argentino. Las características miológicas observadas en Odontophrynus lavillai y Telmato-bius sp. son muy semejantes a las descriptas para otras larvas de anuros. Por el contrario, Ceratophrys cranwelli y Lepidobatrachus llanensis, muestran particularidades en éstos caracteres que los diferencian notablemente entre sí y con el resto de las especies descriptas. Tales particularidades parecen estar relacionadas con su modo de alimentación. Para la larva de Ceratophrys cranwelli se nomina un nuevo músculo, intermandibularis medio superficial. The jaw and hyoid musculature are described and compared for species of anuran tadpoles from the argentinean northwest. The myological characteristics observed in Odontophrynus lavillai and Telmatobius sp. are very similar when compared with other anuran tadpoles. In the contrast, Ceratophrys cranwelli and Lepidobatrachus llanensis show special muscular features which point out difference between each other and with all described species. These different characteristics appear to be related with their feeding habits. A new muscle found in Ceratophrys cranwelli, intermandibularis medio superficial, is desbribed and named.

  5. Valorización de la Sociedad Minera Cerro Verde (al primer trimestre del 2016)

    OpenAIRE

    Sánchez Neira, Jorge Luis; Torres Krivic, Emilio José; Trujillo Trujillo, Hercilio Gil

    2017-01-01

    El presente estudio pretende realizar la valorización de la Sociedad Minera Cerro Verde (SMCV), empresa dedicada a la extracción, producción y comercialización de minerales: cobre, molibdeno y plata. Forma parte del grupo Freeport-McMoRan (Freeport) con sede principal en Arizona, Estados Unidos. Para realizar la valorización se emplearon dos metodologías: Flujo de Caja Descontado (FCD) y Múltiplos. La metodología del Modelo de Dividendos Descontados (MDD) no fue empleada debido a que SMCV man...

  6. Allele dropout caused by a non-primer-site SNV affecting PCR amplification--a call for next-generation primer design algorithm.

    Science.gov (United States)

    Lam, Ching-wan; Mak, Chloe Miu

    2013-06-05

    PCR-based technology is indispensable for genetic diagnosis. On the other hand, allele dropout is one significant cause of genotyping errors. Most allele dropout mechanisms are related to annealing failure caused by single nucleotide variant (SNV) situated inside the primer sequences. Here, we demonstrate a novel allele dropout mechanism caused by a non-primer-binding-site SNV. We demonstrate that the apparent homozygosity of NM_000137.1(FAH):c.1035_1037del was caused by allele dropout. The non-primer-binding-site SNV causes a strong secondary hairpin structure formation of the PCR products and leads to amplification failure. SNV check of the primer sequences per se during primer design is not adequate to avoid allele dropout. The next-generation primer design software should analyze the secondary structure of primers and template sequence taking SNV in both sequences into account in order to avoid genotyping errors. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Primer reporte de miasis hospitalaria por Lucilia cuprina (Diptera: Calliphoridae en Costa Rica

    Directory of Open Access Journals (Sweden)

    Lucía Quesada-Lobo

    2012-12-01

    Full Text Available Introducción. Las miasis hospitalarias son entidades con una importancia manifiesta en salud pública. La documentación de este tipo de casos es escasa en la literatura biomédica regional y mundial. Objetivo. Informar un caso de miasis hospitalaria en Costa Rica, donde el agente etiológico implicado fue Lucilia cuprina (Diptera: Calliphoridae. Este caso de miasis hospitalaria figura como el primer informe para Latinoamérica asociado con este agente etiológico. Presentación del caso. Una paciente de 91 años de edad, con signos de inmunosupresión, afectación grave de la función pulmonar y asistencia respiratoria mecánica, presentó larvas en ambas fosas nasales al séptimo día después del ingreso hospitalario. Varios ejemplares fueron recolectados y procesados para su identificación. La identificación taxonómica de los ejemplares recolectados estableció que la especie de los muscomorfos correspondía a L. cuprina. Conclusión. El presente constituye el primer caso de miasis hospitalaria por L. cuprina en la literatura biomédica de Costa Rica y el primero registrado en Latinoamérica.   doi: http://dx.doi.org/10.7705/biomedica.v32i4.690

  8. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  9. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  10. Onchocercal DNA amplification using beta actin gene primers ...

    African Journals Online (AJOL)

    Onchocercal DNA amplification using beta actin gene primers compared with first internal transcribed spacer sequences for monitoring onchocerciasis eradication strategy. ... Out of the 12 amplicons in agarose gel, there were 6 sharp and 6 faint bands of 100bp molecular weight as documented. The sharp bands included 3 ...

  11. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  12. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  13. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545–549. Table 1.

  14. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  15. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Genet & Botany only

    2012-08-14

    Aug 14, 2012 ... 500. Figure 1. PCR amplification profile of the two genetic stocks of common wheat,. NT2A2B and NT1D1B using RAPD primer GLC-07. M = Molecular size marker (100 bp DNA ladder, Gene Link, USA). important crops species including wheat (T. aestivum L.). Among the DNA markers, randomly amplified.

  16. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  17. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  18. Memorias Primer encuentro amazónico de experiencias de diálogo de saberes

    OpenAIRE

    Gasché, Jorge; Plata, Juan José; Matapí, Uldarico; Rodríguez, Abel; Moreno, Fabián; Andoque, Iris; Bolaños, Aldemar; López, Mario; Tocancipá, Jairo; Londoño, Luis Alfredo; Aguirre, Daniel; Mercado Epieyu, Rafael Segundo; Echeverri, Juan Alvaro

    2010-01-01

    Este libro reúne las memorias del Primer Encuentro de Experiencias Amazónicas de Diálogo de Saberes, que tuvo lugar del 10 al 12 de noviembre de 2008 en la Universidad Nacional de Colombia, Sede Amazonia. Reúne los siguientes artículos: 1. Presentación / Catalina Pérez Niño y Juan A. Echeverri 2. Ceremonia de apertura / Carlos Zárate, Jairo Tocancipá, Anastasia Candre, Germán Palacio, Juan José Plata, Carlos Rodríguez y Juan A. Echeverri. 3. ¿Qué son “saberes” o “conocimientos...

  19. Review of The Atheist’s Primer and Atheism for Beginners

    Directory of Open Access Journals (Sweden)

    Andrew J Bissette

    2014-05-01

    Full Text Available The New Atheists are occasionally accused of lacking nuance and sophistication, or of existing in an intellectual vacuum. To some it may seem that Dawkins 'et al'. are naïve logical positivists; this perspective may be reinforced by recent authors’ explicit rejection of the value of philosophy and other non-scientific approaches to knowledge (cf. Lawrence Krauss, Stephen Hawking. Into the fray steps Michael Palmer, offering his attempt to popularise a version of atheism that is underpinned by a long tradition of philosophical inquiry. 'The Atheist’s Primer', a condensed version of Palmer’s previous work, is aptly named: it is a crash course on the history and major arguments of atheism from a firmly philosophical angle. Its companion text, 'Atheism For Beginners', is a coursebook aimed at tutors seeking to teach this material.

  20. Eduardo Krapf (1901-1963: Primer Presidente de la Sociedad Interamericana de Psicología

    Directory of Open Access Journals (Sweden)

    Hugo Klappenbach

    2004-01-01

    Full Text Available El trabajo, de carácter historiográfico, examina la trayectoria de Eduardo Krapf, quien se recibió de médico en Alemania y posteriormente revalidó su titulo en la Argentina. Se analiza su inserción en la Asociación Psicoanalítica Argentina y sus trabajos sobre psiquiatría y psicología al promediar el siglo XX. En particular, se analizan los intereses que condujeron a Eduardo Krapf a vincularse con la psicología y en particular con la Sociedad Interamericana de Psicología, de la que fue Primer Presidente en 1951. Metodológicamente, se han obtenido los datos principalmente de fuentes primarias, particularmente textos y documentos de archivo existentes en la Facultad de Ciencias Médicas de la Universidad de Buenos Aires

  1. Bolívar, primer diplomático de la libertad americana

    Directory of Open Access Journals (Sweden)

    Rafael Gómez Hoyos

    1969-03-01

    Full Text Available Don Miguel Luis Amunátegui, primer biógrafo de don Andrés Bello, recopilador y comentarista meritorio de sus obras, nos dejó una falsa visión de Bolívar como diplomático de la libertad. Basado en los recuerdos del anciano humanista, cuando ya le flaqueaba la memoria, o gracias a un error suyo de apreciación, al comentar los incidentes de la misión encomendada ante el gobierno británico por la Junta Suprema de Caracas, nos relata increíble falta de tacto y descuido imperdonable en Simón Bolívar, Jefe de la Misión.

  2. INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN

    Directory of Open Access Journals (Sweden)

    Orzuza, Gloria Beatriz

    2013-01-01

    Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.

  3. et al

    African Journals Online (AJOL)

    Schalk Cloete

    experienced (Bath, 2006), while indications are that no new drenches are in the process of being developed. Existing strategies for the control of these pathogens are thus challenged (Bath, 2006), and alternative strategies need to be formulated (Vatta et al., 2000). A possible avenue for dealing with the challenge of ...

  4. Effect of surface preparation on service life of top-coats applied to weathered primer paint

    Science.gov (United States)

    R. Sam Williams; Mark Knaebe; Peter Sotos

    2008-01-01

    Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

  5. Pràctica 9. El desenvolupament psicomotor del xiquet (primer cicle d'Educació Infantil)

    OpenAIRE

    Gomis Selva, Nieves; Sánchez Colodrero, Vicente; Delgado Domenech, Beatriz

    2013-01-01

    El començament del desenvolupament del xiquet està dominat essencialment per la motricitat. En els primers mesos d’edat del nadó, els moviments són veritables manifestacions del seu desenvolupament psicològic. Aquesta motricitat es desenvoluparà amb més precisió i seguretat si creem un ambient segur i de llibertat per als xiquets, on el rol de l’adult és d’acompanyament no invasiu i testimoni dels seus èxits. Els treballs d’investigació de l’Institut Lóczy i de la doctora Emmi Pikler ens indi...

  6. L'Arxiu de Simancas i la Universitat de Cervera: aspectes biogràfics dels primers metges

    OpenAIRE

    Riera i Blanco, Manuel

    2012-01-01

    En aquesta comunicació al XVII Congrés d’HMC, exposarem la investigació històrica dels aspectes biogràfics particulars dels catedràtics, metges i estudiants de la Facultat de Medicina en els primers anys de la Universitat de Cervera. Seguim la tecnologia de l’anàlisi ergonòmica i dels fons documentals del Archivo General de Simancas, però aquí utilitzarem també com a fonts documentals bibliogràfiques, els estudis i aportacions que tenen com a font documental el “Archivo Universitario de Cerve...

  7. Primer registro de infestación en un reptil por larvas de Amblyomma parvitarsum (Acari: Ixodidae en Argentina

    Directory of Open Access Journals (Sweden)

    Gabriel Natalio Castillo

    2015-05-01

    Full Text Available Amblyomma parvitarsum es una garrapata endémica del Altiplano Andino de Argentina, Bolivia, Chile y Perú. En la provincia de San Juan adultos de esta garrapata fueron encontrados en el Parque Nacional San Guillermo sobre Vicugna vicugna. En Argentina también existen citas de adultos de A. parvitarsum sobre bovinos, ovinos y el ñandú . El primer caso de parasitismo de larvas de A. parvitarsum en Liolaemus fue realizado en Chile. El presente trabajo menciona por primera vez para Argentina la presencia de larvas de A. parvitarsum parasitando al lagarto Liolaemus eleodori.

  8. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  9. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  10. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  11. Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

    Science.gov (United States)

    Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

    2011-01-01

    Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

  12. Detection of mutated primers and impact on targeted metagenomics results

    OpenAIRE

    Antoine-Lorquin, Aymeric; Mahé, Frédéric; Dunthorn, Micah; Belleannée, Catherine

    2016-01-01

    International audience; High-throughout sequencing platforms are widely used in metabarcoding studies of environmental microbial diversity as they can quickly produce millions of reads. Resulting reads in these studies are clustered into molecular operational taxonomic units (OTUs) and compared statistically. In order to limit the number of spurious OTUs retrieved from samples, eliminating the reads with mutated primers has become the norm. This process has the advantage of not requiring the ...

  13. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  14. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  15. Defense Primer: The National Defense Budget Function (050)

    Science.gov (United States)

    2017-03-17

    provides a framework for examining spending patterns of the federal government by category of activity, rather than by agency or type of financing ...federal spending. Since federal agencies often have diverse, overlapping responsibilities , it is not uncommon for them to be associated with multiple...agency responsible for approximately 96% of spending within the National Defense Budget (050). Defense Primer: The National Defense Budget Function

  16. The Use of Degenerate Primers in qPCR Analysis of Functional Genes Can Cause Dramatic Quantification Bias as Revealed by Investigation of nifH Primer Performance.

    Science.gov (United States)

    Gaby, John Christian; Buckley, Daniel H

    2017-10-01

    The measurement of functional gene abundance in diverse microbial communities often employs quantitative PCR (qPCR) with highly degenerate oligonucleotide primers. While degenerate PCR primers have been demonstrated to cause template-specific bias in PCR applications, the effect of such bias on qPCR has been less well explored. We used a set of diverse, full-length nifH gene standards to test the performance of several universal nifH primer sets in qPCR. We found significant template-specific bias in all but the PolF/PolR primer set. Template-specific bias caused more than 1000-fold mis-estimation of nifH gene copy number for three of the primer sets and one primer set resulted in more than 10,000-fold mis-estimation. Furthermore, such template-specific bias will cause qPCR estimates to vary in response to beta-diversity, thereby causing mis-estimation of changes in gene copy number. A reduction in bias was achieved by increasing the primer concentration. We conclude that degenerate primers should be evaluated across a range of templates, annealing temperatures, and primer concentrations to evaluate the potential for template-specific bias prior to their use in qPCR.

  17. Heterologous microsatellite primer pairs informative for the whole genus Arachis

    Directory of Open Access Journals (Sweden)

    Andrea Akemi Hoshino

    2006-01-01

    Full Text Available The genus Arachis currently comprises 69 described species, some of which have potential and real value as human and animal foods. These Arachis species have been collected and maintained in germplasm banks to provide material that can be used as sources of genes in breeding programs and for the selection of new cultivars. One of the principal objectives of germplasm conservation is the evaluation of genetic variability, which is best conducted using molecular markers. We investigated the use of heterologous primers to amplify microsatellite loci that could be used to evaluate genetic variability in Arachis germplasm. Fifteen microsatellite primer pairs were tested in 76 accessions of 34 species from the nine Arachis sections. The data indicated that heterologous primers were very useful in Arachis since they had high transferability among the species (91% and allowed the amplification of very polymorphic putative loci, which allowed both the characterization of most accessions and to make inferences about the mating systems of some species analyzed. Our data also revealed that the germplasm analyzed showed high variability, even when represented by few accessions.

  18. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  19. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  20. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  1. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  2. Factores asociados al bajo peso al nacer

    Directory of Open Access Journals (Sweden)

    Georgina J Peraza Roque

    2001-10-01

    Full Text Available El bajo peso al nacer (BPN ha constituido un enigma en la ciencia a través de los tiempos. Múltiples son las investigaciones realizadas acerca de las causas que lo producen y las consecuencias que provoca. Su importancia no solo radica en lo que significa en la morbilidad y la mortalidad infantil, sino que estos niños tienen habitualmente múltiples problemas posteriores. El Programa para la Reducción del BPN señala que los niños nacidos con un peso inferior a los 2 500 g presentan riesgo de mortalidad 14 veces mayor durante el primer año de vida, en comparación con los niños que nacen con un peso normal a término. Dentro de los factores de riesgo del BPN se han encontrado con mayor frecuencia en estudios realizados por diferentes autores, los siguientes: el embarazo en la adolescencia, la desnutrición en la madre, el hábito de fumar, la hipertensión arterial durante el embarazo, la sepsis cervicovaginal, la anemia y los embarazos gemelares, entre otros. Es innegable la influencia que el BPN tiene sobre las futuras generaciones, por lo que debe constituir la diana de los esfuerzos que el médico y la enfermera deben desarrollar en su prevención, sobre todo en la comunidadLow birth weight has been an enigma for Science through times. A lot of research works have been carried out about its causes and consequences. The importance of LBW not only lies in its meaning for infant mortality and morbidity but also in the many problems that low birth weight children regularly face in the future. The program for the reduction of LBW points out that newborns weighing under 2500g have during his/her first year of life a mortality risk 14 times higher than newborns with a normal weight at term. Among the low birth weight risk factors, a number of studies by various authors have frequently found the following; pregnancy at adolescence; undernourishment in mothers, smoking, blood hypertension during pregnancy, cervix-vaginal sepsis; anemia, twin

  3. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  4. AL Amyloidosis

    Directory of Open Access Journals (Sweden)

    Desport Estelle

    2012-08-01

    Full Text Available Abstract Definition of the disease AL amyloidosis results from extra-cellular deposition of fibril-forming monoclonal immunoglobulin (Ig light chains (LC (most commonly of lambda isotype usually secreted by a small plasma cell clone. Most patients have evidence of isolated monoclonal gammopathy or smoldering myeloma, and the occurrence of AL amyloidosis in patients with symptomatic multiple myeloma or other B-cell lymphoproliferative disorders is unusual. The key event in the development of AL amyloidosis is the change in the secondary or tertiary structure of an abnormal monoclonal LC, which results in instable conformation. This conformational change is responsible for abnormal folding of the LC, rich in β leaves, which assemble into monomers that stack together to form amyloid fibrils. Epidemiology AL amyloidosis is the most common type of systemic amyloidois in developed countries with an estimated incidence of 9 cases/million inhabitant/year. The average age of diagnosed patients is 65 years and less than 10% of patients are under 50. Clinical description The clinical presentation is protean, because of the wide number of tissues or organs that may be affected. The most common presenting symptoms are asthenia and dyspnoea, which are poorly specific and may account for delayed diagnosis. Renal manifestations are the most frequent, affecting two thirds of patients at presentation. They are characterized by heavy proteinuria, with nephrotic syndrome and impaired renal function in half of the patients. Heart involvement, which is present at diagnosis in more than 50% of patients, leading to restrictive cardiopathy, is the most serious complication and engages prognosis. Diagnostic methods The diagnosis relies on pathological examination of an involved site showing Congo red-positive amyloid deposits, with typical apple-green birefringence under polarized light, that stain positive with an anti-LC antibody by immunohistochemistry and

  5. Reporte del primer caso de enfermedad de Chagas transplacentaria analizado por AP-PCR en Moniquirá, Boyacá

    Directory of Open Access Journals (Sweden)

    Concepción Judith Puerta

    2009-12-01

    Conclusiones. Éste es el primer caso de enfermedad de Chagas transplacentaria reportado en el municipio de Moniquirá, que demuestra que esta forma de transmisión ocurre en el país. La presencia de infección mixta por ambos grupos de T. cruzi en las muestras del recién nacido, sugiere infección mixta en la madre, con mayor prevalencia de T. cruzi I, al menos en el hemocultivo.

