WorldWideScience

Sample records for al oiea se

  1. Cathodoluminescence of ZnSe(Bi) : Al

    International Nuclear Information System (INIS)

    Studies on cathodoluminescence (CL) in the ZnSe crystals, annealed at the temperature of 1200 K in the Bi melt, containing aluminium admixture, are carried out. The spectra are taken at different levels of excitation and delay times by the t0 registration. With the t0 increase the orange band intensity with λmax = 630 nm (1.968 eV) in the CL spectrum decreases as compared to the intensity of the dominating yellow-green band with λmax = 550 nm (2.254 eV). It is shown that such a behaviour of the yellow-green band is conditioned by competition of two processes: recombination of donor-acceptor pairs and free electrons with holes localized on the acceptors. The first mechanism dominates at low temperatures and the second one - at high temperatures. The contribution of both mechanisms in the area of T ∼ 120 mK becomes equal

  2. La señal de vídeo

    OpenAIRE

    Armenteros, Manuel; Utray Delgado, Francisco

    2013-01-01

    En este artículo se presentan de forma divulgativa y sencilla, los fundamentos técnicos de la señal de vídeo, orientado a un lector sin formación tecnológica específica, cómo pueden ser los estudiantes de Periodismo o de Comunicación Audiovisual. Se abordan aspectos como la formación de la imagen en sensores digitales (CCD; CMOS) para la generación de una señal de video y la codificación de esta información para ser utilizada en sistemas de almacenamiento y edición. Se repasan las disti...

  3. ¿Qué se juega al jugar un juego?

    Directory of Open Access Journals (Sweden)

    Kalejman, Cecilia

    2012-06-01

    Full Text Available En el presente artículo se considera el juego en relación a la niñez. Se indaga acerca del papel que juega el juego en la niñez intentando responder a diversas preguntas, entre ellas la más importante: ¿Qué significa jugar? A lo largo de esta etapa del desarrollo en que comienza a constituirse la subjetividad del individuo el juego constituye, sin dudas, un factor central, una herramienta fundamental en el desarrollo. Juego no es sólo el juego dramático, también consideramos para nuestro análisis aquellas modalidades de juego que se transmiten de generación en generación, juegos de construcción, los dibujos, teniendo en cuenta asimismo los objetos utilizados en los juegos, los contenidos de los mismos, los espacios en los que se desarrollan. Se piensa y se interpreta al juego, como un derecho y como un modo de expresión del niño, se finaliza este desarrollo con una conclusión acera del juego y el espacio que ocupa en la vida cotidiana.

  4. procesadores digitales de señal (DSPs

    Directory of Open Access Journals (Sweden)

    Federico José Barrero García

    2005-01-01

    Full Text Available El presente trabajo describe una aplicación multimedia realizada en el Departamento de Ingeniería Electrónica de la Escuela Superior de Ingenieros de Sevilla. La herramienta, un CD interactivo, se ha desarrollado con vistas a su empleo como laboratorio virtual y sistema de ayuda en la impartición de un laboratorio de Procesadores Digitales de Señal (DSPs. El uso de este CD agiliza el proceso de aprendizaje y/o entrenamiento de los estudiantes en la asignatura, fomentando la participación de los alumnos en el mismo. El material didáctico se emplea en la actualidad, con gran éxito, en las clases prácticas de la asignatura «Complemento de Sistemas Electrónicos Digitales», de tercer curso de Ingeniero de Telecomunicación.

  5. Fabrication and Characterization of Al/p-CuInAlSe2 Thin Film Schottky Diodes

    Directory of Open Access Journals (Sweden)

    Usha Parihar

    2013-05-01

    Full Text Available Al/p-CuInAlSe2 polycrystalline schottky diodes fabricated by flash evaporation method were undertaken for their electrical analysis at room temperature. Diode parameters of the undertaken diodes were then derived from the current-voltage (I-V as well as capacitance-voltage (C-V characteristics. It has been observed that the schottky barrier height deduced from the room temperature I-V is lower to that obtained from the C-V characteristics and is attributed to the fact that I-V analysis includes both the image force and dipole lowering effects and is also reduced by the tunneling and leakage currents. The slope variation of the frequency dependent C – 2-V characteristics for the Al/p-CuInAlSe2 Schottky diode at varying frequency values from 50 kHz to 1 MHz suggests a large density of slow traps or interface states at the M-S junction. As emerging from the parameters values energy band diagram of Al and P-CuInAlSe2 has been reconstructed.

  6. Josephson effect in Al/Bi2Se3/Al coplanar hybrid devices

    International Nuclear Information System (INIS)

    Highlights: • Superconducting proximity effect induced in Al/Bi2Se3/Al coplanar hybrid devices. • Comparative study of Al/Bi2Se3 interfaces with various buffer layers. • Towards a Josephson super-current through the edge states of topological insulators. - Abstract: The edge states of Topological Insulators (TI) are protected against backscattering, thanks to the topological properties arising from their band structure. Coupling a TI to a superconductor (S) can induce unconventional effects, including the creation of Majorana bound states (MBS). The fabrication of coplanar hybrid devices is a fundamental step to pave the way to the understanding of proximity effects in topologically non-trivial systems, and to a large variety of experiments aimed at the possible detection of MBS. We discuss the feasibility and some relevant properties of Al–Bi2Se3–Al coplanar proximity devices. Special attention is devoted to the design of the junction, aimed at enhancing the coupling between the electrodes and the TI

  7. Al-Bentonit Üretimi ve 75Se Radyoizotopunun Al-Bentonitte Adsorpsiyonu

    OpenAIRE

    ORUÇOĞLU, Esra; HACIYAKUPOĞLU, Sevilay

    2015-01-01

    Bu çalışmada, Se(IV) anyonlarının, aluminyum-polioksi katyonları kullanılarak Reşadiye bentonitinden hazırlanan inorganik bentonite adsorpsiyonu konusunda araştırmalar gerçekleştirilmiştir. Adsorpsiyon deneylerinde 79Se ile benzer kimyasal özelliklere sahip ve daha kısa yarı ömürlü 75Se radyoizotopu kullanılmıştır. Bu izotop İTÜ TRIGA MARK II nükleer araştırma reaktöründe, nötron aktivasyonu yöntemiyle üretilmiştir. Kesikli adsorpsiyon yöntemi uygulanarak, modifiye bentonitin değişen süre ve ...

  8. Electrical properties of In2Se3 single crystals and photosensitivity of Al/In2Se3 Schottky barriers

    International Nuclear Information System (INIS)

    In2Se3 single crystals ∼40 mm long and 14 mm in diameter were grown by the Bridgman method. The composition of grown single crystals and their crystal structure were determined. The conductivity (σ) and Hall constant (R) of grown single crystals were measured and the first Schottky barriers Al/n-In2Se3 were fabricated. Rectification and photovoltaic effect were detected in the new structures. Based on the study of the photosensitivity spectra of Al/n-In2Se3 structures, the nature of the interband transitions and band gap of In2Se3 crystals were determined. It was concluded that the new structures can be applied to develop broadband photoconverters of optical radiation.

  9. Photoelectric phenomena in the Cu (Al, In)/p-CuIn3Se5 Schottky barriers

    International Nuclear Information System (INIS)

    Structures are formed on the p-CuIn3Se5 crystals and photoelectric phenomena in the Cu/p-CuIn3Se5, Al/p-CuIn3Se5, and In/p-CuIn3Se5 Schottky barriers are studied. The spectra of quantum efficiency for photoconversion in new structures were obtained for the first time. The characteristics of the interband transitions are discussed, and the CuIn3Se5 band gap is determined. It is concluded that CuIn3Se5 crystals can be used in the fabrication of high-efficiency broadband photoconverters of optical radiation

  10. Growth and properties of CuAlSe{sub 2} single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Bodnar, I.V. [Belarussian State Univ., Minsk (Belarus)

    1994-09-01

    The compound CuAlSe{sub 2} is one of the A{sup I}B{sup III}C{sup VI}{sub 2} ternary compounds that crystallize in the chalcopyrite structure (sp. gr. D{sup 12}{sub 2d} - I{bar 4}2m). Given that CuAlSe{sub 2} exhibits birefringence and an optical isotropy point (the intersection point of the dispersion curves for ordinary n{sub o} and extraordinary n{sub e} indices), it is considered as a promising material for producing electro-optic choppers and narrow-band visible/near-IR filters. Up to now, there have been no reports on growth of high-quality CuAlSe{sub 2} single crystals by the Bridgman technique. Therefore, the purpose of this work was to grow high-quality crystals of CuAlSe{sub 2} and to study their properties.

  11. Aproximación al silencio elocuente de los enunciados: lo que se comunica y no se dice

    OpenAIRE

    Moya Pardo, Constanza

    2012-01-01

    El estudio del silencio muestra otras posibilidades de interacción humana que se creían excluidas al callar. Esta dimensión lacónica del lenguaje posibilita una fenomenología de las formas de expresión que incorpora el mundo de lo implícito y supera el privilegio que ejerce la palabra verbal-explícita en nuestros procesos de comunicación. Muchos de los enunciados de la lengua ocultan otros que les dan sentido. Además de aparecer como privación verbal, como ausencia de habla o artificio de la ...

  12. Influence of temperature on Al/p-CuInAlSe2 thin-film Schottky diodes

    Science.gov (United States)

    Parihar, Usha; Ray, Jaymin; Panchal, C. J.; Padha, Naresh

    2016-06-01

    Al/p-CuInAlSe2 Schottky diodes were fabricated using the optimized thin layers of CuInAlSe2 semiconductor. These diodes were used to study their temperature-dependent current-voltage (I-V) and capacitance-voltage (C-V) analysis over a wide range of 233-353 K. Based on these measurements, diode parameters such as ideality factor ( η), barrier height (ϕbo) and series resistance ( R s) were determined from the downward curvature of I-V characteristics using Cheung and Cheung method. The extracted parameters were found to be strongly temperature dependent; ϕbo increases, while η and R s decrease with increasing temperature. This behavior of ϕbo and η with change in temperature has been explained on the basis of barrier inhomogeneities over the MS interface by assuming a Gaussian distribution (GD) of the ϕbo at the interface. GD of barrier height (BH) was confirmed from apparent BH (ϕap) versus q/2 kT plot, and the values of the mean BH and standard deviation (σs) obtained from this plot at zero bias were found to be 1.02 and 0.14 eV, respectively. Also, a modified ln ( {J_{{s}} /T2 } ) - q2 σ_{{s}}2 /2k2 T2 versus q/ kT plot for Al/p-CuInAlSe2 Schottky diodes according to the GD gives ϕbo and Richardson constant ( A ** ) as 1.01 eV and 26 Acm-2 K-2, respectively. The Richardson constant value of 26 Acm-2 K-2 is very close to the theoretical value of 30 Acm-2 K-2. The discrepancy between BHs obtained from I-V and C-V measurements has also been interpreted.

  13. Aproximación al silencio elocuente de los enunciados: lo que se comunica y no se dice

    Directory of Open Access Journals (Sweden)

    Constanza Moya Pardo

    2012-01-01

    Full Text Available El estudio del silencio muestra otras posibilidades de interacción humana que se creían excluidas al callar. Esta dimensión lacónica del lenguaje posibilita una fenomenología de las formas de expresión que incorpora el mundo de lo implícito y supera el privilegio que ejerce la palabra verbal-explícita en nuestros procesos de comunicación. Muchos de los enunciados de la lengua ocultan otros que les dan sentido. Además de aparecer como privación verbal, como ausencia de habla o artificio de la economía lingüística, el silencio es una manera de pensar y de comunicar. Es el saber compartido, el mundo implícito de los hablantes. Este juego de silencios, mediante el cual transmitimos pensamientos e intenciones sin necesidad de enunciarlos directamente, es posible gracias a habilidades cognitivas de conexión e inferencia, y al conjunto de supuestos compartidos por los miembros que pertenecen a una misma comunidad pragmática y que dominan las reglas de esa gramática del silencio.

  14. Al andar se hace turismo: nuevas ruralidades en torno al Camino de Santiago

    Directory of Open Access Journals (Sweden)

    Carlos Montes Pérez

    2015-04-01

    Full Text Available Nuestro trabajo analiza las nuevas formas turísticas que han surgido en la comarca leonesa del Bierzo, en la provincia de León, y su relación con el Camino de Santiago. Desde la Edad Media el Camino de Santiago ha sido un lugar de tránsito y de peregrinación con un claro y principal sentido religioso. Sin embargo, desde los años noventa del pasado siglo, ha aumentado enormemente su conocimiento y difusión por otros países del mundo, con el consiguiente incremento de peregrinos y visitantes. Esta masiva presencia ha resignificado al propio camino y lo ha convertido en un fenómeno turístico decisivo para la vida de los lugares por donde transita. A través del análisis de una empresa turística proponemos la relación entre nuevos sentidos del camino y nuevas formas de turismo.

  15. Nanostructured Al-ZnO/CdSe/Cu2O ETA solar cells on Al-ZnO film/quartz glass templates

    OpenAIRE

    Wang, Xianghu; Li, Rongbin; Fan, Donghua

    2011-01-01

    The quartz/Al-ZnO film/nanostructured Al-ZnO/CdSe/Cu2O extremely thin absorber solar cell has been successfully realized. The Al-doped ZnO one-dimensional nanostructures on quartz templates covered by a sputtering Al-doped ZnO film was used as the n-type electrode. A 19- to 35-nm-thin layer of CdSe absorber was deposited by radio frequency magnetron sputtering, coating the ZnO nanostructures. The voids between the Al-ZnO/CdSe nanostructures were filled with p-type Cu2O, and therefore, the ent...

  16. Properties of Cu(In,Ga,Al)Se{sub 2} thin films fabricated by magnetron sputtering

    Energy Technology Data Exchange (ETDEWEB)

    Hameed, Talaat A. [Applied Research Center, Old Dominion University, Newport News, Virginia 23606 and Solid State Physics Laboratory, Physics Division, National Research Center, Dokki, Giza 12622 (Egypt); Cao, Wei [Applied Research Center, Old Dominion University, Newport News, Virginia 23606 (United States); Mansour, Bahiga A.; Elzawaway, Inas K. [Solid State Physics Laboratory, Physics Division, National Research Center, Dokki, Giza 12622 (Egypt); Abdelrazek, El-Metwally M. [Department of Physics, College of Science, Mansoura University, Mansoura, Dakhlia 35516 (Egypt); Elsayed-Ali, Hani E., E-mail: helsayed@odu.edu [Applied Research Center, Old Dominion University, Newport News, Virginia 23606 and Department of Electrical and Computer Engineering, Old Dominion University, Norfolk, Virginia 23529 (United States)

    2015-05-15

    Cu(In,Ga,Al)Se{sub 2} (CIGAS) thin films were studied as an alternative absorber layer material to Cu(In{sub x}Ga{sub 1−x})Se{sub 2}. CIGAS thin films with varying Al content were prepared by magnetron sputtering on Si(100) and soda-lime glass substrates at 350 °C, followed by postdeposition annealing at 520 °C for 5 h in vacuum. The film composition was measured by an electron probe microanalyzer while the elemental depth profiles were determined by secondary ion mass spectrometry. X-ray diffraction studies indicated that CIGAS films are single phase with chalcopyrite structure and that the (112) peak clearly shifts to higher 2θ values with increasing Al content. Scanning electron microscopy images revealed dense and well-defined grains, as well as sharp CIGAS/Si(100) interfaces for all films. Atomic force microscopy analysis indicated that the roughness of CIGAS films decreases with increasing Al content. The bandgap of CIGAS films was determined from the optical transmittance and reflectance spectra and was found to increase as Al content increased.

  17. Luxómetro medidor de enfoque para señal alta de lámpara de ferrocarril

    OpenAIRE

    Rodríguez García, Carlos

    2007-01-01

    Ante la complejidad para la correcta instalación y verificación de las Señales Altas de Lámpara para Ferrocarril. Nace un proyecto cuyo objetivo es medir la Iluminancia de los focos de las Señales Altas y calcular el enfoque correcto de la señal. Para ello se estudio el mejor sistema para determinar la verificación de un foco de Señal Alta. Se ha logrado diseñar y construir un Luxómetro capaz de medir el enfoque de la señal. Para llevar a cabo este fin, se ha diseña...

  18. Modelos contemporáneos de asistencia al parto: Cuerpos respetados, mujeres que se potencian

    Directory of Open Access Journals (Sweden)

    Natalia Magnone Alemán

    2013-08-01

    Full Text Available El artículo presentado estudia los modelos de atención contemporáneos al parto en Uruguay. Se nutre teóricamente de teoríassociológicassobre el riesgo, el cuerpo y la medicalización de la sociedad, de los modelos de atención a la salud humana definidos por la antropóloga David Floyd, y de perspectivas feministas sobre la sexualidad. Para su elaboración se toman entrevistas en profundidad y grupos de discusión realizados en el marco de la tesis de maestría en sociología de la autora. Sobre esta base se reflexiona en torno a las siguientes preguntas: ¿Qué concepciones de individuo y de cuerpo tienen los distintos modelos de atención al parto? ¿Qué prácticas obstétricasse establecen como consecuencia de estas concepciones? ¿Qué efectos tiene cada modo de atención sobre el respeto o no de los derechos humanos de las mujeres que paren?

  19. H2Se DOPING OF MOCVD GROWN GaAs AND GaAlAs

    OpenAIRE

    Glew, R.

    1982-01-01

    In the growth of epitaxial layers of GaAs and GaAlAs by the MOCVD process a superlinear relationship between the n-type doping and the H2Se mole fraction in the gas phase has been found. This superlinear effect has been observed both with atmospheric and reduced pressure depositions. The anomalous doping effect is compared to H2S doping where a linear doping relationship has been observed. The dopant incorporation mechanism for sulphur and selenium are different and the possible growth mechan...

  20. Growth and morphology of the CuGaS2, CuAlSe2, CuGaSe2, and CuInS2 ternary compounds

    International Nuclear Information System (INIS)

    Monocrystals of the ternary compounds CuGaS2, CuAlSe2, CuGaSe2, and CuInS2 were grown from their elements by transport reactions; their cell parameters and melting temperature were determined. The character of the phase transition in these compounds was found out and also the boundary conditions of growing the monocrystals as well as their dislocation structure (by etching). (author)

  1. Investigating the electronic properties of Al2O3/Cu(In,GaSe2 interface

    Directory of Open Access Journals (Sweden)

    R. Kotipalli

    2015-10-01

    Full Text Available Atomic layer deposited (ALD Al2O3 films on Cu(In,GaSe2 (CIGS surfaces have been demonstrated to exhibit excellent surface passivation properties, which is advantageous in reducing recombination losses at the rear metal contact of CIGS thin-film solar cells. Here, we report, for the first time, experimentally extracted electronic parameters, i.e. fixed charge density (Qf and interface-trap charge density (Dit, for as-deposited (AD and post-deposition annealed (PDA ALD Al2O3 films on CIGS surfaces using capacitance–voltage (C-V and conductance-frequency (G-f measurements. These results indicate that the AD films exhibit positive fixed charges Qf (approximately 1012 cm−2, whereas the PDA films exhibit a very high density of negative fixed charges Qf (approximately 1013 cm−2. The extracted Dit values, which reflect the extent of chemical passivation, were found to be in a similar range of order (approximately 1012 cm−2 eV−1 for both AD and PDA samples. The high density of negative Qf in the bulk of the PDA Al2O3 film exerts a strong Coulomb repulsive force on the underlying CIGS minority carriers (ns, preventing them to recombine at the CIGS/Al2O3 interface. Using experimentally extracted Qf and Dit values, SCAPS simulation results showed that the surface concentration of minority carriers (ns in the PDA films was approximately eight-orders of magnitude lower than in the AD films. The electrical characterization and estimations presented in this letter construct a comprehensive picture of the interfacial physics involved at the Al2O3/CIGS interface.

  2. Nanostructured Al-ZnO/CdSe/Cu2O ETA solar cells on Al-ZnO film/quartz glass templates

    Science.gov (United States)

    Wang, Xianghu; Li, Rongbin; Fan, Donghua

    2011-12-01

    The quartz/Al-ZnO film/nanostructured Al-ZnO/CdSe/Cu2O extremely thin absorber solar cell has been successfully realized. The Al-doped ZnO one-dimensional nanostructures on quartz templates covered by a sputtering Al-doped ZnO film was used as the n-type electrode. A 19- to 35-nm-thin layer of CdSe absorber was deposited by radio frequency magnetron sputtering, coating the ZnO nanostructures. The voids between the Al-ZnO/CdSe nanostructures were filled with p-type Cu2O, and therefore, the entire assembly formed a p-i-n junction. The cell shows the energy conversion efficiency as high as 3.16%, which is an interesting option for developing new solar cell devices. PACS: 88.40.jp; 73.40.Lq; 73.50.Pz.

  3. Effect of composition gradient in Cu(In,Al)Se{sub 2} solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Hayashi, Takao; Minemoto, Takashi; Tanaka, Kiyoteru; Yamada, Satoshi; Araki, Tsutomu; Takakura, Hideyuki [College of Science and Engineering, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu, Shiga 525-8577 (Japan); Zoppi, Guillaume; Forbes, Ian [Northumbria Photovoltaics Applications Centre, Northumbria University, Ellison Building, Newcastle upon Tyne NE1 8ST (United Kingdom)

    2009-06-15

    Cu(In,Al)Se{sub 2} (CIAS) thin films were prepared by a three-stage evaporation process. In this experiment, the composition ratio of Cu/(In+Al) at the end of the second stage (Cu/III{sub 2nd}) was changed from 1.1 to 1.7. The CIAS films showed an Al distribution with a V-shape profile. The valley depth of the V-shape from the surface increased with increasing the Cu/III{sub 2nd} ratio. The valleys of the V-shape for the films with the Cu/III{sub 2nd} ratio of 1.1-1.7 were located at approximately 0.3-1.0 {mu}m from the film surface, respectively. The rms surface roughness increased from 40 nm for Cu/III{sub 2nd}=1.1 to 90 nm at Cu/III{sub 2nd}=1.3 and then saturated for greater Cu/III{sub 2nd} ratios. Solar cells with the Al/ITO/ZnO/CdS/CIAS/Mo/soda-lime glass structure were fabricated. The fill factor was seen to decrease while the product of short-circuit current and open-circuit voltage remained constant. The reverse saturation current increased when the Cu/III{sub 2nd} ratio is greater than 1.3 which is a behavior of the surface roughness. Cu/III{sub 2nd} ratios greater than 1.3 lead to the distant position of V-shape from the surface and the increase in surface roughness. (author)

  4. Excitonic spectra and energy band structure of ZnAl2Se4 crystals

    Science.gov (United States)

    Syrbu, N. N.; Zalamai, V. V.; Tiron, A. V.; Tiginyanu, I. M.

    2015-11-01

    Absorption, reflection and wavelength modulated reflection spectra were investigated in ZnAl2Se4 crystals. The energy positions of ground and excited states for three excitonic series (A, B and C) were determined. The main parameters of excitons and more precise values of energy intervals V1(Γ7)-C1(Γ6), V2(Γ6)-C1(Γ6), and V3(Γ7)-C1(Γ6) were estimated. Values of splitting due to crystal field and spin-orbital interaction were calculated. Effective masses of electrons (mC1∗) and holes (mV1∗, mV2∗, mV3∗) were estimated. Reflection spectra contours in excitonic region were calculated using dispersion equations. Optical functions for E > Eg from measured reflection spectra were assigned on the base of Kramers-Kronig relations.

  5. El movimiento de comida lenta se opone al de comida rápida

    Directory of Open Access Journals (Sweden)

    Agustín Morales Espinoza

    2013-09-01

    Full Text Available En 1986 Carlo Petrini fundó el movimiento Slow Food. Desde entonces, como presidente de la agrupación, ha demostrado ser un auténtico líder en el tema de la cultura gastronómica. En 1989 en una reunión celebrada en París, Slow Food adoptó como emblema al caracol y se convirtió en un movimiento internacional. La Slow Food o comida lenta surgió en oposición a la fast food (comida rápida y busca promover la educación del gusto, además pretende redescubrir los aromas y sabores de las cocinas regionales, pues considera que la alimentación es producto de la historia y de las tradiciones de los pueblos.

  6. Structural, morphological and optical studies on CuAlS{sub 2} and CuAlSe{sub 2} nanorods prepared by hydrothermal method

    Energy Technology Data Exchange (ETDEWEB)

    Sugan, S.; Baskar, K.; Dhanasekaran, R., E-mail: rdcgc@yahoo.com

    2015-10-05

    Highlights: • CuAlS{sub 2} and CuAlSe{sub 2} nanorods were synthesized by hydrothermal method. • Reaction time enhances the quality of the nanoparticles. • The influence of reaction time was discussed in detail. • Optical properties of nanorods have been studied using PL and Raman spectra. • The reduction in the size of the nanorods enhances the optical band gap. - Abstract: Ternary chalcopyrite CuAlS{sub 2} and CuAlSe{sub 2} nanorods have been successfully synthesized through hydrothermal method at 180 °C and their structure of prepared samples was investigated by X-ray diffraction pattern (XRD), scanning electron microscopy (SEM) and high resolution transmission electron microscopy (HR-TEM). The structural, optical and morphology of the samples are found to depend on synthesizing time and temperature. HR-TEM analysis indicates that the rods like morphology were nearly homogeneous with average dimensions of about 273 nm, 124 nm in length and 24 nm, 21 nm in diameter for CuAlS{sub 2} and CuAlSe{sub 2} respectively. Vibrational modes of CuAlS{sub 2} and CuAlSe{sub 2} nanorods have been investigated by recording micro Raman spectra at room temperature. Optical properties of the synthesized samples were studied using photoluminescence (PL) spectra with excitation of 244 nm at room temperature. The PL spectra show two emission peaks for CuAlS{sub 2} at 307 nm (4.03 eV) and 359 nm (3.45 eV). CuAlSe{sub 2} gives a prominent emission peak at 436 nm (2.84 eV)

  7. Generalized stacking fault energies, cleavage energies, ionicity and brittleness of Cu(Al/Ga/In)Se2 and CuGa(S/Se/Te)2

    International Nuclear Information System (INIS)

    We calculate the generalized stacking fault (GSF) energies and cleavage energies γcl of the chalcopyrite compounds CuAlSe2, CuGaSe2, CuInSe2, CuGaS2 and CuGaTe2 using first principles. From the GSF energies, we obtain the unstable stacking fault energies γus and intrinsic stacking fault energies γisf. By analyzing γus and γisf, we find that the 〈 1-bar 1 0〉 (1 1 2) direction is the easiest slip direction for these five compounds. Also, for CuInSe2, it is most possible to undergo a dislocation-nucleation-induced plastic deformation along the 〈 1-bar 1 0〉 (1 1 2) slip direction. We show that the (1 1 2) plane is the preferable plane for fracture in the five compounds by comparing γcl of the (0 0 1) and (1 1 2) planes. It is also found that both γus and γcl decrease as the cationic or anionic radius increases in these chalcopyrites, i.e. along the sequences CuAlSe2 → CuGaSe2 → CuInSe2 and CuGaS2 → CuGaSe2 → CuGaTe2. Based on the values of the ratio γcl/γus, we discuss the brittle–ductile properties of these compounds. All of the compounds can be considered as brittle materials. In addition, a strong relationship between γcl/γus and the total proportion of ionic bonding in these compounds is found. (paper)

  8. Estudio comparativo de algoritmos para la segmentación de la señal del electrocardiograma

    OpenAIRE

    Beraza Azurmendi, Idoia

    2012-01-01

    Evaluar los diferentes métodos de segmentación de las señales de electrocardiograma (ECG) que permitan la detección automática de los diferentes puntos característicos que conforman la señal. En la actualidad se han desarrollado diversos métodos de segmentación automática de la señal de ECG. En este trabajo se pretende estudiar, evaluar y comparar los diferentes métodos de segmentación existentes en la literatura. Esto permitirá la comprensión de los usos y limitaciones de las técnicas existe...

  9. Structure, tribological and electrochemical properties of low friction TiAlSiCN/MoSeC coatings

    Energy Technology Data Exchange (ETDEWEB)

    Bondarev, A.V.; Kiryukhantsev-Korneev, Ph.V.; Sheveyko, A.N.; Shtansky, D.V., E-mail: shtansky@shs.misis.ru

    2015-02-01

    Highlights: • TiAlSiCN/MoSeC coatings for tribological applications. • Doping with MoSeC reduces friction coefficient in humid air from 0.8–0.9 to 0.05. • Doping with MoSeC increases wear resistance by one-two orders of magnitude. • TiAlSiCN/MoSeC coatings demonstrated low friction coefficient in distilled water. • TiAlSiCN/MoSeC coatings showed superior tribological properties at moderate temperatures. - Abstract: The present paper is focused on the development of hard tribological coatings with low friction coefficient (CoF) in different environments (humid air, distilled water) and at elevated temperatures. TiAlSiCN/MoSeC coatings were deposited by magnetron sputtering of four-segment targets consisting of quarter circle TiAlSiCN segments, obtained by self-propagating high-temperature synthesis, and one or two cold pressed segments made of MoSe{sub 2} and C powders in a ratio 1:1 wt%. The structure and phase composition of coatings were investigated by means of X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy, and Raman spectroscopy. The coatings were characterized in terms of their hardness, elastic modulus, and elastic recovery. The tribological properties of coatings were investigated first at room temperature against Al{sub 2}O{sub 3} and WC–Co balls, after which studied in distilled water and during continuous heating in air in the temperature range of 25–400 °C against Al{sub 2}O{sub 3} counterpart material. To evaluate their electrochemical characteristics, the coatings were tested in 1 N H{sub 2}SO{sub 4} solution. The obtained results show that the coating hardness depends on the amount of MoSeC additives and decreased from 40 to 28 (one MoSeC segment) and 12 GPa (two MoSeC segments). Doping with MoSeC resulted in a significant reduction of CoF values measured in humid air (RH 60 ± 5%) from 0.8–0.9 to 0.05 and an increase of wear resistance by one or two orders of magnitude depending on

  10. Junction parameters and characterization of Au/n-Ge15In5Se80/p-Si/Al heterojunction

    Science.gov (United States)

    El-Nahass, M. M.; Ali, M. H.; El-Shazly, E. A. A.; Zedan, I. T.

    2016-08-01

    The analysis of the electrical properties of Au/n-Ge15In5Se80/p-Si/Al heterojunction is examined. I- V characteristics show diode-like behavior. The series resistance is found to decrease with increasing the temperature in three different methods of calculations. The thermionic emission mechanism is found to be the operating mechanism at relatively low forward voltages ( V limited conduction is the operating mechanism. The rectification ratio, ideality factor, barrier height, total trap concentration and built-in voltage are determined. The capacitance-voltage ( C- V) characteristics of Au/n-Ge15In5Se80/p-Si/Al heterojunction are also investigated. The I- V curve of the Au/n-Ge15In5Se80/p-Si/Al heterojunction in the dark and after illumination is clarified.

  11. Molecular beam epitaxy and characterization of thin Bi2Se3 films on Al2O3 (110)

    Science.gov (United States)

    Tabor, Phillip; Keenan, Cameron; Urazhdin, Sergei; Lederman, David

    2011-07-01

    The structural and electronic properties of thin Bi2Se3 films grown on Al2O3 (110) by molecular beam epitaxy are investigated. The epitaxial films grow in the Frank-van der Merwe mode and are c-axis oriented. They exhibit the highest crystallinity, the lowest carrier concentration, and optimal stoichiometry at a substrate temperature of 200 °C determined by the balance between surface kinetics and desorption of Se. The crystallinity of the films improves with increasing Se/Bi flux ratio. Our results enable studies of thin topological insulator films on inert, non-conducting substrates that allow optical access to both film surfaces.

  12. APROXIMACIÓN AL SILENCIO ELOCUENTE DE LOS ENUNCIADOS: LO QUE SE COMUNICA Y NO SE DICE: WHAT IS COMMUNICATED BUT NOT SAID

    OpenAIRE

    Constanza Moya Pardo

    2012-01-01

    El estudio del silencio muestra otras posibilidades de interacción humana que se creían excluidas al callar. Esta dimensión lacónica del lenguaje posibilita una fenomenología de las formas de expresión que incorpora el mundo de lo implícito y supera el privilegio que ejerce la palabra verbal-explícita en nuestros procesos de comunicación. Muchos de los enunciados de la lengua ocultan otros que les dan sentido. Además de aparecer como privación verbal, como ausencia de habla o artificio de la ...

  13. Sexualidad, afectividad y síndrome de Down: (I) Se hace camino al andar

    OpenAIRE

    García, José Luis

    2005-01-01

    Se presentan algunas de las preocupaciones con las que suelen encontrarse las familias y los profesionales en torno a la educación de la sexualidad y afectividad de las personas con síndrome de Down.

  14. APROXIMACIÓN AL SILENCIO ELOCUENTE DE LOS ENUNCIADOS: LO QUE SE COMUNICA Y NO SE DICE: WHAT IS COMMUNICATED BUT NOT SAID

    Directory of Open Access Journals (Sweden)

    Constanza Moya Pardo

    2012-06-01

    Full Text Available El estudio del silencio muestra otras posibilidades de interacción humana que se creían excluidas al callar. Esta dimensión lacónica del lenguaje posibilita una fenomenología de las formas de expresión que incorpora el mundo de lo implícito y supera el privilegio que ejerce la palabra verbal-explícita en nuestros procesos de comunicación. Muchos de los enunciados de la lengua ocultan otros que les dan sentido. Además de aparecer como privación verbal, como ausencia de habla o artificio de la economía lingüística, el silencio es una manera de pensar y de comunicar. Es el saber compartido, el mundo implícito de los hablantes. Este juego de silencios, mediante el cual transmitimos pensamientos e intenciones sin necesidad de enunciarlos directamente, es posible gracias a habilidades cognitivas de conexión e inferencia, y al conjunto de supuestos compartidos por los miembros que pertenecen a una misma comunidad pragmática y que dominan las reglas de esa gramática del silencio.

  15. Técnicas de bajo coste computacional para el reconocimiento de patrones de activación en la señal de EMG superficial

    OpenAIRE

    Roca González, Joaquín Francisco; Jiménez Martínez, Jacinto María; Conesa, M.; Roca Dorda, Joaquín; Vera Repullo, José Alfonso; Jiménez Buendía, Manuel

    2001-01-01

    Se presenta un sistema dedicado al reconocimiento de patrones de actividad, en la señal del EMG superficial, destinado a proporcionar un nuevo canal de comunicación capaz de comandar prótesis y ayudas técnicas para el acceso al ordenador. El motor de reconocimiento utilizado, ha sido derivado de un algoritmo ampliamente experimentado en el campo del habla, basandose en la detección de formantes, adaptándolo a la naturaleza de la señal de EMGS y a las características del microcontrolador respo...

  16. Novedades acerca del mecanismo de reconocimiento y transducción de la señal brasinoesteroide

    Directory of Open Access Journals (Sweden)

    Danahe Mariela Coll García

    2006-01-01

    Full Text Available Los péptidos señal de bajo peso y las hormonas esteroides constituyen el grupo de moléculas que median la comunicación célula-célula y que controlan, tanto en plantas como en animales, diversos procesos relacionados con el crecimiento. En las plantas, las hormonas esteroides están representados por los llamados brasinoesteroides (BR que se derivan de los esteroles polihidroxilados y aparecen en muy bajas concentraciones dentro de los individuos a todo lo largo del reino vegetal. Los fenotipos característicos de los mutantes de biosíntesis e insensibles de brasinoesteroides han confirmado que estas fitohormonas son esenciales para el normal alargamiento de la célula, así como sugieren un importante papel en la formación de tejido vascular, control de la senescencia, la fertilidad y la morfología de la hoja. Actualmente, las principales investigaciones en el campo de los BR están dirigidas a estudios del mecanismo de reconocimiento y transducción de su señal dentro de la célula. Los últimos tres años han sido decisivos para la dilucidación de este mecanismo demostrando que está muy conservado dentro de las plantas y difiere ampliamente de la cascada de señalización de esteroides en los animales. Estudios genéticos recientes han permitido identificar algunos de los componentes moleculares ubicados en la cascada de señalizaci ón de BR. Sobre esta base, se trabaja en el modelo de cascada de señalización que propone una activación del complejo receptor compuesto por dos proteínas kinasas de membrana y que mediante su heterodimerización, inhiben una tercera kinasa citoplasmática del tipo GSK3, permitiendo la acumulación en el núcleo de dos proteínas independientes que están relacionadas directa o indirectamente con la activación de la expresión de genes de respuesta a brasinoesteroides. Otro aspecto importante que centra la atención de los investigadores de este mecanismo es el hecho de la función dual que tiene

  17. La sobreexpresión de RAC3 es una señal transformante y proliferativa que contribuye al desarrollo tumoral

    Directory of Open Access Journals (Sweden)

    Cecilia V. Alvarado

    2011-02-01

    Full Text Available RAC3 fue caracterizado originalmente como un coactivador de receptores nucleares que se encuentra en cantidades limitantes en células normales, aunque sobreexpresado en tumores y es además coactivador de NF-?B. Si bien se desconocen los mecanismos involucrados en el aumento de su expresión, se sabe que induce resistencia a apoptosis. En este trabajo se investigó si RAC3 podría contribuir al desarrollo tumoral por otros mecanismos y si la citoquina TNF-a, que se encuentra en alto título en pacientes con cáncer, podría favorecer el aumento en la expresión de RAC3. Se observó que el aumento en la expresión del coactivador por transfección de células no tumorales de riñón embrionario humano HEK293 no solo aumenta significativamente la proliferación en presencia de suero, sino además en ausencia de factores de crecimiento. También se indujo la transformación celular dando un fenotipo con crecimiento independiente de anclaje similar a lo observado para células tumorales. El tratamiento de las células HEK293 en cultivo con TNF-a indujo un aumento en los niveles proteicos de RAC3 respecto de las células sin estímulo y este efecto fue inhibido por pretratamiento con un inhibidor específico de la activación de NF-?B, indicando que la activación de este factor de transcripción está involucrada en la acción de la citoquina. Se concluye que RAC3, además de su acción anti-apoptótica, es un factor transformante que promueve la proliferación y el crecimiento independiente de anclaje, cuyos niveles podrían ser aumentados en la tumorigénesis, probablemente vía las citoquinas inflamatorias involucradas en la respuesta anti-tumoral.

  18. El camino se hace al andar: La trayectoria de las multinacionales brasileñas

    Directory of Open Access Journals (Sweden)

    Afonso Fleury

    2010-01-01

    Full Text Available Este artículo analiza las ventajas de las multinacionales de países emergentes. Examina el proceso de internacionalización de 12 multinacionales brasileñas en base a una contextualización histórica e identifica las ventajas y desventajas comparativas del país. Destaca que lo que se distingue en la internacionalización de las empresas brasileñas -y que caracteriza su forma propia de "caminar"- es el modelo de gestión que llevan a cabo, fundamentado en una combinación original de competencias organizacionales y estilo de gestión.

  19. Crystal structure of the quaternary compounds CuFe2AlSe4 and CuFe2GaSe4 from X-ray powder diffraction

    Indian Academy of Sciences (India)

    G E Delgado; A J Mora; P Grima-Gallardo; M Muñoz; S Durán; M Quintero; J M Briceño

    2015-08-01

    The crystal structure of the quaternary compounds CuFe2AlSe4 and CuFe2GaSe4, belonging to the system I–II2–III–VI4, were characterized using X-ray powder diffraction data. Both compounds crystallize in the tetragonal space group I42m (No. 121), = 2, with unit cell parameters = 5.609(1) Å, = 10.963(2) Å for CuFe2AlSe4 and = 5.6165(3) Å, = 11.075(1) Å for CuFe2GaSe4. These compounds are isostructural with CuFe2InSe4, and have a normal adamantane stannite structure.

  20. Physical Design and Dynamical Analysis of Resonant-Antiresonant Ag/MgO/GaSe/Al Optoelectronic Microwave Devices

    Science.gov (United States)

    Kmail, Renal R. N.; Qasrawi, A. F.

    2015-11-01

    In this work, the design and optical and electrical properties of MgO/GaSe heterojunction devices are reported and discussed. The device was designed using 0.4- μm-thick n-type GaSe as substrate for a 1.6- μm-thick p-type MgO optoelectronic window. The device was characterized by means of ultraviolet-visible optical spectrophotometry in the wavelength region from 200 nm to 1100 nm, current-voltage ( I- V) characteristics, impedance spectroscopy in the range from 1.0 MHz to 1.8 GHz, and microwave amplitude spectroscopy in the frequency range from 1.0 MHz to 3.0 GHz. Optical analysis of the MgO/GaSe heterojunction revealed enhanced absorbing ability of the GaSe below 2.90 eV with an energy bandgap shift from 2.10 eV for the GaSe substrate to 1.90 eV for the heterojunction design. On the other hand, analysis of I- V characteristics revealed a tunneling-type device conducting current by electric field-assisted tunneling of charged particles through a barrier with height of 0.81 eV and depletion region width of 670 nm and 116 nm when forward and reverse biased, respectively. Very interesting features of the device are observed when subjected to alternating current (ac) signal analysis. In particular, the device exhibited resonance-antiresonance behavior and negative capacitance characteristics near 1.0 GHz. The device quality factor was ˜102. In addition, when a small ac signal of Bluetooth amplitude (0.0 dBm) was imposed between the device terminals, the power spectra of the device displayed tunable band-stop filter characteristics with maximum notch frequency of 1.6 GHz. The energy bandgap discontinuity, the resonance-antiresonance behavior, the negative capacitance features, and the tunability of the electromagnetic power spectra at microwave frequencies nominate the Ag/MgO/GaSe/Al device as a promising optoelectronic device for use in multipurpose operations at microwave frequencies.

  1. Comentarios al dossier“¿Cómo se piensa lo ‘queer’ en América Latina”?

    Directory of Open Access Journals (Sweden)

    Edgar Vega Suriaga

    2011-05-01

    Full Text Available A partir del dossier de Íconos, 39, ¿Cómo se piensa lo ‘queer’ en América Latina?, este artículo trabajasobre los puntos centrales y las interrogantes que dan de sí cada uno de los artículos que locomponen. Destaca la crítica a la masculinidad hegemónica desde una noción de la alteridad enla que convergen las categorías de clase, etnia, género y edad. A medida que reflexiona sobre estospuntos, repasa cada uno de los artículos contextualizándolos en la crítica radical al sistema heteronormativo.

  2. Caracterización de una señal ECG mediante un análisis automático

    OpenAIRE

    Sáenz de Pipaón Cilveti, Edurne

    2012-01-01

    En el mundo las enfermedades cardiovasculares causan 17,5 millones de muertes al año. En España representan la primera causa de mortalidad, provocando al año 122.000 defunciones. Por tanto, se observa la importancia de avanzar en los conocimientos acerca del análisis del ECG, debido a que las alteraciones en el funcionamiento del corazón se reflejan en modificaciones del mismo. El objetivo de este trabajo es diseñar una aplicación que realice un análisis temporal de una seña...

  3. Mejora de la Señal de Flujo Sanguíneo en Implantes Coronarios Mediante la Detección de Distorsiones Eventuales

    OpenAIRE

    D. Torres Guzmán; C.S. Carbajal Fernández

    2015-01-01

    Se presenta un método para el procesamiento de señales en aplicaciones médicas que utilizan técnicas de diagnóstico basadas en ultrasonido Doppler. El método está orientado a obtener una mejor representación de la señal de flujo sanguíneo, a partir de la identificación y exclusión de los ciclos, de dicha señal, que se encuentran afectados por distorsiones eventuales. Esto permite, de manera robusta y confiable, estimar parámetros y extraer información clínicamente útil con el objetivo de form...

  4. Modelado teórico y experimental de la transmisión de una señal FSK utilizando la técnica de modulación de coherencia luminosa

    OpenAIRE

    Morales Hernández, Omar Emmanuel

    2007-01-01

    En este trabajo se presentan las pruebas y resultados experimentales de dos arreglos propuestos, un interferómetro de polarización y otro de Michelson, basados en la modulación de coherencia luminosa, la cual utiliza a su vez una señal de prueba FSK. Se transmite una señal digital utilizando como portadora un haz de luz de baja coherencia, debido a que con este tipo de modulación se pueden transmitir señales de alta frecuencia y con muy pocas pérdidas de señal. Además, se...

  5. Structural, electronic and optical properties of AgXY{sub 2}(X = Al, Ga, In and Y = S, Se, Te)

    Energy Technology Data Exchange (ETDEWEB)

    Ullah, Saeed; Din, Haleem Ud [Materials Modeling Lab, Department of Physics, Islamia College University, Peshawar (Pakistan); Murtaza, G., E-mail: murtaza@icp.edu.pk [Materials Modeling Lab, Department of Physics, Islamia College University, Peshawar (Pakistan); Ouahrani, T. [Laboratoire de Physique Théorique, B.P. 119, Université de Tlemcen, Tlemcen 13000 (Algeria); Khenata, R., E-mail: khenata_rabah@yahoo.fr [Laboratoire de Physique Quantique et de Modélisation Mathématique, Université de Mascara, Mascara 29000 (Algeria); Naeemullah [Department of Physics, G.D.C. Darra Adam Khel, F.R. Kohat, KPK (Pakistan); Bin Omran, S. [Department of Physics and Astronomy, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451 (Saudi Arabia)

    2014-12-25

    Highlights: • The compounds are studied by FP-LAPW method within mBJ approximation. • All of the studied materials show isotropic behavior. • All the compounds show direct band gap nature. • Bonding nature is mostly covalent among the studied compounds. • High absorption peaks and reflectivity ensures there utility in optoelectronic devices. - Abstract: The structural, electronic and optical properties of the ternary semiconducting compounds AgXY{sub 2} (X = Al, Ga, In and Y = S, Se, Te) in Heusler and chalcopyrite crystal phases have been investigated using the density functional theory (DFT) based on the full potential linear augmented plane wave (FP-LAPW) method. The calculated lattice constant and band gap values for AgXY{sub 2} in chalcopyrite phase are in good agreement with the available experimental data. Band structure calculations are performed using modified Becke–Johnson (mBJ) method which match closely with experimental data and yield better band gaps rather than those obtained by using generalized gradient approximation (GGA) and Engel–Vosko generalized gradient approximation (EV–GGA). Decrease in band gap is observed by changing cations X and Y from the top to bottom of periodic table. Chemical bonding trends are predicted through charge density plots and quantified by Bader’s analysis. Optical properties reveal that these compounds are suitable candidates for optoelectronic devices in the visible and ultraviolet (UV) regions.

  6. Memoria explicativa del tipo de buque y servicio al que se destina : Proyecto número: 1.696 / LPG 7.000 m3

    OpenAIRE

    Millón del Valle, Raimundo; Pérez González, Rosa María

    2010-01-01

    Los buques LPG son los buques destinados al transporte de gases del petróleo licuado, tal y como indican sus siglas, pero además pueden llevar otro tipo de gases cuyas características son similares a las del anterior tipo de buque, en concreto todos los gases que se contemplan como IMO tipo C, que nos indica que el gas se transporta en recipientes convencionales a presión.

  7. Influence of substrate temperature on structural, electrical and optical properties of flash evaporated CuIn0.60Al0.40Se2 thin films

    International Nuclear Information System (INIS)

    CuIn0.60Al0.40Se2 thin films were grown by the flash evaporation method onto glass substrates held at temperatures in the range 303-623 K. The influence of substrate temperature on growth of the films was studied. The growth of the highly (111) oriented CuIn0.60Al0.40Se2 thin films was observed at TS=598 K exhibiting sphalerite structure. The surface morphology of CuIn0.60Al0.40Se2 films deposited at TS=623 K indicates segregation of Cu2-xSe binary phase. The electrical resistivity was around 66 Ωcm (300 nm) with p-type conductivity for the films deposited at 598 K. The temperature dependence of the electrical conductivity suggested that above 493 K the conduction mechanism was intrinsic, whereas extrinsic/impurity conduction dominated in the range 303-473 K. The single phase CuIn0.60Al0.40Se2 films showed an optical bandgap of 1.37 eV. (copyright 2009 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  8. Alótropos del carbono: experimentos de laboratorio que se hacen famosos años después

    Directory of Open Access Journals (Sweden)

    F. Rodríguez Reinoso

    2011-03-01

    Full Text Available Es destacable que el “descubrimiento” de los tres últimos alótropos del elemento carbono se haya producido en un intervalo de pocos años: fullerenos en 1985, nanotubos en 1991 y grafeno en 2004.

  9. Fabrication of Al/MgO/C and C/MgO/InSe/C tunneling barriers for tunable negative resistance and negative capacitance applications

    International Nuclear Information System (INIS)

    Highlights: • Aluminum and indium selenide thin films are used to design MgO tunneling diodes. • The Al/MgO/C and C/MgO/InSe/C tunneling diode structures are characterized. • The C/MgO/InSe/C device exhibited a peak to valley current ratio of 135. • It reflected negative resistance effect in the voltage range of 0.94–2.24. • A resonance peak located at 39 MHz was observed. -- Abstract: In this work, the design and characterization of magnesium oxide based tunneling diodes which are produced on Al and InSe films as rectifying substrates are investigated. It was found that when Al thin films are used, the device exhibit tunneling diode behavior of sharp valley at 0.15 V and peak to valley current ratio (PVCR) of 11.4. In addition, the capacitance spectra of the Al/MgO/C device show a resonance peak of negative capacitance (NC) values at 44.7 MHz. The capacitance and resistance–voltage characteristics handled at an ac signal frequency of 100 MHz reflected a build in voltage (Vbi) of 1.29 V and a negative resistance (NR) effect above 2.05 V. This device quality factor (Q)–voltage response is ∼104. When the Al substrate is replaced by InSe thin film, the tunneling diode valley appeared at 1.1 V. In addition, the PVCR, NR range, NC resonance peak, Q and Vbi are found to be 135, 0.94–2.24 and 39.0 MHz, ∼105 and 1.34 V, respectively. Due to the wide differential negative resistance and capacitance voltage ranges and due to the response of the C/MgO/InSe/C device at 1.0 GHz, these devices appear to be suitable for applications as frequency mixers, amplifiers, and monostable–bistable circuit elements (MOBILE)

  10. Barrier effect of AlN film in flexible Cu(In,Ga)Se2 solar cells on stainless steel foil and solar cell

    International Nuclear Information System (INIS)

    Highlights: • The adhension between AlN film and Mo are verygood. • AlN film can be effectively used as the barrier of flexible CIGS solar cell on SS substrate. • AlN film is suitable as the insulation barrier of flexible CIGS solar cell on SS substrate. - Abstract: The AlN film deposited by DC magnetron sputtering on stainless steel (SS) foils was used as the barrier in flexible Cu(In,Ga)Se2 (CIGS) solar cells on stainless steel foil and characterized comprehensively by X-ray diffraction (XRD), scanning electron microscopy (SEM), I–V, and QE measurements study. The study of AlN as insulation barrier in the flexible CIGS solar cell showed that the adhesion strength between the SS foil and the deposited AlN film was very strong even after annealing at high temperature at 530 °C. More importantly, a high resistance of over 10 MΩ was remained with the film with thickness of around 200 nm after annealing. This indicates that the AlN film is suitable as an effective insulation barrier in flexible CIGS solar cells based on SS foil. In addition, the XRD and SEM results showed that the AlN film did not influence the crystal structure of the Mo film which was deposited upon the AlN layer and used as the electrical contact in CIGS solar cells. It was found that the AlN film contributed to an improved crystallinity of the Mo contact layer compared to the bare SS foil. The combined results of secondary ion mass spectrometry, I–V and EQE measurements of the corresponding flexible CIGS solar cells confirmed that 1 μm-thick AlN film could be used as an efficient barrier layer in CIGS solar cells on SS foil

  11. Molecular beam epitaxy and characterization of thin Bi{sub 2}Se{sub 3} films on Al{sub 2}O{sub 3} (110)

    Energy Technology Data Exchange (ETDEWEB)

    Tabor, Phillip; Keenan, Cameron; Urazdhin, Sergei; Lederman, David

    2011-07-04

    The structural and electronic properties of thin Bi{sub 2}Se{sub 3} films grown on Al{sub 2}O{sub 3} (110) by molecular beam epitaxy are investigated. The epitaxial films grow in the Frank-van der Merwe mode and are c-axis oriented. They exhibit the highest crystallinity, the lowest carrier concentration, and optimal stoichiometry at a substrate temperature of 200 deg. C determined by the balance between surface kinetics and desorption of Se. The crystallinity of the films improves with increasing Se/Bi flux ratio. Our results enable studies of thin topological insulator films on inert, non-conducting substrates that allow optical access to both film surfaces.

  12. Dispersion of the linear and nonlinear optical susceptibilities of the CuAl(S{sub 1–x}Se{sub x})₂ mixed chaclcopyrite compounds

    Energy Technology Data Exchange (ETDEWEB)

    Reshak, A. H., E-mail: maalidph@yahoo.com [New Technologies - Research Centre, University of West Bohemia, Univerzitni 8, 306 14 Pilsen (Czech Republic); Center of Excellence Geopolymer and Green Technology, School of Material Engineering, University Malaysia Perlis, 01007 Kangar, Perlis (Malaysia); Brik, M. G. [College of Mathematics and Physics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Institute of Physics, University of Tartu, Ravila 14C, Tartu 50411 (Estonia); Auluck, S. [Council of Scientific and Industrial Research—National Physical Laboratory Dr. K S Krishnan Marg, New Delhi 110012 (India)

    2014-09-14

    Based on the electronic band structure, we have calculated the dispersion of the linear and nonlinear optical susceptibilities for the mixed CuAl(S{sub 1–x}Se{sub x})₂ chaclcopyrite compounds with x=0.0, 0.25, 0.5, 0.75, and 1.0. Calculations are performed within the Perdew-Becke-Ernzerhof general gradient approximation. The investigated compounds possess a direct band gap of about 2.2 eV (CuAlS₂), 1.9 eV (CuAl(S₀.₇₅Se₀.₂₅)₂), 1.7 eV (CuAl(S₀.₅Se₀.₅)₂), 1.5 eV (CuAl(S₀.₂₅Se₀.₇₅)₂), and 1.4 eV (CuAlSe₂) which tuned to make them optically active for the optoelectronics and photovoltaic applications. These results confirm that substituting S by Se causes significant band gaps' reduction. The optical function's dispersion ε₂{sup xx}(ω) and ε₂{sup zz}(ω)/ε₂{sup xx}(ω), ε₂{sup yy}(ω), and ε₂{sup zz}(ω) was calculated and discussed in detail. To demonstrate the effect of substituting S by Se on the complex second-order nonlinear optical susceptibility tensors, we performed detailed calculations for the complex second-order nonlinear optical susceptibility tensors, which show that the neat parents compounds CuAlS₂ and CuAlSe₂ exhibit | χ₁₂₂²}(-2ω;ω;ω) | as the dominant component, while the mixed alloys exhibit | χ₁₁₁²(-2ω;ω;ω) | as the dominant component. The features of | χ₁₂₃²}(-2ω;ω;ω) | and | χ{sub 111}²}(-2ω;ω;ω) | spectra were analyzed on the basis of the absorptive part of the corresponding dielectric function ε₂(ω) as a function of both ω/2 and ω.

  13. Nuevas técnicas de procesado de señal aplicadas al sistema MC-CDMA en enlace ascendente

    OpenAIRE

    Bader, Faouzi

    2002-01-01

    La presente tesis puede darnos una idea de la complejidad de la transmisión ascendente (UL) y su especificidad en comparación con el esquema descendente, también destacando el impacto que puede tener este modo de transmisión sobre el diseño de los receptores MC-CDMA. La verosimilitud de la detección en el modo ascendente en los sistemas MC-CDMA ha orientado las investigaciones internacionales a desarrollar otros esquemas de transmisión que son considerados más apropiados al modo ascendente co...

  14. Una autobiografía al contrario : Walsh: El "autor de novelas policiales" que se transformó en "detective"

    OpenAIRE

    Adoue, Silvia B.

    2007-01-01

    ¿Es posible descubrir en una obra de ficción las marcas de la biografía de su autor? Parece que se impone un cambio de registro que domina la literatura del escritor para ajustarla a la visión de mundo que resulta de su experiencia vital. La escritura cumple el papel de conciencia y campo de batalla donde el autor intenta superar sus perplejidades. Así, tal vez sea posible, en algún nivel de lectura, leer la obra de un escritor como una autobiografía. Rodolfo Walsh, lector, traductor, adaptad...

  15. ¿Se puede predecir la transferencia de los aprendizajes al lugar de trabajo?: Validación del Modelo de Predicción de la Transferencia

    OpenAIRE

    Quesada Pallarès, Carla

    2014-01-01

    Los estudios sobre evaluación de la transferencia de la formación han mostrado que únicamente entre un 10% y un 30% de lo aprendido en la formación se transfiere al puesto de trabajo (Holton, Bates y Ruona, 2000); y que los predictores y las intervenciones tienen un modesto efecto en la transferencia (Saks y Burke, 2012). En vista de este panorama, la presente tesis doctoral tiene dos objetivos: (1) crear un modelo de predicción de transferencia de la formación, mediante el análisis de la...

  16. Felícisima Victoria concedida del cielo al señor don Juan de Austria en el golfo de Lepanto (1578)

    OpenAIRE

    Corte Real, Jerónimo; Vilá, Lara

    2005-01-01

    La colección Bibliotheca Sphaerica surge del trabajo conjunto del Seminario de Poética Europea del Renacimiento de la Universitat Autònoma de Barcelona y el Instituto Lucio Anneo Séneca de la Universidad Carlos III de Madrid En 1578 el portugués Jerónimo Corte Real dio a la imprenta la Felicísima victoria concedida del cielo al señor don Juan de Austria, un poema épico en castellano, ilustrado por el autor, dedicado íntegramente a narrar y exaltar la victoria cristiana en el golfo de Lepan...

  17. Alila and Se al mar luna——Two Cases of Vessels Design%一个设计师的两艘游艇

    Institute of Scientific and Technical Information of China (English)

    Samuele Mattelli; Luca Dini; 贾陈陈

    2006-01-01

    读者看到的是来自意大利佛罗伦萨的著名游艇设计师Luca Dini的两个最新作品,Alita号和Se al mar cala ta luna号,这两艘游艇无论尺寸还是工艺都十分相似,身长都超过30m,外形由意大利著名造船所CNL设计,这家公司也是Dini先生的主要合作伙伴。

  18. Thickness Effect of Al-Doped ZnO Window Layer on Damp Heat Stability of CuInGaSe2 Solar Cells: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Pern, F. J.; Mansfield, L.; DeHart, C.; Glick, S. H.; Yan, F.; Noufi, R.

    2011-07-01

    We investigated the damp heat (DH) stability of CuInGaSe2 (CIGS) solar cells as a function of thickness of the Al-doped ZnO (AZO) window layer from the 'standard' 0.12 μm to a modest 0.50 μm over an underlying 0.10-μm intrinsic ZnO buffer layer. The CIGS cells were prepared with external electrical contact using fine Au wire to the tiny 'standard' Ni/Al (0.05 μm/3 μm) metal grid contact pads. Bare cell coupons and sample sets encapsulated in a specially designed, Al-frame test structure with an opening for moisture ingress control using a TPT backsheet were exposed to DH at 85oC and 85% relative humidity, and characterized by current-voltage (I-V), quantum efficiency (QE), and (electrochemical) impedance spectroscopy (ECIS). The results show that bare cells exhibited rapid degradation within 50-100 h, accompanied by film wrinkling and delamination and corrosion of Mo and AlNi grid, regardless of AZO thickness. In contrast, the encapsulated cells did not show film wrinkling, delamination, and Mo corrosion after 168 h DH exposure; but the trend of efficiency degradation rate showed a weak correlation to the AZO thickness.

  19. Trace element (Al, As, B, Ba, Cr, Mo, Ni, Se, Sr, Tl, U and V) distribution and seasonality in compartments of the seagrass Cymodocea nodosa.

