WorldWideScience

Sample records for al oiea se

  1. Cathodoluminescence of ZnSe(Bi) : Al

    International Nuclear Information System (INIS)

    Studies on cathodoluminescence (CL) in the ZnSe crystals, annealed at the temperature of 1200 K in the Bi melt, containing aluminium admixture, are carried out. The spectra are taken at different levels of excitation and delay times by the t0 registration. With the t0 increase the orange band intensity with λmax = 630 nm (1.968 eV) in the CL spectrum decreases as compared to the intensity of the dominating yellow-green band with λmax = 550 nm (2.254 eV). It is shown that such a behaviour of the yellow-green band is conditioned by competition of two processes: recombination of donor-acceptor pairs and free electrons with holes localized on the acceptors. The first mechanism dominates at low temperatures and the second one - at high temperatures. The contribution of both mechanisms in the area of T ∼ 120 mK becomes equal

  2. Preparation and characterization of ZnSe: Al thin films

    International Nuclear Information System (INIS)

    Thin films of ZnSe: Al were deposited on glass substrates by laser assisted evaporation. Parameters such as crystal structure, optical and electrical properties of the films have been investigated. X-ray diffraction shows that prepared films are polycrystalline with preferred (111) orientation and having a zinc blend cubic structure. The lattice constant has been evaluated for ZnSe, the value was found to be 0.56 nm, and the value does not show any appreciable change with the addition of aluminium. From optical measurement, it was found that optical band gap, Eg, decreases on adding Al. The value changes from 2.62 eV (for ZnSe) to 1.85 eV with 3.0 wt % of Al in the film. Hall effect measurements showed that the films are all n-type and the carrier concentration increases with the increase of Al concentration in the film. DC electrical conductivity may be thermally activated with negligible activation energy only when the Al concentration is lower than 3 wt % at temperature up to 2000 C, and the transport process may involve hopping of electrons in the localized states near the conduction band edge. However, at higher concentration of Al the process is dominated by usual transition of electrons to the mobility edge. Addition of Al up to 3 wt % does not only increase the electrical conductivity by a factor of 102 but also the carrier concentration by a factor of 103 which may bring about electron degeneracy at room temperature by dislodging the Fermi level (Authors)

  3. ¿Qué se juega al jugar un juego?

    Directory of Open Access Journals (Sweden)

    Kalejman, Cecilia

    2012-06-01

    Full Text Available En el presente artículo se considera el juego en relación a la niñez. Se indaga acerca del papel que juega el juego en la niñez intentando responder a diversas preguntas, entre ellas la más importante: ¿Qué significa jugar? A lo largo de esta etapa del desarrollo en que comienza a constituirse la subjetividad del individuo el juego constituye, sin dudas, un factor central, una herramienta fundamental en el desarrollo. Juego no es sólo el juego dramático, también consideramos para nuestro análisis aquellas modalidades de juego que se transmiten de generación en generación, juegos de construcción, los dibujos, teniendo en cuenta asimismo los objetos utilizados en los juegos, los contenidos de los mismos, los espacios en los que se desarrollan. Se piensa y se interpreta al juego, como un derecho y como un modo de expresión del niño, se finaliza este desarrollo con una conclusión acera del juego y el espacio que ocupa en la vida cotidiana.

  4. procesadores digitales de señal (DSPs

    Directory of Open Access Journals (Sweden)

    Federico José Barrero García

    2005-01-01

    Full Text Available El presente trabajo describe una aplicación multimedia realizada en el Departamento de Ingeniería Electrónica de la Escuela Superior de Ingenieros de Sevilla. La herramienta, un CD interactivo, se ha desarrollado con vistas a su empleo como laboratorio virtual y sistema de ayuda en la impartición de un laboratorio de Procesadores Digitales de Señal (DSPs. El uso de este CD agiliza el proceso de aprendizaje y/o entrenamiento de los estudiantes en la asignatura, fomentando la participación de los alumnos en el mismo. El material didáctico se emplea en la actualidad, con gran éxito, en las clases prácticas de la asignatura «Complemento de Sistemas Electrónicos Digitales», de tercer curso de Ingeniero de Telecomunicación.

  5. Josephson effect in Al/Bi2Se3/Al coplanar hybrid devices

    International Nuclear Information System (INIS)

    Highlights: • Superconducting proximity effect induced in Al/Bi2Se3/Al coplanar hybrid devices. • Comparative study of Al/Bi2Se3 interfaces with various buffer layers. • Towards a Josephson super-current through the edge states of topological insulators. - Abstract: The edge states of Topological Insulators (TI) are protected against backscattering, thanks to the topological properties arising from their band structure. Coupling a TI to a superconductor (S) can induce unconventional effects, including the creation of Majorana bound states (MBS). The fabrication of coplanar hybrid devices is a fundamental step to pave the way to the understanding of proximity effects in topologically non-trivial systems, and to a large variety of experiments aimed at the possible detection of MBS. We discuss the feasibility and some relevant properties of Al–Bi2Se3–Al coplanar proximity devices. Special attention is devoted to the design of the junction, aimed at enhancing the coupling between the electrodes and the TI

  6. Al-Bentonit Üretimi ve 75Se Radyoizotopunun Al-Bentonitte Adsorpsiyonu

    OpenAIRE

    ORUÇOĞLU, Esra; HACIYAKUPOĞLU, Sevilay

    2015-01-01

    Bu çalışmada, Se(IV) anyonlarının, aluminyum-polioksi katyonları kullanılarak Reşadiye bentonitinden hazırlanan inorganik bentonite adsorpsiyonu konusunda araştırmalar gerçekleştirilmiştir. Adsorpsiyon deneylerinde 79Se ile benzer kimyasal özelliklere sahip ve daha kısa yarı ömürlü 75Se radyoizotopu kullanılmıştır. Bu izotop İTÜ TRIGA MARK II nükleer araştırma reaktöründe, nötron aktivasyonu yöntemiyle üretilmiştir. Kesikli adsorpsiyon yöntemi uygulanarak, modifiye bentonitin değişen süre ve ...

  7. Syntheses and characterization of two new selenides Ba5Al2Se8 and Ba5Ga2Se8

    International Nuclear Information System (INIS)

    Graphical abstract: Display Omitted Research highlights: → Two new compounds Ba5M2Se8 (M = Al, Ga) have been synthesized for the first time. → The crystal structures contain isolated MSe4 tetrahedra separated by Ba atoms. → The measured optical band gap is 2.51(2) eV for Ba5Ga2Se8. → The Ba 5d orbitals were found to have significant contribution to the energy bands around Fermi level. - Abstract: Two new barium selenides Ba5Al2Se8 and Ba5Ga2Se8 have been synthesized by solid-state reactions. The structures of Ba5Ga2Se8 and Ba5Al2Se8 were determined by single-crystal X-ray diffraction method and the Rietveld method, respectively. The two isostructural compounds crystallize in space group Cmca of the orthorhombic system with isolated MSe4 (M = Al, Ga) tetrahedra separated by Ba atoms. The optical band gap of 2.51(2) eV for Ba5Ga2Se8 was deduced from the diffuse reflectance spectrum. Band structure calculation indicates that Ba5Ga2Se8 is a direct-gap semiconductor. The valence band maximum is dominated by Se 4p orbitals, while the Ba 5d orbitals have the largest contribution to bottom of the conduction band.

  8. Electrical properties of In2Se3 single crystals and photosensitivity of Al/In2Se3 Schottky barriers

    International Nuclear Information System (INIS)

    In2Se3 single crystals ∼40 mm long and 14 mm in diameter were grown by the Bridgman method. The composition of grown single crystals and their crystal structure were determined. The conductivity (σ) and Hall constant (R) of grown single crystals were measured and the first Schottky barriers Al/n-In2Se3 were fabricated. Rectification and photovoltaic effect were detected in the new structures. Based on the study of the photosensitivity spectra of Al/n-In2Se3 structures, the nature of the interband transitions and band gap of In2Se3 crystals were determined. It was concluded that the new structures can be applied to develop broadband photoconverters of optical radiation.

  9. Introducción al procesado digital de señal: un enfoque práctico

    OpenAIRE

    Ortiz Zaragoza, Francisco José; Jiménez Carvajal, María Concepción; Jiménez Martínez, Jacinto María; Iborra García, Andrés José

    2002-01-01

    Esta comunicación presenta la metodología seguida con las prácticas de la asignatura de Procesado digital de Señal de tercer curso de Ingeniería Técnica Industrial. Dicha asignatura está enfocada de forma eminentemente práctica, orientando las charlas teóricas hacia las prácticas de laboratorio, en las que se emplea hardware específico para procesado en tiempo real. Especial atención se ha dedicado al filtrado. Se muestran las tareas que hay que realizar y los resultados obtenidos en di...

  10. Comportamiento de la señal del metilenodioxi en la secuencia de pulsos DEPT

    OpenAIRE

    Juan C. Martínez V.

    2010-01-01

    En los espectros de RMN 13C, tomados con la secuencia de pulsos DEPT, el grupo metilenodioxi tiene un comportamiento diferente al de otros grupos CH2 , por lo cual se estudio la variación de las intensidades de su señal en función del ángulo de irradiación 0.

  11. Photoelectric phenomena in the Cu (Al, In)/p-CuIn3Se5 Schottky barriers

    International Nuclear Information System (INIS)

    Structures are formed on the p-CuIn3Se5 crystals and photoelectric phenomena in the Cu/p-CuIn3Se5, Al/p-CuIn3Se5, and In/p-CuIn3Se5 Schottky barriers are studied. The spectra of quantum efficiency for photoconversion in new structures were obtained for the first time. The characteristics of the interband transitions are discussed, and the CuIn3Se5 band gap is determined. It is concluded that CuIn3Se5 crystals can be used in the fabrication of high-efficiency broadband photoconverters of optical radiation

  12. Growth and properties of CuAlSe{sub 2} single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Bodnar, I.V. [Belarussian State Univ., Minsk (Belarus)

    1994-09-01

    The compound CuAlSe{sub 2} is one of the A{sup I}B{sup III}C{sup VI}{sub 2} ternary compounds that crystallize in the chalcopyrite structure (sp. gr. D{sup 12}{sub 2d} - I{bar 4}2m). Given that CuAlSe{sub 2} exhibits birefringence and an optical isotropy point (the intersection point of the dispersion curves for ordinary n{sub o} and extraordinary n{sub e} indices), it is considered as a promising material for producing electro-optic choppers and narrow-band visible/near-IR filters. Up to now, there have been no reports on growth of high-quality CuAlSe{sub 2} single crystals by the Bridgman technique. Therefore, the purpose of this work was to grow high-quality crystals of CuAlSe{sub 2} and to study their properties.

  13. Structural, photoelectrical characterization of Cu(InAl)Se2 thin films and the fabrication of Cu(InAl)Se2 based solar cells

    Science.gov (United States)

    Kavitha, B.; Dhanam, M.

    2013-01-01

    Films of Cu(InAl)Se2 were deposited onto glass substrates by SILAR (successive ionic layer adsorption and reaction) method. All the deposited films were found to be polycrystalline in nature exhibiting the chalcopyrite structure with the crystallite orientation along (112), (220/204) and (116/312) directions. The photocurrent was found to increase with increase in film thickness and also with increase of light intensity. Photocurrent spectra showed a peak related to the band-to-band transition. The spectral response of Cu(InAl)Se2 thin films was studied by allowing the radiation to pass through a series of interference filters in the wavelength range 300 to 1200 nm. Films of higher thickness exhibited higher photosensitivity while lower thickness films exhibited moderate photosensitivity. Cu(InAl)Se2-based solar cells with different types of buffer layers such as CdS, CdS:Cu, CdS:In were fabricated. The current and voltage were measured using an optical power meter and an electrometer and the fabricated solar cells were illuminated using 100 mW/cm2 white light under AM1 conditions.

  14. Aproximación al silencio elocuente de los enunciados: lo que se comunica y no se dice

    OpenAIRE

    Moya Pardo, Constanza

    2012-01-01

    El estudio del silencio muestra otras posibilidades de interacción humana que se creían excluidas al callar. Esta dimensión lacónica del lenguaje posibilita una fenomenología de las formas de expresión que incorpora el mundo de lo implícito y supera el privilegio que ejerce la palabra verbal-explícita en nuestros procesos de comunicación. Muchos de los enunciados de la lengua ocultan otros que les dan sentido. Además de aparecer como privación verbal, como ausencia de habla o artificio de la ...

  15. Electronic structure and soft magnetic properties of Se/FeSiAl (110) films

    Science.gov (United States)

    Schwindt, V. Cardoso; Ardenghi, J. S.; Bechthold, P.; Juan, A.; Batic, B. Setina; Jenko, M.; González, E. A.; Jasen, P. V.

    2015-11-01

    The Se adsorption at different coverages on DO3 FeSiAl(110) surface is studied using density functional theory (DFT). Se adsorption is favorable in almost all surface high-symmetry sites, except for the bridge site formed by Fe-Si atoms. The most stable is a hollow site formed by four Fe atoms with adsorption energy of -5.30 eV. When the coverages increase, the energies decrease in the case of hollow sites. The surface present a reconstruction after Se adsorption, being the most important at 1/2 ML. The local magnetic moment for Fe atoms increase for the type A (all nearst neighbours (nn) are Fe atoms) and decrease for the type B (nn are Fe, Si and Al atoms). The most affected metal orbitals are Fe 4s and 4p. In the case of the hollow site the surface Fe-Fe bond is weakened after Se adsorption. A Fe-Se bond is developed at all coverages in both sites being the most important on top (dFe-Se = 2.23 Å, OP: 0.774 at 1/4 ML). The first and second layer Fe-Fe bond increase at 1/4 ML and decrease at 1/2 and 1 ML. Small Se-Se bonding interaction appear at 1/2 ML and increase noticeable for 1 ML. For the top site, the Se-Se bond appears at all coverage. The Fe-Fe surface bonds also decrease its strength with respect to the clean surface at all coverage. The first and second layer Fe-Fe bond increase at all coverage.

  16. Influence of temperature on Al/p-CuInAlSe2 thin-film Schottky diodes

    Science.gov (United States)

    Parihar, Usha; Ray, Jaymin; Panchal, C. J.; Padha, Naresh

    2016-06-01

    Al/p-CuInAlSe2 Schottky diodes were fabricated using the optimized thin layers of CuInAlSe2 semiconductor. These diodes were used to study their temperature-dependent current-voltage (I-V) and capacitance-voltage (C-V) analysis over a wide range of 233-353 K. Based on these measurements, diode parameters such as ideality factor ( η), barrier height (ϕbo) and series resistance ( R s) were determined from the downward curvature of I-V characteristics using Cheung and Cheung method. The extracted parameters were found to be strongly temperature dependent; ϕbo increases, while η and R s decrease with increasing temperature. This behavior of ϕbo and η with change in temperature has been explained on the basis of barrier inhomogeneities over the MS interface by assuming a Gaussian distribution (GD) of the ϕbo at the interface. GD of barrier height (BH) was confirmed from apparent BH (ϕap) versus q/2 kT plot, and the values of the mean BH and standard deviation (σs) obtained from this plot at zero bias were found to be 1.02 and 0.14 eV, respectively. Also, a modified ln ( {J_{{s}} /T2 } ) - q2 σ_{{s}}2 /2k2 T2 versus q/ kT plot for Al/p-CuInAlSe2 Schottky diodes according to the GD gives ϕbo and Richardson constant ( A ** ) as 1.01 eV and 26 Acm-2 K-2, respectively. The Richardson constant value of 26 Acm-2 K-2 is very close to the theoretical value of 30 Acm-2 K-2. The discrepancy between BHs obtained from I-V and C-V measurements has also been interpreted.

  17. Al andar se hace turismo: nuevas ruralidades en torno al Camino de Santiago

    Directory of Open Access Journals (Sweden)

    Carlos Montes Pérez

    2015-04-01

    Full Text Available Nuestro trabajo analiza las nuevas formas turísticas que han surgido en la comarca leonesa del Bierzo, en la provincia de León, y su relación con el Camino de Santiago. Desde la Edad Media el Camino de Santiago ha sido un lugar de tránsito y de peregrinación con un claro y principal sentido religioso. Sin embargo, desde los años noventa del pasado siglo, ha aumentado enormemente su conocimiento y difusión por otros países del mundo, con el consiguiente incremento de peregrinos y visitantes. Esta masiva presencia ha resignificado al propio camino y lo ha convertido en un fenómeno turístico decisivo para la vida de los lugares por donde transita. A través del análisis de una empresa turística proponemos la relación entre nuevos sentidos del camino y nuevas formas de turismo.

  18. Comparison of dielectric dispersion of Al2O3 and Se thin films

    International Nuclear Information System (INIS)

    We investigate the frequency and temperature dependence of the dielectric conductivity and dielectric constant of Al2O3 thin films having ionic structure and compare the results with those obtained for Se thin films having homopolar structure in the 0.1 - 100 kHz frequency range and in the 100 - 400 K temperature range. Our samples have a metal - insulator - metal configuration. Oxide-layer thickness ranges between 50 and 1550 Aa for Al2O3 films and 150 and 8500 Aa for Se films. The existence of a minimum in the imaginary part of dielectric constant versus frequency curves for each thickness of Al2O3 films leads us to conclude that two types of polarization mechanisms are dominant in different frequency regions, depending on the structure of Al2O3 samples, but that only one mechanism dominates in Se samples, which do not have such minima in the imaginary part of their dielectric constant versus frequency curves. [copyright] 2001 American Institute of Physics

  19. El sector exterior se debilita y aumenta su contribución negativa al crecimiento

    OpenAIRE

    Carrasco, Nicolás; ESPASA, Antoni; García, Agustín

    2002-01-01

    La economía internacional ha reducido el grado de incertidumbre tras la superación del conflicto bélico en Irak. No obstante, todavía no da señales de recuperación puesto que los problemas que presentaba con anterioridad al citado conflicto siguen latentes y los últimos resultados de los indicadores económicos muestran señales contradictorias que no avalan la consolidación de la recuperación. De hecho, las revisiones más recientes de las previsiones del crecimiento mundial para el actual ejer...

  20. Properties of Cu(In,Ga,Al)Se{sub 2} thin films fabricated by magnetron sputtering

    Energy Technology Data Exchange (ETDEWEB)

    Hameed, Talaat A. [Applied Research Center, Old Dominion University, Newport News, Virginia 23606 and Solid State Physics Laboratory, Physics Division, National Research Center, Dokki, Giza 12622 (Egypt); Cao, Wei [Applied Research Center, Old Dominion University, Newport News, Virginia 23606 (United States); Mansour, Bahiga A.; Elzawaway, Inas K. [Solid State Physics Laboratory, Physics Division, National Research Center, Dokki, Giza 12622 (Egypt); Abdelrazek, El-Metwally M. [Department of Physics, College of Science, Mansoura University, Mansoura, Dakhlia 35516 (Egypt); Elsayed-Ali, Hani E., E-mail: helsayed@odu.edu [Applied Research Center, Old Dominion University, Newport News, Virginia 23606 and Department of Electrical and Computer Engineering, Old Dominion University, Norfolk, Virginia 23529 (United States)

    2015-05-15

    Cu(In,Ga,Al)Se{sub 2} (CIGAS) thin films were studied as an alternative absorber layer material to Cu(In{sub x}Ga{sub 1−x})Se{sub 2}. CIGAS thin films with varying Al content were prepared by magnetron sputtering on Si(100) and soda-lime glass substrates at 350 °C, followed by postdeposition annealing at 520 °C for 5 h in vacuum. The film composition was measured by an electron probe microanalyzer while the elemental depth profiles were determined by secondary ion mass spectrometry. X-ray diffraction studies indicated that CIGAS films are single phase with chalcopyrite structure and that the (112) peak clearly shifts to higher 2θ values with increasing Al content. Scanning electron microscopy images revealed dense and well-defined grains, as well as sharp CIGAS/Si(100) interfaces for all films. Atomic force microscopy analysis indicated that the roughness of CIGAS films decreases with increasing Al content. The bandgap of CIGAS films was determined from the optical transmittance and reflectance spectra and was found to increase as Al content increased.

  1. Luxómetro medidor de enfoque para señal alta de lámpara de ferrocarril

    OpenAIRE

    Rodríguez García, Carlos

    2007-01-01

    Ante la complejidad para la correcta instalación y verificación de las Señales Altas de Lámpara para Ferrocarril. Nace un proyecto cuyo objetivo es medir la Iluminancia de los focos de las Señales Altas y calcular el enfoque correcto de la señal. Para ello se estudio el mejor sistema para determinar la verificación de un foco de Señal Alta. Se ha logrado diseñar y construir un Luxómetro capaz de medir el enfoque de la señal. Para llevar a cabo este fin, se ha diseña...

  2. Modelos contemporáneos de asistencia al parto: Cuerpos respetados, mujeres que se potencian

    Directory of Open Access Journals (Sweden)

    Natalia Magnone Alemán

    2013-08-01

    Full Text Available El artículo presentado estudia los modelos de atención contemporáneos al parto en Uruguay. Se nutre teóricamente de teoríassociológicassobre el riesgo, el cuerpo y la medicalización de la sociedad, de los modelos de atención a la salud humana definidos por la antropóloga David Floyd, y de perspectivas feministas sobre la sexualidad. Para su elaboración se toman entrevistas en profundidad y grupos de discusión realizados en el marco de la tesis de maestría en sociología de la autora. Sobre esta base se reflexiona en torno a las siguientes preguntas: ¿Qué concepciones de individuo y de cuerpo tienen los distintos modelos de atención al parto? ¿Qué prácticas obstétricasse establecen como consecuencia de estas concepciones? ¿Qué efectos tiene cada modo de atención sobre el respeto o no de los derechos humanos de las mujeres que paren?

  3. H2Se DOPING OF MOCVD GROWN GaAs AND GaAlAs

    OpenAIRE

    Glew, R.

    1982-01-01

    In the growth of epitaxial layers of GaAs and GaAlAs by the MOCVD process a superlinear relationship between the n-type doping and the H2Se mole fraction in the gas phase has been found. This superlinear effect has been observed both with atmospheric and reduced pressure depositions. The anomalous doping effect is compared to H2S doping where a linear doping relationship has been observed. The dopant incorporation mechanism for sulphur and selenium are different and the possible growth mechan...

  4. Growth and morphology of the CuGaS2, CuAlSe2, CuGaSe2, and CuInS2 ternary compounds

    International Nuclear Information System (INIS)

    Monocrystals of the ternary compounds CuGaS2, CuAlSe2, CuGaSe2, and CuInS2 were grown from their elements by transport reactions; their cell parameters and melting temperature were determined. The character of the phase transition in these compounds was found out and also the boundary conditions of growing the monocrystals as well as their dislocation structure (by etching). (author)

  5. Investigating the electronic properties of Al2O3/Cu(In,GaSe2 interface

    Directory of Open Access Journals (Sweden)

    R. Kotipalli

    2015-10-01

    Full Text Available Atomic layer deposited (ALD Al2O3 films on Cu(In,GaSe2 (CIGS surfaces have been demonstrated to exhibit excellent surface passivation properties, which is advantageous in reducing recombination losses at the rear metal contact of CIGS thin-film solar cells. Here, we report, for the first time, experimentally extracted electronic parameters, i.e. fixed charge density (Qf and interface-trap charge density (Dit, for as-deposited (AD and post-deposition annealed (PDA ALD Al2O3 films on CIGS surfaces using capacitance–voltage (C-V and conductance-frequency (G-f measurements. These results indicate that the AD films exhibit positive fixed charges Qf (approximately 1012 cm−2, whereas the PDA films exhibit a very high density of negative fixed charges Qf (approximately 1013 cm−2. The extracted Dit values, which reflect the extent of chemical passivation, were found to be in a similar range of order (approximately 1012 cm−2 eV−1 for both AD and PDA samples. The high density of negative Qf in the bulk of the PDA Al2O3 film exerts a strong Coulomb repulsive force on the underlying CIGS minority carriers (ns, preventing them to recombine at the CIGS/Al2O3 interface. Using experimentally extracted Qf and Dit values, SCAPS simulation results showed that the surface concentration of minority carriers (ns in the PDA films was approximately eight-orders of magnitude lower than in the AD films. The electrical characterization and estimations presented in this letter construct a comprehensive picture of the interfacial physics involved at the Al2O3/CIGS interface.

  6. Investigating the electronic properties of Al2O3/Cu(In,Ga)Se2 interface

    Science.gov (United States)

    Kotipalli, R.; Vermang, B.; Joel, J.; Rajkumar, R.; Edoff, M.; Flandre, D.

    2015-10-01

    Atomic layer deposited (ALD) Al2O3 films on Cu(In,Ga)Se2 (CIGS) surfaces have been demonstrated to exhibit excellent surface passivation properties, which is advantageous in reducing recombination losses at the rear metal contact of CIGS thin-film solar cells. Here, we report, for the first time, experimentally extracted electronic parameters, i.e. fixed charge density (Qf) and interface-trap charge density (Dit), for as-deposited (AD) and post-deposition annealed (PDA) ALD Al2O3 films on CIGS surfaces using capacitance-voltage (C-V) and conductance-frequency (G-f) measurements. These results indicate that the AD films exhibit positive fixed charges Qf (approximately 1012 cm-2), whereas the PDA films exhibit a very high density of negative fixed charges Qf (approximately 1013 cm-2). The extracted Dit values, which reflect the extent of chemical passivation, were found to be in a similar range of order (approximately 1012 cm-2 eV-1) for both AD and PDA samples. The high density of negative Qf in the bulk of the PDA Al2O3 film exerts a strong Coulomb repulsive force on the underlying CIGS minority carriers (ns), preventing them to recombine at the CIGS/Al2O3 interface. Using experimentally extracted Qf and Dit values, SCAPS simulation results showed that the surface concentration of minority carriers (ns) in the PDA films was approximately eight-orders of magnitude lower than in the AD films. The electrical characterization and estimations presented in this letter construct a comprehensive picture of the interfacial physics involved at the Al2O3/CIGS interface.

  7. Thermoelectric properties of CuAlCh2 (Ch = S, Se and Te)

    International Nuclear Information System (INIS)

    Electronic and thermoelectric properties of ternary chalcopyrite-type CuAlCh2 (S, Se and Te) were studied using the first principles density functional calculations implemented in the full potential linear augmented plane wave (FP-LAPW) method. The thermoelectric properties are calculated by solving the Boltzmann transport equation within the constant relaxation time approximation. The calculated band gap using the Tran-Blaha modified Becke-Johnson potential (TB-mBJ), of all the compounds are in good agreement with the available experiment and other theoretical reports. Thermoelectric properties like thermopower, electrical conductivity scaled by relaxation time are calculated as a function of carrier concentrations at different temperatures. The calculated thermoelectric properties are compared with the available experiment and other theoretical calculations of similar materials

  8. El movimiento de comida lenta se opone al de comida rápida

    Directory of Open Access Journals (Sweden)

    Agustín Morales Espinoza

    2013-09-01

    Full Text Available En 1986 Carlo Petrini fundó el movimiento Slow Food. Desde entonces, como presidente de la agrupación, ha demostrado ser un auténtico líder en el tema de la cultura gastronómica. En 1989 en una reunión celebrada en París, Slow Food adoptó como emblema al caracol y se convirtió en un movimiento internacional. La Slow Food o comida lenta surgió en oposición a la fast food (comida rápida y busca promover la educación del gusto, además pretende redescubrir los aromas y sabores de las cocinas regionales, pues considera que la alimentación es producto de la historia y de las tradiciones de los pueblos.

  9. El movimiento de comida lenta se opone al de comida rápida

    OpenAIRE

    Agustín Morales Espinoza

    2013-01-01

    En 1986 Carlo Petrini fundó el movimiento Slow Food. Desde entonces, como presidente de la agrupación, ha demostrado ser un auténtico líder en el tema de la cultura gastronómica. En 1989 en una reunión celebrada en París, Slow Food adoptó como emblema al caracol y se convirtió en un movimiento internacional. La Slow Food o comida lenta surgió en oposición a la fast food (comida rápida) y busca promover la educación del gusto, además pretende redescubrir los aromas y sabores de las cocinas reg...

  10. Thermoelectric properties of CuAlCh2 (Ch = S, Se and Te)

    Science.gov (United States)

    Gudelli, Vijay Kumar; Vaitheeswaran, G.; Kanchana, V.

    2015-06-01

    Electronic and thermoelectric properties of ternary chalcopyrite-type CuAlCh2 (S, Se and Te) were studied using the first principles density functional calculations implemented in the full potential linear augmented plane wave (FP-LAPW) method. The thermoelectric properties are calculated by solving the Boltzmann transport equation within the constant relaxation time approximation. The calculated band gap using the Tran-Blaha modified Becke-Johnson potential (TB-mBJ), of all the compounds are in good agreement with the available experiment and other theoretical reports. Thermoelectric properties like thermopower, electrical conductivity scaled by relaxation time are calculated as a function of carrier concentrations at different temperatures. The calculated thermoelectric properties are compared with the available experiment and other theoretical calculations of similar materials.

  11. Structural, morphological and optical studies on CuAlS{sub 2} and CuAlSe{sub 2} nanorods prepared by hydrothermal method

    Energy Technology Data Exchange (ETDEWEB)

    Sugan, S.; Baskar, K.; Dhanasekaran, R., E-mail: rdcgc@yahoo.com

    2015-10-05

    Highlights: • CuAlS{sub 2} and CuAlSe{sub 2} nanorods were synthesized by hydrothermal method. • Reaction time enhances the quality of the nanoparticles. • The influence of reaction time was discussed in detail. • Optical properties of nanorods have been studied using PL and Raman spectra. • The reduction in the size of the nanorods enhances the optical band gap. - Abstract: Ternary chalcopyrite CuAlS{sub 2} and CuAlSe{sub 2} nanorods have been successfully synthesized through hydrothermal method at 180 °C and their structure of prepared samples was investigated by X-ray diffraction pattern (XRD), scanning electron microscopy (SEM) and high resolution transmission electron microscopy (HR-TEM). The structural, optical and morphology of the samples are found to depend on synthesizing time and temperature. HR-TEM analysis indicates that the rods like morphology were nearly homogeneous with average dimensions of about 273 nm, 124 nm in length and 24 nm, 21 nm in diameter for CuAlS{sub 2} and CuAlSe{sub 2} respectively. Vibrational modes of CuAlS{sub 2} and CuAlSe{sub 2} nanorods have been investigated by recording micro Raman spectra at room temperature. Optical properties of the synthesized samples were studied using photoluminescence (PL) spectra with excitation of 244 nm at room temperature. The PL spectra show two emission peaks for CuAlS{sub 2} at 307 nm (4.03 eV) and 359 nm (3.45 eV). CuAlSe{sub 2} gives a prominent emission peak at 436 nm (2.84 eV)

  12. Structural, morphological and optical studies on CuAlS2 and CuAlSe2 nanorods prepared by hydrothermal method

    International Nuclear Information System (INIS)

    Highlights: • CuAlS2 and CuAlSe2 nanorods were synthesized by hydrothermal method. • Reaction time enhances the quality of the nanoparticles. • The influence of reaction time was discussed in detail. • Optical properties of nanorods have been studied using PL and Raman spectra. • The reduction in the size of the nanorods enhances the optical band gap. - Abstract: Ternary chalcopyrite CuAlS2 and CuAlSe2 nanorods have been successfully synthesized through hydrothermal method at 180 °C and their structure of prepared samples was investigated by X-ray diffraction pattern (XRD), scanning electron microscopy (SEM) and high resolution transmission electron microscopy (HR-TEM). The structural, optical and morphology of the samples are found to depend on synthesizing time and temperature. HR-TEM analysis indicates that the rods like morphology were nearly homogeneous with average dimensions of about 273 nm, 124 nm in length and 24 nm, 21 nm in diameter for CuAlS2 and CuAlSe2 respectively. Vibrational modes of CuAlS2 and CuAlSe2 nanorods have been investigated by recording micro Raman spectra at room temperature. Optical properties of the synthesized samples were studied using photoluminescence (PL) spectra with excitation of 244 nm at room temperature. The PL spectra show two emission peaks for CuAlS2 at 307 nm (4.03 eV) and 359 nm (3.45 eV). CuAlSe2 gives a prominent emission peak at 436 nm (2.84 eV)

  13. Generalized stacking fault energies, cleavage energies, ionicity and brittleness of Cu(Al/Ga/In)Se2 and CuGa(S/Se/Te)2

    International Nuclear Information System (INIS)

    We calculate the generalized stacking fault (GSF) energies and cleavage energies γcl of the chalcopyrite compounds CuAlSe2, CuGaSe2, CuInSe2, CuGaS2 and CuGaTe2 using first principles. From the GSF energies, we obtain the unstable stacking fault energies γus and intrinsic stacking fault energies γisf. By analyzing γus and γisf, we find that the 〈 1-bar 1 0〉 (1 1 2) direction is the easiest slip direction for these five compounds. Also, for CuInSe2, it is most possible to undergo a dislocation-nucleation-induced plastic deformation along the 〈 1-bar 1 0〉 (1 1 2) slip direction. We show that the (1 1 2) plane is the preferable plane for fracture in the five compounds by comparing γcl of the (0 0 1) and (1 1 2) planes. It is also found that both γus and γcl decrease as the cationic or anionic radius increases in these chalcopyrites, i.e. along the sequences CuAlSe2 → CuGaSe2 → CuInSe2 and CuGaS2 → CuGaSe2 → CuGaTe2. Based on the values of the ratio γcl/γus, we discuss the brittle–ductile properties of these compounds. All of the compounds can be considered as brittle materials. In addition, a strong relationship between γcl/γus and the total proportion of ionic bonding in these compounds is found. (paper)

  14. Estudio comparativo de algoritmos para la segmentación de la señal del electrocardiograma

    OpenAIRE

    Beraza Azurmendi, Idoia

    2012-01-01

    Evaluar los diferentes métodos de segmentación de las señales de electrocardiograma (ECG) que permitan la detección automática de los diferentes puntos característicos que conforman la señal. En la actualidad se han desarrollado diversos métodos de segmentación automática de la señal de ECG. En este trabajo se pretende estudiar, evaluar y comparar los diferentes métodos de segmentación existentes en la literatura. Esto permitirá la comprensión de los usos y limitaciones de las técnicas existe...

  15. Structure, tribological and electrochemical properties of low friction TiAlSiCN/MoSeC coatings

    Energy Technology Data Exchange (ETDEWEB)

    Bondarev, A.V.; Kiryukhantsev-Korneev, Ph.V.; Sheveyko, A.N.; Shtansky, D.V., E-mail: shtansky@shs.misis.ru

    2015-02-01

    Highlights: • TiAlSiCN/MoSeC coatings for tribological applications. • Doping with MoSeC reduces friction coefficient in humid air from 0.8–0.9 to 0.05. • Doping with MoSeC increases wear resistance by one-two orders of magnitude. • TiAlSiCN/MoSeC coatings demonstrated low friction coefficient in distilled water. • TiAlSiCN/MoSeC coatings showed superior tribological properties at moderate temperatures. - Abstract: The present paper is focused on the development of hard tribological coatings with low friction coefficient (CoF) in different environments (humid air, distilled water) and at elevated temperatures. TiAlSiCN/MoSeC coatings were deposited by magnetron sputtering of four-segment targets consisting of quarter circle TiAlSiCN segments, obtained by self-propagating high-temperature synthesis, and one or two cold pressed segments made of MoSe{sub 2} and C powders in a ratio 1:1 wt%. The structure and phase composition of coatings were investigated by means of X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy, and Raman spectroscopy. The coatings were characterized in terms of their hardness, elastic modulus, and elastic recovery. The tribological properties of coatings were investigated first at room temperature against Al{sub 2}O{sub 3} and WC–Co balls, after which studied in distilled water and during continuous heating in air in the temperature range of 25–400 °C against Al{sub 2}O{sub 3} counterpart material. To evaluate their electrochemical characteristics, the coatings were tested in 1 N H{sub 2}SO{sub 4} solution. The obtained results show that the coating hardness depends on the amount of MoSeC additives and decreased from 40 to 28 (one MoSeC segment) and 12 GPa (two MoSeC segments). Doping with MoSeC resulted in a significant reduction of CoF values measured in humid air (RH 60 ± 5%) from 0.8–0.9 to 0.05 and an increase of wear resistance by one or two orders of magnitude depending on

  16. APROXIMACIÓN AL SILENCIO ELOCUENTE DE LOS ENUNCIADOS: LO QUE SE COMUNICA Y NO SE DICE: WHAT IS COMMUNICATED BUT NOT SAID

    OpenAIRE

    Constanza Moya Pardo

    2012-01-01

    El estudio del silencio muestra otras posibilidades de interacción humana que se creían excluidas al callar. Esta dimensión lacónica del lenguaje posibilita una fenomenología de las formas de expresión que incorpora el mundo de lo implícito y supera el privilegio que ejerce la palabra verbal-explícita en nuestros procesos de comunicación. Muchos de los enunciados de la lengua ocultan otros que les dan sentido. Además de aparecer como privación verbal, como ausencia de habla o artificio de la ...

  17. Novedades acerca del mecanismo de reconocimiento y transducción de la señal brasinoesteroide

    OpenAIRE

    Danahe Mariela Coll García

    2006-01-01

    Los péptidos señal de bajo peso y las hormonas esteroides constituyen el grupo de moléculas que median la comunicación célula-célula y que controlan, tanto en plantas como en animales, diversos procesos relacionados con el crecimiento. En las plantas, las hormonas esteroides están representados por los llamados brasinoesteroides (BR) que se derivan de los esteroles polihidroxilados y aparecen en muy bajas concentraciones dentro de los individuos a todo lo largo del reino vegetal. Los fenotipo...

  18. Sexualidad, afectividad y síndrome de Down: (I) Se hace camino al andar

    OpenAIRE

    García, José Luis

    2005-01-01

    Se presentan algunas de las preocupaciones con las que suelen encontrarse las familias y los profesionales en torno a la educación de la sexualidad y afectividad de las personas con síndrome de Down.

  19. Growth of Cu(In,Al)(Se,S)2 thin films by selenization and sulfurization for a wide bandgap absorber

    International Nuclear Information System (INIS)

    Full text : Chalcopyrite structure Cu(In1.xAlx)(SySe1-y)2 (CIASS) alloys are attracting attention as promising candidates for the light-absorbing medium of high conversion efficiency, low cost, and lightweight solar cells. In addition, according to the wide variation in the bandgap energy (1.0-3.5eV), multiple-junction or tandem solar cells able to be fabricated using CIASS films of different compositions, x and y. In fact, several research groups have recently fabricated Cu(In,Al)Se2-based solar cells, and a high μ of 16.9 percent has been demonstrated. The sulfurization following selenization of Cu(In,Ga)Se2 (CIGS) films is believed to be promising for bandgap engineering of absorber material. Furthermore, it has been reported that the controlled incorporation of sulfur into CIGS films reduces the carrier recombination in the space charge region due to the deep trap states. Therefore, the sulfurization following selenization is expected to be used as a method of growth of CIASS films. However, sulfurization condition following selenization for obtaining CIASS films has not been clarified. The crystal growth of CIASS must be studied for solar cell applications. In this study, the advantages of using sulfurization for the growth of CIASS will be presented. Cu-In-Al precursors were selenized using diethylselenide (DESe) at 515-570 degrees Celsium for 60- 90 min under atmospheric pressure. The flow rates of DESe and N2 carrier gases were 35 imol/min and 2 L/min, respectively. The films were then sulfurized at 550 degrees Celsium using S vapor. These films were characterized by SEM, EDX, XRD, and PL measurements. Using the selenization and sulfurization technique, polycrystalline Cu(In,Al)Se2, CuIn(Se,S)2, CuInS2 films with thickness of approximately 2.0 im were formed without additional annealing. The films adhered well to the Mo/SLG substrate, which was confirmed by the peeling test. Phase separations, i.e. distinct peaks corresponding to CuInSe2, CuAlSe2 CuInS2

  20. APROXIMACIÓN AL SILENCIO ELOCUENTE DE LOS ENUNCIADOS: LO QUE SE COMUNICA Y NO SE DICE: WHAT IS COMMUNICATED BUT NOT SAID

    Directory of Open Access Journals (Sweden)

    Constanza Moya Pardo

    2012-06-01

    Full Text Available El estudio del silencio muestra otras posibilidades de interacción humana que se creían excluidas al callar. Esta dimensión lacónica del lenguaje posibilita una fenomenología de las formas de expresión que incorpora el mundo de lo implícito y supera el privilegio que ejerce la palabra verbal-explícita en nuestros procesos de comunicación. Muchos de los enunciados de la lengua ocultan otros que les dan sentido. Además de aparecer como privación verbal, como ausencia de habla o artificio de la economía lingüística, el silencio es una manera de pensar y de comunicar. Es el saber compartido, el mundo implícito de los hablantes. Este juego de silencios, mediante el cual transmitimos pensamientos e intenciones sin necesidad de enunciarlos directamente, es posible gracias a habilidades cognitivas de conexión e inferencia, y al conjunto de supuestos compartidos por los miembros que pertenecen a una misma comunidad pragmática y que dominan las reglas de esa gramática del silencio.

  1. Técnicas de bajo coste computacional para el reconocimiento de patrones de activación en la señal de EMG superficial

    OpenAIRE

    Roca González, Joaquín Francisco; Jiménez Martínez, Jacinto María; Conesa, M.; Roca Dorda, Joaquín; Vera Repullo, José Alfonso; Jiménez Buendía, Manuel

    2001-01-01

    Se presenta un sistema dedicado al reconocimiento de patrones de actividad, en la señal del EMG superficial, destinado a proporcionar un nuevo canal de comunicación capaz de comandar prótesis y ayudas técnicas para el acceso al ordenador. El motor de reconocimiento utilizado, ha sido derivado de un algoritmo ampliamente experimentado en el campo del habla, basandose en la detección de formantes, adaptándolo a la naturaleza de la señal de EMGS y a las características del microcontrolador respo...

  2. Novedades acerca del mecanismo de reconocimiento y transducción de la señal brasinoesteroide

    Directory of Open Access Journals (Sweden)

    Danahe Mariela Coll García

    2006-01-01

    Full Text Available Los péptidos señal de bajo peso y las hormonas esteroides constituyen el grupo de moléculas que median la comunicación célula-célula y que controlan, tanto en plantas como en animales, diversos procesos relacionados con el crecimiento. En las plantas, las hormonas esteroides están representados por los llamados brasinoesteroides (BR que se derivan de los esteroles polihidroxilados y aparecen en muy bajas concentraciones dentro de los individuos a todo lo largo del reino vegetal. Los fenotipos característicos de los mutantes de biosíntesis e insensibles de brasinoesteroides han confirmado que estas fitohormonas son esenciales para el normal alargamiento de la célula, así como sugieren un importante papel en la formación de tejido vascular, control de la senescencia, la fertilidad y la morfología de la hoja. Actualmente, las principales investigaciones en el campo de los BR están dirigidas a estudios del mecanismo de reconocimiento y transducción de su señal dentro de la célula. Los últimos tres años han sido decisivos para la dilucidación de este mecanismo demostrando que está muy conservado dentro de las plantas y difiere ampliamente de la cascada de señalización de esteroides en los animales. Estudios genéticos recientes han permitido identificar algunos de los componentes moleculares ubicados en la cascada de señalizaci ón de BR. Sobre esta base, se trabaja en el modelo de cascada de señalización que propone una activación del complejo receptor compuesto por dos proteínas kinasas de membrana y que mediante su heterodimerización, inhiben una tercera kinasa citoplasmática del tipo GSK3, permitiendo la acumulación en el núcleo de dos proteínas independientes que están relacionadas directa o indirectamente con la activación de la expresión de genes de respuesta a brasinoesteroides. Otro aspecto importante que centra la atención de los investigadores de este mecanismo es el hecho de la función dual que tiene

  3. La sobreexpresión de RAC3 es una señal transformante y proliferativa que contribuye al desarrollo tumoral

    Directory of Open Access Journals (Sweden)

    Cecilia V. Alvarado

    2011-02-01

    Full Text Available RAC3 fue caracterizado originalmente como un coactivador de receptores nucleares que se encuentra en cantidades limitantes en células normales, aunque sobreexpresado en tumores y es además coactivador de NF-?B. Si bien se desconocen los mecanismos involucrados en el aumento de su expresión, se sabe que induce resistencia a apoptosis. En este trabajo se investigó si RAC3 podría contribuir al desarrollo tumoral por otros mecanismos y si la citoquina TNF-a, que se encuentra en alto título en pacientes con cáncer, podría favorecer el aumento en la expresión de RAC3. Se observó que el aumento en la expresión del coactivador por transfección de células no tumorales de riñón embrionario humano HEK293 no solo aumenta significativamente la proliferación en presencia de suero, sino además en ausencia de factores de crecimiento. También se indujo la transformación celular dando un fenotipo con crecimiento independiente de anclaje similar a lo observado para células tumorales. El tratamiento de las células HEK293 en cultivo con TNF-a indujo un aumento en los niveles proteicos de RAC3 respecto de las células sin estímulo y este efecto fue inhibido por pretratamiento con un inhibidor específico de la activación de NF-?B, indicando que la activación de este factor de transcripción está involucrada en la acción de la citoquina. Se concluye que RAC3, además de su acción anti-apoptótica, es un factor transformante que promueve la proliferación y el crecimiento independiente de anclaje, cuyos niveles podrían ser aumentados en la tumorigénesis, probablemente vía las citoquinas inflamatorias involucradas en la respuesta anti-tumoral.