  6. Personalidad y tolerancia al dolor

    Directory of Open Access Journals (Sweden)

    JESÚS M.ª CARRILLO

    2005-01-01

    Full Text Available Se examina la relación de algunas variables de personalidad -EPQ-A (Eysenck y Eysenck, 1975, NEO-PI (McCrae y Costa, 1988 y STA -personalidad esquizotípica- y STB -personalidad límite-, de Claridge y Broks (1984, con la tolerancia al dolor experimental inducido mediante agua fría (cold pressor test, según el procedimiento de Staats, Heckmat y Staats (1998 en una muestra filtrada mediante un cuestionario sobre dolor crónico, dolores de cabeza, de espalda, artritis, síndrome de Raynaud, y personas bajo medicación. La tolerancia al dolor experimental se evaluó mediante el Umbral del dolor (tiempo en segundos desde la introducción de la mano en el agua hasta el primer informe de dolor, Mantenimiento del dolor (duración en segundos de la inmersión de la mano desde la aparición del umbral hasta su retirada y Tolerancia al dolor (duración total en segundos de la inmersión de la mano desde su introducción hasta su retirada. Un análisis correlacional, factorial y de regresión por pasos mostraron un efecto cruzado entre medidas de ansiedad (tolerancia negativa al dolor y psicoticismo, siendo psicoticismo junto con control emocional predictores de tolerancia positiva al dolor. En cuanto a psicoticismo, parece que son sus elementos de naturaleza paranoide y de "dureza" los que afectan a una percepción atenuada del dolor.

  7. Effect of saliva contamination and artificial aging on different primer/cement systems bonded to zirconia.

    Science.gov (United States)

    Pitta, João; Branco, Teresa C; Portugal, Jaime

    2017-09-27

    Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermal cycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (Pcontamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (Pcontamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by

  8. PHQ-2 COMO PRIMER INSTRUMENTO DE CRIBADO DE LA DEPRESIÓN PRENATAL

    Directory of Open Access Journals (Sweden)

    María de la Fe Rodríguez-Muñoz

    2017-01-01

    Full Text Available La depresión prenatal es un importante problema de salud pública que apenas recibe tratamiento. La depresión durante este período está asociada con consecuencias negativas tanto para la madre como para el bebé. Por ello, es importante realizar un cribado adecuado en mujeres embarazadas. El objetivo del presente estudio fue conocer la capacidad discriminativa y el punto de corte del cuestionario PHQ-2 como primer instrumento de cribado para identificar la depresión en mujeres embarazadas que viven en España. Método: Participaron voluntariamente 1.019 mujeres, de edad comprendida entre los 19 y los 45 años, que acudieron a revisión obstétrica en el primer trimestre del embarazo. Las participantes completaron un cuestionario sociodemográfico y los cuestionarios PHQ9 y PHQ2. La investigación fue desarrollada en dos hospitales públicos de dos comunidades autónomas diferentes. Se llevó a cabo entre los años 2014 y 2016. Se realizó un análisis con curva ROC para determinar la capacidad discriminativa y el punto de corte del PHQ-2. Resultados: De las 1.019 participantes el 11,1% fueron diagnosticadas de depresión. El área bajo la curva del PHQ2 fue de 0,84 p<0,001. Con el punto de corte de 2 la sensibilidad y especificidad fueron de 85,4% y 79,5% respectivamente. Conclusiones: La puntuación de corte ≥2 es adecuada para la discriminación de la depresión durante el embarazo mediante el cuestionario PHQ2 y podría servir como cribado previo al PHQ-9.

  9. Influence of multimode universal adhesives and zirconia primer application techniques on zirconia repair.

    Science.gov (United States)

    Seabra, Bruno; Arantes-Oliveira, Sofia; Portugal, Jaime

    2014-08-01

    More information is needed on the efficacy of the new universal adhesives and on the best 10-methacryloyloxydecyl dihydrogen phosphate- (MDP)-containing primer protocol to promote adhesion to zirconia. The aim of this study was to evaluate the influence of 2 new multimode MDP-containing adhesives and several application protocols of a zirconia primer on the shear bond strength (SBS) of composite resin to zirconia. Sixty zirconia (3Y-TZP) blocks were abraded (50 μm Al2O3) and divided into 6 experimental groups (n=10): one Z-Prime Plus coat without light polymerization; one Z-Prime Plus light-polymerized coat; two Z-Prime Plus coats without light polymerization; two Z-Prime Plus light-polymerized coats; All-Bond Universal; and ScotchBond Universal Adhesive. Multimode adhesives were applied according to the manufacturers' recommendations. After composite resin (Filtek Z250) light polymerization, the specimens were stored in distilled water (37°C/48 hours) and tested in shear (1 mm/min). Failure mode was classified as adhesive or mixed. Statistical analysis of the SBS data was performed with 1-way ANOVA followed by the Student-Newman-Keuls post hoc tests. Nonparametric tests (Kruskal-Wallis) were used to analyze the failure mode data (α=.05). The ScotchBond Universal Adhesive, All-Bond Universal, and two Z-Prime Plus light-polymerized coats groups showed a higher mean SBS than the other experimental groups (Padhesive failures. The new multimode adhesives tested were effective in promoting adhesion between composite resin and zirconia. Z-Prime Plus should be applied in 2 light-polymerized coats to promote SBS values similar to those of the new multimode adhesives. Copyright © 2014 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  10. Lou Gehrig's Disease (ALS)

    Science.gov (United States)

    ... for Educators Search English Español Lou Gehrig's Disease (ALS) KidsHealth / For Kids / Lou Gehrig's Disease (ALS) What's ... with ALS in the 1930s. What Happens in ALS? ALS damages motor neurons in the brain and ...

  11. Rapid identification of Zygosaccharomyces with genus-specific primers.

    Science.gov (United States)

    Hulin, Michelle; Wheals, Alan

    2014-03-03

    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Status of corrosions protection primers for the automotive industry

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann-Loeser, P. [Adam Opel AG, Ruesselsheim (Germany); Schnell, A. [DaimlerChrysler, Werk Sindelfingen (Germany); Stellnberger, K.H.; Androsch, F.M. [voestalpine Stahl, Linz (Austria); Reier, T. [SZMF, Salzgitter (Germany); Lewandowski, J. [ThyssenKrupp Stahl, Duisburg (Germany); Filthaut, C. [DOC Dortmunder OberflaechenCentrum, Dortmund (Germany); Besseyrias, A. [Arcelor / R and D LEDEPP, Florange (France); Dane, C. [Corus, Ijmuiden (Netherlands); Steinbeck, G. [Steel Institute VDEh, Duesseldorf (Germany)

    2005-07-01

    In Europe, 2.5 - 4 {mu}m Zn-pigmented corrosion protection primers (CPP) are being used by the automotive industry. A short introduction describing the development steps leading up to the state of the art will be given and also the reasons for using it in practice. For some applications it became necessary to try to achieve a significantly higher level of corrosion resistance than this ''first generation'' type coating can offer. It was also important to lower the curing temperature of the paint considerably in order to be able to supply bake-hardening grade steels. This type of corrosion protection primer is now called the ''second generation''. The Opel-production of the Astra-family started using 2{sup nd} generation CPP (4-6 {mu}m) on chromate-free pre-treatment and EG for hood and crash box in 2004. The newest developments show a high potential to lower the coating thickness even further and thus make cost savings possible. The development process is still ongoing and for effective progress, a good mutual basis for laboratory evaluation of properties is of valuable support. In a Steel Institute VDEh working group (Arcelor, Corus, Salzgitter, ThyssenKrupp, voestalpine), test procedures are being generated in order to be able to correctly assess properties such as corrosion resistance, adhesion, peeling-off behavior, etc. An overview of the procedures will be given together with correlations between laboratory results and reality. To round up the paper, corrosion protection primers have a number of potentials which can be utilized by the automotive industry to justify the additional cost. Examples highlighted with results giving evidence of these potentials will be shown. (orig.)

  13. Utilidad de la morfología de los huevos como un método indirecto para identificar Anopheles benarrochi Gabaldón,Cova García & López, Anopheles oswaldoi (Peryassu y Anopheles rangeli Gabaldón, Cova García & López, (Diptera:Culicidae en Putumayo, Colombia.

    Directory of Open Access Journals (Sweden)

    Dora Amparo Estrada

    2003-12-01

    Full Text Available La identificación correcta de las hembras es esencial para el éxito de cualquier estudio de epidemiología, resistencia a insecticidas o de control de vectores. En el departamento del Putumayo, en el sur de Colombia, la transmisión de malaria continúa siendo un problema, a pesar de la ausencia de los vectores principales de Latinoamérica (Anopheles darlingi Root, Anopheles nuneztovari Gabaldón, Anopheles albimanus Wideman, Anopheles trinkae Faran en esta región. Se recolectaron. con cebo humano, hembras de Anopheles y se encontró una variante morfológica de Anopheles benarrochi, que en su estadio adulto fácilmente se confunde con Anopheles oswaldoi. La identificación de hembras de Anopheles, particularmente del subgénero Nyssorhynchus, es en general notoriamente difícil debido a la superposición de caracteres morfológicos en el estadio adulto; por tanto, las colecciones deben estar ligadas a la cría de material asociado para identificar correctamente las especies. Esto requiere tiempo y es difícil de obtener en muchas ocasiones. Se presenta un método indirecto de identificación de las especies A. benarrochi, A. oswaldoi y Anopheles rangeli del sur de Colombia usando la morfología de los huevos de hembras silvestres. Los huevos de A. rangeli y A. benarrochi se diferencian por la corona anterior, la cual es apical en A. rangeli y con paredes altas, mientras que en A. benarrochi es ventral y con paredes más cortas. Esta corona está ausente en A. oswaldoi. Estas diferencias fueron obvias incluso bajo un microscopio de luz, lo que hace posible una identificación correcta de estas especies en condiciones de campo. Se muestra cómo la observación de la morfología de los huevos puede permitir la determinación taxonómica correcta, aunque indirecta, de estas tres especies de Nyssorhynchus encontradas en el sur de Colombia, el cual puede ser útil también en otras regiones de Latinoamérica, en donde se encuentre la variante

  14. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  15. Eficacia del primer tratamiento sistémico con glucocorticoides en la enfermedad inflamatoria intestinal. Revisión sistemática y serie de casos

    OpenAIRE

    López San Román, Antonio

    2009-01-01

    Los glucocorticoides son un fármaco de eficacia alta en pacientes con enfermedad inflamatoria intestinal, consiguiendo inducir respuesta en aproximadamente un 70% de los pacientes, respuesta que perdura a largo plazo en casi la mitad de los casos. La mayor edad al diagnóstico y al inicio del primer tratamiento son los principales factores predoctores de mala respuesta a los glucocorticoides. Una política de inmunosupresión precoz de los pacientes que no se hubieran beneficiado a largo plazo d...

  16. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  17. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  18. Shining On: A primer on solar radiation data

    Energy Technology Data Exchange (ETDEWEB)

    Dunlap, M.A.; Cook, G. [eds.; Marion, B.; Riordan, C.; Renne, D.

    1992-05-01

    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  19. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  20. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  1. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  2. Primer reporte de la familia Cheiridiidae (Arachnida: Pseudoscorpionida en Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Alexander Quirós-Rodríguez

    2015-09-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin-Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito en el departamento de Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.

  3. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  4. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  5. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  6. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  7. Eficacia experimental de anticuerpos IgY producidos en huevos, contra el veneno de la serpiente peruana Bothrops atrox Experimental efficacy of IgY antibodies produced in eggs against the venom of the Peruvian snake Bothrops atrox

    Directory of Open Access Journals (Sweden)

    Julio C. Mendoza

    2012-03-01

    Full Text Available Objetivos. Desarrollar un protocolo de inmunización para producir inmunoglobulinas IgY de origen aviar contra el veneno de la serpiente peruana Bothrops atrox y evaluar la capacidad neutralizante. Materiales y métodos. Se inmunizaron seis gallinas de postura de la raza hy line brown con 500 μg/dosis de veneno de B. atrox en un periodo de dos meses. Cada semana, los huevos fueron colectados para el aislamiento de inmunoglobulinas IgY a partir de la yema, usando dos pasos consecutivos con αcido caprνlico y sulfato de amonio. La detecciσn de anticuerpos se realizσ por inmunodifusiσn doble mientras que el tνtulo y reactividad cruzada se determinaron por las técnicas de ELISA y Western blot. El cálculo de DL50 y de la DE50 del antiveneno IgY producido se realizó utilizando el método de Probits. Resultados. La masa de anticuerpos aislados fue de 8,5 ± 1,35 mg de IgY/mL de yema. Asimismo, la DE50 del antiveneno aviar fue calculada en 575 μL de antiveneno/mg de veneno. Adicionalmente, los ensayos de reactividad cruzada mostraron que el veneno de B. atrox comparte mas epνtopes comunes con el veneno de B. brazili (47% que con otros veneno del mismo género, en tanto que los venenos de Lachesis muta (19% y Crotalus durissus (12% mostraron una baja reactividad cruzada. Conclusiones. Se ha obtenido IgY purificada contra el veneno de B. atrox con capacidad neutralizante y se ha demostrado su utilidad como herramienta inmunoanalítica para evaluar la reactividad cruzada con venenos de otras especies.Objectives. To develop an immunization protocol in order to produce avian IgY immunoglobulins against Bothrops atrox Peruvian snake venom and to evaluate its neutralizing capacity. Materials and methods. Six Hy Line Brown hens were immunized each two weeks using 500μg/doses of B. atrox venom in a period of two months. Each week, eggs were collected for IgY isolation from yolk using two consecutive steps with caprilic acid and ammonium sulfate

  8. Primer for evaluating ecological risk at petroleum release sites.

    Science.gov (United States)

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response.

  9. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  10. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  11. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  12. Modelos de aplicación de ecuaciones diferenciales de primer orden con geogebra: actividades para resolver problemas de mezclas

    Directory of Open Access Journals (Sweden)

    Cesar Augusto Hernández-Suarez

    2016-09-01

    Full Text Available El objetivo del estudio es diseñar una actividad para abordar los problemas de mezclas en un curso de ecuaciones diferenciales que permita realizar cambios de representación en los registros gráfico, algebraico y lengua natural mediante la ayuda de software libre Geogebra, esperando así reducir la dificultad que presentan los estudiantes al momento de plantear la ecuación diferencial que modela un problema de mezclas. La actividad se fundamenta en dos marcos, el didáctico y el matemático, los cuales fueron elaborados con los aportes de distintas fuentes consultadas acerca del objeto de investigación. La selección de los participantes fue realizada mediante muestreo intencional y durante el desarrollo de este proceso se eligieron dieciocho (18 estudiantes de un programa académico de Ingeniería Civil de un curso de ecuaciones diferenciales. Se aplicó una encuesta a los estudiantes sobre los modelos de aplicación de ecuaciones diferenciales de primer orden para determinar el modelo a utilizar; los modelos con mayor porcentaje de elección fueron: Mezclas y ley de enfriamiento de Newton, razón por la cual se eligió el modelo de mezclas para el diseño de una actividad tipo test con 3 problemas que para ser resueltos con el Geogebra. Se analizan las respuestas dadas por los estudiantes al resolver una serie de problemas de aplicación de primer orden con el software libre Geogebra. Estos problemas permiten realizar traspasos del registro lenguaje natural al algebraico mediante representaciones ejecutables y preguntas que pretenden orientar al estudiante durante el desarrollo de la misma, con el fin de proporcionar herramientas para plantear la ecuación diferencial que se ajusta a los problemas planteados. Como resultados se obtiene una propuesta del uso del Geogebra como un recurso didáctico para favorecer la resolución de problemas de aplicación de ecuaciones diferenciales de primer orden (problemas de mezclas. Se puede concluir

  13. Estrategia de motivación para estudiantes de primer año de Medicina, Universidad San Sebastián, Concepción, Chile

    Directory of Open Access Journals (Sweden)

    P. Jorquera-Aguayo

    Full Text Available Introducción. En el marco de un nuevo modelo educativo formativo, la Universidad San Sebastián apunta al desarrollo de estrategias pedagógicas que sitúan al estudiante en el centro de las acciones. Es así como surge la necesidad de incrementar la motivación en los jóvenes que ingresan a la carrera de medicina, profesión desde siempre ligada a los valores sociales y el altruismo. Este trabajo explora la relevancia del contacto temprano con el paciente y el hospital como fuentes de motivación en primer año. Sujetos y métodos. Todos los estudiantes de primer año de medicina (n = 115 fueron invitados a visitar voluntariamente un hospital. Allí, los estudiantes recorrieron el establecimiento y sostuvieron una conversación libre con un paciente. Las opiniones se recogieron a través de un escrito libre. Resultados. Se inscribieron 95 estudiantes, de los cuales 68 concurrieron a la visita. Al consultar sobre la vivencia con el paciente, los estudiantes se refirieron positivamente a ésta. La ansiedad al inicio de la conversación fue uno de los aspectos más mencionados, al igual que la importancia de conocer el futuro lugar de trabajo. Conclusiones. La experiencia evidenció un alto interés en participar. Asimismo reveló elementos de la vida afectiva de los estudiantes, pilar fundamental de la educación médica. Finalmente, se aconseja la temprana relación con el paciente y con el hospital como agentes motivacionales en primer año. Se sugiere incorporar tareas y complementar la evaluación con herramientas que permitan obtener información objetiva sobre los aprendizajes adquiridos.