    Science.gov (United States)

    Malea, Paraskevi; Kevrekidis, Theodoros

    2013-10-01

    Novel information on the biological fate of trace elements in seagrass ecosystems is provided. Al, As, B, Ba, Cr, Mo, Ni, Se, Sr, Tl, U and V concentrations in five compartments (blades, sheaths, vertical rhizomes, main axis plus additional branches, roots) of the seagrass Cymodocea nodosa, as well as in seawater and sediments from the Thessaloniki Gulf, Greece were determined monthly. Uni- and multivariate data analyses were applied. Leaf compartments and roots displayed higher Al, Mo, Ni and Se annual mean concentrations than rhizomes, B was highly accumulated in blades and Cr in sheaths; As, Ba, Sr and Tl contents did not significantly vary among plant compartments. A review summarizing reported element concentrations in seagrasses has revealed that C. nodosa sheaths display a high Cr accumulation capacity. Most element concentrations in blades increased in early mid-summer and early autumn with blade size and age, while those in sheaths peaked in late spring-early summer and autumn when sheath size was the lowest; elevated element concentrations in seawater in late spring and early-mid autumn, possibly as a result of elevated rainfall and associated run-off from the land, may have also contributed to the observed variability. Element concentrations in rhizomes and roots generally displayed a temporary increase in late autumn, which was concurrent with high rainfall, low wind speed associated with reduced hydrodynamism, and elevated sediment element levels. The bioaccumulation factor based on element concentrations in seagrass compartments and sediments was lower than 1 except for B, Ba, Mo, Se and Sr in all compartments, Cr in sheaths and U in roots. Blade V concentration positively correlated with sediment V concentration, suggesting that C. nodosa could be regarded as a bioindicator for V. Our findings can contribute to the design of biomonitoring programs and the development of predictive models for rational management of seagrass meadows. PMID:23838054

  20. ¿CÓMO SE HACE? UNA APROXIMACIÓN AL PROBLEMA DEL MÉTODO EN EL DERECHO Y EN EL TEATRO

    Directory of Open Access Journals (Sweden)

    María Isolina Dabove

    2011-08-01

    Full Text Available En el siglo XVI, la filosofía occidental aborda la pregunta en torno a los métodos, a los caminos eficaces para la producción científica. ¿Cómo se hace… para generar un conocimiento confiable, cierto y útil?, se preguntan los filósofos del conocimiento y, sobre ello comienza la construcción de las ciencias y las tecnologías particulares. En el siglo XIX, son los juristas los que se preguntan ¿cómo se hace? su propia disciplina. Y así, desde ella nacen la Teoría del Derecho y la Metodología jurídica con la Exégesis francesa y la Dogmática alemana. Pero será recién el siglo XX el tiempo adecuado para que irrumpa la pregunta metodológica en el mundo del Teatro. Será a principios del novecientos cuando se interrogue ¿cómo se hace… para producir teatro?, ¿En qué consiste el proceso creador y la actuación? Estos son los cuestionamientos que permitirán la configuración de una nueva perspectiva del Teatro: la Teoría Teatral y la Antropología teatral. En este trabajo intentaremos observar cuáles son los puntos de conexión y de diferenciación que existen en la pregunta acerca de la producción jurídica y teatral. Así como también trataremos de identificar qué beneficios y perjuicios se reportan Derecho y Teatro entre sí, con sus respuestas. En suma, nos preguntamos ¿qué podemos aprender nosotros hoy, con todo ello?[1] Los puntos de conexión más claros en torno al método –es decir, acerca de la actuación para la producción jurídica y teatral, se encuentran en el plano lingüístico y en la perspectiva sociológica. El Derecho y el Teatro se expresan en textos, se configuran por discursos y ambos constituyen lingüísticamente alguna realidad. Ficticia, para el teatro; fáctica para el Derecho. Por otra parte, es curioso observar que los cuestionamientos referidos a los caminos para la producción jurídica y teatral nacen de la mano de la identificación de sus protagonistas, de sus repartidores m

  1. Study of the Al-grading effect in the crystallisation of chalcopyrite CuIn{sub 1−x}Al{sub x}Se{sub 2} thin films

    Energy Technology Data Exchange (ETDEWEB)

    Martín, S., E-mail: sofia.martin@ciemat.es [CIEMAT, Departamento de Energía, Avda. Complutense, 40, E-28040 Madrid (Spain); Zoppi, G.; Aninat, R.; Forbes, I. [Northumbria Photovoltaics Applications Centre, Northumbria University, Ellison Building, Newcastle upon Tyne NE1 8ST (United Kingdom); Guillén, C. [CIEMAT, Departamento de Energía, Avda. Complutense, 40, E-28040 Madrid (Spain)

    2013-06-15

    Chalcopyrite CuIn{sub 1−x}Al{sub x}Se{sub 2} (CIAS) thin films with an atomic ratio of Al/(In + Al) = 0.4 were grown by a two-stage process onto soda-lime glass substrates. The selenisation was carried out at different temperatures, ranging from 400 °C to 550 °C, for metallic precursors layers evaporated with two different sequences. The first sequence, C1, was evaporated with the Al as the last layer, while in the second one, C2, the In was the last evaporated element. The optical, structural and morphological characterisations led to the conclusion that the precursors sequence determines the crystallisation pathway, resulting in C1 the best option due to the homogeneity of the depth distribution of the elements. The influence of the selenisation temperature was also studied, finding 540 °C as the optimum one, since it allows to achieve the highest band gap value for the C1 sequence and for the given composition. - Highlights: • CIAS chalcopyrite thin films were prepared by a two-stage process. • Different metallic precursors sequences have been evaporated. • The samples have been converted at different selenisation temperatures. • Optical, morphological and structural properties have been studied. • The sequence and the temperatures determine the way towards CIAS formation and crystallization.

  2. Geoquímica de las aguas subterráneas en rocas metamórficas al SE de Salamanca

    Directory of Open Access Journals (Sweden)

    García, A.

    1991-08-01

    Full Text Available This paper describes the results of 77 chemical analyses of groundwater from springs and wells in the «Complejo Esquisto Grauváquico» and other paleozoic materials from the south of Salamanca province. The types of groundwater are very diverse, usually bicarbonate dominant, with TDS (Total Dissolved Solids between 0.6 and 16 milimoles/l. Salinity is shown to be greater in the drilled wells than in the dug wells and springs, which confirms the existence of deep flow. Principal Component Analysis indicates that the chemical composition of groundwater must be the result of multiple reactions between the water and the minerals that occur in parallel, with none of the reactions being specially predominant. The organization and geographic distribution of sorne of the elements suggest the existence of regional flow systems.Se presentan los resultados de 77 análisis químicos de aguas subterráneas procedentes de manantiales, pozos excavados y sondeos en el Complejo Esquisto Grauváquico y otros materiales paleozoicos al Sur de la provincia de Salamanca. Se trata de aguas muy dispares, en general bicarbonatadas mixtas, con TSD (total de sólidos disueltos entre 0,6 y 16 milimoles/l. Se pone de manifiesto una mayor salinidad de las aguas de sondeos en relación con las de pozos y manantiales, lo que demuestra la existencia de una circulación a cierta profundidad. El análisis de componentes principales muestra que la composición química de las aguas debe ser el resultado de múltiples reacciones entre el agua y los minerales que se producen en paralelo, sin que destaque ninguna en especial. La distribución geográfica ordenada de algunos elementos obliga a plantear como posible la hipótesis de la existencia de un flujo regional.

  3. Transport properties of CuIn(1-x)Al(x)Se2/AZnO heterostructure for low cost thin film photovoltaics.

    Science.gov (United States)

    Murali, Banavoth; Krupanidhi, S B

    2014-02-01

    CuIn(1-x)Al(x)Se2 (CIASe) thin films were grown by a simple sol-gel route followed by annealing under vacuum. Parameters related to the spin-orbit (ΔSO) and crystal field (ΔCF) were determined using a quasi-cubic model. Highly oriented (002) aluminum doped (2%) ZnO, 100 nm thin films, were co-sputtered for CuIn(1-x)Al(x)Se2/AZnO based solar cells. Barrier height and ideality factor varied from 0.63 eV to 0.51 eV and 1.3186 to 2.095 in the dark and under 1.38 A.M 1.5 solar illumination respectively. Current-voltage characteristics carried out at 300 K were confined to a triangle, exhibiting three limiting conduction mechanisms: Ohms law, trap-filled limit curve and SCLC, with 0.2 V being the cross-over voltage, for a quadratic transition from Ohm's to Child's law. Visible photodetection was demonstrated with a CIASe/AZO photodiode configuration. Photocurrent was enhanced by one order from 3 × 10(-3) A in the dark at 1 V to 3 × 10(-2) A upon 1.38 sun illumination. The optimized photodiode exhibits an external quantum efficiency of over 32% to 10% from 350 to 1100 nm at high intensity 17.99 mW cm(-2) solar illumination. High responsivity Rλ ~ 920 A W(-1), sensitivity S ~ 9.0, specific detectivity D* ~ 3 × 10(14) Jones, make CIASe a potential absorber for enhancing the forthcoming technological applications of photodetection. PMID:24336980

  4. SE PREVENINDO?

    Directory of Open Access Journals (Sweden)

    Ana Débora Assis Moura

    2010-01-01

    Full Text Available Este estudio tuvo como objetivo verificar el comportamiento de las prostitutas en relación a la prevención de enfermedades de transmisión sexual y del Síndrome de Inmunodeficiencia Adquirida-SIDA, así como investigar cómo se previenen de esas enfermedades. Se trata de una investigación exploratoria, con enfoque cualitativo, llevada a cabo en la Asociación de las Prostitutas en Ceará, Brazil, en septiembre de 2008, a través de una encuesta con 25 prostitutas. El análisis de los datos se hizo según el análisis de contenido, después de ser agrupados en cuatro categorías: conocimiento sobre las enfermedades de transmisión sexual/SIDA; convivencia con la(s enfermedad(es; prevención de la enfermedad de transmisión sexual/SIDA; y el uso de drogas. Se concluyó que las prostitutas no usan preservativos en todas las relaciones sexuales, por lo tanto, las enfermedades de transmisión sexual representan una realidad; la desinformación sobre la(s enfermedad(es es notable; el consumo de drogas lícitas e ilícitas es frecuente entre ellas, factor que las expone a situaciones más vulnerables con relación al VIH/SIDA.

  5. Photo-stability and time-resolved photoluminescence study of colloidal CdSe/ZnS quantum dots passivated in Al2O3 using atomic layer deposition

    Science.gov (United States)

    Cheng, Chih-Yi; Mao, Ming-Hua

    2016-08-01

    We report photo-stability enhancement of colloidal CdSe/ZnS quantum dots (QDs) passivated in Al2O3 thin film using the atomic layer deposition (ALD) technique. 62% of the original peak photoluminescence (PL) intensity remained after ALD. The photo-oxidation and photo-induced fluorescence enhancement effects of both the unpassivated and passivated QDs were studied under various conditions, including different excitation sources, power densities, and environment. The unpassivated QDs showed rapid PL degradation under high excitation due to strong photo-oxidation in air while the PL intensity of Al2O3 passivated QDs was found to remain stable. Furthermore, recombination dynamics of the unpassivated and passivated QDs were investigated by time-resolved measurements. The average lifetime of the unpassivated QDs decreases with laser irradiation time due to photo-oxidation. Photo-oxidation creates surface defects which reduces the QD emission intensity and enhances the non-radiative recombination rate. From the comparison of PL decay profiles of the unpassivated and passivated QDs, photo-oxidation-induced surface defects unexpectedly also reduce the radiative recombination rate. The ALD passivation of Al2O3 protects QDs from photo-oxidation and therefore avoids the reduction of radiative recombination rate. Our experimental results demonstrated that passivation of colloidal QDs by ALD is a promising method to well encapsulate QDs to prevent gas permeation and to enhance photo-stability, including the PL intensity and carrier lifetime in air. This is essential for the applications of colloidal QDs in light-emitting devices.

  6. PERSPECTIVAS DE SUSTENTABILIDADE ECOLÓGICA DO TURISMO EM XINGÓ, SE/AL / TOURISM ECOLOGICAL SUSTAINABILITY PERSPECTIVES IN XINGÓ, SERGIPE AND ALAGOAS, BRAZIL

    Directory of Open Access Journals (Sweden)

    Cláudio Roberto Braghini

    2009-06-01

    Full Text Available RESUMO A busca da sustentabilidade em várias dimensões implica olhar para o desenvolvimento local nos territórios em que o turismo ocorre. Este estudo analisou de forma sistêmica a relação entre turismo, gastronomia local e os recursos extraídos do rio São Francisco pela pesca artesanal, na região de Xingó, Nordeste do Brasil. A área de estudo abrangeu três municípios, Poço Redondo/SE, Canindé de São Francisco/SE e Piranhas/AL. Tratou-se de uma pesquisa exploratória, descritiva, intencional e não probabilística, utilizando entrevistas com roteiro estruturado e aberto, junto aos restaurantes, pescadores artesanais e gestores públicos, visitas locais de reconhecimento, construção de mapa coletivo com pescadores e elaboração de diagramas de alças causais, visando selecionar indicadores de sustentabilidade. Os resultados indicaram o Surubim Pseudoplatystoma corruscans (Spix e Agassiz, 1829, Pitu Macrobrachium carcinus (Linnaeus, 1758 e Tubarana Salminus hilarii (Valenciennes, 1850, os pescados típicos mais vendidos, no entanto, dependem de distribuidores e de estoques externos. Observou-se que a redução do pescado na região deveu-se à barragem da UHE de Xingó e a sobrepesca. O fluxo turístico crescente tem forte influência sobre o camarão Pitu. Os indicadores ambientais selecionados apontam necessidade de sistematização de informações sobre a produção pesqueira e o consumo nos restaurantes.Palavras-chaves: Sustentabilidade; Turismo; Xingó; Rio São Francisco; CaatingaABSTRACTThe carrying support and the development of the local tourism involve different looks on its dimensions in the area where it occurs. This study examined in a systematic way the sustainability of tourism in the Northeast - Brazil, region of Xingó: the resources tourist and local gastronomy. The study area covers three districts: Poço Redondo and Canindé do São Francisco at Sergipe and in the state of Alagoas at Piranhas. This research

  7. La sobreexpresión de RAC3 es una señal transformante y proliferativa que contribuye al desarrollo tumoral RAC3 overexpression is a transforming and proliferative signal that contributes to tumoral development

    Directory of Open Access Journals (Sweden)

    Cecilia V. Alvarado

    2011-02-01

    Full Text Available RAC3 fue caracterizado originalmente como un coactivador de receptores nucleares que se encuentra en cantidades limitantes en células normales, aunque sobreexpresado en tumores y es además coactivador de NF-?B. Si bien se desconocen los mecanismos involucrados en el aumento de su expresión, se sabe que induce resistencia a apoptosis. En este trabajo se investigó si RAC3 podría contribuir al desarrollo tumoral por otros mecanismos y si la citoquina TNF-a, que se encuentra en alto título en pacientes con cáncer, podría favorecer el aumento en la expresión de RAC3. Se observó que el aumento en la expresión del coactivador por transfección de células no tumorales de riñón embrionario humano HEK293 no solo aumenta significativamente la proliferación en presencia de suero, sino además en ausencia de factores de crecimiento. También se indujo la transformación celular dando un fenotipo con crecimiento independiente de anclaje similar a lo observado para células tumorales. El tratamiento de las células HEK293 en cultivo con TNF-a indujo un aumento en los niveles proteicos de RAC3 respecto de las células sin estímulo y este efecto fue inhibido por pretratamiento con un inhibidor específico de la activación de NF-?B, indicando que la activación de este factor de transcripción está involucrada en la acción de la citoquina. Se concluye que RAC3, además de su acción anti-apoptótica, es un factor transformante que promueve la proliferación y el crecimiento independiente de anclaje, cuyos niveles podrían ser aumentados en la tumorigénesis, probablemente vía las citoquinas inflamatorias involucradas en la respuesta anti-tumoral.RAC3 has been firstly characterized as a nuclear receptor coactivator that is found in limited amounts in normal cells, but is over-expressed in tumors and is also an NF-?B coactivator. Although the mechanisms involved in its over-expression are not clear, it is well known that it enhances resistance

  8. Las estructuras de la Cuenca de Bermejo y Sierra de Valle Fértil a partir de los métodos deconvolución de Euler y señal analítica

    Directory of Open Access Journals (Sweden)

    Federico Lince Klinger

    2008-06-01

    Full Text Available Se aplicaron técnicas de señal analítica y deconvolución de Euler a valores de anomalías de Bouguer de la cuenca de Bermejo y de la sierra de Valle Fértil, en el sector occidental de las Sierras Pampeanas. A partir de las soluciones encontradas por estas técnicas, se han interpretado la ubicación y profundidad de las fuentes causantes de anomalías, las que se vinculan con las estructuras geológicas que involucran al basamento. Con el objeto de verificar los resultados obtenidos y de minimizar las ambigüedades de los métodos potenciales, se preparó un modelo gravimétrico directo basado en un modelo estructural del área. A la respuesta gravimétrica de este modelo directo se le aplicó la técnica de señal analítica 2D, encontrándose soluciones que son consistentes con la profundidad y geometría de las fuentes previamente interpretadas, corroborando los resultados obtenidos.

  9. Influence of rf-magnetron Sputtered ITO and Al:ZnO on Photovoltaic Behaviour Related to CuInSe{sub 2}-Based Photovoltaic Solar Cells; Influencia del ITO y Al:ZnO, Fabricados mediante Pulverizacion Cataodica, sobre el Comportamiento Fotovoltaico de Dispositivos Basados en el CuInSe{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, M. A.; Guillen, C.; Dona, J. M.; Herrero, J.; Gutierrez, M. T. [Ciemat.Madrid (Spain)

    2000-07-01

    This paper describes several investigations, made in the CIEMAT, on the capability of depositing transparent conducting oxides at room temperature by rf-magnetron sputtering, and their application inCuInSe{sub 2}-based photovoltaic solar cells. ITO and Al:ZnO thin films having simultaneously high transmittance in the visible range and low resistivity, 10''3-10''4{omega}cm, can be obtained only if oxygen mass-flow rate is constrained to a very narrow range (0.5-1 sccm). Cell efficiency enhance when transparent conducting oxides are made without intentional heating and, after, the total devices are annealed in air at 200 degree centigree. (Author) 40 refs.

  10. Nuestra señora del campo. historia de un objeto en santafé de bogotá. siglos xvi al xx

    OpenAIRE

    Acosta, Olga Isabel

    2010-01-01

    Este artículo inicia con un balance de la historiografía colombiana sobre el arte colonial, y luego se concentra en el estudio de la Virgen del Campo. Estudia en detalle su origen como objeto de culto y la devoción que en tomo suyo se formó, desde la época colonial hasta el presente.

  11. Desarrollo y evaluación de diferentes métodos de detección de apnea a partir de la señal electrocardiográfica (ECG)

    OpenAIRE

    Manzanera Navarro, Vladimir

    2009-01-01

    El desarrollo y la mejora de distintos métodos de detección del síndrome de la apnea obstructiva del sueño (SAOS) a partir de únicamente la señal electrocardiográfica (ECG) es la base del proyecto realizado. Hasta ahora el método de detección utilizado es la polisomnografía, que requiere del registro de diferentes señales biomédicas, encareciendo el proceso. Para conseguir el objetivo marcado durante el estudio se desarrollan 5 métodos de extracción de información de l...

  12. El IEO se adhiere a la Declaración de Berlín sobre acceso abierto al conocimiento científico

    OpenAIRE

    Lozano, P.; Mosquera-de-Arancibia, C. (Concha)

    2016-01-01

    El 24 de junio de 2016, el Instituto Español de Oceanografía oficializó su adhesión a la Berlin Declaration on Open Access to Knowledge in the Sciences and Humanities, hito del movimiento de acceso abierto al conocimiento científico gestionado por la Max Planck Society. Los firmantes de la Declaración de Berlín defienden el uso de internet como medio funcional que sirva de base global al conocimiento científico y la reflexión humana. Los declarantes consideran que la misión de diseminar el co...

  13. Análisis de los diferentes tratamientos que se dan al cuerpo de los alumnos dentro de la jornada escolar. Propuesta de intervención

    OpenAIRE

    García Rojo, Laura

    2014-01-01

    En este documento nos adentraremos en el mundo corporal y en el tratamiento de éste dentro de las aulas. A continuación mediante la observación del tratamiento corporal en diversas jornadas a lo largo de tres semanas en un aula concreta y el análisis de las mismas, comprobaremos que se dan unas conclusiones y a partir de ellas veremos el diseño de una posible propuesta de intervención.

  14. Aportación al conocimiento de los hongos del SE. de España VI: Esclerodermatales, Licoperdales, Niludariales, Falales, Himenogásterales, Podaxales (Gasteromicetes, Basidiomicetes)

    OpenAIRE

    Honrubia García, Mario; Calonge, Francisco de Diego; Demoulin, V.; Moreno, G; Llimona, Xavier

    1982-01-01

    Resultados de las exploraciones micoIógicas realizadas entre 1977 y 1980 en 55 localidades de .Murcia, Albacete, Almería, Alicante y Jaén, en lo referente a Gasteromicetes, con exclusi6n de Tulostomatales. 167 recolecciones corresponden a 28 especies, en general poco conocidas o nuevas para el SE de España. En conjunto pertenece* a: Scleroderma (3, con S. meridionde), Pisolithus ('11, Astraeus (11, Sphaerobolus stellatus, Geastrum (6, con G. badium, G. minimum y G. pse...

  15. Structural study of ZnSe films grown on substrate with InxGa1-xAs and Al1-xGaxAs buffer layers: strain, relaxation and lattice parameter

    International Nuclear Information System (INIS)

    ZnSe layers of various thickness were grown on (001) GaAs substrates, using InxGa1-xAs or Al1-xGaxAs as buffer layers by molecular beam epitaxy and were studied by high-resolution x-ray diffraction. The principal structural characteristics of ZnSe layer and buffer layer were determined using several reflections, such as (004) and two pairs of coupled asymmetric reflections, namely (224), (-2-24) and (115) (-1-15). In order to evaluate their validity, the experimental data obtained from these reflections were handled by means of two known expressions found in the literature. We have found the relaxation process of ZnSe layers is well described by a geometrical model including the thermal strain and small strain due to work hardening. The relaxation process is faster for ZnSe grown on ternary buffer layers despite the fact that, some buffer layers are pseudomorphically grown to the substrate; therefore we conclude that not only the lattice mismatches have effect on the relaxation process but also the surface state of the buffer layer has an influence in this process. (author)

  16. Se los por se lo

    OpenAIRE

    José Luis Rivarola

    1985-01-01

    El sistema de la conjugación "objetiva" plantea interesantesproblemas que fueron tratados en parte por K. Heger (1966) en suestudio comparativo del francés y del español. De la comparaciónse desprende, por ejemplo, que en español hay un cierto número deambigüedades que no permiten establecer un "paradigma tan completo y unívoco" como en el caso del francés. Dentro de estas ambigüedades se encuentran las que propicia el gramema se: "El morfema [gramema] se funciona no sólo como pronombre refle...

  17. Encapsulation of Cu(InGa)Se{sub 2} solar cell with Al{sub 2}O{sub 3} thin-film moisture barrier grown by atomic layer deposition

    Energy Technology Data Exchange (ETDEWEB)

    Carcia, P.F.; McLean, R.S. [DuPont Research and Development, Experimental Station, Wilmington, DE 19880-0400 (United States); Hegedus, Steven [Institute of Energy Conversion, University of Delaware, Newark, DE 19716-3820 (United States)

    2010-12-15

    We compared the moisture sensitivity of a Cu(InGa)Se{sub 2} (CIGS) photovoltaic cell protected by 55 nm thick Al{sub 2}O{sub 3}, grown by atomic layer deposition (ALD), with equivalent CIGS cells protected with a glass or a polyester lid. Aging studies for more than 1000 h at 85 C/85% relative humidity with simulated solar illumination showed that the ALD Al{sub 2}O{sub 3} thin-film barrier provided superior moisture protection for the CIGS cell, i.e. no reduction in open circuit voltage or fill factor occurred, compared to cells protected with a glass or plastic lid. We concluded that a moisture barrier grown by ALD could have broad applicability as a strategy for extending the lifetime of flexible CIGS cells. (author)

  18. A transferable force field for CdS-CdSe-PbS-PbSe solid systems

    NARCIS (Netherlands)

    Fan, Zhaochuan; Koster, Rik S.; Wang, Shuaiwei; Fang, Changming; Yalcin, Anil O.; Tichelaar, Frans D.; Zandbergen, Henny W.; van Huis, Marijn A.; Vlugt, Thijs J. H.

    2014-01-01

    A transferable force field for the PbSe-CdSe solid system using the partially charged rigid ion model has been successfully developed and was used to study the cation exchange in PbSe-CdSe heteronanocrystals [A. O. Yalcin et al., "Atomic resolution monitoring of cation exchange in CdSe-PbSe heterona

  19. Se los por se lo

    Directory of Open Access Journals (Sweden)

    José Luis Rivarola

    1985-12-01

    Full Text Available El sistema de la conjugación "objetiva" plantea interesantesproblemas que fueron tratados en parte por K. Heger (1966 en suestudio comparativo del francés y del español. De la comparaciónse desprende, por ejemplo, que en español hay un cierto número deambigüedades que no permiten establecer un "paradigma tan completo y unívoco" como en el caso del francés. Dentro de estas ambigüedades se encuentran las que propicia el gramema se: "El morfema [gramema] se funciona no sólo como pronombre reflexivo, sinotambién como variante combinatoria del pronombre personal complemento indirecto de la tercera persona.

  20. Profile of patients with hepatic hydatid disease not treated surgically Perfil del paciente con hidatidosis hepática al que no se realiza tratamiento quirúrgico

    Directory of Open Access Journals (Sweden)

    José Manuel Ramia

    2011-09-01

    .Introducción: la hidatidosis hepática (HH es todavía un problema sanitario importante en ciertas áreas endémicas en España. El tratamiento es habitualmente quirúrgico pero ciertos pacientes, tras ser valorados por los Servicios de Cirugía, no son intervenidos por un variado conjunto de causas (asintomático, comorbilidades, negativa del paciente,.... Material y métodos: descripción de pacientes valorados en el Servicio de Cirugía de hidatidosis hepática y no intervenidos. Resultados: hemos atendido a 70 pacientes con HH. De ellos, 27 pacientes no fueron intervenidos. Edad media: 72,7 años (rango: 47-97. Catorce eran mujeres (51,8%. El número de quistes que presentaban era 33, con 1,22 quistes/paciente (rango: 1-4. El tamaño del quiste fue 5,5 cm (rango: 2,1-12,5 cm. Los quistes, según la clasificación OMS, eran CE1: 3 pacientes, CE3B: 5, CE4: 10 y CE5: 9. La forma de presentación fue: 9 pacientes sintomáticos, aunque solo 6 atribuibles a la HH (22% y 18 asintomáticos. En estos se realizó la prueba de imagen por: estudio de extensión de neoplasia (6 pacientes y en 12 por variadas razones médicas. Solo hemos realizado dos actuaciones terapéuticas: CPRE y colocación de prótesis biliar y una punción-aspiración-inyección-reaspiración (PAIR, ambas en pacientes que no querían ser intervenidos. Diez pacientes tenían indicación quirúrgica: CE1 (3 pacientes, CE3B (5, CE4 (1, y CE5 (1. Las razones porque no se intervinieron fueron: negativa del paciente (9 y neoplasia avanzada (1. Creemos que la cirugía era necesaria en cinco pacientes. En el seguimiento medio efectuado de 17 meses (rango: 1-37 no hemos realizado ninguna cirugía. Conclusiones: las causas de no intervención de HH tras valoración médica son múltiples: pacientes asintomáticos, enfermos ancianos, pluripatólogicos y oncológicos. Habitualmente es el paciente el que voluntariamente decide no intervenirse.

  1. Comparative study about Al-doped zinc oxide thin films deposited by Pulsed Electron Deposition and Radio Frequency Magnetron Sputtering as Transparent Conductive Oxide for Cu(In,Ga)Se{sub 2}-based solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Pattini, F., E-mail: pattini@imem.cnr.it [IMEM-CNR, Institute of Materials for Electronics and Magnetism, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Annoni, F.; Bissoli, F.; Bronzoni, M. [IMEM-CNR, Institute of Materials for Electronics and Magnetism, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Garcia, J.P. [Delft University of Technology, Faculty of Applied Sciences, Delft Product and Process Design Institute, Julianalaan 67, 2628 BC Delft (Netherlands); Gilioli, E.; Rampino, S. [IMEM-CNR, Institute of Materials for Electronics and Magnetism, Parco Area delle Scienze 37/A, 43124 Parma (Italy)

    2015-05-01

    In this study, a comparison between Al-doped ZnO (AZO) as Transparent Conductive Oxide for Cu(In,Ga)Se{sub 2}-based solar cells grown by Pulsed Electron Deposition (PED) and Radio Frequency Magnetron Sputtering (RFMS) was performed. PED yielded polycrystalline [002] mono-oriented thin films with low electrical resistivity and high optical transparency with heater temperatures ranging from room temperature (RT) to 250 °C. The electrical resistivity of these films can be tuned by varying the heater temperature, reaching a minimum value of 3.5 × 10{sup −4} Ωcm at 150 °C and an average transmittance over 90% in the visible range. An AZO film grown at RT was deposited by PED on an actual Cu(In,Ga)Se{sub 2}-based solar cell, resulting to an efficiency value of 15.2% on the best device. This result clearly shows that PED is a suitable technique for growing ZnO-based thin films for devices/applications where low deposition temperature is required. On the other hand, an optimized AZO thin film front contact for thin film solar cells was studied and fabricated via RFMS. The parameters of this technique were tweaked to obtain highly conductive and transparent AZO thin films. The lowest resistivity value of 3.7 × 10{sup −4} Ωcm and an average transmittance of 86% in the 400-1100 nm wavelength range was obtained with a heater temperature of 250 °C. A thick sputtered AZO film was deposited at RT onto an identical cell used for PED-grown AZO, reaching the highest conversion efficiency value of 14.7%. In both cases, neither antireflection coatings nor pure ZnO layer was used. - Highlights: • Pulsed Electron Deposition (PED) lets high quality films grow at low temperature. • Al:ZnO (AZO) thin films grown by PED present high optical and electrical quality. • AZO electrical resistivity can be tuned from 10{sup −4} to 10{sup −2} Ωcm in proper condition. • Cu(In,Ga)Se{sub 2}-based simplified solar cells achieved efficiency of 15.2% for PED-grown AZO.

  2. Actores no estatales: grupos armados, milicias, señores de la guerra, grupos criminales organizados y paramilitares. ¿Pueden acaso estos grupos cometer crímenes internacionales conforme al Derecho penal internacional?

    Directory of Open Access Journals (Sweden)

    Mónica Rocha Herrera

    2016-03-01

    Full Text Available El legado de los tribunales penales internacionales de la ONU, el ICTY y el ICTR han sido claros y consistentes en una jurisprudencia conducente a responder de manera afirmativa que aquéllos grupos de individuos conformados por actores ‘No Estatales’ como grupos armados, milicias, señores de la guerra, paramilitares e incluso grupos criminales organizados son susceptibles de cometer crímenes internacionales conforme al derecho penal internacional, a saber, genocidio, crímenes de lesa humanidad y crímenes de guerra. La Corte Penal Internacional ha asumido este legado y hoy sabemos que, con o sin la complicidad de las autoridades del Estado, y a partir de la escasa jurisprudencia de la Corte Penal Internacional, estos grupos cometen crímenes de guerra como bien se estableció en la sentencia de Lubanga del 2012 y en Katanga del 2014 respectivamente. Crímenes de lesa humanidad a partir concretamente de la Decisión de Apertura de una Investigación para Kenia en 2010 donde la Sala a pesar de discrepancias adoptó la posición de que estos grupos organizados, con algún tipo de jerarquía y capaces de infringir los derechos humanos pueden ser considerados ‘organización’ en el sentido del artículo 7 del Estatuto de Roma. La comisión de genocidio por estos grupos en la CPI no la encontramos aún, pero el legado dejado por el ICTR y el ICTY es poderoso y elocuente.

  3. La inversión Matuyama-Brunhes en la secuencia de terrazas del río Jarama entre Velilla de San Antonio y Altos de la Mejorada, al SE de Madrid (España

    Directory of Open Access Journals (Sweden)

    Pérez-González, A.

    2013-06-01

    Full Text Available To the east of Madrid city in the Jarama river valley and between Mejorada del Campo and Velilla de San Antonio, we have studied the paleomagnetic properties of the river terrace sequence in the M-203 highway, located between El Rasillo and Altos de La Mejorada. Over a new geomorphological mapping the alluvial plain at +4-5 m and terraces at +20 m, +30-35 m, +60-65 m, +85-90 m, +105-110 m and +125-130 m have been defined. Five terraces have been sampled with the exception of the terrace at +20 m, allowing to place those terraces at altitudes greater or equal to +60-65 m in the Matuyama Chron, while terraces at +20 m and +35 m belong to Brunhes Chron. ESR datings on terraces in the Arlanzón river valley in Burgos (Moreno et al., 2012, suggest that Matuyama-Brunhes inversion in the Jarama valley could be established between the end of the sedimentation of the +60-65 m terrace and the engagement of subsequent +50-55 m terrace, located upstream from Mejorada del Campo, in Marchamalo (Pérez-González, 1994.Al Este de la ciudad de Madrid, en el valle del río Jarama y entre Mejorada del Campo y Velilla de San Antonio se han estudiado las propiedades paleomagnéticas de una secuencia de terrazas comprendidas entre El Rasillo y Altos de la Mejorada, a lo largo de la autopista M-203 de reciente construcción. La cartografía geomorfológica realizada permitió separar además de la llanura aluvial a +4-5 m, terrazas a +20 m, +30-35 m, +60-65 m, +85-90 m, +105-110 m y +125-130 m. De ellas se muestrearon 5 niveles, a excepción de la de +20 m, en taludes frescos de la autovía que permiten situar a las terrazas con altitudes relativas igual o mayores a +60-65 m en el Chron Matuyama, mientras que las terrazas a +20 m y +30-35 m pertenecerían al Chron Brunhes (< 0.780 Ma. Dataciones por ESR en terrazas del valle del río Arlanzón en Burgos (Moreno et al., 2012, sugieren que en el valle del Jarama la inversión Matuyama-Brunhes podría establecerse entre

  4. Disección de la profesión: de cómo y por qué se accede al periodismo, de sus estudios y salidas

    Directory of Open Access Journals (Sweden)

    Dra. Lucía Martínez Odriozola

    2004-01-01

    Full Text Available Cuando me incorporé como docente a la Facultad de Ciencias Sociales y de la Comunicación de la Universidad del País Vasco, la asignatura de la que recibí encargo pertenecía al primer ciclo de los viejos planes de estudios, que entonces compartían los estudiantes de Periodismo y los de Publicidad. Como desconocía completamente cuál era la composición del grupo y quiénes iban a decidirse el año siguiente por cada una de las especialidades, hice una pregunta al grupo, en el que habría cerca de un centenar de estudiantes: «¿Quiénes de vosotros van a ser periodistas?». Solo dos estudiantes levantaron la mano. Resultó decepcionante. Aun no he encontrado la respuesta a una segunda pregunta: ¿Por qué estudian Periodismo quienes no tienen ni intención ni esperanza de ejercer la profesión? «Certeza de muerte, mínimas probabilidades de éxito, ¿a qué esperamos?», dice el enano antes de que comience la última batalla de El señor de los anillos: El retorno del rey. Frente a esta incógnita —que condiciona la disposición del docente, redunda en perjuicio del grupo, resta ánimos para afrontar el estudio y los trabajos prácticos, no estimula la formación ni el interés por la información y los medios, ni por cuanto en ellos acontece—, cabe preguntarse cuáles son las razones que conducen a que una persona decida incorporarse a la profesión periodística.

  5. Women's opinions about mate choices: A qualitative studyKadınların eş seçimleri hakkındaki görüşleri: Nitel bir çalışma

    Directory of Open Access Journals (Sweden)

    Feyruz Usluoğlu

    2015-12-01

    Bu araştırmada, kadınların eş seçimine ilişkin görüşleri incelenmiştir. Çalışmaya sağlık alanında çalışan farklı meslek grubundan 15 kadın alınmıştır. Araştırmada veriler nitel veri toplama yöntemlerinden görüşme yöntemi kullanılarak toplanmış ve görüşmelerden elde edilen nitel verilerin analizinde içerik analizi yöntemi kullanılmıştır. Araştırmanın bulgularına göre kadınlar evlenmek istedikleri kişinin yaşının kendi yaşlarından büyük olmasını, ortalama fiziksel özelliklere sahip olmasını tercih etmektedir.  Kadınların en çok aradığı kişilik özelliği dürüstlük olmuştur ve bunu sırasıyla girişken, saygılı ve anlayışlı olma izlemiştir.  Kadınlar evlenmek istedikleri kişinin kişilik özellikleri ve sosyal statü teması altında gruplanan özellikler açısından kendilerinden farklı olmasını, en çok ilgili ve sevecen temaları altında belirtilen babalık özelliklerine sahip olmasını istediklerini belirtmişlerdir. Evlenmek istenilen kişinin kendileriyle benzer ya da daha yüksek ekonomik gelir ve statüye sahip olmasını,  kişisel zevkler ve kültürel temalara ilişkin konularda uyumlu olmayı bekledikleri belirtilmiştir. Ayrıca kadınlar, evlenmek istedikleri kişinin aileleriyle saygılı, yakın, samimi ve iyi bir ilişkisi olmasını istediklerini, ailenin kültürel uyum, sosyal statü ve kişilik özellikleri temaları kapsamındaki nitelikler konusunda eş seçimini etkilediğini ifade etmişlerdir. Araştırma bulguları, ilgili literatür doğrultusunda tartışılmıştır.

  6. Contribución de las alteraciones del metabolismo lipídico al desarrollo de esteatosis hepática en rata wistar con el envejecimiento. Papel de la señalización hipotalámica de leptina.

    OpenAIRE

    Salamanca Molina, Aurora

    2013-01-01

    El proceso de envejecimiento conlleva el desarrollo de múltiples patologías entre las que se puede destacar el síndrome metabólico por su elevada incidencia entre la población mundial. Este cuadro patológico se puede considerar el reflejo del declive metabólico asociado al envejecimiento y se origina por la pérdida de efectividad de los procesos de regulación del metabolismo que resultan en el desarrollo de sobrepeso, resistencia a insulina, dislipemia e hipertensión. Por todo esto, el síndro...

  7. Las estructuras de la Cuenca de Bermejo y Sierra de Valle Fértil a partir de los métodos deconvolución de Euler y señal analítica The structures of the Bermejo Basin and Sierra de la Huerta based on Euler deconvolution and analytic signal techniques

    Directory of Open Access Journals (Sweden)

    Federico Lince Klinger

    2008-06-01

    Full Text Available Se aplicaron técnicas de señal analítica y deconvolución de Euler a valores de anomalías de Bouguer de la cuenca de Bermejo y de la sierra de Valle Fértil, en el sector occidental de las Sierras Pampeanas. A partir de las soluciones encontradas por estas técnicas, se han interpretado la ubicación y profundidad de las fuentes causantes de anomalías, las que se vinculan con las estructuras geológicas que involucran al basamento. Con el objeto de verificar los resultados obtenidos y de minimizar las ambigüedades de los métodos potenciales, se preparó un modelo gravimétrico directo basado en un modelo estructural del área. A la respuesta gravimétrica de este modelo directo se le aplicó la técnica de señal analítica 2D, encontrándose soluciones que son consistentes con la profundidad y geometría de las fuentes previamente interpretadas, corroborando los resultados obtenidos.These geophysical techniques were applied to the Bouguer anomalies in the Bermejo Basin and Valle Fértil range. The location and depth to source of the anomalies were interpreted from the solutions obtained by these techniques. The found sources have been related with the geologic structures affecting the basement. In order to verify the results obtained and minimize the ambiguity of these potential methods, a forward gravimetric model was prepared, based on a geological and structural model of the area. The 2D analytic signal technique was applied to the gravimetric response of the model, and the solutions found are consistent with the depth and geometry of the above recognized sources, confirming the results obtained.

  8. Carta al Editor

    Directory of Open Access Journals (Sweden)

    José Andrés Burgos Zuleta

    2010-06-01

    Full Text Available La medicina al basarse generalmente en la clínica, correlacionaexámenes complementarios y organiza un diagnóstico y tratamiento, es una disciplina donde es imprescindible saber recolectar, analizar, interpretar y concretar una respuesta adecuada, es así que la información que se recibe es esencial para el desempeño médico.La certeza es una realidad que se da en algunas situaciones y enotras las probabilidades establecen conclusiones. Lo normal muchas veces se define sobre la base de criterios estadísticos, basados en riesgos poblacionales que no necesariamente se aplican al caso boliviano.

  9. Epitaxial 2D MoSe2 (HfSe2) Semiconductor/2D TaSe2 Metal van der Waals Heterostructures.

    Science.gov (United States)

    Tsoutsou, Dimitra; Aretouli, Kleopatra E; Tsipas, Polychronis; Marquez-Velasco, Jose; Xenogiannopoulou, Evangelia; Kelaidis, Nikolaos; Aminalragia Giamini, Sigiava; Dimoulas, Athanasios

    2016-01-27

    Molecular beam epitaxy of 2D metal TaSe2/2D MoSe2 (HfSe2) semiconductor heterostructures on epi-AlN(0001)/Si(111) substrates is reported. Electron diffraction reveals an in-plane orientation indicative of van der Waals epitaxy, whereas electronic band imaging supported by first-principles calculations and X-ray photoelectron spectroscopy indicate the presence of a dominant trigonal prismatic 2H-TaSe2 phase and a minor contribution from octahedrally coordinated TaSe2, which is present in TaSe2/AlN and TaSe2/HfSe2/AlN but notably absent in the TaSe2/MoSe2/AlN, indicating superior structural quality of TaSe2 grown on MoSe2. Apart from its structural and chemical compatibility with the selenide semiconductors, TaSe2 has a workfunction of 5.5 eV as measured by ultraviolet photoelectron spectroscopy, which matches very well with the semiconductor workfunctions, implying that epi-TaSe2 can be used for low-resistivity contacts to MoSe2 and HfSe2. PMID:26727305

  10. « Comment se comporter avec un roi chrétien » : l’ouvrage perdu d’Abū l-Ḥasan ʿAlī Ibn al-Qaṭṭān et les enjeux du cérémonial almohade

    Directory of Open Access Journals (Sweden)

    Mehdi Ghouirgate

    2014-05-01

    Full Text Available Cet article propose de revenir sur un document aussi exceptionnel que méconnu. Il s’agit du résumé d’un ouvrage (maqāla, aujourd’hui perdu, intitulé « Comment se comporter avec un roi chrétien », et que l’on trouve dans le dictionnaire bio-bibliographique d’Ibn ʿAbd al-Malik. Cette maqāla fut rédigée, par un homme de lettres au service des Almohades, Abū l-Ḥasan ʿAlī Ibn al-Qaṭṭān (m. 1231. C’est la seule source qui ait consigné des indications sur la conduite que devait adopter le souverain lors d’une cérémonie, en présence d’un prince étranger. À ce titre, on y trouve des renseignements essentiels sur le cérémonial almohade ainsi que sur les dilemmes que devaient résoudre le calife : d’un point de vue idéologique, il ne pouvait souffrir aucun autre pouvoir, mais l’impossibilité de mener des opérations d’envergure sur deux fronts à la fois l’amena à composer avec le roi du León. De même, c’est le seul document à avoir fait état d’une divergence de point de vue entre le calife et les intellectuels organiques du système, les Ṭalaba. Ce différend met en lumière des tensions latentes au sommet entre divers serviteurs de l’État, qui n’avaient pas la même forme de légitimité, ni tout à fait les mêmes intérêts.

  11. Modulación de la transducción de la señal asociada a receptores tirosina quinasa por el fragmento C-terminal de la toxina tetánica en tejido nervioso

    OpenAIRE

    Chaib Oukadour, Imane

    2004-01-01

    Las neurotoxinas clostridiales (CNTs) producen patologías graves como el tétanos y el botulismo. En ambas patologías la muerte se produce en un porcentaje elevado y generalmente por colapso respiratorio y asfixia. Esta capacidad de causar la muerte en organismos superiores es responsabilidad de la actividad metaloproteásica dependiente de zinc que tienen estas toxinas en el dominio catalítico.Sin embargo, además de la actividad metaloproteásica también se han descubierto otras acciones farmac...

  12. Volver al desarrollo

    Directory of Open Access Journals (Sweden)

    Jaime Ornelas Delgado

    2012-01-01

    Full Text Available El desarrollo, categoría empleada para expresar el crecimiento económico, surge durante la "guerra fría" y si bien fue propuesta por teóricos metropolitanos, se asumió en Latinoamérica como parte de los instrumentos disponibles para lograr el crecimiento y alternativa al socialismo. El desarrollo mantuvo su vigencia entre 1945 y 1975, cuando al advenimiento del neoliberalismo fue paulatinamente retirado de la agenda de las preocupaciones nacionales e internacionales. Al iniciarse el siglo xxi, el fracaso del mercado autorregulado trajo de nueva cuenta al debate los problemas del desarrollo, lo que obliga a revisarlo críticamente, tanto como al concepto mismo para mostrar su carácter colonial, si se quiere construir caminos ajenos al neoliberal y superar los problemas que han hecho de Latinoamérica una de las regiones más desiguales del mundo.

  13. Proposals for an effective application of the continuous improvement at the ININ according to the IAEA 50-C/SG-Q new code; Propuestas para una aplicacion efectiva del proceso de mejora continua en el ININ, de acuerdo al nuevo codigo 50-C/SG-Q del OIEA

    Energy Technology Data Exchange (ETDEWEB)

    Cardenas A, B.M.; Olivares O, L.A. [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, 11801 Mexico D.F. (Mexico)

    1997-07-01

    This work contains the requirements of continuous improvement contained in the IAEA new code {sup Q}uality assurance for safety in nuclear power plants and other nuclear installations, code 50-C/SG-Q. Assuming that it was the base for to elaborate the review No. 5 of the Quality assurance plan at ININ, it was done an analysis to give proposals for the application of continuous improvement in effective way. The relevant points which must be taken in account at the continuous improvement process are: Direction responsibility, involucring of all personnel, process planning, education and training, elaboration of improvement projects, investigation of processes which can be improved, continuation of the improvement process and its evaluation. With the implantation of an effective continuous improvement system it will be obtained to get a better quality and a more efficient safety. (Author)

  14. Introducción al estudio de las mineralizaciones del Señorío y Tierra de Molina de Aragón (Guadalajara, España)

    OpenAIRE

    Mata Perelló, José M.; Octavio PUCHE RIART

    1992-01-01

    In this communication it's efected an introduction to the study of the mineralizations placed in the Señorio and Tierra de Molina de Aragón an historical demarcation of Guadalajara situated in the Sistema Ibérico. In this comunication, we will introduce the Study Castilian mineralizations between them, C/Ag are present as well as stratiform iron and copper mineralization.

  15. SiO{sub 2} and Al{sub 2}O{sub 3}/SiO{sub 2} coatings for increasing emissivity of Cu(In, Ga)Se{sub 2} thin-film solar cells for space applications

    Energy Technology Data Exchange (ETDEWEB)

    Shimazaki, Kazunori [Japan Aerospace Exploration Agency (JAXA), Institute of Aerospace Technology, 2-1-1 Sengen, Tsukuba, Ibaraki 305-8505 (Japan)], E-mail: shimazaki.kazunori@jaxa.jp; Imaizumi, Mitsuru [Japan Aerospace Exploration Agency (JAXA), Institute of Aerospace Technology, 2-1-1 Sengen, Tsukuba, Ibaraki 305-8505 (Japan)], E-mail: imaizumi.mitsuru@jaxa.jp; Kibe, Koichi [Japan Aerospace Exploration Agency (JAXA), Institute of Aerospace Technology, 2-1-1 Sengen, Tsukuba, Ibaraki 305-8505 (Japan)], E-mail: kibe.koichi@jaxa.jp

    2008-02-29

    In this study, optical coatings were investigated as substitutes for the coverglass on flexible thin-film space solar cells. The inherent low emissivity of copper-indium-gallium-diselenide (CIGS) thin-film solar cells was increased using optical coatings for thermal balance in space. Evaporated silicon dioxide (SiO{sub 2}) and an additional aluminum oxide (Al{sub 2}O{sub 3}) coating on the CIGS solar cell increased the emissivity from 0.18 to 0.77. Higher emissivity was realized with the Al{sub 2}O{sub 3}/SiO{sub 2} double-layer coating than with the SiO{sub 2} single-layer coating. The straightforward double-layer coating gives the CIGS solar cells appropriate radiative properties for keeping the cell within a permissible temperature range in space.

  16. Quasikristalle und verwandte Phasen im System Zn-Mg-SE (SE=Y, Er, Ho, Dy)

    OpenAIRE

    Sterzel, Roland

    2003-01-01

    Ziel dieser Arbeit ist die Herstellung und Charakterisierung von Zn-Mg-SE-Legierungen (SE = Y, Ho, Er, Dy, Tb, Gd), um Informationen über Struktur, Stabilisierung und physikalische Eigenschaften der quasikristallinen Phasen dieses Systems zu erhalten. Die Quasikristalle dieses Systems unterscheiden sich von Quasikristallen anderer Legierungen, die meist Al als Hauptkomponente enthalten. Es konnten bis zu 275 mm3 große Einkristalle der flächenzentriert ikosaedrischen Phase in den Systemen Zn-M...

  17. Desarrollo de una aplicación para la adquisición y análisis de la señal de presión intracraneal para la detección de hidrocefalia normotensa

    OpenAIRE

    Riboul Ojeda, Alexandra

    2011-01-01

    El objetivo es realizar una aplicación, partiendo de cero, que cumpla todas las expectativas y requisitos de los especialistas, sencilla en su uso, y que facilite diagnosticar problemas con rapidez. En concreto se trata del desarrollo de un software específico que permita el diagnóstico de hidrocefalia normotensa del adulto, el único tipo de demencia tratable y/o curable en la actualidad. El software debe permitir el análisis de la presión intracraneal de los pacientes, con lo que aunque l...

  18. Structural study of ZnSe films grown on substrate with In{sub x}Ga{sub 1-x}As and Al{sub 1-x}Ga{sub x}As buffer layers: strain, relaxation and lattice parameter

    Energy Technology Data Exchange (ETDEWEB)

    Perez Ladron de Guevara, H.; Gaona-Couto, A.; Vidal, M.A. [Instituto de Investigacion En Comunicacion Optica (IICO), Universidad Autonoma de San Luis Potosi, San Luis Potosi (Mexico)]. E-mail: mavidal@cactus.iico.uaslp.mx; Luyo Alvarado, J.; Melendez Lira, M.; Lopez-Lopez, M. [Departamento de Fisica, Centro de Investigacion y Estudios Avanzados del IPN, Mexico DF (Mexico)

    2002-06-21

    ZnSe layers of various thickness were grown on (001) GaAs substrates, using In{sub x}Ga{sub 1-x}As or Al{sub 1-x}Ga{sub x}As as buffer layers by molecular beam epitaxy and were studied by high-resolution x-ray diffraction. The principal structural characteristics of ZnSe layer and buffer layer were determined using several reflections, such as (004) and two pairs of coupled asymmetric reflections, namely (224), (-2-24) and (115) (-1-15). In order to evaluate their validity, the experimental data obtained from these reflections were handled by means of two known expressions found in the literature. We have found the relaxation process of ZnSe layers is well described by a geometrical model including the thermal strain and small strain due to work hardening. The relaxation process is faster for ZnSe grown on ternary buffer layers despite the fact that, some buffer layers are pseudomorphically grown to the substrate; therefore we conclude that not only the lattice mismatches have effect on the relaxation process but also the surface state of the buffer layer has an influence in this process. (author)

  19. Extension of the T{sub z} = {minus}3/2, A = 4n + 1 series of beta-delayed proton emitters to {sup 65}Se and {sup 73}Sr, and low energy beta-delayed proton emission from the T{sub z} = {minus}3/2, A = 4n + 3 nucleus {sup 23}Al

    Energy Technology Data Exchange (ETDEWEB)

    Batchelder, J.C.

    1993-12-01

    The series of known Tz = {minus}3/2, A = 4n + 1 nuclei has been extended to include the previously undiscovered isotopes {sup 65}Se and {sup 73}Sr, through the observation of beta-delayed proton emission via the isobaric analog state (IAS) of the beta-daughter (emitter). Due to the relatively large proton energies involved, these experiments were conducted using standard Si-Si {Delta}E-E telescopes. Beta-delayed protons arising from {sup 65}Se have been observed at an energy (laboratory) of 3.55 {plus_minus} 0.03 MeV, corresponding to the decay of the T = 3/2 isobaric analog state in {sup 65}As to the ground state of {sup 64}Ge. Similarly, beta-delayed protons from {sup 73}Sr at an energy of 3.75 {plus_minus} 0.04 MeV have been observed, corresponding to decay of the T = 3/2 isobaric analog state in {sup 73}Rb to the ground state of {sup 72}Kr. From the energies of these proton transitions, an improved prediction of the mass excesses of the two parent nuclei ({sup 65}Se and {sup 73}Sr) is made through the use of a Coulomb displacement formula. These predictions are {minus}33.41 {plus_minus} 0.26 and {minus}31.87 {plus_minus} 0.24 MeV for {sup 65}Se and {sup 73}Sr, respectively. Studies of low energy (down to {approximately}200 keV) beta-delayed protons from {sup 23}Al necessitated that a particle identification telescope with a low energy threshold for observation and identification of protons be developed. {sup 23}Al is of interest because of its role in the breakout of the hot CNO cycle leading to the astrophysical rp process.

  20. Orden ARM/2173/2010, de 30 de julio, por la que se crea y regula la Comisión de Coordinación de Bibliotecas del Ministerio de Medio Ambiente, y Medio Rural y Marino y de los organismos y entidades vinculadas al mismo

    OpenAIRE

    España Ministerio de Medio Ambiente y Medio Rural y Marino

    2010-01-01

    Con la constitución de la Comisión de Coordinación de las Bibliotecas del Ministerio de Medio Ambiente, y Medio Rural y Marino se persiguen dos fines: servir de instrumento de apoyo al estudio y por otro lado: que la riqueza de sus colecciones revierta de manera más eficaz en el conjunto de la sociedad en forma de mayor y más fácil accesibilidad por parte de los ciudadanos a todo el patrimonio bibliográfico

  1. Un manual español de administración y contabilidad señorial de principios de siglo XVII: el compendio en materia de acrecentar Estado y hazienda, tocante al oficio de contador, de Gabriel Pérez del Barrio Angulo. (A Spanish guide book on administration and accounting of the early 17th Century: the compendium for the increase of the state and treasury, with regards to the post of accountant, by Gabriel Pérez del Barrio Angulo)

    OpenAIRE

    González Ferrando, José Mª

    2013-01-01

    Frente a lo ocurrido en Inglaterra, donde cuentan con manuscritos sobre administración y contabilidad señorial desde el siglo XIII, en España sólo se conocen hasta ahora cuatro textos de los siglos XV al XVII en que sus autores se ocupan con mayor o menor detalle de este asunto, pero de los que sólo uno, publicado inicialmente en 1613, puede equipararse en cierto modo a los ingleses: el ‘Compendio en razón de acrecentar Estado y Hacienda y Oficio de Contador’ de Gabriel Pérez del Barrio. (Aga...

  2. Mémoires et patrimonialisation d’un passé antéislamique : Mubârak al-Mîlî et l’ethnogenèse du peuple algérien

    OpenAIRE

    Hannouz, Aomar

    2014-01-01

    Dès les débuts de l’indépendance de l’Algérie, les nationalistes ont insisté sur son identité arabo-musulmane. L’islamisation de l‘Afrique du Nord était au fondement de la nation algérienne. Le passé antique de la région en devenait quasiment exclu de l’histoire temporelle et écrite. Grâce aux travaux de James MacDougall, on connaît bien l’importance de l’œuvre de Tawfîq al-Madanî (m. 1983) dans la construction d’une identité nationale algérienne. Or, celle d’un autre historien proche de l’As...

  3. Pouvoir et production urbaine à Tripoli Al-Fayhā’a (Liban) : quand l’illusio de la rente foncière et immobilière se mue en imperium

    OpenAIRE

    Dewailly, Bruno

    2016-01-01

    La recherche dont je présente aujourd’hui les résultats est en chantier depuis près de quinze ans. Géographe-urbaniste de formation, je m’y suis engagé dans l’optique d’une réflexion, en géographie politique et urbaine, centrée sur la question du pouvoir à l’échelle d’une agglomération libanaise : Tripoli al-Fayhā’a. Cet intérêt s’est construit et organisé autour de quatre questions principales :• En premier lieu, pourquoi, une dizaine d’années environ après la fin de la guerre civile (1990),...

  4. Contenha-se, se for capaz

    Directory of Open Access Journals (Sweden)

    Mirna Feitoza Pereira

    2008-11-01

    Full Text Available Em O Instinto da Linguagem, Steven Pinker discorre sobre sua célebre tese: a linguagem não é a mais prodigiosa invenção cultural humana. Ela é uma peça da constituição biológica do cérebro. A linguagem é uma habilidade complexa e especializada, que se desenvolve espontaneamente na criança, sem qualquer esforço consciente ou instrução formal, que se manifesta sem que se perceba sua lógica subjacente, que é qualitativamente a mesma em todo indiví­duo, e que difere de capacidades mais gerais de processamento de informações ou de comportamento inteligente. Para Pinker, a concepção de linguagem como um tipo de instinto transmite a idéia de que as pessoas sabem falar mais ou menos da mesma maneira que as aranhas sabem tecer suas teias. Ele apóia suas idéias em Darwin e Chomsky. Palavras-chave linguagem, gramática universal, evolução Abstract In Language Instinct, Steven Pinker argues about his famous thesis: language is not the most prodigious human cultural invention. It is a distinct piece of the biological constitution of the brain. Language is a complex, specialized skill, which develops spontaneously in the child, without conscious effort or formal instruction. It reveals itself without awareness of its underlying logic, which is qualitatively the same in every individual, and which is distinct from more general abilities of information processing of intelligent behavior. According to Pinker, the conception of language as a kind of instinct conveys the idea that people know how to talk in more or less the same way as spiders know how to spin webs. His thesis is founded in Darwin and Chomsky-s theories. Keywords language, universal grammar, evolution

  5. ¿COLOMBIA DEBE APOSTARLE AL SOFTWARE LIBRE, AL DE FUENTE ABIERTA O AL PROPIETARIO?

    Directory of Open Access Journals (Sweden)

    Luis Alberto Girón Murillo

    2014-06-01

    Full Text Available Es complejo para gestores y administradores conocer las implicaciones que la adopción de modelos de desarrollo de software tendría para una región. Este artículo ofrece una evaluación de las implicaciones dinámicas que para el desarrollo de software de una región tendría el apostar de forma excluyente al software libre, al software de fuente abierta y al software propietario. Se desarrolló un modelo de simulación en Vensim de la dinámica de sistemas en donde se evaluaron 3 escenarios: uno en donde se adopta de forma excluyente el software libre, uno en donde se adopta el software propietario y uno en donde se adopta el software de fuente abierta. Se ofrecen descripciones y explicaciones de los resultados que sugieren las potencialidades de cada uno de los modelos de desarrollo evaluados.

  6. SE-FIT

    Science.gov (United States)

    Chen, Yongkang; Weislogel, Mark; Schaeffer, Ben; Semerjian, Ben; Yang, Lihong; Zimmerli, Gregory

    2012-01-01

    The mathematical theory of capillary surfaces has developed steadily over the centuries, but it was not until the last few decades that new technologies have put a more urgent demand on a substantially more qualitative and quantitative understanding of phenomena relating to capillarity in general. So far, the new theory development successfully predicts the behavior of capillary surfaces for special cases. However, an efficient quantitative mathematical prediction of capillary phenomena related to the shape and stability of geometrically complex equilibrium capillary surfaces remains a significant challenge. As one of many numerical tools, the open-source Surface Evolver (SE) algorithm has played an important role over the last two decades. The current effort was undertaken to provide a front-end to enhance the accessibility of SE for the purposes of design and analysis. Like SE, the new code is open-source and will remain under development for the foreseeable future. The ultimate goal of the current Surface Evolver Fluid Interface Tool (SEFIT) development is to build a fully integrated front-end with a set of graphical user interface (GUI) elements. Such a front-end enables the access to functionalities that are developed along with the GUIs to deal with pre-processing, convergence computation operation, and post-processing. In other words, SE-FIT is not just a GUI front-end, but an integrated environment that can perform sophisticated computational tasks, e.g. importing industry standard file formats and employing parameter sweep functions, which are both lacking in SE, and require minimal interaction by the user. These functions are created using a mixture of Visual Basic and the SE script language. These form the foundation for a high-performance front-end that substantially simplifies use without sacrificing the proven capabilities of SE. The real power of SE-FIT lies in its automated pre-processing, pre-defined geometries, convergence computation operation

  7. Comentarios al Salto Social

    Directory of Open Access Journals (Sweden)

    Facultad de Ciencias Económicas

    1995-06-01

    Full Text Available 1. El Plan considera que la política social es un componente central de la estrategia macroeconómica. A diferencia de la administración Gaviria, lo social ha dejado de ser un asunto marginal, es consustancial al desarrollo y, por tanto, se le confiere una dimensión cualitativamente diferente.

  8. SE debt restructuring plan

    International Nuclear Information System (INIS)

    Slovenske elektrarne, a.s. (SE) plans to restructure one's own debts in 2003-2005. Debt restructuring plan is following: 2003: Collection of pre-payment on electricity - 60 million Euro (2.5 billion Slovak crowns), consumer unknown. Own promissory notes in total value of 100 million US$ (3.5 billion Slovak crowns) - in process. Sale of claims worth 2.4 billion Slovak crowns (57.21 million Euro) - negotiations in process. 2003/2004: Restructuring of loans payable IV. quarter 2003 and at the beginning of 2004 in value of 200 million Euro (8.3 billion Slovak crowns). Aim of SE is a new credit payable within 7 years, with instalments payable in the last two to three without any state subsidies. 2005: Loans worth 460 million Euro (189 billion Slovak crowns) will still remain. SE want to negotiate them with banks without state support

  9. SE-selskabet

    DEFF Research Database (Denmark)

    Schaumburg-Müller, Peer; Werlauff, Erik

    Bogen behandler den særlige, fælleseuropæiske aktieselskabstype, der står til valgfri disposition for virksomhederne i form af europæiske aktieselskaber, såkaldte SE-selskaber, som alene kan stiftes ved en grænseoverskridende transaktion.......Bogen behandler den særlige, fælleseuropæiske aktieselskabstype, der står til valgfri disposition for virksomhederne i form af europæiske aktieselskaber, såkaldte SE-selskaber, som alene kan stiftes ved en grænseoverskridende transaktion....