  4. Optical properties of SnO2-As2Se3-ZnS(Mn, Cu-Al structure with intermediate chalcogenide-glass layer

    Directory of Open Access Journals (Sweden)

    N.Mateleshko

    2003-09-01

    Full Text Available Introducing of As2Se3 as a contrasting intermediate layer into SnO2-As2Se3-ZnS(Mn, Cu-Al structure allows one to increase 1.5 times the light contrast range of the device that facilitates the perception of symbol-alphabetic information. The bleaching of As2Se3 film under the action of moisture allows to control the state of the structure air-tightness. The absorption edge of As-Se film and the electrooptical characteristics of SnO2-ZnS(Mn, Cu-Al active structure are investigated.

  5. Distribution of Be, Al, Se and Bi in the surface waters of the western North Atlantic and Caribbean

    Science.gov (United States)

    Measures, C. I.; Grant, B.; Khadem, M.; Lee, D. S.; Edmond, J. M.

    1984-11-01

    The mixed layer distributions of several trace elements have been determined along a detailed transect from Rhode Island to the Panama Canal. When taken together with a new and existing profile data from the North Atlantic and North Pacific, some general inferences emerge as to the processes controlling their concentrations in the surface waters. The large enrichments in Be observed in the upper waters of the North Atlantic relative to the North Pacific appear to be sustained mainly by fluvial inputs. Those of Se are derived from atmospheric transport. Aluminium and Bi also appear to have an aeolian source in the Sargasso Sea. However, in the tropical eastern Pacific, the Al input may be fluvial On this cruise, Be, Al and the Se species were analyzed on board ship within a few hours of collection. The demonstration that this is feasible opens up the prospect of the application of large-scale chemical hydrography to the study of the processes controlling the distribution and water column variability of trace elements in the oceans.

  6. Crystal structure of the quaternary compounds CuFe2AlSe4 and CuFe2GaSe4 from X-ray powder diffraction

    Indian Academy of Sciences (India)

    G E Delgado; A J Mora; P Grima-Gallardo; M Muñoz; S Durán; M Quintero; J M Briceño

    2015-08-01

    The crystal structure of the quaternary compounds CuFe2AlSe4 and CuFe2GaSe4, belonging to the system I–II2–III–VI4, were characterized using X-ray powder diffraction data. Both compounds crystallize in the tetragonal space group I42m (No. 121), = 2, with unit cell parameters = 5.609(1) Å, = 10.963(2) Å for CuFe2AlSe4 and = 5.6165(3) Å, = 11.075(1) Å for CuFe2GaSe4. These compounds are isostructural with CuFe2InSe4, and have a normal adamantane stannite structure.

  7. Physical Design and Dynamical Analysis of Resonant-Antiresonant Ag/MgO/GaSe/Al Optoelectronic Microwave Devices

    Science.gov (United States)

    Kmail, Renal R. N.; Qasrawi, A. F.

    2015-11-01

    In this work, the design and optical and electrical properties of MgO/GaSe heterojunction devices are reported and discussed. The device was designed using 0.4- μm-thick n-type GaSe as substrate for a 1.6- μm-thick p-type MgO optoelectronic window. The device was characterized by means of ultraviolet-visible optical spectrophotometry in the wavelength region from 200 nm to 1100 nm, current-voltage ( I- V) characteristics, impedance spectroscopy in the range from 1.0 MHz to 1.8 GHz, and microwave amplitude spectroscopy in the frequency range from 1.0 MHz to 3.0 GHz. Optical analysis of the MgO/GaSe heterojunction revealed enhanced absorbing ability of the GaSe below 2.90 eV with an energy bandgap shift from 2.10 eV for the GaSe substrate to 1.90 eV for the heterojunction design. On the other hand, analysis of I- V characteristics revealed a tunneling-type device conducting current by electric field-assisted tunneling of charged particles through a barrier with height of 0.81 eV and depletion region width of 670 nm and 116 nm when forward and reverse biased, respectively. Very interesting features of the device are observed when subjected to alternating current (ac) signal analysis. In particular, the device exhibited resonance-antiresonance behavior and negative capacitance characteristics near 1.0 GHz. The device quality factor was ˜102. In addition, when a small ac signal of Bluetooth amplitude (0.0 dBm) was imposed between the device terminals, the power spectra of the device displayed tunable band-stop filter characteristics with maximum notch frequency of 1.6 GHz. The energy bandgap discontinuity, the resonance-antiresonance behavior, the negative capacitance features, and the tunability of the electromagnetic power spectra at microwave frequencies nominate the Ag/MgO/GaSe/Al device as a promising optoelectronic device for use in multipurpose operations at microwave frequencies.

  8. Structural phase transition, elastic properties and electronic properties of chalcopyrite CuAlX{sub 2} (X = S, Se, Te)

    Energy Technology Data Exchange (ETDEWEB)

    Abdellaoui, A., E-mail: aekabdellaoui@yahoo.f [Laboratoire Materiaux (LABMAT) ENSET d' Oran, BP 1523 Oran Mnaouar, Oran (Algeria); Ghaffour, M.; Bouslama, M. [Laboratoire Materiaux (LABMAT) ENSET d' Oran, BP 1523 Oran Mnaouar, Oran (Algeria); Benalia, S. [Laboratoire des Materiaux Magnetiques, Departement de Physique, Faculte des Sciences, Universite Djillali LIABES, Sidi-Bel-Abbes 22000 (Algeria); Ouerdane, A. [Laboratoire Materiaux (LABMAT) ENSET d' Oran, BP 1523 Oran Mnaouar, Oran (Algeria); Abidri, B. [Laboratoire des Materiaux Magnetiques, Departement de Physique, Faculte des Sciences, Universite Djillali LIABES, Sidi-Bel-Abbes 22000 (Algeria); Monteil, Y. [Laboratoire des Multimateriaux et Interfaces, Universite Claude Bernard Lyon 1, 43 Bd du 11 Novembre 1918, Villeurbanne 69622 (France)

    2009-11-13

    The density functional theory calculations of structural phase transition, elastic constants and electronic structure of the CuAlX{sub 2} (X = S, Se, Te) have been reported using the full potential linear muffin-tin orbital (FP-LMTO). In this approach, the local density approximation is used for the exchange-correlation potential. Results are given for lattice constant, bulk modulus, and its pressure derivative, band structure, density of states and pressure dependence of energy gaps. We note that these compounds are semiconductors with direct energy gaps. The valence-band maximum and conduction-band minimum are located at {Gamma}. Our results are compared with previous theoretical calculations and experimental data. The elastic constants at equilibrium in BCT structure are also determined.

  9. Comentarios al dossier“¿Cómo se piensa lo ‘queer’ en América Latina”?

    Directory of Open Access Journals (Sweden)

    Edgar Vega Suriaga

    2011-05-01

    Full Text Available A partir del dossier de Íconos, 39, ¿Cómo se piensa lo ‘queer’ en América Latina?, este artículo trabajasobre los puntos centrales y las interrogantes que dan de sí cada uno de los artículos que locomponen. Destaca la crítica a la masculinidad hegemónica desde una noción de la alteridad enla que convergen las categorías de clase, etnia, género y edad. A medida que reflexiona sobre estospuntos, repasa cada uno de los artículos contextualizándolos en la crítica radical al sistema heteronormativo.

  10. Caracterización de una señal ECG mediante un análisis automático

    OpenAIRE

    Sáenz de Pipaón Cilveti, Edurne

    2012-01-01

    En el mundo las enfermedades cardiovasculares causan 17,5 millones de muertes al año. En España representan la primera causa de mortalidad, provocando al año 122.000 defunciones. Por tanto, se observa la importancia de avanzar en los conocimientos acerca del análisis del ECG, debido a que las alteraciones en el funcionamiento del corazón se reflejan en modificaciones del mismo. El objetivo de este trabajo es diseñar una aplicación que realice un análisis temporal de una seña...

  11. Mejora de la Señal de Flujo Sanguíneo en Implantes Coronarios Mediante la Detección de Distorsiones Eventuales

    OpenAIRE

    D. Torres Guzmán; C.S. Carbajal Fernández

    2015-01-01

    Se presenta un método para el procesamiento de señales en aplicaciones médicas que utilizan técnicas de diagnóstico basadas en ultrasonido Doppler. El método está orientado a obtener una mejor representación de la señal de flujo sanguíneo, a partir de la identificación y exclusión de los ciclos, de dicha señal, que se encuentran afectados por distorsiones eventuales. Esto permite, de manera robusta y confiable, estimar parámetros y extraer información clínicamente útil con el objetivo de form...

  12. Modelado teórico y experimental de la transmisión de una señal FSK utilizando la técnica de modulación de coherencia luminosa

    OpenAIRE

    Morales Hernández, Omar Emmanuel

    2007-01-01

    En este trabajo se presentan las pruebas y resultados experimentales de dos arreglos propuestos, un interferómetro de polarización y otro de Michelson, basados en la modulación de coherencia luminosa, la cual utiliza a su vez una señal de prueba FSK. Se transmite una señal digital utilizando como portadora un haz de luz de baja coherencia, debido a que con este tipo de modulación se pueden transmitir señales de alta frecuencia y con muy pocas pérdidas de señal. Además, se...

  13. Adquisición y procesado de señales electroencefalográficas: aplicación al Biofeedback

    OpenAIRE

    Martínez Aguilar, Sergio

    2016-01-01

    El objeto del proyecto es el diseño de un amplificador EEG y la implementación de un sistema electro-encefalográfico para la captación de ritmos cerebrales y el procesado digital de las señales asociadas. Se empleará LabVIEW para adquirir y procesar la señal EEG y la tensión facial en tiempo real. Se ilustrarán los desarrollos realizados mediante aplicaciones de biofeedback.

  14. Structural, electronic and optical properties of AgXY{sub 2}(X = Al, Ga, In and Y = S, Se, Te)

    Energy Technology Data Exchange (ETDEWEB)

    Ullah, Saeed; Din, Haleem Ud [Materials Modeling Lab, Department of Physics, Islamia College University, Peshawar (Pakistan); Murtaza, G., E-mail: murtaza@icp.edu.pk [Materials Modeling Lab, Department of Physics, Islamia College University, Peshawar (Pakistan); Ouahrani, T. [Laboratoire de Physique Théorique, B.P. 119, Université de Tlemcen, Tlemcen 13000 (Algeria); Khenata, R., E-mail: khenata_rabah@yahoo.fr [Laboratoire de Physique Quantique et de Modélisation Mathématique, Université de Mascara, Mascara 29000 (Algeria); Naeemullah [Department of Physics, G.D.C. Darra Adam Khel, F.R. Kohat, KPK (Pakistan); Bin Omran, S. [Department of Physics and Astronomy, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451 (Saudi Arabia)

    2014-12-25

    Highlights: • The compounds are studied by FP-LAPW method within mBJ approximation. • All of the studied materials show isotropic behavior. • All the compounds show direct band gap nature. • Bonding nature is mostly covalent among the studied compounds. • High absorption peaks and reflectivity ensures there utility in optoelectronic devices. - Abstract: The structural, electronic and optical properties of the ternary semiconducting compounds AgXY{sub 2} (X = Al, Ga, In and Y = S, Se, Te) in Heusler and chalcopyrite crystal phases have been investigated using the density functional theory (DFT) based on the full potential linear augmented plane wave (FP-LAPW) method. The calculated lattice constant and band gap values for AgXY{sub 2} in chalcopyrite phase are in good agreement with the available experimental data. Band structure calculations are performed using modified Becke–Johnson (mBJ) method which match closely with experimental data and yield better band gaps rather than those obtained by using generalized gradient approximation (GGA) and Engel–Vosko generalized gradient approximation (EV–GGA). Decrease in band gap is observed by changing cations X and Y from the top to bottom of periodic table. Chemical bonding trends are predicted through charge density plots and quantified by Bader’s analysis. Optical properties reveal that these compounds are suitable candidates for optoelectronic devices in the visible and ultraviolet (UV) regions.

  15. Structural, electronic and optical properties of AgXY2(X = Al, Ga, In and Y = S, Se, Te)

    International Nuclear Information System (INIS)

    Highlights: • The compounds are studied by FP-LAPW method within mBJ approximation. • All of the studied materials show isotropic behavior. • All the compounds show direct band gap nature. • Bonding nature is mostly covalent among the studied compounds. • High absorption peaks and reflectivity ensures there utility in optoelectronic devices. - Abstract: The structural, electronic and optical properties of the ternary semiconducting compounds AgXY2 (X = Al, Ga, In and Y = S, Se, Te) in Heusler and chalcopyrite crystal phases have been investigated using the density functional theory (DFT) based on the full potential linear augmented plane wave (FP-LAPW) method. The calculated lattice constant and band gap values for AgXY2 in chalcopyrite phase are in good agreement with the available experimental data. Band structure calculations are performed using modified Becke–Johnson (mBJ) method which match closely with experimental data and yield better band gaps rather than those obtained by using generalized gradient approximation (GGA) and Engel–Vosko generalized gradient approximation (EV–GGA). Decrease in band gap is observed by changing cations X and Y from the top to bottom of periodic table. Chemical bonding trends are predicted through charge density plots and quantified by Bader’s analysis. Optical properties reveal that these compounds are suitable candidates for optoelectronic devices in the visible and ultraviolet (UV) regions

  16. Memoria explicativa del tipo de buque y servicio al que se destina : Proyecto número: 1.696 / LPG 7.000 m3

    OpenAIRE

    Millón del Valle, Raimundo; Pérez González, Rosa María

    2010-01-01

    Los buques LPG son los buques destinados al transporte de gases del petróleo licuado, tal y como indican sus siglas, pero además pueden llevar otro tipo de gases cuyas características son similares a las del anterior tipo de buque, en concreto todos los gases que se contemplan como IMO tipo C, que nos indica que el gas se transporta en recipientes convencionales a presión.

  17. Influence of substrate temperature on structural, electrical and optical properties of flash evaporated CuIn0.60Al0.40Se2 thin films

    International Nuclear Information System (INIS)

    CuIn0.60Al0.40Se2 thin films were grown by the flash evaporation method onto glass substrates held at temperatures in the range 303-623 K. The influence of substrate temperature on growth of the films was studied. The growth of the highly (111) oriented CuIn0.60Al0.40Se2 thin films was observed at TS=598 K exhibiting sphalerite structure. The surface morphology of CuIn0.60Al0.40Se2 films deposited at TS=623 K indicates segregation of Cu2-xSe binary phase. The electrical resistivity was around 66 Ωcm (300 nm) with p-type conductivity for the films deposited at 598 K. The temperature dependence of the electrical conductivity suggested that above 493 K the conduction mechanism was intrinsic, whereas extrinsic/impurity conduction dominated in the range 303-473 K. The single phase CuIn0.60Al0.40Se2 films showed an optical bandgap of 1.37 eV. (copyright 2009 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  18. Alótropos del carbono: experimentos de laboratorio que se hacen famosos años después

    Directory of Open Access Journals (Sweden)

    F. Rodríguez Reinoso

    2011-03-01

    Full Text Available Es destacable que el “descubrimiento” de los tres últimos alótropos del elemento carbono se haya producido en un intervalo de pocos años: fullerenos en 1985, nanotubos en 1991 y grafeno en 2004.

  19. Fabrication of Al/MgO/C and C/MgO/InSe/C tunneling barriers for tunable negative resistance and negative capacitance applications

    International Nuclear Information System (INIS)

    Highlights: • Aluminum and indium selenide thin films are used to design MgO tunneling diodes. • The Al/MgO/C and C/MgO/InSe/C tunneling diode structures are characterized. • The C/MgO/InSe/C device exhibited a peak to valley current ratio of 135. • It reflected negative resistance effect in the voltage range of 0.94–2.24. • A resonance peak located at 39 MHz was observed. -- Abstract: In this work, the design and characterization of magnesium oxide based tunneling diodes which are produced on Al and InSe films as rectifying substrates are investigated. It was found that when Al thin films are used, the device exhibit tunneling diode behavior of sharp valley at 0.15 V and peak to valley current ratio (PVCR) of 11.4. In addition, the capacitance spectra of the Al/MgO/C device show a resonance peak of negative capacitance (NC) values at 44.7 MHz. The capacitance and resistance–voltage characteristics handled at an ac signal frequency of 100 MHz reflected a build in voltage (Vbi) of 1.29 V and a negative resistance (NR) effect above 2.05 V. This device quality factor (Q)–voltage response is ∼104. When the Al substrate is replaced by InSe thin film, the tunneling diode valley appeared at 1.1 V. In addition, the PVCR, NR range, NC resonance peak, Q and Vbi are found to be 135, 0.94–2.24 and 39.0 MHz, ∼105 and 1.34 V, respectively. Due to the wide differential negative resistance and capacitance voltage ranges and due to the response of the C/MgO/InSe/C device at 1.0 GHz, these devices appear to be suitable for applications as frequency mixers, amplifiers, and monostable–bistable circuit elements (MOBILE)

  20. Barrier effect of AlN film in flexible Cu(In,Ga)Se2 solar cells on stainless steel foil and solar cell

    International Nuclear Information System (INIS)

    Highlights: • The adhension between AlN film and Mo are verygood. • AlN film can be effectively used as the barrier of flexible CIGS solar cell on SS substrate. • AlN film is suitable as the insulation barrier of flexible CIGS solar cell on SS substrate. - Abstract: The AlN film deposited by DC magnetron sputtering on stainless steel (SS) foils was used as the barrier in flexible Cu(In,Ga)Se2 (CIGS) solar cells on stainless steel foil and characterized comprehensively by X-ray diffraction (XRD), scanning electron microscopy (SEM), I–V, and QE measurements study. The study of AlN as insulation barrier in the flexible CIGS solar cell showed that the adhesion strength between the SS foil and the deposited AlN film was very strong even after annealing at high temperature at 530 °C. More importantly, a high resistance of over 10 MΩ was remained with the film with thickness of around 200 nm after annealing. This indicates that the AlN film is suitable as an effective insulation barrier in flexible CIGS solar cells based on SS foil. In addition, the XRD and SEM results showed that the AlN film did not influence the crystal structure of the Mo film which was deposited upon the AlN layer and used as the electrical contact in CIGS solar cells. It was found that the AlN film contributed to an improved crystallinity of the Mo contact layer compared to the bare SS foil. The combined results of secondary ion mass spectrometry, I–V and EQE measurements of the corresponding flexible CIGS solar cells confirmed that 1 μm-thick AlN film could be used as an efficient barrier layer in CIGS solar cells on SS foil

  1. Thermoelectric properties of n-type Bi2Te2.7Se0.3 with addition of nano-ZnO:Al particles

    International Nuclear Information System (INIS)

    Nano Al-doped ZnO (AZO) particles were added into n-type Bi2Te2.7Se0.3 alloys by ball milling and hot pressing method. The power factor was improved by ∼22% with addition of nano-AZO particles, accompanied with a ∼40% decrease of lattice thermal conductivity, leading to peak ZT of ∼0.85 at 323 K for Bi2Te2.7Se0.3(AZO)0.005 sample. The effects of the addition of AZO nanoparticles on the microstructure and thermoelectric transport properties are discussed. (paper)

  2. Herramienta multimedia de ayuda en la impartición de un laboratorio de procesadores digitales de señal (DSPs)

    OpenAIRE

    Federico José Barrero García; Sergio Gallardo Vázquez; Antonio Javier Lillo Moreno; Sergioi Luis Toral Marín

    2005-01-01

    El presente trabajo describe una aplicación multimedia realizada en el Departamento de Ingeniería Electrónica de la Escuela Superior de Ingenieros de Sevilla. La herramienta, un CD interactivo, se ha desarrollado con vistas a su empleo como laboratorio virtual y sistema de ayuda en la impartición de un laboratorio de Procesadores Digitales de Señal (DSPs). El uso de este CD agiliza el proceso de aprendizaje y/o entrenamiento de los estudiantes en la asignatura, fomentando la pa...

  3. Generación y evaluación on-chip de señales analógicas para aplicaciones bist de circuitos analógicos y de señal mixta

    OpenAIRE

    Barragán, Manuel J.

    2009-01-01

    En la actualidad, la rápida evolución de la capacidad de integración en tecnologías CMOS ha llevado a la industria de los circuitos integrados hacia sistemas complejos en los que coexisten bloques analógicos con componentes digitales [1]. Esto ha dado lugar a los, así llamados, SoCs (Sistemas on-chip, Systems on-Chip) en los que un sistema completo, compuesto de subsistemas analógicos, digitales y de señal mixta, es integrado sobre un mismo sustrato. Debido a este incremento en la complejidad...

  4. PERSPECTIVAS DE SUSTENTABILIDADE ECOLÓGICA DO TURISMO EM XINGÓ, SE/AL / TOURISM ECOLOGICAL SUSTAINABILITY PERSPECTIVES IN XINGÓ, SERGIPE AND ALAGOAS, BRAZIL

    OpenAIRE

    Cláudio Roberto Braghini; Laura Jane Gomes; Adauto Souza Ribeiro

    2009-01-01

    RESUMO A busca da sustentabilidade em várias dimensões implica olhar para o desenvolvimento local nos territórios em que o turismo ocorre. Este estudo analisou de forma sistêmica a relação entre turismo, gastronomia local e os recursos extraídos do rio São Francisco pela pesca artesanal, na região de Xingó, Nordeste do Brasil. A área de estudo abrangeu três municípios, Poço Redondo/SE, Canindé de São Francisco/SE e Piranhas/AL. Tratou-se de uma pesquisa exploratória, descritiva, intencional e...

  5. Dispersion of the linear and nonlinear optical susceptibilities of the CuAl(S{sub 1–x}Se{sub x})₂ mixed chaclcopyrite compounds

    Energy Technology Data Exchange (ETDEWEB)

    Reshak, A. H., E-mail: maalidph@yahoo.com [New Technologies - Research Centre, University of West Bohemia, Univerzitni 8, 306 14 Pilsen (Czech Republic); Center of Excellence Geopolymer and Green Technology, School of Material Engineering, University Malaysia Perlis, 01007 Kangar, Perlis (Malaysia); Brik, M. G. [College of Mathematics and Physics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Institute of Physics, University of Tartu, Ravila 14C, Tartu 50411 (Estonia); Auluck, S. [Council of Scientific and Industrial Research—National Physical Laboratory Dr. K S Krishnan Marg, New Delhi 110012 (India)

    2014-09-14

    Based on the electronic band structure, we have calculated the dispersion of the linear and nonlinear optical susceptibilities for the mixed CuAl(S{sub 1–x}Se{sub x})₂ chaclcopyrite compounds with x=0.0, 0.25, 0.5, 0.75, and 1.0. Calculations are performed within the Perdew-Becke-Ernzerhof general gradient approximation. The investigated compounds possess a direct band gap of about 2.2 eV (CuAlS₂), 1.9 eV (CuAl(S₀.₇₅Se₀.₂₅)₂), 1.7 eV (CuAl(S₀.₅Se₀.₅)₂), 1.5 eV (CuAl(S₀.₂₅Se₀.₇₅)₂), and 1.4 eV (CuAlSe₂) which tuned to make them optically active for the optoelectronics and photovoltaic applications. These results confirm that substituting S by Se causes significant band gaps' reduction. The optical function's dispersion ε₂{sup xx}(ω) and ε₂{sup zz}(ω)/ε₂{sup xx}(ω), ε₂{sup yy}(ω), and ε₂{sup zz}(ω) was calculated and discussed in detail. To demonstrate the effect of substituting S by Se on the complex second-order nonlinear optical susceptibility tensors, we performed detailed calculations for the complex second-order nonlinear optical susceptibility tensors, which show that the neat parents compounds CuAlS₂ and CuAlSe₂ exhibit | χ₁₂₂²}(-2ω;ω;ω) | as the dominant component, while the mixed alloys exhibit | χ₁₁₁²(-2ω;ω;ω) | as the dominant component. The features of | χ₁₂₃²}(-2ω;ω;ω) | and | χ{sub 111}²}(-2ω;ω;ω) | spectra were analyzed on the basis of the absorptive part of the corresponding dielectric function ε₂(ω) as a function of both ω/2 and ω.

  6. Nuevas técnicas de procesado de señal aplicadas al sistema MC-CDMA en enlace ascendente

    OpenAIRE

    Bader, Faouzi

    2002-01-01

    La presente tesis puede darnos una idea de la complejidad de la transmisión ascendente (UL) y su especificidad en comparación con el esquema descendente, también destacando el impacto que puede tener este modo de transmisión sobre el diseño de los receptores MC-CDMA. La verosimilitud de la detección en el modo ascendente en los sistemas MC-CDMA ha orientado las investigaciones internacionales a desarrollar otros esquemas de transmisión que son considerados más apropiados al modo ascendente co...

  7. La comunicación abreviada como señal de identidad de la juventud actual

    OpenAIRE

    Marín Montín, Joaquín

    2004-01-01

    Desde finales del pasado siglo, nuevas formas de comunicación han ido transformando numerosos hábitos de la sociedad. Una de las grandes diferencias entre los jóvenes actuales y los anteriores es que los de ahora han convivido con la tecnología desde que nacen. Han crecido en la denominada cultura o sociedad de la información, de la que se han familiarizado de forma rápida y casi intuitiva. Fruto de estos nuevos modos surge la comunicación abreviada. Nuevos metalenguajes, creados especialment...

  8. Una autobiografía al contrario : Walsh: El "autor de novelas policiales" que se transformó en "detective"

    OpenAIRE

    Adoue, Silvia B.

    2007-01-01

    ¿Es posible descubrir en una obra de ficción las marcas de la biografía de su autor? Parece que se impone un cambio de registro que domina la literatura del escritor para ajustarla a la visión de mundo que resulta de su experiencia vital. La escritura cumple el papel de conciencia y campo de batalla donde el autor intenta superar sus perplejidades. Así, tal vez sea posible, en algún nivel de lectura, leer la obra de un escritor como una autobiografía. Rodolfo Walsh, lector, traductor, adaptad...

  9. Felícisima Victoria concedida del cielo al señor don Juan de Austria en el golfo de Lepanto (1578)

    OpenAIRE

    Corte Real, Jerónimo; Vilá, Lara

    2005-01-01

    La colección Bibliotheca Sphaerica surge del trabajo conjunto del Seminario de Poética Europea del Renacimiento de la Universitat Autònoma de Barcelona y el Instituto Lucio Anneo Séneca de la Universidad Carlos III de Madrid En 1578 el portugués Jerónimo Corte Real dio a la imprenta la Felicísima victoria concedida del cielo al señor don Juan de Austria, un poema épico en castellano, ilustrado por el autor, dedicado íntegramente a narrar y exaltar la victoria cristiana en el golfo de Lepan...

  10. Influence of rf-magnetron Sputtered ITO and Al:ZnO on Photovoltaic Behaviour Related to CuInSe2-Based Photovoltaic Solar Cells

    International Nuclear Information System (INIS)

    This paper describes several investigations, made in the CIEMAT, on the capability of depositing transparent conducting oxides at room temperature by rf-magnetron sputtering, and their application in CuInSe2-based photovoltaic solar cells. ITO and Al:ZnO thin films having simultaneously high transmittance in the visible range and low resistivity, 103 -10 -4 Ωcm, can be obtained only if oxygen mass-flow rate is constrained to a very narrow range (0.5 - 1 sccm). Cell efficiency enhance when transparent conducting oxides are made without intentional heating and, after, the total devices are annealed in air at 200 degree centigree. (Author) 40 refs

  11. Hybrid systems of AlInP microdisks and colloidal CdSe nanocrystals showing whispering-gallery modes at room temperature

    International Nuclear Information System (INIS)

    We report on the realization of hybrid systems composed of passive optical microdisk resonators prepared from epitaxial layer systems and nanocrystal quantum emitters synthesized by colloidal chemistry. The AlInP disk material allows for the operation in the visible range, as probed by CdSe-based nanocrystals. Photoluminescence spectra at room temperature reveal sets of whispering-gallery modes consistent with finite-difference time-domain simulations. In the experiments, a special sample geometry renders it possible to detect resonant optical modes perpendicular to the disk plane.

  12. Hybrid systems of AlInP microdisks and colloidal CdSe nanocrystals showing whispering-gallery modes at room temperature

    Energy Technology Data Exchange (ETDEWEB)

    Strelow, Christian; Weising, Simon; Bonatz, Dennis; Mews, Alf; Kipp, Tobias, E-mail: kipp@chemie.uni-hamburg.de [Institut für Physikalische Chemie, Universität Hamburg, Grindelallee 117, D-20146 Hamburg (Germany); Penttinen, Jussi-Pekka; Hakkarainen, Teemu V.; Schramm, Andreas [Optoelectronics Research Centre, Tampere University of Technology, P.O. Box 692, FIN-33101 Tampere (Finland)

    2014-09-01

    We report on the realization of hybrid systems composed of passive optical microdisk resonators prepared from epitaxial layer systems and nanocrystal quantum emitters synthesized by colloidal chemistry. The AlInP disk material allows for the operation in the visible range, as probed by CdSe-based nanocrystals. Photoluminescence spectra at room temperature reveal sets of whispering-gallery modes consistent with finite-difference time-domain simulations. In the experiments, a special sample geometry renders it possible to detect resonant optical modes perpendicular to the disk plane.

  13. ¿Se puede predecir la transferencia de los aprendizajes al lugar de trabajo?: Validación del Modelo de Predicción de la Transferencia

    OpenAIRE

    Quesada Pallarès, Carla

    2014-01-01

    Los estudios sobre evaluación de la transferencia de la formación han mostrado que únicamente entre un 10% y un 30% de lo aprendido en la formación se transfiere al puesto de trabajo (Holton, Bates y Ruona, 2000); y que los predictores y las intervenciones tienen un modesto efecto en la transferencia (Saks y Burke, 2012). En vista de este panorama, la presente tesis doctoral tiene dos objetivos: (1) crear un modelo de predicción de transferencia de la formación, mediante el análisis de la...

  14. Influences of S, Se, Te and Po substitutions on structural, electronic and optical properties of hexagonal CuAlO2 using GGA and B3LYP functionals.

    Science.gov (United States)

    Liu, Qi-Jun; Jiao, Zhen; Liu, Fu-Sheng; Liu, Zheng-Tang

    2016-06-01

    The effects of X-doping (X = S, Se, Te and Po) on the structural, electronic and optical properties of hexagonal CuAlO2 were studied using first-principles density functional theory. The calculated results showed the obtained lattice constants to increase with increasing atomic number, and the X-doping to be energetically more favorable under Al-rich conditions. The calculated electronic properties showed decreased bandgaps with increasing atomic number, which was due to the better covalent hybridizations after sulfuration doping. The enhanced covalency was further confirmed by calculating the Mulliken atomic populations and bond populations. The density of states indicated the increase of the contribution to antibonding from the X-p states to be a benefit for p-type conductivity. Moreover, the X-doping induced a red shift of the absorption edge. PMID:27168530

  15. Enhanced performance of Al2O3 coated ZnO nanorods in CdS/CdSe quantum dot-sensitized solar cell

    International Nuclear Information System (INIS)

    CdS/CdSe quantum dot-sensitized solar cells (QDSCs) based on ZnO nanorods, 4.55 μm in length, were studied. Many studies have shown that the performance of QDSCs is limited by a recombination process. Therefore, the interface layer was fabricated on the surface of the ZnO nanorods to retard recombination at the interface between the semiconductor and electrolyte. Overall, the performance of the QDSCs was improved by a surface coating of aluminum isopropoxide (Al2O3) on the ZnO nanorod, which facilitates a decrease in electron recombination and increased adsorption of CdS/CdSe QDs on the ZnO nanorods. - Highlights: • Performance of quantum dot sensitized solar cell was improved by alumina core–shell. • Al2O3 layer acting as a barrier that improves VOC by impeding recombination. • Alumina-coated ZnO showed enhanced absorption intensity over the UV–visible region

  16. Mode of formation of hibonite (CaAl12O19) within the U-Th skarns from the granulites of S-E Madagascar

    Science.gov (United States)

    Rakotondrazafy, Michel A. F.; Moine, B.; Cuney, M.

    1996-03-01

    In Madagascar, hibonite occurs as a rather frequent mineral within thorianite-bearing skarns which are widespread in the Pan African granulitic formations constituting the S-E part of the Island (Tranomaro area). In these skarns, leucocratic segregations made up of CO3-scapolite to meionite (Anequivalent=89 95% which implies T≥850° C), spinel and corundum were formed at stage 1 of metasomatism in a titanite-bearing matrix consisting of scapolite (Aneq=77 88) and aluminous diopside. During stage 2 of metasomatism, scapolite from the lenses were altered to anorthite+calcite while the less calcic scapolite remained stable which indicates T≈800° C. Hibonite crystallized at the expense of corundum and spinel. Expressed as mol% of the CaAl12O19/Ca(Al10TiR2+)O19/REE(Al11R2+)O19 [+Th (Al10R2+ 2)O19] end-members ( R 2+=Mg, Fe2+, Zn2+; Al=Al, Fe3+; Ti=Ti, Si), its composition varies from 26/72/2 to 50/23/27. The ideal activity of the CaAl12O19 component is about 0.25. Fluid inclusions in corundum, hibonite and anorthite are composed of nearly pure CO2. In corundum, the isochores for primary inclusions are in agreement with the P-T estimates for regional metamorphism and stage 1 metasomatism ( T≈850° C, P≈5 kbar). Inclusions with the highest density in hibonite and anorthite constrain P to about 3 3.5 kbar for T=800° C. Thermodynamic calculations indicate that, in addition to a low activity of CaAl12O19, stability of hibonite in equilibrium with anorthite and calcite implies an extremely low activity of silica (below the zircon-baddeleyite buffer). By contrast the activity of CO2 may be high, in agreement with the observed fluid compositions. These results are corroborated by a short comparison with the other granulite occurrences of hibonite in Tanzania and South India.

  17. Trace element (Al, As, B, Ba, Cr, Mo, Ni, Se, Sr, Tl, U and V) distribution and seasonality in compartments of the seagrass Cymodocea nodosa.

    Science.gov (United States)

    Malea, Paraskevi; Kevrekidis, Theodoros

    2013-10-01

    Novel information on the biological fate of trace elements in seagrass ecosystems is provided. Al, As, B, Ba, Cr, Mo, Ni, Se, Sr, Tl, U and V concentrations in five compartments (blades, sheaths, vertical rhizomes, main axis plus additional branches, roots) of the seagrass Cymodocea nodosa, as well as in seawater and sediments from the Thessaloniki Gulf, Greece were determined monthly. Uni- and multivariate data analyses were applied. Leaf compartments and roots displayed higher Al, Mo, Ni and Se annual mean concentrations than rhizomes, B was highly accumulated in blades and Cr in sheaths; As, Ba, Sr and Tl contents did not significantly vary among plant compartments. A review summarizing reported element concentrations in seagrasses has revealed that C. nodosa sheaths display a high Cr accumulation capacity. Most element concentrations in blades increased in early mid-summer and early autumn with blade size and age, while those in sheaths peaked in late spring-early summer and autumn when sheath size was the lowest; elevated element concentrations in seawater in late spring and early-mid autumn, possibly as a result of elevated rainfall and associated run-off from the land, may have also contributed to the observed variability. Element concentrations in rhizomes and roots generally displayed a temporary increase in late autumn, which was concurrent with high rainfall, low wind speed associated with reduced hydrodynamism, and elevated sediment element levels. The bioaccumulation factor based on element concentrations in seagrass compartments and sediments was lower than 1 except for B, Ba, Mo, Se and Sr in all compartments, Cr in sheaths and U in roots. Blade V concentration positively correlated with sediment V concentration, suggesting that C. nodosa could be regarded as a bioindicator for V. Our findings can contribute to the design of biomonitoring programs and the development of predictive models for rational management of seagrass meadows. PMID:23838054

  18. SE PREVENINDO?

    Directory of Open Access Journals (Sweden)

    Ana Débora Assis Moura

    2010-01-01

    Full Text Available Este estudio tuvo como objetivo verificar el comportamiento de las prostitutas en relación a la prevención de enfermedades de transmisión sexual y del Síndrome de Inmunodeficiencia Adquirida-SIDA, así como investigar cómo se previenen de esas enfermedades. Se trata de una investigación exploratoria, con enfoque cualitativo, llevada a cabo en la Asociación de las Prostitutas en Ceará, Brazil, en septiembre de 2008, a través de una encuesta con 25 prostitutas. El análisis de los datos se hizo según el análisis de contenido, después de ser agrupados en cuatro categorías: conocimiento sobre las enfermedades de transmisión sexual/SIDA; convivencia con la(s enfermedad(es; prevención de la enfermedad de transmisión sexual/SIDA; y el uso de drogas. Se concluyó que las prostitutas no usan preservativos en todas las relaciones sexuales, por lo tanto, las enfermedades de transmisión sexual representan una realidad; la desinformación sobre la(s enfermedad(es es notable; el consumo de drogas lícitas e ilícitas es frecuente entre ellas, factor que las expone a situaciones más vulnerables con relación al VIH/SIDA.

  19. Transport properties of CuIn(1-x)Al(x)Se2/AZnO heterostructure for low cost thin film photovoltaics.

    Science.gov (United States)

    Murali, Banavoth; Krupanidhi, S B

    2014-02-01

    CuIn(1-x)Al(x)Se2 (CIASe) thin films were grown by a simple sol-gel route followed by annealing under vacuum. Parameters related to the spin-orbit (ΔSO) and crystal field (ΔCF) were determined using a quasi-cubic model. Highly oriented (002) aluminum doped (2%) ZnO, 100 nm thin films, were co-sputtered for CuIn(1-x)Al(x)Se2/AZnO based solar cells. Barrier height and ideality factor varied from 0.63 eV to 0.51 eV and 1.3186 to 2.095 in the dark and under 1.38 A.M 1.5 solar illumination respectively. Current-voltage characteristics carried out at 300 K were confined to a triangle, exhibiting three limiting conduction mechanisms: Ohms law, trap-filled limit curve and SCLC, with 0.2 V being the cross-over voltage, for a quadratic transition from Ohm's to Child's law. Visible photodetection was demonstrated with a CIASe/AZO photodiode configuration. Photocurrent was enhanced by one order from 3 × 10(-3) A in the dark at 1 V to 3 × 10(-2) A upon 1.38 sun illumination. The optimized photodiode exhibits an external quantum efficiency of over 32% to 10% from 350 to 1100 nm at high intensity 17.99 mW cm(-2) solar illumination. High responsivity Rλ ~ 920 A W(-1), sensitivity S ~ 9.0, specific detectivity D* ~ 3 × 10(14) Jones, make CIASe a potential absorber for enhancing the forthcoming technological applications of photodetection. PMID:24336980

  20. Investigating the electronic properties of Al{sub 2}O{sub 3}/Cu(In,Ga)Se{sub 2} interface

    Energy Technology Data Exchange (ETDEWEB)

    Kotipalli, R., E-mail: raja.kotipalli@uclouvain.be; Rajkumar, R.; Flandre, D. [ICTEAM, Université catholique de Louvain, Louvain-la-Neuve, 1348 (Belgium); Vermang, B., E-mail: bart.vermang@imec.be [Ångström Solar Center, University of Uppsala, Uppsala, 75121 (Sweden); ESAT-KU Leuven, University of Leuven, Leuven, 3001 (Belgium); IMEC, Kapeldreef 75, Leuven, 3001 (Belgium); Joel, J.; Edoff, M. [Ångström Solar Center, University of Uppsala, Uppsala, 75121 (Sweden)

    2015-10-15

    Atomic layer deposited (ALD) Al{sub 2}O{sub 3} films on Cu(In,Ga)Se{sub 2} (CIGS) surfaces have been demonstrated to exhibit excellent surface passivation properties, which is advantageous in reducing recombination losses at the rear metal contact of CIGS thin-film solar cells. Here, we report, for the first time, experimentally extracted electronic parameters, i.e. fixed charge density (Q{sub f}) and interface-trap charge density (D{sub it}), for as-deposited (AD) and post-deposition annealed (PDA) ALD Al{sub 2}O{sub 3} films on CIGS surfaces using capacitance–voltage (C-V) and conductance-frequency (G-f) measurements. These results indicate that the AD films exhibit positive fixed charges Q{sub f} (approximately 10{sup 12} cm{sup −2}), whereas the PDA films exhibit a very high density of negative fixed charges Q{sub f} (approximately 10{sup 13} cm{sup −2}). The extracted D{sub it} values, which reflect the extent of chemical passivation, were found to be in a similar range of order (approximately 10{sup 12} cm{sup −2} eV{sup −1}) for both AD and PDA samples. The high density of negative Q{sub f} in the bulk of the PDA Al{sub 2}O{sub 3} film exerts a strong Coulomb repulsive force on the underlying CIGS minority carriers (n{sub s}), preventing them to recombine at the CIGS/Al{sub 2}O{sub 3} interface. Using experimentally extracted Q{sub f} and D{sub it} values, SCAPS simulation results showed that the surface concentration of minority carriers (n{sub s}) in the PDA films was approximately eight-orders of magnitude lower than in the AD films. The electrical characterization and estimations presented in this letter construct a comprehensive picture of the interfacial physics involved at the Al{sub 2}O{sub 3}/CIGS interface.

  1. PERSPECTIVAS DE SUSTENTABILIDADE ECOLÓGICA DO TURISMO EM XINGÓ, SE/AL / TOURISM ECOLOGICAL SUSTAINABILITY PERSPECTIVES IN XINGÓ, SERGIPE AND ALAGOAS, BRAZIL

    Directory of Open Access Journals (Sweden)

    Cláudio Roberto Braghini

    2009-06-01

    Full Text Available RESUMO A busca da sustentabilidade em várias dimensões implica olhar para o desenvolvimento local nos territórios em que o turismo ocorre. Este estudo analisou de forma sistêmica a relação entre turismo, gastronomia local e os recursos extraídos do rio São Francisco pela pesca artesanal, na região de Xingó, Nordeste do Brasil. A área de estudo abrangeu três municípios, Poço Redondo/SE, Canindé de São Francisco/SE e Piranhas/AL. Tratou-se de uma pesquisa exploratória, descritiva, intencional e não probabilística, utilizando entrevistas com roteiro estruturado e aberto, junto aos restaurantes, pescadores artesanais e gestores públicos, visitas locais de reconhecimento, construção de mapa coletivo com pescadores e elaboração de diagramas de alças causais, visando selecionar indicadores de sustentabilidade. Os resultados indicaram o Surubim Pseudoplatystoma corruscans (Spix e Agassiz, 1829, Pitu Macrobrachium carcinus (Linnaeus, 1758 e Tubarana Salminus hilarii (Valenciennes, 1850, os pescados típicos mais vendidos, no entanto, dependem de distribuidores e de estoques externos. Observou-se que a redução do pescado na região deveu-se à barragem da UHE de Xingó e a sobrepesca. O fluxo turístico crescente tem forte influência sobre o camarão Pitu. Os indicadores ambientais selecionados apontam necessidade de sistematização de informações sobre a produção pesqueira e o consumo nos restaurantes.Palavras-chaves: Sustentabilidade; Turismo; Xingó; Rio São Francisco; CaatingaABSTRACTThe carrying support and the development of the local tourism involve different looks on its dimensions in the area where it occurs. This study examined in a systematic way the sustainability of tourism in the Northeast - Brazil, region of Xingó: the resources tourist and local gastronomy. The study area covers three districts: Poço Redondo and Canindé do São Francisco at Sergipe and in the state of Alagoas at Piranhas. This research

  2. Las estructuras de la Cuenca de Bermejo y Sierra de Valle Fértil a partir de los métodos deconvolución de Euler y señal analítica

    Directory of Open Access Journals (Sweden)

    Federico Lince Klinger

    2008-06-01

    Full Text Available Se aplicaron técnicas de señal analítica y deconvolución de Euler a valores de anomalías de Bouguer de la cuenca de Bermejo y de la sierra de Valle Fértil, en el sector occidental de las Sierras Pampeanas. A partir de las soluciones encontradas por estas técnicas, se han interpretado la ubicación y profundidad de las fuentes causantes de anomalías, las que se vinculan con las estructuras geológicas que involucran al basamento. Con el objeto de verificar los resultados obtenidos y de minimizar las ambigüedades de los métodos potenciales, se preparó un modelo gravimétrico directo basado en un modelo estructural del área. A la respuesta gravimétrica de este modelo directo se le aplicó la técnica de señal analítica 2D, encontrándose soluciones que son consistentes con la profundidad y geometría de las fuentes previamente interpretadas, corroborando los resultados obtenidos.

  3. Hole mobility enhancement of Cu-deficient Cu{sub 1.75}Zn(Sn{sub 1−x}Al{sub x})Se{sub 4} bulks

    Energy Technology Data Exchange (ETDEWEB)

    Kuo, Dong-Hau, E-mail: dhkuo@mail.ntust.edu.tw; Tsega, Moges

    2013-10-15

    Cu-deficient Cu{sub 1.75}ZnSn{sub 1−x}Al{sub x}Se{sub 4} (x=0–0.6) bulks were prepared by a liquid-phase reactive sintering method at 600 {sup °}C with soluble sintering aids of Sb{sub 2}S{sub 3} and Te. Defect chemistry was studied by measuring electrical properties of Al-doped CZTSe as a function of dopant concentration. Al-CZTSe pellets at x=0.4 with electrical conductivity of 57.2 S cm{sup −1} showed the highest hole mobility of 32.5 cm{sup 2} V{sup −1} s{sup −1}. The high mobility is mainly contributed from the low atomic scattering factor of Al. The high carrier concentration and slightly changed lattice parameter of Al-CZTSe are related to the types of its defects. - Graphical abstract: The controls in electrical properties and the changes in lattice parameters of Cu-deficient Cu{sub 2}ZnSnSe{sub 4} by doping Al{sup 3+} on the Sn{sup 4+} site. Display Omitted - Highlights: • Cu-deficient Cu{sub 1.75}Zn(Sn{sub 1−x}Al{sub x})Se{sub 4} was prepared by liquid-phase sintering at 600 °C. • Sintering aids of Sb{sub 2}S{sub 3} and Te were used for reactive sintering. • Al-CZTSe at x=0.4 showed the extremely high mobility of 32.5 cm{sup 2} V{sup −1} s{sup −1}. • Al-CZTSe reached large grains of 2−3 μm, while it was <1.0 μm for the undoped. • Electrical properties of Al-CZTSe pellets changed with the Al content.