  14. Effect of incorporating BisGMA resin on the bonding properties of silane and zirconia primers.

    Science.gov (United States)

    Chen, Liang; Shen, Hong; Suh, Byoung In

    2013-11-01

    Some silane primers and some zirconia primers contain extra resins such as bisphenol A glycol dimethacrylate (BisGMA) in their formulations for better wetting. No studies exist on the bonding properties of zirconia and silane primers, which contain extra resins. The purpose of this study was to investigate the effect of incorporating BisGMA resin on the bonding properties of silane and zirconia primers. Silica-base lithium disilicate was etched and treated with BisGMA-incorporated Porcelain Primer, unmodified Porcelain Primer, or resin-containing Kerr Silane. Zirconia ceramic was airborne-particle abraded and treated with BisGMA-incorporated Monobond Plus, unmodified Monobond Plus, or BisGMA-containing ZPrime Plus. After primer treatment and cleaning with ethanol, the contact angles were measured to determine surface change (n=10). Shear bond strength tests were also performed to measure the adhesion strength between resin cements and ceramic surfaces (n=10). Data were statistically analyzed by 1-way ANOVA followed by the Tukey multiple comparison as a post hoc test (significance level .05). The incorporation of BisGMA resin did not significantly influence the bond strength or contact angle of the zirconia primer (P>.05), but it did significantly reduce those of the silane primer (PSilane (22 degrees, 23 MPa) had a similar contact angle and higher bond strength than the control (21 degrees, 18 MPa), but lower than Porcelain Primer (88 degrees, 34 MPa). Resin-containing ZPrime Plus (75 degrees, 29 MPa) had a similar contact angle and higher bond strength than both Monobond Plus (74 degrees, 18 MPa) and the control (15 degrees, 4 MPa). The addition of BisGMA resin significantly inhibited the efficacy of silane-containing porcelain primers but did not affect that of phosphate-containing zirconia primers. Copyright © 2013 Editorial Council for the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.

  15. Studi Operasi Resin Penukar Ion Dalam Sistem Purifikasi Air Primer Pwr

    OpenAIRE

    Biyantoro, Dwi; Basuki, Kris Tri; Subagiono, Subagiono

    2006-01-01

    STUDI OPERASI RESIN PENUKAR ION DALAM SISTEM PURIFIKASI AIR PRIMER PWR. Telah dilakukan studioperasi resin penukar ion dalam sistem purifikasi air primer PWR. Air pendingin reaktor yang pada awalnya sesuaidengan persyaratan setelah pengoperasian reaktor sering kualitasnya berubah, sehingga harus dimurnikan. Unsurunsurpengotor dalam air primer PWR diidentifikasi sebagai penyebab pengotor seperti korosi, pelepasan produk fisi(Cs137, Sr90, Co60,C14, Tc99), dan pelepasan kembali unsur oleh resin ...

  16. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A

    1999-01-01

    -chain, the immunoglobulin kappa light chain, and the c-myc locus. Whereas none of the mutants were found to revert to tRNAPro primer utilization, in two tumors resulting from the injection of the SL3-3 Lys3 mutant the primer binding site was altered to match that of a new primer species, tRNA1,2Lys. In addition...

  17. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  18. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    Protection of steel structures, using so-called intumescent coatings, is an efficient and space saving way to prolong the time before a building, with load bearing steel constructions, collapses in the event of a fire. In addition to the intumescent coating, application of a primer may be required....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  19. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  20. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Abu al-Layth al-Libi

    Science.gov (United States)

    2015-02-01

    opponents were the stringent militants in the Khaldan camp and its Institute of the Faith Brigades (Ma`had Kata`ib al-Iman), where the virulent ...local fighter remembered that al-Libi used to live together with Hamza al- Rabi `a, the former head of al-Qa`ida’s external operations, and Abu Khabbab

  2. ¿Qué textos leen en primer año los estudiantes de Psicología?

    Directory of Open Access Journals (Sweden)

    María Micaela Villalonga Penna

    2016-11-01

    Full Text Available Resumen Qué se lee en las universidades es una de las temáticas que han abordado los estudios realizados desde los enfoques de las Alfabetizaciones Académicas y de la Literacidad crítica. En este sentido, nos preguntamos ¿qué textos leen en primer año los estudiantes de psicología? Teniendo en cuenta este interrogante, en este trabajo presentamos el análisis del material bibliográfico del primer año de la carrera de psicología de una universidad estatal. Esta investigación se realizó desde los enfoques cualitativo y cuantitativo de investigación. Analizamos un corpus de 320 textos que corresponden al material bibliográfico de las nueve materias del primer año de la mencionada carrera. Empleamos las categorías de análisis propuestas por Carlino (2005, Padilla (2013 y Padilla, Douglas y López (2007; 2011, entre otras, y tuvimos en cuenta categorías emergentes también. Los hallazgos dieron a conocer el uso de ´cuadernillos´, que incluyen fotocopias del material bibliográfico que pueden o no contar con elementos que ayuden a contextuarlo como copias de la tapa y contratapa, página con datos de edición, índice y referencias completas. El material bibliográfico está constituido por textos académicos derivados de textos científicos, entre los que priman los capítulos de libros y las fichas de cátedra. Además, estos textos son predominantemente expositivos o argumentativos.

  3. ¿Qué textos leen en primer año los estudiantes de Psicología?

    Directory of Open Access Journals (Sweden)

    María Micaela Villalonga Penna

    Full Text Available Resumen Qué se lee en las universidades es una de las temáticas que han abordado los estudios realizados desde los enfoques de las Alfabetizaciones Académicas y de la Literacidad crítica. En este sentido, nos preguntamos ¿qué textos leen en primer año los estudiantes de psicología? Teniendo en cuenta este interrogante, en este trabajo presentamos el análisis del material bibliográfico del primer año de la carrera de psicología de una universidad estatal. Esta investigación se realizó desde los enfoques cualitativo y cuantitativo de investigación. Analizamos un corpus de 320 textos que corresponden al material bibliográfico de las nueve materias del primer año de la mencionada carrera. Empleamos las categorías de análisis propuestas por Carlino (2005, Padilla (2013 y Padilla, Douglas y López (2007; 2011, entre otras, y tuvimos en cuenta categorías emergentes también. Los hallazgos dieron a conocer el uso de ´cuadernillos´, que incluyen fotocopias del material bibliográfico que pueden o no contar con elementos que ayuden a contextuarlo como copias de la tapa y contratapa, página con datos de edición, índice y referencias completas. El material bibliográfico está constituido por textos académicos derivados de textos científicos, entre los que priman los capítulos de libros y las fichas de cátedra. Además, estos textos son predominantemente expositivos o argumentativos.

  4. A Primer on Concepts and Applications of Proteomics in Neuroscience.

    Science.gov (United States)

    Hosp, Fabian; Mann, Matthias

    2017-11-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS)-based proteomics, focusing on the analysis of whole proteomes, protein-based interactions, and post-translational modifications. We also discuss how advanced workflows help to unravel spatial, regulatory, and temporal aspects of neuronal systems. These tools and approaches have already led to detailed and quantitative proteomic maps of the brain and its signaling architecture, generating new insights into health and disease. We predict that these new approaches will also accelerate biomarker discovery and contribute to novel therapeutics for neurodegenerative and other brain-related diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  6. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  7. Evaluation of non toxic alkyd primers by electrochemical impedance spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, L.S.; Garcia, G. [UASLP, San Luis Potosi (Mexico). Inst. of Metallurgy]|[UNLP, La Plata (Argentina); Lopez, C. [Univ. Autonoma de Campeche (Mexico)

    1998-12-31

    The purpose of this work was to compare the protective capacity of several alkyd primers pigmented with 12.1 volume percent either of calcium phosphate or micronized zinc phosphate as anticorrosive pigments. A paint containing zinc chromate was used as reference. The performance of these paints on steel was assessed through Electrochemical Impedance Spectroscopy (EIS) using a 3% NaCl solution. After 576 hr immersion, the paint with calcium phosphate and specially that with micronized zinc phosphate, showed a better behavior than paint with zinc chromate. Paint rating, using impedance parameters (ionic resistance and capacitance of the paint film, and breakpoint frequency), was in agreement with the visible paint deterioration and corrosion, In addition, there was a good correlation between these parameter and the open circuit corrosion potential of the metallic substrate.

  8. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  9. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  10. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  11. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  12. Soft solids a primer to the theoretical mechanics of materials

    CERN Document Server

    Freed, Alan D

    2014-01-01

    This textbook presents the physical principles pertinent to the mathematical modeling of soft materials used in engineering practice, including both man-made materials and biological tissues. It is intended for seniors and masters-level graduate students in engineering, physics, or applied mathematics. It will also be a valuable resource for researchers working in mechanics, biomechanics, and other fields where the mechanical response of soft solids is relevant.   Soft Solids: A Primer to the Theoretical Mechanics of Materials is divided into two parts. Part I introduces the basic concepts needed to give both Eulerian and Lagrangian descriptions of the mechanical response of soft solids. Part II presents two distinct theories of elasticity and their associated theories of viscoelasticity. Seven boundary-value problems are studied over the course of the book, each pertaining to an experiment used to characterize materials. These problems are discussed at the end of each chapter, giving students the opportunit...

  13. Susceptibilidad de genotipos de Solanum spp. al nematodo causante del nudo radical Meloidogyne spp. (chitwood

    Directory of Open Access Journals (Sweden)

    Cristian Gelpud Chaves

    2011-01-01

    Full Text Available El cultivo del lulo (Solanum quitoense L. presenta una disminución en su productividad, debido al ataque de patógenos como el nematodo del nudo radical Meloidogyne spp., en el Departamento de Nariño (Colombia, se han reportado incidencias cercanas al 79%, y pérdidas del 50%. En la presente investigación, se colectaron 45 genotipos de (Solanum quitoense L. en los Departamentos de Nariño y Putumayo y 4 genotipos silvestres (S. mammosum, S. hirtum, S. marginatum y S. umbellatum buscando fuentes de resistencia al nematodo. Se inocularon 9 plantas de cada genotipo de dos meses de edad con 10000 huevos de Meloidogyne spp., dejando tres testigos por cada material. Las variables evaluadas fueron: altura de planta, severidad, incidencia, peso fresco (tallo y raíz y especies prevalentes de Meloidogyne spp. Se hizo una clasificación de genotipos mediante escala de resistencia y regresión entre la severidad y las demás variables para establecer el efecto de Meloidogyne spp. sobre los genotipos de planta. Los resultados mostraron 100% de incidencia del nematodo en todos los genotipos, 2.04% genotipos resistentes, 34.7% moderadamente resistentes, 42.8% moderadamente susceptibles, 18.3% susceptibles, y 2.04% altamente susceptibles. El genotipo SQbr05 resistente, no se vio afectado por la severidad, al contrario SQbc04 genotipo susceptible, mostró reducciones significativas en peso fresco de tallo y raíz, (R² = 0.71 y 0.98, el genotipo silvestre (S. mammosum es altamente susceptible, Meloidogyne incognita presentó 55.31% de presencia. El genotipo SQbr05 es promisorio para ser evaluado en campo.

  14. [Influence of primers ' chemical composition on shear bond strength of resin cement to zirconia ceramic].

    Science.gov (United States)

    Łagodzińska, Paulina; Bociong, Kinga; Dejak, Beata

    2014-01-01

    Resin cements establish a strong durable bond between zirconia ceramic and hard tissues of teeth. It is essential to use primers with proper chemical composition before cementation. The aim of this study was to assess the influence of primer's chemical composition on the shear bond strength of zirconia ceramic to resin cements. 132 zirconia specimens were randomly assigned to four groups. There were four resin systems used. They included resin cement and respective primer, dedicated to zirconia: Clearfil Ceramic Primer/Panavia F2.0, Monobond Plus/Multilink Automix, AZ - Primer/ResiCem, Z - Prime Plus/Duo-Link. In each group the protocol of cementation was as follows: application of primer to the zirconia surface and application of the respective resin cement in cylindric mold (dimensions: 3.0 mm height and 3.0 mm diameter). Then, the shear bond strength was evaluated and the failure type was assessed in lupes (×2.5 magnification), also random specimens under SEM. The Wilcoxon test was used to analyze the data, the level of significance was α = 0.05. Finally, the known chemical composition of each primer was analysed in reference to probable chemical bonds, which may occure between primers and zirconia. The mean shear bond strength between resin cements and zirconia was the highest for Z-Prime Plus/Duo-Link (8.24 ± 3,21 MPa) and lowest for Clearfil Ceramic Primer/Panavia F 2.0 (4.60 ± 2.21 MPa). The analysis revealed significant difference between all groups, except pair Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem. The failure type in groups of Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem was mainly adhesive, in groups Monobond Plus/ /Multilink Automix and Z-Prime Plus/Duo-Link mainly mixed. The chemical composition of primers affects different bond mechanisms between resin cements and zirconia. The highest shear bond strength of resin cement to zirconia can be obtained for the primer composed of 10-Methacryloyloxydecyl dihydrogen

  15. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  16. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  17. Addition of Na2CO3 Improves the Shelf Life of Experimental 4-META Self-etch Primer.

    Science.gov (United States)

    Matsumoto, Hiro; Yamamoto, Takatsugu; Hanabusa, Masao; Momoi, Yasuko; Hayakawa, Tohru

    2017-01-01

    The objective of this study was to assess the influence of the addition of Na2CO3 on the shelf life and bond strength of 4-META self-etch primer. Two 4-META self-etch primers were experimentally formulated with and without the addition of Na2CO3 (primer A and primer B, respectively). The primers were stored at 37°C for several periods of time after formulation. Clearfil SE Bond Primer (Kuraray Noritake Dental) was used as a control. A composite was bonded to bovine dentin using a combination of the primer and a bonding agent (Clearfil SE Bond), and the shear bond strengths were measured. Changes in the pH of the experimental primers were monitored and macroscopic observations were made as a function of the storage periods. With 0-day storage, the bond strength of primer A was equivalent to that of primer B and significantly lower than that of Clearfil SE Primer. The bond strengths of primer A were stable during 90-day storage; by contrast, the bond strengths of primer B significantly decreased during 7-day storage. primer A exhibited stable pH values during 180-day storage; primer B exhibited significantly lower pH than primer A with 0-day storage and discolored gelation during 7-day storage. By adding Na2CO3, the shelf life of the 4-META self-etch primer was obviously improved without significant deterioration in dentin bond strength. Adjusting the pH to around 4.5 was effective for obtaining sufficient bond strength and hydrolytic stability of the primer.

  18. Entre las musas y la espada : la imagen del artista durante el primer franquismo

    Directory of Open Access Journals (Sweden)

    Raquel Pelta Resano

    1997-01-01

    Full Text Available El propósito de este trabajo es hacer un breve recorrido por los distintos textos que la literatura artística del primer franquismo dedicó a la figura del artista. Escritores, críticos y periodistas insistieron en una imagen tópica, procedente del Romanticismo, a la que se despojó de todo contenido revolucionario o antisocial y sobre la que se añadieron elementos de corte exacerbadamente nacionalista y católico. Hubo, además, ciertos sectores que trataron de convertir al artista en instrumento de propaganda política y reclamaron su compromiso con los valores del régimen de Franco.The aim of this article is to explore the image of artist present in several writings published during the early regime of the General Franco. Writers, critics and journalists stressed a commonplace image, stripped of any revolutionary or antisocial root. Some radical nationalist and catholic elements were added to this image. Besides, some theorists claimed to artist's political compromise for the construction of the new state.

  19. Reseña del Primer Encuentro Internacional de Institutos de Medicina Tropical 2013

    Directory of Open Access Journals (Sweden)

    Jorge O Alarcón

    2014-04-01

    Full Text Available El Primer Encuentro Internacional de Institutos de Medicina Tropical, llevado a cabo en Lima, fue la actividad principal del cincuentenario de la fundación del Instituto de Medicina Tropical Daniel A. Carrión (1963-2013, de la Facultad de Medicina de la UNMSM. Participaron en su organización las principales instituciones científicas del país relacionadas a la investigación y atención de los problemas de salud que afectan a las regiones tropicales y subtropicales. Asistieron alrededor de mil personas. Los temas tratados fueron salud infantil en los trópicos, salud internacional, VIH/sida, dengue, malaria, leishmaniosis, tuberculosis, enfermedad de Carrión y enfermedades emergentes y reemergentes. Los representantes de los nueve institutos de Medicina Tropical de la región, asistentes al evento, suscribieron una declaración, en la que acordaron, entre otros puntos, promover en sus países las recomendaciones adoptadas en la Asamblea Mundial de la Salud y Organización Panamericana de la Salud en relación a enfermedades desatendidas, investigación en salud y recursos humanos en salud; desarrollar programas de posgrado regionales en medicina tropical, epidemiología y salud pública; articular las acciones de este encuentro con otras iniciativas regionales y subregionales, y realizar el Segundo Encuentro Internacional de Institutos de Medicina Tropical en dos años.