  10. Análisis matemático aplicado al diseño de sistemas de instrumentación electrónica para adquisición de señales en módulos robóticos

    OpenAIRE

    Morales, Diana; Cruz, Mary; Umaña, Oscar; Jimenez, Fabian

    2013-01-01

    Este artículo describe el análisis matemático de la implementación definitiva del diseño, simulación y construcción de los sistemas de instrumentación para la adquisición de la señal. La matemática aplicada permite el diseño de algoritmos y procedimientos para modelar, representar, simplificar y evaluar los sistemas electrónicos en aplicaciones industriales tales como la robótica, explorada en este proyecto. Este desarrollo matemático permite poner en práctica los sistemas electrónicos de ad...

  11. The Structure and Electrical Properties of the Ag2Se + Ga2Se3 + GeSe2 Glass System

    Science.gov (United States)

    Marple, Maxwell Adam Thomas

    Silver containing homogeneous chalcogenide glasses in the ternary system Ag2Se-Ga2Se3-GeSe2 (AGGS) are synthesized and their atomic structure-property relationships are investigated. Structural studies are carried out using Raman, 77Se, 71Ga, 69Ga, and 109Ag nuclear magnetic resonance (NMR) spectroscopy. The structure of these glasses consists primarily of a network of corner sharing (Ga/Ge)Se4/2 tetrahedra with a small fraction of homopolar Se-Se bonds. Compositional modification of the atomic structure follows the charge compensated network model developed in the literature for aluminosilicate glasses. Ag2Se acts as a network modifier, forming non-bridging Se in glasses with Ag/Ga >1, while Ga 2Se3 plays the role of a network intermediate similar to Al2O3 in oxide glasses. The network favors the formation of homopolar Ge-Ge bonding in glasses with Ag/Ga <1, to accommodate the Se deficiency brought by the incorporation of Ga2Se3 with Ga being tetrahedrally coordinated to Se. This structural model is consistent with the variation in the glass transition temperatures and molar volume. Electrical Impedance Spectroscopy (EIS) reveals the ionic conductivity of the AGGS glasses to be quite high at ambient temperature, reaching up to 10 --4 S/cm for glasses with the highest Ag content. Increasing Se deficiency with respect to stoichiometry can enhance the conductivity further to ˜3x10--4 S/cm . Transference number measurements using the electromotive force (EMF) method as well as variable temperature 109Ag NMR line shape studies indicate that the conductivity is predominantly ionic in nature and results from fast hopping dynamics of Ag ions. The high ionic conductivity can be related to a heavily modified structural network that results in a potential energy landscape with many suitable hopping sites for the Ag ions. These structural characteristics and electrical properties of the glasses in the AGGS system may guide in the development of next generation fast ion

  12. El cielo se llena de santos mexicanos

    Directory of Open Access Journals (Sweden)

    Verónica Zárate Toscano

    2005-02-01

    Full Text Available Preliminares A fines del próximo mes de julio, si Dios le conserva la vida y su salud se lo permite, el Papa Juan Pablo II elevará a la categoría de Santo al indio Juan Diego en una ceremonia en la ciudad de México, culminando así un largo, discutido y tortuoso proceso de canonización. Suerte parecida corrió en su momento el criollo Felipe de Jesús; sin embargo, otros miembros de la corte celestial de origen mexicano se han elevado a los altares de manera casi vertiginosa, como es el caso de ...

  13. Se min kjole

    DEFF Research Database (Denmark)

    Bogen Se min kjole udkom i anledning af 50-året for de første ordinationer af kvindelige præster i den danske folkekirke i 1948. Bogen giver analyser af, hvad kvindelige præster har betydet for præsterollen og for prædikengenren; den fortæller om de første kvindelige præsters liv og syn på...

  14. ALS - resources

    Science.gov (United States)

    Resources - ALS ... The following organizations are good resources for information on amyotrophic lateral sclerosis : Muscular Dystrophy Association -- mda.org/disease/amyotrophic-lateral-sclerosis National Amyotrophic Lateral Sclerosis (ALS) Registry -- ...

  15. Türkiye’de Seçilmiş Bazı İllerde Arı Ürünlerinin Tüketim Alışkanlıklarının ve Farkındalık Düzeylerinin Belirlenmesi

    Directory of Open Access Journals (Sweden)

    Rahşan İvgin Tunca

    2015-07-01

    Full Text Available Bu çalışmanın amacı, Türkiye genelinde seçilmiş illerde, bal başta olmak ve arı ürünleri tüketimini etkileyen faktörler ile arı ürünlerinin tüketim alışkanlık ve farkındalık düzeylerini değerlendirmektir. Çalışmanın ana materyalini, 2014 yılı içerisinde Batman, Bursa, Diyarbakır, Erzincan, Kayseri, Kırşehir, Mersin, Muğla, Muş, Ordu ve Samsun illerinden tesadüfî olarak seçilen 1112 kişiye yapılmış olan anket çalışmasından elde edilen orijinal veriler oluşturmuştur. Çalışmadaki veriler iki kısımda incelenmeye alınmıştır. İlk kısım ankete katılanların bal tüketim alışkanlık ve farkındalıklarını içerirken, ikinci kısımda bireylerin polen, propolis, arı sütü ve zehiri gibi arı ürünlerinin kullanım tercihleri incelenmiştir. Her bir kısım için arı ürünleri üzerinde çalışılan değişkenlere ait verilere çok değişkenli lojistik regresyon modeli uygulanmıştır. Araştırma sonuçlarına göre, tüketicilerin % 39.6’sı aylık olarak 0-500 gram arasında bal tükettiği tespit edilmiştir. Tüketicilerin % 51.2’ si balı genel olarak tanıdıklardan, % 41’i ise market ve pazardan aldıklarını belirtmişlerdir. Televizyonda yapılan reklamları inandırıcı bulanların oranı % 5.9 olarak belirlenmiştir. Bal kullananların % 45.8’ i balın kalitesini anlayabildiğini ifade etmişlerdir. Marka olmasına dikkat edenlerin oranı % 52.7 olarak belirlenmiştir. Tüketicilerin yaşı, balı nereden aldığı, balda marka tercihi ve bal reklamlarını inandırıcı bulma durumları 0.05’e göre, eğitim seviyesi, aylık gelir, bal tipi tercihi ve bal reklamından etkilenme durumları ise 0.01’e göre önemli bulunmuştur. Tüketicilerin propolis, polen, arı zehri ve arı sütünü duyma oranları sırasıyla % 28.2 , % 22.9, % 56.8 ve % 23.3 olarak belirlenmiştir. Sonuç olarak çalışma, tüketicilerin arı ürünlerinin faydaları konusunda

  16. Tl2Mo9Se11

    Directory of Open Access Journals (Sweden)

    Patrick Gougeon

    2010-08-01

    Full Text Available The structure of Tl2Mo9Se11, dithallium nonamolybdenum undecaselenide, is isotypic with Tl2Mo9S11 [Potel et al. (1980. Acta Cryst. B36, 1319–1322]. The structural set-up is characterized by a mixture of Mo6Sei8Sea6 and Mo12Sei14Sea6 cluster units in a 1:1 ratio. Both components are interconnected through interunit Mo—Se bonds. The cluster units are centered at Wyckoff positions 3a and 3b (point-group symmetry overline{3}.. The two TlI atoms are situated in the voids of the three-dimensional arrangement. Two of the five independent Se atoms and the Tl atoms lie on sites with 3. symmetry (Wyckoff site 6c.

  17. Prevalência de sinais/sintomas sugestivos de sensibilização ao látex em profissionais de saúde Prevalencia de señales/síntomas sugestivos de sensibilidad al l átex en profesionales de la salud Prevalence of signs/symptoms suggestive of latex sensitization in health care workers

    Directory of Open Access Journals (Sweden)

    Lígia Andrade da Silva Telles Mathias

    2006-04-01

    rea de la salud. El objetivo de este estudio fue el de evaluar la prevalencia de señales/síntomas sugestivos de sensibilidad al látex en profesionales del área de la salud. MÉTODO: Después de aprobado por el Comité de Ética, se seleccionaron individuos pertenecientes a la plantilla de la institución: funcionarios del Sector de Limpieza, Contabilidad y División de Enfermería del Centro Quirúrgico; Médicos de Cirugía, Ginecología, Obstetricia, Anestesiología, Unidad de Terapia Intensiva y Clínica Médica. Después de recibir la información y consentir con la pesquisa, los individuos fueron sometidos a un cuestionario sobre: edad, sexo, categoría profesional; tipo y tiempo de contacto profesional con los derivados del látex; tipo de guante utilizado; señales/síntomas sugestivos de sensibilidad al látex dentro y fuera del ambiente hospitalario; señales/síntomas sugestivos de atopia y de alergia a alimentos. RESULTADOS: Fueron evaluados 326 cuestionarios (193 mujeres y 133 hombres, con edad entre 30 y 73 años. Un 75% de los encuestados tenían 10 años de profesión. La prevalencia de los señales/síntomas sugestivos de sensibilidad al látex dentro del ambiente hospitalario con relación a los grupos compuestos por los funcionarios del Sector de Contabilidad (no expuestos a derivados del látex en el ambiente de trabajo, y el resto de los individuos (expuestos a derivados del látex en el ambiente de trabajo, evidenció una diferencia significativa (p BACKGROUND AND OBJECTIVES: In the literature, the references on adverse reactions to latex products have been significantly increasing for the last few years. However, it lacks Brazilian data regarding the prevalence of latex-related sensitization in health care workers. The objective of this study was to evaluate the prevalence of signs and symptoms suggestive of latex-related sensitization in health care workers. METHODS: Upon approval by the Ethics Committee it were selected a population of

  18. De GPS al mapa

    Directory of Open Access Journals (Sweden)

    Esteban Dörries

    2016-03-01

    Full Text Available Las coordenadas Lambert obtenidas a partir de mediciones con equipos GPS de mano, llamados a veces navegadores, en ciertos casos confunden al usuario, por diferir claramente de su posición real al ser graficadas en un mapa del Instituto Geográfico Nacional (IGN: Esto puede resolverse con suficiente exactitud mediante una transformación de Molodensky, seguida de la correspondiente proyección cartográfica. Sin embargo, los tres parámetros necesarios para la transformación, supuestamente válidos para Costa Rica, se encuentran en muchas variantes y producen obviamente resultados diferentes. En este trabajo se analizan los fundamentos del problema y sus posibles soluciones, culminando con un estudio comparativo de ocho casos, que permite seleccionar los valores más adecuados para los parámetros.

  19. Experimental Conditions: SE51_S01_M01_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE51_S01_M01_D01 SE51 RIKEN tandem mass spectral database (ReSpect) for phytochemic...als: A plant-specific MS/MS-based data resource and database SE51_S01 L. japonicus accessions SE51_S01_M01 N

  20. Blacasset, “Se·l mals d’amor m’auzi ni m’es noisens” (BdT 96.10a; Pujol, “Dieus es amors e verais salvamens” (BdT 386.2; Alaisina ~ Carenza, “Na Carenza al bel cors avenenç” (BdT 12.1 = 108.1

    Directory of Open Access Journals (Sweden)

    Paolo Di Luca

    2012-09-01

    Full Text Available This paper provides a new critical edition of “Se·l mals d’amor m’auzi ni m’es noisens” by Blacasset and “Dieus es amors e verais salvamens by Pujol”. These two poets discuss a topic that is entirely new to Occitan lyric poetry: two young women about to enter a convent. While Blacasset expresses sadness about their choice of life in a convent, using elements of the funeral lament, Pujol praises it and believes it to be the only remedy for the corruption of the world. The tenso between women “Na Carenza al bel cors avenenç” seems to be conceived as a parody of this lyric debate: in the dialogue Alaisina and Yselda, who have doubts about becoming mothers, ask Na Carenza whether it is better to stay virgins or to marry; the latter advises them, in cryptic terms that are difficult to interpret, to become nuns, thereby gaining a husband (God but not children. I will suggest that the question of female authorship for this text be reconsidered, while proposing a new interpretation in the light of the lively debate in the medieval period about the suitability and prerogatives of virginity.

  1. Vorrats-SE ohne Arbeitnehmerbeteiligung

    OpenAIRE

    Blanke, Thomas

    2005-01-01

    Das neue Praxisfeld der SE wirft eine Fülle von Rechtsfragen auf. In Deutschland ist im März 2005 in Berlin die 'Go East Invest SE. Europäische Gesellschaft zur Industrieansiedlung und Markterschließung' in das Handelsregister eingetragen worden, obwohl entgegen Art. 12 Abs.2 SE-VO keine Regelung zur Arbeitnehmermitbestimmung getroffen wurde. Seit Oktober nimmt auch bereits der Handel mit Vorrats-SE Gestalt an. Vorrats-SE sind Gesellschaften, die allein zum Zweck des Handels mit dem SE-Mantel...

  2. Hereditariedade e suscetibilidade à reabsorção radicular em Ortodontia não se fundamentam: erros metodológicos e interpretativos repetidamente publicados podem gerar falsas verdades. Análise crítica do trabalho de Al-Qawasmi et al.² sobre a predisposição genética à reabsorção radicular de natureza ortodôntica Heredity and susceptibility to radicular resorption in Odontology do not base: methodological and interpretative repeatedly published mistakes can generate false truths. Critical analysis of Al-Qawasmi work about genetics predisposition to radicular reabsorption of orthodontic kind

    Directory of Open Access Journals (Sweden)

    Alberto Consolaro

    2004-05-01

    Full Text Available O trabalho de Al-Qawasmi et al.², publicado em agosto de 2003 no periódico Journal of Dental Research, procurou estabelecer um gene candidato para a hereditariedade e predisposição genética nas reabsorções dentárias em Ortodontia, mas apresentou e repetiu algumas limitações metodológicas e equívocos na interpretação de seu trabalho anterior de março de 2003¹. Nas conclusões afirmam explicitamente que os achados são preliminares e sugestivos, necessitando de confirmação por meio de estudos adicionais. Os resultados são correlacionados fundamentando-se em dados de outros autores sobre síndromes ósseas associadas a reabsorções por substituição, cervicais externas e não com as reabsorções radiculares externas apicais induzidas ortodonticamente. O gene da reabsorção radicular externa apical relacionada a tratamentos ortodônticos não foi determinado e muito menos a sua natureza hereditária. Nem tampouco, a suscetibilidade à reabsorção radicular em Ortodontia foi detectada ou provada. O trabalho analisado e os demais relacionados com o mesmo tema não conseguiram comprovar suas hipóteses porque ignoram que o primeiro passo para a reabsorção radicular externa é a destruição da camada cementoblástica e isto apenas ocorre a partir da ação de fatores locais. Analisando criticamente estes trabalhos podemos afirmar que procurar o gene da reabsorção radicular e da suscetibilidade a partir de pesquisas em mediadores e células clásticas demonstra a falta de um conhecimento completo e amplo da etiopatogenia deste importante fenômeno biológico, imprescindível para o estabelecimento da premissa dos trabalhos.The study of Al-Qawasmi et al.² published in August 2003 on Journal of Dental Research, aimed to establish a candidate gene for heritability and genetic predisposition to external root resorption in orthodontic patients. This paper, however, presents and repeated some methodological faults and equivocated

  3. Electron-impact ionization of Se2+ and Se3+

    Science.gov (United States)

    Pindzola, M. S.; Loch, S. D.

    2016-06-01

    Electron-impact ionization cross sections for Se2+ and Se3+ are calculated using a semi-relativistic configuration-average distorted-wave (CADW) method. Good agreement between the CADW calculations and recent experimental measurements are found for the single ionization of Se2+ from threshold to 500 eV and for the double ionization of Se2+ from threshold to 225 eV. Good agreement between the CADW calculations and recent experimental measurements are also found for the single ionization of Se3+ from threshold to 200 eV and for the double ionization of Se3+ near the peak of the cross section at 350 eV. Disagreements at other incident electron energies may be due to the complexity of the ionization pathways for low charged Se atomic ions, the various theoretical approximations, and the difficulty in measuring relatively small double ionization events.

  4. Patrimonio cultural: lo intangible se hace tangible

    Directory of Open Access Journals (Sweden)

    William Heredia Orjuela

    2004-11-01

    Full Text Available Se presentan tres reflexiones a manera de ensayo, elaboradas por estudiantes de vii semestre de la Facultad de Administración de Empresas Turísticas y Hoteleras. El tema central que engloba los escritos es el de la responsabilidad frente al patrimonio cultural, su valoración y su relación con el turismo. En el ensayo La protección del patrimonio cultural como reflejo del ser humano, la estudiante cecilia hinosTrosa hace un llamado de atención frente al problema del tráfico ilícito de bienes que conlleva la pérdida de testimonios de la cultura humana. El escrito de la estudiante mariel cecilia hernández destaca las bondades de recuperar las tradiciones y de cómo éstas se pueden difundir a través del turismo. Por último, el estudiante William heredia hace una reflexión sobre la tangibilidad de lo intangible, en el ensayo Patrimonio Cultural: lo tangible se hace intangible, donde destaca la declaratoria del Carnaval de Barranquilla como patrimonio oral e intangible de la humanidad.

  5. Gliricidia sepium al establecimiento

    Directory of Open Access Journals (Sweden)

    J. L. Valle

    2004-01-01

    Full Text Available Se asoció Cenchrus ciliaris (Cc y Gliricidia sepium (Gs para evaluar la producción de biomasa y la composición química de los forrajes en la fase de establecimiento, en el estado de Morelos, México, en condiciones de trópico seco. Se empleó un análisis de varianza con diseño en bloques al azar, en donde T1 fue pasto solo, T2 Cc más Gs con 5,000 plantas ha-1 y el T3 Cs más Gs con 14,285 plantas ha-1. Se midió la producción de forraje individual y asociado con materia seca (t MS/Ha, la altura (A en cm, la proteína cruda (PC%, las fracciones de fibra (FDN% y FDA% y la digestibilidad in vitro de la materia seca (DIVMS%. El T3 tuvo una mejor producción de biomasa (P0.05. La asociación de 14,285 plantas ha-1 de G. sepium con pasto Cenchrus ciliaris mejoró la producción de biomasa y la disponibilidad total de nutrientes por superficie cultivada al establecimiento

  6. Derivados vinculados al seguro.

    Directory of Open Access Journals (Sweden)

    De Paz Cobo, Sonia

    2003-01-01

    Full Text Available El presente trabajo tiene como objetivo la presentación de los derivados financieros como instrumentos de cobertura de los riesgos del seguro, así como de los principales proyectos que se desarrollan a través de los mismos, como por ejemplo los derivados sobre el clima. Hay que tener presente las pérdidas multimillonarias ocasionadas en casos como el de la banca Baring’s, o el de Orange County, por citar algunas, que si bien ciertos autores afirman que están en relación directa con el uso de estos productos, no podemos olvidar que los instrumentos derivados se desarrollaron con el objetivo principal de proteger al usuario de la posible volatilidad del activo subyacente. Ya en la industria aseguradora los derivados vinculados a tal actividad son instrumentos donde el pago se condiciona a la ocurrencia de su suceso de siniestro, o serie de sucesos múltiples que disparen las pérdidas. Tras el repaso efectuado y la descripción que este tipo de instrumentos puede tener en la gestión del riesgo por parte de la industria aseguradora, concluiremos con la exposición de las relaciones con el reaseguro tradicional así como una breve referencia al futuro de este tipo de instrumentos

  7. As and Se interactions with fly ashes

    OpenAIRE

    López Antón, María Antonia; Díaz Somoano, Mercedes; Martínez Tarazona, María Rosa

    2012-01-01

    [ES] El arsénico y el selenio son elementos tóxicos presentes en el carbón en concentraciones del orden de las trazas que pueden ser emitidos al medio ambiente durante los procesos de conversión del carbón. Sin embargo, los compuestos de arsénico y selenio pueden ser retenidos en las cenizas volantes originadas en el propio proceso en distint as proporciones dependiendo de las características de las cenizas y las condiciones del proceso. Este trabajo se centra en...

  8. Epitaxial growth of ZnSe and ZnSe/CdSe nanowires on ZnSe

    Energy Technology Data Exchange (ETDEWEB)

    Bellet-Amalric, E.; Bounouar, S.; Kheng, K. [CEA-CNRS-UJF Group, Nanophysique et Semiconducteurs, CEA Grenoble, INAC, 17 rue des Martyrs, 38 054 Grenoble (France); Elouneg-Jamroz, M.; Bougerol, C.; Hertog, M. den; Genuist, Y.; Poizat, J.P.; Andre, R.; Tatarenko, S. [CEA-CNRS-UJF Group, Nanophysique et Semiconducteurs, Institut Neel, BP 166, 38 042 Grenoble (France)

    2010-06-15

    We report the molecular beam epitaxy (MBE) growth of ZnSe nanowires (NWs) on a ZnSe(100) epilayer assisted by gold catalyst. Gold dewetting assists in the formation of nanotrenches along the [0-1-1] direction in the ZnSe buffer layer. Nucleation of the gold catalyst in the trenches leads to the growth of NWs preferentially in directions orthogonal to the trenches. The wires adopt mostly the wurtzite type structure and grow along the c-axis. CdSe quantum dots were inserted in the ZnSe NWs. The CdSe insertions systematically adopt a cubic zinc-blende arrangement with a[111] growth axis, as confirmed by transmission electron microscopy. (copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  9. Surface half-metallicity of half-Heusler compound FeCrSe and interface half-metallicity of FeCrSe/GaP

    Science.gov (United States)

    Khalaf Al-zyadi, Jabbar M.; Jolan, Mudhahir H.; Yao, Kai-Lun

    2016-04-01

    Recent studies showed that half-Heusler FeCrSe exhibits half-metallic ferromagnetism (Huang et al. [20]). In this paper, we investigate extensively the electronic, magnetic, and half-metallic properties of the half-Heusler alloy FeCrSe (111) and (001) surfaces and the interface with GaP (111) substrate by using the first-principles calculations within the density functional theory. The atomic density of states demonstrates that the half-me tallicity verified in the bulk FeCrSe is maintained at the CrSe-terminated (001) and Se-terminated (111) surfaces, but lost at both Cr- and Fe-terminated (111) surfaces and the Fe-terminated (001) surface. Alternatively, for the interface of FeCrSe/GaP (111), the bulk half-metallicity is destroyed at Se-P configuration while Se-Ga interface and subinterface show nearly 100% spin polarization. Moreover, the calculated interfacial adhesion energies exhibit that Se-Ga shape is more stable than the Se-P one. The calculated magnetic moments of Se, Ga at the Se-Ga (111) interface and P at the Se-P (111) interface increase with respect to the corresponding bulk values while the atomic magnetic moment of Se atom at the Se-P (111) interface decreases. We also notice that the magnetic moments of subinterface Fe at both Se-Ga and Se-P (111) interfaces decrease compared to the bulk values.

  10. Al Margen de las Cooperativas

    Directory of Open Access Journals (Sweden)

    Gutiérrez Estrada Julio

    1941-04-01

    Full Text Available El sistema Cooperativista, propiamente hablando, no viene a constituir una doctrina económica, es más bien una práctica, un modo de proceder en provecho de determinada agrupación de individuos que se asocian para defenderse de la usura del comercio y del intermediarismo parasitario. "El movimiento cooperativo es tan viejo como la revolución industrial, y ha crecido paralelamente a ella, podría decirse como una protesta en contra del sistema capitalista industrial. Generalmente se considera que tres principios fundamentales determinan su carácter distintivo. 1-Se esfuerza por dar "servido al costo" a sus miembros antes que beneficiarse del negocio con el público en general. El servicio de un grupo organizado se considera como un medio para obtener el máximum de eficacia con mínimo de desperdicio. 2-Insiste en que los beneficios pecuniarios se distribuyan al miembro como productor, después de deducir solamente el interés del capital al tipo que compite, y los salarios y jornales de los trabajadores. 3-Mantiene el control democrático del negocio por todos los participantes en él".

  11. Solid solutions CuAlxIn1-xSe2

    International Nuclear Information System (INIS)

    Solid CuAlxIn1-xSe2 solutions are synthesized by fusion with vibration. Phase equilibrium state diagram in CuInSe2-CuAlSe2 system is plotted by XRPA and DTA methods and the system thermodynamic analysis is performed. Thermal expansion anisotropy of CuAlSe2, CuInSe2 compounds and solid solutions on their base is studied. It is ascertained that coefficient of expansion along C axis is much lower than the coefficient of expansion along the direction, perpendicular to it; practically linear dependence of both expansion coefficients on the composition is observed at all temperatures. 16 refs.; 5 figs

  12. Recursos para visualizar algunas paradojas que se producen en el planeta Mercurio

    OpenAIRE

    Esteban, Esteban

    2011-01-01

    En este trabajo se exponen una serie de circunstancias muy curiosas que se producen en el planeta Mercurio, relativas al movimiento del Sol respecto a su horizonte. También se explica la manera de hacer un modelo que permita visualizar algunas de ellas y la forma de escenificar otras.

  13. Del latín al rumano

    Directory of Open Access Journals (Sweden)

    Montes Giraldo José Joaquín

    2003-06-01

    Full Text Available

    Marius Sala, Del latín al rumano. Versión española de Valeria Neagu, París, Unión Latina - Bucarest, Univers enciclopedic, 2002. El texto se dirige al lector corriente, no especialista, y por eso el aparato técnico-bibliográfico no se presenta en el curso de la exposición.

  14. Pintuco se internacionaliza en el mercado andino.

    Directory of Open Access Journals (Sweden)

    Carlos Enrique Ramírez R.

    2004-01-01

    Full Text Available La historia de la internacionalización de Pintuco está presentada en este trabajo. Es importante resaltar la valiosa información sobre el mercado mundial de pinturas lo cual despierta el interés del lector al mostrar el tamaño del mercado y la importancia económica del mismo. De igual forma, la introducción es muy expedita al señalar cuál es la tendencia de dicho mercado, pues con esto se puede hacer una idea de hacia dónde deberá ir Pintuco y cuáles serán sus principales retos a superar. Luego de dar un vistazo general de lo que son las pinturas y su impacto económico, el artículo continúa con la historia del Grupo Inversiones Mundial (GIM, ente económico que ha triunfado gracias a la tenacidad de sus directivos desde 1921. La estrategia utilizada por la empresa colombiana es explicada a través de los ejemplos de cómo empezó y se desarrolló en Venezuela y Ecuador, principalmente. Y es en esto, en lo que precisamente radica lo más importante del trabajo pues sirve como motivación y como ejemplo a seguir. Las empresas colombianas como Pintuco han entendido que una de las formas de amoldarse a las nuevas tendencias del mundo empresarial es la de competir con calidad, pero no sólo en su propio mercado, sino también en el mercado de origen de su competencia. Hoy en día las fronteras son cada vez más invisibles y eso, más que una amenaza, debería ser un atractivo.

  15. Sample Set (SE): SE14 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE14 Effect of agricultural films for tomato fruit metabolites Investigation of Sol...anum lycopersicum fruit metabolites. 3 growth conditions (covered with normal or UV cut agricultural film or no agricultural

  16. Sample Set (SE): SE16 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE16 Effect of agricultural films for spinach leaf metabolites 2 Investigation of S...pinacia oleracea leaf metabolites. 3 growth conditions (covered with normal or UV cut agricultural film or no agricultural

  17. Sample Set (SE): SE18 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE18 Global identification of phospholipid molecular species in mouse liver and bra...in by Orbitrap MS and automated search engine Lipid Search A comprehensive and precise identification of pho

  18. Sample Set (SE): SE10 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE10 Effect of phosphorus nutrition for cabbage metabolites Investigation of Brassi...ca oleracea var. capitata Hatukoi leaf metabolites. 3 growth conditions (high, low and no phosphorus nutrition

  19. Sample Set (SE): SE20 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE20 Arabidopsis thaliana leaf metabolite analysis for a software test Investigatio...es that were investigated to optimize the parameters of PowerGet software for better metabolite annotation i

  20. Sample Set (SE): SE19 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE19 Grobal triacylglycerol analysis in mouse liver and white adipose tissue (WAT) ...rol (TAG) molecular species from complex lipid mixtures of mouse liver and white adipose tissue (WAT) using

  1. Sample Set (SE): SE30 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE30 Comparison of seed metabolites among soybean varieties Investigation of Glycine max. green seed metabol...ites. 3 varieties (Kamogawashichiri, Koitozairai, Tanbakuro) data are examined. Tak

  2. Sample Set (SE): SE31 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE31 Comparison of seed metabolites among eggplant fruit tissues Investigation of S...olanum melongena Senryounigou metabolites. 3 tissues (flesh, fruit, peel) data are examined. Takeshi Ara 1,

  3. Sample Set (SE): SE3 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE3 Comparison of fruit metabolites among tomato varieties 1 Investigation of Solanum lycopersicum fruit met...abolites. 3 caltivars and an original species, 3 replicates data are examined. Naok

  4. Sample Set (SE): SE26 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE26 Effect of compost for cabbage metabolites Investigation of Brassica oleracea v...ar. capitata YR Seisyun leaf metabolites. 2 growth conditions (with or without 6t compost treatment) and 3 r

  5. Sample Set (SE): SE12 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE12 Effect of agricultural films for spinach leaf metabolites Investigation of Spi...nacia oleracea leaf metabolites. 2 cultivars (Nihon and Wasesaradaakari), 2 growth conditions (normal film and UV film

  6. Sample Set (SE): SE55 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE55 AtMetExpress development: a phytochemical atlas of arabidopsis development We analyzed phytochemical...idopsis produces various phytochemicals in a highly tissue-specific manner, which often accompanies the expr

  7. Colombia frente al manejo del Presupuesto Nacional

    Directory of Open Access Journals (Sweden)

    Germán Enrique Reyes Forero

    2009-07-01

    Colombia pasa de 38 puntos en el 2007 a 46 puntos en el 2009, mejoría que no se corresponde con los múltiples escándalos de corrupción; ésta mejoría responde al manejo de tecnicismos como se intentará aclarar en el presente articulo.

  8. Distribución espacial de señales de cambio climático en Colombia

    OpenAIRE

    Ochoa Jaramillo, Andrés; Poveda Jaramillo, Germán

    2008-01-01

    Se analiza si las tendencias de cambio climático detectadas por Mesa et.al. (1997) siguen algunos patrones espaciales. Asi mismo se evalúo la coherencia local entre las tendencias de cambio en las distintas variables.

  9. Sample Set (SE): SE48 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available e public mass spectral data depositories, including the plant-specific MS/MS-baseddatabase, ReSpect. Zhi...a,Jun Kikuchi,Kazuki Saito Zhigang Y et al. (2014) Metabolomics 10: 543-555 ...

  10. Vetenfinf se ha actualizado recientemente

    Directory of Open Access Journals (Sweden)

    Veterinaria.org

    2008-02-01

    Full Text Available ResumenSe trata de un sitio web alojado en el servidor de Veterinaria.org y mantenido por el Dr. Norberto Fondevila, del Instituto de Virologia CICVyA- INTA Cautelar de Argentina .

  11. Señas Mexicano

    Directory of Open Access Journals (Sweden)

    Juan F. García Mejía

    2007-01-01

    Full Text Available En este artículo se muestra un sistema que permite el estudio y práctica del Lenguaje de Señas Mexicano (LMS, el cual es el método de comunicación de las personas que padecen un trastorno de procesamiento auditivo. El sistema propuesto en este artículo consta de un guante de tela instrumentado con sensores de flexión, una etapa de acondicionamiento de señales y una tarjeta de adquisición de datos; que en su conjunto constituyen el Hardware. El software esta formado por un programa de adquisición de datos y una interfaz de usuario, ambos codificados en Visual Basic Net. El sistema propuesto se modela por medio del lenguaje de modelado unificado (UML, ya que Visual Basic es un lenguaje orientado a eventos.

  12. Trato verbal paterno al adolescente

    Directory of Open Access Journals (Sweden)

    Rodríguez Juan Carlos

    1995-06-01

    Full Text Available

    En alguna ocasión se ha escuchado una palabra, que causa un sentimiento y a la vez un recuerdo, que lleva a evocar la adolescencia o la infancia, se recuerda quien la pronunciaba y en que ocasión la decía. Este es el poder que tiene una palabra y más aún si es dicha por el padre, puesto que este es la figura significativa que se lleva en la memoria. De aquí nace el interés de realizar un estudio, en donde se describe y analice la percepción y el sentimiento del adolescente, quien en esta etapa es vulnerable al cambio, ya que está buscando su propia identidad; que con el trato verbal paterno la encontrara sin ninguna dificultad o por el contrario nunca la encontrará.

     

  13. AL Amyloidosis

    Directory of Open Access Journals (Sweden)

    Desport Estelle

    2012-08-01

    Full Text Available Abstract Definition of the disease AL amyloidosis results from extra-cellular deposition of fibril-forming monoclonal immunoglobulin (Ig light chains (LC (most commonly of lambda isotype usually secreted by a small plasma cell clone. Most patients have evidence of isolated monoclonal gammopathy or smoldering myeloma, and the occurrence of AL amyloidosis in patients with symptomatic multiple myeloma or other B-cell lymphoproliferative disorders is unusual. The key event in the development of AL amyloidosis is the change in the secondary or tertiary structure of an abnormal monoclonal LC, which results in instable conformation. This conformational change is responsible for abnormal folding of the LC, rich in β leaves, which assemble into monomers that stack together to form amyloid fibrils. Epidemiology AL amyloidosis is the most common type of systemic amyloidois in developed countries with an estimated incidence of 9 cases/million inhabitant/year. The average age of diagnosed patients is 65 years and less than 10% of patients are under 50. Clinical description The clinical presentation is protean, because of the wide number of tissues or organs that may be affected. The most common presenting symptoms are asthenia and dyspnoea, which are poorly specific and may account for delayed diagnosis. Renal manifestations are the most frequent, affecting two thirds of patients at presentation. They are characterized by heavy proteinuria, with nephrotic syndrome and impaired renal function in half of the patients. Heart involvement, which is present at diagnosis in more than 50% of patients, leading to restrictive cardiopathy, is the most serious complication and engages prognosis. Diagnostic methods The diagnosis relies on pathological examination of an involved site showing Congo red-positive amyloid deposits, with typical apple-green birefringence under polarized light, that stain positive with an anti-LC antibody by immunohistochemistry and

  14. Porøse materialer

    DEFF Research Database (Denmark)

    Hansen, Ernst Jan de Place

    2000-01-01

    Dette undervisningsnotat er en samling af noter, der refererer til den indledende del af kurset Materialmekanik og Porøse materailer på Insitut for Bærende Konstruktiner og Materialer (BKM).......Dette undervisningsnotat er en samling af noter, der refererer til den indledende del af kurset Materialmekanik og Porøse materailer på Insitut for Bærende Konstruktiner og Materialer (BKM)....

  15. COMENTARIO AL CASO PINOCHET

    Directory of Open Access Journals (Sweden)

    Alberto Contreras Clunes

    2002-01-01

    Full Text Available El fallo en el caso Pinochet tiene distintas formas de ser analizado. De partida, desde un punto de vista político, también constitucional, del derecho penal. Sin embargo, nos abocaremos al estudio desde el punto de vista procesal, en especial a lo referido al Debido Proceso. Para ello se analizará los presupuestos, la solución dada por la Excma. Corte Suprema y las consecuencias del mismo. Además, se criticará la solución dada, desde la óptica de las garantías procesales del imputado, contenidas en el nuevo proceso penal y lo dispuesto en la Constitución y la Convención Americana de Derechos Humanos. Finalmente, se argumentará en favor de una interpretación finalista y armónica de la Constitución y los tratados internacionales de derechos humanos.The verdict of the Pinochet Case has different ways of being analyzed: from the political, the constitutional, and the penal law points of view. However, we will approach this study from the legal point of view, especially to that referred to as the Proper Process. To do this, the budgets, the solution given by the Most Excellent Supreme Court, and its consequences will be analyzed. Furthermore, the given solution will be criticized from the point of view of the legal guarantees of the accused contained in the new penal process and what is contained in the Constitution and in the American Convention of Human Rights. In conclusion, we will argue in favor of a final and harmonious interpretation of the Constitution and the international agreement of human rights.

  16. CdSe quantum dot in vertical ZnSe nanowire and photonic wire for efficient single-photon emission

    DEFF Research Database (Denmark)

    Cremel, Thibault; Bellet-Amalric, Edith; Cagnon, Laurent;

    conformal dielectric coating of Al2O3 on the NW-QDs using Atomic Layer Deposition so that a photonic wire is formed with the CdSe QD deterministically positioned on its axis. The collection enhancement effect is studied by measuring the emission (with pulse excitation, at saturation intensity) of single...

  17. La desaceleración económica colombiana: se cosecha lo que se siembra

    Directory of Open Access Journals (Sweden)

    Carlos Humberto Ortiz

    2009-12-01

    Full Text Available La desaceleración económica que experimenta Colombia desde 1980 se explica por el estancamiento estructural de la economía y por la escalada de violencia relacionada con la expansión del narcotráfico. Los datos disponibles no rechazan esta hipótesis. El artículo plantea que la desindustrialización y el narcotráfico se forjaron en el mismo crisol: un modelo de desarrollo que ha integrado progresivamente la economía nacional a los mercados mundiales al tiempo que ha renunciado, también progresivamente, a la opción industrialista. Además, argumenta que la explosión del narcotráfico obedece a la profundización de la guerra contra las drogas en un contexto de demanda mundial creciente e inelástica.

  18. con bajo peso al nacer

    Directory of Open Access Journals (Sweden)

    Adriana Mora Antó

    2005-01-01

    Full Text Available Esta investigación dio cuenta de la relación entre el estilo de funcionamiento familiar, los patrones de crianza y las edades de desarrollo evolutivo en niños, nacidos con bajo peso. El estudio descriptivo correlacional se realizó con 41 niños y sus madres, aplicándose cuestionarios sobre funcionamiento familiar, prácticas de crianza y desarrollo infantil. Los resultados señalaron la existencia de un funcionamiento familiar caracterizado por una cohesión amalgamada y una adaptabilidad caótica, una disciplina complaciente, falta de control y de límites claros en la díada madre-hijo. Se trataba de familias monoparentales, donde la temprana edad de concepción, el madresolterismo y el apoyo de la familia extensa eran constantes. Las edades evolutivas registradas indicaron un desarrollo inferior a la edad cronológica, en la mayor parte de los casos; sin embargo, éstas tendieron a ser superiores al compararlas con la edades reales de los infantes. No se encontró una correlación estadísticamente significativa entre la edad de desarrollo y los diferentes factores del funcionamiento familiar para algunos de los rangos de edad considerados; sin embargo, no se lo descartó por completo, especialmente en lo referente al optimismo familiar

  19. Sample Set (SE): SE27 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE27 Effect of agricultural films for cabbage leaf metabolites Investigation of Bra...ssica oleracea var. capitata YR Tenkuu leaf metabolites. 3 growth conditions (covered with normal or UV cut agricultural... film or no agricultural film), 3 replicates data are examined. Takeshi Ara 1, Naoki Yamamoto 1,

  20. Sample Set (SE): SE57 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available ster analysis based on the metabolite accumulation patterns clearly showed differences among the plant famil...etabolite accumulation patterns in plants We optimized the MRM conditions for specifi c compounds by perform...SE57 Widely targeted metabolomics based on large-scale MS/MS data for elucidating m

  1. Sample Set (SE): SE56 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE56 MS/MS spectral tag-based annotation of non-targeted profile of plant secondary...sis, resulting in clarification of the functions of reported genes involved in glycosylation of flavonoids. Thus, non-target

  2. Sample Set (SE): SE53 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE53 Covering chemical diversity of genetically-modified tomatoes using metabolomic...rect acquisition of an interpretable data set of estimable chemical diversity. As an example, we report an a...etected compounds that represent 86% of the estimated chemical diversity of the metabolites listed in the Ly

  3. Significados y funciones del "se"

    Directory of Open Access Journals (Sweden)

    Lidia Contreras

    2004-06-01

    Full Text Available En este artículo la autora se limita a comentar críticamente lo que la Real Academia Española de la Lengua (cit. Ac. dice en su "Gramática de la lengua española" de 1931 (Madrid, Espasa-Calpe, S. A. con respecto a los diversos tipos de "se" que ella toma en cuenta, comentario que pretende mostrar una mayor diversificación que la establecida en la mencionada obra. (In this article, its author offers a critical commentary of the position taken by The Spanish Royal Academy of Language (RAE in Gramática de la lengua española (1931 on the subject of "Uses of 'se'". The author intends to show a greater variety of uses than those proposed by RAE.

  4. Editorial: Cartas al Editor

    Directory of Open Access Journals (Sweden)

    Guillermo Llanos

    2006-06-01

    Full Text Available En todas las revistas biomédicas del mundo existe una sección habitual denominada como el título de este editorial y que en Colombia Médica la llamamos correspondencia. Este espacio tiene como objetivo fundamental que los lectores escriban a los autores (investigadores comentando los artículos que se han publicado en números anteriores de la revista. Las cartas son, entonces, breves comentarios de desacuerdo o acuerdo (conceptual, metodológico, interpretativo sobre falencias ubicadas por un lector alerta al tema debatido en cualquiera de las secciones como en los artículos originales, editoriales, revisiones, presentación de casos, etc. publicados previamente en la revista. Las cartas deben permitir el intercambio de opiniones y formas de pensar y analizar los problemas planteados entre los autores y los lectores. En ocasiones una serie de cartas motivadas por un artículo original puede ser tan o más interesante como el artículo que generó la correspondencia. Las cartas son también un formato adecuado para comunicar un hecho novedoso de una observación clínica juiciosa no descrita antes. Un ejemplo de ello es la carta de un gineco-obstetra australiano cuando informó a Lancet los primeros efectos adversos informados de la talidomida. Colombia Médica, a pesar de mantener vigente esta sección, no ha sido muy afortunada en establecer una buena cultura del envío de cartas al editor. Pero últimamente han llegado juiciosas observaciones a las cuales se les ha dado prioridad en su publicación. Toda carta que comenta los hallazgos de un artículo es enviada a los autores para su respuesta, porque ello genera el debate académico buscado, y luego se publican, tanto la carta como su respuesta. El Estilo Vancouver recomienda que la carta y su respuesta deban ser breve, no pasar de dos o tres párrafos y contener sólo cuatro o cinco referencias. En lo posible (a menos que sea indispensable no presentar ni cuadros ni gráficos. El t

  5. Ud at se med Erasmus

    DEFF Research Database (Denmark)

    Frandsen, Pernille

    2009-01-01

    Få lidt luft under vingerne, kom ud at møde udenlandske kolleger og se, hvordan man også kan lave uddannelsesbibliotek. Med begejstring fortæller tre bibliotekarer om deres oplevelser i det store udland – alt sammen finansieret af Erasmus.......Få lidt luft under vingerne, kom ud at møde udenlandske kolleger og se, hvordan man også kan lave uddannelsesbibliotek. Med begejstring fortæller tre bibliotekarer om deres oplevelser i det store udland – alt sammen finansieret af Erasmus....

  6. Procesamiento de señales de radar en presencia de clutter dinámico

    OpenAIRE

    Pascual, Juan Pablo

    2014-01-01

    El radar es un sistema de sensado remoto que utiliza técnicas de procesamiento estadístico de señales para obtener información de la señal recibida. Los radares convencionales son sistemas activos que operan transmitiendo energía en forma de ondas electromagnéticas y recibiendo las señales reflejadas por el entorno y el objeto iluminado. Una de las dificultades a tener en cuenta en los sistemas de radar es que la señal de interés suele encontrarse obscurecida por las reflexiones producidas...

  7. AgSbSe{sub 2} and AgSb(S,Se){sub 2} thin films for photovoltaic applications

    Energy Technology Data Exchange (ETDEWEB)

    Garza, J.G. [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Shaji, S. [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Facultad de Ingenieria Mecanica y Electrica, CIIDIT - Universidad Autonoma de Nuevo Leon, Apodaca, Nuevo Leon (Mexico); Rodriguez, A.C.; Das Roy, T.K. [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Krishnan, B., E-mail: kbindu_k@yahoo.com [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Facultad de Ingenieria Mecanica y Electrica, CIIDIT - Universidad Autonoma de Nuevo Leon, Apodaca, Nuevo Leon (Mexico)

    2011-10-01

    Silver antimony selenide (AgSbSe{sub 2}) thin films were prepared by heating sequentially deposited multilayers of antimony sulphide (Sb{sub 2}S{sub 3}), silver selenide (Ag{sub 2}Se), selenium (Se) and silver (Ag). Sb{sub 2}S{sub 3} thin film was prepared from a chemical bath containing SbCl{sub 3} and Na{sub 2}S{sub 2}O{sub 3}, Ag{sub 2}Se from a solution containing AgNO{sub 3} and Na{sub 2}SeSO{sub 3} and Se thin films from an acidified solution of Na{sub 2}SeSO{sub 3}, at room temperature on glass substrates. Ag thin film was deposited by thermal evaporation. The annealing temperature was 350 deg. C in vacuum (10{sup -3} Torr) for 1 h. X-ray diffraction analysis showed that the thin films formed were polycrystalline AgSbSe{sub 2} or AgSb(S,Se){sub 2} depending on selenium content in the precursor films. Morphology and elemental analysis of these films were done using scanning electron microscopy and energy dispersive X-ray spectroscopy. Optical band gap was evaluated from the UV-visible absorption spectra of these films. Electrical characterizations were done using Hall effect and photocurrent measurements. A photovoltaic structure: glass/ITO/CdS/AgSbSe{sub 2}/Al was formed, in which CdS was deposited by chemical bath deposition. J-V characteristics of this structure showed V{sub oc} = 435 mV and J{sub sc} = 0.08 mA/cm{sup 2} under illumination using a tungsten halogen lamp. Preparation of a photovoltaic structure using AgSbSe{sub 2} as an absorber material by a non-toxic selenization process is achieved.

  8. Processing ambiguous Spanish se in a minimal chain.

    Science.gov (United States)

    Meseguer, Enrique; Acuña-Fariña, Carlos; Carreiras, Manuel

    2009-04-01

    The recovery of pieces of information that are not linguistically expressed is a constant feature of the process of language comprehension. In the processing literature, such missing information is generally referred to as "gaps". Usually, one resolves gaps by finding "fillers" in either the sentence or the context. For instance, in Peter seemed to be upset, Peter is really the subject of being upset but appears as surface subject of seems. Sometimes constituents move, leaving gaps behind. Various Romance languages such as Spanish or Italian have a grammatical particle se/si, which, as it is extremely ambiguous, licenses different sorts of gaps. In Spanish, se can encode at least reflexive, impersonal, and passive meanings. In an eye-tracking experiment we contrast reflexive structures containing postverbal subjects with impersonal structures with no subjects (GAP se vendó apresuradamente el corredor/"the runner bandaged himself hurriedly" vs. GAP se vendó apresuradamente al corridor/"(someone) bandaged the runner hurriedly"). In a second manipulation we contrast the presence of an extra argument with se-passives (GAP se vendó el tobillo el corredor/"the runner bandaged his ankle" vs. GAP se vendó el tobillo al corridor/"the runner's ankle was bandaged"). Our comparisons involve contrasting standard transitive structures with nonstandard word order (postverbal subject and a preverbal subject gap) against inherently complex and less habitual structures such as impersonals (with no subject) or se-passives (with subjects in canonical object position). We evaluate the minimal chain principle (de Vincenzi, 1991), according to which displacement is costly because it entails complex (derivational) "chains" that must be undone before phrasal packaging can commence. We show the minimal chain principle to be essentially correct when contrasting more complex but more frequent structures with less complex but less frequent structures. A noteworthy feature of this research

  9. Introduction to the "SE Field"

    OpenAIRE

    Defourny, Jacques

    2014-01-01

    The "SE Field" stands here for the main concepts defining the research areas of the EMES European Research Network since its creation in an informal (1996-2001) and then formal way (2002): Social Enterprise, Social Entrepreneurship, Social Economy and Solidarity Economy

  10. Derecho humano al agua y al saneamiento: derechos estrechamente vinculados al derecho a la vida

    OpenAIRE

    Fernández Aller, Maria Celia; Luis Romero, Elena de; Guzmán Acha, Cristina

    2013-01-01

    Los derechos humanos al agua y al saneamiento están íntimamente relacionados con otros derechos esenciales para la vida, como la alimentación o la salud. Su reconocimiento como derechos humanos en 2010 marca un hito importante en el respeto, protección y realización de estos derechos, que se encuentran seriamente vulnerados para una mayoría de población más vulnerable y empobrecida, sobre todo en el ámbito rural. Mucho camino queda aún para conseguir no sólo la disponibilidad de agua y saneam...

  11. Investigation of the Pr{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Pr{sub 2}Se{sub 3}-Ag{sub 2}Se-PbSe systems

    Energy Technology Data Exchange (ETDEWEB)

    Marchuk, O.V. [Department of Physical and Colloidal Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine); Gulay, L.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine)]. E-mail: gulay@lab.univer.lutsk.ua; Shemet, V.Ya. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine); Olekseyuk, I.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine)

    2006-06-08

    Phase diagram of the Cu{sub 2}Se-PbSe system was constructed using differential-thermal analysis, X-ray diffraction and metallography. The eutectic reaction L-bar {beta}-Cu{sub 2}Se+PbSe takes place at 886K and corresponds to 46mol% PbSe. The peritectoid reaction {beta}-Cu{sub 2}Se+PbSe-bar {alpha}-Cu{sub 2}Se takes place at 420K. The formation of the PrCuSe{sub 2} compound (LaCuS{sub 2} structure type, space group P2{sub 1}/c) and the solid solution range Pr{sub 2}Se{sub 3}-Pr{sub 2}PbSe{sub 4} (Th{sub 3}P{sub 4} structure type, space group I4-bar 3d, a=0.89916(2)nm, R{sub I}=0.0682 for Pr{sub 2}PbSe{sub 4}) was confirmed using X-ray powder diffraction. The interactions between the components in the Pr{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Pr{sub 2}Se{sub 3}-Ag{sub 2}Se-PbSe systems at 870K were determined using X-ray powder diffraction. No quaternary compounds exist in these systems.

  12. Sample Set (SE): SE58 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available calibration curves over a biologically defined concentration range for all detected compounds. By performing... metabolomics on a stepwise gradient between two biological specimens, we obtain ...rference. Analysis of artificial biological gradients is a general and inexpensive tool for calibration that...ments using artificial biological gradients We introduce a powerful approach that provides semiquantitative ...SE58 Exploring matrix effects and quantification performance in metabolomics experi

  13. Thermoelectric properties of single-layered SnSe sheet.

    Science.gov (United States)

    Wang, Fancy Qian; Zhang, Shunhong; Yu, Jiabing; Wang, Qian

    2015-10-14

    Motivated by the recent study of inspiring thermoelectric properties in bulk SnSe [Zhao et al., Nature, 2014, 508, 373] and the experimental synthesis of SnSe sheets [Chen et al., J. Am. Chem. Soc., 2013, 135, 1213], we have carried out systematic calculations for a single-layered SnSe sheet focusing on its stability, electronic structure and thermoelectric properties by using density functional theory combined with Boltzmann transport theory. We have found that the sheet is dynamically and thermally stable with a band gap of 1.28 eV, and the figure of merit (ZT) reaches 3.27 (2.76) along the armchair (zigzag) direction with optimal n-type carrier concentration, which is enhanced nearly 7 times compared to its bulk counterpart at 700 K due to quantum confinement effect. Furthermore, we designed four types of thermoelectric couples by assembling single-layered SnSe sheets with different transport directions and doping types, and found that their efficiencies are all above 13%, which are higher than those of thermoelectric couples made of commercial bulk Bi2Te3 (7%-8%), suggesting the great potential of single-layered SnSe sheets for heat-electricity conversion.

  14. ¿Se desindustrializa Brasil?

    Directory of Open Access Journals (Sweden)

    Fernando Mattos

    2014-01-01

    Full Text Available Este estudio pretende retomar algunos temas específicos del debate sobre la desindustrialización en Brasil, así como también, apunta a recordar algunos aspectos del debate teórico-histórico sobre la desindustrialización, presente en la literatura sobre desarrollo económico. En la primera parte, se destacan algunos elementos del referido debate presentes en la literatura especializada, discutiendo aspectos teóricos de la formulación kaldoriana que destacan el papel del crecimiento industrial y de la mudanza estructural en el crecimiento de las economías capitalistas. En la segunda, son organizados y analizados algunos indicadores recientes del desempeño del sector industrial brasileño. Finalmente, se ofrecen algunas breves notas conclusivas.

  15. Distopie voor oë: Eben Venter se duister kuns

    Directory of Open Access Journals (Sweden)

    Harry Sewlall

    2016-03-01

    Full Text Available Sedert die verskyning van Joseph Conrad se novelle, Heart of Darkness, uitgegee as vervolgverhaal in 1899, was daar al verskeie pogings om Conrad se teks te ‘herskryf’, al was die verwantskap met die meesterteks dikwels gering of selfs twyfelagtig. Nog ’n herskrywing van Conrad se teks is Eben Venter se roman Trencherman, aanvanklik in Afrikaans uitgegee as Horrelpoot. Hierdie teks volg die meesterteks baie nougeset na, nie slegs deur aanhalings daaruit as motto’s vooraan elke hoofstuk te gebruik nie, maar ook deur beelde en woorde uit die oorspronklike teks op ooglopende of bedekte wyse in die narratief in te weef. Die vrae waarmee ’n leser soos ek, wat nie vertroud is met Afrikaans nie, gekonfronteer word, is of dit ’n geval van plagiaat is of ’n oefening in intertekstualiteit en ofdie boek eerder ’n poging is om sensasie te wek ten einde meer boeke te verkoop. Hierdie vraevorm die basis vir ’n intertekstuele verkenning van die twee tekste, wat neerkom op ’n stiplees van Conrad se teks langs Trencherman ten einde die intertekstuele skakels tussen die twee tekste te identifiseer. Teoreties is die artikel gebaseer op die werk van Kristeva en Barthes. Die ondersoek het bevestig dat Trencherman inderdaad ’n oefening in intertekstualiteit is, nie slegs as intertekstualiteit nie, maar eerder as ’n in-gesprek-tree met Conrad se meesterteks. Daaruit volg die slotsom dat Trencherman ’n geldige intertekstuele antwoord is op Heart of darkness wat Conrad se beroemde novelle dekonstrueer en die draaiboek daarvan transponeer na ’n distopiese, post-demokratiese Suid-Afrika.

  16. Conjuntivitis alérgica

    Directory of Open Access Journals (Sweden)

    Alejandro Tello Hernández

    2008-07-01

    Full Text Available La conjuntivitis alérgica es una de las causas más comunesde consulta externa en oftalmología y tiene una muy altarelación con las reacciones alérgicas sistémicas. Lafisiopatología de las reacciones de hipersensibilidad noshace entender los cuadros clínicos característicos de estapatología y sus diferentes grados de severidad. Eldiagnostico diferencial es amplio, sin embargo hay clavesdiagnosticas que nos orientan rápidamente al diagnosticocorrecto. El tratamiento se enfoca en las medidasfarmacológicas y no farmacológicas, utilizándolas enconjunto para disminuir la recurrencia del cuadro y prevenirsecuelas visuales.

  17. İşveren Markası Yönetimi Sürecinde İşe Alım Öncesi Dönem ve İşgören Seçimi: Kavramsal Bir Değerlendirme (Pre-Recruitment Period and Employee Selection in Employer Brand Management Process: A Conceptual Evaluation)

    OpenAIRE

    Ebru GÖZEN

    2016-01-01

    Nowadays constantly renewing itself technological , socio-economic and cultural changes have dragged the companies to the tight competition. They can sustain their assets depends on finding the right labor and employment abilities. The quality and success of the human resources departments mostly depends on the process of finding employee. This process forms the basis of the other HR processes. One of the components of employer branding is Pre-Recruitment Period and Employee Se...

  18. Aquí se vende todo

    Directory of Open Access Journals (Sweden)

    Amalia Ran

    2010-11-01

    Full Text Available Aunque « memoria » sea la palabra más usada en el contexto histórico reciente de Argentina, es el olvido aquello de lo que más se habla, y lo que domina al final el discurso público de las últimas décadas. ¿ Cuáles son las distintas formas de « recordar » el pasado doloroso en un entorno que intenta silenciarlo al transformar la memoria en un objeto-fetiche ? ¿ De qué modo conserva el espacio urbano —la ciudad y sus múltiples lugares abiertos y cerrados— una memoria de la desgracia y del horror ?, y ¿ cómo se refleja ese espacio urbano dentro del texto narrativo ? El presente trabajo estudia la problemática de la ciudad globalizada del post-trauma y la desmemoria mediante el análisis de la novela de Horacio Vázquez-Rial, La capital del olvido (2004. Asimismo, propone analizar los efectos de los procesos de privatización y globalización que barrieron a Buenos Aires durante los noventa para explorar las diversas expresiones públicas y privadas de una cultura de culpa y vergüenza que niega recordar su pasado.Though memory may be most often used term within the historic context of Argentina, it is oblivion which dominates finally the public discourse of recent years. What are the different forms of “ remembering ” the painful past in an environment that attempts to silence memory by transforming it into a fetish-object ? In which way the urban space —the city with its multiple open and closed places— conserves a memory of the tragedy and horror ? And, how this space is represented within the narrative text ? This work analyzes the problematic of the globalized city, its post-trauma and oblivion by studying Horacio Vázquez-Rial’s novel, La capital del olvido (“ City of Oblivion ”, 2004. Additionally, it offers to analyze the effects of globalization and privatization processes that swept Buenos Aires during the decade of the nineties, in order to explore the diversity of public and private

  19. Electron microscopy of iron chalcogenide FeTe(Se) films

    Energy Technology Data Exchange (ETDEWEB)

    Shchichko, I. O.; Presnyakov, M. Yu. [National Research Centre “Kurchatov Institute” (Russian Federation); Stepantsov, E. A. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Kazakov, S. M.; Antipov, E. V. [Moscow State University (Russian Federation); Makarova, I. P. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Vasil’ev, A. L., E-mail: a.vasiliev56@gmail.com [National Research Centre “Kurchatov Institute” (Russian Federation)

    2015-05-15

    The structure of Fe{sub 1+δ}Te{sub 1−x}Se{sub x} films (x = 0; 0.05) grown on single-crystal MgO and LaAlO{sub 3} substrates has been investigated by transmission and scanning transmission electron microscopy. The study of Fe{sub 1.11}Te/MgO structures has revealed two crystallographic orientation relationships between the film and substrate. It is shown that the lattice mismatch between the film and substrate is compensated for by the formation of misfit dislocations. The Burgers vector projection is determined. The stresses in the film can partially be compensated for due to the formation of an intermediate disordered layer. It is shown that a FeTe{sub 0.5}Se{sub 0.5} film grown on a LaAlO{sub 3} substrate is single-crystal and that the FeTe{sub 0.5}Se{sub 0.5}/LaAlO{sub 3} interface in a selected region is coherent. The orientation relationships between the film and substrate are also determined for this case.

  20. Main: SE1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SE1PVGRP18 S000288 10-Feb-2000 (last modified) seki SE1 (Stem element 1) found in the bean (P.v.) grp1...ecifically; See S000289, S000101 (SE2); SE1; grp1.8; vascular; stem; shoot; bean (Phaseolus vulgaris) ATAATGGGCCACACTGTGGGGCAT ...

  1. Main: SE2PVGRP1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SE2PVGRP1 S000101 17-May-1998 (last modified) kehi SE2 (stem element 2) of bean (P.v.) GRP1....8 gene; part of SE2 element; stem; SE2; GRP; GRP1; bean (Phaseolus vulgaris) TTNNNGTAGCTAGTGTATTTGTAT ...