  4. Los López de Lemos, señores de Ferreira y Sober. El linaje y sus parentelas en los siglos XIII al XVI

    Directory of Open Access Journals (Sweden)

    Pardo de Guevara y Valdés, Eduardo

    2011-12-01

    Full Text Available As has been highlighted on many occasions, the medieval nobility studies require a knowledge built on more accurate and secure their networks lineages and parents. Hence the importance of undertaking studies genealogical database and prosopographic as offered here, focusing on the López de Lemos, a famous but little known lineage that represents very well the profile of the nobility that formed the second interior Galicia. The careful genealogical research done to offer a fairly accurate picture of its formation and consolidation process, articulated from the heritage nucleated around the fortress of Ferreira. Under this effort are revealed signs of lineage identity and life trajectories of each of the characters who represented him, standing at last the milestones of their parental relationships and the different branches under their offspring led.

    Como ha sido resaltado en múltiples ocasiones, los estudios sobre la nobleza medieval precisan construirse sobre un conocimiento más exacto y seguro de los linajes y sus redes parentales. De ahí el interés de abordar estudios de base de carácter genealógico y prosopográfico como el que aquí se ofrece, centrado en los López de Lemos, un célebre pero poco conocido linaje que representa muy bien el perfil de los que conformaron la segunda nobleza del interior de Galicia. La cuidada pesquisa genealógica realizada permite ofrecer un panorama bastante preciso de su proceso de conformación y consolidación, articulado a partir del patrimonio nucleado en torno a la fortaleza de Ferreira. Al amparo de este empeño se desvelan los signos de identidad del linaje, así como las trayectorias vitales de cada uno de los personajes que lo representaron, destacándose por último los hitos fundamentales de sus relaciones parentales y de las diferentes ramas menores que sus vástagos encabezaron.

  5. Influence of rf-magnetron Sputtered ITO and Al:ZnO on Photovoltaic Behaviour Related to CuInSe{sub 2}-Based Photovoltaic Solar Cells; Influencia del ITO y Al:ZnO, Fabricados mediante Pulverizacion Cataodica, sobre el Comportamiento Fotovoltaico de Dispositivos Basados en el CuInSe{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, M. A.; Guillen, C.; Dona, J. M.; Herrero, J.; Gutierrez, M. T. [Ciemat.Madrid (Spain)

    2000-07-01

    This paper describes several investigations, made in the CIEMAT, on the capability of depositing transparent conducting oxides at room temperature by rf-magnetron sputtering, and their application inCuInSe{sub 2}-based photovoltaic solar cells. ITO and Al:ZnO thin films having simultaneously high transmittance in the visible range and low resistivity, 10''3-10''4{omega}cm, can be obtained only if oxygen mass-flow rate is constrained to a very narrow range (0.5-1 sccm). Cell efficiency enhance when transparent conducting oxides are made without intentional heating and, after, the total devices are annealed in air at 200 degree centigree. (Author) 40 refs.

  6. Structural and magnetic properties of single-crystalline spinel systems ZnCr2-xAl xSe4 (x = 0.15 and 0.23)

    International Nuclear Information System (INIS)

    Single crystals of the spinel solid solutions ZnCr2-xAl xSe4 with x = 0.15 and 0.23 were grown and studied by X-ray diffraction and macroscopic magnetic measurements. The solubility of Al3+ ions in the parent compound ZnCr2Se4 is very limited and only weakly substituted single crystals can be obtained. The spinel structure is hardly modified by this admixture and regular cation distribution is preserved. Alike ZnCr2Se4, the two compounds investigated order antiferromagnetically at low temperatures. Both the Neel temperatures and the paramagnetic Curie temperatures are similar to that reported for the parent selenide. Also the effective magnetic moments are close to that of ZnCr2Se4 and compatible with trivalent Cr ions. In contrast, the saturation magnetic moments measured above the metamagnetic phase transitions in strong magnetic fields and calculated per one Cr atom, appear to be strongly affected by the Al-substitution, being rapidly suppressed with rising Al-content

  7. Nuestra señora del campo. historia de un objeto en santafé de bogotá. siglos xvi al xx

    OpenAIRE

    Acosta, Olga Isabel

    2010-01-01

    Este artículo inicia con un balance de la historiografía colombiana sobre el arte colonial, y luego se concentra en el estudio de la Virgen del Campo. Estudia en detalle su origen como objeto de culto y la devoción que en tomo suyo se formó, desde la época colonial hasta el presente.

  8. Técnica de medida con auto-referencia para sensores ópticos de intensidad mediante procesado digital de señal e instrumentación virtual

    OpenAIRE

    Valverde Marín, Laura Guiomar

    2012-01-01

    Esta memoria presenta el proyecto fin de carrera titulado “ Técnica de medida con auto-referencia para sensores ópticos de intensidad mediante procesado digital de señal e instrumentación virtual" realizado en el departamento de Tecnología Electrónica de la Universidad Carlos III de Madrid bajo la supervisión del Prof. David Sánchez Montero. El proyecto se basa en la tesis fin de máster “Coarse WDM passive optical networking of self-referenced fiber-optic intensity sensors with reconfigurable...

  9. Caracterización de la relación señal/ruido de los potenciales evocados auditivos de estado estable durante la promediación

    Directory of Open Access Journals (Sweden)

    Alejandro Torres

    2004-01-01

    Full Text Available El presente estudio evalúa las variaciones que ocurren en la relación señal/ruido de los potenciales evocados auditivos de estado estable (PEAee a Mf provocado por múltiples tonos simultáneos modulados en amplitud, durante la promediación a lo largo del tiempo. Específicamente, se describen en forma cuantitativa las variaciones de la amplitud de los PEAee a Mf, el ruido residual y los estadígrafos utilizados para la detección automática de las respuestas (T2 Hotelling y T2 Circular. Se estudiaron ocho sujetos adultos sanos utilizando el sistema AUDIX IE. En cada sujeto se obtuvieron 128 registros individuales de los PEAee a Mf. Cada registro individual o ventana de análisis tenía 8192 muestras digitalizadas a 1,37 ms, de manera que el tiempo total de registro fue de 23,9 min . Se utilizó como estímulo una mezcla de tonos de 0,5, 1, 2 y 4 kHz modulados en amplitud a frecuencias de 77, 85, 93 y 101 Hz para el oído izquierdo y de 81, 89, 97 y 105 Hz para el derecho respectivamente. El estímulo fue presentado biauralmente a través de audífonos suprauriculares (TDH - 49 a una intensidad cercana al umbral (20 dB nHl. Se encontró que la amplitud de los PEAee a Mf fluctúa inicialmente en forma variable y alcanza un valor estable a partir de la promediación de 20 registros. Por otra parte, el ruido residual decrece en forma monotónica siguiendo una relación cuadrática con el número de promediaciones. Ambos estadígrafos (T2C y T2H siguen un comportamiento similar y alcanzan valores significativos estables a partir de la promediación de 30 registros. Estas variaciones de la relación señal/ruido cumplen los supuestos implícitos en la promediación de manera que se afirma como válido este método para la extracción de los PEAee a Mf. Asimismo, la caracterización paramétrica realizada brinda información útil para el perfeccionamiento de la audiometría objetiva mediante PEAee a Mf.

  10. Contribución al análisis multiescala de señales. Aplicación a imágenes de suelos agrícolas y series financieras

    OpenAIRE

    Piñuela Izquierdo, Juan A.

    2016-01-01

    En el campo del análisis multirresolución de señales, bien sean señales unidimensionales o imágenes, la transformada wavelet (u ondícula) es una de las herramientas más atractivas y potentes debido a su capacidad de análisis de las estructuras y singularidades presentes en una señal cuando esta es analizada en distintas escalas. Este trabajo parte de la investigación de cómo la modificación directa de los coeficientes wavelets permite añadir información en forma de marcas de agua a una imagen...

  11. Desarrollo y evaluación de diferentes métodos de detección de apnea a partir de la señal electrocardiográfica (ECG)

    OpenAIRE

    Manzanera Navarro, Vladimir

    2009-01-01

    El desarrollo y la mejora de distintos métodos de detección del síndrome de la apnea obstructiva del sueño (SAOS) a partir de únicamente la señal electrocardiográfica (ECG) es la base del proyecto realizado. Hasta ahora el método de detección utilizado es la polisomnografía, que requiere del registro de diferentes señales biomédicas, encareciendo el proceso. Para conseguir el objetivo marcado durante el estudio se desarrollan 5 métodos de extracción de información de l...

  12. El IEO se adhiere a la Declaración de Berlín sobre acceso abierto al conocimiento científico

    OpenAIRE

    Lozano, P.; Mosquera-de-Arancibia, C. (Concha)

    2016-01-01

    El 24 de junio de 2016, el Instituto Español de Oceanografía oficializó su adhesión a la Berlin Declaration on Open Access to Knowledge in the Sciences and Humanities, hito del movimiento de acceso abierto al conocimiento científico gestionado por la Max Planck Society. Los firmantes de la Declaración de Berlín defienden el uso de internet como medio funcional que sirva de base global al conocimiento científico y la reflexión humana. Los declarantes consideran que la misión de diseminar el co...

  13. Análisis de los diferentes tratamientos que se dan al cuerpo de los alumnos dentro de la jornada escolar. Propuesta de intervención

    OpenAIRE

    García Rojo, Laura

    2014-01-01

    En este documento nos adentraremos en el mundo corporal y en el tratamiento de éste dentro de las aulas. A continuación mediante la observación del tratamiento corporal en diversas jornadas a lo largo de tres semanas en un aula concreta y el análisis de las mismas, comprobaremos que se dan unas conclusiones y a partir de ellas veremos el diseño de una posible propuesta de intervención.

  14. Aportación al conocimiento de los hongos del SE. de España VI: Esclerodermatales, Licoperdales, Niludariales, Falales, Himenogásterales, Podaxales (Gasteromicetes, Basidiomicetes)

    OpenAIRE

    Honrubia García, Mario; Calonge, Francisco de Diego; Demoulin, V.; Moreno, G; Llimona, Xavier

    1982-01-01

    Resultados de las exploraciones micoIógicas realizadas entre 1977 y 1980 en 55 localidades de .Murcia, Albacete, Almería, Alicante y Jaén, en lo referente a Gasteromicetes, con exclusi6n de Tulostomatales. 167 recolecciones corresponden a 28 especies, en general poco conocidas o nuevas para el SE de España. En conjunto pertenece* a: Scleroderma (3, con S. meridionde), Pisolithus ('11, Astraeus (11, Sphaerobolus stellatus, Geastrum (6, con G. badium, G. minimum y G. pse...

  15. El futuro de la televisión pública educativa y cultural. El caso de Señal Colombia

    OpenAIRE

    Paula Arenas

    2015-01-01

    La televisión sirve de espejo y de ventana de una sociedad. Sin embargo, la televisión privada esta mediada por el filtro del interés comercial que distorsiona el reflejo del espejo y la perspectiva de la ventana, y en lugar de presentar una imagen auténtica, ofrece una imagen aspiracional del mundo. La televisión privada se convierte, entonces, en un espacio en el que las medidas aceptables son las de la reina, el cine posible es el de Hollywood y en el cual la oferta de imaginarios para sus...

  16. ZnO-Nanostäbchen als Licht-koppelndes Element in ultra-dünnen, zweiseitigen Cu(In,Ga)Se2-Solarzellen

    OpenAIRE

    Ohm, Wiebke

    2015-01-01

    In this work, the implementation of ZnO nanorods as light-coupling element at the transparent back contact of bifacial Cu(In,Ga)Se2 (CIGSe) solar cells was investigated. The light-coupling effect of ZnO nanorods embedded into the CIGSe absorber is used to compensate for absorption losses in ultra-thin absorber layers resulting in an increased photocurrent for back side illumination compared to planar back-contacts. The effect of the morphology of textured surfaces on the reflection was dem...

  17. Structural study of ZnSe films grown on substrate with InxGa1-xAs and Al1-xGaxAs buffer layers: strain, relaxation and lattice parameter

    International Nuclear Information System (INIS)

    ZnSe layers of various thickness were grown on (001) GaAs substrates, using InxGa1-xAs or Al1-xGaxAs as buffer layers by molecular beam epitaxy and were studied by high-resolution x-ray diffraction. The principal structural characteristics of ZnSe layer and buffer layer were determined using several reflections, such as (004) and two pairs of coupled asymmetric reflections, namely (224), (-2-24) and (115) (-1-15). In order to evaluate their validity, the experimental data obtained from these reflections were handled by means of two known expressions found in the literature. We have found the relaxation process of ZnSe layers is well described by a geometrical model including the thermal strain and small strain due to work hardening. The relaxation process is faster for ZnSe grown on ternary buffer layers despite the fact that, some buffer layers are pseudomorphically grown to the substrate; therefore we conclude that not only the lattice mismatches have effect on the relaxation process but also the surface state of the buffer layer has an influence in this process. (author)

  18. Posibilidad de identificar defectos en máquinas rotatorias utilizando la medición de nivel total de la señal vibratoria // Possibility of identification of defects in rotatory machinery by means of total level mesurations.

    Directory of Open Access Journals (Sweden)

    L. M. Véliz Marrero

    2000-03-01

    Full Text Available Se expone una herramienta propuesta por el Dr. C. Cempel, poco difundida para identificar algunos defectos al realizar eldiagnóstico de máquinas rotatorias utilizando la medición de Nivel Total. Se ilustra a modo de ejemplo el diagnóstico de unreductor de velocidad.Palabras claves: Medición, vibraciones, nivel total, diagnóstico, engranaje, reductor de velocidad.________________________________________________________________________________AbstractIn this paper is exposed a not much divulged tool proposed by Dr. C. Cempel for the identification of some defects by meansof the measurement of Total Level of vibration in diagnosis of rotatory machinery. As example, a speed reducer diagnostic ispresented.Key words: Vibration measurement, total level, diagnostic, gears, speed reducer.

  19. Se los por se lo

    OpenAIRE

    José Luis Rivarola

    1985-01-01

    El sistema de la conjugación "objetiva" plantea interesantesproblemas que fueron tratados en parte por K. Heger (1966) en suestudio comparativo del francés y del español. De la comparaciónse desprende, por ejemplo, que en español hay un cierto número deambigüedades que no permiten establecer un "paradigma tan completo y unívoco" como en el caso del francés. Dentro de estas ambigüedades se encuentran las que propicia el gramema se: "El morfema [gramema] se funciona no sólo como pronombre refle...

  20. De teules al regreso del Señor desterrado: la imaginación política de las élites mesoamericanas

    OpenAIRE

    Montano, Rafael

    2012-01-01

    Cet article examine la récente hypothèse selon laquelle la perception par les Mésoaméricains de Cortés et de ses hommes comme étant des teules, ou des dieux, ne serait qu’une construction post-conquête élaborée par les descendants des Aztèques, sous l’influence des Franciscains et de la Deuxième lettre de Cortés. Je suggère plutôt que si effectivement l’histoire a été retouchée et améliorée après la chute de Tenochtitlán, il y a trop de témoignages contradictoires qui font qu’on ne peut écart...

  1. Structural and electrical properties of CuIn{sub 1−x}Al{sub x}Se{sub 2} thin films prepared by radio-frequency magnetron sputtering process

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jun [Key Laboratory of Polar Materials and Devices, Ministry of Education, Department of Electronic Engineering, East China Normal University, Shanghai 200241 (China); Deng, Hongmei [Laboratory for Microstructures, Shanghai University, 99 Shangda Rd, Shanghai 200444 (China); He, Jun; Meng, Xiankuan; Liu, Tantan; Sun, Lin [Key Laboratory of Polar Materials and Devices, Ministry of Education, Department of Electronic Engineering, East China Normal University, Shanghai 200241 (China); Yang, Pingxiong, E-mail: pxyang@ee.ecnu.edu.cn [Key Laboratory of Polar Materials and Devices, Ministry of Education, Department of Electronic Engineering, East China Normal University, Shanghai 200241 (China); Chu, Junhao [Key Laboratory of Polar Materials and Devices, Ministry of Education, Department of Electronic Engineering, East China Normal University, Shanghai 200241 (China)

    2015-01-30

    Highlights: • The CIAS thin films are prepared by RF sputtering. • The substitution of In by Al in the films result in the lattice shrink. • The electrical properties of the interface for AZO/CIAS have been investigated. • The film is potential to be used for photodetector applications. - Abstract: The CuIn{sub 1−x}Al{sub x}Se{sub 2} (CIAS) thin films have been prepared by radio-frequency magnetron sputtering process. X-ray diffraction patterns indicate that the lattice constants of the CIAS thin films show about a 2% reduction with the Al content from 0 to 12%. The results of Raman scatting spectroscopy show that the A{sub 1} mode position exhibits a blueshift with the increasing Al content. The grain size becomes smaller evidently with the increase of Al content. From the current–voltage characteristics of the interface for Al-ZnO/CIAS thin films, the threshold voltage decreases varying from darkness to illumination, the barrier heights are 0.775 eV in the dark and 0.697 eV under light illumination, respectively, and the values of ideality factor vary from 2.19 to 1.96 in the dark and under light illumination from the d(V)/d(ln I) versus I curve. The AZO/CIAS thin film exhibits good spectral response in wavelengths ranging from 450 nm to 750 nm. The results indicate that the CIAS thin film is a potential material for photodetector application.

  2. Evaluación de la aplicación de la técnica de percusión, registro de señal sonora y posterior análisis espectral para la verificación de la adherencia de aplacados de piedra como revestimiento encolado en fachadas urbanas en altura

    OpenAIRE

    Zamora i Mestre, Joan-Lluís; Radillo-Llera, Manuel-Hilario

    2008-01-01

    Desde hace años se van produciendo con alarma casos de desprendimiento al vacio de aplacados de piedra natural que revisten paramentos altos de fachadas situadas en entornos urbanos. Se trata de aplacados adheridos al soporte mediante pastas de mortero de cemento. Este tipo de anomalías se presenta sin aviso y presenta un gran daño potencial par alas vidas humanas. Se plantea pues la necesidad de disponer de una técnica simplificada para evaluar “in situ” el estado real de adherencia del res...

  3. Se los por se lo

    Directory of Open Access Journals (Sweden)

    José Luis Rivarola

    1985-12-01

    Full Text Available El sistema de la conjugación "objetiva" plantea interesantesproblemas que fueron tratados en parte por K. Heger (1966 en suestudio comparativo del francés y del español. De la comparaciónse desprende, por ejemplo, que en español hay un cierto número deambigüedades que no permiten establecer un "paradigma tan completo y unívoco" como en el caso del francés. Dentro de estas ambigüedades se encuentran las que propicia el gramema se: "El morfema [gramema] se funciona no sólo como pronombre reflexivo, sinotambién como variante combinatoria del pronombre personal complemento indirecto de la tercera persona.

  4. Profile of patients with hepatic hydatid disease not treated surgically Perfil del paciente con hidatidosis hepática al que no se realiza tratamiento quirúrgico

    Directory of Open Access Journals (Sweden)

    José Manuel Ramia

    2011-09-01

    .Introducción: la hidatidosis hepática (HH es todavía un problema sanitario importante en ciertas áreas endémicas en España. El tratamiento es habitualmente quirúrgico pero ciertos pacientes, tras ser valorados por los Servicios de Cirugía, no son intervenidos por un variado conjunto de causas (asintomático, comorbilidades, negativa del paciente,.... Material y métodos: descripción de pacientes valorados en el Servicio de Cirugía de hidatidosis hepática y no intervenidos. Resultados: hemos atendido a 70 pacientes con HH. De ellos, 27 pacientes no fueron intervenidos. Edad media: 72,7 años (rango: 47-97. Catorce eran mujeres (51,8%. El número de quistes que presentaban era 33, con 1,22 quistes/paciente (rango: 1-4. El tamaño del quiste fue 5,5 cm (rango: 2,1-12,5 cm. Los quistes, según la clasificación OMS, eran CE1: 3 pacientes, CE3B: 5, CE4: 10 y CE5: 9. La forma de presentación fue: 9 pacientes sintomáticos, aunque solo 6 atribuibles a la HH (22% y 18 asintomáticos. En estos se realizó la prueba de imagen por: estudio de extensión de neoplasia (6 pacientes y en 12 por variadas razones médicas. Solo hemos realizado dos actuaciones terapéuticas: CPRE y colocación de prótesis biliar y una punción-aspiración-inyección-reaspiración (PAIR, ambas en pacientes que no querían ser intervenidos. Diez pacientes tenían indicación quirúrgica: CE1 (3 pacientes, CE3B (5, CE4 (1, y CE5 (1. Las razones porque no se intervinieron fueron: negativa del paciente (9 y neoplasia avanzada (1. Creemos que la cirugía era necesaria en cinco pacientes. En el seguimiento medio efectuado de 17 meses (rango: 1-37 no hemos realizado ninguna cirugía. Conclusiones: las causas de no intervención de HH tras valoración médica son múltiples: pacientes asintomáticos, enfermos ancianos, pluripatólogicos y oncológicos. Habitualmente es el paciente el que voluntariamente decide no intervenirse.

  5. Growth and characterization of ZnSe/CdSe/ZnSe quantum dots fabricated by using an alternate molecular beam supplying method

    International Nuclear Information System (INIS)

    ZnSe/CdSe/ZnSe structures inserted CdSe thin layer are fabricated using an alternate molecular beam supply (ALS). Examining the PL peak energy dependence on beam irradiation time in ALS cycle, we studied the initial stage of CdSe growth. When CdSe below the critical thickness is supplied on ZnSe grown on GaAs (1 0 0), two kinds of 2D islands (platelets) appear. We confirmed the alloying of 2D-CdSe islands and 3D-CdSe islands (dots) is prominent under Cd beam irradiation in ALS growth

  6. Comparative study about Al-doped zinc oxide thin films deposited by Pulsed Electron Deposition and Radio Frequency Magnetron Sputtering as Transparent Conductive Oxide for Cu(In,Ga)Se2-based solar cells

    International Nuclear Information System (INIS)

    In this study, a comparison between Al-doped ZnO (AZO) as Transparent Conductive Oxide for Cu(In,Ga)Se2-based solar cells grown by Pulsed Electron Deposition (PED) and Radio Frequency Magnetron Sputtering (RFMS) was performed. PED yielded polycrystalline [002] mono-oriented thin films with low electrical resistivity and high optical transparency with heater temperatures ranging from room temperature (RT) to 250 °C. The electrical resistivity of these films can be tuned by varying the heater temperature, reaching a minimum value of 3.5 × 10−4 Ωcm at 150 °C and an average transmittance over 90% in the visible range. An AZO film grown at RT was deposited by PED on an actual Cu(In,Ga)Se2-based solar cell, resulting to an efficiency value of 15.2% on the best device. This result clearly shows that PED is a suitable technique for growing ZnO-based thin films for devices/applications where low deposition temperature is required. On the other hand, an optimized AZO thin film front contact for thin film solar cells was studied and fabricated via RFMS. The parameters of this technique were tweaked to obtain highly conductive and transparent AZO thin films. The lowest resistivity value of 3.7 × 10−4 Ωcm and an average transmittance of 86% in the 400-1100 nm wavelength range was obtained with a heater temperature of 250 °C. A thick sputtered AZO film was deposited at RT onto an identical cell used for PED-grown AZO, reaching the highest conversion efficiency value of 14.7%. In both cases, neither antireflection coatings nor pure ZnO layer was used. - Highlights: • Pulsed Electron Deposition (PED) lets high quality films grow at low temperature. • Al:ZnO (AZO) thin films grown by PED present high optical and electrical quality. • AZO electrical resistivity can be tuned from 10−4 to 10−2 Ωcm in proper condition. • Cu(In,Ga)Se2-based simplified solar cells achieved efficiency of 15.2% for PED-grown AZO

  7. Comparative study about Al-doped zinc oxide thin films deposited by Pulsed Electron Deposition and Radio Frequency Magnetron Sputtering as Transparent Conductive Oxide for Cu(In,Ga)Se{sub 2}-based solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Pattini, F., E-mail: pattini@imem.cnr.it [IMEM-CNR, Institute of Materials for Electronics and Magnetism, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Annoni, F.; Bissoli, F.; Bronzoni, M. [IMEM-CNR, Institute of Materials for Electronics and Magnetism, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Garcia, J.P. [Delft University of Technology, Faculty of Applied Sciences, Delft Product and Process Design Institute, Julianalaan 67, 2628 BC Delft (Netherlands); Gilioli, E.; Rampino, S. [IMEM-CNR, Institute of Materials for Electronics and Magnetism, Parco Area delle Scienze 37/A, 43124 Parma (Italy)

    2015-05-01

    In this study, a comparison between Al-doped ZnO (AZO) as Transparent Conductive Oxide for Cu(In,Ga)Se{sub 2}-based solar cells grown by Pulsed Electron Deposition (PED) and Radio Frequency Magnetron Sputtering (RFMS) was performed. PED yielded polycrystalline [002] mono-oriented thin films with low electrical resistivity and high optical transparency with heater temperatures ranging from room temperature (RT) to 250 °C. The electrical resistivity of these films can be tuned by varying the heater temperature, reaching a minimum value of 3.5 × 10{sup −4} Ωcm at 150 °C and an average transmittance over 90% in the visible range. An AZO film grown at RT was deposited by PED on an actual Cu(In,Ga)Se{sub 2}-based solar cell, resulting to an efficiency value of 15.2% on the best device. This result clearly shows that PED is a suitable technique for growing ZnO-based thin films for devices/applications where low deposition temperature is required. On the other hand, an optimized AZO thin film front contact for thin film solar cells was studied and fabricated via RFMS. The parameters of this technique were tweaked to obtain highly conductive and transparent AZO thin films. The lowest resistivity value of 3.7 × 10{sup −4} Ωcm and an average transmittance of 86% in the 400-1100 nm wavelength range was obtained with a heater temperature of 250 °C. A thick sputtered AZO film was deposited at RT onto an identical cell used for PED-grown AZO, reaching the highest conversion efficiency value of 14.7%. In both cases, neither antireflection coatings nor pure ZnO layer was used. - Highlights: • Pulsed Electron Deposition (PED) lets high quality films grow at low temperature. • Al:ZnO (AZO) thin films grown by PED present high optical and electrical quality. • AZO electrical resistivity can be tuned from 10{sup −4} to 10{sup −2} Ωcm in proper condition. • Cu(In,Ga)Se{sub 2}-based simplified solar cells achieved efficiency of 15.2% for PED-grown AZO.

  8. Actores no estatales: grupos armados, milicias, señores de la guerra, grupos criminales organizados y paramilitares. ¿Pueden acaso estos grupos cometer crímenes internacionales conforme al Derecho penal internacional?

    Directory of Open Access Journals (Sweden)

    Mónica Rocha Herrera

    2016-03-01

    Full Text Available El legado de los tribunales penales internacionales de la ONU, el ICTY y el ICTR han sido claros y consistentes en una jurisprudencia conducente a responder de manera afirmativa que aquéllos grupos de individuos conformados por actores ‘No Estatales’ como grupos armados, milicias, señores de la guerra, paramilitares e incluso grupos criminales organizados son susceptibles de cometer crímenes internacionales conforme al derecho penal internacional, a saber, genocidio, crímenes de lesa humanidad y crímenes de guerra. La Corte Penal Internacional ha asumido este legado y hoy sabemos que, con o sin la complicidad de las autoridades del Estado, y a partir de la escasa jurisprudencia de la Corte Penal Internacional, estos grupos cometen crímenes de guerra como bien se estableció en la sentencia de Lubanga del 2012 y en Katanga del 2014 respectivamente. Crímenes de lesa humanidad a partir concretamente de la Decisión de Apertura de una Investigación para Kenia en 2010 donde la Sala a pesar de discrepancias adoptó la posición de que estos grupos organizados, con algún tipo de jerarquía y capaces de infringir los derechos humanos pueden ser considerados ‘organización’ en el sentido del artículo 7 del Estatuto de Roma. La comisión de genocidio por estos grupos en la CPI no la encontramos aún, pero el legado dejado por el ICTR y el ICTY es poderoso y elocuente.

  9. La inversión Matuyama-Brunhes en la secuencia de terrazas del río Jarama entre Velilla de San Antonio y Altos de la Mejorada, al SE de Madrid (España

    Directory of Open Access Journals (Sweden)

    Pérez-González, A.

    2013-06-01

    Full Text Available To the east of Madrid city in the Jarama river valley and between Mejorada del Campo and Velilla de San Antonio, we have studied the paleomagnetic properties of the river terrace sequence in the M-203 highway, located between El Rasillo and Altos de La Mejorada. Over a new geomorphological mapping the alluvial plain at +4-5 m and terraces at +20 m, +30-35 m, +60-65 m, +85-90 m, +105-110 m and +125-130 m have been defined. Five terraces have been sampled with the exception of the terrace at +20 m, allowing to place those terraces at altitudes greater or equal to +60-65 m in the Matuyama Chron, while terraces at +20 m and +35 m belong to Brunhes Chron. ESR datings on terraces in the Arlanzón river valley in Burgos (Moreno et al., 2012, suggest that Matuyama-Brunhes inversion in the Jarama valley could be established between the end of the sedimentation of the +60-65 m terrace and the engagement of subsequent +50-55 m terrace, located upstream from Mejorada del Campo, in Marchamalo (Pérez-González, 1994.Al Este de la ciudad de Madrid, en el valle del río Jarama y entre Mejorada del Campo y Velilla de San Antonio se han estudiado las propiedades paleomagnéticas de una secuencia de terrazas comprendidas entre El Rasillo y Altos de la Mejorada, a lo largo de la autopista M-203 de reciente construcción. La cartografía geomorfológica realizada permitió separar además de la llanura aluvial a +4-5 m, terrazas a +20 m, +30-35 m, +60-65 m, +85-90 m, +105-110 m y +125-130 m. De ellas se muestrearon 5 niveles, a excepción de la de +20 m, en taludes frescos de la autovía que permiten situar a las terrazas con altitudes relativas igual o mayores a +60-65 m en el Chron Matuyama, mientras que las terrazas a +20 m y +30-35 m pertenecerían al Chron Brunhes (< 0.780 Ma. Dataciones por ESR en terrazas del valle del río Arlanzón en Burgos (Moreno et al., 2012, sugieren que en el valle del Jarama la inversión Matuyama-Brunhes podría establecerse entre

  10. Women's opinions about mate choices: A qualitative studyKadınların eş seçimleri hakkındaki görüşleri: Nitel bir çalışma

    Directory of Open Access Journals (Sweden)

    Feyruz Usluoğlu

    2015-12-01

    Bu araştırmada, kadınların eş seçimine ilişkin görüşleri incelenmiştir. Çalışmaya sağlık alanında çalışan farklı meslek grubundan 15 kadın alınmıştır. Araştırmada veriler nitel veri toplama yöntemlerinden görüşme yöntemi kullanılarak toplanmış ve görüşmelerden elde edilen nitel verilerin analizinde içerik analizi yöntemi kullanılmıştır. Araştırmanın bulgularına göre kadınlar evlenmek istedikleri kişinin yaşının kendi yaşlarından büyük olmasını, ortalama fiziksel özelliklere sahip olmasını tercih etmektedir.  Kadınların en çok aradığı kişilik özelliği dürüstlük olmuştur ve bunu sırasıyla girişken, saygılı ve anlayışlı olma izlemiştir.  Kadınlar evlenmek istedikleri kişinin kişilik özellikleri ve sosyal statü teması altında gruplanan özellikler açısından kendilerinden farklı olmasını, en çok ilgili ve sevecen temaları altında belirtilen babalık özelliklerine sahip olmasını istediklerini belirtmişlerdir. Evlenmek istenilen kişinin kendileriyle benzer ya da daha yüksek ekonomik gelir ve statüye sahip olmasını,  kişisel zevkler ve kültürel temalara ilişkin konularda uyumlu olmayı bekledikleri belirtilmiştir. Ayrıca kadınlar, evlenmek istedikleri kişinin aileleriyle saygılı, yakın, samimi ve iyi bir ilişkisi olmasını istediklerini, ailenin kültürel uyum, sosyal statü ve kişilik özellikleri temaları kapsamındaki nitelikler konusunda eş seçimini etkilediğini ifade etmişlerdir. Araştırma bulguları, ilgili literatür doğrultusunda tartışılmıştır.

  11. Contribución de las alteraciones del metabolismo lipídico al desarrollo de esteatosis hepática en rata wistar con el envejecimiento. Papel de la señalización hipotalámica de leptina.

    OpenAIRE

    Salamanca Molina, Aurora

    2013-01-01

    El proceso de envejecimiento conlleva el desarrollo de múltiples patologías entre las que se puede destacar el síndrome metabólico por su elevada incidencia entre la población mundial. Este cuadro patológico se puede considerar el reflejo del declive metabólico asociado al envejecimiento y se origina por la pérdida de efectividad de los procesos de regulación del metabolismo que resultan en el desarrollo de sobrepeso, resistencia a insulina, dislipemia e hipertensión. Por todo esto, el síndro...

  12. Las estructuras de la Cuenca de Bermejo y Sierra de Valle Fértil a partir de los métodos deconvolución de Euler y señal analítica The structures of the Bermejo Basin and Sierra de la Huerta based on Euler deconvolution and analytic signal techniques

    Directory of Open Access Journals (Sweden)

    Federico Lince Klinger

    2008-06-01

    Full Text Available Se aplicaron técnicas de señal analítica y deconvolución de Euler a valores de anomalías de Bouguer de la cuenca de Bermejo y de la sierra de Valle Fértil, en el sector occidental de las Sierras Pampeanas. A partir de las soluciones encontradas por estas técnicas, se han interpretado la ubicación y profundidad de las fuentes causantes de anomalías, las que se vinculan con las estructuras geológicas que involucran al basamento. Con el objeto de verificar los resultados obtenidos y de minimizar las ambigüedades de los métodos potenciales, se preparó un modelo gravimétrico directo basado en un modelo estructural del área. A la respuesta gravimétrica de este modelo directo se le aplicó la técnica de señal analítica 2D, encontrándose soluciones que son consistentes con la profundidad y geometría de las fuentes previamente interpretadas, corroborando los resultados obtenidos.These geophysical techniques were applied to the Bouguer anomalies in the Bermejo Basin and Valle Fértil range. The location and depth to source of the anomalies were interpreted from the solutions obtained by these techniques. The found sources have been related with the geologic structures affecting the basement. In order to verify the results obtained and minimize the ambiguity of these potential methods, a forward gravimetric model was prepared, based on a geological and structural model of the area. The 2D analytic signal technique was applied to the gravimetric response of the model, and the solutions found are consistent with the depth and geometry of the above recognized sources, confirming the results obtained.

  13. Epitaxial 2D MoSe2 (HfSe2) Semiconductor/2D TaSe2 Metal van der Waals Heterostructures.

    Science.gov (United States)

    Tsoutsou, Dimitra; Aretouli, Kleopatra E; Tsipas, Polychronis; Marquez-Velasco, Jose; Xenogiannopoulou, Evangelia; Kelaidis, Nikolaos; Aminalragia Giamini, Sigiava; Dimoulas, Athanasios

    2016-01-27

    Molecular beam epitaxy of 2D metal TaSe2/2D MoSe2 (HfSe2) semiconductor heterostructures on epi-AlN(0001)/Si(111) substrates is reported. Electron diffraction reveals an in-plane orientation indicative of van der Waals epitaxy, whereas electronic band imaging supported by first-principles calculations and X-ray photoelectron spectroscopy indicate the presence of a dominant trigonal prismatic 2H-TaSe2 phase and a minor contribution from octahedrally coordinated TaSe2, which is present in TaSe2/AlN and TaSe2/HfSe2/AlN but notably absent in the TaSe2/MoSe2/AlN, indicating superior structural quality of TaSe2 grown on MoSe2. Apart from its structural and chemical compatibility with the selenide semiconductors, TaSe2 has a workfunction of 5.5 eV as measured by ultraviolet photoelectron spectroscopy, which matches very well with the semiconductor workfunctions, implying that epi-TaSe2 can be used for low-resistivity contacts to MoSe2 and HfSe2. PMID:26727305

  14. « Comment se comporter avec un roi chrétien » : l’ouvrage perdu d’Abū l-Ḥasan ʿAlī Ibn al-Qaṭṭān et les enjeux du cérémonial almohade

    Directory of Open Access Journals (Sweden)

    Mehdi Ghouirgate

    2014-05-01

    Full Text Available Cet article propose de revenir sur un document aussi exceptionnel que méconnu. Il s’agit du résumé d’un ouvrage (maqāla, aujourd’hui perdu, intitulé « Comment se comporter avec un roi chrétien », et que l’on trouve dans le dictionnaire bio-bibliographique d’Ibn ʿAbd al-Malik. Cette maqāla fut rédigée, par un homme de lettres au service des Almohades, Abū l-Ḥasan ʿAlī Ibn al-Qaṭṭān (m. 1231. C’est la seule source qui ait consigné des indications sur la conduite que devait adopter le souverain lors d’une cérémonie, en présence d’un prince étranger. À ce titre, on y trouve des renseignements essentiels sur le cérémonial almohade ainsi que sur les dilemmes que devaient résoudre le calife : d’un point de vue idéologique, il ne pouvait souffrir aucun autre pouvoir, mais l’impossibilité de mener des opérations d’envergure sur deux fronts à la fois l’amena à composer avec le roi du León. De même, c’est le seul document à avoir fait état d’une divergence de point de vue entre le calife et les intellectuels organiques du système, les Ṭalaba. Ce différend met en lumière des tensions latentes au sommet entre divers serviteurs de l’État, qui n’avaient pas la même forme de légitimité, ni tout à fait les mêmes intérêts.

  15. Microstructure and transport properties of epitaxial topological insulator Bi2Se3 thin films grown on MgO (100), Cr2O3 (0001), and Al2O3 (0001) templates

    Science.gov (United States)

    Lee, Y. F.; Kumar, R.; Hunte, F.; Narayan, J.; Schwartz, J.

    2015-09-01

    We report the epitaxial integration of defect-induced room temperature ferromagnetic insulators, Cr2O3 and MgO, with topological insulators Bi2Se3 on c-sapphire substrate by pulsed laser deposition. The structural, magnetic, and magnetotransport properties of ˜15 nm Bi2Se3 thin films are investigated on each template. The lattice misfits of Cr2O3/Bi2Se3 and MgO/Bi2Se3 are ˜16% and ˜39%, respectively, where the critical thickness for pseudomorphic growth is less than one monolayer. The insulating behavior is more pronounced due to the additional scattering of the surface states of the Bi2Se3 layer by interfacing with MgO and Cr2O3. The weak antilocalization effect from the surface states is clearly suppressed, accounting for the presence of magnetic bottom layers. This work demonstrates an effective way to study the emergence of a ferromagnetic phase in topological insulators by the magnetic proximity effect in Bi2Se3, a step toward unveiling their exotic properties.

  16. ¿Se puede naturalizar la epistemología? Reflexiones al hilode la lectura del libro «La Evolución del Conocimiento» de Antonio Diéguez Lucena

    OpenAIRE

    Soler Gil, Francisco José

    2012-01-01

    El objetivo de este artículo es discutir la propuesta de naturalización de la epis¬temología que se presenta en el libro «La Evolución del Conocimiento» de Antonio Diéguez Lucena. La conclusión a la que se llega es que el planteamiento de este autor no consigue superar el argumento antinaturalista basado en la evolución (EAAN) de Alvin Plantinga. Y se argumenta que posiblemente ningún intento de naturalización de la epis¬temología puede ser capaz de superar este argumento. Por lo que es proba...

  17. Aportación al conocimiento de las algas epicontinentales del S.E. de España. VI. Dinofíceas (Dinophyceae Fritsch. 1927) y Euglenofíceas (Euglenophyceae Schoenichem, 1925).

    OpenAIRE

    Aboal Sanjurjo, Marina

    1990-01-01

    En prospecciones algológicas realizadas durante los años 1982-85 por todo el sudeste español y en especial en la cuenca del Segura se han identificado 7 táxones de Dinofíceas y 15 de Euglenofíceas. 18 de ellas son novedad para la flora algológica del sudeste español y 3 para la flora española. Se reúnen en tablas los valores de los principales factores físicoquímicos del agua para cada especie

  18. Desarrollo y evaluación de clasificadores neuro-genéticos basados en señales de EEG para la ayuda al diagnóstico de la esquizofrenia

    OpenAIRE

    Santos Mayo, Lorenzo

    2015-01-01

    El presente Trabajo de Fin de Máster (TFM) constituye una ampliación del Proyecto Fin de Carrera (PFC) titulado "Diagnóstico automático de la esquizofrenia basado en el estudio de señales de EEG de actividad cortical en el cerebro". En este proyecto se abordaba el problema de la realización de una clasificación automática entre sujetos sanos y esquizofrénicos basada en la onda P3b, evocada por el cerebro cuando es sometido a una tarea oddball auditiva, y en un esquema de recono...

  19. Modulación de la transducción de la señal asociada a receptores tirosina quinasa por el fragmento C-terminal de la toxina tetánica en tejido nervioso

    OpenAIRE

    Chaib Oukadour, Imane

    2004-01-01

    Las neurotoxinas clostridiales (CNTs) producen patologías graves como el tétanos y el botulismo. En ambas patologías la muerte se produce en un porcentaje elevado y generalmente por colapso respiratorio y asfixia. Esta capacidad de causar la muerte en organismos superiores es responsabilidad de la actividad metaloproteásica dependiente de zinc que tienen estas toxinas en el dominio catalítico.Sin embargo, además de la actividad metaloproteásica también se han descubierto otras acciones farmac...

  20. Proposals for an effective application of the continuous improvement at the ININ according to the IAEA 50-C/SG-Q new code; Propuestas para una aplicacion efectiva del proceso de mejora continua en el ININ, de acuerdo al nuevo codigo 50-C/SG-Q del OIEA

    Energy Technology Data Exchange (ETDEWEB)

    Cardenas A, B.M.; Olivares O, L.A. [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, 11801 Mexico D.F. (Mexico)

    1997-07-01

    This work contains the requirements of continuous improvement contained in the IAEA new code {sup Q}uality assurance for safety in nuclear power plants and other nuclear installations, code 50-C/SG-Q. Assuming that it was the base for to elaborate the review No. 5 of the Quality assurance plan at ININ, it was done an analysis to give proposals for the application of continuous improvement in effective way. The relevant points which must be taken in account at the continuous improvement process are: Direction responsibility, involucring of all personnel, process planning, education and training, elaboration of improvement projects, investigation of processes which can be improved, continuation of the improvement process and its evaluation. With the implantation of an effective continuous improvement system it will be obtained to get a better quality and a more efficient safety. (Author)

  1. Volver al desarrollo

    Directory of Open Access Journals (Sweden)

    Jaime Ornelas Delgado

    2012-01-01

    Full Text Available El desarrollo, categoría empleada para expresar el crecimiento económico, surge durante la "guerra fría" y si bien fue propuesta por teóricos metropolitanos, se asumió en Latinoamérica como parte de los instrumentos disponibles para lograr el crecimiento y alternativa al socialismo. El desarrollo mantuvo su vigencia entre 1945 y 1975, cuando al advenimiento del neoliberalismo fue paulatinamente retirado de la agenda de las preocupaciones nacionales e internacionales. Al iniciarse el siglo xxi, el fracaso del mercado autorregulado trajo de nueva cuenta al debate los problemas del desarrollo, lo que obliga a revisarlo críticamente, tanto como al concepto mismo para mostrar su carácter colonial, si se quiere construir caminos ajenos al neoliberal y superar los problemas que han hecho de Latinoamérica una de las regiones más desiguales del mundo.

  2. Introducción al estudio de las mineralizaciones del Señorío y Tierra de Molina de Aragón (Guadalajara, España)

    OpenAIRE

    Mata Perelló, José M.; Octavio PUCHE RIART

    1992-01-01

    In this communication it's efected an introduction to the study of the mineralizations placed in the Señorio and Tierra de Molina de Aragón an historical demarcation of Guadalajara situated in the Sistema Ibérico. In this comunication, we will introduce the Study Castilian mineralizations between them, C/Ag are present as well as stratiform iron and copper mineralization.

  3. Quasikristalle und verwandte Phasen im System Zn-Mg-SE (SE=Y, Er, Ho, Dy)

    OpenAIRE

    Sterzel, Roland

    2003-01-01

    Ziel dieser Arbeit ist die Herstellung und Charakterisierung von Zn-Mg-SE-Legierungen (SE = Y, Ho, Er, Dy, Tb, Gd), um Informationen über Struktur, Stabilisierung und physikalische Eigenschaften der quasikristallinen Phasen dieses Systems zu erhalten. Die Quasikristalle dieses Systems unterscheiden sich von Quasikristallen anderer Legierungen, die meist Al als Hauptkomponente enthalten. Es konnten bis zu 275 mm3 große Einkristalle der flächenzentriert ikosaedrischen Phase in den Systemen Zn-M...

  4. Ticari gayrimenkul geliştirme sürecinde yer seçimi analizi: Türkiye’de alışveriş merkezlerinin kuruluş yerlerinin incelenmesi

    OpenAIRE

    TÜRK, Mehmet

    2012-01-01

      Alışveriş merkezleri, kurulmaya başladıkları ilk günden bu yana hızlı bir gelişme sürecine girmiş, kentsel alan gelişiminde ve tüketicinin günlük hayatında her geçen gün daha da önemli hale gelmiştir. Literatürde alışveriş merkezlerinin bir yandan daha fazla yatırım ile beraber ekonomiye ciddi fayda sağladıklarından bahsedilmekte, diğer taraftan kent merkezlerini boşalttıkları ve gereksizleştirdikleri gerekçesiyle sık sık eleştirilmektedirler.