  20. Reporte del primer caso humano de infección parasitaria por Mammomonogamus laryngeus en Colombia

    Directory of Open Access Journals (Sweden)

    Jhon Carlos Castaño

    2006-09-01

    Full Text Available Los parásitos del género Mammomonogamus afectan el tracto respiratorio de mamíferos domésticos. La especie M. laryngeus es un nemátodo donde la hembra y el macho están unidos en permanente cópula produciendo una forma distintiva de letra "Y" mayúscula. En el mundo han sido reportados hasta el momento poco más de 100 casos de infección en humanos. Este reporte describe el primer paciente infectado en Colombia (Armenia, Quindío, quien presentó como sintomatología tos crónica productiva de dos meses de duración, con inmediata y total recuperación clínica luego de la expulsión del parásito en el esputo durante un fuerte acceso de tos. Este reporte incluye la descripción morfológica del gusano adulto, así como un breve resumen de la epidemiología y manifestaciones clínicas en humanos. También se presentan las fotografías tomadas al parásito, donde se observan algunos de los detalles morfológicos principales, que sirvieron para su identificación.

  1. Las Provincias Vascas y la Guerra de la Convención. Primer encuentro con la Revolución

    Directory of Open Access Journals (Sweden)

    José María PORTILLO VALDÉS

    2009-12-01

    Full Text Available Entre 1793 y 1795 en las provincias vascas se produjo el primer encuentro con la Revolución, la que entonces era mayúscula y encarnación misma del espíritu revolucionario. Sería la primera ocasión para que los territorios vascos de la monarquía española experimentaran —en mayor o menor grado— lo que tal revolución podía significar. No se trató únicamente de una escaramuza militar ni de una ocupación territorial. No fue tampoco ante todo —como veremos— ocasión para plantear una posible alternativa a la tradicional vinculación al continente de la monarquía católica. Históricamente aquel primer encuentro hubo de tener una significación bastante más profunda marcando una muy clara línea de evolución en el proceso provincial de tránsito de sistemas y en su relación con el fenómeno revolucionario francés.

  2. Primer consenso colombiano del síndrome de apnea hipopnea obstructiva del sueño (SAHOS

    Directory of Open Access Journals (Sweden)

    Natalia Londoño-Palacio

    2017-08-01

    Full Text Available El Grupo de Investigación Transdisciplinario en Trastornos del Sueño (GITTS, conformado en 2011 por representantes de diferentes asociaciones científicas de Colombia, tomó la iniciativa de escribir el Primer Consenso Colombiano de Síndrome de Apnea-Hipopnea Obstructiva del Sueño (SAHOS en adultos con el fin de dar claridad conceptual al tema y con base en la revisión sistemática de la evidencia científica mundial. Esto, luego de publicar la “Guía para la certificación de servicios diagnósticos de trastornos del sueño en Colombia (incluye estándares para servicios pediátricos” (1. Se conformó un grupo de la más elevada calidad científica entre autores principales (miembros de GITTS e invitados nacionales y extranjeros. Hasta la fecha, se considera que este es el primer documento colombiano que reúne el concepto de multidisciplinariedad en una enfermedad sistémica como el SAHOS.

  3. Contribucion al control de motores de reluctancia autoconmutados

    OpenAIRE

    Perat Benavides, José Ignacio

    2006-01-01

    En esta tesis se hacen contribuciones al control de los motores de reluctancia autoconmutados (switched reluctance motors) de potencias comprendidas entre 0.25 y 10 kW. En primer lugar, después de una breve introducción histórica, se ubica al motor de reluctancia autoconmutado en el contexto de los accionamientos eléctricos y se analiza su constitución, modelo y principio de funcionamiento. A continuación se hace una relación de sus ventajas e inconvenientes, de sus principales aplicaciones c...

  4. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    Science.gov (United States)

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  5. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  6. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  7. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  8. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  9. Supplementary table 6. Primers used in real-time PCR for relative ...

    Indian Academy of Sciences (India)

    pushpa

    Supplementary table 6. Primers used in real-time PCR for relative expression analysis of osa-miR399i and osa-miR530 and their predicted target genes. Gene Locus. Primer sequence. TTGTTGGACATGCTCGTGACA. LOC_Os05g48390. TGGTGACAAGCTTCGGCAA. CGTGTGGAGGATTGTATGCATG. LOC_Os01g54480.

  10. Comparing the Accuracy Rate of Two Different Universal Primers in Enteric Pathogen Diagnosis From Blood

    Directory of Open Access Journals (Sweden)

    Esmaeil Soleimani

    2014-02-01

    Full Text Available Background: Detecting enteric bacteria in blood by culture is a slow assay with low accuracy rate. PCR might be a suitable alternative assay but as several species can cause bacteremia, it is necessary to use universal primers. Objectives: In this study we evaluated and compared two pairs of universal primers in detecting four enteric bacteria in blood, which are common causes of bacteremia in human. Materials and Methods: Standard strains of E. faecalis, S. typhi, E. coli, and S. Aeruginosa, were used in this study. A serially diluted bacterial suspension of all strains was made for inoculation to four sets of defibrinated sheep blood which were used to prepare blood specimens with different bacterial contents for performing routine assay and PCR. PCR was performed using two different universal primers designed from two ribosomal genes, 16sr RNA and 23sr RNA. Results: PCR with 16sr RNA universal primer showed more accuracy rate than both blood culture and PCR with 23sr RNA universal primer. Mean time for performing PCR assay and blood culture was eight and 48 hours, respectively. Conclusions: Both PCR with 16sr RNA and 23sr RNA universal primers have more accuracy rate than blood culture and are faster in detection of bacteremia. PCR with 16sr RNA universal primer is more accurate than both PCR with 16sr RNA universal primer and blood culture for diagnosis of bacteremia.

  11. New primers for methylation-specific polymerase chain reaction enhance specificity of detecting STAT1 methylation

    Directory of Open Access Journals (Sweden)

    Ming-Cheng Chang

    2012-03-01

    Conclusion: Specific primers for methylation-specific PCR are mandatory for the accurate detection of STAT1 gene methylation. Besides, specific primers can generate correct interpretation of STAT1 gene methylation, and its correlation with the clinicopathological characteristics and outcome of cancer patients.

  12. Effects of metal primers on bonding of adhesive resin cement to noble alloys for porcelain fusing.

    Science.gov (United States)

    Okuya, Nobuhiro; Minami, Hiroyuki; Kurashige, Hisanori; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo

    2010-03-01

    This study evaluated the effects of metal primers on the bonding of adhesive resin to four pure metals (Au, Pd, Ag, Cu) and two noble alloys for porcelain fusing (high-gold and high-palladium content alloys). Bonding surface was polished with 600-grit silicon carbide paper and primed with one of the three metal primers (V-Primer, Metaltite, and M.L. Primer). Bonded specimens were fabricated by applying adhesive resin (Super-Bond C&B) on the primed surface. Shear bond strength (SBS) was determined both before and after thermocycling (4-60 degrees C for 2,000 cycles). The highest SBS values to each pure metal after thermocycling were 33.5 MPa for Au by M.L. Primer, 35.0 MPa for Ag by V-Primer, and 34.4 MPa for Cu by Metaltite. SBS to high-gold content alloy after thermocycling was 33.3 MPa by M.L. Primer. None of the primers was effective for pure Pd and high-palladium content alloy after thermocycling.

  13. Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage

    Directory of Open Access Journals (Sweden)

    Jin Su Choi

    2014-03-01

    Full Text Available Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

  14. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...... RNA, no direct evidence of interactions with the U-rich anticodon loop of tRNALys3 has been described to date. Here we address the question of the potential role of the interactions between these highly structured regions in the initiation of viral DNA synthesis. To evaluate this we used an antisense...... approach, first validated in our in vitro HIV-1 reverse transcription system. Annealing of the antisense oligonucleotides to the pre-primer binding site (the upstream region contiguous to the HIV-2 primer binding site) was determined in the presence of native tRNALys3 or synthetic primers. Using natural...

  15. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... in microRNA quantification. CONCLUSIONS: MiR-specific quantitative RT-PCR with DNA primers is a highly specific, sensitive and accurate method for microRNA quantification...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...

  16. Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.

    Science.gov (United States)

    Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo

    2016-07-01

    To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.

  17. Bajo Promedio Y Permanencia En Estudiantes Universitarios De Primer Semestre. Estudio Del Observatorio, Programa De Acompañamiento Académico Integral. Universidad Santo Tomas - Bucaramanga (Colombia)

    OpenAIRE

    Garcia Serrano, Saúl Ernesto; Torres Valderrama, María; Ariza Guarin, Catherine

    2016-01-01

    El artículo refleja el resultado de una investigación institucional de seguimiento al desempeño de 290 estudiantes universitarios de diversos programas académicos que al ingresar a primer semestre obtuvieron bajo promedio en su registro académico.Se buscó indagar los determinantes asociados al bajo promedio y permanencia analizando las entrevistas de ingreso estructuradas en escala ordinal y los factores que contribuyeron a la mejora de su condición académica.Utilizando una metodología mixta,...

  18. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  19. Las preguntas de los alumnos, análisis de su aportación al aprendizaje de las ciencias

    OpenAIRE

    Roca Tort, M.

    2009-01-01

    La importancia de las preguntas, en la construcción de las ideas científicas y en el proceso comunicativo que favorece su construcción, ha planteado la necesidad de buscar las características que permiten distinguir las preguntas que favorecen este proceso. Se parte de los resultados encontrados al analizar las preguntas planteadas por los alumnos de primer ciclo de ESO al realizar la unidad didáctica sobre el ciclo del agua. En primer lugar se analizó el contenido y la demanda de cada una de...

  20. A Transparent Window into Biology: A Primer on Caenorhabditis elegans

    Science.gov (United States)

    Corsi, Ann K.; Wightman, Bruce; Chalfie, Martin

    2015-01-01

    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host–parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26088431

  1. Elektronsko izobraževanje v praksi. Primer programa LOLA

    Directory of Open Access Journals (Sweden)

    Lea Bregar

    2003-12-01

    Full Text Available Slovenija je bila vkljucena v program Phare za studij na da!javo v obdobju od I995 do konca I999 kot ena izmed 11 srednje- in vzhodnoevropskih drzav. Eden od najpomembnejsih cil jev programa Phare je bit razviti človeške vire na podrocju studija na dal javo in odprtega ucenja. v okviru podprojekta Phare Train the Trainers so na Harriot Watt University iz Velike Britanije razvili izobrazevalni program LOLA (ucenje o odprtem ucenju. Leta I999 je bilo organizirano usposab!janje za 400 udeležencev iz 11 drzav Phare. Program LOLAje bit uspdna novost v evropskem izobrazevalnem prostoru ne le zaradi svojih vsebin, temvee tudi zaradi inovativne didaktike, sa} je bit celoten program oblikovan in izvajan kot 'on-line' program. V Clanku je na kratko predstavljen izobrazevalni program LOLA in izkusnje z njegovim izvajanjem kot primer e-izobrazevanja v praksi. Clanek avtorici zakljucujeta s predstavitvijo svojih pogledov na nadaljnje izvajanje programa LOLA in razvoj e-izobrazevanja v Sloveniji ter poudarjata potrebo po kakovostno doloceni in jasni strategiji na podrocju studija na daljavo, odprtega ucenja in e-izobrazevanja v Sloveniji.

  2. Review of Attachment, play, and authenticity: A Winnicott primer.

    Science.gov (United States)

    Penn, Linda S

    2009-12-01

    Reviews the book, Attachment, play, and authenticity: A Winnicott primer by Steven Tuber (see record 2008-04633-000). In this book, Tuber does not attempt to offer a comprehensive review of Winnicott's work. Rather, he focuses on what he sees as Winnicott's most central concepts, offering close examination of a few articles that he feels best represent each of these concepts, and frames each with the noting of a central dilemma or paradox. Tuber describes the book as an attempt to teach through "playing" with Winnicott (play being central to Winnicott's ideas) and engaging the reader to join in the play. The book is based on a series of lectures from a course on Winnicott he has given to his clinical psychology doctoral students at the City University of New York. The reviewer noted that the author omitted some information that she considered to be important. However, she concludes that this book is a compelling read that captures what she sees as the essence of Winnicott's work, and as Winnicott would have loved, presents it without jargon or pretense in the simple terms that best elucidate Winnicott's view of the human experience. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  3. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  4. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  5. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  6. An ASIC Low Power Primer Analysis, Techniques and Specification

    CERN Document Server

    Chadha, Rakesh

    2013-01-01

    This book provides an invaluable primer on the techniques utilized in the design of low power digital semiconductor devices.  Readers will benefit from the hands-on approach which starts form the ground-up, explaining with basic examples what power is, how it is measured and how it impacts on the design process of application-specific integrated circuits (ASICs).  The authors use both the Unified Power Format (UPF) and Common Power Format (CPF) to describe in detail the power intent for an ASIC and then guide readers through a variety of architectural and implementation techniques that will help meet the power intent.  From analyzing system power consumption, to techniques that can employed in a low power design, to a detailed description of two alternate standards for capturing the power directives at various phases of the design, this book is filled with information that will give ASIC designers a competitive edge in low-power design. Starts from the ground-up and explains what power is, how it is measur...

  7. All About ALS

    Science.gov (United States)

    ... Subscribe August 2015 Print this issue All About ALS Understanding a Devastating Disorder En español Send us ... Sports Concussions Wise Choices How Can I Help ALS Research? If you have ALS, join the National ...

  8. Selective control of primer usage in multiplex one-step reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Paul Natasha

    2009-12-01

    Full Text Available Abstract Background Multiplex RT-PCR is a valuable technique used for pathogen identification, disease detection and relative quantification of gene expression. The simplification of this protocol into a one-step procedure saves time and reagents. However, intensive PCR optimization is often required to overcome competing undesired PCR primer extension during the RT step. Results Herein, we report multiplex one-step RT-PCR experiments in which the PCR primers contain thermolabile phosphotriester modification groups. The presence of these groups minimizes PCR primer extension during the RT step and allows for control of PCR primer extension until the more stringent, elevated temperatures of PCR are reached. Results reveal that the use of primers whose extension can be controlled in a temperature-mediated way provides improved one-step RT-PCR specificity in both singleplex and multiplex reaction formats. Conclusions The need for an accurate and sensitive technique to quantify mRNA expression levels makes the described modified primer technology a promising tool for use in multiplex one-step RT-PCR. A more accurate representation of the abundances in initial template sample is feasible with modified primers, as artifacts of biased PCR are reduced because of greater improvements in reaction specificity.

  9. UNIVERSAL PRIMERS FOR THE AMPLIFICATION AND SEQUENCE ANALYSIS OF ACTIN-1 FROM DIVERSE MOSQUITO SPECIES

    Science.gov (United States)

    STALEY, MOLLY; DORMAN, KARIN S.; BARTHOLOMAY, LYRIC C.; FERNÁNDEZ-SALAS, ILDEFONSO; FARFAN-ALE, JOSE A.; LOROÑO-PINO, MARIA A.; GARCIA-REJON, JULIAN E.; IBARRA-JUAREZ, LUIS

    2010-01-01

    We report the development of universal primers for the reverse-transcription polymerase chain reaction (RT-PCR) amplification and nucleotide sequence analysis of actin cDNAs from taxonomically diverse mosquito species. Primers specific to conserved regions of the invertebrate actin-1 gene were designed after actin cDNA sequences of Anopheles gambiae, Bombyx mori, Drosophila melanogaster, and Caenorhabditis elegans. The efficacy of these primers was determined by RT-PCR with the use of total RNA from mosquitoes belonging to 30 species and 8 genera (Aedes, Anopheles, Culex, Deinocerites, Mansonia, Psorophora, Toxorhynchites, and Wyeomyia). The RT-PCR products were sequenced, and sequence data were used to design additional primers. One primer pair, denoted as Act-2F (5′-ATGGTCGGYATGGGNCAGAAGGACTC-3′) and Act-8R (5′-GATTCCATACCCAGGAAG-GADGG-3′), successfully amplified an RT-PCR product of the expected size (683-nt) in all mosquito spp. tested. We propose that this primer pair can be used as an internal control to test the quality of RNA from mosquitoes collected in vector surveillance studies. These primers can also be used in molecular experiments in which the detection, amplification or silencing of a ubiquitously expressed mosquito housekeeping gene is necessary. Sequence and phylogenetic data are also presented in this report. PMID:20649132

  10. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.

    Science.gov (United States)

    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar

    2013-06-01

    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  11. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  12. RNA Primer Extension Hinders DNA Synthesis byEscherichia coliMutagenic DNA Polymerase IV.