  2. Investigation of the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe systems at 870K

    Energy Technology Data Exchange (ETDEWEB)

    Gulay, L.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Aveune 13, 43009 Lutsk (Ukraine)]. E-mail: gulay@lab.univer.lutsk.ua; Olekseyuk, I.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Aveune 13, 43009 Lutsk (Ukraine); Wolcyrz, M. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland); Stepien-Damm, J. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland); Pietraszko, A. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland)

    2006-06-08

    The interactions between the components in the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe systems at 870K were determined using X-ray single crystal and powder diffraction. The existence of the compounds with compositions RCuSe{sub 2}-R{sub 2/3}Cu{sub 2}Se{sub 2}(Er{sub 2/3}Cu{sub 2}S{sub 2} structure type, space group P3-bar , a=0.40563(1)nm, c=0.64542(3)nm, R{sub I}=0.0737 for HoCuSe{sub 2} and a=0.40407(1)nm, c=0.64420(3)nm, R{sub I}=0.0660 for ErCuSe{sub 2}) and RCu{sub 5}Se{sub 4} (unknown structure) was confirmed in the R{sub 2}Se{sub 3}-Cu{sub 2}Se (R=Ho, Er) sections. The existence of the compounds Ho{sub 6}Pb{sub 2}Se{sub 11} (Y{sub 6}Pb{sub 2}Se{sub 11} structure type, space group Cmcm, a=0.40561(2)nm, b=1.34018(6)nm, c=3.7525(1)nm) and Er{sub 2}PbSe{sub 4} (CaFe{sub 2}O{sub 4} structure type, space group Pnma, a=1.2554(2)nm, b=0.40778(5)nm, c=1.4885(2)nm, R{sub I}=0.0914) was confirmed in the R{sub 2}Se{sub 3}-PbSe (R=Ho, Er) sections. The existence of the compounds Ho{sub 3.33}CuPb{sub 1.5}Se{sub 7} (Lu{sub 3.33}CuPb{sub 1.5}Se{sub 7} structure type, space group Cm, a=1.35314(8)nm, b=0.40819(2)nm, c=1.25609(7)nm, {beta}=104.577(3){sup o}) and HoCuPbSe{sub 3} ({beta}-BaLaCuSe{sub 3} structure type, space group Pnma, a=1.0516(2)nm, b=0.40470(8)nm, c=1.3410(3)nm, R{sub 1}=0.0541) in the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe system was confirmed. The formation of the compounds Er{sub 5}CuPb{sub 3}Se{sub 11} (Er{sub 5}CuPb{sub 3}Se{sub 11} structure type, space group Cmcm, a=0.40688(2)nm, b=1.34607(7)nm, c=3.8040(2)nm), Er{sub 3.33}CuPb{sub 1.5}Se{sub 7} (Lu{sub 3.33}CuPb{sub 1.5}Se{sub 7} structure type, space group Cm, a=1.35018(7)nm, b=0.40693(2)nm, c=1.25433(6)nm, {beta}=104.492(2){sup o}) and ErCuPbSe{sub 3} ({beta}-BaLaCuSe{sub 3} structure type, space group Pnma, a=1.04846(8)nm, b=0.40424(3)nm, c=1.34143(7)nm) in the Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe system was confirmed.

  3. de drogas que se consumen en su medio

    Directory of Open Access Journals (Sweden)

    José F. Enríquez Bielma

    2006-01-01

    Full Text Available Las adicciones son un problema de salud pública. Se estima que en México 3.5 millones de personas entre 12 a los 65 años han consumido algún tipo de drogas. A pesar de los avances en los estudios, se ha dejado de lado el carácter cultural que tiene la adicción. Con este estudio, se deseba conocer qué saben los estudiantes de segundo de secundaria sobre cuáles son las drogas que se consumen en su medio. Se llevó a cabo un estudio observacional con un muestreo aleatorio, con múltiples etapas y proporcional al tamaño en escuelas públicas y privadas. En total se estudiaron 42 escuelas del municipio de León, Gto., México de las cuales el 76.2% lo conformaron las escuelas públicas y el resto las escuelas privadas. Refirieron que conocen que se consumen, en su medio, 11 tipos de drogas. El 88% mencionó a la cocaína en primer lugar, en segundo lugar con un 85% la marihuana, siguiendo las tachas en un 62% y el pegamento en un 49%. En cuanto a los nombres que los estudiantes le dan a las drogas, estos van desde 23 hasta los 4 nombres, siendo la marihuana a la que se le da el mayor número de nombres, seguidos de la cocaína y el éxtasis.

  4. Escuela para señoritas, Inglaterra

    Directory of Open Access Journals (Sweden)

    Stillman y Eastwlck-Field, Arquitectos

    1963-02-01

    planta baja, para dar la impresión de lúa y ligereza a lo que antes era el semisótano. Las clases tratadas de manera sencilla nos dan la impresión de encontrarnos en una habitación. En todo el edificio domina el principio de líneas claras y materiales sencillos. Se han evitado grandes contrastes en el acabado y los colores están escogidos para procurar un fondo tranquilo a las intensas actividades de la escuela. Señalaremos como características constructivas que las viguetas y soportes están constituidos por unidades de hormigón prefabricado. Los muros exteriores consisten en paneles de ladrillo entre la estructura vista de hormigón. Los lechos interiores son de placas de aislantes, y los solados, de linóleo. Una atención especial se ha prestado al hall. Aquí el techo es de yeso blanco visto, interrumpido sólo por las rejillas de iluminación de neón. Los muros laterales son de cristal con cortinas pesadas de terciopelo. Un balcón enlistonado con madera dura lo hace sencillo y acogedor. Las telas y los muebles han sido cuidadosamente escogidos. La escuela Camden tiene una tradición rígida de individualismo y educación y ha constituido un acierto que el nuevo edificio siga reflejando este concepto logrado habiendo sabido guardar el carácter individual de las partes antiguas y ofrecer el buen aspecto de un edificio moderno.

  5. Personalidad y tolerancia al dolor

    Directory of Open Access Journals (Sweden)

    JESÚS M.ª CARRILLO

    2005-01-01

    Full Text Available Se examina la relación de algunas variables de personalidad -EPQ-A (Eysenck y Eysenck, 1975, NEO-PI (McCrae y Costa, 1988 y STA -personalidad esquizotípica- y STB -personalidad límite-, de Claridge y Broks (1984, con la tolerancia al dolor experimental inducido mediante agua fría (cold pressor test, según el procedimiento de Staats, Heckmat y Staats (1998 en una muestra filtrada mediante un cuestionario sobre dolor crónico, dolores de cabeza, de espalda, artritis, síndrome de Raynaud, y personas bajo medicación. La tolerancia al dolor experimental se evaluó mediante el Umbral del dolor (tiempo en segundos desde la introducción de la mano en el agua hasta el primer informe de dolor, Mantenimiento del dolor (duración en segundos de la inmersión de la mano desde la aparición del umbral hasta su retirada y Tolerancia al dolor (duración total en segundos de la inmersión de la mano desde su introducción hasta su retirada. Un análisis correlacional, factorial y de regresión por pasos mostraron un efecto cruzado entre medidas de ansiedad (tolerancia negativa al dolor y psicoticismo, siendo psicoticismo junto con control emocional predictores de tolerancia positiva al dolor. En cuanto a psicoticismo, parece que son sus elementos de naturaleza paranoide y de "dureza" los que afectan a una percepción atenuada del dolor.

  6. Carl gustav jung: al profesor honorio delgado

    OpenAIRE

    Sánchez, Luis Jaime

    2012-01-01

    Esbozo ideológico de Jung: Con la muerte de Carl Gustav Jung, se deshace -en sus personajes- el trípode ejemplar que ha sostenido en lo que va corrido del siglo XX, lo más significativo del saber psicológico. Con Freud y Adler, Jung ayudo poderosamente a conformar  el a veces crudo y rudo andamiaje de una psicología singular, en el contorno y en la hondura, cuyos problemas -a pesar de todo- se debaten aún en la periferia y en la profundidad del hombre contemporáneo, al cual Jung se acerco sie...

  7. Aproximaciones al concepto de interactividad educativa

    OpenAIRE

    Zangara, Alejandra; Sanz, Cecilia Verónica

    2012-01-01

    Este trabajo presenta una reflexión sobre el concepto de interactividad, y en particular, sobre interactividad educativa. Hoy en día se escucha hablar de software interactivo, televisión digital interactiva, interacción/interactividad, y se asume el concepto de interactividad sin una reflexión sobre éste. Se proponen aquí algunos puntos de análisis al respecto, una diferenciación entre interacción e interactividad, y una vinculación entre interactividad educativa y el concepto de distancia tr...

  8. Se metallomics during lactic fermentation of Se-enriched yogurt.

    Science.gov (United States)

    Palomo, María; Gutiérrez, Ana M; Pérez-Conde, M Concepción; Cámara, Carmen; Madrid, Yolanda

    2014-12-01

    Selenium biotransformation by lactic acid bacteria during the preparation of Se-enriched yogurt was evaluated. The study focused on the distribution of selenium in the aqueous soluble protein fraction and the detection of selenoamino acids. Screening of selenium in Tris-buffer-urea soluble fraction was carried out by sodium dodecyl sulphate polyacrylamide gel electrophoresis after pre-fractionating with asymmetric field flow fractionation using inductively coupled plasma-mass spectrometry as the detector. Selenium-containing fractions were identified by peptide mapping using nano LC-ESI/LTQMS. Proteins such as thioredoxin, glutaredoxin, albumin, β-lactoglobulin, and lactoperoxidase were identified in the selenium-containing fraction. All these proteins were detected in both the control and the selenium-enriched yogurt except chaperones, which were only detected in the control samples. Chaperones are heat-shock proteins expressed in response to elevated temperature or other cellular stresses. Selenium may have an effect on chaperones expression in Lactobacillus. For the amino acids analysis, selenocysteine was the primary seleno-containing species.

  9. Se equivocó el masoreta ¿se equivocaba?

    Directory of Open Access Journals (Sweden)

    Fernández Tejero, Emilia

    2009-12-01

    Full Text Available This article has a didactic purpose; it is not aimed at scholars of the Masora but rather at researchers in closely associated areas. The editions of Hebrew Biblical manuscripts and critical studies that have been published recently are particularly useful tools for those who wish to delve into other areas of research such as the history of the Hebrew Biblical text, its exegesis or the origins of grammar. Here, the author concentrates on the analysis of three issues: variant formulations of a same information; coherence between a text and its Masorah, and the possible discrepancies among sources.

    Este artículo, de carácter didáctico, no está destinado a los estudiosos de la Masora, sino a investigadores de áreas cercanas. Las ediciones de manuscritos y los estudios publicados en los últimos años son instrumentos de gran utilidad para quienes deseen adentrarse en un campo de investigación con repercusión en otras áreas tales como la historia del texto bíblico hebreo, su exégesis o los inicios de la gramática. Se analizan tres cuestiones: distinta formulación para una misma noticia, coherencia entre un texto y su masora y posibles discrepancias entre las fuentes.

  10. Todo lo ilustrado se desvanece en los no lugares

    Directory of Open Access Journals (Sweden)

    Felipe Luis García

    2015-12-01

    Full Text Available A partir del proyecto de restauración del edificio de la Vieja Estación Terminal de la ciudad de Mar del Plata en el año 2009, se presentan múltiples tensiones en torno a cómo se pone en valor un patrimonio histórico y urbano-cultural de la comunidad. La operatoria que prevalece es la de las iniciativas privadas que marcan el rumbo de dicha refacción tendiente a la condensación de una lógica comercial salvaguardando vestigios culturales para dicho cometido. El siguiente informe se encarga de analizar información acerca del caso y conectarla del modo más integral posible con la portentosa amalgama conceptual que acarrea la tradición de la sociología cultural-urbana. Es decir, hilvanar un análisis exhaustivo partiendo de la proliferación de los no lugares como espacios de hiperrealidad en los que se interpele al ciudadano en tanto consumidor; dando por sentado en esta expansión de shoppings, la concepción de ciudad que por detrás se esconde.

  11. Seguimiento al hogar de personas con antecedentes de enfermedad mental

    Directory of Open Access Journals (Sweden)

    Esguerra de Cárdenas Irene

    1995-12-01

    Full Text Available

    El "programa de apoyo y seguimiento al hogar de personas con antecedentes de enfermedad mental" se inició formalmente en marzo de 1993 en la Clínica Nuestra Señora de la Paz. Surgió de la necesidad de implementar acciones concretas al egreso de los pacientes de la institución, tendientes a reforzar la responsabilidad de éstos en su tratamiento y manejo de la enfermedad en el hogar y además de ofrecer un recurso de apoyo para escuchar sus inquietudes y preocupaciones. El propósito del programa es proporcionar al enfermo mental y a su familia un apoyo permanente al egresar de la Institución, en lo relacionado con el manejo de dificultades o problemas que se presenten durante el proceso de la enfermedad, el tratamiento y la reinserción del paciente al hogar y al medio social. Dentro de las estrategias de trabajo se contemplan reuniones semanales con grupos de pacientes próximos a salir de la clínica, reuniones periódicas de reforzamiento con personas inscritas al programa, seguimiento telefónico o mediante entrevistas individuales y/o familiares. Hasta el momento han asistido a las reuniones de egreso cerca de 400 pacientes y se han inscrito voluntariamente al programa 150 personas.

  12. On the charge neutrality level and the electronic properties of interphase boundaries in the layered ε-GaSe semiconductor

    Energy Technology Data Exchange (ETDEWEB)

    Brudnyi, V. N., E-mail: brudnyi@mail.tsu.ru; Sarkisov, S. Yu. [Tomsk State University (Russian Federation); Kosobutsky, A. V. [Kemerovo State University (Russian Federation)

    2015-10-15

    The height of the (Au, Pd, Pt, Cu, Ag, Sn, In, Al, Mg, Ca, Li, Cs)/GaSe(0001) Schottky barrier as a function of the metal work function and the energy-band offsets in InSe(0001)/GaSe(0001) and GaSe(0001)/Si(111) heteropairs are analyzed within the context of the concept of the charge neutrality level, CNL{sub vb}(GaSe) = E{sub v} + 0.83 eV, with consideration for partial screening of the interface electrostatic dipole by metal- or semiconductor-induced tunneling states at the GaSe(0001) surface.

  13. Measurement of the static quadrupole moments of the first 2+ states in 76Se, 78Se, 80Se and 82Se

    International Nuclear Information System (INIS)

    The reorientation effect in Coulomb excitation was employed to measure the static quadrupole moments of the first 2+ excited states in 76Se, 78Se, 80Se, and 82Se. Beams of 4He and 16O were used on thin highly enriched targets and the resulting spectra of the well resolved backward elastic and inelastic scattered particles were detected by four surface-barrier detectors. For constructive interference via the second 2+ excited states the determined quadrupole moments are: -0.34 +- 0.07 e . b for 76Se; -0.26 +- 0.09 e . b for 78Se; -0.31 +- 0.07 e . b for 80Se; -0.22 +- 0.07 e . b for 82Se. (Auth.)

  14. An Atomically Layered InSe Avalanche Photodetector.

    Science.gov (United States)

    Lei, Sidong; Wen, Fangfang; Ge, Liehui; Najmaei, Sina; George, Antony; Gong, Yongji; Gao, Weilu; Jin, Zehua; Li, Bo; Lou, Jun; Kono, Junichiro; Vajtai, Robert; Ajayan, Pulickel; Halas, Naomi J

    2015-05-13

    Atomically thin photodetectors based on 2D materials have attracted great interest due to their potential as highly energy-efficient integrated devices. However, photoinduced carrier generation in these media is relatively poor due to low optical absorption, limiting device performance. Current methods for overcoming this problem, such as reducing contact resistances or back gating, tend to increase dark current and suffer slow response times. Here, we realize the avalanche effect in a 2D material-based photodetector and show that avalanche multiplication can greatly enhance the device response of an ultrathin InSe-based photodetector. This is achieved by exploiting the large Schottky barrier formed between InSe and Al electrodes, enabling the application of a large bias voltage. Plasmonic enhancement of the photosensitivity, achieved by patterning arrays of Al nanodisks onto the InSe layer, further improves device efficiency. With an external quantum efficiency approaching 866%, a dark current in the picoamp range, and a fast response time of 87 μs, this atomic layer device exhibits multiple significant advances in overall performance for this class of devices.

  15. Electron microscopy of iron chalcogenide FeTe(Se) films

    International Nuclear Information System (INIS)

    The structure of Fe1+δTe1−xSex films (x = 0; 0.05) grown on single-crystal MgO and LaAlO3 substrates has been investigated by transmission and scanning transmission electron microscopy. The study of Fe1.11Te/MgO structures has revealed two crystallographic orientation relationships between the film and substrate. It is shown that the lattice mismatch between the film and substrate is compensated for by the formation of misfit dislocations. The Burgers vector projection is determined. The stresses in the film can partially be compensated for due to the formation of an intermediate disordered layer. It is shown that a FeTe0.5Se0.5 film grown on a LaAlO3 substrate is single-crystal and that the FeTe0.5Se0.5/LaAlO3 interface in a selected region is coherent. The orientation relationships between the film and substrate are also determined for this case

  16. La incorporación de Venezuela al MERCOSUR

    OpenAIRE

    Bastías, Julio Adrián

    2006-01-01

    El presente trabajo tiene como objetivo analizar la incorporación de Venezuela al MERCOSUR: qué aporte realiza, y cuales son sus ventajas y desventajas para el Bloque en el ámbito regional e internacional. Para ello se realizó un estudio del contexto actual del MERCOSUR, analizando sobre todo las crisis que actualmente atraviesa y se investigó cómo en éste escenario político se inserta Venezuela en el Bloque. Se estudiaron también los logros de la XXX Cumbre Presidencial del MERCOSUR y se vis...

  17. En la infancia los diagnósticos se escriben con lápiz. La patologización de las diferencias en la clínica y la educación. Untoiglich, Gisela, et al. /266 p. Buenos Aires: Noveduc. 2013.

    Directory of Open Access Journals (Sweden)

    Adriana Cristóforo

    2013-11-01

    Full Text Available El libro está organizado en cuatro partes, en función del eje temático que tienen los trabajos que integra cada una de ellas: Procesos de Patologización; Procesos diagnósticos en la infancia; Patologías psíquicas graves en la primera infancia; y Acerca de inclusiones y exclusiones. Sin embargo más allá de esta organización, el libro tiene una armonía que, a través de la diversidad, otorga coherencia al abordaje de un problema complejo como lo es el de los diagnósticos en la infancia. Precisamente es esa manera compleja de abordar el problema la que aporta uno de los valores del texto: las múltiples miradas, significaciones y expresiones que surgen del entrecruzamiento entre las distintas profesiones de los autores y las diversas inscripciones geográficas (Argentina, Brasil, Portugal. Asimismo tal diversidad geográfica muestra lo extendido del fenómeno de la patologización de la infancia y de los recursos que el mismo aplicapara perpetuarse, por ejemplo, las regulaciones de distinto estatuto legal que los Estados van estableciendo en relación a las instituciones de salud y educación.

  18. Conocer y comprender al otro: la comunicación intercultural de Al-Qaeda

    OpenAIRE

    Evelyn Norma Castro Méndez

    2013-01-01

    La red islamista Al-Qaeda es una de las organizaciones más conocidas en el mundo occidental. En este artículo se presentan los resultados de un análisis discursivo realizado a los mensajes emitidos por la red en el marco de los atentados contra Estados Unidos (2001), Madrid (2004) y Londres (2005), con el fin de responder a las siguientes preguntas: ¿cuál fue el propósito de estos mensajes y qué nos dicen de sus emisores? Al estudiar estos procesos de comunicación intercultural se obtendrán e...

  19. Runoff generation in SE Spain

    Science.gov (United States)

    Dalen, E. N.; Kirkby, M. J.; Chapman, P. J.; Bracken, L. J.

    2007-12-01

    We are working to improve a hydrological model for prediction of runoff in medium-scale semi-arid catchments in SE Spain. The aim is to develop and improve understandings of runoff generation in semi-arid areas and to improve modelling of runoff. Objectives are to investigate the influence of geology, landuse and seasonality on infiltration rates and use remonte sensing (RS) and GIS to classify an area into Hydrologically Similar Surfaces (HYSS) categories. The research includes investigating the impact of different landscape elements on runoff within two 150 km2 catchments, the Rambla Nogalte and the Rambla de Torrealvilla. Most storms within these catchments are of short duration. HYSS are defined as areas with similar1-D (vertical) partitioning of net rainfall between infiltration and overland flow. HYSS are identified from field measurements of soils, micro and macro- topography and infiltration rates; then combined with analysis of multi-spectral airborne RS images. HYSS are selected to minimise internal variability in the relationship between rainfall and local runoff generation and are scaled up to cover larger areas. The overall sampling strategy for measurements has been to undertake constant intensity rainfall simulator measurements within provisional HYSS categories, and to augment this with a large number of minidisk infiltrometer measurements. This strategy captures as much of the variability in the landscape as possible. The wide variability within even small areas has led to the final adoption of only a few large classes that can be effectively distinguished. The final part of the research is to link the spatial partitioning of the two catchments into HYSS with the detailed rainfall records for the areas, and combine these two sets of data into a grid-based model for runoff generation across the area. The applied Green-Ampt modelling approach gave 63 possible combinations of surface properties (9 HYSS) and areas in the Rambla Nogalte each represented

  20. Investigation of the R{sub 2}Se{sub 3}-Cu{sub 2}Se-In{sub 2}Se{sub 3} (R=La, Pr, Y and Er) systems at 870K and crystal structure of the R{sub 2}CuInSe{sub 5} (R=La, Ce and Pr) compounds

    Energy Technology Data Exchange (ETDEWEB)

    Huch, M.R. [Department of General and Inorganic Chemistry, Volyn State University, Voli Avenue 13, 43009 Lutsk (Ukraine); Gulay, L.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Avenue 13, 43009 Lutsk (Ukraine)]. E-mail: gulay@univer.lutsk.ua; Olekseyuk, I.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Avenue 13, 43009 Lutsk (Ukraine)

    2007-07-31

    Phase equilibria in R{sub 2}Se{sub 3}-Cu{sub 2}Se-In{sub 2}Se{sub 3} (R=La, Pr, Y and Er) systems at 870K were determined using X-ray powder diffraction. The existence of the RCuSe{sub 2} (LaCuS{sub 2} structure type, space group P2{sub 1}/c) and La{sub 5}Cu{sub 13}Se{sub 14} (unknown structure) compounds was confirmed in the R{sub 2}Se{sub 3}-Cu{sub 2}Se (R=La, Pr) sections. The formation of the solid solutions R{sub (2+x)/3}Cu{sub 2-x}Se{sub 2} (0bar xbar 1) (Er{sub 2/3}Cu{sub 2}S{sub 2} structure type, space group P3bar) and the ErCu{sub 5}Se{sub 4} compound with unknown structure was confirmed in the R{sub 2}Se{sub 3}-Cu{sub 2}Se (R=Y, Er) sections. The existence of the La{sub 3}In{sub 1.67}Se{sub 7} (Ce{sub 3}Al{sub 1.67}S{sub 7} structure type, space group P6{sub 3}) and La{sub 4}In{sub 4.67}Se{sub 13} (La{sub 4}In{sub 4.72}Se{sub 13} structure type, space group Pbam) compounds in the La{sub 2}Se{sub 3}-In{sub 2}Se{sub 3} system and the Pr{sub 3}InSe{sub 6} (Pr{sub 3}InSe{sub 6} structure type, space group Pnnm) compound in the Pr{sub 2}Se{sub 3}-In{sub 2}Se{sub 3} system was confirmed. No ternary compounds exist in the Er{sub 2}Se{sub 3}-In{sub 2}Se{sub 3} and Y{sub 2}Se{sub 3}-In{sub 2}Se{sub 3} sections. The formation of the CuInSe{sub 2}, CuIn{sub 3}Se{sub 5}, CuIn{sub 5}Se{sub 8}, CuIn{sub 7}Se{sub 11} and CuIn{sub 11}Se{sub 17} compounds in the Cu{sub 2}Se-In{sub 2}Se{sub 3} section was observed. The crystal structure of new quaternary R{sub 2}CuInSe{sub 5} (R=La, Ce and Pr) compounds (space group Pnma, a=1.20382(6)nm, b=0.41185(2)nm, c=1.7556(1)nm (for La{sub 2}CuInSe{sub 5}), a=1.19997(7)nm, b=0.40855(2)nm, c=1.7464(1)nm (for Ce{sub 2}CuInSe{sub 5}) and a=1.1973(3)nm, b=0.40649(9)nm, c=1.7408(4)nm (for Pr{sub 2}CuInSe{sub 5})) was determined.

  1. Metal Ions Mediated Morphology and Phase Transformation of Chalcogenide Semiconductor: From CuClSe2 Microribbon to CuSe Nanosheet.

    Science.gov (United States)

    Liu, Yong-Qiang; Wu, Hao-Di; Zhao, Yu; Pan, Ge-Bo

    2015-05-01

    Foreign ions are of significant importance in controlling and modulating the morphology of semiconductor nanocrystals during the colloidal synthesis process. Herein, we demonstrate the potential of foreign metal ions to simultaneously control the morphology and crystal phase of chalcogenide semiconductors. The results indicate that the introduction of Al(3+) ions can induce the structural transformation from monoclinic CuClSe2 microribbons (MRs) to klockmannite CuSe nanosheets (NSs) and the growth of large-sized CuSe NSs. The as-prepared micrometer-sized CuSe NSs exhibit a high-conducting behavior, long-term durability, and environment stability. The novel properties enable CuSe NSs to open up a bright prospect for printable electrical interconnects and flexible electronic devices.

  2. Turnover of Se in adequately fed chickens using Se-75 as a tracer.

    Science.gov (United States)

    Brandt-Kjelsen, A; Govasmark, E; Haug, A; Salbu, B

    2014-06-01

    Inorganic selenium (Se) in the form of selenite is applied to livestock to avoid Se deficiency. Selenite is, however, an artificial Se source in diets of unsupplemented chickens. It is therefore hypothesized that organic Se sources, such as Se-enriched yeast and wheat, could be a more suitable Se supply in animal nutrition, although information on the transition of Se from organic Se sources in fast-growing chickens is scarce. In this work, chickens were fed a low Se diet (0.27 ± 0.01 mg Se/kg, Se-enriched yeast) until 20 days of age, after which the Se concentration was increased to maximum concentration allowed by the poultry industry in Europe (0.5 p.p.m. Se). At the same time, a daily contribution of carrier-free (75)Se tracer from labelled wheat was administered from day 20 to 27. The chickens showed S and Se homeostasis, as the concentration of S and Se in liver, blood or kidney remained about constant, and steady state of S and Se in the other organs was reached 1 day after the diet shift. The uptake of (75)Se was readily seen in all organs. After 1 week, the depuration of the (75)Se tracer was followed, and biological half-lives and retention in individual organs were determined. The shortest biological half-lives were observed in major metabolic organs, the liver, kidney and pancreas with half-lives close to 4 days. There was a significant (p < 0.05) uptake in lung, brain and muscle that reached steady state when the administration of (75)Se was terminated. The half-life of (75)Se in heart was 9 days and 7 days in blood. The longest half-lives were observed in muscle (12 days), brain and lungs (13 days). All half-lives were shorter than in Se deplete animals.

  3. Low temperature solution-phase growth of ZnSe and ZnSe/CdSe core/shell nanowires

    Science.gov (United States)

    Petchsang, Nattasamon; Shapoval, Liubov; Vietmeyer, Felix; Yu, Yanghai; Hodak, Jose H.; Tang, I.-Ming; Kosel, Thomas H.; Kuno, Masaru

    2011-08-01

    High quality ZnSe nanowires (NWs) and complementary ZnSe/CdSe core/shell species have been synthesized using a recently developed solution-liquid-solid (SLS) growth technique. In particular, bismuth salts as opposed to pre-synthesized Bi or Au/Bi nanoparticles have been used to grow NWs at low temperatures in solution. Resulting wires are characterized using transmission electron microscopy and possess mean ensemble diameters between 15 and 28 nm with accompanying lengths ranging from 4-10 μm. Subsequent solution-based overcoating chemistry results in ZnSe wires covered with CdSe nanocrystals. By varying the shell's growth time, different thicknesses can be obtained and range from 8 to 21 nm. More interestingly, the mean constituent CdSe nanocrystal diameter can be varied and results in size-dependent shell emission spectra.High quality ZnSe nanowires (NWs) and complementary ZnSe/CdSe core/shell species have been synthesized using a recently developed solution-liquid-solid (SLS) growth technique. In particular, bismuth salts as opposed to pre-synthesized Bi or Au/Bi nanoparticles have been used to grow NWs at low temperatures in solution. Resulting wires are characterized using transmission electron microscopy and possess mean ensemble diameters between 15 and 28 nm with accompanying lengths ranging from 4-10 μm. Subsequent solution-based overcoating chemistry results in ZnSe wires covered with CdSe nanocrystals. By varying the shell's growth time, different thicknesses can be obtained and range from 8 to 21 nm. More interestingly, the mean constituent CdSe nanocrystal diameter can be varied and results in size-dependent shell emission spectra. Electronic supplementary information (ESI) available. See DOI: 10.1039/c1nr10176e

  4. Veiligheid als verbindingsvraagstuk : Veerkacht in teams met resilience engineering

    NARCIS (Netherlands)

    Schraagen, J.M.C.; Beek, F.A. van der

    2016-01-01

    We beschouwen de mens traditioneel als zwakste schakel in hoogtechnologische omgevingen. Toch kunnen (teams van) werknemers juist helpen bij het veranderingsproces. Menselijk gedrag is niet per se ongewenst en onveilig. Pas als mens en organisatie zich niet aan hun omgeving aanpassen, tast dat de ve

  5. Pensando al agua como parte del paisaje

    Directory of Open Access Journals (Sweden)

    Lorena Salvatelli

    2009-12-01

    Full Text Available El objetivo de este trabajo es discutir la importancia de los estudios de arqueología terrestre y subacuática como parte de un mismo proceso de interpretación del pasado. Se entiende que el registro arqueológico puede hallarse actualmente en una variedad de ambientes tanto terrestres como subacuáticos a causa de varias razones, como por ejemplo las oscilaciones de los niveles de agua ocurridas entre el Pleistoceno Final y el Holoceno Medio. Por lo tanto, se propone que para su recuperación debe utilizarse una metodología adaptada al medio ambiente en el cual se encuentre. En este sentido, es importante la interpretación integral del paisaje para acceder a la comprensión de la diversidad ambiental en la que se puede emplazar un sitio arqueológico, y en consecuencia poder “bucear” un registro integrado.

  6. The reactivity of [PhP(Se)(mu-Se)]2 and (PhP)3Se2 towards acetylenes and cyanamides: X-ray crystal structures of some P-Se-C and P-Se-C-N heterocycles.

    Science.gov (United States)

    Bhattacharyya, Pravat; Slawin, Alexandra M Z; Woollins, J Derek

    2002-06-17

    Several unusual P-Se-C and P-Se-C-N heterocycles are formed by the reaction of [PhP(Se)(mu-Se)]2 or (PhP)3Se2 with alkynes or cyanamides, generated by the fragmentation of the organophosphorus-selenium compound and addition across the C identical to C or C identical to N triple bond of the organic substrate. X-ray crystallographic analysis reveals an unexpected diversity of structural motifs within these heterocyclic systems, including P2SeCN, P2C2Se and PC2Se2 rings.

  7. Giant piezoelectricity of monolayer group IV monochalcogenides: SnSe, SnS, GeSe, and GeS

    Energy Technology Data Exchange (ETDEWEB)

    Fei, Ruixiang; Yang, Li, E-mail: lyang@physics.wustl.edu [Department of Physics, Washington University, St. Louis, Missouri 63130 (United States); Li, Wenbin [Research Laboratory of Electronics, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); Li, Ju [Department of Nuclear Science and Engineering and Department of Materials Science and Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

    2015-10-26

    We predict enormous, anisotropic piezoelectric effects in intrinsic monolayer group IV monochalcogenides (MX, M=Sn or Ge, X=Se or S), including SnSe, SnS, GeSe, and GeS. Using first-principle simulations based on the modern theory of polarization, we find that their piezoelectric coefficients are about one to two orders of magnitude larger than those of other 2D materials, such as MoS{sub 2} and GaSe, and bulk quartz and AlN which are widely used in industry. This enhancement is a result of the unique “puckered” C{sub 2v} symmetry and electronic structure of monolayer group IV monochalcogenides. Given the achieved experimental advances in the fabrication of monolayers, their flexible character, and ability to withstand enormous strain, these 2D structures with giant piezoelectric effects may be promising for a broad range of applications such as nano-sized sensors, piezotronics, and energy harvesting in portable electronic devices.

  8. Colloidal PbSe/CdSe Heteronanocrystals. Atomic configuration, electronic structure and optical properties

    NARCIS (Netherlands)

    Grodzinska, D.

    2012-01-01

    This thesis focuses on the structural characterization and the opto-electronic properties of PbSe/CdSe core/shell QDs and on the structural and morphological evolution of PbSe/CdSe core/shell QDs upon thermal annealing under vacuum.

  9. Miedo al crimen en estudiantes de la ciudad de Caracas

    OpenAIRE

    Jan Liebnitzky; Maritza Montero

    2013-01-01

    Se midió el miedo al crimen en un grupo de estudiantes universitarios, centrándose en inseguridad subjetiva y paradoja victimización-miedo, que considera que la inseguridad subjetiva no refleja a la objetiva. Se buscaba saber si esa paradoja existía en los estudiantes y si las teorías explicativas serían útiles. Se comparó el nivel de miedo al crimen con dos ciudades Latinoamericanas, empleando un diseño de secciones-cruzadas, usando el Cuestionario de Inseguridad Urbana, y elementos cuantita...

  10. Reduction in the crystal defect density of Zn Se layers grown by molecular beam epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Lopez L, M.; Perez C, A.; Luyo A, J.; Melendez L, M.; Tamura, M. [Departamento de Fisica, Centro de Investigacion y de Estudios Avanzados del instituto politecnico Nacional, A.P. 14-740, 07000 Mexico D.F. (Mexico); Mendez G, V.H.; Vidal, M.A. [Instituto de Investigacion en Comunicacion Optica, Universidad Autonoma de San Luis Potosi, Alvaro Obregon 64, 78000 San Luis Potosi (Mexico)

    2000-07-01

    We present a study of the molecular beam epitaxial (MBE) grown of Zn Se layers on Ga-As and Si substrates. For the growth on GaAs substrates we investigated the effects of introducing buffer layers of Al{sub x}Ga{sub 1-x} As and In{sub x}Ga{sub 1-x} As with x = 0.01. Moreover, an analysis by secondary ion mass spectroscopy revealed that the use of AlGaAs buffer layers effectively suppress the Ga segregation onto the Zn Se layers surface. On the other hand, for the growth of Zn Se on Si substrates, we achieved a significant improvement in the crystal quality of Zn Se by irradiating the Si substrates with plasma of nitrogen prior to the growth. (Author)

  11. CALCULUL CINETOSTATIC AL MECANISMELOR PLANETARE CILINDRICE

    Directory of Open Access Journals (Sweden)

    Păun ANTONESCU

    2012-05-01

    Full Text Available În lucrare se prezintă o metodă analitică pentru calculul cinetostatic al mecanismului planetarmonomobil cu două roţi dinţate centrale. Se consideră mai întâi cazul general al schemelor cinematice cu douăroţi dinţate solidare tip satelit, în două variante practice (multiplicator şi reductor de turaţie. Este menţionatcazul particular al mecanismelor planetare cu o singură roată satelit cu angrenare dublă (exterioară şiinterioară. Pe baza modelului de analiză cinetostatică a mecanismului planetar monomobil cu două roţi dinţatecentrale, în finalul lucrării se abordează o problemă practică de calcul cinetostatic al unui mecanism planetarcilindric simplu folosit la capul de frezat pentru prelucrarea roţilor dinţate cilindrice cu dinţi curbi înhipocicloidă.

  12. Li2Se as a Neutron Scintillator

    International Nuclear Information System (INIS)

    We show that Li2Se:Te is a potential neutron scintillator material based on density functional calculations. Li2Se exhibits a number of properties favorable for efficient neutron detection, such as a high Li concentration for neutron absorption, a small effective atomic mass and a low density for reduced sensitivity to background gamma rays, and a small band gap for a high light yield. Our calculations show that Te doping should lead to the formation of deep acceptor complex VLi-TeSe, which can facilitate efficient light emission, similar to the emission activation in Te doped ZnSe

  13. The Ag{sub 2}Se-HgSe-SiSe{sub 2} system in the 0-60 mol.% SiSe{sub 2} region

    Energy Technology Data Exchange (ETDEWEB)

    Parasyuk, O.V.; Gulay, L.D.; Romanyuk, Ya.E.; Olekseyuk, I.D

    2003-01-13

    Phase equilibria in the quasiternary Ag{sub 2}Se-HgSe-SiSe{sub 2} system were investigated using X-ray phase analysis. Its isothermal section at 298 K was constructed. The formation of the quaternary Ag{sub 6}HgSiSe{sub 6} phase was confirmed. The existence of the homogeneity range for this compound at 23-43 mol.% of Hg{sub 4}SiSe{sub 6} (Ag{sub 6.16-4.56}Hg{sub 0.92-1.72}SiSe{sub 6}) was determined. The formation of three new intermediate phases Ag{sub {approx}}{sub 7.04-{approx}}{sub 6.32}Hg{sub {approx}}{sub 0.48-{approx}}{sub 0.84}Si= Se{sub 6} ({beta}), Ag{sub {approx}}{sub 3.44-{approx}}{sub 2.96}Hg{sub {approx}}{sub 2.28-{approx}}{sub 2.52}Si= Se{sub 6} ({delta}) and Ag{sub 2}Hg{sub 3}SiSe{sub 6} ({epsilon}) was found. All phases are localized along the Ag{sub 8}SiSe{sub 6}-Hg{sub 4}SiSe{sub 6} section. The crystal structures of the {beta}-phase (for the Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6} composition) and {delta}-phase (for the Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6} composition) were determined. Both phases crystallize with a cubic unit cell (space group F4-bar3m) with the lattice parameters a=1.08806(4) nm and a=1.07108(2) nm for the Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6} and Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6}, respectively. Atomic parameters for them were refined in the anisotropic approximation [R{sub I}=0.0830 (Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6}) and R{sub I}=0.0950 (Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6})]. The crystal structure of the {epsilon}-phase is under investigation. The phase diagram of the HgSe-SiSe{sub 2} system was constructed in the range 0-60 mol.% SiSe{sub 2}. It was established that the Hg{sub 4}SiSe{sub 6} compound melts congruently at 1044 K and forms eutectics at {approx}12 mol.% SiSe{sub 2} (1023 K) and {approx}52 mol.% SiSe{sub 2} (961 K)

  14. Adherencia al tratamiento en pacientes con Diabetes tipo 2

    OpenAIRE

    Claudia Troncoso Pantoja; Delia Delgado Segura; Carolina Rubilar Villalobos

    2013-01-01

    La DM2 es una patología de crecimiento exponencial en los últimos años, por lo que su control es un llamado a intensificar los programas de salud dirigidos a esta población. Sin embargo, se presenta una falta de adherencia al tratamiento, por lo que esfuerzos realizados por el equipo médico se ven en numerosas ocasiones frustrados ante este escenario. Objetivo: Interpretar la percepción de los factores que determinan la adherencia al tratamiento prescrito de adultos con DM2 que asisten al Cen...

  15. Maltrato al anciano: "una realidad oculta en nuestra sociedad"

    OpenAIRE

    Rodríguez H. Shirley Catherine

    1996-01-01

    El maltrato al anciano es un hecho cotidiano, no reconocido socialmente como tal, por el contrario, el maltrato es considerado un cuento normal al que se ve expuesto un gran número de personas; que afecta el sistema familiar y a cada uno de sus miembros. Conscientes de la importancia del reconocimiento, identificación, manejo oportuno y adecuado y la intervención que enfermería realice en la situación del maltrato al anciano, se podrá forjar un camino hacia el cambio. La concepción d...

  16. Amyotrophic Lateral Sclerosis (ALS)

    Science.gov (United States)

    ... benefit of 16 months before onset of severe respiratory failure. Other treatments are designed to relieve symptoms and ... of ALS. Most people with ALS die from respiratory failure, usually within 3 to 5 years from the ...

  17. The Ag{sub 2}Se-HgSe-GeSe{sub 2} system and crystal structures of the compounds

    Energy Technology Data Exchange (ETDEWEB)

    Parasyuk, O.V.; Gulay, L.D.; Romanyuk, Ya.E.; Olekseyuk, I.D.; Piskach, L.V

    2003-03-10

    The phase diagram of the quasi-ternary Ag{sub 2}Se-HgSe-GeSe{sub 2} system at 298 K was investigated using X-ray phase analysis and metallography. The formation of five intermediate quaternary phases {beta} (Ag{sub {approx}}{sub 7.12-{approx}}{sub 6.32}Hg{sub {approx}}{sub 0.44-{approx}}{sub 0.82}G= eSe{sub 6}), {gamma} (Ag{sub {approx}}{sub 6.08-{approx}}{sub 4.00}Hg{sub {approx}}{sub 0.96-{approx}}{sub 2.00}G= eSe{sub 6}), {delta} (Ag{sub 3.4}Hg{sub 2.3}GeSe{sub 6}), {epsilon} (Ag{sub {approx}}{sub 2.24-{approx}}{sub 2.00}Hg{sub {approx}}{sub 2.88-{approx}}{sub 3.00}G= eSe{sub 6}) and {approx}Ag{sub 1.4}Hg{sub 1.3}GeSe{sub 6} was established. The crystal structure of the {beta}-phase (for the Ag{sub 6.504}Hg{sub 0.912}GeSe{sub 6} composition) was determined using X-ray single crystal diffraction. It crystallizes in a cubic structure (space group F4-bar 3m) with the lattice parameter a=1.09026(4) nm. The crystal structure of the {delta}-phase (Ag{sub 3.4}Hg{sub 2.3}GeSe{sub 6}) was determined using X-ray powder diffraction (space group F4-bar 3m, a=1.07767(8) nm). The crystal structure determination of the {gamma}-phase (space group Pmn2{sub 1}) was performed for the compositions Ag{sub 5.6}Hg{sub 1.2}GeSe{sub 6}, Ag{sub 4.8}Hg{sub 1.6}GeSe{sub 6} and Ag{sub 4}Hg{sub 2}GeSe{sub 6} using X-ray powder diffraction. The crystal structure of the LT-Hg{sub 2}GeSe{sub 4} compound (space group I4-bar , a=0.56786(2), c=1.12579(5) nm) was confirmed by powder diffraction also.

  18. Ionothermal Synthesis, Structure, and Bonding of the Catena -Heteropolycation 1 ∞ [Sb 2 Se 2 ] +

    KAUST Repository

    Groh, Matthias F.

    2015-01-26

    The reaction of antimony and selenium in the Lewis-acidic ionic liquid 1-butyl-3-methyl-imidazolium tetrachloridoaluminate, [BMIm]Cl•4.7AlCl3, yielded dark-red crystals of [Sb2Se2]AlCl4. The formation starts above 160 ° C; at about 190 ° C, irreversible decomposition takes place. The compound crystallizes in the triclinic space group P 1¯ with a = 919.39(2) pm, b = 1137.92(3) pm, c = 1152.30(3) pm, α = 68.047(1)° , β = 78.115(1)° , γ = 72.530(1)° , and Z = 4. The structure is similar to that of [Sb2Te2]AlCl4 but has only half the number of crystallographically independent atoms. Polycationic chains 1∞ [Sb2Se2]+ form a pseudo-hexagonal arrangement along [011¯] ], which is interlaced by tetrahedral AlCl4 - groups. The catena-heteropolycation 1∞ [Sb2Se2]+ is a sequence of three different four-membered [Sb2Se2 ] rings. The chemical bonding scheme, established from the topological analysis of the real-space bonding indicator ELI-D, includes significantly polar covalent bonding in four-member rings withinthepolycation.Theringsareconnectedintoaninfinitechainbyhomonuclear non-polar Sb-Sb bonds and highly polar Sb-Se bonds. Half of the selenium atoms are three-bonded.

  19. Control de brazo electrónico usando señales electromiográficas

    Directory of Open Access Journals (Sweden)

    Jorge Andrés García-Pinzón

    2015-05-01

    Full Text Available Los trabajos enfocados en la extracción de patrones en señales electromiográficas (SEMG han venido creciendo debido a sus múltiples aplicaciones. En este artículo se presenta una aplicación en la cual se implementa un sistema electrónico para el registro de las SEMG de la extremidad superior en un sujeto, con el fin de controlar de forma remota un brazo electrónico. Se realizó una etapa de preprocesamiento de las señales registradas, para eliminar información poco relevante, y reconocimiento de zonas de interés; enseguida se extraen los patrones y se clasifican. Las técnicas utilizadas fueron: análisis wavelet (AW, análisis de componentes principales (ACP, transformada de fourier (TF, transformada del coseno discreta (TDC, energía, máquinas de soporte vectorial (MSV o SVM y redes neuronales (RNA. En este artículo se demuestra que la metodología planteada permite realizar un proceso de clasificación con un rendimiento superior al 95%. Se registraron más de 4000 señales.

  20. Materiales de Al2O3 - MgAl2O4 - CaAl12O19 - Ca2Mg2Al28O46 obtenidos mediante un proceso de sinterización reactiva entre Al2O3 y CaMg(CO3)2

    OpenAIRE

    Aza Moya, Antonio H. de; Peña, P.; Moset, M.

    2002-01-01

    [ES] Utilizado la información suministrada por el diagrama de equilibrio de fases Al2O3-MgO-CaO se ha diseñado y obtenido un material de Al2O3-MgAl2O4-CaAl12O19-Ca2Mg2Al28O46 mediante sinterización reactiva de una mezcla de Al2O3 y CaMg(CO3)2. Las reacciones que tienen lugar en la mezcla durante el proceso se han estudiado usando técnicas de análisis térmico diferencial, termogravimetrico y dilatometría. Muestras reaccionadas a temperaturas seleccionadas se han estudiado por difracci...

  1. Ambientes virtuales como apoyo al Aprendizaje Colaborativo

    OpenAIRE

    Leguizamón, Guillermo; Chiarani, Marcela Cristina; Lucero, María Margarita; Pianucci, Irma Guadalupe; García, Berta Elena; Ponce, Viviana; Allendes Olave, Paola A.

    2005-01-01

    A partir de las conceptualizaciones sobre Educación a Distancia (EaD); y las Tecnologías disponibles para la EAD; se analizan los Ambientes Virtuales y su relación con el Código Abierto; lo que conlleva a presentar, en forma de grilla, las pautas y alcances de evaluación de plataformas virtuales de OS factibles de ser adaptados hacia la consecución de un Ambiente Virtual como apoyo al Aprendizaje Colaborativo. Con la puesta a punto, aplicación y relevo de esta grilla se estará en condicion...

  2. Semiconductor-metal transition of Se in Ru-Se Catalyst Nanoparticles

    Science.gov (United States)

    Babu, P. K.; Lewera, Adam; Oldfield, Eric; Wieckowski, Andrzej

    2009-03-01

    Ru-Se composite nanoparticles are promising catalysts for the oxygen reduction reaction (ORR) in fuel cells. Though the role of Se in enhancing the chemical stability of Ru nanoparticles is well established, the microscopic nature of Ru-Se interaction was not clearly understood. We carried out a combined investigation of ^77Se NMR and XPS on Ru-Se nanoparticles and our results indicate that Se, a semiconductor in elemental form, becomes metallic when interacting with Ru. ^77Se spin-lattice relaxation rates are found to be proportional to T, the well-known Korringa behavior characteristic of metals. The NMR results are supported by the XPS binding energy shifts which suggest that a possible Ru->Se charge transfer could be responsible for the semiconductor->metal transition of Se which also makes Ru less susceptible to oxidation during ORR.

  3. Synthesis and characterization of ZnSe:Fe/ZnSe core/shell nanocrystals

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Lin; Zhu, Jianguo, E-mail: yanglin_1028@163.com; Xiao, Dingquan

    2014-04-15

    High-quality ZnSe:Fe/ZnSe core/shell nanocrystals were prepared via a hydrothermal microemulsion technique. Effective surface passivation of monodisperse ZnSe:Fe nanocrystals is achieved by overcoating them with a ZnSe shell. The samples were characterized by means of XRD, EDX, TEM, PSD, XPS, photoluminescence, and Raman spectrum. The results show that the as-synthesized nanocrystals are cubic zinc blende ZnSe structure with high purity and the average particle size of ZnSe:Fe/ZnSe core/shell nanocrystal is larger than that of ZnSe:Fe core. The growth of ZnSe shell causes a small red shift in PL spectra, and then the PL quantum yield (QY) increases from 16% before shell growth to the maximum of 37% after increasing shell thickness up to 1.2 monolayers (ML). Moreover, both transverse optic (TO) and longitudinal optic (LO) phonon modes of ZnSe are shifted toward lower frequency as compared with the reported ones. -- Highlights: • ZnSe:Fe/ZnSe core/shell QDs were prepared by a hydrothermal microemulsion method. • ZnSe shell efficiently passivates surface defects by serving as a physical barrier. • The particle size and PL properties can be turned with the growth of ZnSe shell. • The luminescence efficiency and stability of QDs could be improved in this manner.

  4. Cs3Sm7Se12

    Directory of Open Access Journals (Sweden)

    Christof Schneck

    2012-01-01

    Full Text Available The title compound, tricaesium heptasamarium(III dodecaselenide, is setting a new starting point for realization of the channel structure of the Cs3M7Se12 series, now with M = Sm, Gd–Er. This Cs3Y7Se12-type arrangement is structurally based on the Z-type sesquiselenides M2Se3 adopting the Sc2S3 structure. Thus, the structural set-up of Cs3Sm7Se12 consists of edge- and vertex-connected [SmSe6]9− octahedra [dØ(Sm3+ – Se2− = 2.931 Å], forming a rock-salt-related network [Sm7Se12]3− with channels along [001] that are apt to take up monovalent cations (here Cs+ with coordination numbers of 7 + 1 for one and of 6 for the second cation. The latter cation has a trigonal–prismatic coordination and shows half-occupancy, resulting in an impossible short distance [2.394 (4 Å] between symmetrically coupled Cs+ cations of the same kind. While one Sm atom occupies Wyckoff position 2b with site symmetry ..2/m, all other 11 crystallographically different atoms (namely 2 × Cs, 3 × Sm and 6 × Se are located at Wyckoff positions 4g with site symmetry ..m.

  5. Unrecognized hemoglobin SE disease as microcytosis

    OpenAIRE

    Smith, Avery; Cooper, Barry; Guileyardo, Joseph; Mora, Adan

    2016-01-01

    Hemoglobin SE disease was first described during the 1950s as a relatively benign microcytosis, but increasing prevalence has revealed a predisposition towards vasoocclusive sickling. Recognition of SE hemoglobinopathies’ potential complications is crucial so medical measures can be utilized to avoid multiorgan injury.

  6. Cs2UPd3Se6

    Directory of Open Access Journals (Sweden)

    George N. Oh

    2011-02-01

    Full Text Available Dicaesium uranium(IV tripalladium(II hexaselenide, Cs2UPd3Se6, crystallizes in the space group Fmmm in the Ba2NaCu3O6 structure type. The asymmetric unit comprises the following atoms with site symmetries as shown: U1 (mm2, Cs1 (222, Cs2 (m2m, Pd1 (.m., Pd2 (2mm, Se1 (m.., and Se2 (1. This layered structure contains six edge-sharing square-planar [PdSe4] units that form a hexagon. These, in turn, edge-share with [USe6] trigonal–prismatic units, forming an extended layer parallel to (010. The layers are stacked along [010]. They are staggered, and are separated by the Cs atoms. The Cs atoms are either coordinated in a square antiprism of Se atoms or are ten-coordinate, with one square face and the opposite face hexagonal.

  7. Auditoría externa: responsabilidades cuando se trabaja con otros profesionales

    OpenAIRE

    Padin, María Belén

    2008-01-01

    Cuando un Contador Público es contratado como auditor externo se compromete a emitir un informe en el cual expresará su opinión sobre los estados contables del ente (puede suceder que el auditor finalmente deba abstenerse de opinar, pero esta es una excepción, ya que lo normal es que cuando se requieren los servicios de un auditor se espera que emita un informe). Al aceptar ser designado como auditor externo, el contador público acepta también las responsabilidades que recaen sobre él. Que so...

  8. Ecuador: …hasta que se fueron todos

    Directory of Open Access Journals (Sweden)

    JUAN CARLOS MACHADO PUERTAS

    2008-01-01

    Full Text Available El 2007 fue un año de cambios radicales en la política ecuatoriana. Se destaca la batalla política y electoral entre un Ejecutivo encabezado por un líder antisistema y radical, y la desprestigiada clase política que a la postre resultaría en la desaparición del precario sistema de partidos. En este proceso el presidente logró pasar de una situación minoritaria extrema, al no tener ningún respaldo legislativo propio en el Congreso, al extremo opuesto de controlar totalmente una Asamblea Constituyente de plenos poderes. Mientras una muy desilusionada y resentida ciudadanía todavía aplaude la derrota de una clase política corrupta, los problemas estructurales del sistema se han agravado. De manera paradójica, la preocupación actual no se centra ya en la crónica inestabilidad política, sino en la supervivencia misma de la disfuncional democracia ecuatoriana.This article highlights the year 2007 as a watershed in Ecuadorian politics. It underscores the fierce political and electoral battle between the radical and anti-systemic President and the established political class which led to the collapse of the nation’s precarious party system. Within this process the President maneuvered from an extreme minority position, lacking partisan support in Congress, to one of unfettered control of a fully empowered Constituent Assembly. Whilst disaffected citizens still applaud the defeat of a highly corrupt political class, the country’s structural problems have grown even deeper. Paradoxically enough, the current problem is not the country´s cronic instability, , rather the very survival of Ecuador’s dysfunctional democracy.

  9. Se-ducere: esse obscuro objeto de desejo

    Directory of Open Access Journals (Sweden)

    Anna Maria Balogh

    2008-12-01

    Full Text Available No artigo se analisa a última obra-prima de Buñuel, Cet Obscur Objet du Désir, com ênfase nas questões relativas à sedução, ao erotismo e ao desejo. Tal aproximação se faz com base nas reflexões de reputados autores que abordaram o tema tais como Octavio Paz, Francesco Alberoni, Jean Baudrillard e Marilena Chauí, entre outros. Tratam-se também dos elementos de linguagem considerados mais singulares na representação do erotismo por parte de Buñuel no filme. Os principais elementos linguageiros do cineasta seriam as experimentações no tocante à montagem e na utilização das atrizes, as rupturas no sistema de expectativas tradicional no tocante aos papéis do homem e da mulher no erotismo e na sedução. Além dos mencionados, merecem menção o uso de alternâncias entre a narração e o comentário, entre o relato e a moldura, bem como um paradoxal recurso a uma simbologia de cunho erótico bem tradicional dentro de um filme considerado de ruptura e de vanguarda.

  10. Challenges of Agricultural Adaptation to Climate Change in Nigeria: a Synthesis from the Literature Les enjeux de l’adaptation agricole au changement climatique au Nigéria : synthèse de la littérature Retos de la adaptación agrícola al cambio climático en Nigeria: una síntesis de la literatura

    Directory of Open Access Journals (Sweden)

    Anselm A. Enete

    2010-12-01

    services, and encouragement for the formation of farmer groups.Le changement climatique est peut-être la menace environnementale la plus sérieuse qui pèse sur la lutte contre la faim, la malnutrition, les maladies et la pauvreté en Afrique, principalement en raison de son impact sur la productivité agricole. Cet article aborde les enjeux de l’adaptation agricole au changement climatique au Nigéria dans les catégories Faim et Pauvreté ; Financement de la recherche et du développement de technologies dans le secteur de l’agriculture ; Pratiques agricoles traditionnelles ; Libéralisation des échanges commerciaux et Développement du marché ; Politiques, Institutions et Biens publics ; et Informations et Capital humain. La population rurale, qui produit plus de 70 % des denrées alimentaires consommées au Nigéria, est extrêmement pauvre et doit faire face à la malnutrition et aux maladies. L’Etat, tout comme le secteur privé, qui devraient stimuler le secteur par le biais de politiques cohérentes de financements solides et du développement d’infrastructures, n’ont pas accordé au problème la priorité qu’il mérite. En outre, les bénéfices attendus de la libéralisation du commerce n’ont pas été répercutés sur les agriculteurs africains, ce qui n’est pas sans relation avec l’inefficacité du système des marchés locaux. Par ailleurs, les agriculteurs sont lents à modifier leurs pratiques agricoles, comme les feux de brousse, la déforestation et l’agriculture pluviale. Ils manquent de l’éducation, des informations et de la formation nécessaires pour s’adapter au changement climatique. Le gouvernement devrait non seulement décentraliser ses programmes sur la pauvreté / le VIH-SIDA et sur la recherche agricole (financement et activités mais aussi les rendre participatifs. En outre, différents éléments pourraient être mis en place : un cadre de politique agricole nationale explicite ; une planification des systèmes d

  11. Reflexiones en torno al valor pedagógico del constructivismo

    Directory of Open Access Journals (Sweden)

    Pablo Durán Palacios

    2014-01-01

    Full Text Available Se investiga el valor fundamental del constructivismo para el proceso educativo y se establecen conclusiones valiosas al respecto. Se analizan ideas claves de J. Dewey, L. Vigotsky y H. Maturana sobre educación, para concluir con una consideración positiva del constructivismo como proyecto pedagógico consciente y realista res- pecto al valor del ser humano, y de las necesidades y desafíos que las personas tienen en la actual realidad social.

  12. El miedo al rey

    Directory of Open Access Journals (Sweden)

    François FORONDA

    2007-01-01

    Full Text Available La peur du roi. Sources et premières réflexions à propos d’une émotion aristocratique dans la Castille du XIVe siècleFace à un roi qui à présent pousse les effets de son ire jusqu’au meurtre pour faire le vide autour de lui et imposer sa différence souveraine, ses parents et les riches hommes, soit les principaux visés par cette politique de l’arbitraire qui enfreint les règles du jeu autant qu’elle contribue à les redéfinir, disent la peur (metus qu’ils ressentent, qu’ils utilisent aussi afin de donner à leur stratégie de pouvoir un fondement légitime. Et l’expression de cette émotion politique, qui tend à se muer en un stéréotype d’un discours aristocratique d’opposition, surtout présente dans les chroniques, mises ici en relation ici avec d’autres sources, notamment des correspondances, marque profondément l’histoire des relations souvent conflictuelles au sein de cette compagnie en définitive très étroite pendant un siècle, de la fin du XIIIe siècle à la fin du XIVe siècle. Cet article se propose d’ébaucher une première réflexion sur le sujet et d’en présenter les principales sources.El miedo al rey. Fuentes y primeras reflexiones acerca de una emoción aristocrática en la Castilla del siglo XIVFrente a un rey que ahora lleva hasta la muerte los efectos de su ira para hacer el vacío entorno a su persona e imponer su soberana, sus parientes y ricos hombres, o sea los principales afectados por esta política de la arbitrariedad que rompe las reglas del juego a la vez que contribuye a redefinirlas, dicen el miedo (metus que sienten, que utilizan también para darle a su estrategia de poder un fundamento legítimo. Y la expresión de esta emoción política, que tiende a convertirse en un estereotipo de un discurso aristocrático de oposición, sobre todo presente en la crónicas, aquí puestas en relación con otras fuentes, en particular cartas, marca profundamente la historia de

  13. Miedo al crimen y medios de comunicación: una revisión de la literatura

    OpenAIRE

    Isaías Molina Jácome

    2014-01-01

    Se revisa la literatura sobre la categoría "miedo al crimen", con el objetivo de comprender la asociación entre el crimen y los medios. La metodología se centró en revisar en las tres últimas décadas la temática del miedo al crimen, y se obtuvieron resultados en las tres tendencias identificadas: miedo al crimen asociado a la cobertura mediática; el miedo al crimen, la percepción del riesgo y victimización, y los estudios sobre el crimen, la prensa y las distintas miradas en Iberoamérica. Se ...

  14. ¿Con humor se explica y se aprende una lengua mejor?

    Directory of Open Access Journals (Sweden)

    Ricard Morant

    2010-11-01

    Full Text Available Normal 0 21 false false false ES X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabla normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} En el siguiente artículo nos proponemos reflexionar sobre la importancia del humor como estrategia didáctica. Para plantear si “el enseñar contento y el aprender con alegría” pueden aumentar la eficacia en el proceso de enseñanza-aprendizaje presentaremos en el primer apartado las ideas de partida, mostraremos cómo a pesar de las múltiples ventajas que puede aportar el humor a las aulas, se omite su empleo por la existencia de ciertos prejuicios y temores. Seguidamente, y a modo de ejemplo, expondremos, un tema, el tabú lingüístico, en clave de humor con el propósito de acabar planteando si el género humorístico beneficia o perjudica la práctica docente al hablar sobre una lengua o al tratar de enseñarla.

  15. Jalta als Heterotopie

    OpenAIRE

    Schmid, Ulrich

    2013-01-01

    Jalta ist ein Ort, der sich im europäischen Kulturgedächtnis sowohl historisch als auch literarisch als "radikal anderer Ort" - als " Heterotopie" - festgesetzt hat. An der Konferenz von Jalta wurde 1945 eine neue Weltordnung geschaffen in der Hoffnung auf eine bessere Welt. Auch in den Werken von Anton ?echov, vor allem in denjenigen, die in Jalta entstanden sind, wird von einer anderen und besseren Welt geträumt.

  16. Pornographie als Metapher

    OpenAIRE

    Caroline Schubarth

    2010-01-01

    In diesem Artikel werden unterschiedliche metaphorische Verwendungen des Pornografiebegriffs und deren Implikationen untersucht. Während die Existenz von Pornografie der feministischen Anti-Porno-Bewegung als Erklärung für die anhaltende Diskriminierung von Frauen in westlichen Gesellschaften dient, nutzen rechtskonservative Kräfte den Pornografievorwurf als Rechtfertigung für die Zensur von als deviant empfundenen Identitäten und sexuellen Praktiken.This article...