      ...

  5. SiO{sub 2} and Al{sub 2}O{sub 3}/SiO{sub 2} coatings for increasing emissivity of Cu(In, Ga)Se{sub 2} thin-film solar cells for space applications

    Energy Technology Data Exchange (ETDEWEB)

    Shimazaki, Kazunori [Japan Aerospace Exploration Agency (JAXA), Institute of Aerospace Technology, 2-1-1 Sengen, Tsukuba, Ibaraki 305-8505 (Japan)], E-mail: shimazaki.kazunori@jaxa.jp; Imaizumi, Mitsuru [Japan Aerospace Exploration Agency (JAXA), Institute of Aerospace Technology, 2-1-1 Sengen, Tsukuba, Ibaraki 305-8505 (Japan)], E-mail: imaizumi.mitsuru@jaxa.jp; Kibe, Koichi [Japan Aerospace Exploration Agency (JAXA), Institute of Aerospace Technology, 2-1-1 Sengen, Tsukuba, Ibaraki 305-8505 (Japan)], E-mail: kibe.koichi@jaxa.jp

    2008-02-29

    In this study, optical coatings were investigated as substitutes for the coverglass on flexible thin-film space solar cells. The inherent low emissivity of copper-indium-gallium-diselenide (CIGS) thin-film solar cells was increased using optical coatings for thermal balance in space. Evaporated silicon dioxide (SiO{sub 2}) and an additional aluminum oxide (Al{sub 2}O{sub 3}) coating on the CIGS solar cell increased the emissivity from 0.18 to 0.77. Higher emissivity was realized with the Al{sub 2}O{sub 3}/SiO{sub 2} double-layer coating than with the SiO{sub 2} single-layer coating. The straightforward double-layer coating gives the CIGS solar cells appropriate radiative properties for keeping the cell within a permissible temperature range in space.

  6. Desarrollo de una aplicación para la adquisición y análisis de la señal de presión intracraneal para la detección de hidrocefalia normotensa

    OpenAIRE

    Riboul Ojeda, Alexandra

    2011-01-01

    El objetivo es realizar una aplicación, partiendo de cero, que cumpla todas las expectativas y requisitos de los especialistas, sencilla en su uso, y que facilite diagnosticar problemas con rapidez. En concreto se trata del desarrollo de un software específico que permita el diagnóstico de hidrocefalia normotensa del adulto, el único tipo de demencia tratable y/o curable en la actualidad. El software debe permitir el análisis de la presión intracraneal de los pacientes, con lo que aunque l...

  7. Structural study of ZnSe films grown on substrate with In{sub x}Ga{sub 1-x}As and Al{sub 1-x}Ga{sub x}As buffer layers: strain, relaxation and lattice parameter

    Energy Technology Data Exchange (ETDEWEB)

    Perez Ladron de Guevara, H.; Gaona-Couto, A.; Vidal, M.A. [Instituto de Investigacion En Comunicacion Optica (IICO), Universidad Autonoma de San Luis Potosi, San Luis Potosi (Mexico)]. E-mail: mavidal@cactus.iico.uaslp.mx; Luyo Alvarado, J.; Melendez Lira, M.; Lopez-Lopez, M. [Departamento de Fisica, Centro de Investigacion y Estudios Avanzados del IPN, Mexico DF (Mexico)

    2002-06-21

    ZnSe layers of various thickness were grown on (001) GaAs substrates, using In{sub x}Ga{sub 1-x}As or Al{sub 1-x}Ga{sub x}As as buffer layers by molecular beam epitaxy and were studied by high-resolution x-ray diffraction. The principal structural characteristics of ZnSe layer and buffer layer were determined using several reflections, such as (004) and two pairs of coupled asymmetric reflections, namely (224), (-2-24) and (115) (-1-15). In order to evaluate their validity, the experimental data obtained from these reflections were handled by means of two known expressions found in the literature. We have found the relaxation process of ZnSe layers is well described by a geometrical model including the thermal strain and small strain due to work hardening. The relaxation process is faster for ZnSe grown on ternary buffer layers despite the fact that, some buffer layers are pseudomorphically grown to the substrate; therefore we conclude that not only the lattice mismatches have effect on the relaxation process but also the surface state of the buffer layer has an influence in this process. (author)

  8. Sobre Al-Qarmuniyya

    OpenAIRE

    Fierro Bello, María Isabel

    1990-01-01

    [ES] En dos tradiciones escatológicas relativas a al-Andalus y recogidas por 'Abd al-Malik h Haha en su Ta'rg se hace referencia a Carmona. La mención de esta ciudad en dichas tradiciones debe ser puesta en relación con dos episodios de la historia de al-Andalus que tuvieron lugar antes de la muerte de Ibn Habib: la batalla de Carmona en época de 'Abd al-Rahman y la concentración de tropas omeyas en el mismo lugar durante el ataque normando en los años 229-30/844-5.

  9. Orden ARM/2173/2010, de 30 de julio, por la que se crea y regula la Comisión de Coordinación de Bibliotecas del Ministerio de Medio Ambiente, y Medio Rural y Marino y de los organismos y entidades vinculadas al mismo

    OpenAIRE

    España Ministerio de Medio Ambiente y Medio Rural y Marino

    2010-01-01

    Con la constitución de la Comisión de Coordinación de las Bibliotecas del Ministerio de Medio Ambiente, y Medio Rural y Marino se persiguen dos fines: servir de instrumento de apoyo al estudio y por otro lado: que la riqueza de sus colecciones revierta de manera más eficaz en el conjunto de la sociedad en forma de mayor y más fácil accesibilidad por parte de los ciudadanos a todo el patrimonio bibliográfico

  10. Un manual español de administración y contabilidad señorial de principios de siglo XVII: el compendio en materia de acrecentar Estado y hazienda, tocante al oficio de contador, de Gabriel Pérez del Barrio Angulo. (A Spanish guide book on administration and accounting of the early 17th Century: the compendium for the increase of the state and treasury, with regards to the post of accountant, by Gabriel Pérez del Barrio Angulo)

    OpenAIRE

    González Ferrando, José Mª

    2013-01-01

    Frente a lo ocurrido en Inglaterra, donde cuentan con manuscritos sobre administración y contabilidad señorial desde el siglo XIII, en España sólo se conocen hasta ahora cuatro textos de los siglos XV al XVII en que sus autores se ocupan con mayor o menor detalle de este asunto, pero de los que sólo uno, publicado inicialmente en 1613, puede equipararse en cierto modo a los ingleses: el ‘Compendio en razón de acrecentar Estado y Hacienda y Oficio de Contador’ de Gabriel Pérez del Barrio. (Aga...

  11. El silencio y la memoria : "¿Cómo se puede tocar a Schubert por la noche, leer a Rilke por la mañana y torturar al mediodía?"

    OpenAIRE

    Mèlich i Sangrà, Joan Carles

    1997-01-01

    Este artículo es una reflexión sobre la filosofía de la educación de George Steiner. Según este autor, la crisis de la educación occidental es fundamentalmente una crisis de memoria, y el vigor de la memoria sólo puede sostenerse allí donde hay silencio. Hoy, en la sociedad occidental este orden de silencio tiende a convertirse en un lujo. Así, después del gran Acontecimiento, "después de Auschwitz", la educación necesita del silencio y de la memoria para que el Holocausto no se repita, y par...

  12. El materialisme com a antídot als subterfugis ontològics : «Contra filósofos: O ¿en qué se diferencia una mujer de un gato?»

    OpenAIRE

    Armengol Sans, Andrés

    2015-01-01

    La present nota crítica proposa realitzar un breu recorregut per les línies argumentatives generals de la darrera obra de Mercè Rius, Contra filósofos: O ¿en qué se diferencia una mujer de un gato? Partint d’una perspectiva històrica i filosòfica, l’autora s’endinsa en les arrels polítiques que han sustentat l’universalisme excloent del discurs filosòfic d’ençà de la metafísica platònica i artistotèlica, palesant l’arrelament biopolític de les suposades justificacions de caire misogin contra ...

  13. Mémoires et patrimonialisation d’un passé antéislamique : Mubârak al-Mîlî et l’ethnogenèse du peuple algérien

    OpenAIRE

    Hannouz, Aomar

    2014-01-01

    Dès les débuts de l’indépendance de l’Algérie, les nationalistes ont insisté sur son identité arabo-musulmane. L’islamisation de l‘Afrique du Nord était au fondement de la nation algérienne. Le passé antique de la région en devenait quasiment exclu de l’histoire temporelle et écrite. Grâce aux travaux de James MacDougall, on connaît bien l’importance de l’œuvre de Tawfîq al-Madanî (m. 1983) dans la construction d’une identité nationale algérienne. Or, celle d’un autre historien proche de l’As...

  14. Pouvoir et production urbaine à Tripoli Al-Fayhā’a (Liban) : quand l’illusio de la rente foncière et immobilière se mue en imperium

    OpenAIRE

    Dewailly, Bruno

    2016-01-01

    La recherche dont je présente aujourd’hui les résultats est en chantier depuis près de quinze ans. Géographe-urbaniste de formation, je m’y suis engagé dans l’optique d’une réflexion, en géographie politique et urbaine, centrée sur la question du pouvoir à l’échelle d’une agglomération libanaise : Tripoli al-Fayhā’a. Cet intérêt s’est construit et organisé autour de quatre questions principales :• En premier lieu, pourquoi, une dizaine d’années environ après la fin de la guerre civile (1990),...

  15. Evaluación cualitativa de la morfología de la señal fotopletismográfica en el diagnóstico de la insuficiencia arterial Qualitative evaluation of the morphology of the photopletismographic signal in the diagnosis of arterial insufficiency

    Directory of Open Access Journals (Sweden)

    Alfredo Aldama Figueroa

    2008-03-01

    Full Text Available Con el objetivo de evaluar las posibilidades de un análisis cualitativo simple de la curva fotopletismográfica AC para diagnosticar la insuficiencia arterial de miembros inferiores, se compararon los registros obtenidos en las extremidades de 289 pacientes diabéticos y 571 no diabéticos con los valores de índice tobillo/brazo realizado por método Doppler. Las señales fotopletismográficas fueron clasificadas en función de las características siguientes: presencia de señal, asimetría de la misma, características de la fase descenso y presencia de dicrotismo. Como regla de oro, se empleó el índice tobillo/brazo, y se consideró como normales los valores mayores o iguales que 0,9. Se encontraron valores de exactitud, sensibilidad y especificidad de 90,8%, 92% y 90% respectivamente para los pacientes no diabéticos. Los pacientes diabéticos, por su parte, mostraron valores de exactitud, sensibilidad y especificidad de 90%, 85% y 93% respectivamente. Se concluye que el análisis propuesto puede ser útil en el diagnóstico de la insuficiencia arterial.Aimed at evaluating the possibilities of a simple qualitative analysis of the photopletismographic curve AC for diagnosing the arterial insufficiency of the lower limbs, the registers obtained in the extremities of 289 diabetic patients and 571 non diabetic were compared with the values of the ankle/arm index obtained by Doppler method. The photopletismographic signals were classified according to the following characteristics: presence of signal, asymmetry of it, characteristics of the decrease phase and presence of dicrotism. The ankle/arm index was used as a gold standard and those values higher than or equal to 0.9 were considered normal. Values of exactness, sensitivity and specificity of 90.8 %, 92 % y 90 %, respectively, were found for the non diabetic patients. On the other hand, the diabetic patients showed values of exactness, sensitivity and specificity of 90 %, 85 % and 93

  16. Future strategy of SE

    International Nuclear Information System (INIS)

    In this presentation author (General Director of Slovenske elektrarne, a. s.) presents structure and investment plans of SE. The feasibility study of construction of the blocks 3 and 4 of the Mochovce NPP is presented

  17. Lo que no se puede decir: se muestra

    OpenAIRE

    Cerruti, Nicolás

    2015-01-01

    Lacan escribe mal, siempre me ha dado esa sensación. Lacan escribe tan mal que es ilegible. ¿Cómo, un sujeto que se esmeró tanto por el decir y sus límites, que enseñó tanto de lo simbólico y de los discursos, que nombró tanto al Otro, cómo puede ser que un sujeto así no haya encontrado la forma de escribir bien (para trasmitir aún mejor)? ¿Por qué no encontró mejores formas de decir? Si Freud era un maestro, con tanta belleza que hasta mereció un premio, ¿cómo es que Lacan no lo siguió en es...

  18. ALS Association

    Science.gov (United States)

    ... toward a world without ALS! Walk to Defeat ALS® Walk to Defeat ALS® draws people of all ... We need your help. I Will Advocate National ALS Registry The National ALS Registry is a congressionally ...

  19. Experimental Conditions: SE51_S01_M01_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available als: A plant-specific MS/MS-based data resource and database SE51_S01 L. japonicus accessions SE51_S01_M01 N....A. Not written in the paper. SE51_MS01 mQTL analysis SE51_DS01 ReSpect Default SE51_SS01 Metabolic profiling ...

  20. SE debt restructuring plan

    International Nuclear Information System (INIS)

    Slovenske elektrarne, a.s. (SE) plans to restructure one's own debts in 2003-2005. Debt restructuring plan is following: 2003: Collection of pre-payment on electricity - 60 million Euro (2.5 billion Slovak crowns), consumer unknown. Own promissory notes in total value of 100 million US$ (3.5 billion Slovak crowns) - in process. Sale of claims worth 2.4 billion Slovak crowns (57.21 million Euro) - negotiations in process. 2003/2004: Restructuring of loans payable IV. quarter 2003 and at the beginning of 2004 in value of 200 million Euro (8.3 billion Slovak crowns). Aim of SE is a new credit payable within 7 years, with instalments payable in the last two to three without any state subsidies. 2005: Loans worth 460 million Euro (189 billion Slovak crowns) will still remain. SE want to negotiate them with banks without state support

  1. A transferable force field for CdS-CdSe-PbS-PbSe solid systems

    International Nuclear Information System (INIS)

    A transferable force field for the PbSe-CdSe solid system using the partially charged rigid ion model has been successfully developed and was used to study the cation exchange in PbSe-CdSe heteronanocrystals [A. O. Yalcin et al., “Atomic resolution monitoring of cation exchange in CdSe-PbSe heteronanocrystals during epitaxial solid-solid-vapor growth,” Nano Lett. 14, 3661–3667 (2014)]. In this work, we extend this force field by including another two important binary semiconductors, PbS and CdS, and provide detailed information on the validation of this force field. The parameterization combines Bader charge analysis, empirical fitting, and ab initio energy surface fitting. When compared with experimental data and density functional theory calculations, it is shown that a wide range of physical properties of bulk PbS, PbSe, CdS, CdSe, and their mixed phases can be accurately reproduced using this force field. The choice of functional forms and parameterization strategy is demonstrated to be rational and effective. This transferable force field can be used in various studies on II-VI and IV-VI semiconductor materials consisting of CdS, CdSe, PbS, and PbSe. Here, we demonstrate the applicability of the force field model by molecular dynamics simulations whereby transformations are initiated by cation exchange

  2. SE-selskabet

    DEFF Research Database (Denmark)

    Schaumburg-Müller, Peer; Werlauff, Erik

    Bogen behandler den særlige, fælleseuropæiske aktieselskabstype, der står til valgfri disposition for virksomhederne i form af europæiske aktieselskaber, såkaldte SE-selskaber, som alene kan stiftes ved en grænseoverskridende transaktion.......Bogen behandler den særlige, fælleseuropæiske aktieselskabstype, der står til valgfri disposition for virksomhederne i form af europæiske aktieselskaber, såkaldte SE-selskaber, som alene kan stiftes ved en grænseoverskridende transaktion....

  3. Análisis matemático aplicado al diseño de sistemas de instrumentación electrónica para adquisición de señales en módulos robóticos

    OpenAIRE

    Morales, Diana; Cruz, Mary; Umaña, Oscar; Jimenez, Fabian

    2013-01-01

    Este artículo describe el análisis matemático de la implementación definitiva del diseño, simulación y construcción de los sistemas de instrumentación para la adquisición de la señal. La matemática aplicada permite el diseño de algoritmos y procedimientos para modelar, representar, simplificar y evaluar los sistemas electrónicos en aplicaciones industriales tales como la robótica, explorada en este proyecto. Este desarrollo matemático permite poner en práctica los sistemas electrónicos de ad...

  4. The Structure and Electrical Properties of the Ag2Se + Ga2Se3 + GeSe2 Glass System

    Science.gov (United States)

    Marple, Maxwell Adam Thomas

    Silver containing homogeneous chalcogenide glasses in the ternary system Ag2Se-Ga2Se3-GeSe2 (AGGS) are synthesized and their atomic structure-property relationships are investigated. Structural studies are carried out using Raman, 77Se, 71Ga, 69Ga, and 109Ag nuclear magnetic resonance (NMR) spectroscopy. The structure of these glasses consists primarily of a network of corner sharing (Ga/Ge)Se4/2 tetrahedra with a small fraction of homopolar Se-Se bonds. Compositional modification of the atomic structure follows the charge compensated network model developed in the literature for aluminosilicate glasses. Ag2Se acts as a network modifier, forming non-bridging Se in glasses with Ag/Ga >1, while Ga 2Se3 plays the role of a network intermediate similar to Al2O3 in oxide glasses. The network favors the formation of homopolar Ge-Ge bonding in glasses with Ag/Ga <1, to accommodate the Se deficiency brought by the incorporation of Ga2Se3 with Ga being tetrahedrally coordinated to Se. This structural model is consistent with the variation in the glass transition temperatures and molar volume. Electrical Impedance Spectroscopy (EIS) reveals the ionic conductivity of the AGGS glasses to be quite high at ambient temperature, reaching up to 10 --4 S/cm for glasses with the highest Ag content. Increasing Se deficiency with respect to stoichiometry can enhance the conductivity further to ˜3x10--4 S/cm . Transference number measurements using the electromotive force (EMF) method as well as variable temperature 109Ag NMR line shape studies indicate that the conductivity is predominantly ionic in nature and results from fast hopping dynamics of Ag ions. The high ionic conductivity can be related to a heavily modified structural network that results in a potential energy landscape with many suitable hopping sites for the Ag ions. These structural characteristics and electrical properties of the glasses in the AGGS system may guide in the development of next generation fast ion

  5. Se min kjole

    DEFF Research Database (Denmark)

    Bogen Se min kjole udkom i anledning af 50-året for de første ordinationer af kvindelige præster i den danske folkekirke i 1948. Bogen giver analyser af, hvad kvindelige præster har betydet for præsterollen og for prædikengenren; den fortæller om de første kvindelige præsters liv og syn på...

  6. Se il PSI va al governo. Un documento serio

    Directory of Open Access Journals (Sweden)

    Paolo Sylos Labini

    2014-03-01

    Full Text Available The author discusses the “Nota sull’attuale congiuntura economica in Italia e sulle politiche per fronteggiarla”, a document prepared by the Italian Socialist Party (PSI in sight of its access to government. The Italian economy risks entering a prolonged crisis unless a number of reforms are undertaken, aimed at boosting innovation, reforming the public administration, investing in education.

  7. Autosalon se servisem

    OpenAIRE

    Wilkonský, Roman

    2015-01-01

    Diplomová práce se zabývá zpracováním projektové dokumentace pro provádění stavby. Stavba je navržená jako autosalon se servisem. Stavební parcela se nachází v katastrálním území Ostrava - Vítkovice. Projektová dokumentace je zpracována v souladu s platnými zákony, vyhláškami a normami. Stavba je funkčně rozdělena na dva objekty a to výstavní sál s administrativním a sociálním zázemím a servisní část s myčkou a sociálním zázemím. Tyto dva objekty jsou provozně a stavebně propojeny. Nejdelší p...

  8. El pensamiento frente al arte

    OpenAIRE

    Bergmann, Antonio

    2012-01-01

    Es un hecho histórico de gran importancia el que el hombre haya creado arte antes de haberse dedicado a la filosofía. Al mencionar esto no pienso en las pinturas pre-históricas que se encuentran en las cuevas de España y en el Sur de Francia, sino ante todo, en el arte egipcio y mesopotámico.  En Egipto y Mesopotamia --y Mesopotamia parece ser la región más importante -no nació sino que se creó al hombre humano, al hombre como ser arquitectónico.

  9. Türkiye’de Seçilmiş Bazı İllerde Arı Ürünlerinin Tüketim Alışkanlıklarının ve Farkındalık Düzeylerinin Belirlenmesi

    Directory of Open Access Journals (Sweden)

    Rahşan İvgin Tunca

    2015-07-01

    Full Text Available Bu çalışmanın amacı, Türkiye genelinde seçilmiş illerde, bal başta olmak ve arı ürünleri tüketimini etkileyen faktörler ile arı ürünlerinin tüketim alışkanlık ve farkındalık düzeylerini değerlendirmektir. Çalışmanın ana materyalini, 2014 yılı içerisinde Batman, Bursa, Diyarbakır, Erzincan, Kayseri, Kırşehir, Mersin, Muğla, Muş, Ordu ve Samsun illerinden tesadüfî olarak seçilen 1112 kişiye yapılmış olan anket çalışmasından elde edilen orijinal veriler oluşturmuştur. Çalışmadaki veriler iki kısımda incelenmeye alınmıştır. İlk kısım ankete katılanların bal tüketim alışkanlık ve farkındalıklarını içerirken, ikinci kısımda bireylerin polen, propolis, arı sütü ve zehiri gibi arı ürünlerinin kullanım tercihleri incelenmiştir. Her bir kısım için arı ürünleri üzerinde çalışılan değişkenlere ait verilere çok değişkenli lojistik regresyon modeli uygulanmıştır. Araştırma sonuçlarına göre, tüketicilerin % 39.6’sı aylık olarak 0-500 gram arasında bal tükettiği tespit edilmiştir. Tüketicilerin % 51.2’ si balı genel olarak tanıdıklardan, % 41’i ise market ve pazardan aldıklarını belirtmişlerdir. Televizyonda yapılan reklamları inandırıcı bulanların oranı % 5.9 olarak belirlenmiştir. Bal kullananların % 45.8’ i balın kalitesini anlayabildiğini ifade etmişlerdir. Marka olmasına dikkat edenlerin oranı % 52.7 olarak belirlenmiştir. Tüketicilerin yaşı, balı nereden aldığı, balda marka tercihi ve bal reklamlarını inandırıcı bulma durumları 0.05’e göre, eğitim seviyesi, aylık gelir, bal tipi tercihi ve bal reklamından etkilenme durumları ise 0.01’e göre önemli bulunmuştur. Tüketicilerin propolis, polen, arı zehri ve arı sütünü duyma oranları sırasıyla % 28.2 , % 22.9, % 56.8 ve % 23.3 olarak belirlenmiştir. Sonuç olarak çalışma, tüketicilerin arı ürünlerinin faydaları konusunda

  10. De GPS al mapa

    Directory of Open Access Journals (Sweden)

    Esteban Dörries

    2016-03-01

    Full Text Available Las coordenadas Lambert obtenidas a partir de mediciones con equipos GPS de mano, llamados a veces navegadores, en ciertos casos confunden al usuario, por diferir claramente de su posición real al ser graficadas en un mapa del Instituto Geográfico Nacional (IGN: Esto puede resolverse con suficiente exactitud mediante una transformación de Molodensky, seguida de la correspondiente proyección cartográfica. Sin embargo, los tres parámetros necesarios para la transformación, supuestamente válidos para Costa Rica, se encuentran en muchas variantes y producen obviamente resultados diferentes. En este trabajo se analizan los fundamentos del problema y sus posibles soluciones, culminando con un estudio comparativo de ocho casos, que permite seleccionar los valores más adecuados para los parámetros.

  11. Factores asociados al bajo peso al nacer

    OpenAIRE

    Georgina J Peraza Roque; Silvia de la C Pérez Delgado; Zoe de los A Figueroa Barreto

    2001-01-01

    El bajo peso al nacer (BPN) ha constituido un enigma en la ciencia a través de los tiempos. Múltiples son las investigaciones realizadas acerca de las causas que lo producen y las consecuencias que provoca. Su importancia no solo radica en lo que significa en la morbilidad y la mortalidad infantil, sino que estos niños tienen habitualmente múltiples problemas posteriores. El Programa para la Reducción del BPN señala que los niños nacidos con un peso inferior a los 2 500 g presentan riesgo de ...

  12. Blacasset, “Se·l mals d’amor m’auzi ni m’es noisens” (BdT 96.10a; Pujol, “Dieus es amors e verais salvamens” (BdT 386.2; Alaisina ~ Carenza, “Na Carenza al bel cors avenenç” (BdT 12.1 = 108.1

    Directory of Open Access Journals (Sweden)

    Paolo Di Luca

    2012-09-01

    Full Text Available This paper provides a new critical edition of “Se·l mals d’amor m’auzi ni m’es noisens” by Blacasset and “Dieus es amors e verais salvamens by Pujol”. These two poets discuss a topic that is entirely new to Occitan lyric poetry: two young women about to enter a convent. While Blacasset expresses sadness about their choice of life in a convent, using elements of the funeral lament, Pujol praises it and believes it to be the only remedy for the corruption of the world. The tenso between women “Na Carenza al bel cors avenenç” seems to be conceived as a parody of this lyric debate: in the dialogue Alaisina and Yselda, who have doubts about becoming mothers, ask Na Carenza whether it is better to stay virgins or to marry; the latter advises them, in cryptic terms that are difficult to interpret, to become nuns, thereby gaining a husband (God but not children. I will suggest that the question of female authorship for this text be reconsidered, while proposing a new interpretation in the light of the lively debate in the medieval period about the suitability and prerogatives of virginity.

  13. Vorrats-SE ohne Arbeitnehmerbeteiligung

    OpenAIRE

    Blanke, Thomas

    2005-01-01

    Das neue Praxisfeld der SE wirft eine Fülle von Rechtsfragen auf. In Deutschland ist im März 2005 in Berlin die 'Go East Invest SE. Europäische Gesellschaft zur Industrieansiedlung und Markterschließung' in das Handelsregister eingetragen worden, obwohl entgegen Art. 12 Abs.2 SE-VO keine Regelung zur Arbeitnehmermitbestimmung getroffen wurde. Seit Oktober nimmt auch bereits der Handel mit Vorrats-SE Gestalt an. Vorrats-SE sind Gesellschaften, die allein zum Zweck des Handels mit dem SE-Mantel...

  14. Patrimonio cultural: lo intangible se hace tangible

    Directory of Open Access Journals (Sweden)

    William Heredia Orjuela

    2004-11-01

    Full Text Available Se presentan tres reflexiones a manera de ensayo, elaboradas por estudiantes de vii semestre de la Facultad de Administración de Empresas Turísticas y Hoteleras. El tema central que engloba los escritos es el de la responsabilidad frente al patrimonio cultural, su valoración y su relación con el turismo. En el ensayo La protección del patrimonio cultural como reflejo del ser humano, la estudiante cecilia hinosTrosa hace un llamado de atención frente al problema del tráfico ilícito de bienes que conlleva la pérdida de testimonios de la cultura humana. El escrito de la estudiante mariel cecilia hernández destaca las bondades de recuperar las tradiciones y de cómo éstas se pueden difundir a través del turismo. Por último, el estudiante William heredia hace una reflexión sobre la tangibilidad de lo intangible, en el ensayo Patrimonio Cultural: lo tangible se hace intangible, donde destaca la declaratoria del Carnaval de Barranquilla como patrimonio oral e intangible de la humanidad.

  15. Electron-impact ionization of Se2+ and Se3+

    Science.gov (United States)

    Pindzola, M. S.; Loch, S. D.

    2016-06-01

    Electron-impact ionization cross sections for Se2+ and Se3+ are calculated using a semi-relativistic configuration-average distorted-wave (CADW) method. Good agreement between the CADW calculations and recent experimental measurements are found for the single ionization of Se2+ from threshold to 500 eV and for the double ionization of Se2+ from threshold to 225 eV. Good agreement between the CADW calculations and recent experimental measurements are also found for the single ionization of Se3+ from threshold to 200 eV and for the double ionization of Se3+ near the peak of the cross section at 350 eV. Disagreements at other incident electron energies may be due to the complexity of the ionization pathways for low charged Se atomic ions, the various theoretical approximations, and the difficulty in measuring relatively small double ionization events.

  16. CdSe/ZnSe heteroepitaxy: Aspects of growth and self organization of nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, S.; Kiessling, T.; Astakhov, G.V.; Bass, U.; Schmitt, F.; Schumacher, C.; Ossau, W.; Geurts, J.; Molenkamp, L.W.; Brunner, K. [Universitaet Wuerzburg, Physikalisches Institut, EP3, Am Hubland, 97074 Wuerzburg (Germany); Margapoti, E.; Renner, J.; Schmidt, T.; Worschech, L.; Forchel, A. [Universitaet Wuerzburg, Physikalisches Institut, Technische Physik, Am Hubland, 97074 Wuerzburg (Germany); Bougerol, C. [CEA-CNRS NPSC, SP2M/DRFMC/CEA-Grenoble, 17 rue des Martyrs, 38054 Grenoble cedex (France); Bendounan, A.; Reinert, F. [Universitaet Wuerzburg, Physikalisches Institut, EP2, Am Hubland, 97074 Wuerzburg (Germany)

    2007-07-01

    Formation and properties of quantum dots (QDs) and related nanostructures by conventional molecular beam epitaxy (MBE) and two other variants of the technique, have been systematically investigated. While MBE growth of CdSe on ZnSe at 300 C results in the formation of rough CdSe quantum-well-like structures, by one of the variants, which combines epitaxial growth of a CdSe layer at 230 C and subsequent in-situ annealing at 310-340 C, tiny but distinct three-dimensional (3D) QDs are formed. We demonstrate that QD formation by this method, developed originally by Rabe et al. (J. Cryst. Growth 184/185, 248 (1998) [30]), essentially takes place during the annealing step, by a process of ''controlled roughening'' of the as-grown quasi-two-dimensional (2D) CdSe layer. In comparison to conventional MBE, this process results in reduction of the areal density of the self-organized QDs by up to two orders of magnitude, thus making them distinctly discernible. In the second variant technique, similar to that applied originally for the self-organization of CdTe/ZnTe quantum dots by Tinjod et al. (Appl. Phys. Lett. 82, 4340 (2003)), QD-formation takes place as a result of deposition of an amorphous group-VI layer onto a strained 2D CdSe layer at {proportional_to}50 C, and its subsequent re-desorption at temperatures of 280-320 C. While deposition and desorption of amorphous Se leads to the formation of large isolated QDs, we show that use of amorphous Te results in the self-assembly and ordering of a rich variety of nanostructures. Luminescence, morphology, and composition of QDs and the underlying formation mechanism of the three processes are discussed in detail. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  17. Prevalência de sinais/sintomas sugestivos de sensibilização ao látex em profissionais de saúde Prevalencia de señales/síntomas sugestivos de sensibilidad al l átex en profesionales de la salud Prevalence of signs/symptoms suggestive of latex sensitization in health care workers

    Directory of Open Access Journals (Sweden)

    Lígia Andrade da Silva Telles Mathias

    2006-04-01

    rea de la salud. El objetivo de este estudio fue el de evaluar la prevalencia de señales/síntomas sugestivos de sensibilidad al látex en profesionales del área de la salud. MÉTODO: Después de aprobado por el Comité de Ética, se seleccionaron individuos pertenecientes a la plantilla de la institución: funcionarios del Sector de Limpieza, Contabilidad y División de Enfermería del Centro Quirúrgico; Médicos de Cirugía, Ginecología, Obstetricia, Anestesiología, Unidad de Terapia Intensiva y Clínica Médica. Después de recibir la información y consentir con la pesquisa, los individuos fueron sometidos a un cuestionario sobre: edad, sexo, categoría profesional; tipo y tiempo de contacto profesional con los derivados del látex; tipo de guante utilizado; señales/síntomas sugestivos de sensibilidad al látex dentro y fuera del ambiente hospitalario; señales/síntomas sugestivos de atopia y de alergia a alimentos. RESULTADOS: Fueron evaluados 326 cuestionarios (193 mujeres y 133 hombres, con edad entre 30 y 73 años. Un 75% de los encuestados tenían 10 años de profesión. La prevalencia de los señales/síntomas sugestivos de sensibilidad al látex dentro del ambiente hospitalario con relación a los grupos compuestos por los funcionarios del Sector de Contabilidad (no expuestos a derivados del látex en el ambiente de trabajo, y el resto de los individuos (expuestos a derivados del látex en el ambiente de trabajo, evidenció una diferencia significativa (p BACKGROUND AND OBJECTIVES: In the literature, the references on adverse reactions to latex products have been significantly increasing for the last few years. However, it lacks Brazilian data regarding the prevalence of latex-related sensitization in health care workers. The objective of this study was to evaluate the prevalence of signs and symptoms suggestive of latex-related sensitization in health care workers. METHODS: Upon approval by the Ethics Committee it were selected a population of

  18. As and Se interactions with fly ashes

    OpenAIRE

    López Antón, María Antonia; Díaz Somoano, Mercedes; Martínez Tarazona, María Rosa

    2012-01-01

    [ES] El arsénico y el selenio son elementos tóxicos presentes en el carbón en concentraciones del orden de las trazas que pueden ser emitidos al medio ambiente durante los procesos de conversión del carbón. Sin embargo, los compuestos de arsénico y selenio pueden ser retenidos en las cenizas volantes originadas en el propio proceso en distint as proporciones dependiendo de las características de las cenizas y las condiciones del proceso. Este trabajo se centra en...

  19. Derivados vinculados al seguro.

    Directory of Open Access Journals (Sweden)

    De Paz Cobo, Sonia

    2003-01-01

    Full Text Available El presente trabajo tiene como objetivo la presentación de los derivados financieros como instrumentos de cobertura de los riesgos del seguro, así como de los principales proyectos que se desarrollan a través de los mismos, como por ejemplo los derivados sobre el clima. Hay que tener presente las pérdidas multimillonarias ocasionadas en casos como el de la banca Baring’s, o el de Orange County, por citar algunas, que si bien ciertos autores afirman que están en relación directa con el uso de estos productos, no podemos olvidar que los instrumentos derivados se desarrollaron con el objetivo principal de proteger al usuario de la posible volatilidad del activo subyacente. Ya en la industria aseguradora los derivados vinculados a tal actividad son instrumentos donde el pago se condiciona a la ocurrencia de su suceso de siniestro, o serie de sucesos múltiples que disparen las pérdidas. Tras el repaso efectuado y la descripción que este tipo de instrumentos puede tener en la gestión del riesgo por parte de la industria aseguradora, concluiremos con la exposición de las relaciones con el reaseguro tradicional así como una breve referencia al futuro de este tipo de instrumentos

  20. Gliricidia sepium al establecimiento

    Directory of Open Access Journals (Sweden)

    J. L. Valle

    2004-01-01

    Full Text Available Se asoció Cenchrus ciliaris (Cc y Gliricidia sepium (Gs para evaluar la producción de biomasa y la composición química de los forrajes en la fase de establecimiento, en el estado de Morelos, México, en condiciones de trópico seco. Se empleó un análisis de varianza con diseño en bloques al azar, en donde T1 fue pasto solo, T2 Cc más Gs con 5,000 plantas ha-1 y el T3 Cs más Gs con 14,285 plantas ha-1. Se midió la producción de forraje individual y asociado con materia seca (t MS/Ha, la altura (A en cm, la proteína cruda (PC%, las fracciones de fibra (FDN% y FDA% y la digestibilidad in vitro de la materia seca (DIVMS%. El T3 tuvo una mejor producción de biomasa (P0.05. La asociación de 14,285 plantas ha-1 de G. sepium con pasto Cenchrus ciliaris mejoró la producción de biomasa y la disponibilidad total de nutrientes por superficie cultivada al establecimiento

  1. Solid solutions CuAlxIn1-xSe2

    International Nuclear Information System (INIS)

    Solid CuAlxIn1-xSe2 solutions are synthesized by fusion with vibration. Phase equilibrium state diagram in CuInSe2-CuAlSe2 system is plotted by XRPA and DTA methods and the system thermodynamic analysis is performed. Thermal expansion anisotropy of CuAlSe2, CuInSe2 compounds and solid solutions on their base is studied. It is ascertained that coefficient of expansion along C axis is much lower than the coefficient of expansion along the direction, perpendicular to it; practically linear dependence of both expansion coefficients on the composition is observed at all temperatures. 16 refs.; 5 figs

  2. Recursos para visualizar algunas paradojas que se producen en el planeta Mercurio

    OpenAIRE

    Esteban, Esteban

    2011-01-01

    En este trabajo se exponen una serie de circunstancias muy curiosas que se producen en el planeta Mercurio, relativas al movimiento del Sol respecto a su horizonte. También se explica la manera de hacer un modelo que permita visualizar algunas de ellas y la forma de escenificar otras.

  3. Investigation of Se(IV) sorption on Na-kaolinite. Batch experiments and modeling

    International Nuclear Information System (INIS)

    Se(IV) sorption on purified Na-kaolinite was investigated under ambient temperature as functions of contact time, pH, ionic strength and Se(IV) concentration using batch techniques. The rate of sorption is relatively rapid and sorption kinetics of Se(IV) can be successfully described by the pseudo-second-order model. The amount of Se(IV) sorbed was moderately dependent on the solution pH but insensitive to ionic strengths. The sorption/desorption isotherms of Se(IV) show that the sorption process is reversible. A double layer model was set up and used to quantitatively interpret the experimental data. Three surface complexes (≡Al)2SeO3, ≡ AlSeO3- and ≡AlOHSeO32- were proposed which satisfactorily fit our data. (author)

  4. Del latín al rumano

    Directory of Open Access Journals (Sweden)

    Montes Giraldo José Joaquín

    2003-06-01

    Full Text Available

    Marius Sala, Del latín al rumano. Versión española de Valeria Neagu, París, Unión Latina - Bucarest, Univers enciclopedic, 2002. El texto se dirige al lector corriente, no especialista, y por eso el aparato técnico-bibliográfico no se presenta en el curso de la exposición.

  5. La realidad aumentada aplicada al periodismo impreso

    OpenAIRE

    Picón Masero, Horacio

    2014-01-01

    El presente trabajo de fin de grado se trata de un estudio de casos sobre la realidad aumentada aplicada al periodismo impreso. En un primer lugar, se realiza un repaso de la situación actual del periodismo. Desde un punto de vista histórico se analizan las causas del momento en el que nos encontramos, una situación de crisis del modelo tradicional de empresa periodística por varios factores se enumeran en este estudio. Se incorporan, además, diversos datos estadísticos que arrojan cifras de ...

  6. Sample Set (SE): SE20 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE20 Arabidopsis thaliana leaf metabolite analysis for a software test Investigatio...es that were investigated to optimize the parameters of PowerGet software for better metabolite annotation i

  7. Sample Set (SE): SE12 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE12 Effect of agricultural films for spinach leaf metabolites Investigation of Spi...nacia oleracea leaf metabolites. 2 cultivars (Nihon and Wasesaradaakari), 2 growth conditions (normal film and UV film

  8. Sample Set (SE): SE14 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE14 Effect of agricultural films for tomato fruit metabolites Investigation of Sol...anum lycopersicum fruit metabolites. 3 growth conditions (covered with normal or UV cut agricultural film or no agricultural

  9. Sample Set (SE): SE16 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE16 Effect of agricultural films for spinach leaf metabolites 2 Investigation of S...pinacia oleracea leaf metabolites. 3 growth conditions (covered with normal or UV cut agricultural film or no agricultural

  10. Sample Set (SE): SE10 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE10 Effect of phosphorus nutrition for cabbage metabolites Investigation of Brassi...ca oleracea var. capitata Hatukoi leaf metabolites. 3 growth conditions (high, low and no phosphorus nutrition

  11. Sample Set (SE): SE37 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE37 Medicago truncatula shoot metabolite analysis using stable isotopes Metabolite...formed to estimate the elemental composition with high reliability using the number of stable isotopes incor

  12. Distribución espacial de señales de cambio climático en Colombia

    OpenAIRE

    Ochoa Jaramillo, Andrés; Poveda Jaramillo, Germán

    2008-01-01

    Se analiza si las tendencias de cambio climático detectadas por Mesa et.al. (1997) siguen algunos patrones espaciales. Asi mismo se evalúo la coherencia local entre las tendencias de cambio en las distintas variables.

  13. CdSe quantum dot in vertical ZnSe nanowire and photonic wire for efficient single-photon emission

    DEFF Research Database (Denmark)

    Cremel, Thibault; Bellet-Amalric, Edith; Cagnon, Laurent;

    obtained conformal dielectric coating of Al2O3 on the NW-QDs using Atomic Layer Deposition so that a photonic wire is formed with the CdSe QD deterministically positioned on its axis. The collection enhancement effect is studied by measuring the emission (with pulse excitation, at saturation intensity) of...... a single photon source. We have grown vertically oriented ZnSe NWs (with typical diameter of 10 nm) by molecular beam epitaxy on a ZnSe(111)B buffer layer. The growth of a ZnMgSe passivating shell increases the (otherwise weak) ZnSe near-band-edge luminescence by two orders of magnitude. This has...

  14. Trato verbal paterno al adolescente

    Directory of Open Access Journals (Sweden)

    Rodríguez Juan Carlos

    1995-06-01

    Full Text Available

    En alguna ocasión se ha escuchado una palabra, que causa un sentimiento y a la vez un recuerdo, que lleva a evocar la adolescencia o la infancia, se recuerda quien la pronunciaba y en que ocasión la decía. Este es el poder que tiene una palabra y más aún si es dicha por el padre, puesto que este es la figura significativa que se lleva en la memoria. De aquí nace el interés de realizar un estudio, en donde se describe y analice la percepción y el sentimiento del adolescente, quien en esta etapa es vulnerable al cambio, ya que está buscando su propia identidad; que con el trato verbal paterno la encontrara sin ninguna dificultad o por el contrario nunca la encontrará.

     

  15. Señas Mexicano

    Directory of Open Access Journals (Sweden)

    Juan F. García Mejía

    2007-01-01

    Full Text Available En este artículo se muestra un sistema que permite el estudio y práctica del Lenguaje de Señas Mexicano (LMS, el cual es el método de comunicación de las personas que padecen un trastorno de procesamiento auditivo. El sistema propuesto en este artículo consta de un guante de tela instrumentado con sensores de flexión, una etapa de acondicionamiento de señales y una tarjeta de adquisición de datos; que en su conjunto constituyen el Hardware. El software esta formado por un programa de adquisición de datos y una interfaz de usuario, ambos codificados en Visual Basic Net. El sistema propuesto se modela por medio del lenguaje de modelado unificado (UML, ya que Visual Basic es un lenguaje orientado a eventos.

  16. Periodistas: el acceso al mercado laboral

    OpenAIRE

    2006-01-01

    El presente estudio analiza la situación profesional de los Licenciados en Periodismo en España. Para ello esta investigación sigue la lógica del proceso de acceso al mercado laboral, es decir, se estudia, en primer lugar, la oferta de egresados y las demandas del sector; a continuación, se analiza la forma en la que un titulado en la Licenciatura de Periodismo accede al mercado laboral y el tiempo que tarda en hacerlo; y por último, se examinan los medios de comunicación en lo...

  17. AL Amyloidosis

    Directory of Open Access Journals (Sweden)

    Desport Estelle

    2012-08-01

    Full Text Available Abstract Definition of the disease AL amyloidosis results from extra-cellular deposition of fibril-forming monoclonal immunoglobulin (Ig light chains (LC (most commonly of lambda isotype usually secreted by a small plasma cell clone. Most patients have evidence of isolated monoclonal gammopathy or smoldering myeloma, and the occurrence of AL amyloidosis in patients with symptomatic multiple myeloma or other B-cell lymphoproliferative disorders is unusual. The key event in the development of AL amyloidosis is the change in the secondary or tertiary structure of an abnormal monoclonal LC, which results in instable conformation. This conformational change is responsible for abnormal folding of the LC, rich in β leaves, which assemble into monomers that stack together to form amyloid fibrils. Epidemiology AL amyloidosis is the most common type of systemic amyloidois in developed countries with an estimated incidence of 9 cases/million inhabitant/year. The average age of diagnosed patients is 65 years and less than 10% of patients are under 50. Clinical description The clinical presentation is protean, because of the wide number of tissues or organs that may be affected. The most common presenting symptoms are asthenia and dyspnoea, which are poorly specific and may account for delayed diagnosis. Renal manifestations are the most frequent, affecting two thirds of patients at presentation. They are characterized by heavy proteinuria, with nephrotic syndrome and impaired renal function in half of the patients. Heart involvement, which is present at diagnosis in more than 50% of patients, leading to restrictive cardiopathy, is the most serious complication and engages prognosis. Diagnostic methods The diagnosis relies on pathological examination of an involved site showing Congo red-positive amyloid deposits, with typical apple-green birefringence under polarized light, that stain positive with an anti-LC antibody by immunohistochemistry and

  18. La desaceleración económica colombiana: se cosecha lo que se siembra

    Directory of Open Access Journals (Sweden)

    Carlos Humberto Ortiz

    2009-12-01

    Full Text Available La desaceleración económica que experimenta Colombia desde 1980 se explica por el estancamiento estructural de la economía y por la escalada de violencia relacionada con la expansión del narcotráfico. Los datos disponibles no rechazan esta hipótesis. El artículo plantea que la desindustrialización y el narcotráfico se forjaron en el mismo crisol: un modelo de desarrollo que ha integrado progresivamente la economía nacional a los mercados mundiales al tiempo que ha renunciado, también progresivamente, a la opción industrialista. Además, argumenta que la explosión del narcotráfico obedece a la profundización de la guerra contra las drogas en un contexto de demanda mundial creciente e inelástica.