    Science.gov (United States)

    Tashjian, Tommy F; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M; Godoy, Veronica G

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB's fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  13. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    Science.gov (United States)

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability. PMID:28298904

  14. Primique: automatic design of specific PCR primers for each sequence in a family

    Directory of Open Access Journals (Sweden)

    Lange Mette

    2007-10-01

    Full Text Available Abstract Background In many contexts, researchers need specific primers for all sequences in a family such that each primer set amplifies only its target sequence and none of the others, e.g. to detect which transcription factor out of a family of very similar proteins that is present in a sample, or to design diagnostic assays for the identification of pathogen strains. Results This paper presents primique, a new graphical, user-friendly, fast, web-based tool which solves the problem: It designs specific primers for each sequence in an uploaded set. Further, a secondary set of sequences not to be amplified by any primer pair may be uploaded. Primers with high sequence similarity to non-target sequences are selected against. Lastly, the suggested primers may be checked against the National Center for Biotechnology Information databases for possible mis-priming. Conclusion Results are presented in interactive tables, and various primer properties are listed and displayed graphically. Any close match alignments can be displayed. Given 30 sequences, the running time of primique is about 20 seconds. primique can be reached via this web address: http://cgi-www.daimi.au.dk/cgi-chili/primique/front.py

  15. Effects of primers containing thiouracil and phosphate monomers on bonding of resin to Ag-Pd-Au alloy.

    Science.gov (United States)

    Taira, Yohsuke; Kamada, Kohji; Atsuta, Mitsuru

    2008-01-01

    The purpose of the present study was to evaluate the effects of four experimental primers on bond strength between a self-curing luting agent and silver-palladium-gold alloy. The experimental primers were in mixed solutions of a thiouracil primer (Metaltite) and a phosphate primer (Epricord, PM, PE, or PP), which were designated as Metaltite/Epricord, Metaltite/PM, Metaltite/PE, and Metaltite/PP respectively. Three primers (Metal Primer II, V-Primer, and Alloy Primer) were also prepared as controls. Alumina-blasted metal alloys were bonded with acrylic rods. After 5,000 thermocycles, the maximum shear bond strength was obtained with Metaltite/PE (27.8+/-2.4 MPa) and Metaltite/Epricord (27.6+/-5.9 MPa), followed by Metaltite/PP, Alloy Primer, Metaltite, Metaltite/PM, Metal Primer II, V-Primer, and Epricord. PE, PM, and PP showed the lowest bond strength. Results of this study revealed that the combined use of a thiouracil monomer and a phosphate monomer improved adhesive bonding. In this light, clinicians should pay attention to the types of functional monomers dissolved in a primer when fabricating resin-bonded prostheses.

  16. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  17. Mating and memory: an educational primer for use with "epigenetic control of learning and memory in Drosophila by Tip60 HAT action".

    Science.gov (United States)

    Schmidt, Rebecca L; Sheeley, Sara L

    2015-05-01

    An article by Xu et al. in the December 2014 issue of GENETICS can be used to illustrate epigenetic modification of gene expression, reverse genetic manipulation, genetic/epigenetic influence on behavioral studies, and studies using the Drosophila model organism applied to human disease. This Primer provides background information; technical explanations of genetic, biochemical, and behavioral approaches from the study; and an example of an approach for classroom use with discussion questions to aid in student comprehension of the research article. Copyright © 2015 by the Genetics Society of America.

  18. Tambores de guerra y lágrimas de emoción. Nación y masculinidad en el primer republicanismo

    OpenAIRE

    Andreu Miralles, Xavier

    2016-01-01

    El artículo analiza los modelos de masculinidad propuestos por el republicanismo posrevolucionaria en la España isabelina. Aunque esta masculinidad coincide en numerosos aspectos con la de las diversas culturas políticas de la gran familia liberal, posee una serie de rasgos distintivos. En primer lugar, su fidelidad al ideal revolucionario del hombre patriótico: un hombre político y muy varonil, que toma las armas para regenerar (revirilizar) una nación corrompida. Por otro lado, este ideal n...

  19. Ambiente de Aprendizaje para Aritmética mediante la Computadora en el Primer Grado de Educación Secundaria

    OpenAIRE

    Franco Almazán, Rodolfo

    2004-01-01

    A través de esta investigación se busca una propuesta de solución al porcentaje de aprovechamiento de la Aritmética en el primer grado de educación secundaria mediante la aplicación de un ambiente de aprendizaje con tecnología basado en el uso de la computadora, empleando para ello el software supermáticas, utilizándose para su aplicación una prueba pretestpostest con un grupo experimental y un grupo control, bajo la metodología cuantitativa en el enfoque del cusiexperimento, dadas las caract...

  20. Evaluation of several RT-PCR primer pairs for the detection of Apple stem pitting virus.

    Science.gov (United States)

    Komorowska, B; Malinowski, T; Michalczuk, L

    2010-09-01

    Detection of Apple stem pitting virus (ASPV) using RT-PCR based methods was studied in infected apple and pear trees. Three virus-specific primers (ASPF1CP, ASPF2CP, ASPR3CP) were designed to target the most conservative regions of the coat protein gene of 10 virus isolates in Poland and 7 other ASPV sequences available in GenBank. The suitability of the primer pairs ASPF1CP-ASPR3CP and ASPF2CP-ASPR3CP for detection of 19 virus isolates was checked. Both new primer pairs initiated amplification of a specific product from all sources tested. From 1 to 11 isolates were not detected with the primer sets published previously. Detection of the virus in the samples collected in March, using ASPF1CP-ASPR3CP primer pair, was possible up to 512 times dilution. For the samples collected in July, virus was detected in the extracts from infected plants diluted eight times. More than 100-fold increase of sensitivity could be obtained by semi-nested PCR with primers ASPF2CP-ASPR3CP following the first round with ASPF1CP-ASPR3CP. Identification of virus isolates with different number of deletions in the coat protein gene was possible using RT-PCR with newly designed reverse primer ASPDEL in combination with the published primer ASPV7956. Besides, the comparative analysis of silicacapture-RT-PCR (SC-RT-PCR) versus immunocapture-RT-PCR (IC-RT-PCR) assays was carried out. Few ASPV isolates escaped detection by IC-RT-PCR, while all isolates tested were detected using the SC-RT-PCR with the new primers. Copyright 2010 Elsevier B.V. All rights reserved.

  1. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  2. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  3. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  4. Proyecto de edificación de una fábrica de helados para personas alérgicas al huevo, la leche, intolerantes a la lactosa y veganos en el polígono San Cristóbal (Valladolid)

    OpenAIRE

    Gómez Nieto, Elsa

    2016-01-01

    El proyecto incluye el diseño, implementación, cálculo y estudio de: -el proceso productivo de la fábrica de helados -la producción y los factores que intervienen en ella - las instalaciones necesarias - la estructura y los elementos estructurales - la parte de economía y el estudio de los apartados de obligado cumplimiento del CTE. Grado en Ingeniería de las Industrias Agrarias y Alimentarias

  5. Infección inducida en el roedor selvático Dasyprocta leporina (Rodentia: Dasyproctidae, con huevos larvados de Lagochilascaris minor (Nematoda: Ascarididae Induced infection in the wild rodent Dasyprocta leporina (Rodentia: Dasyproctidae with larval eggs of Lagochilascaris minor (Nematoda: Ascarididae

    Directory of Open Access Journals (Sweden)

    S. Gregorio

    1990-12-01

    Full Text Available Ejemplares de Dasyprocta leporina Linnaeus, 1758 fueron criados alejados de su ambiente natural. A los 3 ó 4 meses de edad, se los inoculó por vía oral con huevos de Lagochilascaris minor Leiper, 1909 obtenidos de una paciente nativa. Los huevos se los incubó por más de 80 dias, para que de ellos fuese posible obtener por compresión mecánica, larvas que se mantuviesen vivas en medio acuoso por 48 horas o más. Sacrificados los animales a los 14 ó 46 dias posteriores a la infección, se hallaron en los músculos esqueléticos larvas ovilladas dentro de nódulos inflamatorios, los cuales no presentaban reacción a cuerpo extraño, abscedación o calcificación. El desarollo de los nódulos no parecía afectar la normalidad de los hospedadores. Las larvas obtenidas eran similares a las descritas por SPRENT como de tercer estadio para estos helmintos. Ratones blancos infectados con material similar, no presentaron nódulos en sus músculos ni se pudo recuperar de sus tejidos larva alguna. Por los hallazgos obtenidos con la infección de estos animales, se postula que el helminto no posee ciclo pulmonar y que su desarrollo requiere de un hospedador intermediario.Specimens of Dasyprocta leporina (Linnaeus, 1758 were raised out their natural environment. At three to four months of age they were orally inoculated with Lagochilascaris minor (Leiper, 1909 eggs obtained from a native patient. The eggs were incubated for more than 80 days so that it was possible to obtain, by mechanical compression, larvae that could be maintained alive in liquid medium for 48 hours or more. The animals were sacrificed 14-46 days after infection and tangled larva in inflammatory nodules were found in skeletal muscle without foreign body reaction, abscess formation or calcification. The development of the nodules did not seem to affect the hosts. The larvae obtained were similar to those described by SPRENT as the third stage of these helminths. When white mice were

  6. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    Science.gov (United States)

    Blackman, Eric G.

    2015-05-01

    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  7. A primer on trace metal-sediment chemistry

    Science.gov (United States)

    Horowitz, Arthur J.

    1985-01-01

    In most aquatic systems, concentrations of trace metals in suspended sediment and the top few centimeters of bottom sediment are far greater than concentrations of trace metals dissolved in the water column. Consequently, the distribution, transport, and availability of these constituents can not be intelligently evaluated, nor can their environmental impact be determined or predicted solely through the sampling and analysis of dissolved phases. This Primer is designed to acquaint the reader with the basic principles that govern the concentration and distribution of trace metals associated with bottom and suspended sediments. The sampling and analysis of suspended and bottom sediments are very important for monitoring studies, not only because trace metal concentrations associated with them are orders of magnitude higher than in the dissolved phase, but also because of several other factors. Riverine transport of trace metals is dominated by sediment. In addition, bottom sediments serve as a source for suspended sediment and can provide a historical record of chemical conditions. This record will help establish area baseline metal levels against which existing conditions can be compared. Many physical and chemical factors affect a sediment's capacity to collect and concentrate trace metals. The physical factors include grain size, surface area, surface charge, cation exchange capacity, composition, and so forth. Increases in metal concentrations are strongly correlated with decreasing grain size and increasing surface area, surface charge, cation exchange capacity, and increasing concentrations of iron and manganese oxides, organic matter, and clay minerals. Chemical factors are equally important, especially for differentiating between samples having similar bulk chemistries and for inferring or predicting environmental availability. Chemical factors entail phase associations (with such sedimentary components as interstitial water, sulfides, carbonates, and organic

  8. Oligonucleotide primers for specific detection of actinobacterial laccases from superfamilies I and K.

    Science.gov (United States)

    Fernandes, Tatiana Alves Rigamonte; da Silveira, Wendel Batista; Passos, Flávia Maria Lopes; Zucchi, Tiago Domingues

    2014-08-01

    Although many putative laccase-like genes have been assigned to members of the phylum Actinobacteria, few of the related enzymes have been characterized so far. It is noteworthy, however, that this small number of enzymes has presented properties with industrial relevance. This observation, combined with the recognized biotechnological potential and the capability of this phylum to degrade recalcitrant soil polymers, has attracted attention for bioprospective approaches. In the present work, we have designed and tested primers that were specific for detection of sub-groups of laccase-like genes within actinomycetes, which corresponded to the superfamilies I and K from the classification presented by the laccase and multicopper oxidase engineering database. The designed primers have amplified laccase-like gene fragments from actinomycete isolates that were undetectable by primers available from the literature. Furthermore, phylogenetic alignments suggest that some of these fragments may belong to new laccases-like proteins, and thus emphasize the benefits of designing subgroup-specific primers.

  9. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  10. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  11. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  12. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    Directory of Open Access Journals (Sweden)

    Fernando Bastida-González

    2016-01-01

    Full Text Available Nucleoprotein (N gene from rabies virus (RABV is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs via indirect fluorescent antibody (IFA test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers, for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  13. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  14. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  15. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  16. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  17. Self-Etch Environmentally Acceptable Primer Testing (SEEAPT) Deliver Order 0001

    National Research Council Canada - National Science Library

    Joseph, Christopher

    2001-01-01

    .... The focus of the testing was on primer properties. Filiform corrosion, salt fog exposure, pencil hardness, crosshatch adhesion, impact testing, and wet tape adhesion testing were conducted on the 12 candidate systems, along with 4 control systems...

  18. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  19. Ceramic bond durability and degradation mechanism of commercial gamma-methacryloxypropyl trimethoxysilane-based ceramic primers.

    Science.gov (United States)

    Aida, Masahiro; Tabei, Naoko; Kimoto, Suguru; Tanimura, Hideki; Takahashi, Haruyoshi; Yaguchi, Takehiro; Nishiyama, Norihiro

    2012-08-01

    To investigate the bond durability and degradation mechanism of various commercial ceramic primers that are based on gamma-methacryloxypropyl trimethoxysilane (gamma-MPTS) and contain various organic additives. The null hypotheses tested were that (1) the type of ceramic primer had no effect on the bond strength after thermocycling and (2) the type of ceramic primer had no effect on the water contact angle after rinsing with THF. The adherent was a silica-based ceramic block used for computer-aided design/computer-aided manufacturing (CAD-CAM). Four commercial ceramic primers, Clearfil Mega Bond Porcelain Bonding kit (CM), Tokuso ceramic primer (TC), GC ceramic primer (CP), and Porcelain Liner M (PL), were compared with a simplified experimental ceramic primer (EP) that comprised gamma-MPTS and an inorganic acid (hydrochloric acid) but no other organic additives. The specimens for the adhesion test were prepared after a dual-curing type resin cement (Link Max) had adhered to the ceramic surfaces treated with each ceramic primer. The bonded specimens were then stored in water at 37 degrees C for 1 day. Then, the bonded specimens were thermocycled between 5 degrees C and 55 degrees C in water baths for 5000 or 10,000 cycles. The dwell time in each water bath and the transfer time were 60 and 7 seconds, respectively. The shear bond strength of resin to the ceramic surface was measured under a crosshead speed of 1.0 mm/minute by a conventional testing machine. Thereafter, the fracture mode for each specimen was determined. In addition, the water contact angle on the treated ceramic surfaces was measured before and after THF using a cotton pellet. As a control, the contact angle on the ground ceramic surface was measured without any ceramic primer. For all samples, thermocycling led to an increase in the frequency of interfacial failure, reflecting reduced mean bond strength of the resin to the treated ceramic surfaces. However, the bond degradation behavior differed

  20. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether tRNA...... primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...... by cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  1. Primer Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition

    Science.gov (United States)

    2015-09-01

    Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition by John J Ritter and Richard A Beyer Weapons and Materials Research...primer alone launches the bullet with a shower of hot particles and gases. Similar attempts with a rifled barrel resulted in just enough force being...performance with novel measurement techniques. Journal of Energetic Materials and Chemical Propulsion. 2013;12(4):361–370. 4. Cup, primer (No. 34

  2. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Characterization of RNA primers synthesized by the human breast cancer cell DNA synthesome.

    Science.gov (United States)

    Dai, Heqiao; Liu, Jianying; Malkas, Linda H; Hickey, Robert J

    2009-04-01

    We previously reported on the purification and characterization of a functional multi-protein DNA replication complex (the DNA synthesome) from human cells and tissues. The synthesome is fully competent to carry-out all phases of the DNA replication process in vitro. In this study, DNA primase, a component of the synthesome, is examined to determine its activity and processivity in the in vitro synthesis and extension of RNA primers. Our results show that primase activity in the P4 fraction of the synthesome is 30-fold higher than that of crude cell extracts. The synthesome synthesizes RNA primers that are 7-10 ribonucleotides long and DNA primers that are 20-40 deoxyribonucleotides long using a poly(dT) template of exogenous single-stranded DNA. The synthesome-catalyzed RNA primers can be elongated by E. coli DNA polymerase I to form the complementary DNA strands on the poly(dT) template. In addition, the synthesome also supports the synthesis of native RNA primers in vitro using an endogenous supercoiled double-stranded DNA template. Gel analysis demonstrates that native RNA primers are oligoribonucleotides of 10-20 nt in length and the primers are covalently link to DNA to form RNA-primed nascent DNA of 100-200 nt. Our study reveals that the synthesome model is capable of priming and continuing DNA replication. The ability of the synthesome to synthesize and extend RNA primers in vitro elucidates the organizational and functional properties of the synthesome as a potentially useful replication apparatus to study the function of primase and the interaction of primase with other replication proteins.

  4. Detection of Mycobacterium ulcerans by real-time PCR with improved primers.

    Science.gov (United States)

    Shinoda, Noriko; Nakamura, Hajime; Watanabe, Mineo

    2016-01-01

    Buruli ulcer is a severe skin disease caused by Mycobacterium ulcerans. Real-time PCR targeting the IS2404 sequence has been used as a reliable and rapid method for the diagnosis of Buruli ulcer and detection of M. ulcerans in the environment. The genome of M. ulcerans contains hundreds of IS2404 copies, which have variability in certain sequences. Therefore, the design of new primers specific to conserved IS2404 regions may potentially improve the sensitivity of M. ulcerans detection and, consequently, the diagnosis of Buruli ulcer, thus ensuring timely treatment of the disease. In silico analysis indicates that DNA sequences of the IS2404 elements are highly variable within a single strain. As the binding sites of conventional IS2404-specific primers used for M. ulcerans detection contain polymorphic sequences, we designed new primers, which enabled the detection of M. ulcerans by real-time PCR with higher sensitivity and similar specificity with respect to that of conventional primers. However, the increase in sensitivity with the new primers depended on the M. ulcerans strain. The results suggest that real-time PCR based on the new primers could improve Buruli ulcer diagnosis and M. ulcerans detection in environmental samples.

  5. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  6. PCR primers that amplify fungal rRNA genes from environmental samples.