  17. Pornographie als Metapher

    Directory of Open Access Journals (Sweden)

    Caroline Schubarth

    2010-02-01

    Full Text Available In diesem Artikel werden unterschiedliche metaphorische Verwendungen des Pornografiebegriffs und deren Implikationen untersucht. Während die Existenz von Pornografie der feministischen Anti-Porno-Bewegung als Erklärung für die anhaltende Diskriminierung von Frauen in westlichen Gesellschaften dient, nutzen rechtskonservative Kräfte den Pornografievorwurf als Rechtfertigung für die Zensur von als deviant empfundenen Identitäten und sexuellen Praktiken.

  18. The system SnSe-Bi

    Energy Technology Data Exchange (ETDEWEB)

    Alidzhanov, M.A.; Alizade, M.Z.; Aslanov, G.A.; Gurshumov, A.P.; Persakhova, A.Y.

    1986-10-01

    The authors study the system SnSe-Bi on annealed samples by methods of physicochemical analysis; x-ray phase, differential-thermal analysis, microstructural analysis, and measurements of the microhardness. It was established that the eutectic contains five mole % SnSe and melts at 260 C. A bounded region of the SnSe-based solid solutions exist, and the solubility of SnSe in bismuth was not observed. Anomalies in the temperature dependences of the thermo-emf and electrical conductivity of the solid solutions were determined by the phase transformations of tin monoselenide. The nature of the changes in the thermo-emf and the electrical conductivity as a function of the temperature is associated with the changes in the density and effective mass of the charge carriers.

  19. Como Perseu se defendeu de Medusa?

    Directory of Open Access Journals (Sweden)

    Rose Lumertz de Freitas

    2012-04-01

    Full Text Available Na psicanálise francesa, principalmente com Lacan, o conceito de falta passou a ser de grande importância. Ao que, então, perguntamos: o que é a falta? E quando esta falta? O que acontece? O que acontece quando o não especularizável não está excluído, se fazendo, assim, especular? Quando Perseu vai ao encontro de Medusa, guiando-se por sua imagem refletida em um espelho de bronze polido, segurado por Atena, como pôde este herói defender-se de Medusa? Qual foi a forma encontrada por ele para se defender da presença do objeto que introduz a dimensão do real nu?

  20. Solving the shape conundrum in $^{70}$Se

    CERN Multimedia

    We propose a multi-step Coulomb-excitation study of $^{70}$Se at HIE-ISOLDE using the $^{208}$Pb( $^{70}$Se, $^{70}$Se*)$^{208}$Pb* reaction at a safe energy of 5.0 MeV/u. We aim at a precise measurement of the $\\left \\langle 2^{+}_{1} \\hspace{0.1cm} || \\hspace{0.1cm}\\hat{E}2 \\hspace{0.1cm} || \\hspace{0.1cm}2^{+}_{ 1} \\right \\rangle$ diagonal matrix element as well as gaining information on additional matrix elements. Such information will shed light onto the shape conundrum of the 2$^{+}_{1}$ state in $^{70}$Se as well as foreseeing the opportunity for a more detailed understanding of the shape-coexistence phenomenon in this region.

  1. Sin City: cuando el cine se rinde a los pies del cómic

    OpenAIRE

    Echazarreta Soler, Carmen

    2006-01-01

    Proposta didàctica que se situa entre els llenguatges del còmic i del cinema per a promoure la reflexió sobre la cerca de noves formes de narrar. El fil conductor és Sin City i es proposen, també, 10 activitats per als alumnes

  2. Spectral Motion Synchronization in SE(3)

    OpenAIRE

    Arrigoni, Federica; Fusiello, Andrea; Rossi, Beatrice

    2015-01-01

    This paper addresses the problem of motion synchronization (or averaging) and describes a simple, closed-form solution based on a spectral decomposition, which does not consider rotation and translation separately but works straight in SE(3), the manifold of rigid motions. Besides its theoretical interest, being the first closed form solution in SE(3), experimental results show that it compares favourably with the state of the art both in terms of precision and speed.

  3. Double electron capture searches in $^{74}$Se

    CERN Document Server

    Lehnert, B; Degering, D; Sommer, D; Wagner, L; Zuber, K

    2016-01-01

    A search for various double electron capture modes of $^{74}$Se has been performed using an ultralow background Ge-detector in the Felsenkeller laboratory, Germany. Especially for the potentially resonant transition into the 1204.2 keV excited state of $^{74}$Ge a lower half-life limit of $0.70\\cdot 10^{19}$ yr (90% credibility) has been obtained. Serious concerns are raised about the validity of obtained $^{74}$Se limits in some recent publications.

  4. MAGNETIC ANOMALY IN SUPERCONDUCTING FeSe

    OpenAIRE

    Mendoza, D.; Benitez, J. L.; Morales, F.; Escudero, R.

    2010-01-01

    Synthesis, electrical and magnetic characterization of superconducting FeSe0.85 compound is reported. An anomaly in the magnetization against temperature around 90K is observed. Magnetic characterization of a commercial compound with nominal FeSe stoichiometry is also presented. The overall magnetic behaviors as well as the magnetic anomaly in both compounds are discussed in terms of magnetic impurities and secondary phases. Keyword: A. Superconductors

  5. Magnetic properties of FeSe superconductor

    OpenAIRE

    Grechnev, G. E.; Panfilov, A.S.; Desnenko, V. A.; Fedorchenko, A. V.; Gnatchenko, S. L.; Chareev, D. A.; Volkova, O. S.; A.N. Vasiliev

    2012-01-01

    A detailed magnetization study for the novel FeSe superconductor is carried out to investigate the behavior of the intrinsic magnetic susceptibility $\\chi$ in the normal state with temperature and under hydrostatic pressure. The temperature dependencies of $\\chi$ and its anisotropy $\\Delta \\chi=\\chi_{|}-\\chi_{\\bot}$ are measured for FeSe single crystals in the temperature range 4.2-300 K, and a substantial growth of susceptibility with temperature is revealed. The observed anisotropy $\\Delta ...

  6. Dos algoritmos para estimar el periodo de una señal discreta

    Directory of Open Access Journals (Sweden)

    José Danilo Rairán Antolines

    2014-11-01

    Full Text Available In this paper, we present two algorithms for approximating a period given a discrete data set. These algorithms superimpose two consecutive sections of the data for several candidate periods. The first algorithm counts the number of shuffling points per candidate period, whereas the second algorithm computes a distance between points when sorted by time. The best candidate period maxim-izes the number of shuffling points in the first algorithm, whereas the second algorithm minimizes the distance between points. The experimental validation with noiseless data demonstrates that the relative error for the estimations is less than half of the sampling period and shows that this error does not depend on the harmonic content, as normally occurs with algorithms that estimate a period. The application of the algorithms demonstrates that they properly track the frequency of a power grid and accurately estimate the period of a Van der Pol oscillator, which serves to confirm their applicability to real-time problems. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabla normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0mm 5.4pt 0mm 5.4pt; mso-para-margin:0mm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

  7. Cum se construiește profilul strategic al unei comunități

    Directory of Open Access Journals (Sweden)

    Călin Emilian HINȚEA

    2015-12-01

    Full Text Available The article presents a particular methodology of strategic planning: building a strategic profile of the community. This model is the result of years of research and applied planning in local communities and tries to help all interested parties to understand and use the strategy.

  8. CuInGaAlSe2 Solar Absorbers On Flexible High-Temperature Substrates Project

    Data.gov (United States)

    National Aeronautics and Space Administration — ITN Energy Systems (ITN) proposes to take the next step in spacecraft solar array development, building upon previous development and new findings to make the...

  9. Atomistic Model of Physical Ageing in Se-rich As-Se Glasses

    Energy Technology Data Exchange (ETDEWEB)

    Golovchak,R.; Shpotyuk, O.; Kozdras, A.; Bureau, B.; Vlcek, M.; Ganjoo, A.; Jain, H.

    2007-01-01

    Thermal, optical, X-ray excited and magnetic methods were used to develop a microstructural model of physical ageing in Se-rich glasses. The glass composition As10Se90, possessing a typical cross-linked chain structure, was chosen as a model object for the investigations. The effect of physical ageing in this glass was revealed by differential scanning calorimetry, whereas the corresponding changes in its atomic arrangement were studied by extended X-ray absorption fine structure, Raman and solid-state 77Se nuclear magnetic resonance spectroscopy. Straightening-shrinkage processes are shown to be responsible for the physical ageing in this Se-rich As-Se glass.

  10. Exciton-Phonon Scattering in CdSe/ZnSe Quantum Dots

    Institute of Scientific and Technical Information of China (English)

    张立功; 申德振; 范希武; 吕少哲

    2002-01-01

    A temperature-dependent photoluminescence measurement is performed in CdSe/ZnSe quantum dots with a ZnCdSe quantum well. We deduce the temperature dependence of the exciton linewidth and peak energy of the zero-dimensional exciton in the quantum dots and two-dimensional exciton in the CdSe wetting layer. The experimental data reveal a reduction of homogeneous broadening of the exciton line in the quantum dots in comparison with that in the two-dimensional wetting layer, which indicates the decrease of exciton and optical phonon coupling in the CdSe quantum dots.

  11. Partial pressure diagrams of the In-Se-O and Ga-Se-O systems

    International Nuclear Information System (INIS)

    The partial pressure diagrams of the In-Se-O and Ga-Se-O systems in the po2 and pSeO2 coordinates have been discussed. The mono- and invariant equilibria have been calculated using isothermal Want-Hoff equation. The relationships between the partial pressure diagrams and the condensed phase equilibrium diagrams have been established. It has been shown that the increase of the SeO2 partial pressure leads to the formation of the A2III Se3 compounds and the formation of oxide phases requires relatively high pressures of oxygen

  12. Amphoteric CdSe nanocrystalline quantum dots.

    Science.gov (United States)

    Islam, Mohammad A

    2008-06-25

    The nanocrystal quantum dot (NQD) charge states strongly influence their electrical transport properties in photovoltaic and electroluminescent devices, optical gains in NQD lasers, and the stability of the dots in thin films. We report a unique electrostatic nature of CdSe NQDs, studied by electrophoretic methods. When we submerged a pair of metal electrodes, in a parallel plate capacitor configuration, into a dilute solution of CdSe NQDs in hexane, and applied a DC voltage across the pair, thin films of CdSe NQDs were deposited on both the positive and the negative electrodes. Extensive characterizations including scanning electron microscopy (SEM), atomic force microscopy (AFM), Fourier transform infrared (FTIR) and Raman studies revealed that the films on both the positive and the negative electrodes were identical in every respect, clearly indicating that: (1) a fraction (<1%) of the CdSe NQDs in free form in hexane solution are charged and, more importantly, (2) there are equal numbers of positive and negative CdSe NQDs in the hexane solution. Experiments also show that the number of deposited dots is at least an order of magnitude higher than the number of initially charged dots, indicating regeneration. We used simple thermodynamics to explain such amphoteric nature and the charging/regeneration of the CdSe NQDs.

  13. Introducción al análisis de datos cualitativos y al programa ATLAS.TI 7. Material de apoyo

    OpenAIRE

    Sabariego Puig, Marta; Vilà Baños, Ruth

    2014-01-01

    Este dossier es un recopilatorio de los recursos que se utilizarán y se sugerirán a lo largo del curso, a modo complementario, sobre los principales temas que se presentarán. Se trata de un documento para permitir al lector la profundización de estos temas, mediante lecturas y bibliografía de ampliación al final, junto con los esquemas de todo el contenido para el seguimiento del curso estructurado en cuatro bloques básicos: TEMA 1.- El proceso de investigación cualitativa para la mejora ...

  14. Al- Khwarizmi and axiomatic foundation of algebra

    International Nuclear Information System (INIS)

    This paper intends to investigate the axiomatic foundations of algebra, as they were presented in the book of algebra of al-Khwarizmi (9 th century), and as they were developed in many subsequent Arabic works. The paper gives also a description of algebra evolution towards a discipline independent ofgeometry and arithmetic: the two disciplines whosemarriage had led to its birth.By an in depth reading of some details in the text of al Khwarizmi , we concluded that this mathematician intended to lay down the axiomatic foundations of that new discipline. His resort to arithmetical and geometrical means was a way of making his theory more accessible. He used them to justify the axioms: those that were not explicitly introduced per se, and those that were remained implicit. The paper also relies on some unedited writingsof al-Khwarizmi's successors, which could shedlight on the ways they used to consolidate the foundations of algebra and improve its methods. (author)

  15. Effect of composition on optical properties of GeSe3–Sb2Se3–ZnSe thin films

    Indian Academy of Sciences (India)

    M R Balboul; H M Hosni; M A Soliman; S A Fayek

    2014-10-01

    Optical properties of the chalcogenides GeSe3, Sb2Se3, ZnSe, (GeSe3)80(Sb2Se3)20 and (GeSe3)70 (Sb2Se3)10(ZnSe)20 thin films are investigated. Incorporation of ZnSe into both GeSe3, Sb2Se3 results in amorphous (GeSe3)70(Sb2Se3)10(ZnSe)20 composition. The estimated optical energy gap, g, is found to decrease from 3.06 eV for ZnSe to 1.81 eV for (GeSe3)70(Sb2Se3)10(ZnSe)20. While, the band tail width, e, exhibits an opposite trend. The g behaviour is believed to be associated with cohesive energy, CE, as the incorporation of ZnSe lowers its value. The calculated number of the excess of Se–Se homopolar bonds is found to affect mainly the e values. The refractive index, , is discussed in terms of Wemple–DiDomenico single oscillator dispersion model in the normal dispersion region. The oscillator energy, o, and the dispersion energy, d, are determined for films under investigation.

  16. Gezondheid als marketinginstrument

    NARCIS (Netherlands)

    Vijver, van de L.P.L.; Berg, van den I.

    2008-01-01

    Is biologisch voedsel beter dan gangbaar? Hoe hard zijn de bewijzen daarvoor? En hoe sterk moet het bewijs zijn voordat je het als claim op een product mag zetten? In dit Biokennis bericht een overzicht van de wetenschappelijke conclusies en de mogelijkheden om biologisch te promoten als beter, neer

  17. Al-Anon/Alateen

    Science.gov (United States)

    Find an Al-Anon meeting Español | Français 2018 Int'l Convention Home About Group Meetings What If I'm not ready ... a meeting? What can I expect at an Al-Anon meeting? What was my first meeting like? ...

  18. Sucesión en la empresa familiar: Su futuro cuando la muerte se acerca

    Directory of Open Access Journals (Sweden)

    Jesús Alberto Andrade C.

    2002-01-01

    Full Text Available Este trabajo hace un análisis teórico al tema de la empresa familiar. Tiene como objetivos identificar características que definen a una empresa familiar en comparación con empresas no familiares; analizar la sucesión del negocio familiar al considerar que el futuro deseado de cada uno de los miembros debe ser común y único, si se quiere su continuidad; analizar cómo el manejo de conflictos sirve para desarrollar un buen plan sucesoral que permite integrar a la familia en torno a una visión de negocio común a todos los miembros de la familia. Se parte de la hipótesis que si se quiere que los negocios familiares perduren a la siguiente generación, la familia debe enfrentar el temor de la muerte a fin de poder desarrollar un plan sucesoral que sea beneficioso tanto para la empresa como para la propia familia. Los resultados de la investigación señalan que la empresa familiar es una organización que se sustenta en un permanente conflicto, por lo tanto, para que la empresa perdure deben establecerse mecanismos de participación de los integrantes, y ello es posible, porque en las empresas familiares seconcentran en pocas manos el control, permitiéndoles ser ágiles en el proceso de toma de decisiones estratégicas. Se concluye que las empresas familiares se caracterizan por el estrecho nexo cultural y tradicional con la familia que las dirige; y se distinguen de otros tipos de negocios, por el tipo de compromiso de los miembros con la empresa y por el éxito alcanzado cuando se define un plan de sucesión que sirva de transición no traumática de una generación a la siguiente.

  19. Anclados al neuromarketing

    OpenAIRE

    Castro Lanero, Sonia Beatriz

    2012-01-01

    El neuromarketing es una ciencia de muy reciente creación que se nutre de dos ciencias clave: la investigación empírica del estudio cerebral que nos hace vislumbrar aspectos deterministas del comportamiento humano y su posible aplicación en el proceso de decisión de compra. En este trabajo se recopilan los últimos avances que se han realizado ene ste campo en el ámbito interenacional así como su incipiente desarrollo en España y en la Comunidad Autónoma de Castilla y León en particular. Final...

  20. Al - BASED CAST COMPOSITES

    Directory of Open Access Journals (Sweden)

    Rakesh Kumar Yadav

    2011-08-01

    Full Text Available The economy is very important feature nowadays in themarket. The researches are playing an important role inengineering field to increase the life of machine parts /components and decrease the cost. The compositematerials have the potential to replace widely used steeland aluminium due to their good characteristics withbetter performance. The Al-based composites have foundextensive applications in automobile industries andaerospace industries due to their increased stiffness,strength, thermal conductivity and wear resistanceproperties. A number of particulate phases have beenemployed in the Al-alloy matrix. The cast aluminiumceramicparticulate composites are finding applications inpistons, connecting rods, cylinder liner, engine cylinderblock, electrical contacts etc.The present investigation isbased on study of the effect of particulate phase on theSEM study, micro-hardness, elastic modulus, tensilestrength and the wear behaviour of Al-5 % SiC-7 % Fe,Al-10 % SiC-6 % Fe and Al-15 % SiC-5 % Fe composites.

  1. Auditoría externa: responsabilidades cuando se trabaja con otros profesionales

    Directory of Open Access Journals (Sweden)

    Padin, María Belén

    2008-11-01

    Full Text Available Cuando un Contador Público es contratado como auditor externo se compromete a emitir un informe en el cual expresará su opinión sobre los estados contables del ente (puede suceder que el auditor finalmente deba abstenerse de opinar, pero esta es una excepción, ya que lo normal es que cuando se requieren los servicios de un auditor se espera que emita un informe. Al aceptar ser designado como auditor externo, el contador público acepta también las responsabilidades que recaen sobre él. Que son inherentes a su desempeño profesional y que están regidas por las normas profesionales dentro de las cuales debe encuadrar su actividad. A lo largo de este trabajo, se estudiará qué responsabilidades recaen sobre el auditor cuando actúa en colaboración con otros profesionales. Los casos específicos que se estudiarán son: 1 responsabilidad por la utilización del trabajo de otro auditor; 2 consideración del trabajo de auditoria interna; y 3 utilización del trabajo de un experto. Para ello se mencionarán las normas internacionales de auditoria (NIA que tratan cada tema en específico, y alguna norma en particular que exista de otro organismo al respecto.

  2. Synthesis, structure, magnetic and photo response properties of La3CuGaSe7

    International Nuclear Information System (INIS)

    Highlights: • We successfully synthesized the first Cu2+-containing compound in the Ce6Al3.33S14 family. • The Cu atoms undergo a position disorder along c axis. • The compound shows a band gap of 1.36 eV. • The compound shows paramagnetic properties. • The high photo current up to 2.4 mA is achieved under visible light irradiation. - Abstract: The quaternary compound La3CuGaSe7, which is the first Cu2+-containing compound in the Ce6Al3.33S14 family (space group P63, Pearson symbol hP24), was synthesized in a solid state reaction at 1273 K. The structure was determined by single crystal X-ray diffraction. The refined lattice parameters are a = 10.6010(8) Å and c = 6.376(1) Å. The crystal structure consists of isolated [CuSe3]4− pyramid and [GaSe4]5− tetrahedra. The isolated [CuSe3]4− pyramid and the isolated [GaSe4]5− tetrahedra are connected by [LaSe7]11− monocapped trigonal prisms. Phase purity of the powder sample was confirmed by powder X-ray diffraction. The band gap of the compound is 1.36 eV. The photo current of the compound achieves 2.4 mA under the visible light irradiation

  3. Señalización y seguridad vial

    OpenAIRE

    García Verduch, Antonio

    1992-01-01

    Se explica el suceso de que un autobús con 55 pasajeros se salió de la autopista y sufrió un accidente, se pide que se esclarezcan los hechos y que se dote de mejor señalización a las carreteras españolas

  4. ESTUDIO SOBRE EL DERECHO AL RECURSO EN EL PROCESO PENAL

    Directory of Open Access Journals (Sweden)

    Carlos del Río Ferretti

    2012-01-01

    Full Text Available Esta investigación examina el derecho al recurso en el proceso penal. En lo sustancial se mantiene que estando el proceso, dentro de una concepción cognoscitivista de jurisdicción, orientado a la correcta aplicación del derecho, el derecho al recurso aparece también como una regla epistemológica que propicia justamente dicha orientación. En segundo término, se perfilan precisamente los contenidos y exigencias normativos específicos que derivan del denominado derecho al recurso y se realiza un cotejo con la regulación legal del recurso de nulidad y su realidad aplicativa, con el propósito de poner en evidencia las inconsistencias normativas y jurisprudenciales con los contenidos comprendidos en aquél.

  5. One-pot synthesis of hollow NiSe-CoSe nanoparticles with improved performance for hybrid supercapacitors

    Science.gov (United States)

    Chen, Haichao; Fan, Meiqiang; Li, Chao; Tian, Guanglei; Lv, Chunju; Chen, Da; Shu, Kangying; Jiang, Jianjun

    2016-10-01

    Hollow NiSe-CoSe samples have been synthesized for the first time via a one-pot solvothermal approach. The strategy is robust enough to synthesize NiSe-CoSe nanoparticles with different NiSe to CoSe ratios but with a similar hollow structure. Co ions in the NiSe-CoSe nanoparticles play decisive role for formation of the hollow structure; otherwise, the nanoparticles become solid for the NiSe sample. When used as the positive electroactive materials for energy storage, the NiSe-CoSe samples show excellent electrochemical activity in alkaline electrolyte. Using the synergistic effect between NiSe and CoSe, the electrochemical performance of NiSe-CoSe can be tuned by varying the NiSe to CoSe ratios. The NiSe-CoSe sample with a NiSe to CoSe ratio of 4:2 shows the best electrochemical performance in terms of superior specific capacity, improved rate capability and excellent cycling stability. In addition, the electrochemical performance of NiSe-CoSe sample with a NiSe to CoSe ratio of 4:2 is also evaluated via assembling hybrid supercapacitors with RGO, and the hybrid supercapacitor delivers both high power and energy densities (41.8 Wh kg-1 at 750 W kg-1 and 20.3 Wh kg-1 at 30 kW kg-1).

  6. Monoclinic Cu2Se3Sn.

    Science.gov (United States)

    Gulay, L D; Daszkiewicz, M; Ostapyuk, T A; Klymovych, O S; Zmiy, O F

    2010-05-01

    A previously unknown modification of dicopper(I) triselenostannate(IV), Cu(2)Se(3)Sn, has been obtained from the Cu(2)Se-SnSe(2) quasi-binary system and investigated using X-ray single-crystal diffraction. The Se atoms are stacked in a closest-packed arrangement with the layers in the sequence ABC. The Cu atoms occupy one-third of the tetrahedral interstices, whereas the Sn atoms are located in one-sixth of the tetrahedral interstices. All the atoms occupy general positions. The structure possesses pseudo-inversion symmetry. The Cu(2)Se(3)Sn structure investigated in this paper (96 atoms per unit cell, ordered distribution of Cu and Sn over 12 cation positions) is a superstructure of the reported cubic (eight atoms per unit cell, random distribution of Cu and Sn over one cation position) and monoclinic (24 atoms per unit cell, ordered distribution of Cu and Sn over three cation positions) modifications. PMID:20442500

  7. PbSe Nanocrystal Excitonic Solar Cells

    KAUST Repository

    Choi, Joshua J.

    2009-11-11

    We report the design, fabrication, and characterization of colloidal PbSe nanocrystal (NC)-based photovoltaic test structures that exhibit an excitonic solar cell mechanism. Charge extraction from the NC active layer is driven by a photoinduced chemical potential energy gradient at the nanostructured heterojunction. By minimizing perturbation to PbSe NC energy levels and thereby gaining insight into the "intrinsic" photovoltaic properties and charge transfer mechanism of PbSe NC, we show a direct correlation between interfacial energy level offsets and photovoltaic device performance. Size dependent PbSe NC energy levels were determined by cyclic voltammetry and optical spectroscopy and correlated to photovoltaic measurements. Photovoltaic test structures were fabricated from PbSe NC films sandwiched between layers of ZnO nanoparticles and PEDOT:PSS as electron and hole transporting elements, respectively. The device current-voltage characteristics suggest a charge separation mechanism that Is distinct from previously reported Schottky devices and consistent with signatures of excitonic solar cells. Remarkably, despite the limitation of planar junction structure, and without film thickness optimization, the best performing device shows a 1-sun power conversion efficiency of 3.4%, ranking among the highest performing NC-based solar cells reported to date. © 2009 American Chemical Society.

  8. MoSe2 / Polyaniline Solar Cells

    Directory of Open Access Journals (Sweden)

    H.S. Patel

    2011-01-01

    Full Text Available Solar cells have been investigated since long for harnessing the solar energy. During this decade, a new direction has come up where in the polymers have been used in the fabrication of solar cells. Polyaniline is one of the polymers which has shown potential for its applications in heterostructure solar cells. This material is being used along with the semiconductors like InSe, TiO2, Si etc. to form the photosensitive interface. In this direction, we report our investigations on the use of Molybdenum diselenide (MoSe2 as photosensitive semiconducting material in MoSe2 / polyaniline solar cells. In this paper, the preparation of MoSe2 / polyaniline solar cells has been reported. Also, the photovoltage → photocurrent characteristics of this structure have been discussed in detail in this paper. The variation of different parameters of MoSe2 / polyaniline solar cells (like open circuit voltage, short circuit current, photoconversion efficiency and fill factor with the intensity of incident illuminations has been reported in this paper. In present case, the photocurrent density was found to be around 250 µA/cm2 with the photovoltage around 8.5 mV (which is low the photoconversion efficiency was found to be around 0.7 % along with the fill factor around 0.33. The efforts have been made to explain the low values of the photoconversion efficiency.

  9. Aplicaciones del coaching al deporte: adaptación al pádel

    OpenAIRE

    González Hernández, Antonio; Torres López, Borja

    2015-01-01

    En el presente trabajo pretendemos aportar una visión profunda en la aplicación del coaching al deporte y cómo puede ser usado por directivos, entrenadores o jugadores de una organización deportiva o club, en el pádel de manera concreta. Conoceremos las distintas fases que se deben dar para una correcta intervención, además de los acuerdos entre el coach y el deportista. En el contexto actual, las empresas y entidades deportivas se ven obligadas a adaptarse a la nueva realidad económica. ...

  10. Quito Gay: Al borde del destape y al margen de la ciudad

    OpenAIRE

    Aguirre Arauz, Patricio

    2010-01-01

    En este trabajo se busca explicar cómo se construye las imágenes, lenguajes y discursos de la homosexualidad en Quito. Aunque este tema brotó espontáneamente como inquietud personal, no por ello pierde su sentido antropológico y su compromiso ético con las poblaciones estudiadas. Al inicio las inquietudes del autor brincaban entre el entusiasmo por un tema poco común y el afán de entender una identidad aparentemente oculta. Pronto los discursos a través de los medios de comunicación, el leng...

  11. Benjamin y Wittgenstein en torno al lenguaje de los hombres

    Directory of Open Access Journals (Sweden)

    Kenneth Moreno May

    2015-01-01

    Full Text Available En este trabajo se confrontan las imágenes de Ludwig Wittgenstein y Walter Benjamin en torno al lenguaje; se toma como punto de partida el Tractatus Logico-Philosophicus de Wittgenstein, y otros textos de su obra madura, comparándolos con algunos textos de la juventud de Benjamin, entre los que resalta, Sobre el lenguaje en general y el lenguaje de los humanos. Los objetivos generales son dos: Por un lado, mostrar como ambos autores confluyen desde caminos diferentes hacia el mismo punto. Por otro lado, exponer la manera como Benjamin se adelanta al Wittgenstein maduro mostrando las conexiones del lenguaje y espiritualidad a través de lo que Benjamin llama “facultad mimética” de la naturaleza y del ser humano. A partir de esta reflexión se mantiene con Benjamin una postura crítica respecto a la obra del joven Wittgenstein.

  12. Del sistema al actor

    Directory of Open Access Journals (Sweden)

    Alain Touraine

    2009-11-01

    impone a los órganos en la concepción biológica tradicional. Se puede distinguir también la sociología funcionalista sistémica de la sociología funcionalista crítica. En ambos casos se trata de dos de las orientaciones mas importantes del pensamiento sociológico desde sus orígenes.

  13. Improved photoluminescence quantum yield and stability of CdSe-TOP, CdSe-ODA-TOPO, CdSe/CdS and CdSe/EP nanocomposites

    Science.gov (United States)

    Wei, Shutian; Zhu, Zhilin; Wang, Zhixiao; Wei, Gugangfen; Wang, Pingjian; Li, Hai; Hua, Zhen; Lin, Zhonghai

    2016-07-01

    Size-controllable monodisperse CdSe nanocrystals with different organic capping were prepared based on the hot-injection method. The effective separation of nucleation and growth was achieved by rapidly mixing two highly reactive precursors. As a contrast, we prepared CdSe/CdS nanocrystals (NCs) successfully based on the selective ion layer adsorption and reaction (SILAR) technique. This inorganic capping obtained higher photoluminescence quantum yield (PLQY) of 59.3% compared with organic capping of 40.8%. Furthermore, the CdSe-epoxy resin (EP) composites were prepared by adopting a flexible ex situ method, and showed excellent stability in the ambient environment for one year. So the composites with both high PLQY of nanocrystals and excellent stability are very promising to device application.

  14. Lattice thermal conductivity of LaSe

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wei, E-mail: tolwwt@163.com [School of Physics and Telecommunication Engineering, South China Normal University, 510006 Guangzhou (China); Pan, Zhong-liang; Chen, Jun-fang; He, Qin-yu [School of Physics and Telecommunication Engineering, South China Normal University, 510006 Guangzhou (China); Wang, Teng [School of Computer, South China Normal University, 510631 Guangzhou (China)

    2015-07-15

    The phonon dispersions and phonon density of states of LaSe are obtained, based on density functional perturbation theory and the norm-conserving pseudo-potential method. An anomaly in calculated phonon dispersion curves is presented and interpreted as a Kohn anomaly. The heat capacity of LaSe is calculated then. For the three-phonon process scattering, the lowest non-harmonic cubic terms of the interatomic potential are considered to obtain single-phonon relaxation rate by applying the Fermi's golden rule. For the boundary scattering, the average phonon relaxation time was obtained. Considering two kinds of phonon scattering mechanisms, we obtain the lattice thermal conductivity of LaSe.

  15. Cd And Se Atomic Environments During the Growth of CdSe Nanoparticles in Glass

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, T.M.; Persans, P.D.; Filin, A.; Peng, C.; Huang, W.

    2006-10-27

    Thermal treatment of Cd and Se doped borosilicate glass yields CdSe nanoparticles that are interesting for applied and fundamental studies of quantum and size effects in semiconductors. Using x-ray absorption spectroscopy at both the Cd and Se K-edges, we have studied the local atomic structure for each of these reactants at several stages of particle growth. When the doped glass is quenched from 1050 C, the Cd neighbor is mostly oxygen and the Se neighbor is mostly Zn. With heat treatment at 600-750 C, the concentration of nearest neighbor Cd-Se bonds increases and becomes dominant while the optical spectrum evolves toward that of a composite containing CdSe.

  16. Što se dogodilo gospodinu Davisonu

    Directory of Open Access Journals (Sweden)

    Una Krizmanić Ožegović

    2014-12-01

    Full Text Available Prije svega, dozvolite mi da kažem da svi osjećamo najiskreniju sućut zbog onoga što se dogodilo gospodinu Davidsonu. Naravno, nitko od nas nije mogao ni pomisliti da će sve tako završiti. To ne treba ni napominjati. Mislim, doista ne vjerujem da je bilo tko mogao predvidjeti posljedice onoga što se dogodilo. Daleko od toga da smo sjeli i proveli detaljnu analizu rizika kad smo odlučili djelovati u tome smjeru. Naravno da ne. Riječ je o spontanoj odluci, jednostavno nas je ponio trenutak. No, unatoč nedostatku podrobnije analize, mogu sa sigurnošću reći kako ovakav ishod nitko od nas nije mogao ni zamisliti. Mislim, očito da nije. Jednostavno, mi nismo takvi ljudi, nitko od nas. Mislim da se to podrazumijeva. Mislim da sa sigurnošću mogu reći kako se to uvriježilo među nekim ljudima koje je ovo pogodilo, u odnosu na kasniji tijek događaja. Uključujući i samoga gospodina Davidsona. S obzirom na sve što smo uspjeli zaključiti. Mislim, znate, neki od ljudi kojima se okružio bili su s pravom oprezni, s obzirom na ono što bismo mogli nazvati pristupom. Tako barem ja to, i dandanas, vidim: takav pristup u sadašnjem trenutku ne bi bio dobro prihvaćen, s obzirom na trenutačne okolnosti. Govorim s obzirom i u odnosu na treće strane, u ovome kontekstu. S obzirom da smo držali kako bi se izravan pristup protumačio kao neprimjeren, u odnosu na širi kontekst i povijest i tome slično.

  17. Synthesis of near-infrared-emitting CdTe/CdSe/ZnSe/ZnS heterostructure.

    Science.gov (United States)

    Yang, Ping

    2014-04-01

    Near-infrared-emitting quantum dots (QDs) were fabricated via organic synthesis strategies through constructing CdTe/CdSe/ZnSe/ZnS multishell heterostructure. An effective shell-coating route was developed for multishell growth on CdTe cores. Core/shell growth was monitored by absorption and photoluminescence (PL) spectroscopy and transmission electron microscopy observation. Yellow emitting CdTe cores were coated with a CdSe shell to generate type II structure. This yields core/shell QDs with red photoluminescence. The passivation by the ZnSe shell having a substantially wide bandgap confines the excitons within the CdTe/CdSe interface and isolates them from the solution environment and consequently improves the stability of the heterostructure. An additional ZnS shell was deposited around the outer layer of CdTe/CdSe/ZnSe QDs to form a heterostructure through the reaction between zinc oleate and trioctylphosphine sulfur in the crude CdTe/CdSe/ZnSe solution. By varying CdTe core size and each shell thickness, the PL wavelength of the obtained heterostructure can span from 580 to 770 nm. The PL efficiency is quenched in CdTe QDs in diluted solution but increases substantially up to 24% for CdTe/CdSe core/shell QDs. The PL efficiency of CdTe/CdSe/ZnSe/ZnS QDs with average diameter of 5.4 nm and a PL peak wavelength of 770 nm is 20%. PMID:24734747

  18. Brasil. Cuando la modernidad se hizo color.

    OpenAIRE

    Cortina Maruenda, Francisco Javier; Molina Siles, Pedro Javier

    2013-01-01

    La modernidad deformada ha desterrado en múltiples ocasiones el uso del color en sus realizaciones. Incluso, hasta hoy en día, esta idea se repite como irreflexivo punto de partida de múltiples proyectos. Esto, a pesar de que los grandes maestros han hecho uso de este recurso sin ocultarlo. Un claro ejemplo fue Le Corbusier que incluso generó sus propias colecciones de colores. Por otro lado, Brasil se ha significado desde siempre como un reducto donde la manera de ver el movimiento modern...

  19. Análisis de la actualización que se proporciona a los docentes del Centro de Estudios Científicos y Tecnológicos Narciso Bassols.

    OpenAIRE

    Reynoso Urbano, Agustín

    2015-01-01

    La investigación aborda la actualización que se proporciona a los docentes del CECyT “Narciso Bassols”, centro que pertenece al Instituto Politécnico Nacional. Se revisaron los trabajos que se han desarrollado en esta materia. Se encuentra que la actualización, es un elemento muy importante en la vida de cualquier Institución y esta cobra relevancia si se trata de una que se dedica a la prestación de servicios. De los diversos autores que se revisaron, se observo que estos coinciden en manife...

  20. Cogito y locura. En torno al debate Foucault-Derrida

    OpenAIRE

    Amar Díaz, Mauricio

    2012-01-01

    El artículo indaga en la polémica en torno al estatuto de la locura en la filosofía, en el que participaron Michel Foucault y Jacques Derrida. Se plantea la posibilidad abierta por Foucault de realizar una historia de la locura, así como la pertinencia de las críticas que realiza Derrida a la manera aparentemente contradictoria en que Foucault se refiere, a lo largo de su obra, al psicoanálisis y a la figura de Freud. The article explores the controversy surrounding the status of madness i...

  1. Seguimiento al hogar de personas con antecedentes de enfermedad mental

    OpenAIRE

    Esguerra de Cárdenas Irene

    2010-01-01

    El "programa de apoyo y seguimiento al hogar de personas con antecedentes de enfermedad mental" se inició formalmente en marzo de 1993 en la Clínica Nuestra Señora de la Paz. Surgió de la necesidad de implementar acciones concretas al egreso de los pacientes de la institución, tendientes a reforzar la responsabilidad de éstos en su tratamiento y manejo de la enfermedad en el hogar y además de ofrecer un recurso de apoyo para escuchar sus inquietudes y preocupaciones. El propósito del...

  2. Reduction in the crystal defect density of Zn Se layers grown by molecular beam epitaxy

    International Nuclear Information System (INIS)

    We present a study of the molecular beam epitaxial (MBE) grown of Zn Se layers on Ga-As and Si substrates. For the growth on GaAs substrates we investigated the effects of introducing buffer layers of AlxGa1-x As and InxGa1-x As with x = 0.01. Moreover, an analysis by secondary ion mass spectroscopy revealed that the use of AlGaAs buffer layers effectively suppress the Ga segregation onto the Zn Se layers surface. On the other hand, for the growth of Zn Se on Si substrates, we achieved a significant improvement in the crystal quality of Zn Se by irradiating the Si substrates with plasma of nitrogen prior to the growth. (Author)

  3. Miedo al crimen en estudiantes de la ciudad de Caracas

    Directory of Open Access Journals (Sweden)

    Jan Liebnitzky

    2013-01-01

    Full Text Available Se midió el miedo al crimen en un grupo de estudiantes universitarios, centrándose en inseguridad subjetiva y paradoja victimización-miedo, que considera que la inseguridad subjetiva no refleja a la objetiva. Se buscaba saber si esa paradoja existía en los estudiantes y si las teorías explicativas serían útiles. Se comparó el nivel de miedo al crimen con dos ciudades Latinoamericanas, empleando un diseño de secciones-cruzadas, usando el Cuestionario de Inseguridad Urbana, y elementos cuantitativos y cualitativos. Las mujeres presentaron más miedo al crimen que los varones, resultado significativo sólo para la escala fisiológica. Nivel socioeconómico bajo presentó menos miedo al crimen que niveles medios. Victimización previa no hace diferencias en miedo al crimen, mayor en Lima y San Luis, que en Caracas. Inseguridad objetiva es muy alta y el miedo es bajo en comparación. La paradoja está invertida en el grupo. Se propone el concepto de habituación como hipótesis para explicarlo.

  4. Señales purinérgicas Purinergic signals

    Directory of Open Access Journals (Sweden)

    Eduardo R Lazarowski

    2009-04-01

    Full Text Available En la última década se ha aportado clara evidencia de que tanto nucleósidos como nucleótidos de adenina y uridina pueden funcionar como factores de señalización extracelular. Su acción es mediada por dos tipos principales de receptores de superficie denominados purinérgicos. Los receptores P1 se activan por adenosina, y son todos metabotrópicos, mientras que los receptores de nucleótidos (ATP, ADP, UTP y UDP y nucleótidos-azúcares (UDP-glucosa y UDP-galactosa pueden ser metabotrópicos (P2Y o ionotrópicos (P2X. La importancia y complejidad de este sistema de señalización se evidencia por la diversidad de mecanismos de liberación de nucleótidos al medio extracelular y por la distribución ubicua de varios grupos de ectonucleotidasas capaces de catalizar la degradación y conversión de nucleótidos. Hasta el momento se han descrito y clonado una veintena de estos receptores que modulan una variedad de respuestas, como el impulso nervioso, la respuesta inflamatoria, la secreción de insulina, la regulación del tono vascular y la percepción del dolor. En la presente revisión se describen las características estructurales y farmacológicas de los receptores purinérgicos y se analiza la interacción dinámica entre estos receptores, los nucleósidos y nucleótidos, y las ectonucleotidasas, con especial atención a la dinámica de la agregación plaquetaria, la respuesta inmune y la hidratación de las mucosas respiratorias.In the last decade evidence accumulated that nucleosides and nucleotides of both uridine and adenine can act as extracellular signaling factors. Their action is mediated by two main types of surface receptors commonly known as purinergic. P1 receptors are metabotropic and activated by adenosine, whereas receptors for nucleotides (ATP, ADP, UTP and UDP and nucleotide-sugars (UDP-glucose and UDP-galactose can be either metabotropic (P2Y or ionotropic (P2X. The importance and complexity of this signaling system

  5. ¿Cómo se leen los números?

    Directory of Open Access Journals (Sweden)

    Pedro Macizo

    2012-07-01

    Full Text Available En los modelos de procesamiento numérico se asume que para llegar a la información fonológica que nos permite nombrar un dígito arábigo como “3”, tenemos que acceder previamente a su significado (la cantidad 3. Esto no es necesario cuando leemos una palabra numérica como “tres”, pues podemos pronunciarla sin entender a qué cantidad se refiere. Pero nuestro equipo ha mostrado recientemente que tanto la denominación de dígitos arábigos como la lectura de palabras numéricas pueden realizarse sin acceder al significado. Creemos que el acceso directo a la fonología en el caso de los dígitos arábigos podría derivarse del aprendizaje temprano y de la frecuencia de uso de este tipo de símbolos numéricos.

  6. Sociale media als leermiddel

    NARCIS (Netherlands)

    Rubens, Wilfred

    2012-01-01

    Rubens, W. (2012, 5 juni). Sociale media als leermiddel. Presentatie over het gebruik van sociale media binnen het onderwijs, verzorgd tijdens een ouderraadbijeenkomst van de Katholieke Scholengemeenschap Etten-Leur, Etten-Leur, Nederland.

  7. MDA ALS Caregiver's Guide

    Science.gov (United States)

    ... R.D., C.N.S.D., L.D.N. Nutritionist MDA/ALS Center at Vanderbilt University Medical Center ... neurologists, physiatrists, therapists (physical, occupa- tional, speech, respiratory), nutritionists, social work- ers, pulmonologists, gastroenterologists and medical equipment ...

  8. Regionale Herkunft als Bonus

    OpenAIRE

    Kratochvil, Dr. Ruth

    2004-01-01

    Der Bio-Sektor durchlebt bewegte Zeiten. Die biologische Landwirtschaft hat sich aus der Nische herausbewegt und dafür an „Besonderheiten“ eingebüßt. Diese müssen als Zusatznutzen wiedergefunden werden.

  9. La vigilancia de factores vinculados al desarrollo, el aprendizaje y la salud en la primera infancia

    OpenAIRE

    Ojeda del Valle, Mayra

    2012-01-01

    Se desarrollaron tres investigaciones entre 1997-2007 con el objetivo de perfeccionar la vigilancia de los factores vinculados al desarrollo, el aprendizaje y la salud en la primera infancia. Fueron identificados factores asociados al desarrollo y a la respuesta adaptativa de los niños asistentes a instituciones infantiles, se evaluaron indicadores del neurodesarrollo infantil asociados al aprendizaje escolar en la Atención Primaria y se realizó la pesquisa de factores de riesgo en niños pree...

  10. Iniciaci??n al ajedrez en Educaci??n Infantil y su aplicaci??n al desarrollo del pensamiento l??gico-matem??tico

    OpenAIRE

    Trobajo de las Matas, Mar??a Teresa; Castro-Garc??a, Noem?? de

    2016-01-01

    En el documento se desarrolla el proyecto de innovaci??n docente titulado "Iniciaci??n al ajedrez en Educaci??n Infantil y su aplicaci??n al desarrollo del pensamiento-l??gico". Este proyecto se ha llevado a cabo en el tercer curso del Grado de Educaci??n Infantil en la asignatura de Recursos para la Ense??anza de las Matem??ticas durante el curso escolar 2014/2015

  11. Partizipation als Ausnahmezustand

    OpenAIRE

    Korf, Benedikt

    2009-01-01

    In «Die Erfindung des Politischen» (1993) beschreibt Ulrich Beck Subpolitik als den Ort, an dem die Grenze zwischen Politik und Nichtpolitik verschwindet. Aus der zunehmenden Wirkkraft von Subpolitik erwächst die grundlegende Frage, mit welcher Legitimation diese Art von Subpolitik in die Sphäre der institutionalisierten Politik eindringt. Beck’s Subpolitik soll im Anschluss an theoretische Arbeiten von Chantal Mouffe und Giorgio Agamben als post-politische Aspiration bezeichnet werden, die e...

  12. Econometría + Investigación Acción Participativa: ¿se reconoce la utilidad de usarlos juntos en las Ciencias Sociales?

    Directory of Open Access Journals (Sweden)

    Maribel Castillo Caicedo

    2012-01-01

    Full Text Available En economía, al hacer análisis sociales, normalmente se utilizan modelos econométricos que se basan en modelos teóricos económicos para acercarse a la comprobación de hipótesis en las poblaciones analizadas. Las decisiones de política que se toman teniendo en cuenta modelos econométricos dejan de lado información importante que no se recoge a partir de los mismos debido al afán de contextualizar. Por lo anterior, se plantea que al utilizar la Investigación Acción Participativa (IAP y la econometría se podría tener un acercamiento además de una generalización de la población a analizar, adicionalmente se podría hacer algún tipo de transformación social sobre la misma. En el presente trabajo se revisa la importancia de incorporar metodologías cualitativas tipo IAP a los análisis econométricos tradicionales que se usan en Economía para analizar temas sociales. Para lo anterior se plantean las bases teóricas de cada metodología y se plantea qué aporta cada una

  13. Reference: SE2PVGRP1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ter, domain A of the 35S promoter and the 35S2 promoter. Transgenic Res 4:388-396 (1995) PubMed: 7581519; ... ...SE2PVGRP1 Elmayan T, Tepfer M. Evaluation in tobacco of the organ specificity and strength of the rolD promo

  14. Det faderløse samfund

    DEFF Research Database (Denmark)

    Jensen, Henrik

    Det faderløse samfund er en kulturhistorisk afdækning af fader- og autoritetstabet i det 20. århundredes Europa, med fokus på fader-søn-forholdet og fortalt gennem skikkelser som Max Weber, Freud, Jung, Kafka - og ’den uregerlige søn’ over dem alle, psykologen og anarkisten Otto Gross. Den er...

  15. Enriched $^{82}$Se for the LUCIFER experiment

    CERN Document Server

    Beeman, J W; Benetti, P; Cardani, L; Casali, N; Chiesa, D; Clemenza, M; Dafinei, I; Di Domizio, S; Ferroni, F; Gironi, L; Giuliani, A; Gotti, C; Laubenstein, M; Maino, M; Nagorny, S; Nisi, S; Nones, C; Orio, F; Pagnanini, L; Pattavina, L; Pessina, G; Piperno, G; Pirro, S; Previtali, E; Rusconi, C; Schäffner, K; Tomei, C; Vignati, M

    2015-01-01

    The LUCIFER project aims at deploying the first array of enriched scintillating bolometers for the investigation of neutrinoless double-beta decay of $^{82}$Se. The matrix which embeds the source is an array of ZnSe crystals, where enriched $^{82}$Se is used as decay isotope. The radiopurity of the initial components employed for manufacturing crystals, that can be operated as bolometers, is crucial for achieving a null background level in the region of interest for double-beta decay investigations. In this work, we evaluated the radioactive content in 2.5 kg of 96.3% enriched $^{82}$Se metal, measured with a high-purity germanium detector at the Gran Sasso deep underground laboratory. The limits on internal contaminations of primordial decay chain elements of $^{232}$Th, $^{238}$U and $^{235}$U are respectively: $<$61 $\\mu$Bq/kg, $<$110 $\\mu$Bq/kg and $<$74 $\\mu$Bq/kg at 90% C.L.. The extremely low-background conditions in which the measurement was carried out and the high radiopurity of the $^{82}$...

  16. Biaxially Oriented CdSe Nanorod

    DEFF Research Database (Denmark)

    Breiby, Dag W.; Chin, Patrick T.K.; Andreasen, Jens Wenzel;

    2009-01-01

    The shape, structure, and orientation of rubbing-aligned cadmium selenide (CdSe) nanorods on polymer coated glass substrates have been studied using transmission electron microscopy (TEM) and grazing incidence X-ray scattering combined with computer simulations. The nanorods are found to be of...

  17. Structural studies of amorphous Se under pressure

    OpenAIRE

    Tanaka, Keiji

    1990-01-01

    X-ray-diffraction patterns, macroscopic compressibility, and crystallization in amorphous Se subject to pressure have been investigated. The material exhibits pressure-induced structural modifications in the glassy state and a phase transformation to the hexagonal phase at 120±20 kbar. The observations are discussed on the basis of microscopic and thermodynamic models.

  18. New GPS measurements in SE Turkey and in NW Syria

    Science.gov (United States)

    Mahmoud, Y.; Masson, F.; Meghraoui, M.; Cakir, Z.; Alchalbi, A.; Daoud, M.; Ergintav, S.; Inan, S.

    2010-05-01

    The triple junction area located between SE Turkey and NW Syria is tectonically complex because it is at the intersection of three main fault systems, the left-lateral East Anatolian Fault Zone (EAF), the left-lateral Dead Sea Fault (DSF) and the Cyprus Arc. Previous GPS results indicate 9.7+0.9 mm/yr along the EAF and 2.5-6 mm/yr along the DSF (McClusky et al., 2003; Reilinger et al., 2006; Alchalbi et al., 2009). This zone of active deformation is at the boundary between the Arabian, African, and Anatolia-Eurasia plates. The tectonic complexity results from the existence of several tectonic blocks limited by individual fault segments (DSF, EAF, Osmaniye fault, Karasu fault, Latakia fault, Jisr-al-shuggur fault, Idleb fault and Afrin fault) whose kinematics and related fault-slip rates are poorly constrained. Main issues to address in this region are: What are the velocities (geodetic) and slip rates (geologic) along the three main strike-slip fault systems? What is the role of individual tectonic blocks in the regional deformation? In order to answer these questions we established a network of 59 campaign GPS points in NW Syria and in SE Turkey. The 59 GPS monuments consist of 10 cm steel pins fixed into bedrock and are located on both sides of the active faults. The sites are distributed in 4 main profiles (35 points) in Syria with an extension of 2 profiles (24 points) in Turkey. The compatibility between all profiles in Syria and in Turkey is taken into account for a better assessment of velocity field and physical parameters of fault branches along the three major fault systems. The first campaign was carried out in 2009 where the 24 points in Turkey are measured in September, where all sites observed for 24 hours over two sessions of 12 hours using Thales Z Max receivers with Thales Z Max Ashtech antenna. The 35 points in Syria were measured in October and November 2009 where each site was observed for one session of 24 hours using Thales DSNP 6502MK

  19. EFECTO DEL PRECALENTAMIENTO Y LA SEVERIDAD DE TEMPLE SOBRE LA RESISTENCIA AL DESGASTE ADHESIVO DEL ACERO AUSTENÍTICO AL MANGANESO

    Directory of Open Access Journals (Sweden)

    OSCAR FABIÁN HIGUERA COBOS

    2010-01-01

    Full Text Available En este trabajo de investigación se estudió el efecto del precalentamiento y la severidad de temple sobre la resistencia al desgaste adhesivo del acero austenítico al manganeso ASTM A 128 grado C. El material se sometió a ciclos térmicos de temple y revenido con y sin precalentamiento con el fin de evaluar su influencia sobre la resistencia al desgaste. Posteriormente el material fue sometido a prueba según norma ASTM G83 y se determinó que el acero Austenítico al manganeso, es un material que presenta una microestructura metaestable en condiciones estables y no debe ser sometido a tratamiento térmico de revenido a altas temperaturas debido que favorece la descomposición de esta a ferrita (fase blanda de los acero y por ende disminuye su resistencia al desgaste.

  20. Anisotropic Terahertz Emission from Bi2Se3 Thin Films with Inclined Crystal Planes.

    Science.gov (United States)

    Hamh, Sun Young; Park, Soon-Hee; Han, Jeongwoo; Jeon, Jeong Heum; Kahng, Se-Jong; Kim, Sung; Choi, Suk-Ho; Bansal, Namrata; Oh, Seongshik; Park, Joonbum; Kim, Jun Sung; Kim, Jae Myung; Noh, Do Young; Lee, Jong Seok

    2015-12-01

    We investigate the surface states of topological insulator (TI) Bi2Se3 thin films grown on Si nanocrystals and Al2O3 substrates by using terahertz (THz) emission spectroscopy. Compared to bulk crystalline Bi2Te2Se, film TIs exhibit distinct behaviors in the phase and amplitude of emitted THz radiation. In particular, Bi2Se3 grown on Al2O3 shows an anisotropic response with a strong modulation of the THz signal in its phase. From x-ray diffraction, we find that the crystal plane of the Bi2Se3 films is inclined with respect to the plane of the Al2O3 substrate by about 0.27°. This structural anisotropy affects the dynamics of photocarriers and hence leads to the observed anisotropic response in the THz emission. Such relevance demonstrates that THz emission spectroscopy can be a sensitive tool to investigate the fine details of the surface crystallography and electrostatics of thin film TIs. PMID:26694079

  1. Der Preis als Kaufbarriere?

    DEFF Research Database (Denmark)

    Mueller Loose, Simone

    2012-01-01

    Die Preispolitik hat eine herausragende Stellung im Marketing. Der Preis eines Produktes ist für Verbraucher ein direkter Kostenfaktor und für Unternehmen die Stellgröße im Mar-ketingmix, die den Umsatz am stärksten beeinflusst (vgl. Nieschlag et al. 2002). Wenn die Akzeptanz und der regelmäßige...... Verzehr gesunder Lebensmittel erhöht werden soll, ist es sowohl für die Verbraucherpolitik als auch für Lebensmittelproduzenten wichtig, den Ein-fluss des Preises auf die Kaufentscheidung zu verstehen. Aus Verbrauchersicht ist der Preis neben dem Geschmack die wichtigste Produkteigen-schaft beim Kauf von...... Lebensmitteln (vgl. Brunsø/Grunert 1998) und stellt eine Kaufbarrie-re für Lebensmittel mit gesundheitsfördernden Eigenschaften dar. Studien in den USA (vgl. Cassady et al. 2007), Frankreich (vgl. Drewnowski et al. 2004; Andrieu et al. 2005) und Deutschland (vgl. Karg et al. 2008) kommen übereinstimmend zu dem...

  2. Digitalización: su contribución al desarrollo de la gerencia empresarial

    OpenAIRE

    Mario González Arencibia; Dagmaris Martínez Cardero

    2014-01-01

    En este trabajo se hace una presentación de las principales tendencias y discusiones vinculadas al tema del mundo de unos y ceros, en el entendido de que muchos de los puntos que se abordan podrían ser objeto de un tratamiento detallado. Atendiendo a esto se persigue, como objetivo, promover la reflexión crítica acerca de las posibilidades que ofrece la digitalización para el desarrollo de la gerencia empresarial. Los resultados obtenidos señalan que la digitalización, al estar imbricando nov...

  3. Ayuda al aprendizaje con tecnología en la educación superior

    OpenAIRE

    Badia, Antoni

    2006-01-01

    Se presentan reflexiones sobre una conceptualización psicoeducativa basada en un enfoque sociocognitivo del significado de la ayuda al aprendizaje con las TIC en la educación superior. El contenido se organiza en tres partes. En la primera, se desarrolla el significado de la ayuda al aprendizaje desde una visión constructivista sociocognitiva (con el uso del concepto de andamiaje educativo). En la segunda, se tratan implicaciones conceptuales significativas sobre la introducción de la tecnolo...

  4. Luis López-Ballesteros: primer traductor de las obras completas de Freud al castellano

    OpenAIRE

    Juan Manuel Martín Arias; Lorenzo Gallego Borghini

    2011-01-01

    El castellano fue el primer idioma al que se tradujeron las obras completas de Sigmund Freud. A ello contribuyeron diversos factores, entre los que se destaca la figura de Luis López-Ballesteros, a quien le encargó la traducción la editorial Biblioteca Nueva. En este artículo se esbozan someramente la recepción del psicoanálisis en España y las traducciones de Freud al español y se ofrece una breve semblanza de Luis López-Ballesteros. --------------------------------------------- Luis López-B...

  5. Speciation of Se and DOC in soil solution and their relation to Se bioavailability.

    NARCIS (Netherlands)

    Weng, L.P.; Vega, F.A.; Supriatin, S.; Bussink, W.; Riemsdijk, van W.H.

    2011-01-01

    A 0.01 M CaCl2 extraction is often used to asses the bioavailability of plant nutrients in soils. However, almost no correlation was found between selenium (Se) in the soil extraction and Se content in grass. The recently developed anion Donnan membrane technique was used to analyze chemical speciat

  6. Ultra-Fast Synthesis for Ag2Se and CuAgSe Thermoelectric Materials

    Science.gov (United States)

    DUAN, H. Z.; LI, Y. L.; ZHAO, K. P.; QIU, P. F.; SHI, X.; CHEN, L. D.

    2016-10-01

    Ag2Se and CuAgSe have been recently reported as promising thermoelectric materials at room temperature. The traditional melting-annealing-sintering processes are used to grow Ag2Se and CuAgSe materials with the disadvantages of high costs of energy and time. In this work, phase-pure polycrystalline Ag2Se and CuAgSe compounds were synthesized from raw elemental powders directly by manual mixing followed by spark plasma sintering (MM-SPS) in a few minutes. The influence of SPS heating rate on the phase composition, microstructure, and thermoelectric properties, including Seebeck coefficient, electrical conductivity, and thermal conductivity, were investigated. The zTs of 0.8 at 390 K and 0.6 at 450 K are obtained for Ag2Se and CuAgSe, respectively, which is comparable with the values in the materials prepared by the traditional method. Furthermore, this ultrafast sample synthesis can significantly save material synthesis time and thus has the obvious advantage for large-scale production.

  7. Pivško jygajo se 'guncajo se' (Petelinje) ali o nastanku slovenskega razmerja jugati : gugati:

    OpenAIRE

    Furlan, Metka

    2010-01-01

    Since the Pivka dialect does not have second palatalization of velars, the verb jyugajo se 'they are swinging' (Petelinje), with its Slovene phonetic equivalents from Slovene gúgati se, is explained with dissimilation g : g --> o : g and the appearance of the prothetic -j.

  8. Dephasing and interaction of excitons CdSe/ZnSe islands

    DEFF Research Database (Denmark)

    Wagner, H. P.; Tranitz, H.-P.; Preis, H.;

    2000-01-01

    The dephasing of excitons in self-organized CdSe/ZnSe islands grown by molecular-beam epitaxy is investigated using spectrally resolved four-wave mixing. A distribution of dephasing times is observed, indicating the existence of localized excitons with different relaxation times at comparable...

  9. Neumonitis por hipersensibilidad asociado al cuidado de aves

    OpenAIRE

    Ana María González-Zúñiga; Juana Alejandra Gutiérrez-Ríos

    2015-01-01

    La neumonitis por hipersensibilidad asociada al cuidado de las aves es uno de los tipos más frecuentes de esta que se presentan. Aunque no se tienen datos epidemiológicos claros sobre su prevalencia, en los hospitales llegan casos de este tipo. No es una patología muy común; sin embargo, una muestra representativa de la población se encuentra expuesta a las aves y, consecuentemente, a los antígenos que causan la enfermedad. Su diagnóstico temprano puede significar para el paciente evitar daño...

  10. Geometría aplicada al número 8

    OpenAIRE

    Icaza Lomelí, Leonardo

    2011-01-01

    En este texto se plantea como objetivo descubrir en la arquitectura y sus elementos, nociones de geometría de manifestación mudéjar, a través de indagar y determinar principios en el ocho como número y sustento geométrico, y de cómo éstos contribuyeron para constituir una identidad, ya que al ser aceptados y permanecer, se integraron en la arquitectura española y novohispana. La hipótesis a probar es cómo se conservan nociones de geometría griega aplicada a instrumentos y trazos en aquellos h...

  11. 'Cold' crystallization in nanostructurized 80GeSe2-20Ga2Se3 glass.

    Science.gov (United States)

    Klym, Halyna; Ingram, Adam; Shpotyuk, Oleh; Calvez, Laurent; Petracovschi, Elena; Kulyk, Bohdan; Serkiz, Roman; Szatanik, Roman

    2015-01-01

    'Cold' crystallization in 80GeSe2-20Ga2Se3 chalcogenide glass nanostructurized due to thermal annealing at 380°C for 10, 25, 50, 80, and 100 h are probed with X-ray diffraction, atomic force, and scanning electron microscopy, as well as positron annihilation spectroscopy performed in positron annihilation lifetime and Doppler broadening of annihilation line modes. It is shown that changes in defect-related component in the fit of experimental positron lifetime spectra for nanocrystallized glasses testify in favor of structural fragmentation of larger free-volume entities into smaller ones. Nanocrystallites of Ga2Se3 and/or GeGa4Se8 phases and prevalent GeSe2 phase extracted mainly at the surface of thermally treated samples with preceding nucleation and void agglomeration in the initial stage of annealing are characteristic features of cold crystallization. PMID:25852346

  12. 'Cold' crystallization in nanostructurized 80GeSe2-20Ga2Se3 glass.