  19. Diagrama de fases de las aleaciones (CuGaSe2)1-x(FeSe)x (0≤x≤0.5)

    OpenAIRE

    Miguel Soto; Pedro Grima-Gallardo; Miguel Quintero; Menjamin Salas; Marcos Muñoz; Sonia Durán; Luis Nieves; Ekadink Moreno; Ramos, Miguel A.; José M Briceño

    2013-01-01

    Se prepararon muestras policristalinas del sistema de aleaciones (CuGaSe2)1-x (FeSe)x en el rango de composiciones (0≤x≤0,5) por la técnica de fusión y recocido. Los productos fueron analizados usando las técnicas de Difracción de Rayos X (DRX) y Análisis Térmico Diferencial (ATD). Del análisis de los resultados experimentales se propone un diagrama de fases, T-x, en la región de composiciones cercana al CuGaSe2

  20. De los derechos humanos al derecho al aborto

    OpenAIRE

    Zúñiga Fajuri, Alejandra

    2013-01-01

    Ninguna otra persona, en ninguna situación, es obligada a realizar el acto supererogatorio que se exige a la mujer embarazada. Aun cuando una adecuada aplicación de la teoría general de los derechos humanos permite reconocer el derecho al aborto durante los dos primeros trimestres del embarazo sobre la base de que los derechos sólo pueden restringirse por mor de los propios derechos. En esa línea, se intenta responder a quienes sostienen que el problema del aborto no puede resolverse pues no ...

  1. Ecuador: cuando la inestabilidad se vuelve estable

    Directory of Open Access Journals (Sweden)

    Pachano , Simón

    2005-09-01

    Full Text Available El presente artículo busca explicaciones para los derrocamientos de tres presidentes ecuatorianos, que han marcado los puntos culminantes de una década de inestabilidad. Lo hace indagando en el campo de las movilizaciones sociales que precedieron a cada uno de esos hechos, con especial referencia a su composición social y a los objetivos de sus integrantes. En la parte final se proponen algunas hipótesis acerca de la movilización en contra del gobierno de Gutiérrez. Sugiere que no son válidas las explicaciones de racismo y de temor clasista. Enlaza la explicación al surgimiento de reivindicaciones democráticas originadas tanto en los bajos rendimientos del sistema político como en el carácter dictatorial que iba tomando el último gobierno.

  2. Sample Set (SE): SE27 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE27 Effect of agricultural films for cabbage leaf metabolites Investigation of Bra...ssica oleracea var. capitata YR Tenkuu leaf metabolites. 3 growth conditions (covered with normal or UV cut agricultural... film or no agricultural film), 3 replicates data are examined. Takeshi Ara 1, Naoki Yamamoto 1,

  3. Sample Set (SE): SE58 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE58 Exploring matrix effects and quantification performance in metabolomics experiments using artificial...ificial biological gradients is a general and inexpensive tool for calibration that... the peaks but also highlights cases with strong background-dependent signal interference. Analysis of art

  4. Sample Set (SE): SE56 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE56 MS/MS spectral tag-based annotation of non-targeted profile of plant secondary...sis, resulting in clarification of the functions of reported genes involved in glycosylation of flavonoids. Thus, non-target

  5. Procesamiento de señales de radar en presencia de clutter dinámico

    OpenAIRE

    Pascual, Juan Pablo

    2014-01-01

    El radar es un sistema de sensado remoto que utiliza técnicas de procesamiento estadístico de señales para obtener información de la señal recibida. Los radares convencionales son sistemas activos que operan transmitiendo energía en forma de ondas electromagnéticas y recibiendo las señales reflejadas por el entorno y el objeto iluminado. Una de las dificultades a tener en cuenta en los sistemas de radar es que la señal de interés suele encontrarse obscurecida por las reflexiones producidas...

  6. Editorial: Cartas al Editor

    Directory of Open Access Journals (Sweden)

    Guillermo Llanos

    2006-06-01

    Full Text Available En todas las revistas biomédicas del mundo existe una sección habitual denominada como el título de este editorial y que en Colombia Médica la llamamos correspondencia. Este espacio tiene como objetivo fundamental que los lectores escriban a los autores (investigadores comentando los artículos que se han publicado en números anteriores de la revista. Las cartas son, entonces, breves comentarios de desacuerdo o acuerdo (conceptual, metodológico, interpretativo sobre falencias ubicadas por un lector alerta al tema debatido en cualquiera de las secciones como en los artículos originales, editoriales, revisiones, presentación de casos, etc. publicados previamente en la revista. Las cartas deben permitir el intercambio de opiniones y formas de pensar y analizar los problemas planteados entre los autores y los lectores. En ocasiones una serie de cartas motivadas por un artículo original puede ser tan o más interesante como el artículo que generó la correspondencia. Las cartas son también un formato adecuado para comunicar un hecho novedoso de una observación clínica juiciosa no descrita antes. Un ejemplo de ello es la carta de un gineco-obstetra australiano cuando informó a Lancet los primeros efectos adversos informados de la talidomida. Colombia Médica, a pesar de mantener vigente esta sección, no ha sido muy afortunada en establecer una buena cultura del envío de cartas al editor. Pero últimamente han llegado juiciosas observaciones a las cuales se les ha dado prioridad en su publicación. Toda carta que comenta los hallazgos de un artículo es enviada a los autores para su respuesta, porque ello genera el debate académico buscado, y luego se publican, tanto la carta como su respuesta. El Estilo Vancouver recomienda que la carta y su respuesta deban ser breve, no pasar de dos o tres párrafos y contener sólo cuatro o cinco referencias. En lo posible (a menos que sea indispensable no presentar ni cuadros ni gráficos. El t

  7. Significados y funciones del "se"

    Directory of Open Access Journals (Sweden)

    Lidia Contreras

    2004-06-01

    Full Text Available En este artículo la autora se limita a comentar críticamente lo que la Real Academia Española de la Lengua (cit. Ac. dice en su "Gramática de la lengua española" de 1931 (Madrid, Espasa-Calpe, S. A. con respecto a los diversos tipos de "se" que ella toma en cuenta, comentario que pretende mostrar una mayor diversificación que la establecida en la mencionada obra. (In this article, its author offers a critical commentary of the position taken by The Spanish Royal Academy of Language (RAE in Gramática de la lengua española (1931 on the subject of "Uses of 'se'". The author intends to show a greater variety of uses than those proposed by RAE.

  8. AgSbSe{sub 2} and AgSb(S,Se){sub 2} thin films for photovoltaic applications

    Energy Technology Data Exchange (ETDEWEB)

    Garza, J.G. [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Shaji, S. [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Facultad de Ingenieria Mecanica y Electrica, CIIDIT - Universidad Autonoma de Nuevo Leon, Apodaca, Nuevo Leon (Mexico); Rodriguez, A.C.; Das Roy, T.K. [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Krishnan, B., E-mail: kbindu_k@yahoo.com [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Facultad de Ingenieria Mecanica y Electrica, CIIDIT - Universidad Autonoma de Nuevo Leon, Apodaca, Nuevo Leon (Mexico)

    2011-10-01

    Silver antimony selenide (AgSbSe{sub 2}) thin films were prepared by heating sequentially deposited multilayers of antimony sulphide (Sb{sub 2}S{sub 3}), silver selenide (Ag{sub 2}Se), selenium (Se) and silver (Ag). Sb{sub 2}S{sub 3} thin film was prepared from a chemical bath containing SbCl{sub 3} and Na{sub 2}S{sub 2}O{sub 3}, Ag{sub 2}Se from a solution containing AgNO{sub 3} and Na{sub 2}SeSO{sub 3} and Se thin films from an acidified solution of Na{sub 2}SeSO{sub 3}, at room temperature on glass substrates. Ag thin film was deposited by thermal evaporation. The annealing temperature was 350 deg. C in vacuum (10{sup -3} Torr) for 1 h. X-ray diffraction analysis showed that the thin films formed were polycrystalline AgSbSe{sub 2} or AgSb(S,Se){sub 2} depending on selenium content in the precursor films. Morphology and elemental analysis of these films were done using scanning electron microscopy and energy dispersive X-ray spectroscopy. Optical band gap was evaluated from the UV-visible absorption spectra of these films. Electrical characterizations were done using Hall effect and photocurrent measurements. A photovoltaic structure: glass/ITO/CdS/AgSbSe{sub 2}/Al was formed, in which CdS was deposited by chemical bath deposition. J-V characteristics of this structure showed V{sub oc} = 435 mV and J{sub sc} = 0.08 mA/cm{sup 2} under illumination using a tungsten halogen lamp. Preparation of a photovoltaic structure using AgSbSe{sub 2} as an absorber material by a non-toxic selenization process is achieved.

  9. AgSbSe2 and AgSb(S,Se)2 thin films for photovoltaic applications

    International Nuclear Information System (INIS)

    Silver antimony selenide (AgSbSe2) thin films were prepared by heating sequentially deposited multilayers of antimony sulphide (Sb2S3), silver selenide (Ag2Se), selenium (Se) and silver (Ag). Sb2S3 thin film was prepared from a chemical bath containing SbCl3 and Na2S2O3, Ag2Se from a solution containing AgNO3 and Na2SeSO3 and Se thin films from an acidified solution of Na2SeSO3, at room temperature on glass substrates. Ag thin film was deposited by thermal evaporation. The annealing temperature was 350 deg. C in vacuum (10-3 Torr) for 1 h. X-ray diffraction analysis showed that the thin films formed were polycrystalline AgSbSe2 or AgSb(S,Se)2 depending on selenium content in the precursor films. Morphology and elemental analysis of these films were done using scanning electron microscopy and energy dispersive X-ray spectroscopy. Optical band gap was evaluated from the UV-visible absorption spectra of these films. Electrical characterizations were done using Hall effect and photocurrent measurements. A photovoltaic structure: glass/ITO/CdS/AgSbSe2/Al was formed, in which CdS was deposited by chemical bath deposition. J-V characteristics of this structure showed Voc = 435 mV and Jsc = 0.08 mA/cm2 under illumination using a tungsten halogen lamp. Preparation of a photovoltaic structure using AgSbSe2 as an absorber material by a non-toxic selenization process is achieved.

  10. Ud at se med Erasmus

    DEFF Research Database (Denmark)

    Frandsen, Pernille

    2009-01-01

    Få lidt luft under vingerne, kom ud at møde udenlandske kolleger og se, hvordan man også kan lave uddannelsesbibliotek. Med begejstring fortæller tre bibliotekarer om deres oplevelser i det store udland – alt sammen finansieret af Erasmus.......Få lidt luft under vingerne, kom ud at møde udenlandske kolleger og se, hvordan man også kan lave uddannelsesbibliotek. Med begejstring fortæller tre bibliotekarer om deres oplevelser i det store udland – alt sammen finansieret af Erasmus....

  11. Introduction to the "SE Field"

    OpenAIRE

    Defourny, Jacques

    2014-01-01

    The "SE Field" stands here for the main concepts defining the research areas of the EMES European Research Network since its creation in an informal (1996-2001) and then formal way (2002): Social Enterprise, Social Entrepreneurship, Social Economy and Solidarity Economy

  12. Derecho humano al agua y al saneamiento: derechos estrechamente vinculados al derecho a la vida

    OpenAIRE

    Fernández Aller, Maria Celia; Luis Romero, Elena de; Guzmán Acha, Cristina

    2013-01-01

    Los derechos humanos al agua y al saneamiento están íntimamente relacionados con otros derechos esenciales para la vida, como la alimentación o la salud. Su reconocimiento como derechos humanos en 2010 marca un hito importante en el respeto, protección y realización de estos derechos, que se encuentran seriamente vulnerados para una mayoría de población más vulnerable y empobrecida, sobre todo en el ámbito rural. Mucho camino queda aún para conseguir no sólo la disponibilidad de agua y saneam...

  13. Investigation of the Pr{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Pr{sub 2}Se{sub 3}-Ag{sub 2}Se-PbSe systems

    Energy Technology Data Exchange (ETDEWEB)

    Marchuk, O.V. [Department of Physical and Colloidal Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine); Gulay, L.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine)]. E-mail: gulay@lab.univer.lutsk.ua; Shemet, V.Ya. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine); Olekseyuk, I.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine)

    2006-06-08

    Phase diagram of the Cu{sub 2}Se-PbSe system was constructed using differential-thermal analysis, X-ray diffraction and metallography. The eutectic reaction L-bar {beta}-Cu{sub 2}Se+PbSe takes place at 886K and corresponds to 46mol% PbSe. The peritectoid reaction {beta}-Cu{sub 2}Se+PbSe-bar {alpha}-Cu{sub 2}Se takes place at 420K. The formation of the PrCuSe{sub 2} compound (LaCuS{sub 2} structure type, space group P2{sub 1}/c) and the solid solution range Pr{sub 2}Se{sub 3}-Pr{sub 2}PbSe{sub 4} (Th{sub 3}P{sub 4} structure type, space group I4-bar 3d, a=0.89916(2)nm, R{sub I}=0.0682 for Pr{sub 2}PbSe{sub 4}) was confirmed using X-ray powder diffraction. The interactions between the components in the Pr{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Pr{sub 2}Se{sub 3}-Ag{sub 2}Se-PbSe systems at 870K were determined using X-ray powder diffraction. No quaternary compounds exist in these systems.

  14. Utilitarismus als Methode der Ethik

    OpenAIRE

    Daniels, Malte Cornelius

    2011-01-01

    In diesem Buch schlage ich eine radikal neuartige Sicht auf den Utilitarismus vor. Meine Hauptthese ist, dass der Utilitarismus selbst keine vollständige normative Theorie ist, aus der sich per se Handlungsbewertungen ableiten ließen, sondern normativ untersättigt und neutral ist. Sein normativer Gehalt ist vollständig abhängig von angenommenen Nutzenfunktionen. Jede konsistente Menge von moralischen Regeln (Moralsystem) kann, wie ich im Anhang beweise, als ein Spezialfall des Utilitarismus i...

  15. Evaluación del uso de señales visuales y de localización por el colibrí cola-ancha (Selasphorus platycercus al visitar flores de Penstemon roseus Evaluation of the use of visual and location cues by the Broad-tailed hummingbird (Selasphorus platycercusforaging in flowers of Penstemon roseus

    Directory of Open Access Journals (Sweden)

    Guillermo Pérez

    2012-03-01

    Full Text Available En los colibríes la memoria espacial desempeña un papel importante durante el forrajeo. Éste se basa en el uso de señales específicas (visuales o en señales espaciales (localización de flores y plantas con néctar. Sin embargo, el uso de estas señales por los colibríes puede variar de acuerdo con la escala espacial que enfrentan cuando visitan flores de una o más plantas durante el forrajeo; ésto se puso a prueba con individuos del colibrí cola-ancha Selasphorus platycercus. Por otro lado, para evaluar la posible variación en el uso de las señales, se llevaron a cabo experimentos en condiciones semi-naturales utilizando flores de la planta Penstemon roseus, nativa del sitio de estudio. A través de la manipulación de la presencia/ausencia de una recompensa (néctar y señales visuales, evaluamos el uso de la memoria espacial durante el forrajeo entre 2 plantas (experimento 1 y dentro de una sola planta (experimento 2. Los resultados demostraron que los colibríes utilizaron la memoria de localización de la planta de cuyas flores obtuvieron recompensa, independientemente de la presencia de señales visuales. Por el contrario, en flores individuales de una sola planta, después de un corto periodo de aprendizaje los colibríes pueden utilizar las señales visuales para guiar su forrajeo y discriminar las flores sin recompensa. Asimismo, en ausencia de señales visuales los individuos basaron su forrajeo en la memoria de localización de la flor con recompensa visitada previamente. Estos resultados sugieren plasticidad en el comportamiento de forrajeo de los colibríes influenciada por la escala espacial y por la información adquirida en visitas previas.In hummingbirds spatial memory plays an important role during foraging. It is based in use of specific cues (visual or spatial cues (location of flowers and plants with nectar. However, use of these cues by hummingbirds may change according to the spatial scale they face when visit

  16. Redes neuronales artificiales : Aplicaciones en minería de datos y procesamiento de señales temporales

    OpenAIRE

    Lanzarini, Laura Cristina; Hasperué, Waldo; Estrebou, César Armando; Ronchetti, Franco; Villa Monte, Augusto; Aquino, Germán Osvaldo; Quiroga, Facundo; Rojas, Luis; Jimbo Santana, Patricia

    2015-01-01

    Esta línea de investigación se centra en el estudio y desarrollo de Sistemas Inteligentes basados en Redes Neuronales Artificiales aplicadas al Procesamiento de Señales Temporales y a la Minería de Datos. Con respecto al Procesamiento de Señales Temporales, el énfasis está puesto en el reconocimiento de acciones humanas con el objetivo de mejorar la interfaz hombre/máquina y en el reconocimiento de señales oculares como herramienta de ayuda al diagnóstico médico semi-automático de alteraci...

  17. ¿Se desindustrializa Brasil?

    Directory of Open Access Journals (Sweden)

    Fernando Mattos

    2014-01-01

    Full Text Available Este estudio pretende retomar algunos temas específicos del debate sobre la desindustrialización en Brasil, así como también, apunta a recordar algunos aspectos del debate teórico-histórico sobre la desindustrialización, presente en la literatura sobre desarrollo económico. En la primera parte, se destacan algunos elementos del referido debate presentes en la literatura especializada, discutiendo aspectos teóricos de la formulación kaldoriana que destacan el papel del crecimiento industrial y de la mudanza estructural en el crecimiento de las economías capitalistas. En la segunda, son organizados y analizados algunos indicadores recientes del desempeño del sector industrial brasileño. Finalmente, se ofrecen algunas breves notas conclusivas.

  18. Transiente Globale Amnesie und jugularvenöse Insuffizienz

    OpenAIRE

    Ramspott, Martina Gertrudis

    2008-01-01

    Bei der Hypothese der jugularvenösen Insuffizienz als prädisponierenden Faktor für das Auftreten einer Transienten Globalen Amnesie (TGA) handelt es sich um einen neueren ätiologischen Ansatz. Eine weitere Hypothese geht von einer paradoxen Embolie im Sinne einer TIA als ursächlich für die TGA aus.Es wurden zum einen MRT- Darstellungen des intracerebralen venösen Abstroms bei den TGA-Patienten vorgenommen, zum anderen wurden beide Gruppen sonographisch auf jugularvenöse Insuffizienz sowie auf...

  19. Conjuntivitis alérgica

    Directory of Open Access Journals (Sweden)

    Alejandro Tello Hernández

    2008-07-01

    Full Text Available La conjuntivitis alérgica es una de las causas más comunesde consulta externa en oftalmología y tiene una muy altarelación con las reacciones alérgicas sistémicas. Lafisiopatología de las reacciones de hipersensibilidad noshace entender los cuadros clínicos característicos de estapatología y sus diferentes grados de severidad. Eldiagnostico diferencial es amplio, sin embargo hay clavesdiagnosticas que nos orientan rápidamente al diagnosticocorrecto. El tratamiento se enfoca en las medidasfarmacológicas y no farmacológicas, utilizándolas enconjunto para disminuir la recurrencia del cuadro y prevenirsecuelas visuales.

  20. Neumonitis por hipersensibilidad asociado al cuidado de aves

    Directory of Open Access Journals (Sweden)

    Ana María González-Zúñiga

    2015-01-01

    Full Text Available La neumonitis por hipersensibilidad asociada al cuidado de las aves es uno de los tipos más frecuentes de esta que se presentan. Aunque no se tienen datos epidemiológicos claros sobre su prevalencia, en los hospitales llegan casos de este tipo. No es una patología muy común; sin embargo, una muestra representativa de la población se encuentra expuesta a las aves y, consecuentemente, a los antígenos que causan la enfermedad. Su diagnóstico temprano puede significar para el paciente evitar daños, al dejar de exponerse al antígeno; por el contrario, si no se realiza un diagnóstico temprano, puede generarse un daño pulmonar irreversible. En este artículo, se presenta un caso clínico de neumonitis por hipersensibilidad al cuidado de aves.

  1. El análisis de las características dinámicas de la señal de habla como posible marca para la contratación e identificación forense de voz: un estudio para el español de México

    OpenAIRE

    López Escobedo, Fernanda

    2011-01-01

    El objetivo principal de esta tesis es determinar si el análisis dinámico de la frecuencia fundamental (F0) y de los tres primeros formantes vocálicos (F1, F2 y F3) es un rasgo idiosincrásico de los hablantes que puede utilizarse como marca identificativa para la comparación forense de voz. Los dos parámetros acústicos se han estudiado en el sonido vocálico /a/ ya que es uno de los fonemas más frecuentes en el español. Además, en esta tesis se han analizado cuatro tipos de corpus con el f...

  2. İşveren Markası Yönetimi Sürecinde İşe Alım Öncesi Dönem ve İşgören Seçimi: Kavramsal Bir Değerlendirme (Pre-Recruitment Period and Employee Selection in Employer Brand Management Process: A Conceptual Evaluation)

    OpenAIRE

    Ebru GÖZEN

    2016-01-01

    Nowadays constantly renewing itself technological , socio-economic and cultural changes have dragged the companies to the tight competition. They can sustain their assets depends on finding the right labor and employment abilities. The quality and success of the human resources departments mostly depends on the process of finding employee. This process forms the basis of the other HR processes. One of the components of employer branding is Pre-Recruitment Period and Employee Se...

  3. Aquí se vende todo

    Directory of Open Access Journals (Sweden)

    Amalia Ran

    2010-11-01

    Full Text Available Aunque « memoria » sea la palabra más usada en el contexto histórico reciente de Argentina, es el olvido aquello de lo que más se habla, y lo que domina al final el discurso público de las últimas décadas. ¿ Cuáles son las distintas formas de « recordar » el pasado doloroso en un entorno que intenta silenciarlo al transformar la memoria en un objeto-fetiche ? ¿ De qué modo conserva el espacio urbano —la ciudad y sus múltiples lugares abiertos y cerrados— una memoria de la desgracia y del horror ?, y ¿ cómo se refleja ese espacio urbano dentro del texto narrativo ? El presente trabajo estudia la problemática de la ciudad globalizada del post-trauma y la desmemoria mediante el análisis de la novela de Horacio Vázquez-Rial, La capital del olvido (2004. Asimismo, propone analizar los efectos de los procesos de privatización y globalización que barrieron a Buenos Aires durante los noventa para explorar las diversas expresiones públicas y privadas de una cultura de culpa y vergüenza que niega recordar su pasado.Though memory may be most often used term within the historic context of Argentina, it is oblivion which dominates finally the public discourse of recent years. What are the different forms of “ remembering ” the painful past in an environment that attempts to silence memory by transforming it into a fetish-object ? In which way the urban space —the city with its multiple open and closed places— conserves a memory of the tragedy and horror ? And, how this space is represented within the narrative text ? This work analyzes the problematic of the globalized city, its post-trauma and oblivion by studying Horacio Vázquez-Rial’s novel, La capital del olvido (“ City of Oblivion ”, 2004. Additionally, it offers to analyze the effects of globalization and privatization processes that swept Buenos Aires during the decade of the nineties, in order to explore the diversity of public and private

  4. Como se formam as dunas?

    OpenAIRE

    Gonçalves, Adorinda; Velho, António; Pires, Delmina; Rodrigues, Maria José; Mafra, Paulo

    2006-01-01

    O ensino experimental das ciências, em particular no 1º Ciclo do Ensino Básico, tem sido objecto de estudo de vários investigadores nas últimas décadas. Encontram-se vários indicadores que apontam que este tipo de ensino promove o desenvolvimento de competências muito importantes para o desenvolvimento integral da criança no sentido de uma maior autonomia e capacidade reflexiva, aspecto potenciado pelo espírito criativo e de descoberta que encontramos nestas idades. O 1º Ciclo do Ensino Básic...

  5. Main: SE1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SE1PVGRP18 S000288 10-Feb-2000 (last modified) seki SE1 (Stem element 1) found in the bean (P.v.) grp1...ecifically; See S000289, S000101 (SE2); SE1; grp1.8; vascular; stem; shoot; bean (Phaseolus vulgaris) ATAATGGGCCACACTGTGGGGCAT ...

  6. Main: SE2PVGRP1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SE2PVGRP1 S000101 17-May-1998 (last modified) kehi SE2 (stem element 2) of bean (P.v.) GRP1....8 gene; part of SE2 element; stem; SE2; GRP; GRP1; bean (Phaseolus vulgaris) TTNNNGTAGCTAGTGTATTTGTAT ...

  7. de drogas que se consumen en su medio

    Directory of Open Access Journals (Sweden)

    José F. Enríquez Bielma

    2006-01-01

    Full Text Available Las adicciones son un problema de salud pública. Se estima que en México 3.5 millones de personas entre 12 a los 65 años han consumido algún tipo de drogas. A pesar de los avances en los estudios, se ha dejado de lado el carácter cultural que tiene la adicción. Con este estudio, se deseba conocer qué saben los estudiantes de segundo de secundaria sobre cuáles son las drogas que se consumen en su medio. Se llevó a cabo un estudio observacional con un muestreo aleatorio, con múltiples etapas y proporcional al tamaño en escuelas públicas y privadas. En total se estudiaron 42 escuelas del municipio de León, Gto., México de las cuales el 76.2% lo conformaron las escuelas públicas y el resto las escuelas privadas. Refirieron que conocen que se consumen, en su medio, 11 tipos de drogas. El 88% mencionó a la cocaína en primer lugar, en segundo lugar con un 85% la marihuana, siguiendo las tachas en un 62% y el pegamento en un 49%. En cuanto a los nombres que los estudiantes le dan a las drogas, estos van desde 23 hasta los 4 nombres, siendo la marihuana a la que se le da el mayor número de nombres, seguidos de la cocaína y el éxtasis.

  8. Investigation of the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe systems at 870K

    Energy Technology Data Exchange (ETDEWEB)

    Gulay, L.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Aveune 13, 43009 Lutsk (Ukraine)]. E-mail: gulay@lab.univer.lutsk.ua; Olekseyuk, I.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Aveune 13, 43009 Lutsk (Ukraine); Wolcyrz, M. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland); Stepien-Damm, J. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland); Pietraszko, A. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland)

    2006-06-08

    The interactions between the components in the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe systems at 870K were determined using X-ray single crystal and powder diffraction. The existence of the compounds with compositions RCuSe{sub 2}-R{sub 2/3}Cu{sub 2}Se{sub 2}(Er{sub 2/3}Cu{sub 2}S{sub 2} structure type, space group P3-bar , a=0.40563(1)nm, c=0.64542(3)nm, R{sub I}=0.0737 for HoCuSe{sub 2} and a=0.40407(1)nm, c=0.64420(3)nm, R{sub I}=0.0660 for ErCuSe{sub 2}) and RCu{sub 5}Se{sub 4} (unknown structure) was confirmed in the R{sub 2}Se{sub 3}-Cu{sub 2}Se (R=Ho, Er) sections. The existence of the compounds Ho{sub 6}Pb{sub 2}Se{sub 11} (Y{sub 6}Pb{sub 2}Se{sub 11} structure type, space group Cmcm, a=0.40561(2)nm, b=1.34018(6)nm, c=3.7525(1)nm) and Er{sub 2}PbSe{sub 4} (CaFe{sub 2}O{sub 4} structure type, space group Pnma, a=1.2554(2)nm, b=0.40778(5)nm, c=1.4885(2)nm, R{sub I}=0.0914) was confirmed in the R{sub 2}Se{sub 3}-PbSe (R=Ho, Er) sections. The existence of the compounds Ho{sub 3.33}CuPb{sub 1.5}Se{sub 7} (Lu{sub 3.33}CuPb{sub 1.5}Se{sub 7} structure type, space group Cm, a=1.35314(8)nm, b=0.40819(2)nm, c=1.25609(7)nm, {beta}=104.577(3){sup o}) and HoCuPbSe{sub 3} ({beta}-BaLaCuSe{sub 3} structure type, space group Pnma, a=1.0516(2)nm, b=0.40470(8)nm, c=1.3410(3)nm, R{sub 1}=0.0541) in the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe system was confirmed. The formation of the compounds Er{sub 5}CuPb{sub 3}Se{sub 11} (Er{sub 5}CuPb{sub 3}Se{sub 11} structure type, space group Cmcm, a=0.40688(2)nm, b=1.34607(7)nm, c=3.8040(2)nm), Er{sub 3.33}CuPb{sub 1.5}Se{sub 7} (Lu{sub 3.33}CuPb{sub 1.5}Se{sub 7} structure type, space group Cm, a=1.35018(7)nm, b=0.40693(2)nm, c=1.25433(6)nm, {beta}=104.492(2){sup o}) and ErCuPbSe{sub 3} ({beta}-BaLaCuSe{sub 3} structure type, space group Pnma, a=1.04846(8)nm, b=0.40424(3)nm, c=1.34143(7)nm) in the Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe system was confirmed.

  9. Envejecer (se) y cuidar (se): una aproximación antropológica al mundo de los mayores

    OpenAIRE

    Cerri, Chiara

    2015-01-01

    El presente trabajo de tesis reúne los resultados de cuatro años de investigación sobre envejecimiento y cuidado. Su propósito no es definir cuáles serían las mejores políticas de cuidado y envejecimiento activo a poner en práctica. Tampoco cuál sería la mejor representación de los mayores y la vejez. Su propósito principal es abordar el envejecimiento y el cuidado desde una perspectiva que no entiende el envejecimiento y el cuidado como entes separados entre ellos y unidos a través de la ide...

  10. Blacasset, “Se·l mals d’amor m’auzi ni m’es noisens” (BdT 96.10a); Pujol, “Dieus es amors e verais salvamens” (BdT 386.2); Alaisina ~ Carenza, “Na Carenza al bel cors avenenç” (BdT 12.1 = 108.1)

    OpenAIRE

    Paolo Di Luca

    2012-01-01

    This paper provides a new critical edition of “Se·l mals d’amor m’auzi ni m’es noisens” by Blacasset and “Dieus es amors e verais salvamens by Pujol”. These two poets discuss a topic that is entirely new to Occitan lyric poetry: two young women about to enter a convent. While Blacasset expresses sadness about their choice of life in a convent, using elements of the funeral lament, Pujol praises it and believes it to be the only remedy for the corruption of the world. The tenso between women “...

  11. Personalidad y tolerancia al dolor

    Directory of Open Access Journals (Sweden)

    JESÚS M.ª CARRILLO

    2005-01-01

    Full Text Available Se examina la relación de algunas variables de personalidad -EPQ-A (Eysenck y Eysenck, 1975, NEO-PI (McCrae y Costa, 1988 y STA -personalidad esquizotípica- y STB -personalidad límite-, de Claridge y Broks (1984, con la tolerancia al dolor experimental inducido mediante agua fría (cold pressor test, según el procedimiento de Staats, Heckmat y Staats (1998 en una muestra filtrada mediante un cuestionario sobre dolor crónico, dolores de cabeza, de espalda, artritis, síndrome de Raynaud, y personas bajo medicación. La tolerancia al dolor experimental se evaluó mediante el Umbral del dolor (tiempo en segundos desde la introducción de la mano en el agua hasta el primer informe de dolor, Mantenimiento del dolor (duración en segundos de la inmersión de la mano desde la aparición del umbral hasta su retirada y Tolerancia al dolor (duración total en segundos de la inmersión de la mano desde su introducción hasta su retirada. Un análisis correlacional, factorial y de regresión por pasos mostraron un efecto cruzado entre medidas de ansiedad (tolerancia negativa al dolor y psicoticismo, siendo psicoticismo junto con control emocional predictores de tolerancia positiva al dolor. En cuanto a psicoticismo, parece que son sus elementos de naturaleza paranoide y de "dureza" los que afectan a una percepción atenuada del dolor.

  12. Aproximaciones al concepto de interactividad educativa

    OpenAIRE

    Zangara, Alejandra; Sanz, Cecilia Verónica

    2012-01-01

    Este trabajo presenta una reflexión sobre el concepto de interactividad, y en particular, sobre interactividad educativa. Hoy en día se escucha hablar de software interactivo, televisión digital interactiva, interacción/interactividad, y se asume el concepto de interactividad sin una reflexión sobre éste. Se proponen aquí algunos puntos de análisis al respecto, una diferenciación entre interacción e interactividad, y una vinculación entre interactividad educativa y el concepto de distancia tr...

  13. Carl gustav jung: al profesor honorio delgado

    OpenAIRE

    Sánchez, Luis Jaime

    2012-01-01

    Esbozo ideológico de Jung: Con la muerte de Carl Gustav Jung, se deshace -en sus personajes- el trípode ejemplar que ha sostenido en lo que va corrido del siglo XX, lo más significativo del saber psicológico. Con Freud y Adler, Jung ayudo poderosamente a conformar  el a veces crudo y rudo andamiaje de una psicología singular, en el contorno y en la hondura, cuyos problemas -a pesar de todo- se debaten aún en la periferia y en la profundidad del hombre contemporáneo, al cual Jung se acerco sie...

  14. Seguimiento al hogar de personas con antecedentes de enfermedad mental

    Directory of Open Access Journals (Sweden)

    Esguerra de Cárdenas Irene

    1995-12-01

    Full Text Available

    El "programa de apoyo y seguimiento al hogar de personas con antecedentes de enfermedad mental" se inició formalmente en marzo de 1993 en la Clínica Nuestra Señora de la Paz. Surgió de la necesidad de implementar acciones concretas al egreso de los pacientes de la institución, tendientes a reforzar la responsabilidad de éstos en su tratamiento y manejo de la enfermedad en el hogar y además de ofrecer un recurso de apoyo para escuchar sus inquietudes y preocupaciones. El propósito del programa es proporcionar al enfermo mental y a su familia un apoyo permanente al egresar de la Institución, en lo relacionado con el manejo de dificultades o problemas que se presenten durante el proceso de la enfermedad, el tratamiento y la reinserción del paciente al hogar y al medio social. Dentro de las estrategias de trabajo se contemplan reuniones semanales con grupos de pacientes próximos a salir de la clínica, reuniones periódicas de reforzamiento con personas inscritas al programa, seguimiento telefónico o mediante entrevistas individuales y/o familiares. Hasta el momento han asistido a las reuniones de egreso cerca de 400 pacientes y se han inscrito voluntariamente al programa 150 personas.

  15. Adherencia al tratamiento en la esquizofrenia

    OpenAIRE

    Ruiz Manrique, Olatz

    2015-01-01

    [Es]La adherencia al tratamiento es un problema real en los pacientes esquizofrénicos, que dificulta su inserción en la sociedad y puede ocasionarles graves repercusiones médicas. Por ello, el objetivo de esta revisión es valorar la eficacia de las intervenciones psicoeducacionales con la ayuda del personal sanitario y/o familiares, en la adherencia al tratamiento de los pacientes esquizofrénicos. Se realizó una revisión sistemática para dar respuesta al objetivo planteado, analizando las res...

  16. All About ALS

    Science.gov (United States)

    ... please review our exit disclaimer . Subscribe All About ALS Understanding a Devastating Disorder In the summer of ... of research dollars—for a fatal disease called ALS. ALS stands for amyotrophic lateral sclerosis. It’s also ...

  17. On the charge neutrality level and the electronic properties of interphase boundaries in the layered ε-GaSe semiconductor

    Energy Technology Data Exchange (ETDEWEB)

    Brudnyi, V. N., E-mail: brudnyi@mail.tsu.ru; Sarkisov, S. Yu. [Tomsk State University (Russian Federation); Kosobutsky, A. V. [Kemerovo State University (Russian Federation)

    2015-10-15

    The height of the (Au, Pd, Pt, Cu, Ag, Sn, In, Al, Mg, Ca, Li, Cs)/GaSe(0001) Schottky barrier as a function of the metal work function and the energy-band offsets in InSe(0001)/GaSe(0001) and GaSe(0001)/Si(111) heteropairs are analyzed within the context of the concept of the charge neutrality level, CNL{sub vb}(GaSe) = E{sub v} + 0.83 eV, with consideration for partial screening of the interface electrostatic dipole by metal- or semiconductor-induced tunneling states at the GaSe(0001) surface.

  18. En la infancia los diagnósticos se escriben con lápiz. La patologización de las diferencias en la clínica y la educación. Untoiglich, Gisela, et al. /266 p. Buenos Aires: Noveduc. 2013.

    OpenAIRE

    Adriana Cristóforo

    2013-01-01

    El libro está organizado en cuatro partes, en función del eje temático que tienen los trabajos que integra cada una de ellas: Procesos de Patologización; Procesos diagnósticos en la infancia; Patologías psíquicas graves en la primera infancia; y Acerca de inclusiones y exclusiones. Sin embargo más allá de esta organización, el libro tiene una armonía que, a través de la diversidad, otorga coherencia al abordaje de un problema complejo como lo es el de los diagnósticos en la infancia. Precisa...

  19. Measurement of the static quadrupole moments of the first 2+ states in 76Se, 78Se, 80Se and 82Se

    International Nuclear Information System (INIS)

    The reorientation effect in Coulomb excitation was employed to measure the static quadrupole moments of the first 2+ excited states in 76Se, 78Se, 80Se, and 82Se. Beams of 4He and 16O were used on thin highly enriched targets and the resulting spectra of the well resolved backward elastic and inelastic scattered particles were detected by four surface-barrier detectors. For constructive interference via the second 2+ excited states the determined quadrupole moments are: -0.34 +- 0.07 e . b for 76Se; -0.26 +- 0.09 e . b for 78Se; -0.31 +- 0.07 e . b for 80Se; -0.22 +- 0.07 e . b for 82Se. (Auth.)

  20. Time course of selenium labelling of selenoproteins in Se adequate and Se deficient rats

    International Nuclear Information System (INIS)

    Column chromatography has identified a number of new selenoproteins. To discriminate between selenoproteins and Se-binding proteins, the authors used SDS-PAGE to remove loosely-bound 75Se and thus quantitate 75Se-labelled selenoproteins. +Se (Wayne Lab Blox) and -Se rats (75Se]selenite (0.5 ug Se) and sacrificed 1, 3, 24 or 72 hr later. 75Se-proteins in various tissues were separated according to subunit molecular weight by SDS-PAGE, and gel slices were counted to determine 75Se labelling. In +Se plasma, a 55kDa protein was the major 75Se-protein at 1 and 3 hr; gluathione peroxidase (GSH-Px, 20kDa subunit) was labelled at 24 and 72 hr. In -Se plasma the 55kDa 75Se-protein was 4-fold higher and GSH-Px 75Se was reduced. In +Se liver cytosol GSH-Px was the major 75Se- species at all times; GSH-Px 75Se was greater in +Se than -Se liver. In +Se and -Se testes, a 17kDa protein was labelled increasingly over 72 hr. Notably, a number of additional 75Se-proteins were observed, but cycloheximide pretreatment completely blocked 75Se-labelling of all selenoproteins in both +Se and -Se rats. This study shows that SDS-PAGE can be used to resolve and quantify a number of selenoproteins in addition to GSH-Px. The cycloheximide inhibition of labelling further suggests that these species are true selenoproteins that are labelled only during or immediately after protein synthesis

  1. Servicio de asesoramiento al riego una necesidad del futuro

    OpenAIRE

    Enrique Cisneros Zayas; Pedro González Baucells; Oscar Solano Ojeda

    2006-01-01

    En el trabajo se brinda la información necesaria para llevar a cabo el servicio de asesoramiento al riego y se basa en las capacidades tecnológicas instaladas actualmente en los Institutos de Meteorología y de Investigaciones de Riego y Drenaje. Se desarrolla en tres etapas: durante la primera etapa se utilizará información meteorológica correspondiente a períodos de diez días, la segunda etapa para períodos de cinco días y la tercera proveerá información diaria. En Cuba se preten...

  2. La incorporación de Venezuela al MERCOSUR

    OpenAIRE

    Bastías, Julio Adrián

    2006-01-01

    El presente trabajo tiene como objetivo analizar la incorporación de Venezuela al MERCOSUR: qué aporte realiza, y cuales son sus ventajas y desventajas para el Bloque en el ámbito regional e internacional. Para ello se realizó un estudio del contexto actual del MERCOSUR, analizando sobre todo las crisis que actualmente atraviesa y se investigó cómo en éste escenario político se inserta Venezuela en el Bloque. Se estudiaron también los logros de la XXX Cumbre Presidencial del MERCOSUR y se vis...

  3. Metaheurísticas aplicadas a procesamiento de señales y minería de datos

    OpenAIRE

    Lanzarini, Laura Cristina; Hasperué, Waldo; Estrebou, César Armando; Formia, Sonia; Corbalán, Leonardo César; Ronchetti, Franco; Villa Monte, Augusto; Aquino, Germán Osvaldo; Quiroga, Facundo

    2014-01-01

    Esta línea de investigación se centra en el estudio y desarrollo de Sistemas Inteligentes basados en metaheurísticas aplicadas al Procesamiento de Señales y a la Minería de Datos. Con respecto al Procesamiento de Señales, el énfasis está puesto en el reconocimiento de gestos dinámicos y patrones biométricos combinando distintas arquitecturas de redes neuronales con estrategias adaptativas inteligentes. Como resultado de estas tareas se han obtenido reconocedores eficientes. En el área d...

  4. The Intraplate Earthquakes of SE Africa

    Science.gov (United States)

    Fonseca, J. F. B. D.; Domingues, A.

    2014-12-01

    Southeast Africa is a region of complex tectonic inheritance, combining early Archean cratonic blocks - the Zimbabwe and Kaapvaal cratons - and several collision belts ranging in age from ~2.6Ga (Limpopo Belt) to the Pan-African Orogeny, 800-500 Ma ago (Zambezi Belt, Mozambique Belt). Mesozoic rifting was the last tectonic event to leave an imprint in the lithosphere of the region. Tertiary deformation is mild and related to the extensional regime of the East African Rift System (EARS) further north. Instrumental seismology started in Johannesburg in 1910 (Saunders et al., 2008). Ambraseys and Adams (1991) conducted a reappraisal of the seismicity of Sub-Saharan Africa from 1900 to 1930, and the compilations by Krige and Maree (1948) and Gutenberg and F. Richter (1949) are main sources for the two subsequent decades. The available data can be considered complete since 1900 for magnitudes above M6 (Ambraseys and Adams, 1991), although major epicentral errors are likely to affect the early decades. Earthquakes above this threshold in the region to the south of Lake Malawi and to the east of the Okavango Rift are reported in 1919 (MS6.5, NE South Africa), 1932 (MS6.8, Natal Bay), 1940 (MS6.2, SE Mozambique), 1951 (MS6.0, Central Mozambique), 1957 (M6.0, Central Mozambique), again in 1957 (M6.2, Central Mozambique), 1958 (M6.0, Southern Zimbabwe), 1959 (M6.1, Southern Zambia) and 2006 (M7.0, Central Mozambique). The four M>6 earthquakes from 1957 to 1959 configure a cluster in time, followed by a shutdown (at M>6) that was to last nearly five decades. While a coincidence is unlikely, a causal link is challenged by the large spatial scatter of about 500 km. However, the fact that the four earthquakes occurred on the border of the Zimbabwe craton may provide a clue to the mechanism promoting the clustering. We combine these data with recent seismicity results (Fonseca et al., 2014) to discuss possible factors controlling the seismotectonics of the region.

  5. Electron microscopy of iron chalcogenide FeTe(Se) films

    International Nuclear Information System (INIS)

    The structure of Fe1+δTe1−xSex films (x = 0; 0.05) grown on single-crystal MgO and LaAlO3 substrates has been investigated by transmission and scanning transmission electron microscopy. The study of Fe1.11Te/MgO structures has revealed two crystallographic orientation relationships between the film and substrate. It is shown that the lattice mismatch between the film and substrate is compensated for by the formation of misfit dislocations. The Burgers vector projection is determined. The stresses in the film can partially be compensated for due to the formation of an intermediate disordered layer. It is shown that a FeTe0.5Se0.5 film grown on a LaAlO3 substrate is single-crystal and that the FeTe0.5Se0.5/LaAlO3 interface in a selected region is coherent. The orientation relationships between the film and substrate are also determined for this case

  6. Investigation of the R{sub 2}Se{sub 3}-Cu{sub 2}Se-In{sub 2}Se{sub 3} (R=La, Pr, Y and Er) systems at 870K and crystal structure of the R{sub 2}CuInSe{sub 5} (R=La, Ce and Pr) compounds

    Energy Technology Data Exchange (ETDEWEB)

    Huch, M.R. [Department of General and Inorganic Chemistry, Volyn State University, Voli Avenue 13, 43009 Lutsk (Ukraine); Gulay, L.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Avenue 13, 43009 Lutsk (Ukraine)]. E-mail: gulay@univer.lutsk.ua; Olekseyuk, I.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Avenue 13, 43009 Lutsk (Ukraine)

    2007-07-31

    Phase equilibria in R{sub 2}Se{sub 3}-Cu{sub 2}Se-In{sub 2}Se{sub 3} (R=La, Pr, Y and Er) systems at 870K were determined using X-ray powder diffraction. The existence of the RCuSe{sub 2} (LaCuS{sub 2} structure type, space group P2{sub 1}/c) and La{sub 5}Cu{sub 13}Se{sub 14} (unknown structure) compounds was confirmed in the R{sub 2}Se{sub 3}-Cu{sub 2}Se (R=La, Pr) sections. The formation of the solid solutions R{sub (2+x)/3}Cu{sub 2-x}Se{sub 2} (0bar xbar 1) (Er{sub 2/3}Cu{sub 2}S{sub 2} structure type, space group P3bar) and the ErCu{sub 5}Se{sub 4} compound with unknown structure was confirmed in the R{sub 2}Se{sub 3}-Cu{sub 2}Se (R=Y, Er) sections. The existence of the La{sub 3}In{sub 1.67}Se{sub 7} (Ce{sub 3}Al{sub 1.67}S{sub 7} structure type, space group P6{sub 3}) and La{sub 4}In{sub 4.67}Se{sub 13} (La{sub 4}In{sub 4.72}Se{sub 13} structure type, space group Pbam) compounds in the La{sub 2}Se{sub 3}-In{sub 2}Se{sub 3} system and the Pr{sub 3}InSe{sub 6} (Pr{sub 3}InSe{sub 6} structure type, space group Pnnm) compound in the Pr{sub 2}Se{sub 3}-In{sub 2}Se{sub 3} system was confirmed. No ternary compounds exist in the Er{sub 2}Se{sub 3}-In{sub 2}Se{sub 3} and Y{sub 2}Se{sub 3}-In{sub 2}Se{sub 3} sections. The formation of the CuInSe{sub 2}, CuIn{sub 3}Se{sub 5}, CuIn{sub 5}Se{sub 8}, CuIn{sub 7}Se{sub 11} and CuIn{sub 11}Se{sub 17} compounds in the Cu{sub 2}Se-In{sub 2}Se{sub 3} section was observed. The crystal structure of new quaternary R{sub 2}CuInSe{sub 5} (R=La, Ce and Pr) compounds (space group Pnma, a=1.20382(6)nm, b=0.41185(2)nm, c=1.7556(1)nm (for La{sub 2}CuInSe{sub 5}), a=1.19997(7)nm, b=0.40855(2)nm, c=1.7464(1)nm (for Ce{sub 2}CuInSe{sub 5}) and a=1.1973(3)nm, b=0.40649(9)nm, c=1.7408(4)nm (for Pr{sub 2}CuInSe{sub 5})) was determined.