    Science.gov (United States)

    Borneman, J; Hartin, R J

    2000-10-01

    Two PCR primer pairs were designed to amplify rRNA genes (rDNA) from all four major phyla of fungi: Ascomycota, Basidiomycota, Chytridomycota, and Zygomycota. PCRs performed with these primers showed that both pairs amplify DNA from organisms representing the major taxonomic groups of fungi but not from nonfungal sources. To test the ability of the primers to amplify fungal rDNA from environment samples, clone libraries from two avocado grove soils were constructed and analyzed. These soils possess different abilities to inhibit avocado root rot caused by Phythophthora cinnamomi. Analysis of the two rDNA clone libraries revealed differences in the two fungal communities. It also revealed a markedly different depiction of the soil fungal community than that generated by a culture-based analysis, confirming the value of rDNA-based approaches for identifying organisms that may not readily grow on agar media. Additional evidence of the usefulness of the primers was obtained by identifying fungi associated with avocado leaves. In both the soil and leaf analyses, no nonfungal rDNA sequences were identified, illustrating the selectivity of these PCR primers. This work demonstrates the ability of two newly developed PCR primer sets to amplify fungal rDNA from soil and plant tissue, thereby providing unique tools to examine this vast and mostly undescribed community of organisms.

  7. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  8. GSP: a web-based platform for designing genome-specific primers in polyploids.

    Science.gov (United States)

    Wang, Yi; Tiwari, Vijay K; Rawat, Nidhi; Gill, Bikram S; Huo, Naxin; You, Frank M; Coleman-Derr, Devin; Gu, Yong Q

    2016-08-01

    The sequences among subgenomes in a polyploid species have high similarity, making it difficult to design genome-specific primers for sequence analysis. We present GSP, a web-based platform to design genome-specific primers that distinguish subgenome sequences in a polyploid genome. GSP uses BLAST to extract homeologous sequences of the subgenomes in existing databases, performs a multiple sequence alignment, and design primers based on sequence variants in the alignment. An interactive primers diagram, a sequence alignment viewer and a virtual electrophoresis are displayed as parts of the primer design result. GSP also designs specific primers from multiple sequences uploaded by users. GSP is a user-friendly and efficient web platform freely accessible at http://probes.pw.usda.gov/GSP Source code and command-line application are available at https://github.com/bioinfogenome/GSP CONTACTS: yong.gu@ars.usda.gov or devin.coleman-derr@ars.usda.gov Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  10. Family-Specific Degenerate Primer Design: A Tool to Design Consensus Degenerated Oligonucleotides

    Science.gov (United States)

    Goñi, Sandra Elizabeth; Lozano, Mario Enrique

    2013-01-01

    Designing degenerate PCR primers for templates of unknown nucleotide sequence may be a very difficult task. In this paper, we present a new method to design degenerate primers, implemented in family-specific degenerate primer design (FAS-DPD) computer software, for which the starting point is a multiple alignment of related amino acids or nucleotide sequences. To assess their efficiency, four different genome collections were used, covering a wide range of genomic lengths: Arenavirus (10 × 104 nucleotides), Baculovirus (0.9 × 105 to 1.8 × 105 bp), Lactobacillus sp. (1 × 106 to 2 × 106 bp), and Pseudomonas sp. (4 × 106 to 7 × 106 bp). In each case, FAS-DPD designed primers were tested computationally to measure specificity. Designed primers for Arenavirus and Baculovirus were tested experimentally. The method presented here is useful for designing degenerate primers on collections of related protein sequences, allowing detection of new family members. PMID:23533783

  11. Association of different primers and resin cements for adhesive bonding to zirconia ceramics.

    Science.gov (United States)

    Maeda, Fernando Akio; Bello-Silva, Marina Stella; de Paula Eduardo, Carlos; Miranda Junior, Walter Gomes; Cesar, Paulo Francisco

    2014-06-01

    To evaluate the shear bond strength (SBS) to zirconia ceramics using different associations of primers and resin cements. Two blocks of LAVA zirconia (3Y-TZP) were randomly submitted to an application of three different commercially available primers: Alloy Primer (AP), Z-Prime Plus (ZP), and Signum Zirconia Bond (SZB). Nonprimed specimens were considered controls. After treatment, the 80 specimens (5 mm × 5 mm × 2 mm) were randomly cemented with one of the resin cements: Panavia F, Multilink, seT, and NX3. For cementation, cylinders of resin cement were built on the ceramic surfaces using the SDI SBS apparatus. The specimens were submitted to the SBS test. Fractured surfaces were observed under stereomicroscopy to determine the failure mode, and mean bond strength values were analyzed using the Kruskal-Wallis and Mann-Whitney tests (α = 0.05). Signum Zirconia Bond had the highest SBS compared to all other primers and the control group, regardless of the resin cement used. The highest values were obtained when associating Panavia F with Signum Zirconia Bond. Alloy Primer increased bonding values when associated with seT cement only. When no primer was used, no statistical difference was observed among resin cements. All specimens fractured due to adhesive failure. Signum Zirconia Bond is capable of increasing bonding values of resin cements to zirconia ceramics. Its association with Panavia F shows enhanced results when considering short-term adhesion to zirconia.

  12. Effects of primer containing silane and thiophosphate monomers on bonding resin to a leucite-reinforced ceramic.

    Science.gov (United States)

    Taira, Yohsuke; Sakai, Miyuki; Sawase, Takashi

    2012-05-01

    Silane primers are commonly used for bonding between resin-based luting agents and ceramic restorations. The purpose of the present study was to evaluate the effects of nine silane primers on the bond strength of resin to a leucite-reinforced ceramic. The commercially available dental primers used were five silane primers (GC Ceramic Primer, GP; Clearfil Ceramic Primer, CP; Tokuso Ceramic Primer, TP; Porcelain Liner M, PM; and Monobond Plus, MB). Four experimental primers (MDS, MTS, MDS/MPII, and MTS/MPII) and two control primers (MMA and MMA/MPII) were also prepared. The ceramic specimen was ground with silicon carbide paper, primed, and then bonded to a resin composite disc using a dual-curing luting agent. After a 24-h immersion in water, the shear bond strengths were determined. Shear bond testing revealed that the bond strength was significantly improved with the use of a MTS/MPII primer when compared to MDS, MTS, MMA, MDS/MPII and MMA/MPII. Although no significant differences were detected between GP, CP, PM, and MB, the primers CP, TP, PM, and MTS/MPII exhibited the highest bond strengths, followed by GP and MB, whilst the no-primer control resulted in the lowest values. The maximum bond strengths were obtained with CP, TP, PM, and MTS/MPII. It was suggested that the thiophosphate monomer accelerated the role of the silane monomer. When selecting a primer to bond ceramic restorations, clinicians should be aware that not only the silane monomer but also additional components of the primer considerably affect the bond strength. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. Primer registro de la familia Morchellaceae (Ascomycota: Pezizales para Colombia

    Directory of Open Access Journals (Sweden)

    César Augusto Pinzón Osorio

    2017-04-01

    Full Text Available Se registra por primera vez al género Morchella Dill. ex Pers. (Ascomycota, Pezizales, único representante de la familia Morchellaceae para la micobiota Colombiana. El ascocarpo fue recolectado en un bosque muy húmedo premontano, en la vereda Santa Helena, municipio de Gachalá, departamento de Cundinamarca. El espécimen es descrito e ilustrado con fotografías y se aporta información sobre su distribución, ecología y sustrato de crecimiento. La identidad taxonómica del ejemplar es discutida de acuerdo al concepto morfológico tradicional establecido en la literatura micológica. Con este reporte, en Colombia el orden Pezizales queda constituido por 17 especies contenidas en 12 géneros y 7 familias.

  14. El caso Glivec®: primer ejemplo de debate global en torno al sistema de patentes de medicamentos

    Directory of Open Access Journals (Sweden)

    Inês Moital

    2014-11-01

    Conclusión: El caso Glivec® ha planteado el debate sobre la adecuación de las normas internacionales, su aplicabilidad en el entorno económico y su adaptación en cada país. Este caso, y otros, deberían contribuir a la reflexión sobre el sistema internacional de patentes a fin de preservar la salud de la población más necesitada de una atención sanitaria adecuada en equilibrio con la protección de la propiedad intelectual y la innovación.

  15. Table 1 Oligonucleotide primers used for SNP verification by Sanger ...

    Indian Academy of Sciences (India)

    charissa

    1 Ao W, Aldous S, Woodruf E, Hicke B, Rea L, Kreiswirth B, Jenison R. Rapid detection of rpoB gene mutations conferring rifampin resistance in Mycobacterium tuberculosis. J Clin Microbiol. 2012; 50: 2433-2440. 2 Bakuła Z, Napiórkowska A, Bielecki J et al. Mutations in the embB gene and their association with ethambutol ...

  16. Development of Non-Chromate Waterborne Wash Primer.

    Science.gov (United States)

    1983-02-01

    formulations to give a reasonably good sprayed-up coating was: (1) Ethylene glycol monobutyl etheris (2) Diethylene glycol monoethyl ether -47- 77i...before spraying. (1) Texaco Chemicals Ethylene Glycol Monoethyl Ether -21- a.l Henkel Gen Epoxy 370-H55 The first epoxy that we tried was Henkel Gen...Chemicalq Jeffersol DB ( diethylene glycol monobutyl ether ) in place of Dowanol DPM in the original formulation at the same * level,and twice as much. The

  17. A Primer on Population Health Management and Its Perioperative Application.

    Science.gov (United States)

    Boudreaux, Arthur M; Vetter, Thomas R

    2016-07-01

    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  18. Evolución del peso en pacientes durante el primer año del trasplante renal

    Directory of Open Access Journals (Sweden)

    Pilar López Garrigós

    Full Text Available Durante el primer año de trasplante renal es frecuente una ganancia de peso, debido, entre otros a la dieta, sedentarismo, e inmunosupresores, pudiendo aumentar los factores de riesgo del síndrome metabólico. Objetivos: Conocer la evolución del peso de nuestros pacientes durante el primer año del trasplante, y analizar la influencia con las distintas variables asociadas al paciente, sexo, edad, IMC, tratamiento inmunosupresor entre otras. Determinar la asociación entre la ganancia de peso y la aparición de factores de riesgo, como hipertensión arterial, diabetes y dislipidemia. Material y Método: Estudio retrospectivo y analítico. Se estudiaron 100 pacientes con un año de evolución en el trasplante, del Hospital Virgen de la Salud de Toledo. Sé analizaron datos antropométricos, demográficos y clínicos. La ganancia de peso se distribuyo según a las variables del estudio. Resultados: La ganancia de peso al año del trasplante afecto a 93 pacientes, con una media de 7,21 kg ±5,87. El 44,1% aumento su peso por encima de la media, y el 23,7% gano > 10 kg. La prevalencia de sobrepeso y obesidad antes del trasplante fue 57% y 76% después del trasplante. Los hombres ganaron ligeramente más peso que las mujeres. Los más jóvenes < 49 años ganaron más peso, media 9,3 kg. Mayor incidencia de diabetes, hipertensión y dislipemias en los pacientes con sobrepeso y obesidad. Conclusiones: La mayoría de los pacientes aumentaron significativamente de peso al año del trasplante, asociándose con varios de los factores del síndrome metabólico. - Importante la educación, por parte de la enfermería, del paciente para fomentar hábitos de vida saludable.

  19. Quantification of Blautia wexlerae and Blautia luti in human faeces by real-time PCR using specific primers.

    Science.gov (United States)

    Touyama, M; Jin, J S; Kibe, R; Hayashi, H; Benno, Y

    2015-01-01

    The Clostridium coccoides group, including the genus Blautia and other genera, is one of the predominant bacterial groups in the human intestine. We re-examined 266 human faecal clones and 58 isolates in the C. coccoides group isolated by Hayashi et al. (2002) in order to elucidate the detailed distribution of Blautia wexlerae and Blautia luti in human faeces. Subsequently, we designed a primer pair specific for B. wexlerae and B. luti based on the 16S ribosomal RNA (16S rRNA) gene sequence. The number of B. wexlerae and B. luti in faecal samples of 12 healthy Japanese subjects was examined by real-time PCR assay. The number of the C. coccoides group in the 12 faecal samples was also determined using C. coccoides group-specific primers. Re-examination of the human faecal clones and isolates revealed that B. wexlerae and B. luti accounted for 19.5% of the clones and 25.9% of the isolates. B. wexlerae and B. luti were detected in all faecal samples with 5.3±3.2×10(9) cells/g faeces (wet weight, average ± standard deviation) as assessed by real-time PCR. Furthermore, B. wexlerae and B. luti constituted 32.3±12.7% (average ± standard deviation) of the C. coccoides group (1.7±0.8×10(10) cells/g faeces). This demonstrates that B. wexlerae and B. luti were presented in human faeces with a high frequency as the dominant bacteria.

  20. Necesidades en salud del diabético usuario del primer nivel de atención

    Directory of Open Access Journals (Sweden)

    Salinas-Martínez Ana M.

    2001-01-01

    Full Text Available Objetivo. Determinar la magnitud y jerarquizar la necesidad de salud satisfecha del diabético tipo 2, usuario del primer nivel de atención. Material y métodos. Se realizó un estudio transversal comparativo con representatividad rural y urbana, en el Instituto Mexicano del Seguro Social, en Nuevo León, en 1999. Fueron entrevistados, al azar, 256 diabéticos tipo 2 con dos o más años de diagnóstico. La información fue complementada con el expediente clínico y encuesta al proveedor. Se evaluaron cinco áreas y cuatro determinantes de salud, con base en estándares de la Norma Oficial Mexicana y la Asociación Americana de Diabetes. El plan de análisis consistió en estadística descriptiva y estimación de puntajes z. Resultados. Se registró una media de satisfacción global de necesidades de salud de 48.8%. En la zona rural la media de satisfacción fue menor que en la urbana (36.8% vs 53.3%, phttp://www.insp.mx/salud/index.html

  1. El aprendizaje de distintos dominios notacionales según niños de preescolar y primer grado

    Directory of Open Access Journals (Sweden)

    Nora Scheuer

    2010-10-01

    Full Text Available Se investiga si las concepciones de los niños acerca del aprendizaje adoptan matices diferentes según tres dominios notacionales: dibujo, escritura y notación numérica. Se entrevistó individualmente a 120 alumnos de preescolar (60 y primer grado (60 de escuelas públicas en Argentina. Se aplicó la lexicometría a las transcripciones de sus respuestas completas a tres preguntas referidas a la actividad, dificultades y metas en relación al propio aprendizaje del dibujo, escritura o notación numérica. Los resultados revelan diferencias significativas en cómo los niños refieren el contenido de aprendizaje y a sí mismos como aprendices según el dominio, indicando una teoría interpretativa del aprendizaje en relación al dibujo y la notación numérica, y una teoría directa en relación a la escritura.

  2. Trasplante simultáneo de páncreas y riñón: reporte del primer caso realizado en el Perú

    Directory of Open Access Journals (Sweden)

    José De Vinatea

    2010-04-01

    Full Text Available El trasplante simultáneo de páncreas y riñón es la opción terapéutica ideal para pacientes con diabetes mellitus tipo 1 con insuficiencia renal crónica. Permite recuperar la insulino-independencia y evita la necesidad de diálisis, mejorando notablemente la calidad de vida. Así mismo, la restitución de la euglicemia logra que las complicaciones tardías de la diabetes no progresen e incluso regresionen, prolongando la supervivencia global de estos pacientes. Estos beneficios superan a los riesgos de la cirugía y de la inmunosupresión inherentes al trasplante. A nivel mundial, desde 1966, en que se llevó a cabo el primer trasplante de páncreas en Minnesota (Estados Unidos, se han registrado más de 20 000 trasplantes de páncreas, con resultados cada vez mejores gracias al refinamiento en las técnicas quirúrgicas y a los nuevos esquemas de inmunosupresión. En el presente caso clínico, se reporta y describe la realización del primer trasplante simultáneo de páncreas y riñón en el Perú.

  3. /Cu-Al System

    Science.gov (United States)

    Kish, Orel; Froumin, Natalya; Aizenshtein, Michael; Frage, Nachum

    2014-05-01

    Wettability and interfacial interaction of the Ta2O5/Cu-Al system were studied. Pure Cu does not wet the Ta2O5 substrate, and improved spreading is achieved when relatively a high fraction of the active element (~40 at.% Al) was added. The Al2O3 and AlTaO4 phases were observed at the Ta2O5/Cu-Al interface. A thermodynamic evaluation allowed us to suggest that the lack of wetting bellow 40 at.% Al is due to the presence of a native oxide, which covers the drop. The conditions of the native oxide decomposition and the formation of the volatile Al2O suboxide strongly depend on the vacuum level during sessile drop experiments and the composition of the Cu-Al alloy. In our case, Al contents greater than 40% provides thermodynamic conditions for the formation of Al2O (as a result of Al reaction with Al2O3) and the drop spreading. It was suggested that the final contact angle in the Ta2O5/Cu-Al system (50°) is determined by Ta adsorption on the newly formed alumina interlayer.

  4. Aussprache als motorische Fertigkeit

    DEFF Research Database (Denmark)

    Bonner, Maria

    2013-01-01

    Authentische Aussprache gilt im Fremdsprachenunterricht als schwer erreichbares Ziel, fremdsprachlicher Akzent wird als nahezu unvermeidbar gesehen. Weder die Hypothese einer kritischen Periode für den Erwerb einer authentischen Aussprache noch das Konzept der Fossilierung im Sprachlernprozess...

  5. Genetic Testing for ALS

    Science.gov (United States)

    ... In Your Community Advocate Get Involved Donate Familial Amyotrophic Lateral Sclerosis (FALS) and Genetic Testing By Deborah Hartzfeld, MS, CGC, Certified Genetic Counselor Familial ALS Most of the time ALS is not inherited. ...

  6. Initial Symptoms of ALS

    Science.gov (United States)

    ... Chapters Certified Centers and Clinics Support Groups About ALS About Us Our Research In Your Community Advocate ... Diagnosis En español Symptoms The initial symptoms of ALS can be quite varied in different people. One ...

  7. Amyotrophic Lateral Sclerosis (ALS)

    Science.gov (United States)

    ... cognitive problems involving word fluency, decision-making, and memory. Most cases of ALS happen ... and edaravone have approved by the Food and Drug Administration (FDA) to treat ALS. Riluzole ...