    Science.gov (United States)

    Klym, Halyna; Ingram, Adam; Shpotyuk, Oleh; Calvez, Laurent; Petracovschi, Elena; Kulyk, Bohdan; Serkiz, Roman; Szatanik, Roman

    2015-01-01

    'Cold' crystallization in 80GeSe2-20Ga2Se3 chalcogenide glass nanostructurized due to thermal annealing at 380°C for 10, 25, 50, 80, and 100 h are probed with X-ray diffraction, atomic force, and scanning electron microscopy, as well as positron annihilation spectroscopy performed in positron annihilation lifetime and Doppler broadening of annihilation line modes. It is shown that changes in defect-related component in the fit of experimental positron lifetime spectra for nanocrystallized glasses testify in favor of structural fragmentation of larger free-volume entities into smaller ones. Nanocrystallites of Ga2Se3 and/or GeGa4Se8 phases and prevalent GeSe2 phase extracted mainly at the surface of thermally treated samples with preceding nucleation and void agglomeration in the initial stage of annealing are characteristic features of cold crystallization.

  13. Anisotropy in CdSe quantum rods

    Energy Technology Data Exchange (ETDEWEB)

    Li, Liang-shi

    2003-09-01

    The size-dependent optical and electronic properties of semiconductor nanocrystals have drawn much attention in the past decade, and have been very well understood for spherical ones. The advent of the synthetic methods to make rod-like CdSe nanocrystals with wurtzite structure has offered us a new opportunity to study their properties as functions of their shape. This dissertation includes three main parts: synthesis of CdSe nanorods with tightly controlled widths and lengths, their optical and dielectric properties, and their large-scale assembly, all of which are either directly or indirectly caused by the uniaxial crystallographic structure of wurtzite CdSe. The hexagonal wurtzite structure is believed to be the primary reason for the growth of CdSe nanorods. It represents itself in the kinetic stabilization of the rod-like particles over the spherical ones in the presence of phosphonic acids. By varying the composition of the surfactant mixture used for synthesis we have achieved tight control of the widths and lengths of the nanorods. The synthesis of monodisperse CdSe nanorods enables us to systematically study their size-dependent properties. For example, room temperature single particle fluorescence spectroscopy has shown that nanorods emit linearly polarized photoluminescence. Theoretical calculations have shown that it is due to the crossing between the two highest occupied electronic levels with increasing aspect ratio. We also measured the permanent electric dipole moment of the nanorods with transient electric birefringence technique. Experimental results on nanorods with different sizes show that the dipole moment is linear to the particle volume, indicating that it originates from the non-centrosymmetric hexagonal lattice. The elongation of the nanocrystals also results in the anisotropic inter-particle interaction. One of the consequences is the formation of liquid crystalline phases when the nanorods are dispersed in solvent to a high enough

  14. Del sistema al actor

    OpenAIRE

    Alain Touraine

    2009-01-01

    Si consideramos que las conductas sociales están determinadas por el lugar que los individuos, los grupos o las categorías sociales ocupan en la organización social, entonces será necesario aceptar la idea de que aquello que se denomina la Sociedad posee sus propios intereses y refuerza su integración y funcionamiento. Esta idea ha encontrado dos expresiones concretas: o bien se piensa que el bien y el mal son definidos por aquello que es funcional o disfuncional para la sociedad, es decir qu...

  15. Modification of residual stress in Al-[AlBO]w/Al compound plate

    Institute of Scientific and Technical Information of China (English)

    姜传海; 吴建生; 王德尊

    2001-01-01

    The application of compound parts of Al-[AlBO]w/Al not only reduces the cost of the parts but also improves its properties. However, there is a large thermal residual stress between Al and [AlBO]w/Al, and it is harmful for practical application. From the theoretical analyses and experimental results, it was found that by the compressive pre-plastic deformation perpendicular to the interface between Al and [AlBO]w/Al, the interlayer residual stress of compound parts can be reduced, while the mechanical properties of compound parts can be improved.

  16. ¿Se fabrica una crisis de la educación nacional?

    OpenAIRE

    Vaca Uribe, Dr. Jorge; Universidad Veracruzana

    2012-01-01

    Cuando uno de nosotros se enteró (alrededor del año 2002) que en Estados Unidos —país que casi siempre nos lleva la delantera y al que muchos mexicanos buscan imitar y agradar—, se manufacturó una crisis de la educación pública desde ciertas esferas del propio gobierno, no pudo menos que asombrarse y conseguir el libro que reportaba las indagaciones respectivas: The Manufactured Crisis: Myths, Fraud and Attack on America's Public School, escrito por David Berlinger y Bruce Biddle y publicado ...

  17. Fortschritt als Fortschrittsdiskurs

    Directory of Open Access Journals (Sweden)

    Rainer Schmid-Zartner

    2014-12-01

    Full Text Available Zur Erzielung gesellschaftlichen Fortschritts in demokratisch verfassten Gesellschaften soll die Möglichkeit am Fortschrittsdiskurs teilnehmen zu können für alle Mitglieder der Gesellschaft als selbstverständliche Prämisse gelten. Fortschritt wird also als Bewusstseinsbildung dem Fortschritt selbst gegenüber und als Entscheidungs- und Handlungsfähigkeit auf individueller und gesellschaftlicher Ebene definiert. Dies setzt entsprechende Maßnahmen zur Befähigung dazu voraus, die alle Mitglieder der Gesellschaft erfassen. Dabei ist der Bildungsbereich angesprochen, insbesondere der Schulunterricht. Neben dem in der aktuellen blidungspolitischen Debatte forcierten Fokus auf den Aspekt der Kompetenzorientierung, der hier nicht infrage gestellt wird, ist als notwendige Ergänzung ein reflexionsorientierter Schulunterricht in allen Bildungsfächern einzufordern und umzusetzen. Im Weiteren beschreibt der Text den Weg von der Brauchbarkeit zur Bedeutsamkeit von schulischem Wissen durch Relevanzreflexionsprovokationen im Schulunterricht, um Sinn und Bedeutung der vermittelten Bildungsinhalte zu verhandeln. Am Beispiel von Mathematik als Bildungsfach wird der Inhalt von reflexionsorientertem Unterricht verdeutlicht. Darüber hinaus beschreibt der Text eine Reihe von konkreten Fallbeispielen aus der aktuell versuchsweise durchgeführten Unterrichtspraxis in Mathematik.

  18. Iwill P4SE-Gold

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    这是Iwill公司865PE产品线中的一款高档产品。主板要用红色PCB.整体布局显得比较紧凑。P4SE-Gold同时集成了Intel 82547EI千兆网卡芯片和Realtek RTL8100百兆网卡芯片,如果你家中有两台PC需要共享Internet连接.这块主板倒是可以省去额外添置网卡的麻烦。P4SE-Gold在I/O接口的设计上也比较特殊.它集成了2个以太网卡接口,

  19. Kan pædagogen se barnet

    DEFF Research Database (Denmark)

    Øhrgaard, Per

    2008-01-01

    relationer er noget levende og foranderligt. Begrebet Kontekst fremhæves ligeledes som et vigtigt begreb, der understreger, at moderne børn må lære at være kontekst-følsomme. Børnene må lære, at forskellige kontekster efterspørger forskellig adfærd. Pædagogerne må se institutionen som et læringsrum hvor...

  20. Excitons, biexcitons, and phonons in ultrathin CdSe/ZnSe quantum structures

    DEFF Research Database (Denmark)

    Gindele, F.; Woggon, Ulrike; Langbein, Wolfgang Werner;

    1999-01-01

    The optical properties of CdSe nanostructures grown by migration-enhanced epitaxy of CdSe on ZnSe are studied by time-, energy-, and temperature-dependent photoluminescence and excitation spectroscopy, as well as by polarization-dependent four-wave mixing and two-photon absorption experiments....... The nanostructures consist of a coherently strained Zn1-xCdxSe/ZnSe quantum well with embedded islands of higher Cd content with sizes of a few nanometer due to strain-induced CdSe accumulation. The local increase in CdSe concentration results in a strong localization of the excitonic wave function, in an increase...... in radiative lifetime, and a decrease of the dephasing rate. Local LO-phonon modes caused by the strong modulation of the Cd concentration profile are found in phonon-assisted relaxation processes. Confined biexcitons with large binding energies between 20 and 24 meV are observed, indicating the important role...

  1. Experience with the SE in Germany

    Directory of Open Access Journals (Sweden)

    Jochem Reichert

    2008-03-01

    Full Text Available A rather significant proportion of the Societas Europaeas (the European Company, or SE formed to date have had German roots. German corporate law has been enriched by an interesting alternative which meanwhile seems to have gained momentum. This contribution focuses on SEs incorporated by German entrepreneurs and provides an interesting account concerning the use of SEs in Germany in practice, such as Allianz, Fresenius, BASF and Porsche. Has the SE been used to circumvent rigid company law provisions or is it a more flexible and effective tool, perhaps, for company mobility? The practical motives behind setting up this company form are also reflected upon. These include: the facilitation of cross-border mergers; transfer of the registered office; the ‘European’ image; a more flexible form of co-determination in large companies (reduction of the number of supervisory board members; avoidance and freezing of co-determination for medium-sized enterprises; the appeal of the one-tier system and its endangerment by German co-determination; and flat and uniform structures for company groups. The author also briefly discusses some of the problems arising from the formation of SEs in Germany. He ultimately concludes that practice has shown that it is possible to work with the legal regime of the SE in Germany, which adds a new company form to those available in that Member State.

  2. Thermoelectric properties of SnSe compound

    International Nuclear Information System (INIS)

    Highlights: • The electronic and thermoelectric properties of SnSe bulk material are studied. • The ZT can reach as high as 1.87 along yy and 1.6 along zz direction at 800k. • SnSe is an indirect-band material, and SOC has little effect on the band structure. • The high ZT can be attributed to the intrinsically ultralow thermal conductivity. - Abstract: A first-principles study and Boltzmann transport theory have been performed to evaluate the electronic structure and thermoelectric properties of SnSe compound. The energy band structure and density of states are studied in detail. The electronic transport coefficients are then calculated as a function of chemical potential or temperature within the assumption of the constant relaxation time. The figure of merit ZT is obtained with the use of calculated thermoelectric properties and can reach as high as 1.87 along yy and 1.6 along zz direction at 800 K. Our theoretical result agrees well with previous experimental data

  3. Forming Glasses from Se and Te

    Directory of Open Access Journals (Sweden)

    Pierre Lucas

    2009-10-01

    Full Text Available Despite being close neighbors on the Periodic Table, selenium and tellurium present a totally different abilities to form glasses. Se is a very good glass former, and gives rise to numerous glass compositions which are popular for their transparency in the infrared range and their stability against crystallization. These glasses can be shaped into sophisticated optical devices such as optical fibers, planar guides or lenses. Nevertheless, their transparencies are limited at about 12 μm (depending on the thickness of the optical systems due to the relatively small mass of the Se element. On the other hand, tellurium is heavier and its use in substitution for Se permits to shift the IR cutoff beyond 20 μm. However, the semimetallic nature of Te limits its glass formation ability and this glass family is known to be unstable and consequently has found application as phase change material in the Digital Versatile Disk (DVD technology. In this paper, after a review of selenide glasses and their applications, it will be shown how, in a recent past, it has been possible to stabilize tellurium glasses by introducing new elements like Ga or I in their compositions.

  4. Thermoelectric properties of SnSe compound

    Energy Technology Data Exchange (ETDEWEB)

    Guan, Xinhong [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Lu, Pengfei, E-mail: photon@bupt.edu.cn [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Wu, Liyuan; Han, Lihong [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Liu, Gang [School of Electronic Engineering, Beijing University of Posts and Telecommunications, Beijing 100876 (China); Song, Yuxin [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, Shanghai 200050 (China); Wang, Shumin [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, Shanghai 200050 (China); Photonics Laboratory, Department of Microtechnology and Nanoscience, Chalmers University of Technology, 41296 Gothenburg (Sweden)

    2015-09-15

    Highlights: • The electronic and thermoelectric properties of SnSe bulk material are studied. • The ZT can reach as high as 1.87 along yy and 1.6 along zz direction at 800k. • SnSe is an indirect-band material, and SOC has little effect on the band structure. • The high ZT can be attributed to the intrinsically ultralow thermal conductivity. - Abstract: A first-principles study and Boltzmann transport theory have been performed to evaluate the electronic structure and thermoelectric properties of SnSe compound. The energy band structure and density of states are studied in detail. The electronic transport coefficients are then calculated as a function of chemical potential or temperature within the assumption of the constant relaxation time. The figure of merit ZT is obtained with the use of calculated thermoelectric properties and can reach as high as 1.87 along yy and 1.6 along zz direction at 800 K. Our theoretical result agrees well with previous experimental data.

  5. Pornographie als Metapher

    Directory of Open Access Journals (Sweden)

    Caroline Schubarth

    2010-03-01

    Full Text Available In diesem Artikel werden unterschiedliche metaphorische Verwendungen des Pornografiebegriffs und deren Implikationen untersucht. Während die Existenz von Pornografie der feministischen Anti-Porno-Bewegung als Erklärung für die anhaltende Diskriminierung von Frauen in westlichen Gesellschaften dient, nutzen rechtskonservative Kräfte den Pornografievorwurf als Rechtfertigung für die Zensur von als deviant empfundenen Identitäten und sexuellen Praktiken.This article examines different metaphorical uses of the term pornography and the resulting implications. While the existence of pornography for the feminist anti-porno movement serves as factor in the continuing discrimination of women in western societies, conservative powers on the right use the allegation of pornography as a justification for censorship of those identities and sexual practices deemed deviant.

  6. Sucesión en la empresa familiar: Su futuro cuando la muerte se acerca

    OpenAIRE

    Jesús Alberto Andrade C.

    2002-01-01

    Este trabajo hace un análisis teórico al tema de la empresa familiar. Tiene como objetivos identificar características que definen a una empresa familiar en comparación con empresas no familiares; analizar la sucesión del negocio familiar al considerar que el futuro deseado de cada uno de los miembros debe ser común y único, si se quiere su continuidad; analizar cómo el manejo de conflictos sirve para desarrollar un buen plan sucesoral que permite integrar a la familia en torno a ...

  7. Tolerancia al co en celdas de combustible

    Directory of Open Access Journals (Sweden)

    BIBIAN HOYOS

    2008-01-01

    Full Text Available El entendimiento completo del proceso de adsorción y posterior oxidación de moléculas de CO en platino es de fundamental importancia para el desarrollo de celdas de combustible poliméricas que operan a baja temperatura. En este trabajo se presenta una revisión de las cinco estrategias experimentales más importantes en la búsqueda de mejorar la tolerancia al CO: disminución del potencial de inicio de la reacción de oxidación, reducción de la cantidad de CO adsorbido, utilización de pequeñas cantidades de oxígeno en la corriente de alimentación al ánodo, aumento de la temperatura de operación y limpieza del CO a la entrada. Aunque se han desarrollado catalizadores bastante promisorios (PtMo y PdAu, todavía se sigue considerando a la mezcla Pt-Ru como el catalizador anódico más eficiente para combustibles que contienen 10 ppm de CO o más. La estrategia de inyectar oxígeno al ánodo parece promisoria pero requiere el desarrollo de nuevas membranas más resistentes y de la implementación de condiciones más seguras de operación de la celda. El diseño estructural de ánodos especiales con múltiples capas soportando catalizadores específicos para cada tipo de combustible puede ser una estrategia muy atractiva.

  8. ALTERACIONES CELULARES INDUCIDAS POR EL IÓN AL 3+ EN DOS VARIEDADES CUBANAS DE ARROZ (Oryza sativa L.)

    OpenAIRE

    Idioleidys Alvarez; Ofelia Sam; Inés Reynaldo

    2005-01-01

    Con el propósito de estudiar las modificaciones, que a nivel celular provoca el aluminio en el sistema radicular del arroz, se desarrolló un experimento, en el cual se emplearon diferentes dosis de AlCl3 para imponer la condición de estrés. Para el estudio los ápices radicales de las plántulas se procesaron por un método de disminución progresiva de la temperatura (PLT) y se incluyeron en resina Lowicryl para su posterior seccionamiento y observación al microscopio de Contraste de Fase. Se ap...

  9. Wikipedia als Referenzorgan

    OpenAIRE

    Voß, Jakob

    2006-01-01

    Wikipedia wird inzwischen von vielen Nutzern regelmäßig als Nachschlagewerk genutzt. Aufgrund des offenen Charakters der Online-Enzyklopädie, bei der sich jeder direkt beteiligen kann, ist jedoch zusätzliche Medienkompetenz notwendig, um die Qualität einzelner Wikipedia-Artikel einschätzen zu können. Im Vortrag sollen Methoden zur Beurteilung von Wikipedia-Artikeln dargestellt und die Frage beleuchtet werden, unter welchen Umständen Wikipedia als Referenzorgan geeignet ist.

  10. Caracterización molecular de la microbiota asociada al queso cotija

    OpenAIRE

    Barrera Chavez, Hugo

    2013-01-01

    El presente trabajo contempla la caracterización fenotípica y molecular de la microbiota asociada al proceso de elaboracion del queso cotija. Para esto, se obtuvieron 27 aislamientos pertenecientes a bacterias (16) y a levaduras (11).

  11. Fabrication and tribological properties of Al reinforced with carbon fibers

    Directory of Open Access Journals (Sweden)

    Estrems Amestoy, Manuel

    2000-10-01

    Full Text Available The present work studies the manufacturing process of Al reinforced with Carbon Fibres (CF by "Squeeze Casting", establishing the variables for obtaining an acceptable product with little Al4C3 at the interface. Friction and wear tests are performed and the necessary conditions for the formation of a tribofilm are established. The tests show an increasing resistance to abrasion due to their own wear mechanism. Certain design criteria for those components subjected to friction are recommended in order to maximise the mechanical performance of the tribological system.

    Este trabajo estudia el proceso de fabricación de composites Al reforzado con fibras de carbono mediante la técnica ''Squeeze Casting'', estableciendo las variables para obtener un producto aceptable que tenga poca cantidad de Al4C3 en la interfase. Se han realizado ensayos de fricción y desgaste y se han establecido las condiciones necesarias para la formación de la tribocapa. Se muestra la alta capacidad de resistencia a la abrasión de las piezas producidas debido a su propio mecanismo de desgaste y se recomiendan ciertos criterios de diseño para componentes mecánicos con el fin de optimizar las prestaciones mecánicas en un sistema tribológico.

  12. Del mito creacionista al mito futurista

    Directory of Open Access Journals (Sweden)

    Fernando Uhía

    2011-12-01

    Full Text Available La primera foto tomada a la Tierra desde el espacio, en 1946, es uno de los signos de la reprogramación mitológica que está afectando la percepción actual de las ciencias y las artes. Esta reprogramación opone a Dios como artífice y al artista como dios creador: un superhumano tecnólogo y un artista administrador de la Tierra. Se repasa en esta reprogramación el papel de las academias de arte, de las revoluciones científicas, del arte de vanguardia y del arte pop.

  13. 1950 En torno al Museo Louisiana 1970

    OpenAIRE

    García Sánchez, Carmen

    2015-01-01

    La tesis “1950 En torno al Museo Louisiana 1970” analiza varias obras relacionadas con el espacio doméstico, que se realizaron entre 1950 y 1970 en Dinamarca, un periodo de esplendor de la Arquitectura Moderna. Tras el aislamiento y restricciones del conflicto bélico que asoló Europa, los jóvenes arquitectos daneses, estaban deseosos por experimentar nuevas ideas de procedencia internacional, favorecidos por diferentes circunstancias, encuentran el mejor campo de ensayo en el espacio doméstic...

  14. Léxico relativo al vestuario infantil

    OpenAIRE

    Torres Villaseñor, Hermila E.; Centro de Lingüística Hispánica, IIFL, UNAM

    2013-01-01

    Con base en el Cuestionario preparado por la Comisión de Lingüísticay Dialectología Iberoamericanas para el estudio del españolc ontemporáneo, preparé un cuestionario más amplio, con el cual he llevado a cabo una investigación sobre el léxico referente al vestido, según se emplea actualmente en la ciudad de México. Presento aquí los resultados de mi estudio en lo que respecta, únicamente, al vestuario de los niños menores de un año. Toda ladocumentación fue proporcionada por doce informantes ...

  15. Adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene: First principle calculations

    Energy Technology Data Exchange (ETDEWEB)

    Üzengi Aktürk, O., E-mail: ouzengi@adu.edu.tr [Department of Physics, Adnan Menderes University, Aydın 09100 (Turkey); Tomak, M. [Department of Physics, Middle East Technical University, Ankara 06800 (Turkey)

    2015-08-30

    Highlights: • Electronic properties of adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene are investigated. • It is found that RuSe, RuSe{sub 4}, RuSe{sub 5} adsorbate make substrate metallic. • RuSe{sub 2} makes it half metallic and RuSe{sub 3} makes semiconductor. - Abstract: We have investigated the adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene. The change of the adsorption energy with the number of Se atoms and magnetization values are investigated. Electronic properties of adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene are investigated. The highest adsorption energy belongs to RuSe adsorbate. The biggest magnetization value belongs to RuSe{sub 2} adsorbate. This adsorbate makes the substrate half metallic. This property is important in electronic device applications. It is observed that substitutional Se atom changes the electronic properties of graphene. This substitution makes graphene metallic. While RuSe, RuSe{sub 4}, RuSe{sub 5} adsorbate make substrate metallic, RuSe{sub 3} makes it semiconducting. Generally, it is found that there is a charge transfer from the substrate to clusters within the Löwdin analysis. This is in line with the charge difference results.

  16. ZnSe-ZnMnSe and CdTe-CdMnTe superlattices

    Science.gov (United States)

    Gunshor, R. L.; Kolodziejski, L. A.; Otsuka, N.; Datta, S.

    1986-08-01

    We report the growth and characterization of superiattices of a new wide-gap, zincblende material system, Zn 1 - xMn xSe. ZnSe exhibiting dominant free excitonic emission in photoluminescence (PL) is the well material, while wider-band-gap Zn 1 - xMn xSe (0.23 efficiency compared to films of the ZnSe well material, while transmission electron microscopy shows extremely abrupt interfaces by the presence of seventh-order satellite spots. Previously reported superiattices in the CdTe-CdMnTe material system were grown with the (111) orientation, and exhibit unique excitonic properties believed related to the (111) interfaces. Using various techniques to select (111) or (100) heteroepitaxy of CdTe on (100) GaAs, we report the first (100) superlattices of this material, and compare the optical properties to the previous (111) structures.

  17. 77Se nuclear magnetic resonance of topological insulator Bi2Se3

    Science.gov (United States)

    Georgieva, Nataliya M.; Rybicki, Damian; Guehne, Robin; Williams, Grant V. M.; Chong, Shen V.; Kadowaki, Kazuo; Garate, Ion; Haase, Jürgen

    2016-05-01

    Topological insulators constitute a new class of materials with an energy gap in the bulk and peculiar metallic states on the surface. We report on new features resulting from the bulk electronic structure, based on a comprehensive nuclear magnetic resonance (NMR) study of 77Se on Bi2Se3 and Cu0.15Bi2Se3 single crystals. First, we find two resonance lines and show that they originate from the two inequivalent Se lattice sites. Second, we observe unusual field-independent linewidths and attribute them to an unexpectedly strong internuclear coupling mediated by bulk electrons. In order to support this interpretation, we present a model calculation of the indirect internuclear coupling and show that the Bloembergen-Rowland coupling is much stronger than the Ruderman-Kittel-Kasuya-Yosida coupling. Our results call for a revision of earlier NMR studies and add information concerning the bulk electronic properties.

  18. Synthèse et caractérisation des propriétés structurales et magnétiques de nouveaux siliciures et germaniures à base d'uranium et de cuivre. Etude des propriétés physiques et d'hydruration de quelques composés appartenant aux systèmes Gd - Ni - X où X = Ga, Al, Sn.

    OpenAIRE

    Pechev, Stanislav

    1998-01-01

    Three novel phases, U3Cu4Si4, U3Cu4Ge4 and UCuGe1,77, were prepared in the U - Cu - X (X = Si or Ge) ternary system. Their structural and magnetic properties were investigated. The magnetic structures of the first two compounds were determined by neutron diffraction. Structural and magnetic behaviour transitions occur as copper substitutes silicon atoms in the UCuxSi2-x (0,28 ≤ x ≤ 0,96) solid solution. Thus, the structure of the compositions changes in the α-ThSi2(tetragonal) → AlB2(hexagona...

  19. Calculation of interaction of AlCl, AlCl2 and AlCl3 on Al4C3 (001) Al4CO4 (001) and Al2CO (001) planes

    Institute of Scientific and Technical Information of China (English)

    段少飞; 陈秀敏; 杨斌; 郁青春; 徐宝强; 刘大春

    2015-01-01

    To make sure the intermediate products of the carbothermic reduction of Al2O3 process, such as Al4CO4, Al2CO and Al4C3, and the interaction of AlCl, AlCl2, AlCl3 with Al4CO4, Al2CO and Al4C3, respectively, thermodynamic analyses were used to study the chloride reaction production of them under the vacuum situation. The stable structures and electronic properties of AlCl, AlCl2 and AlCl3 adsorbed on Al4CO4, Al2CO and Al4C3 were calculated by first-principles calculations by the CASTEP module in the Materials Studio program. The results show that the AlCl3 and AlCl2 molecules have decomposed on the plane of Al4C3 (001), while there are no obvious decomposition of AlCl3 and AlCl2 on Al4CO4 (001) and Al2CO (001) planes. The adsorption of AlCl on the Al4CO4 (001) and Al2CO (001) planes is stronger than that on the Al4C3(001) plane. The interaction strength of AlCl3, as well as AlCl2, with Al4CO4, Al2CO and Al4C3 is in the sequence of Al4CO4Al2CO>Al4C3.

  20. Temperature dependence of excitonic transition in ZnSe/ZnCdSe quantum wells

    Institute of Scientific and Technical Information of China (English)

    GUO Zi-zheng; LIANG Xi-xia; BAN Shi-liang

    2005-01-01

    A theoretical calculation for the temperature dependence of the excitonic transition in ZnSe/ZnCdSe quantum wells is performed. The exciton binding energy is calculated with a variational technique by considering the temperature-dependence parameters. Our results show that the exciton binding energy reduces linearly with temperature increasing. We find that the strain due to lattice mismatch and differential thermal expansion decreases with the temperature increasing.

  1. INFLUENCIA DE LAS TECNOLOGÍAS DE PREPARACIÓN DE SUELO CUANDO SE CULTIVA ARROZ (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    M. Ruiz

    2005-01-01

    Full Text Available El efecto, que sobre el suelo provocan las diferentes tecnologías que se utilizado para su preparación, cuando se cultiva arroz, es discutido y analizado por todos aquellos que se dedican a su explotación e investigación agrícola, debido a que inciden directamente sobre sus propiedades físicoquímicas y biológicas, así como en los procesos que dan lugar al crecimiento y desarrollo de las plantas. La alta demanda de la mecanización que tienen todas las tecnologías de preparación de suelos conduce a la degradación del agroecosistema arrocero, por lo que sí no se toman las medidas oportunas, las áreas dedicadas al cultivo del arroz pronto se convertirán en improductivas. El presente trabajo pretende reunir en un solo texto coherentemente estructurado, parte de la información que al respecto se ha elaborado en Cuba y el mundo.

  2. Slowenisch als fremdsprache

    Directory of Open Access Journals (Sweden)

    Jože Toporišič

    1981-12-01

    Full Text Available Nicht ganz zwei Millionen Menschen sprechen Slowenisch als Muttersprache. Wenige gibt es, die das Slowenische zwar spre­ chen oder zu sprechen versuchen, aber eine andere Muttersprache haben, vielleicht hunderttausend; für die ist Slowenisch also eine Fremdsprache.

  3. Energy dynamics in ZnSe/ZnMnSe double-quantum-well structures

    Energy Technology Data Exchange (ETDEWEB)

    Jankowski, Stephanie; Heimbrodt, Wolfram; Horst, Swantje; Chernikov, Alexej; Chatterjee, Sangam [Department of Physics and Material Sciences Center, Phillipps-University Marburg (Germany)

    2009-07-01

    Asymmetric ZnSe/ZnMnSe double-quantum-well (DQW) structures with different barrier width have been grown between dilute magnetic ZnMnSe cladding layers on a (100)GaAs substrate with a ZnSe buffer. The DQWs have been studied by cw and time resolved spectroscopy in external magnetic fields up to 7 Tesla. The ZnSe quantum wells are under tensile strain in these DQW structures yielding the light-hole exciton states to be the energetically lowest lying states. This is the main difference to earlier papers, where tunnelling of carriers and excitons have been studied in DQW structures with heavy hole excitons being the lowest lying states. In the magnetic field we were able to change the barrier height, to split the states of the wells due to the Giant-Zeeman-effect of the ZnMnSe barriers and to manipulate the radiationless energy transfer processes between the 3d-internal transitions and the excitonic states. As a result of the sophisticated interaction of these mechanisms a unique excitation energy dynamics was found and is discussed in detail.

  4. Tunnelling process in ZnSe/ZnMnSe double-quantum-well structures

    Energy Technology Data Exchange (ETDEWEB)

    Jankowski, Stephanie; Niebling, Tobias; Heimbrodt, Wolfram [Phillipps-University Marburg (Germany). Department of Physics and Matrial Science Center

    2008-07-01

    Asymmetric ZnSe/ZnMnSe double-quantum-well (DQW) structures with different barrier width have been grown between ZnMnSe cladding layers on a (100)GaAs substrate with a ZnSe buffer. The ZnSe wells are under tensile strain in these DQW structures yielding the light-hole exciton states to be the energetically lowest lying states. This is different to earlier papers, where tunnelling of carriers and excitons have been studied in DQW structures made of diluted magnetic semiconductors with heavy hole excitons to be the lowest lying states. In an external magnetic field we were able to manipulate the barrier height due to Giant Zeeman effect of the ZnMnSe barriers. Hence we can study the tunnelling processes in these structures in dependence of the height and width of the barrier by photoluminescence, photomodulated reflectivity as well as time resolved measurements. Surprisingly, very different results to heavy hole tunnelling have been found. The obtained results and differences will be discussed in detail.

  5. Molecular dynamics simulation of nanoindentation in Cr, Al layers and Al/Cr bilayers, using a hard spherical nanoindenter

    Directory of Open Access Journals (Sweden)

    Sebastián Amaya-Roncancio

    2014-01-01

    Full Text Available En este trabajo se realizaron simulaciones empleando dinámica molecular tridimensional aplicada a la técnica de nanoindentación, usando el método de la esfera dura en películas de Cr (bcc, Al (fcc y sistemas (Cr/Aln (n=1,2. Se empleó un potencial interatómico de Morse con el fin de describir la interacción en cada cristal y el contacto entre las estructuras de Cr y Al. Se emplearon condiciones de frontera fijas y un potencial radial repulsivo para modelar la punta esférica del indentador. Con estas condiciones se obtuvieron las propiedades mecánicas ideales a 0 K, simulando curvas de carga-descarga. Las bicapas presentaron dureza y módulo de Young altos, comparados con valores obtenidos en capas de Cr y Al. Además, la región de los átomos en movimiento después del proceso de descarga muestra un límite parabólico continuo en las capas de Al y Cr, y limites discontinuos en las bicapas, causados por las interfaces.

  6. Presentación al Dossier de Historia Ambiental

    Directory of Open Access Journals (Sweden)

    Jairo Antonio Melo Flórez

    2014-06-01

    Full Text Available Entrando en el tema de este número, el Dossier de Historia Ambiental fue una propuesta que se presentó al Comité Editorial de la revista teniendo en cuenta la vigencia de un tema como este en las condiciones actuales de la sociedad que se debate entre el temor, la negación y la acción ambientalista. Pero más allá del activismo, la historia ambiental se ha constituido en una rama de la historia que entra en comunicación con las ciencias naturales y ambientales para insertar lo humano en la discusión actual, centrada en el cambio climático, pero que no es ajena a los “desastres naturales” ni a las transformaciones del paisaje para dar paso al desarrollo.

  7. Néo-libéralisme et minorités. Analyse comparative des écrits de Rachid Al-Ghanouchi et de Hassan Al-Tourabi

    OpenAIRE

    Moss'ad, Névine

    2013-01-01

    Cette étude se propose d'analyser les visions de deux grandes figures de la tendance islamiste concernant la question des minorités, dans le cadre du néolibéralisme. Une série de considérations objectives nous ont amenés à nous pencher sur les positions respectives du Hassan Al-Tourabi, leader du Front national islamique (FNI, Soudan), et de Rachid Al-Ghanouchi, fondateur du mouvement al-Nahda (Tunisie). Ce choix se justifie d'abord par le fait que les deux hommes ont plusieurs traits en comm...

  8. V1.42In1.83Mo15Se19

    Directory of Open Access Journals (Sweden)

    Michel Potel

    2010-10-01

    Full Text Available The structure of the title compound, vanadium indium pentadecamolybdenum nonadecaselenide, V1.42In1.83Mo15Se19, is isotypic with In2.9Mo15Se19 [Grüttner et al. (1979. Acta Cryst. B35, 285–292]. It is characterized by two cluster units Mo6Sei8Sea6 and Mo9Sei11Sea6 (where i represents inner and a apical atoms that are present in a 1:1 ratio. The cluster units are centered at Wyckoff positions 2b and 2c and have point-group symmetry overline{3} and overline{6}, respectively. The clusters are interconnected through additional Mo—Se bonds. In the title compound, the V3+ cations replace the trivalent indium atoms present in In2.9Mo15Se19, and a deficiency is observed on the monovalent indium site. One Mo, one Se and the V atom are situated on mirror planes, and two other Se atoms and the In atom are situated on threefold rotation axes.

  9. Apoyo psicológico en mujeres que se someten a histerectomía

    Directory of Open Access Journals (Sweden)

    Ma ROSA CÁNOVAS

    2001-01-01

    Full Text Available El objetivo de este estudio fue comprobar en qué medida el apoyo psicológico es efectivo para preparar a mujeres que se someten a histerectomía abdominal. La muestra se compuso de 30 pacientes que fueron re p a rtidas al azar en dos grupos: experimental y control. Se emplearon técnicas de counselling y se proporcionaron habilidades y estrategias de afrontamiento del estrés como respiración profunda, relajación y visualización. Los resultados indicaron que las mujeres del grupo experimental respecto a las del grupo control, padecieron menos ansiedad, depresión y rebajaron sus preocupaciones durante el proceso quirúrgico y dos meses después del alta, pero además padecieron menos dolor, consumieron menos analgésicos y se acortó su estancia hospitalaria. La conclusión que se desprende de este estudio es que la técnica de apoyo psicológico diseñada es eficaz para mejorar la recuperación de estas pacientes, tanto a nivel físico como psicológico durante la hospitalización, y para facilitar la reincorporación a su vida cotidiana.

  10. Crystallization kinetics of overlapping phases in Se70Te15Sb15 using isoconversional methods

    OpenAIRE

    M.A. Abdel-Rahim; M.M. Hafiz; A.Z. Mahmoud

    2015-01-01

    The crystallization kinetics of Se70Te15Sb15 chalcogenide glass was studied by Differential Scanning Calorimetry (DSC) under non-isothermal conditions. This glass was found to have a double glass transition and double overlapped crystalline phases. The overlapped crystalline phases were successfully separated using the Gaussian fit model. The activation energy, Ec, and Avrami index, n, were determined by analyzing the data using the Matausita et. al. method. A strong heating rate depending on...

  11. El conocimiento "forma" cuando se sabe "deformado" por el suelo que habitamos

    OpenAIRE

    Carlos A. Cullen

    2014-01-01

    La tesis que sostiene este trabajo es que la formación es una cultura que busca su sujeto, para lo cual se intenta una breve genealogia del concepto, para delinear luego una presentación narrativa de su sentido hoy. La relación del conocimiento aparece así como resistencia al pensamiento único y a la pretensión de una sola forma de entender el sujeto cognoscente y la verdad.

  12. El conocimiento "forma" cuando se sabe "deformado" por el suelo que habitamos

    Directory of Open Access Journals (Sweden)

    Carlos A. Cullen

    2014-11-01

    Full Text Available La tesis que sostiene este trabajo es que la formación es una cultura que busca su sujeto, para lo cual se intenta una breve genealogia del concepto, para delinear luego una presentación narrativa de su sentido hoy. La relación del conocimiento aparece así como resistencia al pensamiento único y a la pretensión de una sola forma de entender el sujeto cognoscente y la verdad.

  13. Fabrication and characterization of CuInSe{sub 2} thin films from In{sub 2}Se{sub 3} and Cu{sub 2}Se precursors

    Energy Technology Data Exchange (ETDEWEB)

    Song, Jin Soo [Korea Inst. of Energy and Resources, Daeduk (Korea, Republic of); Huh, Gyung Jae; Kwon, Se Han; Ahn, Byung Tae [Korea Advanced Energy Research Inst., Daeduk-Danji (Korea, Republic of). Korea Nuclear Safety Center

    1995-12-01

    CuInSe{sub 2} this films as a light absorber layer were fabricated by vacuum evaporation using In{sub 2}Se{sub 3} and Cu{sub 2}Se precursors and their properties were analyzed. Indium selenide films of 0.5{mu}m thickness were first deposited by vacuum evaporation of In{sub 2}Se{sub 3} on a Corn ing 7059 glass substrate. The films deposited at susceptor temperature of 400 degree showed a flat surface morphology with densely packed grain structure. CuInSe{sub 2} films directly formed by evaporating Cu{sub 2}Se in the pre-deposited In{sub 2}Se{sub 2} films also showed a very flat surface when the susceptor temperature was 700 degree. Cu{sub 2}Se, a second phase in the CuInSe{sub 2} film, was removed by evaporating additional In{sub 2}Se{sub 3} on the CuInSe{sub 2} film at 700 degree. The grain size of 1.2{mu}m thick CuInSe{sub 2} film was about 2{mu}m and the film had a (112) preferred orientation. As the amount of deposited In{sub 2}Se{sub 3} increased, the electrical resistivity of CuInSe{sub 2} films increased because of the decrease of hole concentration. But the optical band gap was almost constant at the value of 1.04 eV. The CuInSe{sub 2} film grown in a Mo/glass substrate had a similar smooth microstructure compared to that on a glass substrate. A solar cell with ZnO/CdS/CuInSe{sub 2}/Mo structure may be realized based on the above CuInSe{sub 2} films. (author). 16 refs., 11 figs.

  14. El yo como límite al modelo perceptivo de conocimiento

    OpenAIRE

    Ricardo Gutiérrez Aguilar

    2010-01-01

    En este artículo se trata de presentar una panorámica general del problema del conocimiento cuando es aplicado a la temática del yo. Cuando su objeto goza de las características presupuestas que se le suelen adjudicar al ego personal, el material de que disponemos para juzgar los resultados que se obtienen con el modelo usual cognoscitivo, uno perceptivo, se vuelve obsoleto y se precisa del recurso a un nuevo modelo. Un lenguaje límite para la Ciencia que implica el concepto de certeza y el l...

  15. Kerro se korulla : personoitavia vuolukivikoruja miehille

    OpenAIRE

    Latva, Susanna

    2011-01-01

    Opinnäytetyön yhtenä keskeisenä aiheena oli kartoittaa vuolukiven käyttömahdollisuutta koru kontekstista katsottuna ja sitä kautta liittää se osaksi korumuotoilua. Vuolukiven käyttöä osana korua lähestyttiin perehtyen alan kirjallisuuteen sekä materiaalikokeilujen kautta. Toinen keskeinen aihe opinnäytetyössä oli perehtyä koruun tyylin, persoonallisuuden ja tunteiden viestijänä, jonka pohjana käytettiin teoreettista lähdeaineistoa, lisäksi osiossa on opinnäytetyön tekijän omia pohdintoja aihe...

  16. Schilddrüse und Schwangerschaft

    Directory of Open Access Journals (Sweden)

    Zettinig G

    2009-01-01

    Full Text Available Kinderwunsch, Schwangerschaft und die Zeit nach einer Geburt sind besondere Lebensabschnitte bei Patientinnen mit Schilddrüsenerkrankungen. Bei jungen Frauen sind Autoimmunerkrankungen der Schilddrüse, die Einfluss auf die Fruchtbarkeit und die intellektuelle und körperliche Entwicklung des Fetus haben können, häufig. Schilddrüsenerkrankungen können sich in dieser Lebensphase auch erstmals manifestieren; besondere Beachtung verdient die Wechselwirkung von β-HCG mit dem TSH-Rezeptor. Diese Übersicht behandelt das aktuelle Management von Patientinnen mit Schilddrüsenerkrankungen bei Kinderwunsch, in der Schwangerschaft und Postpartalperiode.

  17. A study of the non-isothermal crystallization kinetic of Zn10Se90 glass

    Science.gov (United States)

    Abdel-Rahim, M. A.; Hafiz, M. M.; Abdel-Latief, A. Y.; Abd-Elnaiem, Alaa M.; Alwany, A. Elwhab. B.

    2015-06-01

    The glass transition and the crystallization kinetics of Zn10Se90 glass by differential thermal analysis (DTA) technique under non-isothermal conduction were studied. The effective activation energies of the glass transition and the crystallization have been evaluated on the basses of the Kissinger and Matusita et al. approximations. Kinetic parameters of the crystallization process are significantly influenced by the heating rate. We have compared the experimental DTA with the calculated data curves for Zn10Se90 system using the Johanson-Mehl-Avrami (JMA) and Sestak-Berggren SB( M, N) models. Simulation results indicated that the SB( M, N) model is more suitable for describing the crystallization kinetics for the studied composition. Furthermore, the crystalline phases of annealed Zn10Se90 were characterized by X-ray diffraction. The surface morphology of the annealed samples was examined using scanning electron microscopy.

  18. ZnSe-based white LEDs

    Science.gov (United States)

    Katayama, K.; Matsubara, H.; Nakanishi, F.; Nakamura, T.; Doi, H.; Saegusa, A.; Mitsui, T.; Matsuoka, T.; Irikura, M.; Takebe, T.; Nishine, S.; Shirakawa, T.

    2000-06-01

    The first phosphor-free white LED based on II-IV compound materials is demonstrated. Our device utilizes a phenomenon unique to ZnSe homoepitaxy, where a portion of the main greenish-blue emission from the active layer of a pn junction diode is absorbed by the conductive substrate which in turn gives off an intense broad-band yellow emission centered around 585 nm by photoluminescence. These two emission bands combine to give a spectrum which appears white to the naked eye. A typical ZnSe-based white LED lamp exhibits a color temperature of approximately 3400 K with a CRI (color rendering index) of 68. The optical output power and operating voltage of such a device at a forward current of 20 mA is 2.0 mW and 2.7 V, respectively. The luminous efficiency estimated from these results is 10.4l m/W, which is comparable to the incandescent lamp as well as the commercial InGaN-based white LED. Device lifetimes (half-life) have exceeded 800 h at 20°C.

  19. Se il filosofo ha un compito

    Directory of Open Access Journals (Sweden)

    Carmine Di Martino

    2011-01-01

    Full Text Available Il testo muove da una ricognizione dello “stile” complessivo dell’interrogazione filosofica contemporanea: stile decostruttivo, che si risolve in un’illustrazione del limite istitutivo e costitutivo di ogni dire filosofico (e non solo filosofico. In un secondo tempo del suo intervento, l’autore si chiede se una tale comprensione, puramente “negativa”, di quel limite e della validità della parola che ne discende, non sia essa stessa ideologica, e se non sia possibile frequentare una definizione positiva di tale limite, e una possibilità non soltanto autodecostruttiva della parola filosofica “dopo” Nietzsche, Heidegger, Derrida.

  20. Structure of Se-rich As-Se glasses by high-resolution x-ray photoelectron spectroscopy

    International Nuclear Information System (INIS)

    To establish the validity of various proposed structural models, we have investigated the structure of the binary AsxSe100-x chalcogenide glass family (x≤40) by high-resolution x-ray photoelectron spectroscopy. From the composition dependence of the valence band, the contributions to the density of states from the 4p lone pair electrons of Se and the 4p bonding states and 4s electrons of Se and As are identified in the top part of the band. The analysis of Se 3d and As 3d core-level spectra supports the so-called chain crossing model for the atomic structure of Se-rich AsxSe100-x bulk glasses. The results also indicate small deviations (∼3-8%) from this model, especially for glass compositions with short Se chains (2540Se60 and of Se-Se-Se fragments in a glass with composition x=30 is established

  1. Bio-fortification and isotopic labelling of Se metabolites in onions and carrots following foliar application of Se and 77Se

    DEFF Research Database (Denmark)

    Kápolna, Emese; Laursen, Kristian H.; Husted, Søren;

    2012-01-01

    that foliar application of Se(IV) gave rise to bio-synthesis of a higher fraction of the desired organic Se species and was better tolerated by the plants than Se(VI). Based on these findings onions and carrots were bio-fortified by foliar application of a solution of 77Se(IV) that was enriched to 99.7% as 77...

  2. Teoria de la deteccion de señales (tds y caracteristicas de la memoria transitoria

    Directory of Open Access Journals (Sweden)

    Paul Stephaneck

    1987-01-01

    Full Text Available Seis sujetos fueron sometidos a una tarea de memorización en la cual el sujeto conserva informaciones, recibe nuevos datos durante el intervalo de retención y elimina, al mismo tiempo, algunos aspectos antiguos de su memoria que se volvían inútiles. El material memorizado consistió en objetos abstractos que poseían varios atributos. Fueron establecidas dos condiciones experimentales. Condición V: numerosos atributos de pocos objetos. Condición U: un solo atrio buto de numerosos objetos. Los resultados obtenidos por la aplicación de la Teoría de la Detección de Señales (TDS muestran una leve superioridad del desempeño de los sujetos en la condición U. Reagrupando los datos se puede mostrar que el efecto principal en la degradación de la memoria se debe al número de aspectos conservados en la memoria en el momento de recordar

  3. La gran vida al aire libre PSA (:30) (The Great Outdoors)

    Centers for Disease Control (CDC) Podcasts

    2016-05-31

    Un hombre y una mujer se están alistando para irse a una caminata. La mujer le recuerda al hombre que se proteja del sol.  Created: 5/31/2016 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/31/2016.

  4. Preparation and characterization of Bi2Se3(0001) and of epitaxial FeSe nanocrystals on Bi2Se3(0001)

    Science.gov (United States)

    Cavallin, Alberto; Sevriuk, Vasilii; Fischer, Kenia Novakoski; Manna, Sujit; Ouazi, Safia; Ellguth, Martin; Tusche, Christian; Meyerheim, Holger L.; Sander, Dirk; Kirschner, Jürgen

    2016-04-01

    Procedures to prepare clean Bi2Se3(0001) surfaces from bulk samples and epitaxial FeSe nanocrystals on Bi2Se3(0001) are reported. Bi2Se3(0001) substrates are prepared by in vacuo cleavage of bulk samples, followed by ion bombardment and annealing cycles. FeSe is prepared by Fe deposition onto Bi2Se3 at 303 K, followed by annealing at T ≈ 623 K. We use low-energy electron diffraction, surface X-ray diffraction, photoemission spectroscopy, scanning tunneling microscopy and spectroscopy, and stress measurements to elucidate the correlation between structural and electronic properties of the pristine Bi2Se3(0001) and FeSe covered surfaces. Our analysis reveals the formation of epitaxial FeSe nanocrystals with a thickness of three unit cells (1.5 nm). Electron diffraction experiments indicate an anisotropic epitaxial strain in FeSe. A negligible strain close to 0.0% and a tensile strain of + 2.1% are observed along the in-plane [ 01 1 bar 0 ] and [ 2 11 bar 0 ] Bi2Se3 directions, respectively. The out-of-plane strain is + 4.2%. The role of this strain state for the reported high-TC superconductivity in bulk FeSe is discussed.

  5. ALS insertion devices

    International Nuclear Information System (INIS)

    The Advanced Light Source (ALS), the first US third generation synchrotron radiation source, is currently under construction at the Lawrence Berkeley Laboratory. The low-emittance, 1.5 GeV electron storage ring and the insertion devices are specifically designed to produce high brightness beams in the UV to soft X-Ray range. The planned initial complement of insertion devices includes four 4.6 m long undulators, with period lengths of 3.9 cm, 5.0 cm (2) and 8.0 cm, and a 2.9 m long wiggler of 16 cm period length. Undulator design is well advanced and fabrication has begun on the 5.0 cm and 8.0 cm period length undulators. This paper discusses ALS insertion device requirements; general design philosophy; and design of the magnetic structure, support structure/drive systems, control system and vacuum system. 18 refs., 9 figs., 5 tabs

  6. From Kitāb al-ḥadā’iq to Kitāb al-dawā’ir: Reconsidering Ibn al-Sīd al-Batalyawsī’s Philosophical Treatise

    Directory of Open Access Journals (Sweden)

    Eliyahu, Ayala

    2015-06-01

    Full Text Available The philosophical treatise known as Kitāb al-ḥadā’iq is generally ascribed to the 12th century Andalusian author Ibn al-Sīd al-Batalyawsī, although this attribution is sometimes contested. This paper offers a new interpretation of the title, textual history, authorship, sources, and literary genre of this treatise, on the basis of new textual evidence, a reexamination of known evidence, and a comparison between the treatise and Batalyawsī’s works. The conclusions of this study are first, that Kitāb al-ḥadā’iq was not the treatise’s original title, and therefore it should be renamed Kitāb al-dawā’ir; second, that Kitāb al-dawā’ir was originally part of (one of the versions of Batalyawsī’s Kitāb al-masā’il; and third, that the textual and stylistic similarities between this treatise and Batalyawsī’s other works prove the authenticity of the treatise’s attribution to Batalyawsī. In addition, new findings regarding Batalyawsī’s use of formulas from the Rasā’il Ikhwān al-Safā, in Kitāb al-dawā’ir and Kitāb al-masā’il provide further evidence for the deep impact of the Ikhwān on Batalyawsī’s thought, as well as for the close connection between Kitāb al-dawā’ir and Kitāb al-masā’il. This connection is further highlighted according to the attribution of both treatises to the genre of questions and answers in Arabic literature. The evidence gathered in this paper supports the claim that Batalyawsī’s Kitāb al-dawā’ir should be seen as an integral part of his literary oeuvre, as well as of Andalusian philosophical literature in general.Generalmente el tratado filosófico conocido como Kitāb al-ḥadā’iq se asocia al autor andalusí del siglo XII Ibn al-Sid al-Batalyawsī, aunque esta atribución ha sido discutida en ocasiones. Este artículo ofrece una nueva interpretación del título, la historia del texto, la autoría, las fuentes e incluso del género literario al que se

  7. Opportunities and challenges for a sustainable energy policy in SE Europe: SE European Energy Community Treaty

    International Nuclear Information System (INIS)

    Energy demand continues to increase in turn raising concerns about energy supply. In this paper, the author has tried to systematize the role of the energy sector in South Eastern (SE) Europe in the context of the European energy policy process. This should make the energy sector in SE Europe more visible and open to substantial activities and appropriate funding. This is important to assure its full alignment with the European energy policy process, and in so doing, make it less fragile. According to the SE European Energy Community Treaty, parties to the Treaty are obliged to implement reforms in the energy and environmental sector in accordance with the European Union's respective policy. This paper raises awareness of the environmental requirements that have been set, of renewable energy and its implementation, at the same time pointing out that the response in SE Europe has been at a low level. It is believed that this paper could draw attention to the existing problems and could contribute to the establishment of a common integrated energy market in SE Europe and the EU. (author)

  8. Synthesis, characterization and properties of Se nanowires intercalated polyaniline/Se nanocomposites

    Directory of Open Access Journals (Sweden)

    M. Husain

    2013-09-01

    Full Text Available Present work reports novel synthesis of Polyaniline (PANI/Se nanocomposites. Se nanowires are prepared from SeO2 under assistance of vitamin C and polyaniline is synthesized through chemical oxidation. The effect of composition of Se nanowires on the properties of polyaniline was investigated and five orders increase in conductivity after doping has been observed. The electrical properties of nanocomposites show that conduction is through hopping process due to the wide range of localized states present near fermi level. FTIR (Fourier Transform Infrared spectroscopy and ultraviolet (UV-visible studies confirm the occurrence of polyaniline in conducting emeraldine salt form in the composites and suggest incorporation of Se in polymer. The optical studies indicate that absorption mechanism is due to indirect allowed transition and the optical band gap tends to decrease after doping. The thermal stability of composites has been ascertained on the basis of DSC (Differential Scanning Calorimetery measurements. TEM (Transmission Electron Microscopy and SEM (Scanning Electron Microscopy analysis have also been carried out for morphological studies.

  9. AL-IZDIWAJIYYAH AL-LUGHOWIYAH FII ISTIHDHAMI AL-LUGHOH AL-‘ARABIYAH

    OpenAIRE

    Imam Muslimin

    2011-01-01

    Al-Izdiwajiyyah (diglosia) is standardizing a specific language when there are two variants of language that live side by side in societal life and each variant has its own social function. Disglosia is related to the use of local languages variations of low language and high language in a community. In Arabic language, disglosia covers dialects among the speakers, for instance there are two variants of language that each has roles and functions. The use of the variant depends on the situatio...

  10. Carta al editor

    Directory of Open Access Journals (Sweden)

    Harry Pachajoa

    2012-02-01

    Full Text Available Recently, Valencia et al., published a very interesting article called «Lipid profile in a group of patients with Turner’s syndrome at Clínica Universitaria Bolivariana in the city of Medellín between 2000 and 2009". An article which evaluated lipid levels in patients withTurner syndrome in a Colombian clinic, the study associated results of lipid profile with karyotype and other risk factors for coronary heart disease.

  11. Carta al editor

    OpenAIRE

    Harry Pachajoa

    2012-01-01

    Recently, Valencia et al., published a very interesting article called «Lipid profile in a group of patients with Turner’s syndrome at Clínica Universitaria Bolivariana in the city of Medellín between 2000 and 2009". An article which evaluated lipid levels in patients withTurner syndrome in a Colombian clinic, the study associated results of lipid profile with karyotype and other risk factors for coronary heart disease.

  12. Esquema basado en Wavelet para la reducción de ruido online en señales industriales

    Directory of Open Access Journals (Sweden)

    Antonio Cedeño Pozo

    2014-07-01

    Full Text Available En este trabajo se propone un esquema para la reducción de ruido gaussiano online basado en wavelet con ventanas deslizantes para ser utilizado en señales industriales. Este tipo de técnicas se utilizan cuando la señal debe ser tratada a medida que se obtienen las muestras, funcionalidad necesaria en aplicaciones con requerimientos de tiempo real, por ejemplo en sistemas SCADA. El algoritmo introducido en el presente trabajo se diferencia de algoritmos similares en que: en primer término utiliza una selección adaptativa del umbral basada en NeighShrink; adicionalmente reutiliza en lo posible los coeficientes wavelet calculados en pasos anteriores para el procesamiento de cada punto; finalmente utiliza la wavelet Haar en lugar de otros filtros de mayor complejidad computacional. Para la comprobación experimental del nuevo esquema se utilizó un conjunto de señales sintéticas introducido por Donoho y Marron, complementadas por señales adquiridas en procesos reales de plantas industriales. Las pruebas realizadas revelan que el algoritmo propuesto mejora la reducción de ruido online respecto a esquemas similares reportados anteriormente y es computacionalmente menos complejo.

  13. Photo and electroluminescence of ZnSe: Sn and ZnSe:(Sn, Pr) phosphors

    Science.gov (United States)

    Mishra, A. K.; Mishra, S. K.; Pandey, S. P.; Lakshmi Mishra, Kshama

    2016-09-01

    We have prepared ZnSe (luminescent grade) phosphor doped with Sn and (Sn,Pr) with varying concentration in an inert atmosphere in a silica tubular furnace at temperature of (780 ± 20) °C for 1 hr to obtain ZnSe:Sn and ZnSe: (Sn,Pr) phosphors. The photo luminescence (PL) and electroluminescence (EL) spectra of these phosphors have been studied at room temperature and results were discussed in the light of existing models. Dependence of EL emission on the voltage frequency has also been carried out. It is found that the plot between the integrated light intensity versus 1/√Vrms is a straight line suggesting the existence of Mott-Schottky type barrier on the metal semiconductor interface.

  14. Absorption Spectra of CuGaSe 2 and CuInSe 2 Semiconducting Nanoclusters

    KAUST Repository

    Mokkath, Junais Habeeb

    2015-10-01

    The structural and optical properties of the chalcopyrite CunGanSe2n and CunInnSe2n nanoclusters (n = 2, 4, 6, and 8) are investigated as a function of the size using a combination of basin-hopping global optimization and time-dependent density functional theory. Although the lowest energy structures are found to show almost random geometries, the band gaps and absorption spectra still are subject to systematic blue shifts for decreasing cluster size in the case of CunGanSe2n, indicating strong electron confinement. The applicability of the nanoclusters in photovoltaics is discussed. © 2015 American Chemical Society.

  15. Así es como se empezó a enseñar, a sacar la figura de lo que se conoce

    Directory of Open Access Journals (Sweden)

    Abel Rodríguez

    2014-09-01

    Full Text Available Abel Rodríguez cuenta como sus pinturas se inscriben en los procesos de reactualización de la creación cósmica narrada en la historia oral del pueblo nonuya. Esta reactualización se efectúa en la vida cotidiana, iniciándose con la enseñanza nocturna de las palabras del creador y desarrollándose durante el día, gracias al trabajo y el sudor de la gente que transforma las palabras en figuras y las materializa haciendo chagras, malocas y cuerpos de parientes reunidos en las fiestas. Las pinturas de Abel muestran diversos momentos de estos procesos.

  16. Tee-se-itse-asenne tyyliblogeissa

    OpenAIRE

    Vartama, Saana

    2011-01-01

    Tämä opinnäytetyö käsittelee suomalaisten tyyliblogien tee-se-itse- eli DIY-asennetta esimerkkiblogien kautta. Aluksi määritellään, mitä eroa on muodilla ja tyylillä ja mitä DIY-kulttuuri on. Tyyliblogeissa on erilaisia DIY-sisältöjä; itse tehtyjä vaatteita ja asusteita, tuunattuja vaatteita ja asusteita sekä kierrätettyjä vaatteita ja asusteita. On tyyliblogeja, joissa käsitellään ainoastaan DIY-sisältöä ja jaetaan DIY-ohjeita, ja sellaisia DIY-tyyliblogeja, joissa käsitellään muutakin ty...

  17. Optical properties of thermally annealed CdZnSe/ZnSe quantum dots

    International Nuclear Information System (INIS)

    To analyse the diffusion characteristics, photoluminescence (PL) spectroscopy has been carried out in extensive detail on single, as well as, ensembles of thermally annealed (TA) CdSe/ZnSe QDs. For a series of QD-ensembles, each annealed for tA = 30 s at temperatures from TA = 300-550 C, the change in the QD-composition has been calculated from the blue-shift of the exciton ground-state PL-emission, using a concentration function based on Fick's laws of diffusion. The diffusion length (LD) and the activation energy (EA) have been determined thereof. For the studied QDs, EA has been evaluated to be 2.2 eV. Additionally, TA results also in an enhancement of the PL-intensity and reduction of the full-width-at-half maximum (FWHM) of the spectra. This point towards an increased homogeneity of the QD-size and composition, and decrease in the concentration of defects around the QDs. For single CdSe/ZnSe QDs, TA has been varied from 100-240 C, in steps for 20 C, with tA kept fixed at 30 s. Finally, the evolution of the magneto-optic response with post-growth thermal annealing has been studied for both individual QDs and QD-ensembles. An external magnetic field, applied perpendicular to the plane of the QDs (Faraday configuration), results in Zeeman spin splitting of the ground exciton state. The emissions from the Zeeman-split states are left and right circularly polarized and from the degree of circular polarization (DCP), as well as, the spectral separation of the PL-peaks, the g-factor can be estimated. For CdSe/ZnSe QD-ensembles, the g-factor has been observed to change sign with TA. (orig.).

  18. PbSe/PbSe xS1-x core-alloyed shell nanocrystals

    International Nuclear Information System (INIS)

    This work describes a novel synthetic method for the formation of PbSe core-shell nanocrystals. The PbSe show a special interest due to their strong quantum size effect and activity in the near IR spectral regime. Common colloidal procedure of semiconductor core-shell structures includes an initial preparation of the core, isolation of the NCs from the mother solution, dissolving in a new solution with a post injection of the shell constituents. This paper discusses an alternative procedure, utilizing a single-injection of the core and shell constituents, simultaneously. The faster reactivity of selenium to a lead precursor, directs a nucleation of a PbSe core, while the sulfur reagent participate at a later stage as a PbSe xS1-x shell. PbSe core-shell NCs, prepared by the discussed single-injection process, were compared with those prepared via a two-step injection, containing equimolar reagents and NCs size. Both cases showed a strong fluorescence (with quantum efficiency 30-60%), but with a pronounced red-shift of the band edge (30-120 meV), with respect to the core, upon an increase of the shell thickness. This red-shift was substantially larger for core-shell NCs prepared via a one-step injection. The red-shift corresponds to the formation of type II transition between E c,PbSe and E v,PbS. While the extra red-shift, upon preparation by a single injection, corresponds to the formation of shells with a tunable alloy composition

  19. Temperature dependent band offsets in PbSe/PbEuSe quantum well heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Simma, M.; Bauer, G.; Springholz, G. [Institut fuer Halbleiter und Festkoerperphysik, Johannes Kepler Universitaet, A-4040 Linz (Austria)

    2012-10-22

    The band offsets of PbSe/Pb{sub 1-x}Eu{sub x}Se multi-quantum wells grown by molecular beam epitaxy are determined as a function of temperature and europium content using temperature-modulated differential transmission spectroscopy. The confined quantum well states in the valence and conduction bands are analyzed using a k{center_dot}p model with envelope function approximation. From the fit of the experimental data, the normalized conduction band offset is determined as 0.45{+-}0.15 of the band gap difference, independently of Eu content up to 14% and temperature from 20 to 300 K.