  7. "Lo que se dice y se hace. Lo que se calla y se niega" : Apropiaciones de la literatura en el aula

    OpenAIRE

    Mattioli, María Luz

    2012-01-01

    El presente trabajo surge a partir de una indagación personal que se va consolidando a medida que transito distintas aulas y experiencias. En todas estas situaciones se me presentan los mismos interrogantes: ¿cuáles son los distintos modos de leer literatura que se presentan en las aulas? ¿Cómo se presentan y en la voz de qué actores/alumnos? Y ¿cuáles son las distintas formas del conocimiento que se da en cada situación en particular?

  8. Runoff generation in SE Spain

    Science.gov (United States)

    Dalen, E. N.; Kirkby, M. J.; Chapman, P. J.; Bracken, L. J.

    2007-12-01

    We are working to improve a hydrological model for prediction of runoff in medium-scale semi-arid catchments in SE Spain. The aim is to develop and improve understandings of runoff generation in semi-arid areas and to improve modelling of runoff. Objectives are to investigate the influence of geology, landuse and seasonality on infiltration rates and use remonte sensing (RS) and GIS to classify an area into Hydrologically Similar Surfaces (HYSS) categories. The research includes investigating the impact of different landscape elements on runoff within two 150 km2 catchments, the Rambla Nogalte and the Rambla de Torrealvilla. Most storms within these catchments are of short duration. HYSS are defined as areas with similar1-D (vertical) partitioning of net rainfall between infiltration and overland flow. HYSS are identified from field measurements of soils, micro and macro- topography and infiltration rates; then combined with analysis of multi-spectral airborne RS images. HYSS are selected to minimise internal variability in the relationship between rainfall and local runoff generation and are scaled up to cover larger areas. The overall sampling strategy for measurements has been to undertake constant intensity rainfall simulator measurements within provisional HYSS categories, and to augment this with a large number of minidisk infiltrometer measurements. This strategy captures as much of the variability in the landscape as possible. The wide variability within even small areas has led to the final adoption of only a few large classes that can be effectively distinguished. The final part of the research is to link the spatial partitioning of the two catchments into HYSS with the detailed rainfall records for the areas, and combine these two sets of data into a grid-based model for runoff generation across the area. The applied Green-Ampt modelling approach gave 63 possible combinations of surface properties (9 HYSS) and areas in the Rambla Nogalte each represented

  9. Pensando al agua como parte del paisaje

    Directory of Open Access Journals (Sweden)

    Lorena Salvatelli

    2009-12-01

    Full Text Available El objetivo de este trabajo es discutir la importancia de los estudios de arqueología terrestre y subacuática como parte de un mismo proceso de interpretación del pasado. Se entiende que el registro arqueológico puede hallarse actualmente en una variedad de ambientes tanto terrestres como subacuáticos a causa de varias razones, como por ejemplo las oscilaciones de los niveles de agua ocurridas entre el Pleistoceno Final y el Holoceno Medio. Por lo tanto, se propone que para su recuperación debe utilizarse una metodología adaptada al medio ambiente en el cual se encuentre. En este sentido, es importante la interpretación integral del paisaje para acceder a la comprensión de la diversidad ambiental en la que se puede emplazar un sitio arqueológico, y en consecuencia poder “bucear” un registro integrado.

  10. Grenzüberschreitende Umstrukturierungen jenseits von SE und Verschmelzungsrichtlinie

    OpenAIRE

    Decher, Christian E.

    2006-01-01

    Grenzüberschreitende Umstrukturierungen wurden bislang unter Nutzung traditioneller Strukturmodelle als Übernahmen oder Zusammenschluss zwischen Gleichen mit öffentlichen Erwerbsangeboten gegen bar oder Aktien vollzogen. Eine grenzüberschreitende Verschmelzung im rechtstechnischen Sinne war bislang in Deutschland nicht möglich. Die SEVIC-Entscheidung des EuGH, die Einführung der SE und demnächst die gesetzliche Regelung einer EU-weiten Verschmelzung ermöglichen auch grenzüberschreitende Versc...

  11. Giant piezoelectricity of monolayer group IV monochalcogenides: SnSe, SnS, GeSe, and GeS

    Energy Technology Data Exchange (ETDEWEB)

    Fei, Ruixiang; Yang, Li, E-mail: lyang@physics.wustl.edu [Department of Physics, Washington University, St. Louis, Missouri 63130 (United States); Li, Wenbin [Research Laboratory of Electronics, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); Li, Ju [Department of Nuclear Science and Engineering and Department of Materials Science and Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

    2015-10-26

    We predict enormous, anisotropic piezoelectric effects in intrinsic monolayer group IV monochalcogenides (MX, M=Sn or Ge, X=Se or S), including SnSe, SnS, GeSe, and GeS. Using first-principle simulations based on the modern theory of polarization, we find that their piezoelectric coefficients are about one to two orders of magnitude larger than those of other 2D materials, such as MoS{sub 2} and GaSe, and bulk quartz and AlN which are widely used in industry. This enhancement is a result of the unique “puckered” C{sub 2v} symmetry and electronic structure of monolayer group IV monochalcogenides. Given the achieved experimental advances in the fabrication of monolayers, their flexible character, and ability to withstand enormous strain, these 2D structures with giant piezoelectric effects may be promising for a broad range of applications such as nano-sized sensors, piezotronics, and energy harvesting in portable electronic devices.

  12. Giant piezoelectricity of monolayer group IV monochalcogenides: SnSe, SnS, GeSe, and GeS

    International Nuclear Information System (INIS)

    We predict enormous, anisotropic piezoelectric effects in intrinsic monolayer group IV monochalcogenides (MX, M=Sn or Ge, X=Se or S), including SnSe, SnS, GeSe, and GeS. Using first-principle simulations based on the modern theory of polarization, we find that their piezoelectric coefficients are about one to two orders of magnitude larger than those of other 2D materials, such as MoS2 and GaSe, and bulk quartz and AlN which are widely used in industry. This enhancement is a result of the unique “puckered” C2v symmetry and electronic structure of monolayer group IV monochalcogenides. Given the achieved experimental advances in the fabrication of monolayers, their flexible character, and ability to withstand enormous strain, these 2D structures with giant piezoelectric effects may be promising for a broad range of applications such as nano-sized sensors, piezotronics, and energy harvesting in portable electronic devices

  13. Miedo al crimen en estudiantes de la ciudad de Caracas

    OpenAIRE

    Jan Liebnitzky; Maritza Montero

    2013-01-01

    Se midió el miedo al crimen en un grupo de estudiantes universitarios, centrándose en inseguridad subjetiva y paradoja victimización-miedo, que considera que la inseguridad subjetiva no refleja a la objetiva. Se buscaba saber si esa paradoja existía en los estudiantes y si las teorías explicativas serían útiles. Se comparó el nivel de miedo al crimen con dos ciudades Latinoamericanas, empleando un diseño de secciones-cruzadas, usando el Cuestionario de Inseguridad Urbana, y elementos cuantita...

  14. Excitons, biexcitons, and phonons in ultrathin CdSe/ZnSe quantum structures

    DEFF Research Database (Denmark)

    Gindele, F.; Woggon, Ulrike; Langbein, Wolfgang Werner; Hvam, Jørn Märcher; Leonhardi, K.; Hommel, D.; Selke, H.

    1999-01-01

    nanostructures consist of a coherently strained Zn1-xCdxSe/ZnSe quantum well with embedded islands of higher Cd content with sizes of a few nanometer due to strain-induced CdSe accumulation. The local increase in CdSe concentration results in a strong localization of the excitonic wave function, in an increase...

  15. Reduction in the crystal defect density of Zn Se layers grown by molecular beam epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Lopez L, M.; Perez C, A.; Luyo A, J.; Melendez L, M.; Tamura, M. [Departamento de Fisica, Centro de Investigacion y de Estudios Avanzados del instituto politecnico Nacional, A.P. 14-740, 07000 Mexico D.F. (Mexico); Mendez G, V.H.; Vidal, M.A. [Instituto de Investigacion en Comunicacion Optica, Universidad Autonoma de San Luis Potosi, Alvaro Obregon 64, 78000 San Luis Potosi (Mexico)

    2000-07-01

    We present a study of the molecular beam epitaxial (MBE) grown of Zn Se layers on Ga-As and Si substrates. For the growth on GaAs substrates we investigated the effects of introducing buffer layers of Al{sub x}Ga{sub 1-x} As and In{sub x}Ga{sub 1-x} As with x = 0.01. Moreover, an analysis by secondary ion mass spectroscopy revealed that the use of AlGaAs buffer layers effectively suppress the Ga segregation onto the Zn Se layers surface. On the other hand, for the growth of Zn Se on Si substrates, we achieved a significant improvement in the crystal quality of Zn Se by irradiating the Si substrates with plasma of nitrogen prior to the growth. (Author)

  16. EL COMERCIO ELECTRÓNICO. COMO SE COMPRARÁ Y VENDERÁ EN EL FUTURO

    OpenAIRE

    Mao Garzón Q.

    2012-01-01

    El comercio Electrónico se está transformando en un mecanismo cada vez más viable para el crecimiento productivo de los países, y el internet, además de ser un canal de comunicación muy eficaz, también se está transformando en un mercado alternativo para productos y servicios en el mundo entero. ¿Qué pasará en el futuro con respecto al comercio electrónico? ¿Cómo se está involucrando el internet en la sociedad actual? ¿Qué tecnologías se están e irán incorporándose al internet para el desarro...

  17. CALCULUL CINETOSTATIC AL MECANISMELOR PLANETARE CILINDRICE

    Directory of Open Access Journals (Sweden)

    Păun ANTONESCU

    2012-05-01

    Full Text Available În lucrare se prezintă o metodă analitică pentru calculul cinetostatic al mecanismului planetarmonomobil cu două roţi dinţate centrale. Se consideră mai întâi cazul general al schemelor cinematice cu douăroţi dinţate solidare tip satelit, în două variante practice (multiplicator şi reductor de turaţie. Este menţionatcazul particular al mecanismelor planetare cu o singură roată satelit cu angrenare dublă (exterioară şiinterioară. Pe baza modelului de analiză cinetostatică a mecanismului planetar monomobil cu două roţi dinţatecentrale, în finalul lucrării se abordează o problemă practică de calcul cinetostatic al unui mecanism planetarcilindric simplu folosit la capul de frezat pentru prelucrarea roţilor dinţate cilindrice cu dinţi curbi înhipocicloidă.

  18. Factores de riesgo asociados al embarazo ectópico

    OpenAIRE

    Jónathan Hernández Núñez; Magel Valdés Yong; Andrés Oscar Torres Chávez

    2013-01-01

    Fundamento: el embarazo ectópico se ha duplicado en la mayor parte de los países industrializados y representa una de las principales causas de muerte materna. Objetivo: identificar factores de riesgo que predisponen al embarazo ectópico.Métodos: estudio de casos y controles realizado en un universo de 132 pacientes del Municipio Habana del Este, operadas de embarazo ectópico en el Hospital Dr. Luís Díaz Soto desde el 2009 al 2011. Se escogió una muestra al azar de 66 pacientes que constituyó...

  19. Adherencia al tratamiento en pacientes con Diabetes tipo 2

    OpenAIRE

    Claudia Troncoso Pantoja; Delia Delgado Segura; Carolina Rubilar Villalobos

    2013-01-01

    La DM2 es una patología de crecimiento exponencial en los últimos años, por lo que su control es un llamado a intensificar los programas de salud dirigidos a esta población. Sin embargo, se presenta una falta de adherencia al tratamiento, por lo que esfuerzos realizados por el equipo médico se ven en numerosas ocasiones frustrados ante este escenario. Objetivo: Interpretar la percepción de los factores que determinan la adherencia al tratamiento prescrito de adultos con DM2 que asisten al Cen...

  20. Maltrato al anciano: "una realidad oculta en nuestra sociedad"

    OpenAIRE

    Rodríguez H. Shirley Catherine

    1996-01-01

    El maltrato al anciano es un hecho cotidiano, no reconocido socialmente como tal, por el contrario, el maltrato es considerado un cuento normal al que se ve expuesto un gran número de personas; que afecta el sistema familiar y a cada uno de sus miembros. Conscientes de la importancia del reconocimiento, identificación, manejo oportuno y adecuado y la intervención que enfermería realice en la situación del maltrato al anciano, se podrá forjar un camino hacia el cambio. La concepción d...

  1. Generador de señales de conmutación y control en un SRD utilizando un FPLD

    OpenAIRE

    Ramon Lumbreras, Pedro

    2013-01-01

    Se presenta este trabajo con el principal objetivo de implementar una electrónica que de forma simplificada nos permita generar las señales de disparo en diferentes convertidores de potencia, para un motor de reluctancia autoconmutado (SRM), computando la señal de conmutación de las fases con diferentes señales de control y partiendo de la posición en la que se encuentra su rotor mediante el uso de un sistema digital de medida (conjunto de optointerruptores asociados a un disco ranurado). ...

  2. Ionothermal Synthesis, Structure, and Bonding of the Catena -Heteropolycation 1 ∞ [Sb 2 Se 2 ] +

    KAUST Repository

    Groh, Matthias F.

    2015-01-26

    The reaction of antimony and selenium in the Lewis-acidic ionic liquid 1-butyl-3-methyl-imidazolium tetrachloridoaluminate, [BMIm]Cl•4.7AlCl3, yielded dark-red crystals of [Sb2Se2]AlCl4. The formation starts above 160 ° C; at about 190 ° C, irreversible decomposition takes place. The compound crystallizes in the triclinic space group P 1¯ with a = 919.39(2) pm, b = 1137.92(3) pm, c = 1152.30(3) pm, α = 68.047(1)° , β = 78.115(1)° , γ = 72.530(1)° , and Z = 4. The structure is similar to that of [Sb2Te2]AlCl4 but has only half the number of crystallographically independent atoms. Polycationic chains 1∞ [Sb2Se2]+ form a pseudo-hexagonal arrangement along [011¯] ], which is interlaced by tetrahedral AlCl4 - groups. The catena-heteropolycation 1∞ [Sb2Se2]+ is a sequence of three different four-membered [Sb2Se2 ] rings. The chemical bonding scheme, established from the topological analysis of the real-space bonding indicator ELI-D, includes significantly polar covalent bonding in four-member rings withinthepolycation.Theringsareconnectedintoaninfinitechainbyhomonuclear non-polar Sb-Sb bonds and highly polar Sb-Se bonds. Half of the selenium atoms are three-bonded.

  3. Control de brazo electrónico usando señales electromiográficas

    Directory of Open Access Journals (Sweden)

    Jorge Andrés García-Pinzón

    2015-05-01

    Full Text Available Los trabajos enfocados en la extracción de patrones en señales electromiográficas (SEMG han venido creciendo debido a sus múltiples aplicaciones. En este artículo se presenta una aplicación en la cual se implementa un sistema electrónico para el registro de las SEMG de la extremidad superior en un sujeto, con el fin de controlar de forma remota un brazo electrónico. Se realizó una etapa de preprocesamiento de las señales registradas, para eliminar información poco relevante, y reconocimiento de zonas de interés; enseguida se extraen los patrones y se clasifican. Las técnicas utilizadas fueron: análisis wavelet (AW, análisis de componentes principales (ACP, transformada de fourier (TF, transformada del coseno discreta (TDC, energía, máquinas de soporte vectorial (MSV o SVM y redes neuronales (RNA. En este artículo se demuestra que la metodología planteada permite realizar un proceso de clasificación con un rendimiento superior al 95%. Se registraron más de 4000 señales.

  4. Li2Se as a Neutron Scintillator

    International Nuclear Information System (INIS)

    We show that Li2Se:Te is a potential neutron scintillator material based on density functional calculations. Li2Se exhibits a number of properties favorable for efficient neutron detection, such as a high Li concentration for neutron absorption, a small effective atomic mass and a low density for reduced sensitivity to background gamma rays, and a small band gap for a high light yield. Our calculations show that Te doping should lead to the formation of deep acceptor complex VLi-TeSe, which can facilitate efficient light emission, similar to the emission activation in Te doped ZnSe

  5. The Ag{sub 2}Se-HgSe-SiSe{sub 2} system in the 0-60 mol.% SiSe{sub 2} region

    Energy Technology Data Exchange (ETDEWEB)

    Parasyuk, O.V.; Gulay, L.D.; Romanyuk, Ya.E.; Olekseyuk, I.D

    2003-01-13

    Phase equilibria in the quasiternary Ag{sub 2}Se-HgSe-SiSe{sub 2} system were investigated using X-ray phase analysis. Its isothermal section at 298 K was constructed. The formation of the quaternary Ag{sub 6}HgSiSe{sub 6} phase was confirmed. The existence of the homogeneity range for this compound at 23-43 mol.% of Hg{sub 4}SiSe{sub 6} (Ag{sub 6.16-4.56}Hg{sub 0.92-1.72}SiSe{sub 6}) was determined. The formation of three new intermediate phases Ag{sub {approx}}{sub 7.04-{approx}}{sub 6.32}Hg{sub {approx}}{sub 0.48-{approx}}{sub 0.84}Si= Se{sub 6} ({beta}), Ag{sub {approx}}{sub 3.44-{approx}}{sub 2.96}Hg{sub {approx}}{sub 2.28-{approx}}{sub 2.52}Si= Se{sub 6} ({delta}) and Ag{sub 2}Hg{sub 3}SiSe{sub 6} ({epsilon}) was found. All phases are localized along the Ag{sub 8}SiSe{sub 6}-Hg{sub 4}SiSe{sub 6} section. The crystal structures of the {beta}-phase (for the Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6} composition) and {delta}-phase (for the Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6} composition) were determined. Both phases crystallize with a cubic unit cell (space group F4-bar3m) with the lattice parameters a=1.08806(4) nm and a=1.07108(2) nm for the Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6} and Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6}, respectively. Atomic parameters for them were refined in the anisotropic approximation [R{sub I}=0.0830 (Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6}) and R{sub I}=0.0950 (Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6})]. The crystal structure of the {epsilon}-phase is under investigation. The phase diagram of the HgSe-SiSe{sub 2} system was constructed in the range 0-60 mol.% SiSe{sub 2}. It was established that the Hg{sub 4}SiSe{sub 6} compound melts congruently at 1044 K and forms eutectics at {approx}12 mol.% SiSe{sub 2} (1023 K) and {approx}52 mol.% SiSe{sub 2} (961 K)

  6. Materiales de Al2O3 - MgAl2O4 - CaAl12O19 - Ca2Mg2Al28O46 obtenidos mediante un proceso de sinterización reactiva entre Al2O3 y CaMg(CO3)2

    OpenAIRE

    Aza Moya, Antonio H. de; Peña, P.; Moset, M.

    2002-01-01

    [ES] Utilizado la información suministrada por el diagrama de equilibrio de fases Al2O3-MgO-CaO se ha diseñado y obtenido un material de Al2O3-MgAl2O4-CaAl12O19-Ca2Mg2Al28O46 mediante sinterización reactiva de una mezcla de Al2O3 y CaMg(CO3)2. Las reacciones que tienen lugar en la mezcla durante el proceso se han estudiado usando técnicas de análisis térmico diferencial, termogravimetrico y dilatometría. Muestras reaccionadas a temperaturas seleccionadas se han estudiado por difracci...

  7. The Ag{sub 2}Se-HgSe-GeSe{sub 2} system and crystal structures of the compounds

    Energy Technology Data Exchange (ETDEWEB)

    Parasyuk, O.V.; Gulay, L.D.; Romanyuk, Ya.E.; Olekseyuk, I.D.; Piskach, L.V

    2003-03-10

    The phase diagram of the quasi-ternary Ag{sub 2}Se-HgSe-GeSe{sub 2} system at 298 K was investigated using X-ray phase analysis and metallography. The formation of five intermediate quaternary phases {beta} (Ag{sub {approx}}{sub 7.12-{approx}}{sub 6.32}Hg{sub {approx}}{sub 0.44-{approx}}{sub 0.82}G= eSe{sub 6}), {gamma} (Ag{sub {approx}}{sub 6.08-{approx}}{sub 4.00}Hg{sub {approx}}{sub 0.96-{approx}}{sub 2.00}G= eSe{sub 6}), {delta} (Ag{sub 3.4}Hg{sub 2.3}GeSe{sub 6}), {epsilon} (Ag{sub {approx}}{sub 2.24-{approx}}{sub 2.00}Hg{sub {approx}}{sub 2.88-{approx}}{sub 3.00}G= eSe{sub 6}) and {approx}Ag{sub 1.4}Hg{sub 1.3}GeSe{sub 6} was established. The crystal structure of the {beta}-phase (for the Ag{sub 6.504}Hg{sub 0.912}GeSe{sub 6} composition) was determined using X-ray single crystal diffraction. It crystallizes in a cubic structure (space group F4-bar 3m) with the lattice parameter a=1.09026(4) nm. The crystal structure of the {delta}-phase (Ag{sub 3.4}Hg{sub 2.3}GeSe{sub 6}) was determined using X-ray powder diffraction (space group F4-bar 3m, a=1.07767(8) nm). The crystal structure determination of the {gamma}-phase (space group Pmn2{sub 1}) was performed for the compositions Ag{sub 5.6}Hg{sub 1.2}GeSe{sub 6}, Ag{sub 4.8}Hg{sub 1.6}GeSe{sub 6} and Ag{sub 4}Hg{sub 2}GeSe{sub 6} using X-ray powder diffraction. The crystal structure of the LT-Hg{sub 2}GeSe{sub 4} compound (space group I4-bar , a=0.56786(2), c=1.12579(5) nm) was confirmed by powder diffraction also.

  8. Aussprache als motorische Fertigkeit

    DEFF Research Database (Denmark)

    Bonner, Maria

    2013-01-01

    Authentische Aussprache gilt im Fremdsprachenunterricht als schwer erreichbares Ziel, fremdsprachlicher Akzent wird als nahezu unvermeidbar gesehen. Weder die Hypothese einer kritischen Periode für den Erwerb einer authentischen Aussprache noch das Konzept der Fossilierung im Sprachlernprozess...

  9. Amyotrophic Lateral Sclerosis (ALS)

    Science.gov (United States)

    ... benefit of 16 months before onset of severe respiratory failure. Other treatments are designed to relieve symptoms and ... of ALS. Most people with ALS die from respiratory failure, usually within 3 to 5 years from the ...

  10. Initial Symptoms of ALS

    Science.gov (United States)

    ... Chapters Certified Centers and Clinics Support Groups About ALS About Us Our Research In Your Community Advocate ... Diagnosis En español Symptoms The initial symptoms of ALS can be quite varied in different people. One ...

  11. APROXIMACIÓN AL CONSTITUCIONALISMO POPULAR

    OpenAIRE

    Daniel Eduardo Florez Muñoz

    2012-01-01

    RESUMOEn el presente trabajo se expondrán las principales líneas de pensamiento de la corriente de pensamiento iusconstitucional norteamericana conocida como Popular Constitutionalism. Al interior de la cual se realiza un frontal cuestionamiento de las bases democráticas que presuntamente detentan las lecturas del constitucionalismo soportadas en la desconfianza hacia la intervención de pueblo como instancia de decisión política concreta. Palavras- chave: Constitución, Pueblo, Tribunal Consti...

  12. Informe del Consejo de Indias al Rey

    OpenAIRE

    Mier, Adolfo

    2015-01-01

    Por el mes de Agosto de 1780 se divulgaron en la Villa de Oruro, Provincia de Charcas, algunas noticias y especies sediciosas de la Sublevación principiada en el Perú por el infame Jossef Gabriel fingido Tupac-amaro y se propagaban sus convocatorias a los Criollos contra los Europeos en pasquines y aun en conversaciones particulares: aparecieron también por navidad otros pasquines amenazando al Corregidor Dn. Ramón Urrutia, en el día, Gobernador Intendente de Tarma, con la ira y venganza de a...

  13. Ambientes virtuales como apoyo al Aprendizaje Colaborativo

    OpenAIRE

    Leguizamón, Guillermo; Chiarani, Marcela Cristina; Lucero, María Margarita; Pianucci, Irma Guadalupe; García, Berta Elena; Ponce, Viviana; Allendes Olave, Paola A.

    2005-01-01

    A partir de las conceptualizaciones sobre Educación a Distancia (EaD); y las Tecnologías disponibles para la EAD; se analizan los Ambientes Virtuales y su relación con el Código Abierto; lo que conlleva a presentar, en forma de grilla, las pautas y alcances de evaluación de plataformas virtuales de OS factibles de ser adaptados hacia la consecución de un Ambiente Virtual como apoyo al Aprendizaje Colaborativo. Con la puesta a punto, aplicación y relevo de esta grilla se estará en condicion...

  14. Regulación de la contractilidad miocárdica por vías de señalización epac-dependiencias

    OpenAIRE

    Lucotti, I.; Lezcano, N.; Said, Matilde; Mundiña-Weilenmann, Cecilia

    2011-01-01

    La estimulación beta-adrenérgica es un modulador importantísimo de la contractilidad cardíaca. Clásicamente los efectos de la estimulación del receptor beta1, se atribuyen al aumento del AMPc, que se produce cuando el agonista se une al receptor y activa a la AC a través de la proteína Gs. Inicialmente los efectos del AMPc se atribuyeron a la activación de la PKA, pero recientemente se conoce que el AMPc puede activar directamente a las proteínas Epac (proteínas que interc...

  15. Phase equilibrium in the AgInSe2-CdSe system

    International Nuclear Information System (INIS)

    Results of phase equilibrium in the AgInSe2-CdSe system by differential thermal, X-ray, microstructural analyses and measurements of microhardness are given. The system is quasibinary with limited solubility of the components in the solid state. The region of solid solution on the base of AgInSe2 is 4 mol.% CdSe (820 K). The ranges of solid solutions on the base of CdSe are much larger (up to 40 mol.% AgInSe2 at 820 K). Coordinates of eutectic point are 10 mol.% CdSe, 1023 K. The alloy AgCd2InSe4 is located in the solid solution ranges based on CdSe. (author)

  16. Semiconductor-metal transition of Se in Ru-Se Catalyst Nanoparticles

    Science.gov (United States)

    Babu, P. K.; Lewera, Adam; Oldfield, Eric; Wieckowski, Andrzej

    2009-03-01

    Ru-Se composite nanoparticles are promising catalysts for the oxygen reduction reaction (ORR) in fuel cells. Though the role of Se in enhancing the chemical stability of Ru nanoparticles is well established, the microscopic nature of Ru-Se interaction was not clearly understood. We carried out a combined investigation of ^77Se NMR and XPS on Ru-Se nanoparticles and our results indicate that Se, a semiconductor in elemental form, becomes metallic when interacting with Ru. ^77Se spin-lattice relaxation rates are found to be proportional to T, the well-known Korringa behavior characteristic of metals. The NMR results are supported by the XPS binding energy shifts which suggest that a possible Ru->Se charge transfer could be responsible for the semiconductor->metal transition of Se which also makes Ru less susceptible to oxidation during ORR.

  17. Synthesis and characterization of ZnSe:Fe/ZnSe core/shell nanocrystals

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Lin; Zhu, Jianguo, E-mail: yanglin_1028@163.com; Xiao, Dingquan

    2014-04-15

    High-quality ZnSe:Fe/ZnSe core/shell nanocrystals were prepared via a hydrothermal microemulsion technique. Effective surface passivation of monodisperse ZnSe:Fe nanocrystals is achieved by overcoating them with a ZnSe shell. The samples were characterized by means of XRD, EDX, TEM, PSD, XPS, photoluminescence, and Raman spectrum. The results show that the as-synthesized nanocrystals are cubic zinc blende ZnSe structure with high purity and the average particle size of ZnSe:Fe/ZnSe core/shell nanocrystal is larger than that of ZnSe:Fe core. The growth of ZnSe shell causes a small red shift in PL spectra, and then the PL quantum yield (QY) increases from 16% before shell growth to the maximum of 37% after increasing shell thickness up to 1.2 monolayers (ML). Moreover, both transverse optic (TO) and longitudinal optic (LO) phonon modes of ZnSe are shifted toward lower frequency as compared with the reported ones. -- Highlights: • ZnSe:Fe/ZnSe core/shell QDs were prepared by a hydrothermal microemulsion method. • ZnSe shell efficiently passivates surface defects by serving as a physical barrier. • The particle size and PL properties can be turned with the growth of ZnSe shell. • The luminescence efficiency and stability of QDs could be improved in this manner.

  18. Unrecognized hemoglobin SE disease as microcytosis

    OpenAIRE

    Smith, Avery; Cooper, Barry; Guileyardo, Joseph; Mora, Adan

    2016-01-01

    Hemoglobin SE disease was first described during the 1950s as a relatively benign microcytosis, but increasing prevalence has revealed a predisposition towards vasoocclusive sickling. Recognition of SE hemoglobinopathies’ potential complications is crucial so medical measures can be utilized to avoid multiorgan injury.

  19. Analysis of One-Bond Se-Se Nuclear Couplings in Diselenides and 1,2-Diselenoles on the Basis of Molecular Orbital Theory: Torsional Angular Dependence, Electron Density Influence, and Origin in J1(Se, Se)

    OpenAIRE

    Waro Nakanishi; Satoko Hayashi; Akito Tanioku

    2009-01-01

    Nuclear couplings for the Se-Se bonds, 1 J(Se, Se), are analyzed on the basis of the molecular orbital (MO) theory. The values are calculated by employing the triple ζ basis sets of the Slater type at the DFT level. 1 J(Se, Se) are calculated modeled by MeSeSeMe (1a), which shows the typical torsional angular dependence on ϕ(CMeSeSeCMe). The dependence explains well the observed 1 J obsd (Se, Se) of small values (≤ 64 Hz) for RSeSeR′ (1) (simple derivatives of 1a) and large values (330–380 Hz...

  20. Auditoría externa: responsabilidades cuando se trabaja con otros profesionales

    OpenAIRE

    Padin, María Belén

    2008-01-01

    Cuando un Contador Público es contratado como auditor externo se compromete a emitir un informe en el cual expresará su opinión sobre los estados contables del ente (puede suceder que el auditor finalmente deba abstenerse de opinar, pero esta es una excepción, ya que lo normal es que cuando se requieren los servicios de un auditor se espera que emita un informe). Al aceptar ser designado como auditor externo, el contador público acepta también las responsabilidades que recaen sobre él. Que so...

  1. Cs2UPd3Se6

    Directory of Open Access Journals (Sweden)

    George N. Oh

    2011-02-01

    Full Text Available Dicaesium uranium(IV tripalladium(II hexaselenide, Cs2UPd3Se6, crystallizes in the space group Fmmm in the Ba2NaCu3O6 structure type. The asymmetric unit comprises the following atoms with site symmetries as shown: U1 (mm2, Cs1 (222, Cs2 (m2m, Pd1 (.m., Pd2 (2mm, Se1 (m.., and Se2 (1. This layered structure contains six edge-sharing square-planar [PdSe4] units that form a hexagon. These, in turn, edge-share with [USe6] trigonal–prismatic units, forming an extended layer parallel to (010. The layers are stacked along [010]. They are staggered, and are separated by the Cs atoms. The Cs atoms are either coordinated in a square antiprism of Se atoms or are ten-coordinate, with one square face and the opposite face hexagonal.

  2. Ecuador: …hasta que se fueron todos

    Directory of Open Access Journals (Sweden)

    JUAN CARLOS MACHADO PUERTAS

    2008-01-01

    Full Text Available El 2007 fue un año de cambios radicales en la política ecuatoriana. Se destaca la batalla política y electoral entre un Ejecutivo encabezado por un líder antisistema y radical, y la desprestigiada clase política que a la postre resultaría en la desaparición del precario sistema de partidos. En este proceso el presidente logró pasar de una situación minoritaria extrema, al no tener ningún respaldo legislativo propio en el Congreso, al extremo opuesto de controlar totalmente una Asamblea Constituyente de plenos poderes. Mientras una muy desilusionada y resentida ciudadanía todavía aplaude la derrota de una clase política corrupta, los problemas estructurales del sistema se han agravado. De manera paradójica, la preocupación actual no se centra ya en la crónica inestabilidad política, sino en la supervivencia misma de la disfuncional democracia ecuatoriana.This article highlights the year 2007 as a watershed in Ecuadorian politics. It underscores the fierce political and electoral battle between the radical and anti-systemic President and the established political class which led to the collapse of the nation’s precarious party system. Within this process the President maneuvered from an extreme minority position, lacking partisan support in Congress, to one of unfettered control of a fully empowered Constituent Assembly. Whilst disaffected citizens still applaud the defeat of a highly corrupt political class, the country’s structural problems have grown even deeper. Paradoxically enough, the current problem is not the country´s cronic instability, , rather the very survival of Ecuador’s dysfunctional democracy.

  3. Se-ducere: esse obscuro objeto de desejo

    Directory of Open Access Journals (Sweden)

    Anna Maria Balogh

    2008-12-01

    Full Text Available No artigo se analisa a última obra-prima de Buñuel, Cet Obscur Objet du Désir, com ênfase nas questões relativas à sedução, ao erotismo e ao desejo. Tal aproximação se faz com base nas reflexões de reputados autores que abordaram o tema tais como Octavio Paz, Francesco Alberoni, Jean Baudrillard e Marilena Chauí, entre outros. Tratam-se também dos elementos de linguagem considerados mais singulares na representação do erotismo por parte de Buñuel no filme. Os principais elementos linguageiros do cineasta seriam as experimentações no tocante à montagem e na utilização das atrizes, as rupturas no sistema de expectativas tradicional no tocante aos papéis do homem e da mulher no erotismo e na sedução. Além dos mencionados, merecem menção o uso de alternâncias entre a narração e o comentário, entre o relato e a moldura, bem como um paradoxal recurso a uma simbologia de cunho erótico bem tradicional dentro de um filme considerado de ruptura e de vanguarda.

  4. Tratamiento numérico de señales

    Directory of Open Access Journals (Sweden)

    Andrés Maria Dockx

    2010-11-01

    Full Text Available En el campo de las comunicaciones detectamos claramente la tendencia del procesamiento de datos. Ya hace años la modulación de pulsos ha servido para una mayor utilización del canal conductor de la Información mientras la fuente seguía análoga. Mientras tanto la técnica digital ha desplazado también la técnica análoga en el campo del procesamiento. Antes el filtrado, amplificación, multiflexado y amortiguación eran procesos netamente análogos. Actualmente se busca diseñar una red telefónica basada en la generación digital en la fuente, en la transferencia digital y finalmente' en el procesamiento digital de la señal. La transformación discreta de Fourier Juega un papel importante en el análisis, en el diseño y en la Implementación de algoritmos y sistemas de procesamiento digital de datos. Su significado se expresa en el creciente número de procedimientos para realizar tal Información. Este trabajo pretende expresar en forma sencilla en qué consiste el método.

  5. On Some Physical Properties of GeSe3-Sb2Se3-ZnSe Thin Films and Their Radiation Response

    International Nuclear Information System (INIS)

    Thin films of the chalcogenides GeSe3, Sb2Se3, ZnSe, (GeSe3)80(Sb2Se3)20 and (GeSe3)70(Sb2Se3)10(ZnSe)20, are prepared by thermal evaporation onto glass substrates. The effect of ZnSe incorporation with both GeSe3, Sb2Se3 results in amorphous (GeSe3)70(Sb2Se3)10(ZnSe)20 composition as obtained from the X-ray analysis. Electrical measurements reveal a decrease in dc activation energy, ΔEdc, and an increase in ac activation energy, ΔEac, for (GeSe3)70(Sb2Se3)10(ZnSe)20 as compared with (GeSe3)80(Sb2Se3)20. Optical energy gap, Eg, and band tail width, Ee, are estimated in UV/VIS spectral region for fresh and γ-irradiated films, revealing a decrease in Eg and an increase in Ee for ZnSe and (GeSe3)70(Sb2Se3)10(ZnSe)20 compositions, with irradiation dose.

  6. Miedo al crimen y medios de comunicación: una revisión de la literatura

    OpenAIRE

    Isaías Molina Jácome

    2014-01-01

    Se revisa la literatura sobre la categoría "miedo al crimen", con el objetivo de comprender la asociación entre el crimen y los medios. La metodología se centró en revisar en las tres últimas décadas la temática del miedo al crimen, y se obtuvieron resultados en las tres tendencias identificadas: miedo al crimen asociado a la cobertura mediática; el miedo al crimen, la percepción del riesgo y victimización, y los estudios sobre el crimen, la prensa y las distintas miradas en Iberoamérica. Se ...

  7. Challenges of Agricultural Adaptation to Climate Change in Nigeria: a Synthesis from the Literature Les enjeux de l’adaptation agricole au changement climatique au Nigéria : synthèse de la littérature Retos de la adaptación agrícola al cambio climático en Nigeria: una síntesis de la literatura

    Directory of Open Access Journals (Sweden)

    Anselm A. Enete

    2010-12-01

    services, and encouragement for the formation of farmer groups.Le changement climatique est peut-être la menace environnementale la plus sérieuse qui pèse sur la lutte contre la faim, la malnutrition, les maladies et la pauvreté en Afrique, principalement en raison de son impact sur la productivité agricole. Cet article aborde les enjeux de l’adaptation agricole au changement climatique au Nigéria dans les catégories Faim et Pauvreté ; Financement de la recherche et du développement de technologies dans le secteur de l’agriculture ; Pratiques agricoles traditionnelles ; Libéralisation des échanges commerciaux et Développement du marché ; Politiques, Institutions et Biens publics ; et Informations et Capital humain. La population rurale, qui produit plus de 70 % des denrées alimentaires consommées au Nigéria, est extrêmement pauvre et doit faire face à la malnutrition et aux maladies. L’Etat, tout comme le secteur privé, qui devraient stimuler le secteur par le biais de politiques cohérentes de financements solides et du développement d’infrastructures, n’ont pas accordé au problème la priorité qu’il mérite. En outre, les bénéfices attendus de la libéralisation du commerce n’ont pas été répercutés sur les agriculteurs africains, ce qui n’est pas sans relation avec l’inefficacité du système des marchés locaux. Par ailleurs, les agriculteurs sont lents à modifier leurs pratiques agricoles, comme les feux de brousse, la déforestation et l’agriculture pluviale. Ils manquent de l’éducation, des informations et de la formation nécessaires pour s’adapter au changement climatique. Le gouvernement devrait non seulement décentraliser ses programmes sur la pauvreté / le VIH-SIDA et sur la recherche agricole (financement et activités mais aussi les rendre participatifs. En outre, différents éléments pourraient être mis en place : un cadre de politique agricole nationale explicite ; une planification des systèmes d

  8. Glass formation and the third harmonic generation of Cu2Se-GeSe2-As2Se3 glasses

    Science.gov (United States)

    Reshak, A. H.; Klymovych, O. S.; Myronchuk, G. L.; Zamuruyeva, O. V.; Zmiy, O. F.; Alahmed, Z. A.; Chyský, J.; Bila, Jiri; Kamarudin, H.

    2014-10-01

    We have performed the investigation of the nonlinear optical properties namely the third harmonic generation (THG) of the glass-formation region in the Cu2Se-GeSe2-As2Se3 system. The samples were synthesized by direct single-temperature method from high-purity elementary substances. We have found that the value of disorder parameter Δ depends on the composition of the glassy alloys. The measurements show that increasing the Cu2Se concentration leads to increased slope of the absorption edge, which may be explained by the decrease of the height of random potential relief for the electrons in the tails of the state density which border the band edges. A very sharp increase in the THG at low temperature was observed. Significant enhancement in THG was obtained with decreasing the energy gap, which agreed well with the nonlinear optical susceptibilities obtained from other glasses.

  9. El miedo al rey

    Directory of Open Access Journals (Sweden)

    François FORONDA

    2007-01-01

    Full Text Available La peur du roi. Sources et premières réflexions à propos d’une émotion aristocratique dans la Castille du XIVe siècleFace à un roi qui à présent pousse les effets de son ire jusqu’au meurtre pour faire le vide autour de lui et imposer sa différence souveraine, ses parents et les riches hommes, soit les principaux visés par cette politique de l’arbitraire qui enfreint les règles du jeu autant qu’elle contribue à les redéfinir, disent la peur (metus qu’ils ressentent, qu’ils utilisent aussi afin de donner à leur stratégie de pouvoir un fondement légitime. Et l’expression de cette émotion politique, qui tend à se muer en un stéréotype d’un discours aristocratique d’opposition, surtout présente dans les chroniques, mises ici en relation ici avec d’autres sources, notamment des correspondances, marque profondément l’histoire des relations souvent conflictuelles au sein de cette compagnie en définitive très étroite pendant un siècle, de la fin du XIIIe siècle à la fin du XIVe siècle. Cet article se propose d’ébaucher une première réflexion sur le sujet et d’en présenter les principales sources.El miedo al rey. Fuentes y primeras reflexiones acerca de una emoción aristocrática en la Castilla del siglo XIVFrente a un rey que ahora lleva hasta la muerte los efectos de su ira para hacer el vacío entorno a su persona e imponer su soberana, sus parientes y ricos hombres, o sea los principales afectados por esta política de la arbitrariedad que rompe las reglas del juego a la vez que contribuye a redefinirlas, dicen el miedo (metus que sienten, que utilizan también para darle a su estrategia de poder un fundamento legítimo. Y la expresión de esta emoción política, que tiende a convertirse en un estereotipo de un discurso aristocrático de oposición, sobre todo presente en la crónicas, aquí puestas en relación con otras fuentes, en particular cartas, marca profundamente la historia de

  10. Rasgos de personalidad y adherencia al tratamiento antirretroviral en pacientes que conviven con VIH/SIDA

    OpenAIRE

    Solti, Valeria; Albanesi, Susana

    2013-01-01

    Se hace relevante comprender que la adherencia al tratamiento de cualquier enfermedad crónica está atravesada por múltiples factores. Al hablar de la adherencia al TARV, generalmente se pone el acento en la toma de la medicación o demás aspectos clínicos (visitas a control médico, análisis de CD4 y Carga viral, etc.) que son absolutamente importantes, pero no lo único al hablar de adherencia en sentido amplio y reflexivo. La adhesión al TARV involucra además que el paciente practique ejercici...

  11. Historia del primer templo mayor de Tunja, nombrado de Nuestra Señora de Guadalupe

    Directory of Open Access Journals (Sweden)

    Ernesto Porras Collantes

    2004-01-01

    Full Text Available Gonzalo Suárez Rendón Sarmiento, fundador de Tunja, bautizó con el nombrede Nuestra Señora de Guadalupe al primer templo mayor de la ciudad. Elcarpintero Gregorio López estuvo a cargo de la construcción de la obra, desdefebrero hasta la navidad del año de

  12. Sin City: cuando el cine se rinde a los pies del cómic

    OpenAIRE

    Echazarreta Soler, Carmen

    2006-01-01

    Proposta didàctica que se situa entre els llenguatges del còmic i del cinema per a promoure la reflexió sobre la cerca de noves formes de narrar. El fil conductor és Sin City i es proposen, també, 10 activitats per als alumnes

  13. Self-organization in P_xGe_xSe_1-2x glasses^*

    Science.gov (United States)

    Chakravarty, Swapnajit; Georgiev, Daniel; Boolchand, Punit; Micoulaut, Matthieu

    2003-03-01

    Bulk glasses in the titled ternary, in the 0 MDSC and Raman scattering measurements. Both fresh and aged samples were studied. Bimodal endotherms are observed but only the high^T endotherm displays a reversing heat flow signal that represents a glass transition. The pre^_Tg endotherm is observed in quenched samples only, and represents an activation energy [1] associated with P4 units (Se^_P(Se_1/2)_3) converting to P3 (P(Se_1/2)_3) ones. T_g(x) accessed from the reversing heat flow are found to increase with x as a power^_law, displaying a cusp near x = 0.04. The non^_reversing enthalpy is found to display a global minimum in the 0.08 < x < 0.145 range identified with the self^_organized phase. Raman scattering reveals the isostatically rigid units ( P3 , P_4, CS and ES Ge(Se_1/2)_4) comprising building blocks of the self^_organized phase. These results are parallel to those encountered in the As^_Ge^_Se ternary [2,3]. ^*Supported by NSF grant DMR ^_01^_01808 1. D.G. Georgiev et al Phys. Rev. B 64,134204(2001) 2.Y. Wang et al Europhys. Lett. 52, 633 (2000) 3. T.Qu et al. companion abstract

  14. Solving the shape conundrum in $^{70}$Se

    CERN Multimedia

    We propose a multi-step Coulomb-excitation study of $^{70}$Se at HIE-ISOLDE using the $^{208}$Pb( $^{70}$Se, $^{70}$Se*)$^{208}$Pb* reaction at a safe energy of 5.0 MeV/u. We aim at a precise measurement of the $\\left \\langle 2^{+}_{1} \\hspace{0.1cm} || \\hspace{0.1cm}\\hat{E}2 \\hspace{0.1cm} || \\hspace{0.1cm}2^{+}_{ 1} \\right \\rangle$ diagonal matrix element as well as gaining information on additional matrix elements. Such information will shed light onto the shape conundrum of the 2$^{+}_{1}$ state in $^{70}$Se as well as foreseeing the opportunity for a more detailed understanding of the shape-coexistence phenomenon in this region.