  8. A randomised trial comparing the antibacterial effects of dentine primers against bacteria in natural root caries.

    Science.gov (United States)

    Rolland, S L; McCabe, J F; Imazato, S; Walls, A W G

    2011-01-01

    As people are living longer and retaining their teeth into old age, root caries is an increasingly significant problem. A minimally invasive treatment strategy, involving sealing the root caries lesion with an antibacterial resin sealant, could be highly beneficial. The aim of this study was to compare the antibacterial properties of the primers of two proprietary dentine bonding agents, Clearfil SE Bond (SE; Kuraray Medical, Japan) and Clearfil Protect Bond (PB; Kuraray Medical), which contains the antibacterial monomer methacryloyloxydodecylpyridinium bromide. Fifty-two root caries lesions were identified and randomly assigned to a primer. The lesion was cleaned, isolated, sampled with a sharp spoon excavator, a primer applied and a second sample taken. Samples were transported in fastidious anaerobe broth, vortex-dispersed and serial dilutions inoculated onto selective agars. Reduction in colony-forming units (CFU, %) after primer application was calculated for both primers for bacterial growth on each selective agar and compared to a hypothesised mean of 100% (one-sample t test, p < 0.05). No significant differences between primers were seen, indicating efficient bacterial elimination by both materials. Comparing percent reduction between SE and PB for each agar (Mann-Whitney test, p < 0.05), a significantly greater CFU reduction by PB was seen for streptococci but not other bacteria. More lesions exhibited bacterial growth and several lesions demonstrated marked bacterial growth after treatment with SE compared with PB. Therefore, PB appears to exhibit superior antimicrobial properties, particularly against streptococci. Both primers are highly antibacterial towards root caries bacteria and may therefore be suitable for minimally invasive treatment. Copyright © 2011 S. Karger AG, Basel.

  9. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  10. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  11. La ayuda oficial al desarrollo en el sector agrario

    OpenAIRE

    Areta García, Álvaro; Marín, Gonzalo

    2006-01-01

    El primer Objetivo de Desarrollo del Milenio habla de erradicar la pobreza extrema y el hambre. Por tanto, dado que la mayoría de la gente pobre vive en el medio rural o depende de la agricultura, y que en las naciones más pobres la agricultura prepara el terreno para el desarrollo económico, será imprescindible una gran inversión en el desarrollo rural y, por ende, en uno de sus “pilares” básicos, la agricultura. Sin embargo, el papel de la agricultura en el marco de la Ayuda Oficial al Desa...

  12. Una mirada al surgimiento del turismo en Pátzcuaro

    OpenAIRE

    José Manuel Martínez Aguilar

    2017-01-01

    El turismo en Pátzcuaro, como actividad económica, tuvo su origen y primer impulso desde finales del siglo XIX, a partir de la puesta en marcha del tramo ferroviario de Morelia a Pátzcuaro, cuando distintos empresarios apostaron por invertir en servicios de hospedaje, alimentación y transporte destinados al turismo. Sin embargo, la inestabilidad de la Revolución Mexicana cortó la inercia del desarrollo turístico. Fue hasta que el General Lázaro Cárdenas del ...

  13. Amyotrophic lateral sclerosis (ALS)

    Science.gov (United States)

    Lou Gehrig disease; ALS; Upper and lower motor neuron disease; Motor neuron disease ... One out of 10 cases of ALS is due to a genetic defect. The cause is unknown in most other cases. In ALS, motor nerve cells (neurons) waste away ...

  14. Abiodun et al (19)

    African Journals Online (AJOL)

    DELL

    2018-03-01

    Mar 1, 2018 ... carboxymethylation) and enzymatic technique. (Abbas et al., 2010; Jyothi et al., 2013). Modification of other starches from corn, cassava, potato and some yam ..... release of water from the polymeric network. (syneresis). The water thus released leaves the starch gel with a sponge-like texture. Abiodun et al.

  15. Cloning flanking sequence by single-primer PCR in transgenic plants.

    Science.gov (United States)

    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W

    2014-10-20

    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  16. Microleakage under metallic and ceramic brackets bonded with orthodontic self-etching primer systems.

    Science.gov (United States)

    Uysal, Tancan; Ulker, Mustafa; Ramoglu, Sabri Ilhan; Ertas, Huseyin

    2008-11-01

    To compare the in vitro microleakage of orthodontic brackets (metal and ceramic) between enamel-adhesive and adhesive-bracket interfaces at the occlusal and gingival sides produced by self-etching primer system with that of conventional acid etching and bonding. Sixty freshly extracted human mandibular premolar teeth were used in this study. The teeth were separated into four groups of 15 teeth each and received the following treatments: Group 1, 37% phosphoric acid gel + Transbond XT liquid primer + stainless steel bracket; Group 2, Transbond Plus Self-Etching Primer (TSEP) + stainless steel bracket; Group 3, 37% phosphoric acid gel + Transbond XT liquid primer + ceramic bracket; Group 4, TSEP + ceramic bracket. After curing, specimens were further sealed with nail varnish, stained with 0.5% basic fuchsine for 24 hours, sectioned and examined under a stereomicroscope, and scored for microleakage for the enamel-adhesive and bracket-adhesive interfaces from both occlusal and gingival margins. Statistical analyses were performed using Kruskal-Wallis and Mann-Whitney U tests. The gingival sides in all groups exhibited higher microleakage scores compared with those observed in occlusal sides for both adhesive interfaces. Enamel-adhesive interfaces exhibited more microleakage than did the adhesive-bracket interfaces. Brackets bonded with self-etching primer system showed significantly higher microleakage at the enamel-adhesive interface of the gingival side. TSEP causes more microleakage between enamel-adhesive interfaces, which may lead to lower bond strength and/or white-spot lesions.

  17. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2017-12-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  18. Genus-specific PCR primers targeting intracellular parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2017-12-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  19. Bonding of Resin Cement to Zirconia with High Pressure Primer Coating

    Science.gov (United States)

    Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua

    2014-01-01

    Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (pzirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678

  20. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  1. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  2. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin.

    Science.gov (United States)

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra; Park, Chan-Jin

    2015-10-01

    The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (PAg-Pd alloy surfaces presented significantly decreased shear bond strength. Combined use of MDP and VBATDT were effective in bonding of the resin to Co-Cr and Au-Ag-Pd alloy. Tarnish using polyvinylpyrrolidone solution negatively affected on the bonding of veneer resin to Co-Cr and Au-Ag-Pd alloys.

  3. Evaluation of genotypic diversity of Streptococcus mutans using distinct arbitrary primers

    Directory of Open Access Journals (Sweden)

    Cínthia Pereira Machado Tabchoury

    2008-12-01

    Full Text Available Streptococcus mutans has been considered one of the main etiological agents of dental caries and the genotypic diversity rather than its salivary counts may be considered as a virulence factor of this bacterium. For genotyping with polymerase chain reaction (PCR with arbitrary primers, several primers have been used in order to improve complexity and specificity of amplicon patterns. Thus, the aim of this study was to evaluate the degree of agreement of genotypic identification among AP-PCR reactions performed with 5 distinct arbitrary primers of S. mutans isolated from saliva. Stimulated saliva was collected from 11 adult volunteers for isolation of S. mutans, and a total of 88 isolates were genotyped with arbitrary primers OPA 02, 03, 05, 13 and 18. Fourteen distinct genotypes were identified in the saliva samples. Most volunteers (9 out of 11 presented only one genotype. The results of the present study suggest that primers OPA 02, 03, 05 and 13 were suitable for genotypic identification of S. mutans isolates of saliva from adult volunteers.

  4. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  5. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    Science.gov (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  6. Development of SCAR primers based on a repetitive DNA fingerprint for Escherichia coli detection.

    Science.gov (United States)

    Sangdee, Aphidech; Natphosuk, Sitakan; Srisathan, Adunwit; Sangdee, Kusavadee

    2013-02-01

    The present study aimed to use enterobacterial repetitive intergenic consensus (ERIC) fingerprints to design SCAR primers for the detection of Escherichia coli. The E. coli strains were isolated from various water sources. The primary presumptive identification of E. coli was achieved using MacConkey agar. Nineteen isolates were selected and confirmed to be E. coli strains based on seven biochemical characteristics. ERIC-PCR with ERIC 1R and ERIC 2 primers were used to generate DNA fingerprints. ERIC-PCR DNA profiles showed variant DNA profiles among the tested E. coli strains and distinguished all E. coli strains from the other tested bacterial strains. A 350 bp band that predominated in five E. coli strains was used for the development of the species-specific SCAR primers EC-F1 and EC-R1. The primers showed good specificity for E. coli, with the exception of a single false positive reaction with Sh. flexneri DMST 4423. The primers were able to detect 50 pg and 10(0) CFU/ml of genomic DNA and cells of E. coli, respectively.

  7. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    Science.gov (United States)

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

    2013-01-01

    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (pcontrol. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  8. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  9. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  10. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  11. An alternative suite of universal primers for genotyping in multiplex PCR.

    Directory of Open Access Journals (Sweden)

    Cheng Ge

    Full Text Available The universal primer three-primer approach can dramatically reduce the cost when genotyping the microsatellites. One former research reported four universal primers that can be used in singleplex and multiplex genotyping. In this study, we proposed an alternative suite of universal primers with four dyes for genotyping 8-12 loci in one single run. This multiplex method was tested on Tetranychus truncatus. Published microsatellite loci of T. kanzawai, Frankliniella occidentalis and Nilaparvata lugens were modified as needed and also tested. The robustness of the method was confirmed by comparing with singleplex using multiple fluorophores and genotyping two populations of T. truncatus. This method showed lower signal strength than the singleplex three-primer system, but it was still sufficient to determine the fragment length. The cost of such a project can be reduced dramatically when many loci of different species are involved. In this way, laboratories performing population genetic analyses or studying several different species may benefit from the use of this cost-effective protocol.

  12. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae) and Cross-Amplification in Related Mediterranean Species

    OpenAIRE

    Sánchez Robles, José Manuel; Talavera Lozano, Salvador; García Castaño, Juan Luis; Terrab Benjelloun, Anass; Navarro Sampedro, Laura; Balao Robles, Francisco J.

    2012-01-01

    Twelve nuclear microsatellite primers (nSSR) were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454) data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other ...

  13. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  14. Primer fármaco antiepiléptico : patrón de uso y efectividad

    OpenAIRE

    Martínez Domeño, Alejandro

    2013-01-01

    Estudiem el primer fàrmac antiepileptic utlitzat en 430 pacients amb epilèpsia, per valorar la seva taxa de retenció, efectivitat i tolerabilitat en el primer any de tractament. El 81% van rebre àcid valproic, carbamazepina o feintoina com primer tractament, tot i que l'ús de la fenitoina ha disminuit significativamen en els últims anys. La taxa de retenció annual és del 87%, sent més altes amb levetiracetam i lamotrigina. Un 40% van presentar recurrències en el primer any, sent major el risc...

  15. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  16. Analytical comparison of nine PCR primer sets designed to detect the presence of Escherichia coli/Shigella in water samples.

    Science.gov (United States)

    Maheux, Andrée F; Picard, François J; Boissinot, Maurice; Bissonnette, Luc; Paradis, Sonia; Bergeron, Michel G

    2009-07-01

    The analytical performance of 9 different PCR primer sets designed to detect Escherichia coli and Shigella in water has been evaluated in terms of ubiquity, specificity, and analytical detection limit. Of the 9 PCR primer sets tested, only 3 of the 5 primer sets targeting uidA gene and the primer set targeting tuf gene amplified DNA from all E. coli strains tested. However, of those 4 primer sets, only the primer set targeting the tuf gene also amplified DNA from all Shigella strains tested. For the specificity, only the primer sets targeting the uidA gene were 100% specific although the primer sets targeting 16S rRNA, phoE, and tuf genes only amplified Escherichia fergusonii as non-specific target. Finally, the primer set targeting the 16S-ITS-23S gene region, was not specific as it amplified DNA from many other Enterobacteriaceae species. In summary, only the assay targeting the tuf gene detected all E. coli/Shigella strains tested in this study. However, if it becomes important to discriminate between E. coli and E. fergusonii, assays targeting the uidA gene would represent a good choice although none of them were totally ubiquitous to detect of the presence of Shigella strains.

  17. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether t......RNA primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...

  18. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

    DEFF Research Database (Denmark)

    Blair, D.; Waycott, M.; Byrne, L.

    2006-01-01

    This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...... designed that can act as a forward primer in PCRs for any Perna species. Four reverse primers have also been designed, based on nad4 and intergenic spacer sequences, which yield species-specific products of different lengths when paired with the conserved forward primer. A further pair of primers has been...

  19. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  20. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  1. Protagonismo de los alumnos en el aprendizaje: Una experiencia en el primer curso de medicina

    Directory of Open Access Journals (Sweden)

    Agustín Hidalgo

    Full Text Available Objetivo. Presentar y analizar la experiencia realizada en una asignatura del primer curso del Grado de Medicina para abordar competencias formativas en documentación, método científico y humanismo médico. Sujetos y métodos. Participaron 151 alumnos distribuidos en grupos de 5-6 estudiantes para realizar los trabajos propuestos en forma de seminarios y aprendizaje basado en problemas (ABP, utilizando, entre otros materiales, narraciones literarias e imágenes de cuadros pictóricos cuyo análisis y discusión se presentaron oralmente. En las prácticas se inició a los estudiantes en la búsqueda y evaluación de la información. Un ensayo y las clases teóricas completan los métodos utilizados. Todos los materiales a utilizar estuvieron disponibles en el campus virtual. Resultados. La asistencia a prácticas, seminarios y ABP fue próxima al 100%, y a clases teóricas, del 67%. Los alumnos mostraron inquietud intelectual en las tareas. El método ha demostrado una elevada implicación en el proceso de autoaprendizaje, capacidad de autorregulación en el trabajo, trabajo en grupo, grado de adquisición de conceptos y capacidad de redactar documentos. La adecuación de los contenidos a los objetivos ha sido considerada favorable por más del 70% de los alumnos. El grado de adquisición de las competencias fue favorable en un 80% de los casos. Conclusiones. Las características de la asignatura pueden fomentar la inquietud científica y el humanismo médico entre los alumnos. La literatura y la lectura de cuadros pueden contribuir a identificar los aspectos del acto médico y a desarrollar la observación de las características físicas y conductuales en los pacientes.

  2. Clorhidrorrea congénita:: primer reporte en Cuba Congenital chlorhydria:: first report in Cuba

    Directory of Open Access Journals (Sweden)

    Carlos Ramírez Pérez

    2009-12-01

    Full Text Available En el presente trabajo se exponen los antecedentes prenatales, perinatales y posnatales de un lactante de 6 meses de edad, del sexo masculino, con clorhidrorrea congénita, así como el cuadro clínico, diagnóstico y tratamiento utilizado. Un elemento significativo lo constituyó la expulsión anal de abundante líquido no meconial desde las primeras horas de nacido, así como alcalosis metabólica grave y la presencia de desnutrición rápidamente progresiva. En los exámenes complementarios se constató hipocloremia de un 50 % con respecto a las cifras de referencia y un pH sanguíneo mayor de 7,50. El diagnóstico confirmatorio se obtuvo al comprobar concentraciones de cloro en heces fecales superiores a las de la suma de sodio y potasio. Se proponen indicadores diagnósticos prenatales entre los que tienen gran valor la consanguinidad, el polihidramnios y los resultados del ultrasonido en el tercer trimestre del embarazo. El diagnóstico precoz permitió establecer el tratamiento y evitó el frecuente desenlace fatal. Es el primer caso de esta enfermedad que se informa en el país.In present paper are showed the prenatal, perinatal and postnatal backgrounds from a male breast-fed baby aged 6 months presenting with congenital chlorhydria, as well as the clinical picture, diagnosis and treatment applied. A significant element was the anal expulsion of non-meconium abundant fluid from the first hours of born, as well as a severe metabolic alkalosis and the presence of a quickly progressive malnutrition. In complementary examinations was confirmed a 50% hypochloremia regarding the reference figures and a blood pH over 7,50. Confirmatory diagnosis was achieved verifying the chlorine concentrations in feces higher to that of the sum of sodium and potassium. Prenatal diagnostic indicators are proposed those with higher value including the consanguinity, polyhydramnios and the US results during the third trimester of pregnancy. Early diagnosis

  3. La política ferroviaria del primer gobierno radical 1916-1922

    Directory of Open Access Journals (Sweden)

    MARIO JUSTO LÓPEZ

    2013-05-01

    Full Text Available El gobierno argentino adoptó a comienzos del siglo XX un modelo de explotación ferroviaria basado en la actuación de empresas extranjeras, que obtenían su capital en el mercado financiero y que, para ello, debían tener utilidades. Su actuación quedó sometida al control estatal que se ejerció a través de la Dirección General de Ferrocarriles. Con el triunfo electoral de la Unión Cívica Radical en las elecciones presidenciales de 1916 la situación no cambió. El primer presidente radical, Hipólito Yrigoyen, continuó con dicho modelo y en los años difíciles que siguieron a la Primera Guerra Mundial se preocupó en mantener las utilidades de las empresas dándoles sucesivos aumentos de tarifas. La Dirección General de Ferrocarriles continuó siendo el órgano específico de contralor pero ahora con menos autonomía respecto del Presidente de la Nación. El estudio detallado de lo hecho en estos años desmiente la creencia de que el presidente Yrigoyen fue contrario a las empresas ferroviarias extranjeras y llevó adelante acciones en su perjuicio. Abstract At the beginning of the XXth Century, the Argentine Government left the main sections of the railway system in the hands of foreign companies. Those companies managed to obtain their capital from the financial market under the condition of being profitable. All those companies were controlled by the National Railways Board. In 1916, when the Radical Civic Union won the presidential election, nothing changed. Even during the difficult years after the First World War, Hipólito Yrigoyen, the first Radical President allowed fares increases that kept the level of profitability. The National Railways Board went on with the surveillance of the foreign companies, but now under the direct power of the President. A careful study of the first Radical Government railway policy shows that the mythical idea about President Yrigoyen acting against foreign companies is not true.