  20. At læse er at se – med den andens øjne

    DEFF Research Database (Denmark)

    Christensen, Bodil

    2015-01-01

    i en almindelig skoleklasse? Hvordan kan (ungdoms)litteraturen hjælpe os til at se med den andens øjne? Det forsøger denne artikel at gøre rede for. Artiklen er opbygget ud fra en praksisstrategi, hvorfor der indledes med den samlede konklusion. Herefter følger argumentationen (også) i en...... danskundervisningen. Når først interessen er vakt, så kan teorien underbygge målet med læsningen: Gennem litteraturen kan vi lære at se verden, som den ser ud for andre end os selv....

  1. 'Cold' crystallization in nanostructurized 80GeSe 2 -20Ga 2 Se 3 glass

    OpenAIRE

    Klym, Halyna; Ingram, Adam; Shpotyuk, Oleh; Calvez, Laurent; Petracovschi, Elena; Kulyk, Bohdan; Serkiz, Roman; Szatanik, Roman

    2015-01-01

    'Cold' crystallization in 80GeSe 2-20Ga 2 Se 3 chalcogenide glass nanostructurized due to thermal annealing at 380°C for 10, 25, 50, 80, and 100 h are probed with X-ray diffraction, atomic force, and scanning electron microscopy, as well as positron annihilation spectroscopy performed in positron annihilation lifetime and Doppler broadening of annihilation line modes. It is shown that changes in defect-related component in the fit of experimental positron lifetime spectra for nanocrystallized...

  2. Energy transfer processes in ZnSe/(Zn,Mn)Se double quantum wells

    Science.gov (United States)

    Jankowski, Stephanie; Horst, Swantje; Chernikov, Alexej; Chatterjee, Sangam; Heimbrodt, Wolfram

    2009-10-01

    The complex interplay of energy transfer and tunneling processes in a series of asymmetric ZnSe/(Zn,Mn)Se double quantum-well (DQW) structures is investigated. Steady-state and time-resolved photoluminescence at low temperatures and external magnetic fields up to 7 T in this system show remarkable differences to earlier studies on CdTe/(Cd,Mn)Te DQWs. The pure quantum-mechanical tunneling process is only a minor contribution to the magnetic field dependence of the emission even in case of small barriers and strong QW coupling. The experimental results are supported by quantum-well calculations.

  3. ¿De qué se habla cuando se habla de calidad de los servicios?

    OpenAIRE

    Rey, Carina

    2012-01-01

    En los últimos años, la calidad de los servicios y por ende de las bibliotecas se ha convertido en un tema estrella. En los medios de comunicación y en los foros profesionales se comentan las puntuaciones obtenidas en EFQM, los procesos de evaluación para optar a una certificación, o sobre las bondades de un modelo u otro; y surge la duda: ¿de qué estamos hablando?, ¿qué entendemos por calidad de servicio?, ¿cuáles son los aspectos a tener en cuenta en las valoraciones?, ¿qué elementos tenemo...

  4. Carta al director

    Directory of Open Access Journals (Sweden)

    Carlos Tulio Medeiros

    2016-01-01

    Full Text Available Vivimos hoy bajo el concepto de la Globalización, lo que significa vivir en una Sociedad en/de Redes, donde el conocimiento es antes de todo circulante, múltiple, multidisciplinar, híbrido, interconectado, es decir, se alimenta y bebe de todas las fuentes disponibles y cruza las fronteras, sean estas geográficas o de conocimiento. No hay más un sentido o sentimiento de identidad único, pero hay algo que en la literatura llamamos de “pertenencia”, ya que estar en una red o hacer parte de ella es sentir que perteneces a algo.

  5. Del relato al contacto

    OpenAIRE

    Bernete García, Francisco

    2010-01-01

    La desatención (cuando no el desdén) a los relatos que enseñan, y su sustitución por los que muestran inme- diatamente lo que ocurre, pero cuyo sentido no se explica, posiblemente tenga como consecuencia que la sociabilidad de muchos individuos sea una cualidad construida sobre bases más débiles. En todo caso, lo que pretendo sostener en las páginas que siguen es que, así como puede rastrearse y escribirse más de una histo- ria sobre cómo van apareciendo narraciones con alta capacidad de ayud...

  6. Derivados vinculados al seguro.

    OpenAIRE

    De Paz Cobo, Sonia

    2003-01-01

    El presente trabajo tiene como objetivo la presentación de los derivados financieros como instrumentos de cobertura de los riesgos del seguro, así como de los principales proyectos que se desarrollan a través de los mismos, como por ejemplo los derivados sobre el clima. Hay que tener presente las pérdidas multimillonarias ocasionadas en casos como el de la banca Baring’s, o el de Orange County, por citar algunas, que si bien ciertos autores afirman que están en relación directa con el us...

  7. Camino al hogar inteligente

    Directory of Open Access Journals (Sweden)

    Ferreira Gili, Marco

    2004-12-01

    Full Text Available Today there are many projects related to intelligent houses such as Casa Internet, Madrid 2001 or its british equivalent in Watford, and most recently the Solar Decathlon´s project. Thanks to these proposals the domotic market gently opens to one day become what we could call as the intelligent “home”. Thought out the last few years, huge technological improvements have provided the buildings with brand new senses. However ,the idea of a comfortable home where the coffee maker would notice our awakening or the entrance door would suggest it’s closure after we leave, is still far away. A new path is opening in front of us, one that won’t end until all the necessary steps will be taken in the same direction, the merging of interfaces in the field of domotics.There are many domotic tendencies and possibilities discussed in this article, many options for one very same goal, control. Or even better, the capability of decision of tiny parts or hour home or office for a better and richer living experience.En la actualidad ya se conocen numerosos proyectos de casas inteligentes como Casa Internet en Madrid [1] o su homónimo británico en Watford [2] , y más actual el proyecto Solar Decathlon [3]. Gracias a estas propuestas, el mercado de la domótica, poco a poco, se abre paso para llegar a ser lo que un día podríamos llegar a llamar, el “hogar” inteligente. Si bien es cierto que en los últimos años el crecimiento y avances tecnológicos han dotado a los edificios de nuevos sentidos, queda lejos la visión de un confortable hogar donde la cafetera advierta nuestro despertar o la puerta de entrada sugiera su cierre tras nuestra marcha. Un camino por recorrer se abre ante nosotros, que no terminará hasta que todos los pasos se tomen en una misma dirección.Existen muchas tendencias y posibilidades domóticas que desgranaremos en este artículo. Múltiples opciones para un mismo fin. El control, o, mejor dicho, la

  8. APROXIMACIÓN AL CONSTITUCIONALISMO POPULAR

    Directory of Open Access Journals (Sweden)

    Daniel Eduardo Florez Muñoz

    2012-04-01

    Full Text Available RESUMOEn el presente trabajo se expondrán las principales líneas de pensamiento de la corriente de pensamiento iusconstitucional norteamericana conocida como Popular Constitutionalism. Al interior de la cual se realiza un frontal cuestionamiento de las bases democráticas que presuntamente detentan las lecturas del constitucionalismo soportadas en la desconfianza hacia la intervención de pueblo como instancia de decisión política concreta. Palavras- chave: Constitución, Pueblo, Tribunal Constitucional, Control de Constitucionalidad. APPROACH TO POPULAR CONSTITUTIONALISM ABSTRACT In this paper we will present the main lines of thought school of thought known as American iusconstitucional Popular Constitutionalism. Inside the front which makes a questioning of the alleged hold democratic foundations of constitutionalism readings supported the suspicion of the involvement of people, as an actual politic decision. Key-words: Constitution, People, Constitutional Court, Judicial Review. SUMÁRIO1. Introducción 2. Los Orígenes: La clausura del universo político. 3. La Objeción Contramayoritaria. 4. En qué se reconoce el Constitucionalismo Popular? 5. Tipología del Constitucionalismo Popular.

  9. Does lipophilicity per se induce adjuvant effects?

    DEFF Research Database (Denmark)

    Hansen, Jitka Stilund; Larsen, Søren Thor; Poulsen, Lars K.;

    2007-01-01

    ) or on lung function parameters. Thus, MP did not possess irritant or inflammatory properties, which may be a precursive stimulus for adjuvant effects. Second, mice were exposed to aerosols of MP, 6 or 323 mg/m3, for 1 h followed by a 20-min low-dose ovalbumin (OVA) inhalation. OVA only and OVA + Al......Anthopogenically introduced substances and pollutants are suspected to promote sensitization and development of allergic airway diseases, that is, acting as adjuvants. Lipophilicity may serve as an immunological warning signal, promoting adjuvant effects. Whether the lipophilicity of an inhaled...... compound induces immunomodulatory effects was investigated in a murine inhalation model with the highly lipophilic methyl palmitate (MP) as model substance. First, studies of acute effects following a 1-h exposure of up to 348 mg/m3 MP showed no effects on cell composition in bronchoalveolar lavage (BAL...

  10. Não se preocupe, durma bem!

    OpenAIRE

    Soares, Catarina Alexandra Pereira

    2014-01-01

    Objectivo: Explorar as relações entre traços de personalidade, aspectos relacionados com o comportamento de sono-vigília, stresse, coping, humor/afecto, auto-percepção de saúde e perturbação do sono devido a preocupações, em estudantes universitários. Metodologia: Vários instrumentos de auto-resposta foram utilizados na recolha dos dados: Questionário do Sono-vigília (Azevedo, 2008); Escala de Sonolência de Epworth (Johns, 1991); activação pré-sono (Nicassio et al., 1985), Inventário de Pe...

  11. La prensa y la dictadura franquista. De la censura al 'Parlamento de papel'

    OpenAIRE

    Diego González, Álvaro de

    2016-01-01

    Los periódicos que defendían durante la Segunda Guerra Mundial el nuevo orden europeo impuesto por la Alemania nazi y se congratulaban del "lazo espiritual" que anudaba al Caudillo Franco con Hitler, se deshacían en elogios ante la “democratización” (sic) anunciada por el presidente Arias a principios de 1974. Entre ambos extremos, de la censura y la consigna establecidas por la Ley de Prensa del 38 al "Parlamento de papel" auspiciado por la Ley Fraga del 66, se dirimió la evolución del rég...

  12. EXTRUIDOS DE AlFe-PILC EN LA OXIDACIÓN CATALÍTICA DE FENOL

    OpenAIRE

    Nancy R. Sanabria; Molina, Rafael A.; Sonia Moreno

    2010-01-01

    Extruidos de AlFe-PILC con forma de cilindro compacto se emplearon como catalizadores en la reacción de oxidación de fenol en medio acuoso. Debido a que el proceso de elaboración de los extruidos con fase activa AlFe-PILC afecta la actividad intrínseca del catalizador, en este trabajo se determinaron la resistencia mecánica y la estabilidad química del catalizador conformado, así como las limitaciones difusionales por efecto de la aglomeración. Los extruidos se elaboraron con la proporción má...

  13. Photocatalytic Hydrogen Generation by CdSe/CdS Nanoparticles.

    Science.gov (United States)

    Qiu, Fen; Han, Zhiji; Peterson, Jeffrey J; Odoi, Michael Y; Sowers, Kelly L; Krauss, Todd D

    2016-09-14

    The photocatalytic hydrogen (H2) production activity of various CdSe semiconductor nanoparticles was compared including CdSe and CdSe/CdS quantum dots (QDs), CdSe quantum rods (QRs), and CdSe/CdS dot-in-rods (DIRs). With equivalent photons absorbed, the H2 generation activity orders as CdSe QDs ≫ CdSe QRs > CdSe/CdS QDs > CdSe/CdS DIRs, which is surprisingly the opposite of the electron-hole separation efficiency. Calculations of photoexcited surface charge densities are positively correlated with the H2 production rate and suggest the size of the nanoparticle plays a critical role in determining the relative efficiency of H2 production. PMID:27478995

  14. Distribution of Se and its species in Myriophyllum spicatum and Ceratophyllum demersum growing in water containing Se (VI).

    Science.gov (United States)

    Mechora, Spela; Cuderman, Petra; Stibilj, Vekoslava; Germ, Mateja

    2011-09-01

    The uptake of Se (VI) by two aquatic plants, Myriophyllum spicatum L. and Ceratophyllum demersum L., and its effects on their physiological characteristics have been studied. Plants were cultivated outdoors under semi-controlled conditions and in two concentrations of Na selenate solution (20 μg Se L(-1) and 10 mg Se L(-1)). The higher dose of Se reduced the photochemical efficiency of PSII in both species, while the lower dose had no effect on PSII. Addition of Se had no effect on the amounts of chlorophyll a and b. The concentration of Se in plants grown in 10 mg Se L(-1), averaged 212 ± 12 μg Seg(-1) DM in M. spicatum (grown from 8-13 d), and 492 ± 85 μg Se g(-1) DM in C. demersum (grown for 31 d). Both species could take up a large amount of Se. The amount of soluble Se compounds in enzyme extracts ranged from 16% to 26% in control, and in high Se solution from 48% to 36% in M. spicatum and C. demersum, respectively. Se-species were determined using HPLC-ICP-MS. The main soluble species in both plants was selenate (∼37%), while SeMet and SeMeSeCys were detected at trace levels. PMID:21703659

  15. Purification and identification of Se-containing antioxidative peptides from enzymatic hydrolysates of Se-enriched brown rice protein.

    Science.gov (United States)

    Liu, Kunlun; Zhao, Yan; Chen, Fusheng; Fang, Yong

    2015-11-15

    As a further study of Se-containing proteins (Se-Pro) derived from Se-enriched brown rice (Se-BR), this paper aimed to purify and identify Se-containing antioxidative peptides (Se-antioxi-Peps) from Se-Pro hydrolysates. The total Se content in Se-BR was 6.26μg/g DW, and selenocystine, Se-methylselenocysteine, and selenomethionine were identified as the main organic Se species by high-performance liquid chromatography-inductively coupled plasma mass spectrometry. Se-Pro was extracted and hydrolyzed by four types of proteases, and Alcalase was chosen as the optimum enzyme according to the degree of hydrolysis (DH). The hydrolysate with 17.08% DH possessing the highest DPPH radical scavenging activity was separated into five fractions (F1 to F5). Fractions F3 to F5, which had high antioxidative activities, were further separated. Sub-fractions F3-3, F4-2, and F5-1 were chosen to evaluate antioxidative activities and analyze Se species. The Se-antioxi-Pep with the sequence SeMet-Pro-Ser was identified by electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry. PMID:25977046

  16. ofrece al mundo

    Directory of Open Access Journals (Sweden)

    Ana Reventós Gil de Biedma

    2007-01-01

    Full Text Available Barcelona es hoy una ciudad de referencia en el mapa turístico mundial. Ello ha sido fruto de un proceso de terciarización de su economía y de la construcción de una potente imagen de marca, desde los JJOO y hasta nuestros días. En este contexto, la cultura ha sido colocada en el eje de la estrategia global de desarrollo, tratando de construir un “espectáculo cultural” destinado a diferenciar a la ciudad en el mercado. Se promueven además unos iconos específicos, orientados a apoyar una visión catalana, cosmopolita y moderna, añadiéndoles además valores simbólicos como la diversidad, la tolerancia o la mediterraneidad. Para ello, se fomentan hasta la saciedad una serie de elementos patrimoniales, mientras otros quedan relegados e incluso escondidos. Barcelona aparece pues como el resultado de una planificación estratégica perfectamente orquestada desde el poder politico, y disimulada bajo la apariencia del consenso social y la participación ciudadana.

  17. Poverty as covered in the election bulletins during the 7 June Elections7 Haziran Seçimleri’nde parti bildirgelerine yansıyan yoksulluk

    Directory of Open Access Journals (Sweden)

    Kaan Taşbaşı

    2016-04-01

     Bu çalışmada öncelikle yoksulluk tanımlamaları ele alınmış ve Türkiye'de yoksulluk meselesi özetlenmiştir. Daha sonra yoksulluk-medya ilişkisi açıklanmış, 7 Haziran Seçimleri'ne katılan ve Meclis'te grubu bulunan partilerin seçim bildirgelerinde yoksulluk meselesinin yer alış biçimi ve seçim bildirgelerinden günlük ulusal gazetelere (Hürriyet, Sabah, Cumhuriyet yansıyanlar incelenerek, iki veri kümesi arasında bağlantı kurulmaya çalışılmıştır.

  18. Hexagonal CoSe formation in mechanical alloyed Co 75Se 25 mixture

    Science.gov (United States)

    Campos, C. E. M.; de Lima, J. C.; Grandi, T. A.; Machado, K. D.; Drago, V.; Pizani, P. S.

    2004-07-01

    A hexagonal CoSe alloy with NiAs-type structure was obtained by mechanical alloying starting from a mixture of pure crystalline powders with nominal composition Co 75Se 25. X-ray diffraction (XRD), differential scanning calorimetry (DSC), Mössbauer spectroscopy (MS) and Raman scattering (RS) techniques were used to follow the structural, thermal, magnetic and optical properties of the binary mixture as a function of milling time. XRD results show the formation of a nanometric hexagonal CoSe phase between 3 and 70 h of milling coexisting with non-reacted Co phases, also in nanometric scale. DSC and RS results showed some changes in the thermal and optical properties of the crystalline phases when the milling time increases. The Raman active modes of the CoSe and Co oxide phases were observed. MS results showed practically no iron in the samples milled up to 15 h, while for extended milling times (70 h), they showed the presence of some α-Fe and the formation of other iron alloys due to the contamination by the milling media.

  19. O que pensam os pacientes sobre o uso de sondas para se alimentar

    Directory of Open Access Journals (Sweden)

    Jaqueline Almeida Guimarães Barbosa

    2012-11-01

    Full Text Available Apesar dos avanços obtidos na terapia nutricional enteral nas últimas décadas e dos benefícios que ela oferece aos pacientes, esses, muitas vezes, se mostram insatisfeitos com o uso de sondas para se alimentar, e, não raras vezes, recusam essa terapêutica. O objetivo desse estudo foi compreender os significados atribuídos pelos pacientes ao uso de sondas para alimentação. Realizou-se entrevista aberta com 16 pacientes adultos hospitalizados em uso de sondas para alimentação, analisadas com base na análise estrutural de narração. Os resultados mostraram que mesmo havendo reconhecimento de que esse tratamento é importante para a sua recuperação, os pacientes possuem representações negativas acerca do uso da sonda, o que se torna um entrave ao seu uso.  Além disso, a sonda impactou negativamente a auto-estima das pessoas. A equipe de saúde, e em especial os enfermeiros, precisam considerar os aspectos psicossociais envolvidos nessa terapêutica para que se alcance maior adesão ao tratamento.

  20. Aspectos biopsicosociales asociados al embarazo adolescente

    Directory of Open Access Journals (Sweden)

    Regina Cogollo Jiménez

    2012-12-01

    Full Text Available Introducción: El embarazo en la adolescencia, es un evento inesperado, sorpresivo. Este artículo establece la importancia de identificar los aspectos biopsicosociales asociados al embarazo adolescente en las embarazadas asistentes al programa de Control Prenatal de una Empresa Social del Estado de nivel 1 en Montería en 2009, para comprender las actitudes y los comportamientos asociados a esta etapa tan temprana. Materiales y Métodos: Es un estudio descriptivo, cuantitativo, de corte transversal. Población y muestra: 30 adolescentes embarazadas asistentes al Programa, el muestreo por conveniencia. Se utilizó la encuesta y la observación directa, previa autorización del Director de la empresa. Resultados: Caracterización de la población: predominó la edad de 15 a 19 años (adolescencia tardía, uniones libres, baja escolaridad debido a la deserción escolar, ingreso económico menor al salario mínimo legal vigente. Aspectos Biológicos: la menarquía a temprana edad (9 a 14 años, y en ella la mitad de los embarazos. La mayoría de los segundos embarazos terminaron en parto, la minoría en cesárea y aborto. La captación para los controles prenatales fue tardía, algunas no cumplieron con las citas programadas. Aspectos Psicológicos: inestabilidad con la pareja al enterarse del embarazo, tuvieron soporte familiar moral y económico, abandonaron sus estudios y presentaron malestares como estrés, depresión y tristeza. Aspectos Sociales: predominó la convivencia con la familia extensa. Hubo aceptación en el colegio y en los amigos. Discusión y Conclusiones: Se plantean estrategias para disminuir estos aspectos: elaboración de una cartilla sobre “Cuidado de la adolescente embarazada”, creación de espacios de reflexión, jornadas lúdicas educativas, entre otros. (Rev Cuid 2012; 3(3:385-93.Palabras clave: Embarazo en Adolescencia, Bienestar Materno, Atención Prenatal. (Fuente: De

  1. L'Hemisferic: Una ventana al mundo

    Directory of Open Access Journals (Sweden)

    Calatrava Valls, Santiago

    2000-12-01

    Full Text Available The "Hemisféric-Planetario" building is located in the center line East-West of the "Ciudad de las Artes y las Ciencias" complex, flanked by two rectangular lakes, in the north and in the south, respectively. In the East side we can find a promenade between the Museum and its south lake. Nevertheless its West side is virtual. and located in the area of the "Hermanos Marista 's" viaducto The building is visited, daily, by about 3.000 people, distributed between its 8 duties. The showing room holds 321 seats, four of those for wheel-chairs. The building has a possible room of 999 people (at the same time.El edificio Hemisféric-Planetarío está situado sobre el eje Este-Oeste del complejo de la Ciudad de las Artes y las Ciencias; está flanqueado por dos estanques rectangulares, al Norte y al Sur, respectivamente. Por el Este, un paseo limita la parcela con el Museo y su estanque Sur. El limite Oeste, sin embargo. es virtual y se encuentra en la proyección del viaducto de Hermanos Maristas. Este edificio es visitado diariamente por unos 3.000 personas, distribuyéndose en 8 funciones. La sala de proyección dispone de 321 butacas, con posibilidad de alojar 4 sillas de ruedas. La capacidad de acogida del edificio (al mismo tiempo es de 999 personas.

  2. Polimorfismo y divergencia en genes implicados en la resistencia al frío en "Drosophila".

    OpenAIRE

    Arboleda Bustos, Carlos Eduardo

    2008-01-01

    El objetivo principal de la tesis doctoral es analizar la evolución molecular de genes implicados en la tolerancia y aclimatación al frío en Drosophila, ya que estos genes son buenos candidatos de haber sufrido cambios adaptativos. Los genes elegidos fueron Frost(Fst) y Drosophila cold acclimation gene(Dca) que en D. melanogaster se sobreexpresan tras someter a los individuos a un estrés por frío. Posteriormente, el estudio se amplió al gen CG6296, que al igual que Fst codifica una proteína c...

  3. Modeling neuronal vulnerability in ALS.

    Science.gov (United States)

    Roselli, Francesco; Caroni, Pico

    2014-08-20

    Using computational models of motor neuron ion fluxes, firing properties, and energy requirements, Le Masson et al. (2014) reveal how local imbalances in energy homeostasis may self-amplify and contribute to neurodegeneration in ALS.

  4. AL-USRCRN Station Information

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Documentation of United States Alabama Regional Climate Reference Network (AL-USRCRN) installations in 2006. Installations documented are for AL-USRCRN pilot...

  5. ICT als medicijn tegen onveiligheid

    OpenAIRE

    Linders, Lilian; Steyaert, Jan

    2002-01-01

    Hoe verhoudt ICT zich tot veiligheid? SQM zou niet 'ict oplossingen voor sociale kwesties' als ondertitel hebben, als we geen aandacht gaven aan deze vraag. In de eerste Rode Draad Notitie verkent SQM dit thema.

  6. Disordered La3Cu4.88Se7.

    Science.gov (United States)

    Gulay, L D; Daszkiewicz, M; Strok, O M; Pietraszko, A

    2011-03-01

    The crystal structure of copper(I) lanthanum selenide, La(3)Cu(4.88)Se(7), obtained from the La(2)Se(3)-Cu(2)Se quasi-binary system, has been investigated using X-ray single-crystal diffraction. The positions of the La and Se atoms are ordered and lie on mirror planes, whereas all positions for the Cu atoms are partially occupied. The crystal is built from edge-sharing [LaSe(6)] and [LaSe(7)] polyhedra. The five positions for the Cu atoms determine an ionic diffusion pathway in the structure. PMID:21368401

  7. Wallada Bint al Mustakfi entre dos culturas

    Directory of Open Access Journals (Sweden)

    shreen Mahmoud Al Refai

    2013-10-01

    Full Text Available La princesa cordobesa Wallada Bint al Mustakfi bil-lah, hija del califa al Mustakfi Muhammad Ibn Abdel Rahman Ibn Obaidil-lah Ibn Al Nasir lidin Al-lah era una poetisa estimable, a quien los grandes poetas no podían superar. Era una mujer única, guapa y decente. Mantenía una relación sentimental con el  poeta y visir Ibn Zaydún. Dicha pasión, narrada por los poemas escritos por ambos amantes, se terminó por la separación debida a los celos, también de ambos;  al poeta le gustó la voz de una esclava de la princesa. Eso dio rabia a la última. Movido también por los celos, Ibn Zaydún dedicó una epístola satírica al visir Ibn Abdús, que estaba enamorado de Wallada. Tal hecho también irritó a la princesa. A pesar de tener amantes y admiradores, Wallada murió sin casarse al  día 2 de safar de 480 (o 484 de la Híjira pasando los ochenta años Me han llamado la atención el carácter tan culto, independiente y liberal de aquella mujer, su relación amorosa con Ibn Zaydún que no acabó felizmente y los muchos años que vivió sin casasre. Parece que la vida de la princesa hispano-musulmana llamó también la atención de muchos escritores árabes y españoles. Prueba de ello son varias obras literarias escritas en árabe y en español sobre Wallada e Ibn Zaydún. Por consiguiente, me resulta muy interesante realizar un estudio comparativo sobre este tema averiguando si, o no, la diferencia de culturas influiría en las opiniones  de los autores sobre la vida sentimental de aquella poetisa cordobesa.

  8. The electric dipole response of $^{76}$Se

    CERN Document Server

    Goddard, P M; Werner, V; Rusev, G; Stevenson, P D; Rios, A; Bernards, C; Chakraborty, A; Crider, B P; Kelley, J H; Kwan, E; Glorius, J; Peters, E E; Pietralla, N; Raut, R; Romig, C; Savran, D; Schnorrenberger, L; Smith, M K; Sonnabend, K; Tonchev, A P; Tornow, W; Yates, S W

    2013-01-01

    The dipole response of $^{76}_{34}$Se in the energy range 4 to 9 MeV has been analyzed using a $(\\vec\\gamma,{\\gamma}')$ polarized photon scattering technique, performed at the High Intensity $\\gamma$-Ray Source facility, to complement previous work performed using unpolarized photons. The results of this work offer both an enhanced sensitivity scan of the dipole response and an unambiguous determination of the parities of the observed J=1 states. The dipole response is found to be dominated by $E1$ excitations, and can reasonably be attributed to a pygmy dipole resonance. Evidence is presented to suggest that a significant amount of directly unobserved excitation strength is present in the region, due to unobserved branching transitions in the decays of resonantly excited states. The dipole response of the region is severely underestimated when considering only ground state decay branches. We investigate the electric dipole response theoretically, performing calculations in a 3D cartesian-basis time-dependent...

  9. Medikamentöse Therapie der Epilepsie

    Directory of Open Access Journals (Sweden)

    Gallmetzer P

    2009-01-01

    Full Text Available Durch neu zugelassene Antiepileptika wurde die medikamentöse Epilepsietherapie in den vergangenen Jahren entscheidend bereichert. Bei ca. 65 % der Epilepsiepatienten kann durch eine antiepileptische Therapie anhaltende Anfallsfreiheit erreicht werden, bei den übrigen 35 % entwickelt sich eine schwer behandelbare Epilepsie. Die wichtigsten Behandlungsziele sind neben der Anfallskontrolle die gute Verträglichkeit der medikamentösen Therapie, die Vermeidung chronischer Nebenwirkungen, die einfache Handhabung der Medikation für Arzt und Patient, die günstige Beeinflussung assoziierter Begleiterkrankungen sowie die Berücksichtigung der Bedürfnisse spezieller Patientengruppen. Generell sollte somit eine möglichst individualisierte Therapie erfolgen, die auf die Bedürfnisse des jeweiligen Patienten abgestimmt ist. Bei fehlender Anfallskontrolle sollte eine prächirurgische Epilepsiediagnostik erfolgen, um zu klären, ob der Patient ein Kandidat für einen epilepsiechirurgischen Eingriff ist. Mit Rufinamid, Stiripentol und Lacosamid sowie demnächst auch mit Eslicarbazepin stehen zur Behandlung schwer behandelbarer Epilepsiesyndrome neue Therapieoptionen zur Verfügung.

  10. Cuando alguien habla la maya, se nota que son pobres

    Directory of Open Access Journals (Sweden)

    Elizabeth Bellon Cárdenas

    2010-06-01

    Full Text Available En este trabajo se examinan las narrativas de identidad de los receptores culturalesde la radiodifusora indigenista “La Voz de los Mayas, Xepet”, respecto de su relacióncon la oferta radiofónica de esta emisora ubicada en la cabecera municipal de Peto,al sur de Yucatán, México. El propósito es, por un lado, sistematizar, desde el análisisargumentativo, el uso, estructura y estrategias argumentativas de los maya hablantesradioescuchas de Xepet (bilingües o monolingües en torno a la oferta cultural de lamisma, así como a la presencia cotidiana de esta emisora en su mundo de vida; y, porotro, reflexionar acerca de la radio indigenista en México como un recurso que podríacontribuir a la “cultura de paz”.“U chíikul u t’aan maayao’ob” o “La voz de los mayas”, salió al aire el 29 de noviembrede 1982, en la frecuencia de los 740 khz de AM y fue reubicada al 730 en enero de2001. Su área de cobertura abarca unos 100 km a la redonda, alcanzando cerca de milcomunidades de la península y parte de Quintana Roo, con una audiencia potencial de500 mil personas. Su programación incluye géneros musicales y no musicales, compuestosestos últimos por programas informativos, de difusión cultural, servicio e infantiles.Xepet ha sido una de las radiodifusoras pioneras del sistema indigenista promovido porel Estado mexicano desde 1979, modelo que habría de extenderse en las más de veinteemisoras que aparecieron después. Hoy en día, la crítica respecto de la función, contenidosy operación de estas emisoras “oficiales” o “voceras del Gobierno” permanence,debido a que tanto la práctica indigenista como su experiencia radiofónica parecieranestar rebasadas por las demandas de los pueblos indios que reivindican su derecho a lalibre determinación y a la autonomía, así como a la propiedad y gestión de sus propiosmedios de comunicación. Lo anterior reitera la necesidad de una propuesta radiofónicaque se constituya en

  11. Desarrollo de un aroma de mamey similar al natural.

    OpenAIRE

    Muñoz, Y. M.; Pino, J. A.; Ortega, A. G.; Montelongo, I.; Ronca, E.

    2008-01-01

    Se desarrolló un sabor de mamey similar al natural a partir de aromáticos químicos, para esto fueron aislados los compuestos volátiles de la fruta y analizados mediante GC y GC-MS. En total fueron identificados 24 compuestos volátiles en la fruta, destacándose como componentes mayoritarios el benzaldehído, hexanal y ácido hexadecanoico. Se desarrollaron 16 formulaciones, que fueron evaluadas sensorialmente, mediante prueba hedónica de calificación de la calidad, por 12...

  12. Adaptación de pilotos al glass-cockpit

    OpenAIRE

    Sorin, Jacques

    2003-01-01

    Se presenta una propuesta de diseño de cabina de pilotaje de aviones cuyo objetivo es ayudar la adaptación de los pilotos al pilotaje de los aviones de pasajeros de tipo glass-cockpit. Se acompaña esta propuesta de una descripción de conjunto de la relación piloto-avión tal como evoluciona desde que el piloto aprende a pilotar la primera avioneta de escuela hasta que aborda los aviones de transporte de pasajeros. Esta descripción abarca elementos cognitivos y afectivo-emocionales de la relaci...

  13. Bioadhesión sobre Alúmina. Propiedades superficiales

    OpenAIRE

    Donoso, M.G.; González-Martín, M.L.; Gallardo Moreno, A.M.; Vilas, A. M.; Bruque, J.M.; González-Carrasco, J. L.

    2008-01-01

    La alúmina es uno de los materiales cerámicos de mayor relevancia en usos biomédicos. Así, este trabajo hace una completa caracterización de su superficie a través de propiedades que son de especial importancia en aquellos procesos de interacción con superficies biológicas como son células y microorganismos. Tensión superficial, potencial zeta y rugosidad superficial se analizan utilizando métodos diversos. La tensión superficial se muestra en torno a 35 mJ m-2 aunque los valores dependen en ...

  14. Dificultades en el aprendizaje de problemas que se modelan con ecuaciones lineales: El caso de estudiantes de octavo nivel de un colegio de Heredia

    OpenAIRE

    Gilberto Chavarría Arroyo

    2014-01-01

    Se presentan los resultados de una investigación, cuyo propósito fue analizar las dificultades de estudiantes de octavo año, al aprender el tema de resolución de problemas algebraicos modelados mediante ecuaciones lineales con una incógnita. Los protagonistas fueron estudiantes con bajo rendimiento en matemática de un colegio de Heredia. La investigación se desarrolló desde el paradigma naturalista y se utilizó el estudio de caso como método, mediante un enfoque cualitativo. Se aplicaron técn...

  15. Señalización de Ca2+intracelular en endotelio in situ de aorta de rata con diabetes mellitus tipo II

    OpenAIRE

    Paredes Juárez, Genaro Alberto

    2008-01-01

    La diabetes mellitus es la primera causa de muerte en nuestro país, debido a las alteraciones que provoca en la función y estructura de los vasos sanguíneos, aumentando el riesgo de hipertensión, infarto miocárdico y derrame cerebral. Las alteraciones vasculares se han correlacionado con disfunción endotelial. La señal de Ca2+ es un mecanismo clave en la función de las actividades endoteliales. A la fecha no se cuenta con información respecto a la señalización de Ca2+ en ...

  16. Study of crystal structure of ternary compounds CuIn3Se5 and CuIn5Se8

    International Nuclear Information System (INIS)

    The structures of monocrystals of CuIn3Se5 and CuIn5Se8 ternary compounds have been studied by X-ray diffraction for the first time. The lattice parameters of CuIn3Se5 and CuIn5Se8 crystals are determined. It is established that CuIn3Se5 has a thiogallate lattice with c = 2a, which leads to the domain structure formation. CuIn5Se8 has a hexagonal lattice and exhibits cleavage along the (001) plane. The interrelation between the atomic composition and crystal structure of these new ternary semiconductor compounds is discussed

  17. Hiperalgesia asociada al tratamiento con opioides

    Directory of Open Access Journals (Sweden)

    A. Gil Martín

    2014-10-01

    opioide o la asociación al tratamiento de otro tipo de analgésico. Otras opciones son los antagonistas del receptor NMDA o la terapia combinada con los inhibidores de la COX-2. En el presente trabajo se revisan los avances recientes en el conocimiento de los mecanismos subyacentes que la producen, los estudios clínicos realizados así como las diferentes estrategias de tratamiento disponibles.

  18. Li2Se:Te as a neutron scintillator

    International Nuclear Information System (INIS)

    We show that Li2Se:Te is a potential neutron scintillator material based on density functional calculations. Li2Se exhibits a number of properties favorable for efficient neutron detection, such as a high Li concentration for neutron absorption, a small effective atomic mass and a low density for reduced sensitivity to background gamma rays, and a small band gap for a high light yield. Our calculations show that Te doping should lead to the formation of deep acceptor complex VLi–TeSe, which can facilitate efficient light emission, similar to the emission activation in Te doped ZnSe. - Highlights: • Te doped Li2Se is proposed as a promising neutron scintillator based on density functional calculations. • Li2Se has a high Li concentration, a low density, and a small band gap, favorable for neutron detection. • Li2Se can be activated by VLi–TeSe

  19. Maltrato al anciano: "una realidad oculta en nuestra sociedad"

    Directory of Open Access Journals (Sweden)

    Rodríguez H. Shirley Catherine

    1996-06-01

    Full Text Available

    El maltrato al anciano es un hecho cotidiano, no reconocido socialmente como tal, por el contrario, el maltrato es considerado un cuento normal al que se ve expuesto un gran número de personas; que afecta el sistema familiar y a cada uno de sus miembros. Conscientes de la importancia del reconocimiento, identificación, manejo oportuno y adecuado y la intervención que enfermería realice en la situación del maltrato al anciano, se podrá forjar un camino hacia el cambio. La concepción de envejecimiento que tiene la sociedad favorece el maltrato al anciano, situación tan común como el maltrato de esposas y niños. Sumado a ello, los casos de maltrato al anciano son poco reconocidos y denunciados; las situaciones que evidencian el maltrato son negadas o justificadas por la familia, lo cual dificulta el reconocimiento de este hecho.


  20. Estudio de las preocupaciones asociadas al embarazo en un grupo de embarazadas primigestas chilenas

    Directory of Open Access Journals (Sweden)

    Chamarrita Farkas

    2008-05-01

    Full Text Available Este artículo se centra en la identificación de las preocupaciones y temores que surgen en el período del primer embarazo. Se utiliza una metodología cualitativa, con un diseño transversal, exploratorio y descriptivo. La muestra se compone de 17 embarazadas primigestas de 19 a 40 años y nivel socio-económico medio, que asistieron a dos talleres de “Promoción del primer vínculo” con una frecuencia semanal durante 6 semanas. A partir de las transcripciones de las sesiones, se identificaron y construyeron categorías de respuesta asociadas a temores y preocupaciones de esta etapa. Los resultados se presentan considerando los temores y preocupaciones asociados al embarazo, al parto y a la primera etapa de la maternidad.

  1. Freshwater flux to Sermilik Fjord, SE Greenland

    Directory of Open Access Journals (Sweden)

    S. H. Mernild

    2010-10-01

    Full Text Available Terrestrial inputs of freshwater flux to Sermilik Fjord, SE Greenland, were estimated, indicating ice discharge to be the dominant source of freshwater. A freshwater flux of 40.4 ± 4.9×109 m3 y−1 was found (1999–2008, with an 85% contribution originated from ice discharge (65% alone from Helheim Glacier, 11% from terrestrial surface runoff (from melt water and rain, 3% from precipitation at the fjord surface area, and 1% from subglacial geothermal and frictional melting due to basal ice motion. The results demonstrate the dominance of ice discharge as a primary mechanism for delivering freshwater to Sermilik Fjord. Time series of ice discharge for Helheim Glacier, Midgård Glacier, and Fenris Glacier were calculated from satellite-derived average surface velocity, glacier width, and estimated ice thickness, and fluctuations in terrestrial surface freshwater runoff were simulated based on observed meteorological data. These simulations were compared and bias corrected against independent glacier catchment runoff observations. Modeled runoff to Sermilik Fjord was variable, ranging from 2.9 ± 0.4×109 m3 y−1 in 1999 to 5.9 ± 0.9×109 m3 y−1 in 2005. The sub-catchment runoff of the Helheim Glacier region accounted for 25% of the total runoff to Sermilik Fjord. The runoff distribution from the different sub-catchments suggested a strong influence from the spatial variation in glacier coverage, indicating high runoff volumes, where glacier cover was present at low elevations.

  2. Freshwater flux to Sermilik Fjord, SE Greenland

    Directory of Open Access Journals (Sweden)

    S. H. Mernild

    2010-07-01

    Full Text Available Fluctuations in terrestrial surface freshwater flux to Sermilik Fjord, SE Greenland, were simulated and analyzed. SnowModel, a state-of-the-art snow-evolution, snow and ice melt, and runoff modeling system, was used to simulate the temporal and spatial terrestrial runoff distribution to the fjord based on observed meteorological data (1999–2008 from stations located on and around the Greenland Ice Sheet (GrIS. Simulated runoff was compared and verified against independent glacier catchment runoff observations (1999–2005. Modeled runoff to Sermilik Fjord was highly variable, ranging from 2.9×109 m3 y−1 in 1999 to 5.9×109 m3 y−1 in 2005. The uneven spatial runoff distribution produced an areally-averaged annual maximum runoff at the Helheim glacier terminus of more than 3.8 m w.eq. The sub-catchment runoff of the Helheim glacier region accounted for 25% of the total runoff to Sermilik Fjord. The runoff distribution from the different sub-catchments suggested a strong influence from the spatial variation in glacier coverage. To assess the Sermilik Fjord freshwater flux, simulated terrestrial runoff and net precipitation (precipitation minus evaporation and sublimation for the fjord area were combined with satellite-derived ice discharge and subglacial geothermal and frictional melting due to basal ice motion. A terrestrial freshwater flux of ~40.4×109 m3 y−1 was found for Sermilik Fjord, with an 11% contribution originated from surface runoff. For the Helheim glacier sub-catchment only 4% of the flux originated from terrestrial surface runoff.

  3. Lo siniestro, el pasaje al acto y el acting out

    OpenAIRE

    Barberis, Osmar

    2007-01-01

    El seminario que Lacan dedica a la angustia se ha convertido para los analistas, en una importante referencia en lo que a los conceptos de pasaje al acto y acting out respecta. Sabemos que no es la primera vez que estos términos han sido nombrados, pero sí consideramos que en El Seminario 10, hay un importante esfuerzo de formalización que hace de ellos, referencias ineludibles de la clínica psicoanalítica. Intentaremos ubicar y desarrollar las relaciones entre la angustia, el pasaje al...

  4. El acceso al agua para consumo humano en Colombia

    OpenAIRE

    Martha Yánez Contreras; Karina Acevedo González

    2013-01-01

    El acceso al agua es un derecho humano que se debe garantizar sin ninguna discriminación. Este artículo examina la existencia de inequidades en el ejercicio de este derecho mediante un análisis discriminante que identifica los factores que explican las diferencias en la calidad del agua para consumo humano entre los municipios colombianos en 2009. Los resultados indican que existen inequidades en el acceso al agua potable. En particular, los municipios más pobres registran los niveles de cali...

  5. El acceso al agua para consumo humano en Colombia

    Directory of Open Access Journals (Sweden)

    Martha Yánez Contreras

    2013-12-01

    Full Text Available El acceso al agua es un derecho humano que se debe garantizar sin ninguna discriminación. Este artículo examina la existencia de inequidades en el ejercicio de este derecho mediante un análisis discriminante que identifica los factores que explican las diferencias en la calidad del agua para consumo humano entre los municipios colombianos en 2009. Los resultados indican que existen inequidades en el acceso al agua potable. En particular, los municipios más pobres registran los niveles de calidad más bajos.

  6. Alergia al espárrago Allergy to the asparagus

    OpenAIRE

    A.I. Tabar; M.J. Álvarez; E. Celay; López, R.; B. de Esteban; B. Gómez

    2003-01-01

    El espárrago (Asparagus officinalis), ampliamente cultivado a escala mundial, forma parte, junto con el ajo, la cebolla y el puerro de la familia de Liliáceas. Se ha descrito hipersensibilidad al espárrago en forma de reacciones retardadas mediadas por células, y de reacciones inmediatas mediadas por IgE. Mientras que las primeras (dermatitis alérgica de contacto) son una causa relativamente frecuente de patología ocupacional, la literatura sólo muestra casos puntuales de alergia IgE mediada....

  7. Del uno de la forma al eros del ser.

    OpenAIRE

    Jorge Ivan Zapata.

    1999-01-01

    La dínamis erótica, se aborda en esta ocasión a luz del magistral texto de Freud "La negación". Parménides, en su demostración de lo uno en sí, aporta al planteamiento posible de una erótica, como aquella alteridad que mueve al sujeto a perseverar en su ser, una vía a la reflexión psicoanalítica sobre el tema.

  8. Corrosion behaviour of Al/SiC and Al/Al2O3 nanocomposites

    Directory of Open Access Journals (Sweden)

    Tamer Samir Mahmoud

    2012-12-01

    Full Text Available In the present investigation, the static immersion corrosion behavior of Al/Al2O3 and Al/SiC nanocomposites in 1 M HCl acidic solution was evaluated. The nanocomposites were fabricated using conventional powder metallurgy (P/M route. The effect of nanoparticulates size and volume fraction on the corrosion behavior of nanocomposites was studied. The durations of the corrosion tests ranged from 24 to 120 hours and the temperatures of the solution ranged from ambient to 75 ºC. The corrosion rates of the nanocomposites were calculated using the weight loss method. The results showed that both Al/SiC and Al/Al2O3 MMNCs have lower corrosion rates than the pure Al matrix. Such behavior was noticed at both ambient and higher temperatures. Generally, the Al/Al2O3 nanocomposites exhibited lower corrosion rates than the Al/SiC nanocomposites. The Al/Al2O3 (60 nm nanocomposites exhibited the highest corrosion resistance among all the investigated nanocomposites. The corrosion rate was found to be reduced by increasing of the exposure time and the volume fraction of the nanoparticulates, while it was found to be increased by increasing of the nanoparticulates size and the solution temperature.

  9. El reportaje se reinventa en la red: estructura del reportaje hipertextual

    Directory of Open Access Journals (Sweden)

    Lic. Ainara Larrondo Ureta

    2004-01-01

    Full Text Available El desarrollo tecnológico permitió hace algo más de una década que Internet se convirtiera en soporte periodístico, revolucionando aspectos fundamentales de una profesión que hoy se sitúa en un entorno hipertextual, multimediático e interactivo. Con el tiempo, han dejado de ser una excepción productos periodísticos capaces de integrar distintos tipos de información (textual, sonora, visual, etc. y ofrecer mayores posibilidades de interacción y personalización al usuario. La perspectiva temporal que nos ofrece un decenio de experiencia en Internet, nos permite comprobar cómo el volcado inicial del periódico impreso a la Red ha ido dando paso a versiones pensadas exclusivamente para su difusión en el ciberespacio que conviven con otros diarios sin referente escrito. Tal y como nos recuerda Antonio López (López Hidalgo, 2002: 212, al igual que ya sucedió en su día con medios como la radio y la televisión, los diarios digitales han copiado muchas de las técnicas estilísticas y narrativas de los periódicos convencionales, aunque con el tiempo se aprecia un interés por desarrollar un lenguaje propio.

  10. Doppelthydrophile Blockcopolymere als Mineralisationstemplate

    Science.gov (United States)

    Kasparova, Pavla

    2002-07-01

    Die vorliegende Arbeit beschäftigt sich mit der Synthese und den Eigenschaften von doppelthydrophilen Blockcopolymeren und ihrer Anwendung in einem biomimetischen Mineralisationsprozeß von Calciumcarbonat und Bariumsulfat. Doppelthydrophile Blockcopolymere bestehen aus einem hydrophilen Block, der nicht mit Mineralien wechselwirkt und einem zweiten Polyelektrolyt-Block, der stark mit Mineraloberflächen wechselwirkt. Diese Blockcopolymere wurden durch ringöffnende Polymerisation von N-carboxyanhydriden (NCA's) und a-methoxy-ω-amino[poly(ethylene glycol)] PEG-NH2 als Initiator hergestellt. Die hergestellten Blockcopolymere wurden als effektive Wachstumsmodifikatoren für die Kristallisation von Calciumcarbonat und Bariumsulfat Mineralien eingesetzt. Die so erhaltenen Mineralpartikel (Kugeln, Hantel, eiförmige Partikel) wurden durch Lichtmikroskopie in Lösung, SEM und TEM charakterisiert. Röntgenweitwinkelstreuung (WAXS) wurde verwendet, um die Modifikation von Calciumcarbonat zu ermitteln und die Größe der Calciumcarbonat- und Bariumsulfat-Nanopartikel zu ermitteln. This work describes the synthesis and characterization of double hydrophilic block copolymers and their use in a biomimetic mineralization process of Calcium Carbonate and Barium Sulfate. Double hydrophilic block copolymers consist of a hydrophilic block that does not interact with minerals and another hydrophilic polyelectrolyte block that strongly interacts with mineral surfaces. These polymers were synthesised via ring opening polymerisation of N-carboxyanhydride (NCA), and the first hydrophilic block a-methoxy-ω-amino[poly(ethylene glycol)] PEG-NH2 was used as an initiator. The prepared block copolymers were used as effective crystal growth modifiers to control the crystallization of Calcium Carbonate and Barium Sulfate minerals. The resulting mineral particles (spheres, dumbbells, egg-like particles) were characterised by light microscopy in solution, by SEM, and by TEM. X-Ray scattering

  11. ASPECTOS AMBIENTALES EN LA EXPERIMENTACIÓN QUÍMICA PARA PREVENIR RIESGOS A LA SALUD Y AL AMBIENTE

    OpenAIRE

    María O. Peña O.; Esperanza González Q.; Walter Ramírez M.; Sergio A. Franco Ch.

    2011-01-01

    Un aspecto ambiental se considera como cualquier material o elemento físico o químico que el hombre arroja al agua, al aire y al suelo o que interactúe con el ambiente y propicie un riesgo para la salud y para el medio ambiente. Los residuos originados durante el desarrollo de actividades relacionadas con la experimentación química, aunque en una proporción menor que en un proceso industrial, ellos pueden ser residuos peligrosos al medio ambiente. Los aspectos ambientales se asocian con las a...

  12. 21 CFR 118.4 - Salmonella Enteritidis (SE) prevention measures.

    Science.gov (United States)

    2010-04-01

    ... National Poultry Improvement Plan's standards for “U.S. S. Enteritidis Clean” status (9 CFR 145.23(d)) or... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Salmonella Enteritidis (SE) prevention measures....4 Salmonella Enteritidis (SE) prevention measures. You must follow the SE prevention measures...

  13. Calculation of half-life for 79Se decay

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The half-life for 79Se decay is calculated by using the Logf1ut systematics method. Based on the data analysis and comparison with experimental data the 79Se half-life is recommended. The scheme for 79Se decay is also shown and the radiation data are calculated in the text.

  14. Por uma cidade que se move e se comunica: corpo, rua e improviso

    Directory of Open Access Journals (Sweden)

    Julia Saldanha Vieira de Aguiar

    2009-06-01

    Full Text Available Este trabalho trata da relação de um lugar com suas pessoas. A reflexão acontece a partir de um estudo de caso: o Camelódromo da Praça XV. O Camelódromo foi uma grande feira, que durante 40 anos ocupou um espaço importante no centro de Porto Alegre/RS. (Auto organizado e vivido principalmente pelo povo, o fenômeno se configurava em um lugar onde improviso e estética constituiam o modo de ser e agir no cotidiano da rua. Ironicamente, no início de 2009, o Camelódromo foi transferido para dentro de um prédio. Hoje, onde se desenrolava o espetáculo do imprevisível, encontra-se um estacionamento para carros. Este trabalho foi produzido nos últimos meses do Camelódromo; em um espírito de elogio à estética do improviso e à auto-organização. Buscamos articular idéias da teoria da complexidade, do urbanismo, das artes e da comunicação, para tentar compreender um pouco essa manifestação espontânea, tão característica da urbe no século XXI.

  15. Epitaxial growth of Al/Al2O3 multilayer structures

    International Nuclear Information System (INIS)

    In order to obtain Al-Al2O3 quantum effect devices, it is necessary to deposit epitaxially Al on Al2O3 and Al2O3 on Al. We have already obtained an epitaxial Al/Al2O3/Al structures on Si(111). In this paper, we have deposit Al/Al2O3/Al structures on Si(111), and investigated the crystallinity by using RBS. (author)

  16. Ecuador, lo que no se dice

    Directory of Open Access Journals (Sweden)

    Jorge Benavides Solís

    2008-12-01

    Full Text Available Ecuador es un país que hasta hace pocos años, no era noticia. Sumido en su distancia y aislamiento, es el único país sudamericano que no ha tenido un movimiento guerrillero y ha soportado los efectos de la violencia. Debido a su ubicación geográfica es rico en recursos naturales y encierra todo tipo de climas y paisajes. Tiene un alto índice de crecimiento de la población que supera los doce millones de personas. Su deuda externa, en menos de treinta años supera los doce mil millones de dólares y compromete al cincuenta por ciento de su presupuesto. Actualmente soporta un proceso de emigración que en los últimos tres años ha llevado a más de veinte países a tres millones de ecuatorianos cuyas remesas de dinero ya constituyen la tercera fuente de ingreso de divisas. País empobrecido por los malos gobiernos y por quienes los eligen.___________________ABSTRACT:Ecuador is a country that until a few years was not a piece of news. Submerged in its distance and isolation, it is the only South American country that has not had a guerrilla movement and has not tolerated violence effects. Due to its geographical location, it is wealthy because of its natural resources and it holds all type of weathers and landscapes. It has a high population growth index that exceeds twelve millions of people. Its external debt exceeds twelve thousand millions dollars and it compromises the fifty per cent of its budget. Nowadays, it endures an emigration process that in the last three years has taken to more than twenty countries, three millions of Ecuadorians whose remittance already represents the third source of foreign currency incomes. It is an impoverished country due to bad governments and the ones that elect them.

  17. La Guerra Civil en Siria y el Programa Nuclear Iraní: dos cuestiones fundamentales en el Medio Oriente

    Directory of Open Access Journals (Sweden)

    Atilio Molteni

    2013-01-01

    Full Text Available En el siguiente artículo abordaremos dos grandes conflictos que se desarrollan en el Medio Oriente estrechamente relacionados entre sí. En primer lugar, haremos referencia a las características geopolíticas de la región y luego al interés de Irán de consolidarse como una potencia regional, y al enfrentamiento que mantiene con los Estados Unidos. Describiremos las características de la guerra civil en Siria y las luchas étnicas y religiosas a las que dan lugar, destacando las dificultades para hallar una solución consensuada, la gran crisis humanitaria existente y la incertidumbre acerca de su resultado final. En segundo lugar, analizaremos el plan nuclear iraní, describiendo su tratamiento en el OIEA y en el Consejo de Seguridad, así como los intentos internacionales para evitar que Irán llegue a tener una capacidad nuclear militar. Tanto Siria como Irán han buscado la cooperación de Rusia. Moscú tiene intereses estratégicos en Siria originados en el período de la Guerra Fría, mientras que a Irán le suministra tecnología nuclear y militar, situaciones a través de las cuales pretende consolidar su gravitación en el Medio Oriente.

  18. PHOTOELECTRIC PROPERTIES OF PbSe/BaF2/CaF2 FILMS ON Si(111)%硅基PbSe/BaF2/CaF2薄膜及其光电特性

    Institute of Scientific and Technical Information of China (English)

    金进生; 常勇; 等

    2001-01-01

    PbSe films were grown on Si(111) by incorporation of BaF2/CaF2 buffers using molecular beam epitaxy. The measurements of both scanning electronic microscopy and high-resolution X-ray diffraction showed high crystalline quality of the PbSe films. The surface of PbSe was mirror-like and no cracks were observed. The full width at half-maximum of PbSe diffraction peak was only 153 arcsec. The epitaxial PbSe films were used to fabricate photodiodes. For the first time, metallic aluminum was used to form Al-PbSe Schottky diodes, which demonstrated better and more stable current-voltage characteristics than that obtained from Pb-PbSe Schottky diodes.%采用分子束外延方法在Si(111)衬底上生长了PbSe/BaF2/CaF2薄膜,扫描电镜和X-光衍射分析显示,通过生长BaF2/CaF2缓冲层的方法,在Si(111)衬底上外延的PbSe薄膜晶体质量高,PbSe表面光亮,无开裂现象发生,X-光衍射峰峰宽窄(153arcs).外延生长的PbSe薄膜被应用于制作光电二极管,首次采用热蒸发金属铝膜在PbSe表面形成Al-PbSe肖特基结光电二极管,获得了比Pb-PbSe肖特基结更为稳定和理想的电流-电压特性曲线.

  19. Sobrevida de pacientes con infarto agudo al miocardio en un hospital de Costa Rica

    Directory of Open Access Journals (Sweden)

    Manrique Leal Mateos

    2005-12-01

    Full Text Available Objetivo:El presente estudio tiene como propósito principal estimar la probabilidad acumulada de sobrevida al sexto mes de pacientes egresados del Hospital Calderón Guardia bajo el diagnóstico de infarto agudo al miocardio. Metodología:Se realizó un estudio de cohorte retrospectivo que incluyó a pacientes internados bajo el diagnóstico de infarto agudo al miocardio en el Servicio de Medicina Interna del Hospital Calderón Guardia entre el primero de octubre del 2003 al 31 de septiembre del 2004. La probabilidad acumulada de sobrevida de los pacientes se estimó al sexto mes posterior al evento cardiovascular y fue realizada mediante el método de Kaplan Meier. El tiempo de sobreviva fue medido en meses. La fecha inicial del estudio correspondió al momento en que se realizó el diagnóstico de infarto agudo al miocardio a cada paciente.La fecha de término del estudio fue el 31 de septiembre del 2004. El efecto independiente de las variables seleccionadas se realizó mediante el modelo de regresión múltiple de riesgos proporcionales de Cox.El nivel de significancia fue fijado en p<0,05. Resultados:Entre el 1 ºde octubre del 2003 y el 31 de septiembre del 2004, se identificaron 127 pacientes,cuyo diagnóstico de ingreso al Servicio de Medicina Interna del Hospital Calderón Guardia fue infarto agudo al miocardio. El 66,1%(n=84de los casos correspondieron a pacientes del sexo masculino.La edad promedio de los pacientes fue 64,6 años (DE ±12,2. El 63%(n=80de los pacientes presentaron antecedentes de Hipertensión Arterial,siendo este factor de riesgo el más frecuente en la población estudiada. Al final del período de estudio fallecieron 18 pacientes.De éstos,8 murieron por causas diferentes o no derivadas del infarto agudo al miocardio.La probabilidad acumulada de sobrevida para ambos sexos a los seis meses posteriores del evento cardiovascular fue de un 91,3%. Conclusiones:La sobrevida proporcional de la cohorte estudiada se puede

  20. Análisis del ciberbullying en el IES Al-Qázeres

    OpenAIRE

    LUCARELLI, ENRICO

    2015-01-01

    El Trabajo Fin de Máster que se presenta a continuación se centra en estudiar la problemática del ciberacoso a menores en las aulas de secundaria. Para ello se lleva a cabo un estudio de caso de un Instituto de Educación Secundaria de titularidad pública de Extremadura, el IES Al-Qázeres, en que se analizan aspectos básicos relacionados con el ciberbullying en una muestra de alumnado de 3º de ESO, utilizando como instrumento de trabajo un cuestionario modificado a partir del diseñado por Orte...

  1. Identidad y cuerpo : Auto-percepciones de sujetos no conformes al género

    OpenAIRE

    Martínez, Ariel

    2015-01-01

    Esta tesis de doctorado se sostiene en una profunda investigación bibliográfica y en los hallazgos obtenidos mediante trabajo de campo. A diferencia del grueso de las producciones organizadas en torno a la no conformidad de género, este aporte no se aproxima al tema en términos de desvío social, ni de patología, tampoco de etiología. El marco teórico de referencia aquí articulado no se interesa por delimitar e indagar una realidad sustancial específica de los sujetos per se comprendidos dentr...

  2. Aprendizaje de aversión al sabor y respuestas condicionadas de náusea

    OpenAIRE

    Gasalla Cano, Patricia

    2014-01-01

    En esta tesis doctoral se examina el efecto de la preexposición a los estímulos en el aprendizaje de la aversión al sabor en ratas. Más específicamente, se analiza el efecto de la exposición repetida a los estímulos condicionado (EC) e incondicionado (EI) sobre la adquisición de respuestas de náusea. Tradicionalmente, estos efectos se han evaluado midiendo los cambios en el consumo voluntario de la solución gustativa tras el condicionamiento. En los experimentos aquí realizados se utilizaron ...

  3. Grado de adherencia al protocolo de registros clínicos de enfermería

    OpenAIRE

    Luz Marina Bautista Rodríguez; Leidy Yeraldin Vejar Río; Mary Rolecxy Pabón Parra; Jackson Jesús Moreno; Ludy Fuentes Rodríguez; Kenny Yelibeth León Solano; Jorge Andrés Bonilla

    2016-01-01

    Introducción: La utilización de las guías de manejo clínicas, protocolos y manuales se constituyen en un elemento fundamental para la prestación de servicios de salud con calidad. El protocolo de registros clínicos es una herramienta que orienta al personal de enfermería en los lineamientos claves que se deben tener en cuenta en cada uno de los cuidados que se brindan.  Materiales y Métodos: Se realizó un estudio cuantitativo de tipo descriptivo de corte transversal. La muestra estuvo conform...