  15. Jalta als Heterotopie

    OpenAIRE

    Schmid, Ulrich

    2013-01-01

    Jalta ist ein Ort, der sich im europäischen Kulturgedächtnis sowohl historisch als auch literarisch als "radikal anderer Ort" - als " Heterotopie" - festgesetzt hat. An der Konferenz von Jalta wurde 1945 eine neue Weltordnung geschaffen in der Hoffnung auf eine bessere Welt. Auch in den Werken von Anton ?echov, vor allem in denjenigen, die in Jalta entstanden sind, wird von einer anderen und besseren Welt geträumt.

  16. Pornographie als Metapher

    Directory of Open Access Journals (Sweden)

    Caroline Schubarth

    2010-02-01

    Full Text Available In diesem Artikel werden unterschiedliche metaphorische Verwendungen des Pornografiebegriffs und deren Implikationen untersucht. Während die Existenz von Pornografie der feministischen Anti-Porno-Bewegung als Erklärung für die anhaltende Diskriminierung von Frauen in westlichen Gesellschaften dient, nutzen rechtskonservative Kräfte den Pornografievorwurf als Rechtfertigung für die Zensur von als deviant empfundenen Identitäten und sexuellen Praktiken.

  17. Pornographie als Metapher

    OpenAIRE

    Caroline Schubarth

    2010-01-01

    In diesem Artikel werden unterschiedliche metaphorische Verwendungen des Pornografiebegriffs und deren Implikationen untersucht. Während die Existenz von Pornografie der feministischen Anti-Porno-Bewegung als Erklärung für die anhaltende Diskriminierung von Frauen in westlichen Gesellschaften dient, nutzen rechtskonservative Kräfte den Pornografievorwurf als Rechtfertigung für die Zensur von als deviant empfundenen Identitäten und sexuellen Praktiken.This article...

  18. Introducción al análisis de datos cualitativos y al programa ATLAS.TI 7. Material de apoyo

    OpenAIRE

    Sabariego Puig, Marta; Vilà Baños, Ruth

    2014-01-01

    Este dossier es un recopilatorio de los recursos que se utilizarán y se sugerirán a lo largo del curso, a modo complementario, sobre los principales temas que se presentarán. Se trata de un documento para permitir al lector la profundización de estos temas, mediante lecturas y bibliografía de ampliación al final, junto con los esquemas de todo el contenido para el seguimiento del curso estructurado en cuatro bloques básicos: TEMA 1.- El proceso de investigación cualitativa para la mejora ...

  19. Spectral Motion Synchronization in SE(3)

    OpenAIRE

    Arrigoni, Federica; Fusiello, Andrea; Rossi, Beatrice

    2015-01-01

    This paper addresses the problem of motion synchronization (or averaging) and describes a simple, closed-form solution based on a spectral decomposition, which does not consider rotation and translation separately but works straight in SE(3), the manifold of rigid motions. Besides its theoretical interest, being the first closed form solution in SE(3), experimental results show that it compares favourably with the state of the art both in terms of precision and speed.

  20. Magnetic properties of FeSe superconductor

    OpenAIRE

    Grechnev, G. E.; Panfilov, A.S.; Desnenko, V. A.; Fedorchenko, A. V.; Gnatchenko, S. L.; Chareev, D. A.; Volkova, O. S.; A.N. Vasiliev

    2012-01-01

    A detailed magnetization study for the novel FeSe superconductor is carried out to investigate the behavior of the intrinsic magnetic susceptibility $\\chi$ in the normal state with temperature and under hydrostatic pressure. The temperature dependencies of $\\chi$ and its anisotropy $\\Delta \\chi=\\chi_{|}-\\chi_{\\bot}$ are measured for FeSe single crystals in the temperature range 4.2-300 K, and a substantial growth of susceptibility with temperature is revealed. The observed anisotropy $\\Delta ...

  1. The system SnTe-InSe

    International Nuclear Information System (INIS)

    This paper discusses the nature of the interaction and physicochemical properties of the alloys of the system SnTe-InSe. The DTA was performed on an NTR-74 pyrometer, XPA on a Dron-2.0 diffractometer and MSA on an MIM-7 metallographic microscope. The microhardness of the samples was determined on a PMT-3 microhardness tester. The congruently melting compound SnInTeSe and solid solutions based on the starting components are formed in the system

  2. MAGNETIC ANOMALY IN SUPERCONDUCTING FeSe

    OpenAIRE

    Mendoza, D.; Benitez, J. L.; Morales, F.; Escudero, R.

    2010-01-01

    Synthesis, electrical and magnetic characterization of superconducting FeSe0.85 compound is reported. An anomaly in the magnetization against temperature around 90K is observed. Magnetic characterization of a commercial compound with nominal FeSe stoichiometry is also presented. The overall magnetic behaviors as well as the magnetic anomaly in both compounds are discussed in terms of magnetic impurities and secondary phases. Keyword: A. Superconductors

  3. Double electron capture searches in $^{74}$Se

    CERN Document Server

    Lehnert, B; Degering, D; Sommer, D; Wagner, L; Zuber, K

    2016-01-01

    A search for various double electron capture modes of $^{74}$Se has been performed using an ultralow background Ge-detector in the Felsenkeller laboratory, Germany. Especially for the potentially resonant transition into the 1204.2 keV excited state of $^{74}$Ge a lower half-life limit of $0.70\\cdot 10^{19}$ yr (90% credibility) has been obtained. Serious concerns are raised about the validity of obtained $^{74}$Se limits in some recent publications.

  4. Exciton-Phonon Scattering in CdSe/ZnSe Quantum Dots

    Institute of Scientific and Technical Information of China (English)

    张立功; 申德振; 范希武; 吕少哲

    2002-01-01

    A temperature-dependent photoluminescence measurement is performed in CdSe/ZnSe quantum dots with a ZnCdSe quantum well. We deduce the temperature dependence of the exciton linewidth and peak energy of the zero-dimensional exciton in the quantum dots and two-dimensional exciton in the CdSe wetting layer. The experimental data reveal a reduction of homogeneous broadening of the exciton line in the quantum dots in comparison with that in the two-dimensional wetting layer, which indicates the decrease of exciton and optical phonon coupling in the CdSe quantum dots.

  5. Atomistic Model of Physical Ageing in Se-rich As-Se Glasses

    Energy Technology Data Exchange (ETDEWEB)

    Golovchak,R.; Shpotyuk, O.; Kozdras, A.; Bureau, B.; Vlcek, M.; Ganjoo, A.; Jain, H.

    2007-01-01

    Thermal, optical, X-ray excited and magnetic methods were used to develop a microstructural model of physical ageing in Se-rich glasses. The glass composition As10Se90, possessing a typical cross-linked chain structure, was chosen as a model object for the investigations. The effect of physical ageing in this glass was revealed by differential scanning calorimetry, whereas the corresponding changes in its atomic arrangement were studied by extended X-ray absorption fine structure, Raman and solid-state 77Se nuclear magnetic resonance spectroscopy. Straightening-shrinkage processes are shown to be responsible for the physical ageing in this Se-rich As-Se glass.

  6. Partial pressure diagrams of the In-Se-O and Ga-Se-O systems

    International Nuclear Information System (INIS)

    The partial pressure diagrams of the In-Se-O and Ga-Se-O systems in the po2 and pSeO2 coordinates have been discussed. The mono- and invariant equilibria have been calculated using isothermal Want-Hoff equation. The relationships between the partial pressure diagrams and the condensed phase equilibrium diagrams have been established. It has been shown that the increase of the SeO2 partial pressure leads to the formation of the A2III Se3 compounds and the formation of oxide phases requires relatively high pressures of oxygen

  7. Dos algoritmos para estimar el periodo de una señal discreta

    Directory of Open Access Journals (Sweden)

    José Danilo Rairán Antolines

    2014-11-01

    Full Text Available In this paper, we present two algorithms for approximating a period given a discrete data set. These algorithms superimpose two consecutive sections of the data for several candidate periods. The first algorithm counts the number of shuffling points per candidate period, whereas the second algorithm computes a distance between points when sorted by time. The best candidate period maxim-izes the number of shuffling points in the first algorithm, whereas the second algorithm minimizes the distance between points. The experimental validation with noiseless data demonstrates that the relative error for the estimations is less than half of the sampling period and shows that this error does not depend on the harmonic content, as normally occurs with algorithms that estimate a period. The application of the algorithms demonstrates that they properly track the frequency of a power grid and accurately estimate the period of a Van der Pol oscillator, which serves to confirm their applicability to real-time problems. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabla normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0mm 5.4pt 0mm 5.4pt; mso-para-margin:0mm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

  8. Cum se construiește profilul strategic al unei comunități

    Directory of Open Access Journals (Sweden)

    Călin Emilian HINȚEA

    2015-12-01

    Full Text Available The article presents a particular methodology of strategic planning: building a strategic profile of the community. This model is the result of years of research and applied planning in local communities and tries to help all interested parties to understand and use the strategy.

  9. CuInGaAlSe2 Solar Absorbers On Flexible High-Temperature Substrates Project

    Data.gov (United States)

    National Aeronautics and Space Administration — ITN Energy Systems (ITN) proposes to take the next step in spacecraft solar array development, building upon previous development and new findings to make the...

  10. Al- Khwarizmi and axiomatic foundation of algebra

    International Nuclear Information System (INIS)

    This paper intends to investigate the axiomatic foundations of algebra, as they were presented in the book of algebra of al-Khwarizmi (9 th century), and as they were developed in many subsequent Arabic works. The paper gives also a description of algebra evolution towards a discipline independent ofgeometry and arithmetic: the two disciplines whosemarriage had led to its birth.By an in depth reading of some details in the text of al Khwarizmi , we concluded that this mathematician intended to lay down the axiomatic foundations of that new discipline. His resort to arithmetical and geometrical means was a way of making his theory more accessible. He used them to justify the axioms: those that were not explicitly introduced per se, and those that were remained implicit. The paper also relies on some unedited writingsof al-Khwarizmi's successors, which could shedlight on the ways they used to consolidate the foundations of algebra and improve its methods. (author)

  11. Effect of composition on optical properties of GeSe3–Sb2Se3–ZnSe thin films

    Indian Academy of Sciences (India)

    M R Balboul; H M Hosni; M A Soliman; S A Fayek

    2014-10-01

    Optical properties of the chalcogenides GeSe3, Sb2Se3, ZnSe, (GeSe3)80(Sb2Se3)20 and (GeSe3)70 (Sb2Se3)10(ZnSe)20 thin films are investigated. Incorporation of ZnSe into both GeSe3, Sb2Se3 results in amorphous (GeSe3)70(Sb2Se3)10(ZnSe)20 composition. The estimated optical energy gap, g, is found to decrease from 3.06 eV for ZnSe to 1.81 eV for (GeSe3)70(Sb2Se3)10(ZnSe)20. While, the band tail width, e, exhibits an opposite trend. The g behaviour is believed to be associated with cohesive energy, CE, as the incorporation of ZnSe lowers its value. The calculated number of the excess of Se–Se homopolar bonds is found to affect mainly the e values. The refractive index, , is discussed in terms of Wemple–DiDomenico single oscillator dispersion model in the normal dispersion region. The oscillator energy, o, and the dispersion energy, d, are determined for films under investigation.

  12. Sucesión en la empresa familiar: Su futuro cuando la muerte se acerca

    Directory of Open Access Journals (Sweden)

    Jesús Alberto Andrade C.

    2002-01-01

    Full Text Available Este trabajo hace un análisis teórico al tema de la empresa familiar. Tiene como objetivos identificar características que definen a una empresa familiar en comparación con empresas no familiares; analizar la sucesión del negocio familiar al considerar que el futuro deseado de cada uno de los miembros debe ser común y único, si se quiere su continuidad; analizar cómo el manejo de conflictos sirve para desarrollar un buen plan sucesoral que permite integrar a la familia en torno a una visión de negocio común a todos los miembros de la familia. Se parte de la hipótesis que si se quiere que los negocios familiares perduren a la siguiente generación, la familia debe enfrentar el temor de la muerte a fin de poder desarrollar un plan sucesoral que sea beneficioso tanto para la empresa como para la propia familia. Los resultados de la investigación señalan que la empresa familiar es una organización que se sustenta en un permanente conflicto, por lo tanto, para que la empresa perdure deben establecerse mecanismos de participación de los integrantes, y ello es posible, porque en las empresas familiares seconcentran en pocas manos el control, permitiéndoles ser ágiles en el proceso de toma de decisiones estratégicas. Se concluye que las empresas familiares se caracterizan por el estrecho nexo cultural y tradicional con la familia que las dirige; y se distinguen de otros tipos de negocios, por el tipo de compromiso de los miembros con la empresa y por el éxito alcanzado cuando se define un plan de sucesión que sirva de transición no traumática de una generación a la siguiente.

  13. Synthesis, structure, magnetic and photo response properties of La3CuGaSe7

    International Nuclear Information System (INIS)

    Highlights: • We successfully synthesized the first Cu2+-containing compound in the Ce6Al3.33S14 family. • The Cu atoms undergo a position disorder along c axis. • The compound shows a band gap of 1.36 eV. • The compound shows paramagnetic properties. • The high photo current up to 2.4 mA is achieved under visible light irradiation. - Abstract: The quaternary compound La3CuGaSe7, which is the first Cu2+-containing compound in the Ce6Al3.33S14 family (space group P63, Pearson symbol hP24), was synthesized in a solid state reaction at 1273 K. The structure was determined by single crystal X-ray diffraction. The refined lattice parameters are a = 10.6010(8) Å and c = 6.376(1) Å. The crystal structure consists of isolated [CuSe3]4− pyramid and [GaSe4]5− tetrahedra. The isolated [CuSe3]4− pyramid and the isolated [GaSe4]5− tetrahedra are connected by [LaSe7]11− monocapped trigonal prisms. Phase purity of the powder sample was confirmed by powder X-ray diffraction. The band gap of the compound is 1.36 eV. The photo current of the compound achieves 2.4 mA under the visible light irradiation

  14. Auditoría externa: responsabilidades cuando se trabaja con otros profesionales

    Directory of Open Access Journals (Sweden)

    Padin, María Belén

    2008-11-01

    Full Text Available Cuando un Contador Público es contratado como auditor externo se compromete a emitir un informe en el cual expresará su opinión sobre los estados contables del ente (puede suceder que el auditor finalmente deba abstenerse de opinar, pero esta es una excepción, ya que lo normal es que cuando se requieren los servicios de un auditor se espera que emita un informe. Al aceptar ser designado como auditor externo, el contador público acepta también las responsabilidades que recaen sobre él. Que son inherentes a su desempeño profesional y que están regidas por las normas profesionales dentro de las cuales debe encuadrar su actividad. A lo largo de este trabajo, se estudiará qué responsabilidades recaen sobre el auditor cuando actúa en colaboración con otros profesionales. Los casos específicos que se estudiarán son: 1 responsabilidad por la utilización del trabajo de otro auditor; 2 consideración del trabajo de auditoria interna; y 3 utilización del trabajo de un experto. Para ello se mencionarán las normas internacionales de auditoria (NIA que tratan cada tema en específico, y alguna norma en particular que exista de otro organismo al respecto.

  15. Phase Separation in As_2-xGe_xSe_1-2x Glasses^*

    Science.gov (United States)

    Georgiev, Daniel; Mamedov, Sergey; Qu, Tao; Boolchand, Punit

    2003-03-01

    The global maximum in Tg near stoichiometric compositions(GeSe_2, As_2Se_3) in binary (Ge-Se, As-Se) selenide glasses is evidence for nanoscale phase separation [1]. The connection between Tg and network connectivity has thus opened new possibilities to address glass structure issues using scanning calorimetry. Eleven compositions spanning the two end members of the titled ternary are examined in MDSC [2] and FT-Raman scattering measurements. T_g(x) are found to increase with x in the 0 increases. At x =1, the glass can be described as a random network of polymeric As2 (Se_1/2)4 units mixed with Ge(Se_1/2)4 tetrahedra. At x > x_t, the Ge/Se ratio > 1/2 , as ethanelike Ge_2Se3 nanophase nucleates, and Tg decline as decreases [1]. ^* Supported by NSF grant DMR 01-010808 [1] P.Boolchand and W.J.Bresser Phil. Mag. B 80,1757(2000). [2] D.G.Georgiev et al. Phys.Rev B 62,R9228(2000).

  16. Señalización y seguridad vial

    OpenAIRE

    García Verduch, Antonio

    1992-01-01

    Se explica el suceso de que un autobús con 55 pasajeros se salió de la autopista y sufrió un accidente, se pide que se esclarezcan los hechos y que se dote de mejor señalización a las carreteras españolas

  17. Predictores de adicción al tabaco en adultos jóvenes

    OpenAIRE

    Vara, E. (E.); Montejo, R. (R.); Martinez-Soroa, I. (I.); Orenga, E. (E.); Medina, E.; Martinez-Gonzalez, M.A.

    1997-01-01

    Se entrevistó a 150 fumadores activos para identificar los predictores de la adicción al tabaco. Para determinar dicha adicción se utilizó el test de Fagerstrom. Se examinó la posible asociación entre la adicción al tabaco y diversas variables referidas al estilo de vida. Partiendo de un estudio de casos y controles, se consideró un tiempo de inducción 2" 2 meses. Se ajustó un modelo de regresión logística después de estimar las odds ratios crudas. La adicción al ta...

  18. Al-Anon/Alateen

    Science.gov (United States)

    Find an Al-Anon meeting Español | Français 2018 Int'l Convention Home About Group Meetings What If I'm not ready ... a meeting? What can I expect at an Al-Anon meeting? What was my first meeting like? ...

  19. Anclados al neuromarketing

    OpenAIRE

    Castro Lanero, Sonia Beatriz

    2012-01-01

    El neuromarketing es una ciencia de muy reciente creación que se nutre de dos ciencias clave: la investigación empírica del estudio cerebral que nos hace vislumbrar aspectos deterministas del comportamiento humano y su posible aplicación en el proceso de decisión de compra. En este trabajo se recopilan los últimos avances que se han realizado ene ste campo en el ámbito interenacional así como su incipiente desarrollo en España y en la Comunidad Autónoma de Castilla y León en particular. Final...

  20. Al - BASED CAST COMPOSITES

    Directory of Open Access Journals (Sweden)

    Rakesh Kumar Yadav

    2011-08-01

    Full Text Available The economy is very important feature nowadays in themarket. The researches are playing an important role inengineering field to increase the life of machine parts /components and decrease the cost. The compositematerials have the potential to replace widely used steeland aluminium due to their good characteristics withbetter performance. The Al-based composites have foundextensive applications in automobile industries andaerospace industries due to their increased stiffness,strength, thermal conductivity and wear resistanceproperties. A number of particulate phases have beenemployed in the Al-alloy matrix. The cast aluminiumceramicparticulate composites are finding applications inpistons, connecting rods, cylinder liner, engine cylinderblock, electrical contacts etc.The present investigation isbased on study of the effect of particulate phase on theSEM study, micro-hardness, elastic modulus, tensilestrength and the wear behaviour of Al-5 % SiC-7 % Fe,Al-10 % SiC-6 % Fe and Al-15 % SiC-5 % Fe composites.

  1. Aplicaciones del coaching al deporte: adaptación al pádel

    OpenAIRE

    González Hernández, Antonio; Torres López, Borja

    2015-01-01

    En el presente trabajo pretendemos aportar una visión profunda en la aplicación del coaching al deporte y cómo puede ser usado por directivos, entrenadores o jugadores de una organización deportiva o club, en el pádel de manera concreta. Conoceremos las distintas fases que se deben dar para una correcta intervención, además de los acuerdos entre el coach y el deportista. En el contexto actual, las empresas y entidades deportivas se ven obligadas a adaptarse a la nueva realidad económica. ...

  2. Quito Gay: Al borde del destape y al margen de la ciudad

    OpenAIRE

    Aguirre Arauz, Patricio

    2010-01-01

    En este trabajo se busca explicar cómo se construye las imágenes, lenguajes y discursos de la homosexualidad en Quito. Aunque este tema brotó espontáneamente como inquietud personal, no por ello pierde su sentido antropológico y su compromiso ético con las poblaciones estudiadas. Al inicio las inquietudes del autor brincaban entre el entusiasmo por un tema poco común y el afán de entender una identidad aparentemente oculta. Pronto los discursos a través de los medios de comunicación, el leng...

  3. MoSe2 / Polyaniline Solar Cells

    Directory of Open Access Journals (Sweden)

    H.S. Patel

    2011-01-01

    Full Text Available Solar cells have been investigated since long for harnessing the solar energy. During this decade, a new direction has come up where in the polymers have been used in the fabrication of solar cells. Polyaniline is one of the polymers which has shown potential for its applications in heterostructure solar cells. This material is being used along with the semiconductors like InSe, TiO2, Si etc. to form the photosensitive interface. In this direction, we report our investigations on the use of Molybdenum diselenide (MoSe2 as photosensitive semiconducting material in MoSe2 / polyaniline solar cells. In this paper, the preparation of MoSe2 / polyaniline solar cells has been reported. Also, the photovoltage → photocurrent characteristics of this structure have been discussed in detail in this paper. The variation of different parameters of MoSe2 / polyaniline solar cells (like open circuit voltage, short circuit current, photoconversion efficiency and fill factor with the intensity of incident illuminations has been reported in this paper. In present case, the photocurrent density was found to be around 250 µA/cm2 with the photovoltage around 8.5 mV (which is low the photoconversion efficiency was found to be around 0.7 % along with the fill factor around 0.33. The efforts have been made to explain the low values of the photoconversion efficiency.

  4. PbSe Nanocrystal Excitonic Solar Cells

    KAUST Repository

    Choi, Joshua J.

    2009-11-11

    We report the design, fabrication, and characterization of colloidal PbSe nanocrystal (NC)-based photovoltaic test structures that exhibit an excitonic solar cell mechanism. Charge extraction from the NC active layer is driven by a photoinduced chemical potential energy gradient at the nanostructured heterojunction. By minimizing perturbation to PbSe NC energy levels and thereby gaining insight into the "intrinsic" photovoltaic properties and charge transfer mechanism of PbSe NC, we show a direct correlation between interfacial energy level offsets and photovoltaic device performance. Size dependent PbSe NC energy levels were determined by cyclic voltammetry and optical spectroscopy and correlated to photovoltaic measurements. Photovoltaic test structures were fabricated from PbSe NC films sandwiched between layers of ZnO nanoparticles and PEDOT:PSS as electron and hole transporting elements, respectively. The device current-voltage characteristics suggest a charge separation mechanism that Is distinct from previously reported Schottky devices and consistent with signatures of excitonic solar cells. Remarkably, despite the limitation of planar junction structure, and without film thickness optimization, the best performing device shows a 1-sun power conversion efficiency of 3.4%, ranking among the highest performing NC-based solar cells reported to date. © 2009 American Chemical Society.

  5. Monoclinic Cu2Se3Sn.

    Science.gov (United States)

    Gulay, L D; Daszkiewicz, M; Ostapyuk, T A; Klymovych, O S; Zmiy, O F

    2010-05-01

    A previously unknown modification of dicopper(I) triselenostannate(IV), Cu(2)Se(3)Sn, has been obtained from the Cu(2)Se-SnSe(2) quasi-binary system and investigated using X-ray single-crystal diffraction. The Se atoms are stacked in a closest-packed arrangement with the layers in the sequence ABC. The Cu atoms occupy one-third of the tetrahedral interstices, whereas the Sn atoms are located in one-sixth of the tetrahedral interstices. All the atoms occupy general positions. The structure possesses pseudo-inversion symmetry. The Cu(2)Se(3)Sn structure investigated in this paper (96 atoms per unit cell, ordered distribution of Cu and Sn over 12 cation positions) is a superstructure of the reported cubic (eight atoms per unit cell, random distribution of Cu and Sn over one cation position) and monoclinic (24 atoms per unit cell, ordered distribution of Cu and Sn over three cation positions) modifications. PMID:20442500

  6. Análisis de la actualización que se proporciona a los docentes del Centro de Estudios Científicos y Tecnológicos Narciso Bassols.

    OpenAIRE

    Reynoso Urbano, Agustín

    2015-01-01

    La investigación aborda la actualización que se proporciona a los docentes del CECyT “Narciso Bassols”, centro que pertenece al Instituto Politécnico Nacional. Se revisaron los trabajos que se han desarrollado en esta materia. Se encuentra que la actualización, es un elemento muy importante en la vida de cualquier Institución y esta cobra relevancia si se trata de una que se dedica a la prestación de servicios. De los diversos autores que se revisaron, se observo que estos coinciden en manife...

  7. Comportamiento en fluencia de un material compuesto de matriz metálica Al6061-15 vol % SiCw pulvimetalúrgico

    OpenAIRE

    Fernández, Ricardo; García-Alonso, E.; González-Doncel, Gaspar

    2005-01-01

    Se ha realizado un estudio de las propiedades en fluencia del material compuesto pulvimetalúrgico Al6061-15 vol % SiCw. Su comportamiento se ha comparado con el de la aleación Al6061 pulvimetalúrgica y la aleación Al6061 de colada. El comportamiento del material pulvimetalúrgico sin reforzar mejora respecto al del material de colada. Al mismo tiempo, el del material compuesto mejora respecto al comportamiento del material pulvimetalúrgico sin reforzar. Se consideran dos factores microestructu...

  8. Phonon softening in the CDW systems NbSe2 and TiSe2

    International Nuclear Information System (INIS)

    We present new results on the soft-mode behaviour of phonons in the Charge Density Wave (CDW) systems NbSe2 and TiSe2. Our theoretical predictions from Density Functional Theory (DFT) based on ab-initio phonon calculations coincide with the CDW instability behaviour that we observed experimentally by means of high resolution Inelastic X-ray Scattering (IXS). While TiSe2 shows a rather sharp phonon anomaly at T=190 K, the anomaly in NbSe2 at T=33 K is much broader than expected for a Fermi surface nesting driven CDW instability. For NbSe2, we exclude Fermi surface nesting as main origin of the phonon softening. For TiSe2, the phonon softening seems to be well described within the framework of DFT.

  9. Cd And Se Atomic Environments During the Growth of CdSe Nanoparticles in Glass

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, T.M.; Persans, P.D.; Filin, A.; Peng, C.; Huang, W.

    2006-10-27

    Thermal treatment of Cd and Se doped borosilicate glass yields CdSe nanoparticles that are interesting for applied and fundamental studies of quantum and size effects in semiconductors. Using x-ray absorption spectroscopy at both the Cd and Se K-edges, we have studied the local atomic structure for each of these reactants at several stages of particle growth. When the doped glass is quenched from 1050 C, the Cd neighbor is mostly oxygen and the Se neighbor is mostly Zn. With heat treatment at 600-750 C, the concentration of nearest neighbor Cd-Se bonds increases and becomes dominant while the optical spectrum evolves toward that of a composite containing CdSe.

  10. Bio-fortification and isotopic labelling of Se metabolites in onions and carrots following foliar application of Se and 77Se

    OpenAIRE

    Kapolna, Emese; Laursen, Kristian Holst; Husted, Søren; Larsen, Erik H

    2011-01-01

    The aims were to bio-fortify onions by foliar application of selenium (Se) and to intrinsically label bioactive Se-metabolites in onion and carrot by enriched, stable77Se for use in human physiological studies. Onion bulbs and leaves were enriched in Se by repeated foliar spraying of 10 or 100 μg Se mL-1 solutions of sodium selenite (Se(IV)) or sodium selenate (Se(VI)). ICP-MS analysis of onion leaves and bulbs showed that the Se concentration was enhanced by up to a factor of approximately 5...

  11. Half-life determination of 65Se

    International Nuclear Information System (INIS)

    65Se, a nuclide with Tz = -3/2, A = 4n + 1 produced in 40Ca(28Si, 3n) reaction was identified via its β-delayed proton emission. A single proton group at 3.70 +- 0.08 MeV was observed and its half-life was experimentally determined to be 9.6-4.1+5.3 ms which was corresponding to superallowed β transition from ground state of 65Se to the isospin analog state, the lowest T = 3/2 state, in 65As and the subsequent proton emission to the ground state of 64Ge. Based on these results combining with coulomb displacement energy calculation, the mass excess of 65Se was obtained as -33.26 +- 0.25 MeV. (2 tabs., 5 figs.)

  12. Klaidos patyrimas audiovizualinėse medijose

    OpenAIRE

    Tamaševičius, Saulius

    2011-01-01

    Šiame bakalauro darbe siekiama ištirti klaidos raiškos ir patyrimo galimybes skaitmeninėse audiovizualinėse medijose. Klaida analizuojama kaip teorinė ir filosofinė sąvoka. Klaidos ir skaitmeninių medijų patyrimo santykyje iškyla sinestezijos reikšmė, kvestionuojanti skaitmeninių medijų juslinio patyrimo sąlygas. Klaidos apraiškos skaitmeninėse medijose tiriamos ne tik teoriškai, žvelgiama ir į trikties (angl. glitch ) reiškinį kaip į tiesioginę skaitmeninės klaidos apraišką tiek garsinėje, t...

  13. Seguimiento al hogar de personas con antecedentes de enfermedad mental

    OpenAIRE

    Esguerra de Cárdenas Irene

    2010-01-01

    El "programa de apoyo y seguimiento al hogar de personas con antecedentes de enfermedad mental" se inició formalmente en marzo de 1993 en la Clínica Nuestra Señora de la Paz. Surgió de la necesidad de implementar acciones concretas al egreso de los pacientes de la institución, tendientes a reforzar la responsabilidad de éstos en su tratamiento y manejo de la enfermedad en el hogar y además de ofrecer un recurso de apoyo para escuchar sus inquietudes y preocupaciones. El propósito del...

  14. Cogito y locura. En torno al debate Foucault-Derrida

    OpenAIRE

    Amar Díaz, Mauricio

    2012-01-01

    El artículo indaga en la polémica en torno al estatuto de la locura en la filosofía, en el que participaron Michel Foucault y Jacques Derrida. Se plantea la posibilidad abierta por Foucault de realizar una historia de la locura, así como la pertinencia de las críticas que realiza Derrida a la manera aparentemente contradictoria en que Foucault se refiere, a lo largo de su obra, al psicoanálisis y a la figura de Freud. The article explores the controversy surrounding the status of madness i...

  15. Reduction in the crystal defect density of Zn Se layers grown by molecular beam epitaxy

    International Nuclear Information System (INIS)

    We present a study of the molecular beam epitaxial (MBE) grown of Zn Se layers on Ga-As and Si substrates. For the growth on GaAs substrates we investigated the effects of introducing buffer layers of AlxGa1-x As and InxGa1-x As with x = 0.01. Moreover, an analysis by secondary ion mass spectroscopy revealed that the use of AlGaAs buffer layers effectively suppress the Ga segregation onto the Zn Se layers surface. On the other hand, for the growth of Zn Se on Si substrates, we achieved a significant improvement in the crystal quality of Zn Se by irradiating the Si substrates with plasma of nitrogen prior to the growth. (Author)

  16. Synthesis of near-infrared-emitting CdTe/CdSe/ZnSe/ZnS heterostructure.

    Science.gov (United States)

    Yang, Ping

    2014-04-01

    Near-infrared-emitting quantum dots (QDs) were fabricated via organic synthesis strategies through constructing CdTe/CdSe/ZnSe/ZnS multishell heterostructure. An effective shell-coating route was developed for multishell growth on CdTe cores. Core/shell growth was monitored by absorption and photoluminescence (PL) spectroscopy and transmission electron microscopy observation. Yellow emitting CdTe cores were coated with a CdSe shell to generate type II structure. This yields core/shell QDs with red photoluminescence. The passivation by the ZnSe shell having a substantially wide bandgap confines the excitons within the CdTe/CdSe interface and isolates them from the solution environment and consequently improves the stability of the heterostructure. An additional ZnS shell was deposited around the outer layer of CdTe/CdSe/ZnSe QDs to form a heterostructure through the reaction between zinc oleate and trioctylphosphine sulfur in the crude CdTe/CdSe/ZnSe solution. By varying CdTe core size and each shell thickness, the PL wavelength of the obtained heterostructure can span from 580 to 770 nm. The PL efficiency is quenched in CdTe QDs in diluted solution but increases substantially up to 24% for CdTe/CdSe core/shell QDs. The PL efficiency of CdTe/CdSe/ZnSe/ZnS QDs with average diameter of 5.4 nm and a PL peak wavelength of 770 nm is 20%. PMID:24734747

  17. [Environmental factors in ALS].

    Science.gov (United States)

    Juntas-Morales, Raul; Pageot, Nicolas; Corcia, Philippe; Camu, William

    2014-05-01

    ALS is likely to be a disorder of multifactorial origin. Among all the factors that may increase the risk of ALS, environmental ones are being studied for many years, but in the recent years, several advances have pointed to a new interest in their potential involvement in the disease process, especially for the cyanotoxin BMAA. Food containing BMAA has been found on Guam, a well-known focus of ALS/parkinsonism/dementia and high levels of BMAA have been identified into the brain of these patients. The BMAA cyanotoxin is potentially ubiquitous and have also been found into the food of patients who died from ALS both in Europe and USA. BMAA can be wrongly integrated into the protein structure during mRNA traduction, competing with serine. This may induce abnormal protein folding and a subsequent cell death. Heavy metals, such as lead or mercury may be directly toxic for neuronal cells. Several works have suggested an increased risk of ALS in individuals chronically exposed to these metals. Exposure to pesticides has been suggested to be linked to an increased risk of developing ALS. The mechanism of their toxicity is likely to be mediated by paraoxonases. These proteins are in charge of detoxifying the organism from toxins, and particularly organophosphates. To date, there are insufficient scientific data to suggest that exposure to electromagnetic fields may increase the risk of having ALS. We are particularly missing longitudinal cohorts to demonstrate that risk. PMID:24703731

  18. Se num passado remoto uma mulher...

    Directory of Open Access Journals (Sweden)

    Simone Guimarães Matheus

    2011-11-01

    Full Text Available A mulher que escreveu a Bíblia, de Moacyr Scliar,é um romance de estrutura complexa e constitui-­se de duas narrativas diferenciadas, inclusive, na apresentação gráfica. A primeira narrativa, em itálico, é conduzida por um narrador-­personagem anônimo, um fracassado professor de História que se torna, de forma pouco confiável, em um “terapeuta” de vidas passadas.

  19. Brasil. Cuando la modernidad se hizo color.

    OpenAIRE

    Cortina Maruenda, Francisco Javier; Molina Siles, Pedro Javier

    2013-01-01

    La modernidad deformada ha desterrado en múltiples ocasiones el uso del color en sus realizaciones. Incluso, hasta hoy en día, esta idea se repite como irreflexivo punto de partida de múltiples proyectos. Esto, a pesar de que los grandes maestros han hecho uso de este recurso sin ocultarlo. Un claro ejemplo fue Le Corbusier que incluso generó sus propias colecciones de colores. Por otro lado, Brasil se ha significado desde siempre como un reducto donde la manera de ver el movimiento modern...

  20. Synthesis and properties of new CdSe-AgI-As2Se3 chalcogenide glasses

    International Nuclear Information System (INIS)

    Research highlights: → Determination of the glass-forming region in the pseudo-ternary CdSe-AgI-As2Se3 system. → Characterization of macroscopic properties of the new CdSe-AgI-As2Se3 glasses. → Far infrared transmission of chalcogenide glasses. → Characterization of the total conductivity of CdSe-AgI-As2Se3 glasses. -- Abstract: The glass-forming region in the pseudo-ternary CdSe-AgI-As2Se3 system was determined. Measurements including differential scanning calorimetry (DSC), density, and X-ray diffraction were performed. The effect resulting from the addition of CdSe or AgI has been highlighted by examining three series of different base glasses. The characteristic temperatures of the glass samples, including glass transition (Tg), crystallisation (Tx), and melting (Tm) temperatures are reported and used to calculate their ΔT = Tx - Tg and their Hruby, Hr = (Tx - Tg)/(Tm - Tx), criteria. Evolution of the total electrical conductivity σ and the room temperature conductivity σ298 was also studied. The terahertz transparency domain in the 50-600 cm-1 region was pointed for different chalcogenide glasses (ChGs) and the potential of the THz spectroscopy was suggested to obtain structural information on ChGs.

  1. Se status in normal and pathological human individuals before and after Se supplementation

    Science.gov (United States)

    Bellisola, G.; Cinque, G.; Galassini, S.; Guidi, G. C.; Liu, N. Q.; Moschini, G.

    1996-04-01

    The determination of selenium in plasma and in urine samples has been suggested for the assessment of Se status in human individuals. The kidney is of fundamental importance in Se homeostasis: with low Se intake its excretion will be decreased and with high Se intake it will be increased. In 21 patients with kidney disease (8 with normal kidney function and 13 with moderate renal failure) Se was measured in 1 ml of urine by PIXE after preconcentration of the sample. The total urine volume was measured to calculate total daily Se excretion. The same procedure was applied to 14 normal individuals for comparison. All individuals were then supplemented orally with selenite for 8 weeks (Se = 600 μg/day) and the procedure was repeated. The behaviour of the major selenoproteins was also investigated by measuring glutathione peroxidase activities in plasma, in platelets and in erythrocyte samples. For renal function, serum and urine creatinine concentrations were utilised and creatinine clearances were calculated. Results obtained were compared before and after Se treatment and between groups. Some correlation studies were carried out between Se and kidney functions and/or selenoperoxidase activities.

  2. Cuidando al adulto y al anciano

    OpenAIRE

    Alba Lucero López Díaz

    2003-01-01

    El propósito del artículo es describir, desde el ámbito universitario, la experiencia en la aplicación de la Teoría del Déficit de Autocuidado (TDAC) con la población adulta y anciana. Se explican los procesos y resultados desde la preparación docente, la conformación de la asignatura, hasta el desarrollo de la experiencia práctica en el ámbito hospitalario y de la vida cotidiana. La experiencia muestra la adecuación de la TDAC para abordar el cuidado de esta población y ...

  3. La vigilancia de factores vinculados al desarrollo, el aprendizaje y la salud en la primera infancia

    OpenAIRE

    Ojeda del Valle, Mayra

    2012-01-01

    Se desarrollaron tres investigaciones entre 1997-2007 con el objetivo de perfeccionar la vigilancia de los factores vinculados al desarrollo, el aprendizaje y la salud en la primera infancia. Fueron identificados factores asociados al desarrollo y a la respuesta adaptativa de los niños asistentes a instituciones infantiles, se evaluaron indicadores del neurodesarrollo infantil asociados al aprendizaje escolar en la Atención Primaria y se realizó la pesquisa de factores de riesgo en niños pree...

  4. Entendiendo al escalamiento industrial y el trabajo, como potenciadores del desarrollo regional

    OpenAIRE

    Ricardo López Salazar

    2013-01-01

    Este documento se centra en analizar teóricamente al escalamiento industrial y el trabajo como dos elementos fundamentales en el tipo de desarrollo que se genera al interior de las regiones. La perspectiva utilizada resulta novedosa ya que se coloca al desarrollo como variable dependiente de la profundidad y tipo de escalamiento, así como de la calidad del trabajo generado por las empresas regionales. De esta manera, mientras más profundo sea el escalamiento de las empresas regionales, el tra...

  5. La orientación al mercado y sus efectos en los resultados de la empresa

    OpenAIRE

    Llonch i Andreu, Joan

    1993-01-01

    La presente tesis doctoral pretende demostrar la existencia de una relación positiva entre el grado de orientación al mercado y los resultados de la empresa. A estos efectos se construye un modelo sobre la orientación de la empresa al mercado. Para probar las hipótesis que se formulan se realiza una investigación entre 144 empresas industriales con los resultados siguientes: 1) el grado de orientación al mercado puede medirse a través de un modelo unidimensional con tres componentes (orientac...

  6. Iniciaci??n al ajedrez en Educaci??n Infantil y su aplicaci??n al desarrollo del pensamiento l??gico-matem??tico

    OpenAIRE

    Trobajo de las Matas, Mar??a Teresa; Castro-Garc??a, Noem?? de

    2016-01-01

    En el documento se desarrolla el proyecto de innovaci??n docente titulado "Iniciaci??n al ajedrez en Educaci??n Infantil y su aplicaci??n al desarrollo del pensamiento-l??gico". Este proyecto se ha llevado a cabo en el tercer curso del Grado de Educaci??n Infantil en la asignatura de Recursos para la Ense??anza de las Matem??ticas durante el curso escolar 2014/2015

  7. Señalización para indicar los pasos de cebra para peatones

    Directory of Open Access Journals (Sweden)

    Mateos, Manuel

    1967-05-01

    Full Text Available This article summarises the experience collected by the Road Research Laboratory on pedestrian crossings that are not regulated by a traffic light. These crossings are marked, by international convention, by a number of longitudinal stripes, alternatively yellow and black. It is also recommended that additional signalling be provided, enabling the driver to know that he is approaching such a crossing, and appreciate its precise location. The proposed method is to show a reduced version of the zebra crossing on vertical signposts, which can be seen at night, by painting them with a reflecting material. The drawings and photographs in the article show such signs, and how they can be located along the roadside.En el presente artículo se resumen las experiencias sacadas por el Road Research Laboratory, sobre pasos para peatones no regulados por semáforos. Internacionabnente se señalan sobre la calzada mediante pasos cebra, formados por una serie de franjas longitudinales con colores amarillo y negro alternados. Se recomienda también un tipo de señalización, que permita al conductor apreciar intuitivamente la proximidad de estos pasos y conocer su situación exacta sobre la calzada en cualquier circunstancia. La solución propuesta consiste en representar el paso cebra con tamaño reducido, en señales verticales visibles durante la noche gracias a un material reflectante. En los dibujos y fotografías que acompañan al artículo se pueden apreciar la forma de estas señales y los esquemas para su colocación.

  8. EFECTO DEL PRECALENTAMIENTO Y LA SEVERIDAD DE TEMPLE SOBRE LA RESISTENCIA AL DESGASTE ADHESIVO DEL ACERO AUSTENÍTICO AL MANGANESO

    Directory of Open Access Journals (Sweden)

    OSCAR FABIÁN HIGUERA COBOS

    2010-01-01

    Full Text Available En este trabajo de investigación se estudió el efecto del precalentamiento y la severidad de temple sobre la resistencia al desgaste adhesivo del acero austenítico al manganeso ASTM A 128 grado C. El material se sometió a ciclos térmicos de temple y revenido con y sin precalentamiento con el fin de evaluar su influencia sobre la resistencia al desgaste. Posteriormente el material fue sometido a prueba según norma ASTM G83 y se determinó que el acero Austenítico al manganeso, es un material que presenta una microestructura metaestable en condiciones estables y no debe ser sometido a tratamiento térmico de revenido a altas temperaturas debido que favorece la descomposición de esta a ferrita (fase blanda de los acero y por ende disminuye su resistencia al desgaste.

  9. Anisotropic Terahertz Emission from Bi2Se3 Thin Films with Inclined Crystal Planes.

    Science.gov (United States)

    Hamh, Sun Young; Park, Soon-Hee; Han, Jeongwoo; Jeon, Jeong Heum; Kahng, Se-Jong; Kim, Sung; Choi, Suk-Ho; Bansal, Namrata; Oh, Seongshik; Park, Joonbum; Kim, Jun Sung; Kim, Jae Myung; Noh, Do Young; Lee, Jong Seok

    2015-12-01

    We investigate the surface states of topological insulator (TI) Bi2Se3 thin films grown on Si nanocrystals and Al2O3 substrates by using terahertz (THz) emission spectroscopy. Compared to bulk crystalline Bi2Te2Se, film TIs exhibit distinct behaviors in the phase and amplitude of emitted THz radiation. In particular, Bi2Se3 grown on Al2O3 shows an anisotropic response with a strong modulation of the THz signal in its phase. From x-ray diffraction, we find that the crystal plane of the Bi2Se3 films is inclined with respect to the plane of the Al2O3 substrate by about 0.27°. This structural anisotropy affects the dynamics of photocarriers and hence leads to the observed anisotropic response in the THz emission. Such relevance demonstrates that THz emission spectroscopy can be a sensitive tool to investigate the fine details of the surface crystallography and electrostatics of thin film TIs. PMID:26694079

  10. Luis López-Ballesteros: primer traductor de las obras completas de Freud al castellano

    OpenAIRE

    Juan Manuel Martín Arias; Lorenzo Gallego Borghini

    2011-01-01

    El castellano fue el primer idioma al que se tradujeron las obras completas de Sigmund Freud. A ello contribuyeron diversos factores, entre los que se destaca la figura de Luis López-Ballesteros, a quien le encargó la traducción la editorial Biblioteca Nueva. En este artículo se esbozan someramente la recepción del psicoanálisis en España y las traducciones de Freud al español y se ofrece una breve semblanza de Luis López-Ballesteros. --------------------------------------------- Luis López-B...