  4. 143 - 148_Makeri et al.

    African Journals Online (AJOL)

    USER

    2015-06-01

    Jun 1, 2015 ... Yuan et al., 2003), antimicrobial activity (Sundarrao et al., 1993; Betancur-Galvis et al., 1999; Takashi et al., 2006), anti-parasitic, anti-malarial activities (Alali et al., 1998; Jaramillo et al., 2000; Luna et al.,. 2005). This study evaluates the antibacterial activity of extract of stem –bark and leaf extracts of Annona.

  5. [Aging effect of one bottle-type ceramic primer on bonding efficacy of resin cement].

    Science.gov (United States)

    Goto, Haruhiko

    2008-04-01

    To understand the degradation mechanisms of commercially available one bottle-type ceramic primer, we prepared one bottle-type experimental ceramic primer consisting of gamma-methacryloxy-propyl-trimethoxysilane, gamma-MPTS, and 90% ethanol solution. The effects of aging of the experimental primer on the hydrolysis and condensation behavior of gamma -MPTS and on the bonding efficacy of gamma-MPTS at the interface between cement and ceramic were studied. We used two lamina bond porcelain primers (LB), that had been aged for 20 months and newly purchased. Experimental primer was aged at 20 degrees C. After aging, we measured 29Si NMR spectrum of the gamma-MPTS and the shear bond strength of the cement to silane-treated ceramic by varying aging periods. When the LB was aged for 20 months, the mean bond strength decreased from 26 to 11 MPa. To understand the degradation mechanism in the bond strength, the effects of aging of experimental primer on molecular species of gamma-MPTS were examined. With prolonging its aging period, the methoxy group of the silicone functional portion in the gamma-MPTS hydrolyzed and the hydrolyzed gamma-MPTS species condensed together. The molecular weight of condensed gamma-MPTS species increased. On the other hand, when the dimer species of gamma-MPTS were produced, a maximum mean bond strength of 28 MPa was observed. Thereafter, the bond strength dropped down and leveled off at 16 MPa. When the LB was aged for 20 months, the bond strength dramatically decreased. This decrease in the mean bond strength was probably attributed to ester exchange reaction of the methoxyl group in the gamma-MPTS by the ethanol used as diluent solvent.

  6. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  7. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2004-01-01

    of multiple SNPs in a single reaction. Biotin-labeled ddNTPs were used in the SBE reaction and solid phase-bound monomeric avidin was used as capturing/purification scheme allowing the exclusive release of the SBE products under gentle conditions using 5% triethylamine. We dubbed this method monomeric avidin...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal...

  8. Gorduras em laticínios, ovos, margarinas e óleos: implicações para a aterosclerose Grasas en lácteos, huevos, margarinas y aceites: implicaciones para la aterosclerosis Fat content of dairy products, eggs, margarines and oils: implications for atherosclerosis

    Directory of Open Access Journals (Sweden)

    Carlos Scherr

    2010-07-01

    Full Text Available FUNDAMENTO: Para o aconselhamento adequado de um planejamento alimentar, com vistas à prevenção da cardiopatia isquêmica, é necessário o conhecimento da composição química dos alimentos. ObJETIVO: Analisar a composição de gorduras, ácidos graxos e colesterol de alguns exemplos nacionais de óleos comestíveis, manteigas, margarinas, laticínios e ovos, utilizando os limites de uma dieta para prevenção de doença arterial coronariana. MÉTODOS: Foi analisada a composição de óleos comestíveis, manteigas, margarinas, laticínios e ovos. Os resultados foram empregados de acordo com o recomendado pela American Heart Association para uma dieta de 1.800 calorias. RESULTADOS: Na comparação entre os óleos comestíveis, o de canola apresentou-se como o melhor. Já entre os leites, o desnatado é o mais recomendável, porém não há vantagens em relação ao semidesnatado. No caso do ovo, não existiram diferenças nos tipos encontrados no mercado. Em relação aos queijos, o tipo minas é o que apresentou o menor conteúdo de colesterol e gordura saturada. Na comparação margarina com manteiga, a primeira levou vantagem quando os níveis de gorduras trans que não ultrapassam o recomendado. CONCLUSÃO: A composição de alimentos usados no Brasil indica que dietas com objetivo de prevenção primária e secundária da cardiopatia isquêmica podem priorizar o uso de leite semidesnatado, óleo de girassol, margarinas com baixo teor de gorduras trans e queijo do tipo minas.FUNDAMENTO: Para aconsejar adecuadamente sobre una planificación alimentaria, con vistas a la prevención de la cardiopatía isquémica, es necesario el conocimiento de la composición química de los alimentos. OBJETIVO: Analizar la composición de grasas, ácidos grasos y colesterol de algunos ejemplos nacionales de aceite comestible, mantecas, margarina, lácteos y huevos, utilizando los límites de una dieta para prevención de enfermedad arterial coronaria. M

  9. Pornographie als Metapher

    Directory of Open Access Journals (Sweden)

    Caroline Schubarth

    2010-02-01

    Full Text Available In diesem Artikel werden unterschiedliche metaphorische Verwendungen des Pornografiebegriffs und deren Implikationen untersucht. Während die Existenz von Pornografie der feministischen Anti-Porno-Bewegung als Erklärung für die anhaltende Diskriminierung von Frauen in westlichen Gesellschaften dient, nutzen rechtskonservative Kräfte den Pornografievorwurf als Rechtfertigung für die Zensur von als deviant empfundenen Identitäten und sexuellen Praktiken.

  10. Contribución al Estudio de las Moscas Anastrephas en Colombia.

    Directory of Open Access Journals (Sweden)

    González Mendoza Rafael

    1952-11-01

    como oriunda del Brasil, es decir una especie enteramente tropical. 8. Dentro de los dípteros, las moscas del género Anastrepha se pueden clasificar como suborden Cyclorrapha, serie Schyzophora, sección Myodaria, subsección Acalyptratae, familia Trypetidae. 9. Las moscas Anastrephas cumplen su ciclo biológico al través de 4 estados metamorfósicos que ocurren así: imago en el ambiente aéreo, huevo y larva en la fruta y pupa en el suelo. En cada uno de los estados metamorfósicos, el insecto exhibe las características comunes de los dípteros. 10. Los huevos miden l , mm.; son de forma ovalada y ápices un tanto agudos, de color blancuzco ligeramente cremoso. La incubación demora de 4 a 7 días; el número de huevos por postura es de 3 y hasta l. La incubación de los huevos y la vida de la larva recién nacida son afectados por temperatura, humedad y determinados factores resultantes de la condición de madurez de la fruta. 11. Las larvas son vermiformes, puntiagudas en la cabeza, de color amarillo crema claro en tonalidades diversas hasta blanquecino o cremoso. No poseen patas; no tienen ojos ni antenas. Su tamaño y la duración del período larvario varían con la temperatura, la humedad, y diversas condiciones de la fruta en cuanto a cantidad de material parásito, acidez, estado de madurez, etc. El número de larvas puede ser de 1 a 3 por fruta y hasta cifras muy elevadas como 72, según la población de moscas y la clase de fruta. Las larvas adquieren su desarrollo completo entre tres estadios y dos "écdicis". 12. Las pupas son ovaladas como una barrilito; miden de 3 a 7 mm, de largo x 1 1⁄2 a 21⁄2 de ancho. Son de color castaño claro en tonalidades hasta el tabaco oscuro. La duración del período de pupa, así como diferentes hechos relacionados con el estado, sufren variaciones debidas a temperatura, humedad, acidez, soltura y textura del suelo, que es el medio donde normalmente ocurre el empupamiento. 13. El estado

  11. Testing of Flame Sprayed Al2O3 Matrix Coatings Containing TiO2

    Directory of Open Access Journals (Sweden)

    Czupryński A.

    2016-09-01

    Full Text Available The paper presents the results of the properties of flame sprayed ceramic coatings using oxide ceramic materials coating of a powdered aluminium oxide (Al2O3 matrix with 3% titanium oxide (TiO2 applied to unalloyed S235JR grade structural steel. A primer consisting of a metallic Ni-Al-Mo based powder has been applied to plates with dimensions of 5×200×300 mm and front surfaces of Ø40×50 mm cylinders. Flame spraying of primer coating was made using a RotoTec 80 torch, and an external coating was made with a CastoDyn DS 8000 torch. Evaluation of the coating properties was conducted using metallographic testing, phase composition research, measurement of microhardness, substrate coating adhesion (acc. to EN 582:1996 standard, erosion wear resistance (acc. to ASTM G76-95 standard, and abrasive wear resistance (acc. to ASTM G65 standard and thermal impact. The testing performed has demonstrated that flame spraying with 97% Al2O3 powder containing 3% TiO2 performed in a range of parameters allows for obtaining high-quality ceramic coatings with thickness up to ca. 500 µm on a steel base. Spray coating possesses a structure consisting mainly of aluminium oxide and a small amount of NiAl10O16 and NiAl32O49 phases. The bonding primer coat sprayed with the Ni-Al-Mo powder to the steel substrate and external coating sprayed with the 97% Al2O3 powder with 3% TiO2 addition demonstrates mechanical bonding characteristics. The coating is characterized by a high adhesion to the base amounting to 6.5 MPa. Average hardness of the external coating is ca. 780 HV. The obtained coatings are characterized by high erosion and abrasive wear resistance and the resistance to effects of cyclic thermal shock.

  12. Desbalance energético proteico en lactantes durante el primer año de vida*

    Directory of Open Access Journals (Sweden)

    Virginia Díaz-Argüelles Ramírez-Corría

    2004-06-01

    Full Text Available La alimentación de los lactantes durante el primer año de vida tiene gran influencia en el crecimiento y desarrollo posterior, sobre todo en el lactante de muy bajo peso al nacer. El objetivo de este trabajo fue caracterizar el consumo de energía y macronutrientes en un grupo de recién nacidos, con peso inferior a 1 800 g y compararlo con un grupo control de término, para conocer si existía un consumo adecuado durante el primer año de vida. Para ello, se realizó un estudio de cohorte en 25 recién nacidos con peso al nacer menor de 1800 g y 34 semanas de edad gestacional, en el Hospital Ginecoobstétrico "Ramón González Coro", en Ciudad de La Habana, desde enero del 2000 hasta enero del 2001 y en 25 recién nacidos de buen peso a término como grupo control. Se realizó encuesta dietética de registro de 3 días, y a los 4, 6, 9 y 12 meses de edad para evaluar el consumo de macronutrientes. Los datos se procesaron por el Programa para la evaluación del consumo de alimentos (CERES. El consumo de energía fue adecuado, pero con un desequilibrio manifiesto de los macronutrientes en uno y otro grupos, a expensas del consumo de proteínas que fue excesivo (5 g/kg/día durante todo el primer año de vida y una baja densidad energética de la dieta. Se hace necesaria una revisión de la ablactación en los lactantes, del tipo de leche utilizado durante los primeros meses de la lactancia y los hábitos alimentarios de la población, con el objetivo de mejorar su calidad durante los primeros años de la vida.The feeding of infants during the first year of life has a great influence on the further growth and development, mainly on the infant with very low birth weight. The objective of this paper was to characterize the intake of energy and macronutrients in a group of newborn infants with a weight under 1 800 g and to compare it with a term control group to know if there was an adequate consumption during the first year of life. To this end, a

  13. Susceptibilidad de genotipos de Solanum spp. al nematodo causante del nudo radical Meloidogyne spp. (chitwood

    Directory of Open Access Journals (Sweden)

    Gelpud Chaves Cristian

    2011-03-01

    Full Text Available

    El cultivo del lulo (Solanum quitoense L. presenta una disminución en su productividad, debido al ataque de patógenos como el nematodo del nudo radical Meloidogyne  spp., en el Departamento  de Nariño (Colombia, se han reportado incidencias cercanas al 79%, y pérdidas del 50%.   En la presente investigación, se colectaron 45 genotipos de (Solanum quitoense  L. en los Departamentos  de Nariño  y Putumayo  y 4 genotipos  silvestres  (S. mammosum, S. hirtum,       S. marginatum  y S. umbellatum buscando fuentes de resistencia al nematodo. Se inocularon 9 plantas de cada genotipo de dos meses de edad con 10000 huevos de Meloidogyne spp., dejando tres testigos por cada material. Las variables evaluadas fueron: altura de planta, severidad, incidencia, peso fresco (tallo y raíz y especies prevalentes de Meloidogyne spp. Se hizo una clasificación de genotipos mediante escala de resistencia y regresión entre la severidad y las demás variables para establecer el efecto de Meloidogyne spp. sobre los genotipos de planta. Los resultados mostraron 100% de incidencia del nematodo en  todos  los  genotipos,  2.04%  genotipos  resistentes,  34.7%  moderadamente  resistentes, 42.8% moderadamente susceptibles, 18.3% susceptibles, y 2.04% altamente susceptibles. El genotipo SQbr05 resistente, no se vio afectado por la severidad, al contrario SQbc04 genotipo susceptible, mostró reducciones significativas en peso fresco de tallo y raIz, (R2 = 0.71 y 0.98,el genotipo silvestre (S. mammosum es altamente susceptible, Meloidogyne incognita presentó 55.31% de presencia. El genotipo SQbr05 es promisorio para ser evaluado en campo.

  14. En pos del "buen lector" : censura editorial y clases populares durante el primer franquismo (1939-1945

    Directory of Open Access Journals (Sweden)

    Eduardo Ruiz Bautista

    2004-01-01

    Full Text Available El artículo trata de analizar la censura de libros durante el primer franquismo desde un punto de vista sociocultural que apenas ha sido contemplado. Por un lado, se muestra cómo la censura impidió que determinadas obras cultas llegasen al lector popular, dificultando las ediciones asequibles o restringiéndolas directamente a eruditos. Por el otro, da cuenta de la dura represión de las lecturas populares sufrieron en nombre de la infancia, pese a que las motivaciones reales deban buscarse en el enfrentamiento entre lo culto y lo popular.The article tries to analyze the censorship of books during the first franquism from a sociocultural point of view that has been scarcely contemplated. In one hand, it shows how the censorship prevented the popular reader from getting learned works by obstructing cheap editions or by restricting them directly to scholars. In the other one, it shows the hard repression of the popular readings in the ñame of the infancy, although real motivations should be looked in the clash between the educated culture and the popular one.

  15. SCORE TEST PARA EL EFECTO DEL COEFICIENTE DE SOLAPAMIENTO EN MODELOS DE SUPERFICIES DE RESPUESTA DE PRIMER Y SEGUNDO ORDEN

    Directory of Open Access Journals (Sweden)

    ENRIQUE DARGHAN

    2011-01-01

    Full Text Available En este artículo ha sido propuesto un test para el coeficiente de solapamiento para el modelo de Draper y Guttman utilizando modelos de superficies de respuesta de primer y segundo orden. El test está basado en el test de score de Rao y hace uso de la teoría de operadores de proyección perpendicular. El test puede utilizarse en diferentes patrones de vecindad siempre y cuando se considere al vecino más cercano como la unidad experimental directamente afectada por los tratamientos y los modelos de la superficie sean de primero y segundo orden. El método es simple de adoptar y puede implementarse en el campo de la agronomía o en la investigación de mercados, pues su naturaleza asintótica está en concordancia con el gran número de unidades experimentales generalmente presentes en este tipo de investigaciones.

  16. Alles is al uitgevonden

    NARCIS (Netherlands)

    J.G.M. van Marrewijk (Charles)

    1996-01-01

    textabstractDe voordelen van vrijhandel zijn zeer beperkt, al-thans als we de empirische schattingen van vooraanstaande economen en internationale organisaties mogen geloven. Zo worden de voordelen van liberalisatie voor de Europese Unie geraamd op ongeveer 0,5% van het bnp 1. De door het IMF

  17. ALS (Amyotrophic Lateral Sclerosis)

    Science.gov (United States)

    ... here Home » Disorders » Patient & Caregiver Education » Fact Sheets Amyotrophic Lateral Sclerosis (ALS) Fact Sheet What is amyotrophic lateral sclerosis? Who ... Where can I get more information? What is amyotrophic lateral sclerosis? Amyotrophic lateral sclerosis (ALS) is a group of ...

  18. Lukman et al. (5)

    African Journals Online (AJOL)

    DELL

    1 Civil Engineering Department, Obafemi Awolowo University, Ile-Ife- Nigeria and Corresponding author. 2Department of Water Resources and Environmental Engineering, Ahmadu Bello University, Samaru, Zaria- Nigeria s Department of Civil Engineering, University of Hafr Al-Batin, Hafr Al-Batin, Saudi Arabia.

  19. Taiwo et al (8)

    African Journals Online (AJOL)

    DELL

    gender equity (Waddington et al., 2009). These benefits act as barriers to transmission of diseases from the environment to the human body (Kosek et al., 2003). The disease burden that results from poor access to improved source of drinking water is significant; the WHO estimated that more than. 9% of the disease burden ...

  20. Adekola et al (7)

    African Journals Online (AJOL)

    Timothy Ademakinwa

    Orange Basin as part of oil exploration protocols. (van Der Spuy, 2003; Hirsch et al., 2009; Hirsch et al., 2010). ... in the determination of both oil and gas reservoirs and potential source rocks (Franca and Potter,. 1988). ...... opening. Geophysical Journal International. 168, 353-361. Franca, A.B., and Potter, P.E. 1988.