  4. VI ENCUENTRO DE PROYECTOS Y PRÁCTICAS DE COOPERACIÓN AL DESARROLLO

    OpenAIRE

    CENTRO DE COOPERACIÓN AL DESARROLLO

    2014-01-01

    La VI Edición del Encuentro se celebró en el Campus Vera de la UPV, el 23 de mayo de 2014. La estructura de la publicación es la siguiente: en primer lugar, se analizan brevemente los programas de la UPV en los que el alumnado participa en proyectos de cooperación; justificando como se incardinan estos en las actividades de Cooperación Universitaria al Desarrollo (CUD), ofrecemos un resumen de sus características, y destacamos su evolución y principales resultados. En segundo lugar, se recoge...

  5. Interface oxygen and heat sensitivity of Cu(In,Ga)Se2 and CuGaSe2 solar cells

    Science.gov (United States)

    Ishizuka, Shogo; Fons, Paul J.; Yamada, Akimasa; Kamikawa-Shimizu, Yukiko; Shibata, Hajime

    2016-05-01

    Combined oxygen and heat exposure processes after p-CuGaSe2/n-CdS junction formation degrade CuGaSe2 solar cell efficiency, whereas such annealing processes can improve high In content Cu(In,Ga)Se2 device performance. This result is chiefly attributable to different interface structures consisting of oxygen-sensitive CuGaSe2 or relatively oxygen-insensitive Cu(In,Ga)Se2. To reduce CuGaSe2 interfacial recombination, reduction of the process temperature of the front contact layer deposition process is found to be the key. In this work, fill factor values exceeding 0.7 are reproducibly obtained from CuGaSe2 solar cells, though such high fill factor values have been very challenging to demonstrate to date using CuGaSe2 photoabsorber layers.

  6. Escriure (correctament) per al web

    OpenAIRE

    Centelles Velilla, Miquel

    2004-01-01

    Se presentan las exigencias de escritura impuestas por la lectura de textos en páginas web y las recomendaciones generales de redacción de cara a facilitar la lectura. Después de introducir el marco general de la lectura del texto escrito, las técnicas y las estrategias, se exponen los condicionantes y especificidades de la lectura de páginas web. A partir de estos elementos se hacen una serie de recomendaciones de buenas prácticas para una correcta redacción de páginas web que se organizan s...

  7. La señalización como determinante de la satisfacción del turista español en un territorio: el caso de Quintana Roo

    OpenAIRE

    Rafael Fabricio Matos Cámara; Alfredo Jiménez Palmero; Martha Verónica Ocampo Franco; Mariana Recio López

    2014-01-01

    Se investiga la satisfacción experimentada por el turista que es determinada por las señales que los diferentes agentes en un territorio envían al mercado. Se utiliza el método de ecuaciones estructurales. Los resultados obtenidos muestran que la reputación, el precio, la calidad percibida, los activos específicos y la preservación del medioambiente son determinantes de la satisfacción; al contrario que la publicidad, la cual no ha sido corroborada. Se comentan las implicaciones profesionales...

  8. Rem Koolhaas y la nueva Babel. De la torre metropolitana al monumento al vacío

    OpenAIRE

    José Antonio Tallón

    2015-01-01

    Un primer acercamiento a las reflexiones de Rem Koolhaas en torno a la tipología de torre introduce al rascacielos neoyorquino como la alegoría del “automonumen­to”: una construcción en esencia destinada a reafirmar su sola presencia y que se distingue del resto por medio de su estatura, que la monumentaliza. La torre de Babel, símbolo inquebrantable de la leyenda de la construcción en altura, escenifi­ca una historia de construcción y destrucción que está vinculada ineludiblemente al pensami...

  9. Cartas al editor

    Directory of Open Access Journals (Sweden)

    Manuel Rincón Mesa

    2013-01-01

    Full Text Available Mi estimado Jorge y demás compañeros amigos de Costa Rica.Acá en Colombia revisando muy complacido el documento que ustedes recuperaron, editaron y han dispuesto publicar en la revista electrónica delCCP.Quiero mediante este correo expresar mi gratitud, de una parte, por la voluntad y esfuerzo que sin duda tuvieron que hacer de recuperar esas notas escritas hace ya 20 año y que, en su experiencia y entender llegaron a considerar que alguna manera aún tienen vigencia y, no dudo, que con la ampliación y complementación del caso en base a los aportes de los últimos censos y las nuevas proyecciones de población serán de gran utilidad hacia el futuro. Por otro lado mis expresiones de gratitud por lo que, como presentación del documento, se indica sobre mis actividad profesional, expresiones que me alagan y no sé si realmente merezco. Ustedes bien saben que Costa Rica fue, para mí y familia, el lugar en donde pudimos encontrar amigos y colegas con los cuales fue posible compartir y adelantar una labor que, de alguna manera pudo haber dejando alguna huella en América Latina y que con posterioridad, ustedes, en el Centro Centroamericano de Población CCP han logrado mantener y continuar con esta labor que considero muy importante para la región. Me alegra mucho y felicito a ese equipo tan valioso que afortunadamente logró conformarse y que sin duda es, hoy el día, una soporte fundamental para la capacitación e investigación en el campo demográfico. Ahora que ustedes, quienes en algunos casos fueron mis alumnos, compañeros y amigos se encuentran en estas lides de trabajar en este campo tan importante como es la demografía, me lleva a estar cada vez más seguro e interesado en que en algún momento pueda reunirme con ustedes ahora que ya sin duda ha pasado muchos años de haber dejado Costa Rica. Mi más cordiales saludos y abrazos para todos los amigos en ese bello país que es Costa Rica.

  10. Demandas físicas en jugadores semiprofesionales de fútbol: ¿se entrena igual que se compite?

    Directory of Open Access Journals (Sweden)

    David Casamichana

    2011-01-01

    Full Text Available Este estudio describe las demandas físicas de la competición en jugadores semiprofesionales de fútbol, en función de su demarcación, y el grado de similitud de éstas con el entrenamiento que realizan. Durante la temporada 2010-11, 32 jugadores de fútbol fueron estudiados tanto en competición (n = 67 como en entrenamiento (n = 206 durante el mismo periodo de la temporada.Los registros del perfil físico fueron realizados con dispositivos GPS. Comparado con el entrenamiento (E, los partidos amistosos (C mostraron diferencias significativas en las demandas físicas, presentando valores superiores en todas las variables estudiadas excepto en la distancia recorrida a baja intensidad (0¿6.9 km·h-1, que fue superior en E. Durante la C los jugadores recorren más distancia total por minuto (112.9 vs. 73.5 m·min-1 y a velocidades de 7.0-12.9, 13.0-17.9, 18.0-20.9 y >21 km·h-1. Con relación a los sprints, en C se dan con mayor frecuencia por hora de juego (15.3 vs. 3.2, son más largos (15.2 vs. 9.4 m, de mayor duración (2.3 vs. 1.5 s y de velocidad máxima superior (27.1 vs. 23.5 km·h-1. Finalmente, y con relación a los indicadores establecidos, en C se da una mayor Carga del jugador·min-1 (13.4 vs. 8.6 UA y un ratio trabajo:descanso también mayor (2.4. vs. 0.9 UA. Los resultados de este estudio deberían ayudar al desarrollo de tareas específicas de E, aumentando la calidad y cantidad del trabajo, que permitieran acercarse a las demandas físicas de C.

  11. Effect of AlN Particulate Size on Superplasticity of AlNp/6061 Al Composites

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Superplastic tensile tests of AlNp/606l Al Composites, fabricated by powder metallurgy techniques, were performed at strain rates ranging from 10-1-10-3S-1 and at temperatures from 833 to 893 K. Hot rolling after extrusion was employed to obtain a fine grained structure before \\superplastic testing. The superplastic behavior of AlNp/6061 Al Composites was compared with that of AlN particulate size. Differential scanning calorimeter was used to ascertain the possibility of any partial melting in the vicinity of optimum superplastic temperatures.

  12. El manejo de la información editorial en el Diario de Yucatán, con respecto al tema de la basura

    OpenAIRE

    Lic. Fernando Pacheco Bailón

    2000-01-01

    Tres rotativos dominan el panorama de la prensa en Yucatán. Para efectos de estudio se abarcó solamente al Diario de Yucatán. En la página editorial –sección local– de este rotativo se localizaron unos escritos que mencionaban el caso de estudio, al cual se hace referencia en esta investigación.

  13. Reestimación y actualización del costo económico en Argentina de la mortalidad atribuible al tabaco en adultos

    OpenAIRE

    Conte Grand, Mariana

    2005-01-01

    Existe amplia evidencia científica que vincula al tabaquismo con la mortalidad. Para estimar el costo de la mortalidad anual atribuible al tabaco (MAT) para adultos en Argentina se utilizaron datos de prevalencia de consumo de fumadores y ex fumadores (SEDRONAR 2004), riesgos relativos de muerte por las patologías relevantes (Cancer Prevention Study II), muertes por dichas enfermedades (MSAL 2004) y el valor de la consecuente productividad perdida (EPH 2004). Se concluye que en el 2003, se pr...

  14. El manejo de la información editorial en el Diario de Yucatán, con respecto al tema de la basura

    Directory of Open Access Journals (Sweden)

    Lic. Fernando Pacheco Bailón

    2000-01-01

    Full Text Available Tres rotativos dominan el panorama de la prensa en Yucatán. Para efectos de estudio se abarcó solamente al Diario de Yucatán. En la página editorial –sección local– de este rotativo se localizaron unos escritos que mencionaban el caso de estudio, al cual se hace referencia en esta investigación.

  15. Aqueous synthesis of CdSe and CdSe/CdS quantum dots with controllable introduction of Se and S sources

    Institute of Scientific and Technical Information of China (English)

    Xiao Long Rong; Qin Zhao; Guan Hong Tao

    2012-01-01

    A new and convenient route is developed to synthesize CdSe and core-shell CdSe/CdS quantum dots (QDs) in aqueous solution.The gaseous precursors,H2Se and H2S,generated on-line by reducing SeO32-with NaBH4 and the reaction between Na2S and diluted H2SO4,are used to form high-quality CdSe and CdSe/CdS QDs,respectively.The synthesized water-soluble CdSe and CdSe/CdS QDs possess high quantum yield (3% and 20%) and narrow full-width-at-half-maximum (43 nm and 38 nm).The synthesis process is easily reproducible with simple apparatus and low-toxic chemicals,and can be readily extended to the large-scale aqueous synthesis of QDs.(C) 2012 Guan Hong Tao.Published by Elsevier B.V.on behalf of Chinese Chemical Society.All rights reserved.

  16. Nuevas cabeceras contra viejos señoríos: la separación de Tecomatlan del señorío de Yanhuitlan

    Directory of Open Access Journals (Sweden)

    Hermann Lejarazu, Manuel A.

    2008-06-01

    Full Text Available In 1582 the town of Tecomatlan attempted to prove its independence from the most important and powerful lordship of the Mixteca Alta: Yanhuitlan. According to the Tecomatlan autority, this town had had its own “cacique” y “señor natural” since prehispanic times. Tecomatlan denied the roll of Yanhuitlan as “cabecera” or colonial administrative center due to colonial reorganization after to the Spanish Conquest.

    En el año de 1582, el pueblo de Tecomatlan presentaba antes las instancias virreinales una serie de testimonios para probar su independencia del entonces más importante y poderoso señorío de la Mixteca Alta: Yanhuitlan. Según las autoridades de Tecomatlan, este pueblo había tenido su cacique y “señor natural” desde la época prehispánica y no quería reconocer al pueblo de Yanhuitlan como su cabecera debido, principalmente, a la reorganización colonial implementada después de la conquista española.

  17. Probing diffusion of In and Ga in CuInSe2/CuGaSe2 bilayer thin films by x-ray diffraction

    Science.gov (United States)

    Namnuan, B.; Yoodee, K.; Chatraphorn, S.

    2015-12-01

    The bilayer thin films of CuInSe2 (CIS) and CuGaSe2 (CGS) are fabricated by a molecular beam deposition (MBD) technique by sequential depositions of CGS followed by CIS and vise versa on Mo-coated soda-lime glass (SLG) and Mo/Al2O3-coated (Na blocking) SLG substrates. The thicknesses of CIS/CGS layers are adjusted to have the overall x=[Ga]/([In]+[Ga]) at approximately 0.4 similar to what is generally used in CIGS thin film solar cells. The growth temperature and the Cu-ratio y=[Cu]/([In]+[Ga]) of the CIS and CGS layers are systematically varied for Cu-rich (y>1) and Cu-poor (y<1) conditions. X-ray diffraction (XRD) technique is used to analyze the shift of diffraction peaks of the preferred orientations of the bilayers compared to those of the single-layer CIS, CGS and CIGS thin films. The XRD results show that higher Ga diffusion is observed in the Cu-rich CIS/CGS bilayer rather than others. The results suggest that the diffusion of Ga is enhanced by the excess Cu-Se phase that is dependent upon the substrate temperature. The Na from the SLG substrate is one of the important factors affecting Ga diffusion. The results show alloying CIGS patterns rather than separated CIS and CGS patterns as observed in the bilayers with Na.

  18. Atmospheric pressure chemical vapour deposition of SnSe and SnSe{sub 2} thin films on glass

    Energy Technology Data Exchange (ETDEWEB)

    Boscher, Nicolas D.; Carmalt, Claire J.; Palgrave, Robert G. [Department of Chemistry, University College London, 20 Gordon Street, London, WC1H OAJ (United Kingdom); Parkin, Ivan P. [Department of Chemistry, University College London, 20 Gordon Street, London, WC1H OAJ (United Kingdom)], E-mail: i.p.parkin@ucl.ac.uk

    2008-06-02

    Atmospheric pressure chemical vapour deposition of tin monoselenide and tin diselenide films on glass substrate was achieved by reaction of diethyl selenide with tin tetrachloride at 350-650 {sup o}C. X-ray diffraction showed that all the films were crystalline and matched the reported pattern for SnSe and/or SnSe{sub 2}. Wavelength dispersive analysis by X-rays show a variable Sn:Se ratio from 1:1 to 1:2 depending on conditions. The deposition temperature, flow rates and position on the substrate determined whether mixed SnSe-SnSe{sub 2}, pure SnSe or pure SnSe{sub 2} thin films could be obtained. SnSe films were obtained at 650 {sup o}C with a SnCl{sub 4} to Et{sub 2}Se ratio greater than 10. The SnSe films were silver-black in appearance and adhesive. SnSe{sub 2} films were obtained at 600-650 {sup o}C they had a black appearance and were composed of 10 to 80 {mu}m sized adherent crystals. Films of SnSe only 100 nm thick showed complete absorbtion at 300-1100 nm.

  19. Recordando al doctor Alberto Pradilla Ferreira

    Directory of Open Access Journals (Sweden)

    Mercedes de Onís

    2012-02-01

    profesor e investigador en la Escuela de Salud Pública; participó activamente en la reforma curricular que se llevaba a cabo en la Facultad. Planteó un modelo para la enseñanza de la nutrición en la Escuela de Medicina, que fue adoptado y hace parte del currículo actual, modelo premiado en el Congreso de la Sociedad Latinoamericana de Nutrición (SLAN.Dedicó su saber y entusiasmo al Grupo de Nutrición de la Facultad de Salud, al que le dio una nueva orientación incluyendo el componente de nutrición básica, interesando a profesores de esta área que se vincularon grupo. Contribuyó durante los últimos diez años al desarrollo de la investigación en nutrición, consiguiendo que el Grupo ocupara la más alta clasificación entre los mejores grupos de la Universidad del Valle.Supo adelantarse a los problemas a los cuales el país tendría que enfrentarse como nación en transición. A finales de la década de 1990 orientó las investigaciones hacia las enfermedades crónicas no transmisibles, identificando en la población escolar y adolescente de Cali, factores de riesgo para estas enfermedades que ocupaban ya los primeros lugares de morbilidad y mortalidad y que son hoy su primera causa. Luego encaminó al Grupo de Nutrición en el trabajo sobre programación fetal de enfermedades crónicas no transmisibles, una de las líneas de investigación más activa actualmente con estudiantes de pregrado y posgrado vinculados a ella.Autor de gran cantidad de artículos científicos y de libros, el doctor Pradilla fue objeto de reconocimientos por parte de organizaciones internacionales, del Gobierno y de la misma Universidad del Valle. Pero ningún reconocimiento público y ningún halago fracturaron en él su humildad ni lo impulsaron a romper su inveterada sencillez y calidez en el trato con colegas, estudiantes y directivos de todos los niveles. Entusiasta y solidario, siempre tuvo una voz de aliento, una pregunta aguda y estimulante para animar a quienes se acercaban

  20. Apertura al conocimiento

    Directory of Open Access Journals (Sweden)

    Revista Ingeniería e investigación

    2011-01-01

    Full Text Available Tres son los aspectos fundamentales del proceso de apertura económica propuestos por el actual gobierno: -Buscar en la competencia reformar la rígida estructura monopólica de muchos sectores productivos nacionales; -Desmontar monopolios estatales mediante programas de privatización; -Comprometer inversión extranjera en la privatización. Los analistas del proceso, desde el punto de vista ecoñómico, consideran que es necesaria la adaptación del aparato productivo a las condiciones del mercado internacional y discuten que la apertura no ha pasado por un proceso previo de preparación. Es importante señalar que tal proceso no solamente puede ser considerado desde lo meramente económico sin incluir en su adaptación los aspectos tecnológicos y científicos, amén de los culturales, sociales y políticos.

  1. Malamih al-Ashwat al-'Arabiyyah wa Makharijaha

    Directory of Open Access Journals (Sweden)

    Amrah Muhammad Kasim

    2015-12-01

    Full Text Available This writing discusses on al-ashwat al-‘arabiyyah that is known with “phonetic” term. It talks and interprets makharij al-huruf or place for producing sounds and also processing production of sounds by parts of mouth in Arabic language. The problems of sounds and its systems in Arabic language have been conducted by the scholars of al-ashwat al-‘arabiyyah attractively, neatly, and detail and gotten ahead the phonetic western scholars. Part of their analysis results formulate the study about al-ashwat al-sakinah (al-Shamit is known with vocal and consonant sounds in research questions shawait – shawamit. Ibnu Jinni has formulated “harakat”(wowel in Arabic language and dimension of letter  mad and liyn on alif  letter - waw - ya’ (ا و ي, from these letters create  harakat fathah, dammah, and kasrah. Moreover, in this writing also exist the description of hija’i letters and its makhraj that are correct from parts of mouth and the unity of coordinative sounds that produce sounds in morphemes arrangement, in one word that produces meaning. The result of phonological study has divided al-ashwat to be kinds of sound like the pronounced sounds, produced sounds from mouth, and heard sound.

  2. The phase evolution mechanism in Fe(Se, Te) system

    Science.gov (United States)

    Liu, Jixing; Li, Chengshan; Zhang, Shengnan; Feng, Jianqing; Zhang, Pingxiang; Zhou, Lian

    2016-08-01

    The phase evolution mechanism in Fe(Se, Te) system during sintering was investigated with step-by-step heat treatment process. It was noticed that the diffusion processes between Fe and Se (Te) as well as that between Se and Te were both very important to the formation of superconducting Fe(Se, Te) phase with very uniform chemical composition. During heat treatment, solid solutions of (Se, Te)ss with different chemical composition were formed with the diffusion of Se atoms into Te solids and Te atoms into Se melts, simultaneously. Then with the increasing temperature, Fe atoms diffused into (Se, Te)ss, Fe(Se, Te)2 and Fe(Se, Te) phases were formed in sequence with the increasing Fe content. The chemical composition in melts became more and more uniform with the further increasing of sintering temperature and dwell time. Therefore, it was suggested that in order to achieve Fe(Se, Te) phase with high superconducting properties, it was necessary to enhance the diffusion process during sintering. The critical temperature of the sample, which was sintered at 700 °C for 12 h with slow cooling process and an O2-annealing process for 24 h, was above 14.0 K. This Tc value proved that a good superconducting β phase could be obtained under this sintering condition.

  3. El impacto del TLC frente al derecho comunitario andino

    Directory of Open Access Journals (Sweden)

    Marcel Tangarife Torres

    2006-11-01

    Full Text Available En esta conferencia analiza el impacto del Tratado de Libre Comercio que se celebrará entre la República de Colombia y los Estados Unidos de Norteamérica frente al Derecho Comunitario Andino, con gran importancia en los temas relacionados con la propiedad intelectual. Adicional a lo anterior se suma un aspecto trascendental y es la supervivencia de la Comunidad Andina de Naciones y en este sentido se cuestiona la coexistencia de las normas comunitarias en relación con las previstas en el Tratado de Libre Comercio. De esta manera, se examina el marco constitucional del Tratado de Libre Comercio y del Acuerdo de Cartagena, para así determinar las características que tienen esta clase de tratados y con ello establecer el nivel jerárquico que le corresponden dentro del ordenamiento jurídico Colombiano. Finalmente se observa la prevalencía de las normas del Acuerdo de Cartagena y el Tratado de Libre Comercio o viceversa, para con ello encontrar soluciones frente a los posibles conflictos de normas que se pueden presentar por la coexistencia de dichas normatividades.

  4. El impacto del TLC frente al derecho comunitario andino

    Directory of Open Access Journals (Sweden)

    Marcel Tangarife Torres

    2006-01-01

    Full Text Available En esta conferencia analiza el impacto del Tratado de Libre Comercio que se celebrará entre la República de Colombia y los Estados Unidos de Norteamérica frente al Derecho Comunitario Andino, con gran importancia en los temas relacionados con la propiedad intelectual. Adicional a lo anterior se suma un aspecto trascendental y es la supervivencia de la Comunidad Andina de Naciones y en este sentido se cuestiona la coexistencia de las normas comunitarias en relación con las previstas en el Tratado de Libre Comercio. De esta manera, se examina el marco constitucional del Tratado de Libre Comercio y del Acuerdo de Cartagena, para así determinar las características que tienen esta clase de tratados y con ello establecer el nivel jerárquico que le corresponden dentro del ordenamiento jurídico Colombiano. Finalmente se observa la prevalencía de las normas del Acuerdo de Cartagena y el Tratado de Libre Comercio o viceversa, para con ello encontrar soluciones frente a los posibles conflictos de normas que se pueden presentar por la coexistencia de dichas normatividades.

  5. Seguimiento al marco institucional del mercado de valores en Colombia

    Directory of Open Access Journals (Sweden)

    Constanza Blanco Barón

    2007-12-01

    Full Text Available En un artículo anterior (Blanco, 2007 en el que se analizó la pertinencia de aplicar regulación prudencial al mercado de valores, se concluyó que esto era posible reelaborando los conceptos, y dándoles un alcance más amplio que el que tradicionalmente se le ha asignado según los parámetros del Comité de Basilea. sin embargo, aunque se aceptó la importancia de lograr la sostenibilidad y profundidad del sistema financiero, así como la estabilidad del sistema de pagos, que son los propósitos más importantes de la regulación prudencial, se indicó que tal cosa no debería ir en contravía de la necesidad imperiosa de desarrollar el mercado de valores, lo que como se sabe, es presupuesto para el crecimiento económico y por ende para el desarrollo.

  6. Usos y ocurrencia de los principales metales que se producen en Sonora

    Directory of Open Access Journals (Sweden)

    Eva Lourdes Vega Granillo

    2013-06-01

    Full Text Available México posee gran cantidad de recursos minerales producto de la naturaleza, por lo que su explotación a través de la minería y el cuidado del medio ambiente deben de coexistir de una manera armoniosa. A través del tiempo la minería ha desempeñado un papel fundamental en la vida económica del país, ya que su desarrollo ha permitido que en la actualidad sea la tercera fuente generadora de ingresos. Asimismo, la minería permite que se desarrollen actividades, como la agrícola y la industrial (automotriz, acerera, cinematográfica, etcétera, entre otras. A nivel mundial, México ocupa el primer lugar en producción de plata, existiendo otros minerales metálicos importantes, como el oro, plomo, hierro, zinc, cobre, uranio y torio. Se considera a la minería como una actividad económica primaria debido a que los minerales se toman directamente de la naturaleza, encontrándose sobre la superficie o bien en el subsuelo a diferentes profundidades. Algunos de los principales centros mineros se localizan al norte del país, pero en los últimos años, Sonora se ha revelado como el estado productor de minerales más importante de México. Los principales minerales son: cobre y metales preciosos, como el oro y la plata. Por ello en el presente artículo, se mencionan los usos más comunes de estos metales, así como su ocurrencia en el estado, y su importancia económica a escala regional.

  7. A escravatura no al-Ândalus

    OpenAIRE

    Penedo, Ana Paula Cortes

    2012-01-01

    A escravatura foi uma instituição generalizada em todo o mundo muçulmano. A sua prática no al-Ândalus seguiu basicamente as mesmas regras que se aplicavam no mundo do Islão embora com algumas particularidades próprias. A sua proximidade com Reinos Cristãos colocava este território numa situação privilegiada no que respeita ao constante fornecimento deste “produto” e constituiu um importante interposto comercial na transação de escravos para os outros territórios islâmicos. A população escrava...

  8. Del presidente tlatoani al presidente gerente

    Directory of Open Access Journals (Sweden)

    Asael Mercado Maldonado

    2009-01-01

    Full Text Available El concepto de presidente tlatoani se relaciona con las formas de poder existentes en el México prehispánico, pertinentes para investigar su origen y uso desde una perspectiva del ejercicio del poder. En este artículo analizamos el símbolo del tlatoani como detentador único del máximo poder político que ha tenido vigencia en México, cuando menos desde 1917 -El jefe máximo de la revolución constitucionalista-, caracterizando al presidencialismo mexicano durante todo el siglo XX. La forma del presidente gerente prácticamente comienza con Carlos Salinas de Gortari hasta la fecha.

  9. Sample (S): SE45_S01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available o quench enzymatic activity. The all raw data are also available in MetaboLights (Salek et al., 2013) (accession no. MTBLS47), and The MetabolomeExpress (Carroll et al., 2010). ...

  10. Synthesis of CdSe/ZnSe/ZnS Core/Shell Structure Quantum Dots by Hydrothermal Method%水热法合成CdSe/ZnSe/ZnS核壳结构量子点

    Institute of Scientific and Technical Information of China (English)

    胥燕; 王新; 翟镇德; 刘敏; 苏秀荣

    2014-01-01

    本研究采用水热法合成了3-巯基丙酸稳定的具有高荧光活性的CdSe/ZnSe/ZnS核/壳结构量子点,并通过透射电镜对量子点的形貌进行了表征。研究了影响量子点荧光强度的因素,并分析了量子点的稳定性。结果表明,水热法合成的CdSe/ZnSe/ZnS量子点,分布均匀,粒径大小均匀,约为5~8 nm。当激发波长为372 nm时CdSe/ZnSe/ZnS量子点可发射蓝紫色(446 nm)荧光,荧光活性高、荧光稳定性好,毒性低,可用于生物荧光标记、组分测定等。%In the study, 3-mercaptopropionic acid modified CdSe/ZnSe/ZnS core/shell structure quantum dots (QDs) with high fluorescence were prepared by hydrothermal method and characterized via transmission electron microscopy (TEM). The influence factors of the fluorescence intensity and the stability of QDs have been studied. Results showed that excellent CdSe/ZnSe/ZnS QDs with uniform diameter (5-8 nm) were obtained. The prepared CdSe/ZnSe/ZnS QDs emit blue-violet light (446 nm) when excited at 372 nm with low toxicity, high fluorescence intensity and excellent stability, endowing the synthesized CdSe/ZnSe/ZnS QDs applied in biochemical analysis.

  11. Una aproximación al concepto de empresario y al tratamiento de los terceros dentro de la responsabilidad civil en la construcción

    OpenAIRE

    Tobar Salazar, Laura; Vélez Escobar, Daniel

    2014-01-01

    Si bien la construcción, de acuerdo con el Código de Comercio colombiano, es una actividad mercantil, su régimen de responsabilidad civil se encuentra regulado dentro del Código Civil colombiano -- Dentro de estas normas se establece como sujeto pasivo de dicha responsabilidad al empresario, el cual responde contractual y extracontractualmente por hechos ocurridos durante la ejecución de una obra y después de la entrega de la misma -- Al encontrarse dentro del régimen de responsabilidad de la...

  12. AL-IZDIWAJIYYAH AL-LUGHOWIYAH FII ISTIHDHAMI AL-LUGHOH AL-‘ARABIYAH

    Directory of Open Access Journals (Sweden)

    Imam Muslimin

    2011-10-01

    Full Text Available Al-Izdiwajiyyah (diglosia is standardizing a specific language when there are two variants of language that live side by side in societal life and each variant has its own social function. Disglosia is related to the use of local languages variations of low language and high language in a community. In Arabic language, disglosia covers dialects among the speakers, for instance there are two variants of language that each has roles and functions. The use of the variant depends on the situation. The most important characteristic of diglosia is specifying the functions of wach language variant. For high level language variant is aimed for formal situations such as religious ceremony, lectures, news, or editorials of newspaper. On the contrary, the low level language variant is commonly used in less formal situation such as daily communication in the family, chat with friends, stories in radion, and folk literature. In Arabic language, diglosia can be identified when the speaker of the language use diction commonly used for daily communication (amiyah in a formal expression (fusha, and vice versa.

  13. Challenge of replacing CdS in CuInSe{sub 2}-based solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Olsen, L.C.; Addis, F.W.; Lei, W.; Aguilar, H. [Washington State University at Tri-Cities, 100 Sprout Rd., Richland, Washington 99352 (United States)

    1997-02-01

    This paper discusses some key issues concerning the replacement of CdS buffer layers in CIS solar cell structures, and describes investigations of alternative buffer layers deposited by MOCVD. One apparently unique property of CdS buffer layers grown by CBD is that a ZnO TCO can be deposited on top of a CdS/CIS structure without significantly degrading the photovoltaic properties of the CdS-CIS junction. Investigation of alternative buffer materials such as high resistance ZnO (i-ZnO), ZnSe and InSe have first identified MOCVD growth procedures that yield Al/X/CIS test structures (X=i-ZnO, ZnSe and InSe) with good properties, and then addressed the challenge of fabricating efficient, complete cells with conductive ZnO top contact layers. These studies have been conducted with Siemens CIS and CIGSS substrates, and with NREL CIGS substrates. A total area efficiency of 12.7{percent} and estimated active area efficiency of 13.4{percent} is reported for a CIGS cell with an i-ZnO buffer layer grown by MOCVD. {copyright} {ital 1997 American Institute of Physics.}

  14. Challenge of replacing CdS in CuInSe2-based solar cells

    Science.gov (United States)

    Olsen, Larry C.; Addis, F. William; Lei, Wenhua; Aguilar, Heriberto

    1997-02-01

    This paper discusses some key issues concerning the replacement of CdS buffer layers in CIS solar cell structures, and describes investigations of alternative buffer layers deposited by MOCVD. One apparently unique property of CdS buffer layers grown by CBD is that a ZnO TCO can be deposited on top of a CdS/CIS structure without significantly degrading the photovoltaic properties of the CdS-CIS junction. Investigation of alternative buffer materials such as high resistance ZnO (i-ZnO), ZnSe and InSe have first identified MOCVD growth procedures that yield Al/X/CIS test structures (X=i-ZnO, ZnSe and InSe) with good properties, and then addressed the challenge of fabricating efficient, complete cells with conductive ZnO top contact layers. These studies have been conducted with Siemens CIS and CIGSS substrates, and with NREL CIGS substrates. A total area efficiency of 12.7% and estimated active area efficiency of 13.4% is reported for a CIGS cell with an i-ZnO buffer layer grown by MOCVD.

  15. Nouveau procédé de synthèse du nitrure d'aluminium

    OpenAIRE

    Haussonne, J.; Lostec, J.; Bertot, J.; Lostec, L.; Sadou, S.

    1993-01-01

    Les calculs thermodynamiques montrent que, même à température ambiante, l'aluminium pur peut réagir avec l'azote pour former le nitrure d'aluminium AlN. Cependant, la poudre d'aluminium pur n'existe pas : ses grains sont toujours entourés d'une couche d'alumine protectrice. De plus, dans l'hypothèse où l'on pourrait faire réagir de la poudre d'aluminium avec de l'azote, il se formerait de même une couche protectrice de nitrure d'aluminium qui empêcherait le centre des grains de réagir. S'insp...

  16. Bréal, un antinaturalisme d’inspiration humboldtienne

    Directory of Open Access Journals (Sweden)

    Babu Jean-Philippe

    2014-07-01

    Full Text Available Dans De la forme et de la fonction des mots, Bréal formulait, dès 1866, outre une critique générale du formalisme de la philologie comparative depuis Bopp, une thèse radicalement opposée à l’orientation naturaliste de l’évolutionnisme linguistique de Schleicher. Cette thèse, que nous prendrons le risque de définir comme thèse du primat de la fonction sur la forme linguistique, est au coeur de ce programme de linguistique générale pour lequel Bréal allait forger, quelques années plus tard, le mot de sémantique. Fortement marqué par la notion humboldtienne d’innere Sprachform, Bréal, contrairement à Saussure, n'abandonnera jamais le changement linguistique au hasard de l'histoire et maintiendra l'intelligence comme premier moteur des langues, quitte à poser la nécessité de repenser cette intelligence.

  17. Viaje al palenque Caribe de Ana Mercedes Hoyos

    Directory of Open Access Journals (Sweden)

    Maria Cristina Laverde Toscano

    1995-04-01

    Full Text Available Transitar por el camino de un artista consagrado despierta en el espectador diversos y entrañables sentimientos. Recorrer la obra de Ana Mercedes Hoyos nos enfrenta al proceso coherente y mesurado de una creadora que se apropió de la luz majestuosa para dar vida a objetos del entorno cotidiano. Objetos que danzan, dueños del movimiento y la sensualidad que los convierte en sagrados. El encuentro con un cuadro de esta artista se transforma así en un acto sublime de contemplación. Esta Maestra vive hoy en función de su trabajo las veinticuatro horas de cada día: sus viajes continuos tienen que ver siempre con sus labores artísticas en Nueva York, con sus exposiciones en los más disímiles puntos del planeta, con su anhelo ferviente de conocer lo que grandes maestros de la plástica universal muestran en famosos museos y galerías del mundo. Así preserva la riqueza de esa relación constante en su obra entre temáticas locales y estilos y lenguajes contemporáneos e internacionales. En Bogotá, la vida de Ana Mercedes Hoyos transcurre alderredor de su taller donde infatigablemente lleva al lienzo sólo algunos de los múltiples proyectos que invaden su creativa imaginación. Los pocos compromisos que acepta giran también en torno al trabajo, al igual que sus amigos con quienes comparte actividades y labores de su quehacer artístico. Al final, como ella afirma ... “todo se me vuelve el mismo cuento”.

  18. para medir adicción al amor en adolescentes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Retana Franco

    2005-01-01

    Full Text Available La llamada “adicción al amor” no es privativa de cierto grupo de individuos, máxime en etapas de la vida en las que se inicia el proceso de atracción y cortejo. Dado lo anterior, resultó importante desarrollar un instrumento para medir dicha adicción en los adolescentes. El instrumento, con validez y confiabilidad robustas, comprendió 45 reactivos y se aplicó a 300 estudiantes de secundaria. Los resultados indican la presencia de diez factores: dependencia, necesidad apremiante, alivio, celos, fisiología, emociones negativas, no adicción, cuidado de la relación, obsesión y resistencia. Se discuten el concepto y su impacto en la salud de individuos y parejas.

  19. SeP, ApoER2 and megalin as necessary factors to maintain Se homeostasis in mammals.

    Science.gov (United States)

    Krol, Magdalena Beata; Gromadzinska, Jolanta; Wasowicz, Wojciech

    2012-10-01

    Selenoprotein P (SeP) is an extracellular protein containing ten selenium atoms in the form of selenocysteine, secreted mainly from the liver. About 60% of the whole plasma selenium level is present in SeP, which makes it a useful biomarker of selenium nutritional status. The main functions of SeP are transport and storage of selenium in plasma. It is especially an important protein for the brain, testes and kidneys where the supplementation of the proper amount of Se ensures the synthesis of selenoenzymes with antioxidant properties.Recently, it has been found that SeP uptake in kidneys, testes and brain depends on the apolipoprotein receptor 2 (ApoER2) and lipoprotein megalin receptor (Lrp2). Megalin receptor represents a physiological SeP receptor in kidneys, mediating the re-uptake of secreted SeP from the primary urine. The absence of a functional megalin receptor causes a significant reduction of plasma selenium and the SeP levels as a result of Se excretion. ApoER2 is a SeP receptor in the brain and testes which uptakes Se from the extracellular fluid. Deletion of ApoER2 in mice leads to a lowered selenium level in the brain and testes, neurological dysfunction, production of abnormal spermatozoa, infertility and even death when the subjects are fed a low-selenium diet. PMID:22683052

  20. A dry method to synthesize dendritic Ag2Se nanostructures utilizing CdSe quantum dots and Ag thin films

    Science.gov (United States)

    Hu, Lian; Zhang, Bingpo; Xu, Tianning; Li, Ruifeng; Wu, Huizhen

    2015-01-01

    Dendritic Ag2Se nanostructures are synthesized in a dry environment by UV irradiating the hybrids composed of CdSe quantum dots (QDs) and silver (Ag). UV irradiation on CdSe QDs induces a photooxidation effect on the QD surface and leads to the formation of SeO2 components. Then SeO2 reacts with the Ag atoms in either Ag film or QD layer to produce the Ag2Se. The growth mechanism of Ag2Se dendrites on solid Ag films is explored and explained by a diffusion limited aggregation model in which the QD layer provides enough freedom for Ag2Se motion. Since the oxidation of the CdSe QDs is the critical step for the Ag2Se dendrites formation this dry chemical interaction between QDs and Ag film can be applied in the study of the QD surface chemical properties. With this dry synthesis method, the Ag2Se dendrites can also be facilely formed at the designed area on Ag substrates.

  1. Properties of CuIn3Se5 crystals and In/CuIn3Se5 structures

    International Nuclear Information System (INIS)

    Using the method of planar crystallization from the melt with deviations from the stoichiometric composition, p-CuIn3Se5 single crystals are grown. The electrical properties of the homogeneous crystals are studied. It is found that the resistivity of the p-CuIn3Se5 crystals depends on the excess Se content in the melt. It is established that the voltaic photosensitivity of the In/CuIn3Se5 structures is enhanced with an increasing excess of Se content in the melt. The energy spectrum and the character of interband transitions in the CuIn3Se5 crystals are discussed. It is concluded that the CuIn3Se5 ternary compound can be used in high efficiency photoelectric converters of solar radiation

  2. Los cuentos en el programa “Libro al Viento”

    Directory of Open Access Journals (Sweden)

    Carolina Arias-Arenas

    2013-01-01

    Full Text Available Esta investigación analiza el funcionamiento, conocimiento y valoración del programa Libro al Viento con el propósito de ofrecer nuevos datos que permitan mejoras, en la ciudad, al programa en su modalidad Institución Educativa. El trabajo de campo se abordó con un grupo de 60 docentes del Colegio Marco Antonio Carreño Silva, ubicado en la ciudad de Bogotá (Colombia. Con el cuestionario cerrado que se aplicó se indagaron tres aspectos: el conocimiento del programa, el acceso y uso de los libros de cuento y las prácticas de lectura de los cuentos. Los cinco libros de cuentos menos conocidos por los docentes han sido clasificados y valorados según el tipo de lector sugerido por Fundalectura. Finalmente se proponen algunos indicadores de impacto a partir de las variables analizadas con respecto a la lectura de cuentos para este programa.

  3. Foucault y su crítica al humanismo

    Directory of Open Access Journals (Sweden)

    Ignacio Bárcenas Monroy

    2007-01-01

    Full Text Available El objetivo del presente trabajo es determinar el significado de la frase “la muerte del Hombre” en la filosofía contemporánea. Para ello se comienza por dar un panorama general del lugar que ocupa esta reflexión en la filosofía contemporánea. Después se muestra que, a partir de los análisis de Michel Foucault, el hombre es una invención reciente, pues no ha sido una constante en la historia del pensamiento. En seguida se describen aquellos saberes que tienen como objeto de estudio al hombre, mostrando que en lugar de darnos una respuesta sobre lo que éste sea, antes bien lo disuelven, más aún las ciencias humanas producen mecanismos de poder que normalizan a los seres humanos. Se concluye que una reflexión así planteada promueve la indagación de nuevas formas para pensar al ser humano, alejadas de un viejo humanismo.

  4. First-principles materials design of CuInSe{sub 2}-based high-efficiency photovoltaic solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Tani, Yoshimasa, E-mail: tani@aquarius.mp.es.osaka-u.ac.jp [Graduate School of Engineering Science, Osaka University, 1-3 Machikaneyama, Toyonaka, Osaka 560-8531 (Japan); Sato, Kazunori [Graduate School of Engineering Science, Osaka University, 1-3 Machikaneyama, Toyonaka, Osaka 560-8531 (Japan); PRESTO, Japan Science and Technology Agency (JST), 4-1-8 Honcho Kawaguchi, Saitama 332-0012 (Japan); Katayama-Yoshida, Hiroshi [Graduate School of Engineering Science, Osaka University, 1-3 Machikaneyama, Toyonaka, Osaka 560-8531 (Japan)

    2012-08-01

    Based on ab initio electronic structure calculations by self-interaction-corrected local-density-approximation (SIC-LDA) with the Korringa-Kohn-Rostoker coherent potential approximation (KKR-CPA), we propose a materials design for high efficiency photovoltaic solar cells (PVSCs). It is shown that (i) the concentration dependence of the mixing energy of CuIn{sub 1-x}Ga{sub x}Se{sub 2} shows upward convexity, thus this system favors phase separation. Due to the type II band alignment between CuInSe{sub 2} and CuGaSe{sub 2}, efficient electron-hole separation is realized in decomposed phase of this system. (ii) CuIn{sub 1-x}Zn{sub 0.5x}Sn{sub 0.5x}Se{sub 2} has a direct band gap and no impurity state appears in the gap. Therefore, cost reduction is possible by using Zn and Sn instead of In. (iii) n-type CuAl{sub 1-x}Sn{sub x}S{sub 2} and p-type Cu{sub 1-x}V{sub Cux}AlS{sub 2} have negative activation energy for doped impurities and are expected to be low-resistive transparent conducting sulfides, which should be useful for CuInSe{sub 2}-based PVSCs.

  5. Comment on "Unconventional s-wave superconductivity in Fe(Se,Te)"

    OpenAIRE

    Mazin, I.I.; Singh, D. J.

    2010-01-01

    Hanaguri et al (Science, 8th of January 2010, p. 181) have reported STM measurements on an Fe-based superconductor Fe(Se,Te). After Fourier-transforming their data they found three sets of sharp peaks in the reciprocal space. They interpreted one as a Bragg peak (an umklapp scattering) and two as resulting from quasiparticle interference (QPI) We point out that at least one of these two peaks is also a Bragg peak, corresponding to another reciprocal lattice vector, and therefore is not a QPI ...

  6. Los servicios de salud mental se enredan en la informática

    OpenAIRE

    Moreno-Küstner, Berta

    2015-01-01

    Con los últimos adelantos en la tecnología informática, cada vez resulta más fácil diseñar, alimentar y gestionar grandes bases de datos, estandarizar la entrada y salida de la información, mejorar su accesibilidad, facilitar las tareas administrativas y repetitivas como informes, recetas, circulares,… en definitiva suponen una mejora en la gestión de la información clínica. Efectivamente se está avanzando en el desarrollo informático aplicado al ámbito sanitario, sin embargo, el gran avance ...

  7. El acero que nunca se fundió. Una reseña sobre Stalin

    Directory of Open Access Journals (Sweden)

    Iñaki Oneca Agurruza

    2004-02-01

    Full Text Available Era el 5 de marzo de 1953 cuando murió el fetiche, el gurú, el símbolo. Stalin significa “acero”, y precisamente una de las cosas que se reprochó al joven revolucionario, tras la adopción de este apodo, era que el acero era duro pero también frío. Así iniciamos esta breve nota sobre la figura de uno de los personajes clave del siglo XX.

  8. Estudio de caso: adaptaciones de acceso al currículum en un alumno de educación infantil con parálisis cerebral.

    OpenAIRE

    Tárraga Mínguez, Raúl

    2012-01-01

    Se presenta el contenido de una intervención con un alumno de educación infantil afectado de parálisis cerebral. La intervención se basa en una adaptación de acceso al currículum consistente en el diseño de tareas y actividades educativas con soporte informático accesible al alumno y adecuadas al nivel curricular propio para su edad y curso académico. Esta metodología garantiza al alumno un acceso al currículum minimizando los efectos de sus problemas de movilidad. This paper exposes the c...

  9. Synthesis of dextran/Se nanocomposites for nanomedicine application

    Energy Technology Data Exchange (ETDEWEB)

    Shen Yuhua [School of Chemistry and Chemical Engineering, Anhui University, Feixi Road 3, Hefei 230039 (China)], E-mail: s_yuhua@163.com; Wang Xiufang; Xie Anjian; Huang Lachun; Zhu Jinmiao; Chen Long [School of Chemistry and Chemical Engineering, Anhui University, Feixi Road 3, Hefei 230039 (China)

    2008-06-15

    In this study, spherical Se nanoparticles were prepared by the reduction of aqueous selenious acid with ice bath through a simple, conventional, and one-step method without the aid of any surfactant, or template. The nanoparticles were characterized by transmission electron microscopy (TEM), photon correlation spectroscopy (PCS), X-ray powder diffraction (XRD), Ultraviolet-visible spectroscopy (UV-vis), Zeta potential, respectively. The results show the Se nanoparticles have good particle dispersion with the average diameters of 36 nm and are amorphous ({alpha}-Se). Tablets A and B containing dextran and Se nanoparticles were synthesized with different preparation methods. Se nanoparticles studded equably in the interior and the surface of the tablets, and there are strong interactions between Se and dextran. The release of Se from tablets is investigated in the simulated gastric and intestinal conditions. It is found that the pH environment and different synthetical methods have significant influence on the release rate of Se. The release mechanism of Se nanoparticles is also discussed. The nanocomposites can be applied in controlled releasing of Se nanomedicine.

  10. Al versus Si competition in FeSiAl alloys

    Energy Technology Data Exchange (ETDEWEB)

    Legarra, E. [Dpto. Electricidad y Electronica, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco (UPV/EHU), CP 644, 48080 Bilbao (Spain)], E-mail: estibaliz.legarra@ehu.es; Apinaniz, E. [Dpto. Fisica Aplicada I, Escuela de Ingenieria Tecnica Superior, Universidad del Pais Vasco, Alameda de Urquijo s/n 48013 Bilbao (Spain); Plazaola, F. [Dpto. Electricidad y Electronica, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco (UPV/EHU), CP 644, 48080 Bilbao (Spain); Jimenez, J.A. [Centro Nacional de Investigaciones Metalurgicas (CENIM), Avda. Gregorio del amo 8, 28040 Madrid (Spain); Pierna, A.R. [Chemical Engineering and Environmental Department, UPV/EHU, Box 1379, 20008 San Sebastian (Spain)

    2008-10-15

    In FeSiAl alloys, when Si substitutes for Al, important changes take place in the magnetism as well as in the structural properties. Alloys in the two composition series Fe{sub 75}Al{sub 25-x}Si{sub x} (x=0, 7.5, 12.5, 17.5, 25) and Fe{sub 70}Al{sub 30-x}Si{sub x} (x=0, 9, 15, 21, 30) were prepared by induction melting; afterwards they were crushed and then annealed in order to recover the DO{sub 3} stable phase. The deformed FeAl samples show larger lattice parameters than the ordered ones; however, this difference ({delta}a) decreases when Si substitutes for Al until it becomes zero (i.e. until the ordered samples and the deformed ones have the same lattice parameters). This trend is the same for both sample series and does not depend on the Fe content of the alloy. However, the magnetization has a different behaviour depending on the Fe content. For deformed Fe{sub 75}Al{sub 25-x}Si{sub x} alloys the saturation magnetization decreases with increasing Si content while for Fe{sub 70}Al{sub 30-x}Si{sub x} deformed alloys the saturation magnetization has a plateau in which the saturation magnetization values do not vary.

  11. La Rama Judicial frente al conflicto armado

    Directory of Open Access Journals (Sweden)

    Luis Alberto Gómez Araujo

    2003-01-01

    Full Text Available La Rama Judicial en Colombia ha sido victima continua de la violencia, pero en igual sentido, se ha convertido también en un factor generador en la medida en que la falta de una pronta y cumplida justicia o la imposibilidad de acceder a ella, trae como consecuencia una desconfianza en la institucionalídad y una tenencia a la búsqueda de otras soluciones al margen de la ley. No obstante la existencia de un marco normativo idóneo para impulsar procesos de paz en Colombia y los intentos formales por acudir a los mecanismos concertados de solución de conflictos, el fracaso de tales esfuerzos se debe a la ausencia de voluntad política real de los actores del conflicto, lo que ha venido generando en la comunidad incredulidad y desesperanza en la solución del conflicto por estas vias. Sin embargo, es vital para elfuturo de la sociedad colombiana persistir en la exploración defórmulas que busquen una salída a la coyuntura dolorosa de violencia que estamos pasando.

  12. Servir al soberano sin detrimento del vasallo

    Directory of Open Access Journals (Sweden)

    René Salinas Meza

    2011-10-01

    Full Text Available Con este sugestivo título Cavieres se interna en un análisis renovado del comercio y los comerciantes de Chile colonial especialmente en el siglo XVIII, tratando de entender la singularidad regional al tiempo que la forma, la dimensión y el significado de su inserción en el contexto de economías-mundo. El autor sitúa su trabajo en el campo de «la historia colonial desde la perspectiva de la historiografía económica y social y de la historia regional». Para ello parte de los problemas que ocuparon a grandes teóricos del sistema mundial, a historiadores de la economía y la sociedad de Hispanoamérica colonia y a historiadores chilenos, y propone una mirada más de cerca, que hace síntesis de muchos trabajos publicados, aporta nueva documentación, nuevos cálculos y revisa los efectos del decreto de Libre Comercio de 1778. Como resultado general nos mostrará una economía que aunque de pequeña escala, fue mucho más activa, dinámica y moderna de lo que se ha pensado hasta ahora y cumplió roles importantes y significativos en el espacio económico colonial y en el sistema imperial español.

  13. Fenómenos fisiopatológicos sistémicos asociados al bruxismo de sueño

    OpenAIRE

    V. Iturriaga; T. Bornhardt; R. Casassus; C. Alveal; H. Medina; C. Reuque

    2014-01-01

    El bruxismo de sueño (BS) se define como un trastorno del movimiento estereotipado que se presenta durante el sueño, caracterizado por rechinamiento y/o apretamiento dentario. Se encuentra dentro de la clasificación internacional de desórdenes de sueño como un trastorno del movimiento asociado a una exagerada actividad muscular masticatoria rítmica. Se reporta una incidencia del 15% al 22% en la población general. Antiguamente se creía que la etiología del BS estaba relacionada con alteracion...

  14. Shear elastic constants of thin films of the misfit layered compound [(SnSe)1.05]n[MoSe2]n

    Science.gov (United States)

    Li, Dongyao; Mitchson, Gavin; Johnson, David; Schleife, Andre; Cahill, David

    Crystalline materials with interlayer van der Waals bonding typically have low stiffness for shear deformation that reduces the through-plane thermal conductivity and facilitates the use of layered materials as solid-state lubricants. In graphite and MoS2, c44 = 5GPa and 18GPa respectively. The shear modulus of incommensurate layered materials is expected to be strongly reduced relative to ordered crystals but the magnitude of the suppression is currently unknown. We have recently developed an approach for measuring the shear modulus of thin layers using GHz surface acoustic waves (SAW). [(SnSe)1.05]n[MoSe2]n with n =1-4 were prepared as thin films (60 nm) on Si substrates using the modulated elemental reactants technique. The SAW velocity vSAWof Al/[(SnSe)(MoSe2) ]/Si structures was measured using a polydimethylsiloxane (PDMS) phase-shift optical mask in a pump-probe system. c44 was determined by fitting the measured vSAW to the calculated SAW velocity using multi-layer SAW model. c33was measured by picosecond acoustics. c11, c12 and c13 were calculated using density functional theory (DFT) with van der Waals correction. The measured c33 and c44 are compared with the DFT prediction. Experimentally we obtain c44 = 1.9GPa, 1.2GPa, and smaller than 0.05GPa for n =1, 2 and 4. The author acknowledge the support of International Institute for Carbon Neutral Energy Research.

  15. Undulators at the ALS

    International Nuclear Information System (INIS)

    At Lawrence Berkeley Laboratory's (LBL) Advanced Light Source (ALS), three 4.6 m long undulators have been completed, tested and installed. A fourth is under construction. The completed undulators include two 5.0 cm period length, 89 period devices (U5.0s) which achieve a 0.85 T effective field at a 14 mm minimum gap and a 8.0 cm period length, 55 period device (U8.0) that reaches a 1.2 T effective field at a 14 mm minimum gap. The undulator under construction is a 10.0 cm period length, 43 period device (U10.0) that is designed to achieve 0.98 T at a 23 mm gap. Undulator magnetic gap variation (rms) is within 25 microns over the periodic structure length. Reproducibility of the adjustable magnetic gap has been measured to be within +/- 5 microns. Gap adjusting range is from 14 mm to 210 mm, which can be scanned in one minute. The 5.1 m long vacuum chambers are flat in the vertical direction to within 0.74 mm and straight in the horizontal direction to within 0.08 mm over the 4.6 m magnetic structure sections. Vacuum chamber base pressures after UHV beam conditioning are. in the mid 10-11 Torr range and storage ring operating pressures with full current are in the low 10-10 Torr range. Measurements show that the uncorrelated magnetic field errors are 0.23%, and 0.20% for the two U5.Os and the U8.0 respectively and that the field integrals are small over the 1 cm by 6 cm beam aperture. Device description, fabrication, and measurements are presented

  16. Alexandria (Al Iskandariya), Egypt

    Science.gov (United States)

    2002-01-01

    This image of Alexandria was taken by astronauts on board the International Space Station in December 2000 using an Electronic Still Camera. A wider-angle view (STS088-739-90) taken from the Space Shuttle in December 1998 is available for context. Alexandria (Al Iskandariya) occupies a T-shaped peninsula and strip of land separating the Mediterranean from Lake Mariout. Originally the town was built upon a mole (stone breakwater) called Heptastadium, which joined the island of Pharos (see referenced website, below) to the mainland. Since then sedimentary deposits have widened the mole. Since 1905, when the 370,000 Alexandrians lived in an area of about 4 sq km between the two harbors, the city (population 4 million; see referenced website, below) has grown beyond its medieval walls and now occupies an area of about 300 sq km. The Mahmudiya Canal, connecting Alexandria with the Nile, runs to the south of the city and, by a series of locks, enters the harbor of the principal port of Egypt (note ships). The reddish and ochre polygons west of Lake Mariout are salt-evaporation, chemical-storage, and water-treatment ponds within the coastal lagoon. Reference Youssef Halim and Fatma Abou Shouk, 2000, Human impacts on Alexandria's marine environment: UNESCO, Coastal Regions and Small Islands Unit (CSI), Coastal Management Sourcebooks 2 (accessed December 20, 2000) Additional photographs taken by astronauts can be viewed at NASA-JSC's Gateway to Astronaut Photography of Earth. Image ISS001-ESC-5025 provided by the Earth Sciences and Image Analysis Laboratory, Johnson Space Center.

  17. Magnetooptical properties of a single CdMnSe/CdMgSe quantum well

    International Nuclear Information System (INIS)

    The spectra of photoluminescence and reflectance in magnetic fields up to 7 T are studied for a 3.8 nm semimagnetic CdMnSe quantum well confined by two CdMgSe barriers. A noticeable magnetic shift in the σ+-polarized emission line of the heavy exciton to low energies and a decrease in the halfwidth of the line by more than one-half are detected with increasing magnetic field. It is established that a localized magnetic polaron is formed, with the polaron energy of 19.8 meV determined from the change in the degree of circular polarization in magnetic field. A σ--polarized emission line is observed in magnetic fields ranging from 0.4 to 2 T. This line can be interpreted as being produced by the complex of two electrons, with oppositely directed spins, and a heavy hole, i.e., by the trion X- or the exciton localized at a donor, D0X. The binding energy of such complex is 10 meV.

  18. Inter-island transport in CdSe/ZnSe quantum heterostructures

    CERN Document Server

    Wachter, S; Baldauf, M; Schmidt, M; Kurtz, E; Klingshirn, C F; Kalt, H; Litvinov, D A; Gerthsen, D

    2001-01-01

    We report on localization dynamics of excitons in ensembles of self- organized CdSe islands embedded in ZnSe. The experimental methods employed are temperature-dependent, spatially resolved photoluminescence ( mu -PL), spatially integrated PL (macro-PL), as well as time-resolved PL (TRPL). We observe the well known non- monotonous shift of the PL maximum with temperature caused by redistribution of the excitons amongst the islands. The measured shift is compared with the exact shift of the bandgap deduced from mu -PL measurements and found to depend strongly on island size and distribution. These transport processes are recovered in the temporal evolution of the PL. The decaytime of the spectrally integrated PL reaches its maximum at exactly the same temperature at which the redshift of the macro-PL turns into a blueshift. In TRPL the PL- spectrum consists of two contributions. We put the emission on the high energy side down to excited states in the islands. (17 refs).

  19. Condiciones de trabajo materno y bajo peso al nacer en la Ciudad de México

    Directory of Open Access Journals (Sweden)

    CERÓN-MIRELES PRUDENCIA

    1997-01-01

    Full Text Available Objetivo. Estudiar la asociación entre condiciones de trabajo materno y bajo peso al nacer en la Ciudad de México. Material y métodos. Se encuestaron 2 623 trabajadoras que atendieron sus partos en tres grandes hospitales de la Ciudad de México en 1992. Se obtuvo información sobre los principales factores biológicos y sociales que se asocian al bajo peso al nacer; asimismo, se determinó el estrés ocupacional utilizando el instrumento desarrollado por Karasek. Se utilizaron modelos de regresión logística para evaluar la relación de las condiciones de trabajo con el bajo peso al nacer, controlando por variables confusoras. Resultados. El bajo peso al nacer fue más alto en trabajadoras con jornadas mayores a 50 horas semanales (RM= 1.6; IC= 1.17, 2.28 y con conflictos laborales (RM= 1.5; IC= 1.0, 2.25. La falta de apoyo social tangible fue identificado como un factor de riesgo de bajo peso al nacer (RM= 1.7; IC= 1.20, 2.33. Las medidas preventivas laborales como el cambio de tareas, disminución de la jornada y las salidas por enfermedad no mostraron un efecto benéfico en el peso al nacer, a excepción de la licencia de maternidad; las madres que no la tuvieron mostraron una probabilidad 2.2 veces mayor para bajo peso al nacer (IC= 1.66, 2.93. Conclusiones. Estos hallazgos resaltan la importancia de identificar los factores de riesgo ocupacional en el embarazo..

  20. First and second harmonic generation of the XAl{sub 2}Se{sub 4} (X=Zn,Cd,Hg) defect chalcopyrite compounds

    Energy Technology Data Exchange (ETDEWEB)

    Ouahrani, Tarik, E-mail: tarik_ouahrani@yahoo.fr [Laboratoire de Physique Theorique, Universite de Tlemcen, B.P.230,13000 Tlemcen (Algeria); Ecole Preparatoire en Sciences et Techniques, Depertement de Physique EPST-T, Tlemcen 13000 (Algeria); Khenata, R. [Laboratoire de Physique Quantique et de Modelisation Mathematique (LPQ3M), Universite de Mascara, 29000 Mascara (Algeria); Lasri, B. [Laboratoire de Physique Theorique, Universite de Tlemcen, B.P.230,13000 Tlemcen (Algeria); Universite Dr Tahar Moulay de Saida, B.P. 138, Cite el Nasr, Saida 20000 (Algeria); Reshak, Ali H. [School of Complex systems, FFPW- South Bohemia University, Nove Hrady 37333 (Czech Republic); School of Material Engineering, Malaysia University of Perlis, P.O Box 77, d/a Pejabat Pos Besar, 01007 Kangar, Perlis (Malaysia); Bouhemadou, A. [Department of Physics, Faculty of Sciences, University of Setif, 19000 Setif (Algeria); Bin-Omran, S. [Department of Physics and Astronomy, Faculty of Science, King Saud University, P.O. Box 2455, Riyadh 11451 (Saudi Arabia)

    2012-09-15

    The chemical bonding of the ZnAl{sub 2}Se{sub 4}, CdAl{sub 2}Se{sub 4} and HgAl{sub 2}Se{sub 4} defect chalcopyrites has been studied in the framework of the quantum theory of atoms in molecules (AIM). The GW quasi-particle approximation is used to correct the DFT-underestimation of energy gap, and as a consequence the linear and nonlinear optical properties are significantly enhanced. The second harmonic generation (SHG) displays certain dependence with the ionicity degree decrease through the dependency of the SHG on the band gap. The occurrence of the AIM saddle point is characterized and some clarifying features in relationship with the density topology are exposed, which enable to understand the relation with the second harmonic generation effect.