  11. Digitalización: su contribución al desarrollo de la gerencia empresarial

    OpenAIRE

    Mario González Arencibia; Dagmaris Martínez Cardero

    2014-01-01

    En este trabajo se hace una presentación de las principales tendencias y discusiones vinculadas al tema del mundo de unos y ceros, en el entendido de que muchos de los puntos que se abordan podrían ser objeto de un tratamiento detallado. Atendiendo a esto se persigue, como objetivo, promover la reflexión crítica acerca de las posibilidades que ofrece la digitalización para el desarrollo de la gerencia empresarial. Los resultados obtenidos señalan que la digitalización, al estar imbricando nov...

  12. Ayuda al aprendizaje con tecnología en la educación superior

    OpenAIRE

    Badia, Antoni

    2006-01-01

    Se presentan reflexiones sobre una conceptualización psicoeducativa basada en un enfoque sociocognitivo del significado de la ayuda al aprendizaje con las TIC en la educación superior. El contenido se organiza en tres partes. En la primera, se desarrolla el significado de la ayuda al aprendizaje desde una visión constructivista sociocognitiva (con el uso del concepto de andamiaje educativo). En la segunda, se tratan implicaciones conceptuales significativas sobre la introducción de la tecnolo...

  13. Sociale media als leermiddel

    NARCIS (Netherlands)

    Rubens, Wilfred

    2012-01-01

    Rubens, W. (2012, 5 juni). Sociale media als leermiddel. Presentatie over het gebruik van sociale media binnen het onderwijs, verzorgd tijdens een ouderraadbijeenkomst van de Katholieke Scholengemeenschap Etten-Leur, Etten-Leur, Nederland.

  14. MDA ALS Caregiver's Guide

    Science.gov (United States)

    ... R.D., C.N.S.D., L.D.N. Nutritionist MDA/ALS Center at Vanderbilt University Medical Center ... neurologists, physiatrists, therapists (physical, occupa- tional, speech, respiratory), nutritionists, social work- ers, pulmonologists, gastroenterologists and medical equipment ...

  15. Regionale Herkunft als Bonus

    OpenAIRE

    Kratochvil, Dr. Ruth

    2004-01-01

    Der Bio-Sektor durchlebt bewegte Zeiten. Die biologische Landwirtschaft hat sich aus der Nische herausbewegt und dafür an „Besonderheiten“ eingebüßt. Diese müssen als Zusatznutzen wiedergefunden werden.

  16. Neutron diffraction study of MnSe

    International Nuclear Information System (INIS)

    We report our neutron diffraction studies at low temperature on MnSe. The low temperature data shows co-existence of cubic and hexagonal phases with both of them ordered antiferromagnetically. The ordering temperature for cubic phase is ∼ 130 K while that for the hexagonal phase is ∼ 250 K. (author)

  17. Main: 1SE9 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available 1SE9 シロイヌナズナ Arabidopsis Arabidopsis thaliana (L.) Heynh. T4p13.27 Protein Name=T4p13.27; ... abidopsis Thaliana To Be Published Ubiquitin-Like, Cell -Free, Wheat Germ, Structural Genomics, Protein Str ...

  18. Reference: SE2PVGRP1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ter, domain A of the 35S promoter and the 35S2 promoter. Transgenic Res 4:388-396 (1995) PubMed: 7581519; ... ...SE2PVGRP1 Elmayan T, Tepfer M. Evaluation in tobacco of the organ specificity and strength of the rolD promo

  19. Biaxially Oriented CdSe Nanorod

    DEFF Research Database (Denmark)

    Breiby, Dag W.; Chin, Patrick T.K.; Andreasen, Jens Wenzel;

    2009-01-01

    The shape, structure, and orientation of rubbing-aligned cadmium selenide (CdSe) nanorods on polymer coated glass substrates have been studied using transmission electron microscopy (TEM) and grazing incidence X-ray scattering combined with computer simulations. The nanorods are found to be of...

  20. Structural studies of amorphous Se under pressure

    OpenAIRE

    Tanaka, Keiji

    1990-01-01

    X-ray-diffraction patterns, macroscopic compressibility, and crystallization in amorphous Se subject to pressure have been investigated. The material exhibits pressure-induced structural modifications in the glassy state and a phase transformation to the hexagonal phase at 120±20 kbar. The observations are discussed on the basis of microscopic and thermodynamic models.

  1. Reference: SE1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available lled by three specific regulatory elements and one unspecific activating sequence Plant Mol Biol 26: 747-756 (1994) PubMed: 7948928 ... ...SE1PVGRP18 Keller B, Heierli D Vascular expression of the grp1.8 promoter is contro

  2. Enriched $^{82}$Se for the LUCIFER experiment

    CERN Document Server

    Beeman, J W; Benetti, P; Cardani, L; Casali, N; Chiesa, D; Clemenza, M; Dafinei, I; Di Domizio, S; Ferroni, F; Gironi, L; Giuliani, A; Gotti, C; Laubenstein, M; Maino, M; Nagorny, S; Nisi, S; Nones, C; Orio, F; Pagnanini, L; Pattavina, L; Pessina, G; Piperno, G; Pirro, S; Previtali, E; Rusconi, C; Schäffner, K; Tomei, C; Vignati, M

    2015-01-01

    The LUCIFER project aims at deploying the first array of enriched scintillating bolometers for the investigation of neutrinoless double-beta decay of $^{82}$Se. The matrix which embeds the source is an array of ZnSe crystals, where enriched $^{82}$Se is used as decay isotope. The radiopurity of the initial components employed for manufacturing crystals, that can be operated as bolometers, is crucial for achieving a null background level in the region of interest for double-beta decay investigations. In this work, we evaluated the radioactive content in 2.5 kg of 96.3% enriched $^{82}$Se metal, measured with a high-purity germanium detector at the Gran Sasso deep underground laboratory. The limits on internal contaminations of primordial decay chain elements of $^{232}$Th, $^{238}$U and $^{235}$U are respectively: $<$61 $\\mu$Bq/kg, $<$110 $\\mu$Bq/kg and $<$74 $\\mu$Bq/kg at 90% C.L.. The extremely low-background conditions in which the measurement was carried out and the high radiopurity of the $^{82}$...

  3. Partizipation als Ausnahmezustand

    OpenAIRE

    Korf, Benedikt

    2009-01-01

    In «Die Erfindung des Politischen» (1993) beschreibt Ulrich Beck Subpolitik als den Ort, an dem die Grenze zwischen Politik und Nichtpolitik verschwindet. Aus der zunehmenden Wirkkraft von Subpolitik erwächst die grundlegende Frage, mit welcher Legitimation diese Art von Subpolitik in die Sphäre der institutionalisierten Politik eindringt. Beck’s Subpolitik soll im Anschluss an theoretische Arbeiten von Chantal Mouffe und Giorgio Agamben als post-politische Aspiration bezeichnet werden, die e...

  4. Neumonitis por hipersensibilidad asociado al cuidado de aves

    OpenAIRE

    Ana María González-Zúñiga; Juana Alejandra Gutiérrez-Ríos

    2015-01-01

    La neumonitis por hipersensibilidad asociada al cuidado de las aves es uno de los tipos más frecuentes de esta que se presentan. Aunque no se tienen datos epidemiológicos claros sobre su prevalencia, en los hospitales llegan casos de este tipo. No es una patología muy común; sin embargo, una muestra representativa de la población se encuentra expuesta a las aves y, consecuentemente, a los antígenos que causan la enfermedad. Su diagnóstico temprano puede significar para el paciente evitar daño...

  5. Geometría aplicada al número 8

    OpenAIRE

    Icaza Lomelí, Leonardo

    2011-01-01

    En este texto se plantea como objetivo descubrir en la arquitectura y sus elementos, nociones de geometría de manifestación mudéjar, a través de indagar y determinar principios en el ocho como número y sustento geométrico, y de cómo éstos contribuyeron para constituir una identidad, ya que al ser aceptados y permanecer, se integraron en la arquitectura española y novohispana. La hipótesis a probar es cómo se conservan nociones de geometría griega aplicada a instrumentos y trazos en aquellos h...

  6. Der Preis als Kaufbarriere?

    DEFF Research Database (Denmark)

    Mueller Loose, Simone

    2012-01-01

    Die Preispolitik hat eine herausragende Stellung im Marketing. Der Preis eines Produktes ist für Verbraucher ein direkter Kostenfaktor und für Unternehmen die Stellgröße im Mar-ketingmix, die den Umsatz am stärksten beeinflusst (vgl. Nieschlag et al. 2002). Wenn die Akzeptanz und der regelmäßige...... Verzehr gesunder Lebensmittel erhöht werden soll, ist es sowohl für die Verbraucherpolitik als auch für Lebensmittelproduzenten wichtig, den Ein-fluss des Preises auf die Kaufentscheidung zu verstehen. Aus Verbrauchersicht ist der Preis neben dem Geschmack die wichtigste Produkteigen-schaft beim Kauf von...... Lebensmitteln (vgl. Brunsø/Grunert 1998) und stellt eine Kaufbarrie-re für Lebensmittel mit gesundheitsfördernden Eigenschaften dar. Studien in den USA (vgl. Cassady et al. 2007), Frankreich (vgl. Drewnowski et al. 2004; Andrieu et al. 2005) und Deutschland (vgl. Karg et al. 2008) kommen übereinstimmend zu dem...

  7. Interaction induced dephasing of excitons in wide ZnSe/ZnMgSe single quantum wells

    DEFF Research Database (Denmark)

    Wagner, Hans Peter; Schätz, A.; Maier, R.;

    1998-01-01

    The dephasing of excitons in wide ZnSe/Zn0.94Mg0.06Se single quantum wells (SQW) is investigated by spectrally resolved, time integrated four-wave mixing (FWM). Simultaneous excitation of Is center-of-mass quantized heavy-hole and light-hole excition states leads to pronounced quantum beats...

  8. Dephasing and interaction of excitons CdSe/ZnSe islands

    DEFF Research Database (Denmark)

    Wagner, H. P.; Tranitz, H.-P.; Preis, H.;

    2000-01-01

    The dephasing of excitons in self-organized CdSe/ZnSe islands grown by molecular-beam epitaxy is investigated using spectrally resolved four-wave mixing. A distribution of dephasing times is observed, indicating the existence of localized excitons with different relaxation times at comparable...

  9. Pivško jygajo se 'guncajo se' (Petelinje) ali o nastanku slovenskega razmerja jugati : gugati:

    OpenAIRE

    Furlan, Metka

    2010-01-01

    Since the Pivka dialect does not have second palatalization of velars, the verb jyugajo se 'they are swinging' (Petelinje), with its Slovene phonetic equivalents from Slovene gúgati se, is explained with dissimilation g : g --> o : g and the appearance of the prothetic -j.

  10. Investigation of inter-diffusion in bilayer GeTe/SnSe phase change memory films

    International Nuclear Information System (INIS)

    A metal-chalcogenide layer, SnSe, is inserted between the memory layer GeTe and the top electrode to form a phase change memory cell. The GeTe layer exhibits ovonic threshold switching at a threshold field of ∼ 110 V/μm. For subsequent implementation into applications and reliability, material inter-diffusion and sublimation are examined in bilayer phase change films of GeTe/SnSe. Transmission electron microscopy and parallel electron energy loss spectroscopy analyses reveal Sn migration to the GeTe layer, which is responsible for lowering the rhombohedral to cubic structural transformation temperature in GeTe. Incongruent sublimation of SnSe and GeTe is observed at temperatures higher than 500 °C. Severe volatilization of Se results in the separation of a metallic Sn phase. The use of Al2O3 as a capping layer has been found to mitigate these effects. - Highlights: ► In the as-deposited state, GeTe is amorphous and SnSe is orthorhombic in structure. ► After 300 °C, Sn migration results in the formation of a GexSn1−xTe solid solution. ► Film decomposition and incongruent sublimation are observed at high temperatures. ► A consequence of incongruent sublimation is the separation of metallic Sn phase. ► Al2O3 capping mitigates volatilization and Sn phase separation at high temperatures.

  11. Bio-fortification and isotopic labelling of Se metabolites in onions and carrots following foliar application of Se and 77Se

    DEFF Research Database (Denmark)

    Kápolna, Emese; Laursen, Kristian H.; Husted, Søren;

    2012-01-01

    The aims were to bio-fortify onions by foliar application of selenium (Se) and to intrinsically label bioactive Se-metabolites in onion and carrot by enriched, stable 77Se for use in human physiological studies. Onion bulbs and leaves were enriched in Se by repeated foliar spraying of 10 or 100μg......Seml−1 solutions of sodium selenite (Se(IV)) or sodium selenate (Se(VI)). ICP-MS analysis of onion leaves and bulbs showed that the Se concentration was enhanced by up to a factor of approximately 50 and 200 in bulbs and leaves, respectively. HPLC–ICP-MS analysis of proteolytic plant extracts showed......Se. The 77Se- labelled metabolites in onions were predominantly γ-glutamyl-77Se-selenomethyl-selenocysteine (γ-glu-Me77SeCys), 77Se-methylselenocysteine (Me77SeCys) and 77Se-selenomethionine (77SeMet). Furthermore, we report here for the first time the finding in carrots of the bioactive Me77Se...

  12. 'Cold' crystallization in nanostructurized 80GeSe2-20Ga2Se3 glass.

    Science.gov (United States)

    Klym, Halyna; Ingram, Adam; Shpotyuk, Oleh; Calvez, Laurent; Petracovschi, Elena; Kulyk, Bohdan; Serkiz, Roman; Szatanik, Roman

    2015-01-01

    'Cold' crystallization in 80GeSe2-20Ga2Se3 chalcogenide glass nanostructurized due to thermal annealing at 380°C for 10, 25, 50, 80, and 100 h are probed with X-ray diffraction, atomic force, and scanning electron microscopy, as well as positron annihilation spectroscopy performed in positron annihilation lifetime and Doppler broadening of annihilation line modes. It is shown that changes in defect-related component in the fit of experimental positron lifetime spectra for nanocrystallized glasses testify in favor of structural fragmentation of larger free-volume entities into smaller ones. Nanocrystallites of Ga2Se3 and/or GeGa4Se8 phases and prevalent GeSe2 phase extracted mainly at the surface of thermally treated samples with preceding nucleation and void agglomeration in the initial stage of annealing are characteristic features of cold crystallization. PMID:25852346

  13. The adsorption properties of the ZnSe-CdSe system components

    International Nuclear Information System (INIS)

    Adsorption properties of solid solutions ZnxCd1-xSe and their binary components (ZnSe and CdSe) in reference to ammonia and carbon dioxide were studied by the method of thermodesorption spectroscopy with manometric and mass-spectrometric analysis of desorption products, IR and ESR spectroscopy. The adsorbents mentioned were powders with specific surface 0.91-1.40 m2/g and monocrystals. It was ascertained that ammonia, which is a probe for acid centers on the surface, is adsorbed better by 1-2 orders than carbon dioxide. It permitted making conclusion on the nature of active centers in the selenides studied and on adsorption mechanism. Regularities in the change of adsorption activity of components in the system ZnSe-CdSe were established

  14. First and second harmonic generation of the XAl2Se4 (X=Zn,Cd,Hg) defect chalcopyrite compounds

    International Nuclear Information System (INIS)

    The chemical bonding of the ZnAl2Se4, CdAl2Se4 and HgAl2Se4 defect chalcopyrites has been studied in the framework of the quantum theory of atoms in molecules (AIM). The GW quasi-particle approximation is used to correct the DFT-underestimation of energy gap, and as a consequence the linear and nonlinear optical properties are significantly enhanced. The second harmonic generation (SHG) displays certain dependence with the ionicity degree decrease through the dependency of the SHG on the band gap. The occurrence of the AIM saddle point is characterized and some clarifying features in relationship with the density topology are exposed, which enable to understand the relation with the second harmonic generation effect.

  15. Reflexiones : Se ha desatado en el mundo una nueva revolución industrial

    OpenAIRE

    Castro, Jorge

    2014-01-01

    Es imposible desarrollar la industria en la Argentina en las condiciones del siglo XXI sobre la base de la estrategia de sustitución de importaciones. Se ha desatado en el mundo avanzado una nueva revolución industrial, con eje en EE.UU. y Alemania, que fija nuevos estándares, cualitativamente superiores, de productividad y competitividad. Este cambio tecnológico no tiene una naturaleza puramente cuantitativa en lo que se refiere al aumento de la productividad, sino que es un momento di...

  16. Anisotropy in CdSe quantum rods

    Energy Technology Data Exchange (ETDEWEB)

    Li, Liang-shi

    2003-09-01

    The size-dependent optical and electronic properties of semiconductor nanocrystals have drawn much attention in the past decade, and have been very well understood for spherical ones. The advent of the synthetic methods to make rod-like CdSe nanocrystals with wurtzite structure has offered us a new opportunity to study their properties as functions of their shape. This dissertation includes three main parts: synthesis of CdSe nanorods with tightly controlled widths and lengths, their optical and dielectric properties, and their large-scale assembly, all of which are either directly or indirectly caused by the uniaxial crystallographic structure of wurtzite CdSe. The hexagonal wurtzite structure is believed to be the primary reason for the growth of CdSe nanorods. It represents itself in the kinetic stabilization of the rod-like particles over the spherical ones in the presence of phosphonic acids. By varying the composition of the surfactant mixture used for synthesis we have achieved tight control of the widths and lengths of the nanorods. The synthesis of monodisperse CdSe nanorods enables us to systematically study their size-dependent properties. For example, room temperature single particle fluorescence spectroscopy has shown that nanorods emit linearly polarized photoluminescence. Theoretical calculations have shown that it is due to the crossing between the two highest occupied electronic levels with increasing aspect ratio. We also measured the permanent electric dipole moment of the nanorods with transient electric birefringence technique. Experimental results on nanorods with different sizes show that the dipole moment is linear to the particle volume, indicating that it originates from the non-centrosymmetric hexagonal lattice. The elongation of the nanocrystals also results in the anisotropic inter-particle interaction. One of the consequences is the formation of liquid crystalline phases when the nanorods are dispersed in solvent to a high enough

  17. Modification of residual stress in Al-[AlBO]w/Al compound plate

    Institute of Scientific and Technical Information of China (English)

    姜传海; 吴建生; 王德尊

    2001-01-01

    The application of compound parts of Al-[AlBO]w/Al not only reduces the cost of the parts but also improves its properties. However, there is a large thermal residual stress between Al and [AlBO]w/Al, and it is harmful for practical application. From the theoretical analyses and experimental results, it was found that by the compressive pre-plastic deformation perpendicular to the interface between Al and [AlBO]w/Al, the interlayer residual stress of compound parts can be reduced, while the mechanical properties of compound parts can be improved.

  18. ZnSe immersion grating in the short NIR region

    Science.gov (United States)

    Ikeda, Yuji; Kobayashi, Naoto; Kuzmenko, Paul; Little, Steve L.; Mirkarimi, Paul B.; Alameda, Jennifer B.; Kaji, Sayumi; Sarugaku, Yuki; Yasui, Chikako; Kondo, Sohei; Fukue, Kei; Kawakita, Hideyo

    2014-07-01

    ZnSe has a high refractive index (n~ 2.45) and low optical loss (high-resolution spectroscopy over a wide wavelength range. We are developing ZnSe immersion gratings for a ground-based NIR high-resolution spectrograph WINERED. We previously produced a large prism-shaped ZnSe immersion grating with a grooved area 50 mm x 58 mm (Ikeda et al. 2010). However, we find two problems as NIR immersion grating: (i) serious chipping of the grooves, and (ii) inter-order ghosts in the diffraction pattern. We believed the chipping to be due to micro cracks just beneath surface present prior to diamond machining. Therefore we removed this damaged region, a few tens of microns thick, by etching the ZnSe grating blank with a mixture of HCl and HNO3. Ghosts appearing halfway between main diffraction orders originate from small differences in spacing between odd and even grooves. Apparently the blank shifts repeatably by about 120 nm in the direction orthogonal to the grooves depending on whether the translation stage holding the blank is moving right to left or left to right. Therefore we remachined the grating only cutting grooves with the stage moving from right to left. After re-cutting, we also deposit the Cu coating with an enhanced interface layer of SiO2 on the groove, which is developed in our previous study. We evaluated the optical performances of this immersion grating. It shows light scattering of 3.8 % at 1μm, no prominent ghosts, and a spectral resolution of 91,200 at 1 μm. However we measured an absolute diffraction efficiency of only 27.3% for TE and 25.9 % for TM waves at 1.55 μm. A non-immersed measurement of the diffraction efficiency of the facet blazed near 20º exceeded 60%, much closer to theoretical predictions. We plan to carry out more tests to resolve this discrepancy.

  19. Del sistema al actor

    OpenAIRE

    Alain Touraine

    2009-01-01

    Si consideramos que las conductas sociales están determinadas por el lugar que los individuos, los grupos o las categorías sociales ocupan en la organización social, entonces será necesario aceptar la idea de que aquello que se denomina la Sociedad posee sus propios intereses y refuerza su integración y funcionamiento. Esta idea ha encontrado dos expresiones concretas: o bien se piensa que el bien y el mal son definidos por aquello que es funcional o disfuncional para la sociedad, es decir qu...

  20. TRAPITOS AL ARTE

    OpenAIRE

    Laura Díaz

    2013-01-01

    El proyecto ambiental se desarrolló y presentó de manera interdisciplinaria, expuesto en el Encuentro 2012 de Semilleros FESC. La motivación a los estudiantes de Diseño de Modas para que sean conscientes del impacto ambiental que se genera en la región y a nivel internacional con el manejo de los residuos producidos por el sector de las confecciones; de ahí la importancia de involucrar el Semillero de Investigación para realizar un estudio y reflejar la problemática.

  1. ALTERACIONES CELULARES INDUCIDAS POR EL IÓN AL 3+ EN DOS VARIEDADES CUBANAS DE ARROZ (Oryza sativa L.)

    OpenAIRE

    Idioleidys Alvarez; Ofelia Sam; Inés Reynaldo

    2005-01-01

    Con el propósito de estudiar las modificaciones, que a nivel celular provoca el aluminio en el sistema radicular del arroz, se desarrolló un experimento, en el cual se emplearon diferentes dosis de AlCl3 para imponer la condición de estrés. Para el estudio los ápices radicales de las plántulas se procesaron por un método de disminución progresiva de la temperatura (PLT) y se incluyeron en resina Lowicryl para su posterior seccionamiento y observación al microscopio de Contraste de Fase. Se ap...

  2. Changes in SE has rounded the minister

    International Nuclear Information System (INIS)

    After transformation of filial companies of Slovenske elektrarne (SE) a.s, Bratislava to separate enterprises, a change of its managers also arose to 1 August. The changes were announced by executive chairman and general manager of SE Miroslav Rapsik. Minister of economy Robert Nemcsics has not participated in companies manager selection. Robert Gunis was named as Bohunice NPP manager, Jaroslav Holubec was named as Mochovce NPP, Eduard Seboek was named as Novaky thermal power plant. Martin Slezak is chief of imposition company, Milan Fedorco is manager of Vojany thermal power plant. Vladimir Majercak has remained manager of Trencin water power plant and Jozef Guba has remained manager of uncompleted Mochovce 3-4 NPP

  3. Iwill P4SE-Gold

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    这是Iwill公司865PE产品线中的一款高档产品。主板要用红色PCB.整体布局显得比较紧凑。P4SE-Gold同时集成了Intel 82547EI千兆网卡芯片和Realtek RTL8100百兆网卡芯片,如果你家中有两台PC需要共享Internet连接.这块主板倒是可以省去额外添置网卡的麻烦。P4SE-Gold在I/O接口的设计上也比较特殊.它集成了2个以太网卡接口,

  4. Sucesión en la empresa familiar: Su futuro cuando la muerte se acerca

    OpenAIRE

    Jesús Alberto Andrade C.

    2002-01-01

    Este trabajo hace un análisis teórico al tema de la empresa familiar. Tiene como objetivos identificar características que definen a una empresa familiar en comparación con empresas no familiares; analizar la sucesión del negocio familiar al considerar que el futuro deseado de cada uno de los miembros debe ser común y único, si se quiere su continuidad; analizar cómo el manejo de conflictos sirve para desarrollar un buen plan sucesoral que permite integrar a la familia en torno a ...

  5. Low Temperature Photoluminescence of PVT Grown ZnSe and ZnSeTe

    Science.gov (United States)

    Wang, Ling Jun; Su, Ching-Hua; Lehoczky, S. L.

    1999-01-01

    ZnSe and ZnSeTe single crystals were grown by physical vapor transport (PVT) technique horizontally and vertically. The grown ZnSe and ZnSeTe single crystals were characterized by low temperature photoluminescence at 5 to 10 K using the 3.4 eV emission of an argon laser. The intensity of the sharp near band edge defect lines at 2.799, 2.783 eV and the intrinsic free exciton line at 2.802 eV were mapped on various crystal surfaces with different orientations to the gravitational field. The results show the effects of gravity vector orientation on the defect segregation. Comparison of the photoluminescence spectra of the ZeSe crystal before and after annealing in the Zn vapor shows that the 2.783 eV line of ZnSe crystal is related to the zinc vacancy. The photoluminescence spectra of the ternary ZnSeTe crystal were characterized by a single broad band from 2.2 to 2.4 eV, with a Full Width at Half Maximum (FWHM) of about 100 meV. The temperature dependence of the peak position and intensity were determined from 7 to 150 K.

  6. Filtros no lineales para reconstruir señales de electrocardiogramas

    Directory of Open Access Journals (Sweden)

    Saba Infante

    2014-12-01

    Full Text Available Las señales de los electrocardiogramas han sido usadas en patologías cardíacas para detectar enfermedades del corazón. El objetivo principal de este trabajo es proponer técnicas de filtraje de señales para reducir el ruido, extraer información, reconstruir los estados, y propiedades morfológicas de los latidos del corazón. Adicionalmente se pretende representar la actividad cardíaca en forma simple, informativa, precisa, y de fácil interpretación para los Cardiólogos. Para lograr estos objetivos se proponen implementar los siguientes algoritmos: filtro de partículas genérico (FPG, filtro de partículas con remuestreo (FPR, filtro de Kalman sin esencia (FKSE, y el filtro de partículas sin esencia (FPSE, considerando la estructura básica del modelo dinámico sintético de McSharry et al. (2003 [16]. Los resultados demuestran que los filtros se desempeñan muy bien en la reconstrucción de los estados del sistema del ritmo cardíaco, aun introduciendo pequeñas variaciones en las varianzas de los ruidos de la ecuación de observación; es decir, losmétodos tiene la capacidad de reproducir la señal original del modelo sintético simulado y del modelo sintético con datos reales en forma precisa. Finalmente se evalúa el desempeño de los filtros en términos de la desviación estándar empírica, observándose poca variabilidad entre los errores estimados y una rápida ejecución de los algoritmos.

  7. Det faderløse samfund

    DEFF Research Database (Denmark)

    Jensen, Henrik

    Det faderløse samfund er en kulturhistorisk afdækning af fader- og autoritetstabet i det 20. århundredes Europa, med fokus på fader-søn-forholdet og fortalt gennem skikkelser som Max Weber, Freud, Jung, Kafka - og ’den uregerlige søn’ over dem alle, psykologen og anarkisten Otto Gross. Den er sam...

  8. Kan pædagogen se barnet

    DEFF Research Database (Denmark)

    Øhrgaard, Per

    2008-01-01

    relationer er noget levende og foranderligt. Begrebet Kontekst fremhæves ligeledes som et vigtigt begreb, der understreger, at moderne børn må lære at være kontekst-følsomme. Børnene må lære, at forskellige kontekster efterspørger forskellig adfærd. Pædagogerne må se institutionen som et læringsrum hvor...

  9. Neutron Diffraction Researches of Spiractin Layered Semiconductor in Se

    International Nuclear Information System (INIS)

    The analysis of magnetic properties and neutron diffractometry of layered semiconductor In Se doped by Mn was carried out. Neutron diffraction structural researches shown that semiconductor In Se consists of several phases namely In1-x Mn x Se,α-Mn Se, In4Se3. It is a result of low solubility of Mn in In Se. Nonmonotonic temperature dependence of magnetic susceptibility for In Se within temperature range 2.4 . 270 K is due to antiferromagnetic properties of α-Mn Se cubic phase. Quantitative coincidence is achieved at its content about 0.15% weight in In Se. For the first time the lowering of magnetic sublattice parameter for α-Mn Se was discovered. It leads to an appearance of weak ferromagnetism. The assumption of existence self organization superlattices ferromagnetic In-xMnxSe / antiferromagnetic Mn Se is stated

  10. Structures of superconducting palladium selenides, Pd7Se2 and Pd34Se11

    International Nuclear Information System (INIS)

    (I) Pd7Se2, Mr=902.72, monoclinic, P21/a, a=9.441 (7), b=5.370 (5), c=5.495 (4) A, β=93.61 (7)0, V=278.0 (4) A3, Z=2, Dx=10.78 Mg m-3, λ(AgKα)=0.5608 A, μ(AgKα)=17.5 mm-1, F(000)=780, 298 K, R=0.042.16, monoclinic, P21/n, a=21.413 (5), b=5.504 (1), c=12.030 (2) A, β=99.44 (2)0, V=1398.6 (5) A3, Z=2, Dx=10.65 Mg m-3, λ(MoKα)=0.71073 A, μ(MoKα)=35.2 mm-1, F(000)=3876, 298 K, R=0.032 for 2591 reflections. In Pd7Se2, the Se atom is surrounded by seven Pd atoms, and the Pd atom has eight or nine Pd neighbors. In Pd34Se11, the Se atom is surrounded by five to seven Pd atoms, and the Pd atom has five to ten Pd neighbors. In both crystals, each Pd atom is coordinated by two Se atoms with a few exceptions in Pd34Se11. The Pd-Se bonds are essentially covalent with the bond lengths ranging from 2.4 to 2.6 A; the Pd-Pd bonds with interatomic distances 2.7-3.2 A are considered to be metallic. Irregular three-dimensional networks of Pd-Se chains are formed. (orig.)

  11. Thermoelectric properties of SnSe compound

    International Nuclear Information System (INIS)

    Highlights: • The electronic and thermoelectric properties of SnSe bulk material are studied. • The ZT can reach as high as 1.87 along yy and 1.6 along zz direction at 800k. • SnSe is an indirect-band material, and SOC has little effect on the band structure. • The high ZT can be attributed to the intrinsically ultralow thermal conductivity. - Abstract: A first-principles study and Boltzmann transport theory have been performed to evaluate the electronic structure and thermoelectric properties of SnSe compound. The energy band structure and density of states are studied in detail. The electronic transport coefficients are then calculated as a function of chemical potential or temperature within the assumption of the constant relaxation time. The figure of merit ZT is obtained with the use of calculated thermoelectric properties and can reach as high as 1.87 along yy and 1.6 along zz direction at 800 K. Our theoretical result agrees well with previous experimental data

  12. Forming Glasses from Se and Te

    Directory of Open Access Journals (Sweden)

    Pierre Lucas

    2009-10-01

    Full Text Available Despite being close neighbors on the Periodic Table, selenium and tellurium present a totally different abilities to form glasses. Se is a very good glass former, and gives rise to numerous glass compositions which are popular for their transparency in the infrared range and their stability against crystallization. These glasses can be shaped into sophisticated optical devices such as optical fibers, planar guides or lenses. Nevertheless, their transparencies are limited at about 12 μm (depending on the thickness of the optical systems due to the relatively small mass of the Se element. On the other hand, tellurium is heavier and its use in substitution for Se permits to shift the IR cutoff beyond 20 μm. However, the semimetallic nature of Te limits its glass formation ability and this glass family is known to be unstable and consequently has found application as phase change material in the Digital Versatile Disk (DVD technology. In this paper, after a review of selenide glasses and their applications, it will be shown how, in a recent past, it has been possible to stabilize tellurium glasses by introducing new elements like Ga or I in their compositions.

  13. Thermoelectric properties of SnSe compound

    Energy Technology Data Exchange (ETDEWEB)

    Guan, Xinhong [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Lu, Pengfei, E-mail: photon@bupt.edu.cn [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Wu, Liyuan; Han, Lihong [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Liu, Gang [School of Electronic Engineering, Beijing University of Posts and Telecommunications, Beijing 100876 (China); Song, Yuxin [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, Shanghai 200050 (China); Wang, Shumin [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, Shanghai 200050 (China); Photonics Laboratory, Department of Microtechnology and Nanoscience, Chalmers University of Technology, 41296 Gothenburg (Sweden)

    2015-09-15

    Highlights: • The electronic and thermoelectric properties of SnSe bulk material are studied. • The ZT can reach as high as 1.87 along yy and 1.6 along zz direction at 800k. • SnSe is an indirect-band material, and SOC has little effect on the band structure. • The high ZT can be attributed to the intrinsically ultralow thermal conductivity. - Abstract: A first-principles study and Boltzmann transport theory have been performed to evaluate the electronic structure and thermoelectric properties of SnSe compound. The energy band structure and density of states are studied in detail. The electronic transport coefficients are then calculated as a function of chemical potential or temperature within the assumption of the constant relaxation time. The figure of merit ZT is obtained with the use of calculated thermoelectric properties and can reach as high as 1.87 along yy and 1.6 along zz direction at 800 K. Our theoretical result agrees well with previous experimental data.

  14. Experience with the SE in Germany

    Directory of Open Access Journals (Sweden)

    Jochem Reichert

    2008-03-01

    Full Text Available A rather significant proportion of the Societas Europaeas (the European Company, or SE formed to date have had German roots. German corporate law has been enriched by an interesting alternative which meanwhile seems to have gained momentum. This contribution focuses on SEs incorporated by German entrepreneurs and provides an interesting account concerning the use of SEs in Germany in practice, such as Allianz, Fresenius, BASF and Porsche. Has the SE been used to circumvent rigid company law provisions or is it a more flexible and effective tool, perhaps, for company mobility? The practical motives behind setting up this company form are also reflected upon. These include: the facilitation of cross-border mergers; transfer of the registered office; the ‘European’ image; a more flexible form of co-determination in large companies (reduction of the number of supervisory board members; avoidance and freezing of co-determination for medium-sized enterprises; the appeal of the one-tier system and its endangerment by German co-determination; and flat and uniform structures for company groups. The author also briefly discusses some of the problems arising from the formation of SEs in Germany. He ultimately concludes that practice has shown that it is possible to work with the legal regime of the SE in Germany, which adds a new company form to those available in that Member State.

  15. Tolerancia al co en celdas de combustible

    Directory of Open Access Journals (Sweden)

    BIBIAN HOYOS

    2008-01-01

    Full Text Available El entendimiento completo del proceso de adsorción y posterior oxidación de moléculas de CO en platino es de fundamental importancia para el desarrollo de celdas de combustible poliméricas que operan a baja temperatura. En este trabajo se presenta una revisión de las cinco estrategias experimentales más importantes en la búsqueda de mejorar la tolerancia al CO: disminución del potencial de inicio de la reacción de oxidación, reducción de la cantidad de CO adsorbido, utilización de pequeñas cantidades de oxígeno en la corriente de alimentación al ánodo, aumento de la temperatura de operación y limpieza del CO a la entrada. Aunque se han desarrollado catalizadores bastante promisorios (PtMo y PdAu, todavía se sigue considerando a la mezcla Pt-Ru como el catalizador anódico más eficiente para combustibles que contienen 10 ppm de CO o más. La estrategia de inyectar oxígeno al ánodo parece promisoria pero requiere el desarrollo de nuevas membranas más resistentes y de la implementación de condiciones más seguras de operación de la celda. El diseño estructural de ánodos especiales con múltiples capas soportando catalizadores específicos para cada tipo de combustible puede ser una estrategia muy atractiva.

  16. Substrate- and interface-mediated photocrystallization in a-Se films and multi-layers

    Science.gov (United States)

    Lindberg, G. P.; Tallman, R. E.; Weinstein, B. A.; Abbaszadeh, S.; Karim, K. S.; Reznik, A.

    2012-02-01

    Photocrystallization in a-Se films and layered a-Se structures is studied by Raman scattering as a function of temperature for photon energies near or slightly below the band gap. The samples are ˜16.5 μm thick films of a-Se grown i) directly on glass, ii) on indium tin oxide (ITO) coated glass, iii) on glass that is spin coated with 800nm polymide, and iv) on a Capton sheet. A low As-concentration (< 0.2 %) is present in several of the a-Se films. We compare the results on these samples to prior findings on a-Se HARP targets, and on a polymer-encapsulated a-Se film [1]. We observe strong evidence that the interface between the a-Se film and the underlying substrate and/or multi-layers plays an important role in the onset time and growth rate of photocrystallized Se domains. In some samples a discontinuous increase in the onset time with increasing temperature occurs near the glass transition (˜310K), and there is a surprising ``dead zone'' of no crystallization in this region. Other samples merely show a minimum in the onset time at similar temperatures, but no discontinuity and no region where crystallization is absent. Soft intermediate layers appear to increase stability against crystallization in an overlying a-Se film. The competing effects of substrate shear strain and thermal driving forces on the photocrystallization process are considered to account for these findings. [4pt] [1] R.E. Tallman et. al. J. Non-crystalline Sols. 354, 4577-81 (2008)

  17. Altern als Widerstand

    Directory of Open Access Journals (Sweden)

    Roberta Maierhofer

    2005-07-01

    Full Text Available Gullettes kulturwissenschaftliche Untersuchung Aged by Culture ist wie bereits ihre zwei vorangehenden Werke, die sich mit Altern beschäftigen – Safe at Last in the Middle Years: The Invention of the Midlife Progress Novel (1988 und Declining to Decline. Cultural Combat and the Politics of the Middle (1997 –, von großem persönlichen Engagement und durch ein politisches Anliegen motiviert. Sowohl die Dringlichkeit als auch der Widerstand, den Gullette, die sich als „age critic“ definiert, als moralische und politische Notwendigkeit postuliert, werden in der Zweiteilung der Abhandlung angesprochen: „Cultural Urgencies“ und „Theorizing Age Resistantly“. Während Gullette den Begriff „aged by culture“ bereits in Declining to Decline einführt, stellt sie ihn nun in den Mittelpunkt ihrer Untersuchung. Das Buch ist einerseits einer gesellschaftspolitischen Analyse der USA gewidmet, andererseits wird eine Theorie des Widerstands gegenüber Altersdiskriminierung entwickelt.

  18. Pornographie als Metapher

    Directory of Open Access Journals (Sweden)

    Caroline Schubarth

    2010-03-01

    Full Text Available In diesem Artikel werden unterschiedliche metaphorische Verwendungen des Pornografiebegriffs und deren Implikationen untersucht. Während die Existenz von Pornografie der feministischen Anti-Porno-Bewegung als Erklärung für die anhaltende Diskriminierung von Frauen in westlichen Gesellschaften dient, nutzen rechtskonservative Kräfte den Pornografievorwurf als Rechtfertigung für die Zensur von als deviant empfundenen Identitäten und sexuellen Praktiken.This article examines different metaphorical uses of the term pornography and the resulting implications. While the existence of pornography for the feminist anti-porno movement serves as factor in the continuing discrimination of women in western societies, conservative powers on the right use the allegation of pornography as a justification for censorship of those identities and sexual practices deemed deviant.

  19. Rapid synthesis of CuInSe{sub 2} from sputter-deposited bilayer In{sub 2}Se{sub 3}/Cu{sub 2}Se precursors

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Jaseok [School of Chemical Engineering, Yeungnam University, Gyeongsan, Gyeongbuk 712-749 (Korea, Republic of); Kim, Chae-Woong; Jeong, Chaehwan [Applied Optics and Energy Research Group, Korean Institute of Industrial Technology, 500-480 (Korea, Republic of); Kim, Woo Kyoung, E-mail: wkim@ynu.ac.kr [School of Chemical Engineering, Yeungnam University, Gyeongsan, Gyeongbuk 712-749 (Korea, Republic of)

    2015-05-01

    Binary bilayer glass/Mo/In{sub 2}Se{sub 3}/Cu{sub 2}Se precursors have been used to rapidly form CuInSe{sub 2}. Considering their possible application to large-area deposition processes, bilayer precursors were deposited by sequential radiofrequency sputtering of In{sub 2}Se{sub 3} and direct current sputtering of Cu{sub 2}Se onto unheated, Mo-coated glass substrates. High-temperature X-ray diffraction analysis of the glass/Mo/Cu{sub 2}Se sample confirmed that the as-deposited polycrystalline Cu{sub 2−x}Se phase is likely transformed to CuSe at approximately 210 °C, and then to CuSe{sub 2} at 260 °C. Further increase in temperature resulted in the peritectic decomposition of CuSe{sub 2} to CuSe (+ liquid) at approximately 330 °C, and then to Cu{sub 2−x}Se (+ liquid) at around 380 °C with the release of Se. Pre-annealing of In{sub 2}Se{sub 3}/Cu{sub 2}Se precursors in Se environment resulted in the formation of a liquid phase, which is in equilibrium with CuSe. Rapid, thermal annealing of pre-annealed samples between 500 and 550 °C apparently enhanced grain growth and reduced the reaction time to about 3 min; this can be explained by a liquid phase-assisted grain growth mechanism. - Highlights: • CuInSe{sub 2} can be synthesized from In{sub 2}Se{sub 3}/Cu{sub 2}Se precursor within 3 min at 550 °C. • In{sub 2}Se{sub 3} and Cu{sub 2}Se precursors were deposited by sputtering binary targets. • Heat treatment of Cu{sub 2}Se with Se vapor at 300 °C for 10 min can lead to CuSe.

  20. Del mito creacionista al mito futurista

    Directory of Open Access Journals (Sweden)

    Fernando Uhía

    2011-12-01

    Full Text Available La primera foto tomada a la Tierra desde el espacio, en 1946, es uno de los signos de la reprogramación mitológica que está afectando la percepción actual de las ciencias y las artes. Esta reprogramación opone a Dios como artífice y al artista como dios creador: un superhumano tecnólogo y un artista administrador de la Tierra. Se repasa en esta reprogramación el papel de las academias de arte, de las revoluciones científicas, del arte de vanguardia y del arte pop.

  1. Cruzando la cordillera por Manizales, al Magdalena

    OpenAIRE

    Duque Escobar, Gonzalo

    2014-01-01

    Corredor logístico propuesto por la UN-SMP, proyecto modulable a futuro que iniciaría con el Ferrocarril Cafetero como tren de montaña y posteriormente desarrollaría La Transversal Cafetera como vía de primer orden, ambos cruzando la cordillera por el Túnel Cumanday (doble). Este sistema de transporte de carga que articula la Región Andina, se financiaría con el carbón andino, al integrar el Altiplano con los mares de Colombia, y el corredor del Cauca con el Magdalena Centro, será el cataliza...

  2. Valores y creencias asociadas al trabajo

    OpenAIRE

    Filippi, Graciela; Zubieta, Elena; Córdoba, Esteban; Napoli, María Laura; Beramendi, Maite; Ceballos, Samantha; Sánchez, Mariana; Martínez, Adriana

    2007-01-01

    La presente investigación se inscribe en el marco de un proyecto general cuyo objetivo general es abordar desde una perspectiva psicosocial los valores y creencias de los individuos en relación al trabajo. Abordándolo desde la teoría de Teoría de los Valores Humanos (Schwartz, 1992), la cual estudia los valores en actitudes y conductas, los orígenes de los valores en las experiencias únicas y compartidas de los sujetos, y en las diferencias de priorizaciones transculturales, la teoría en la C...

  3. 1950 En torno al Museo Louisiana 1970

    OpenAIRE

    García Sánchez, Carmen

    2015-01-01

    La tesis “1950 En torno al Museo Louisiana 1970” analiza varias obras relacionadas con el espacio doméstico, que se realizaron entre 1950 y 1970 en Dinamarca, un periodo de esplendor de la Arquitectura Moderna. Tras el aislamiento y restricciones del conflicto bélico que asoló Europa, los jóvenes arquitectos daneses, estaban deseosos por experimentar nuevas ideas de procedencia internacional, favorecidos por diferentes circunstancias, encuentran el mejor campo de ensayo en el espacio doméstic...

  4. Del pergamino al blog: leer para escribir

    OpenAIRE

    Marín Peralta, Beatriz; Arias, Aida; Morales, Rebeca

    2005-01-01

    A partir de la lectura de El Quijote, los alumnos de 3ESO se pusieron en el lugar de sus personajes emblemáticos y escribieron dos bitácoras de ficción: las que hubieran escrito Quijote y Sancho de haber existido entonces tal herramienta. La propuesta fue un desafío al uso de Internet que actualmente hacen los alumnos de la ESO. El objetivo general fue potenciar la lectura y escritura como hábitos cotidianos más allá de una lectura puntual en clase y la adquisición de habilidades y nuevos ...

  5. Léxico relativo al vestuario infantil

    OpenAIRE

    Torres Villaseñor, Hermila E.; Centro de Lingüística Hispánica, IIFL, UNAM

    2013-01-01

    Con base en el Cuestionario preparado por la Comisión de Lingüísticay Dialectología Iberoamericanas para el estudio del españolc ontemporáneo, preparé un cuestionario más amplio, con el cual he llevado a cabo una investigación sobre el léxico referente al vestido, según se emplea actualmente en la ciudad de México. Presento aquí los resultados de mi estudio en lo que respecta, únicamente, al vestuario de los niños menores de un año. Toda ladocumentación fue proporcionada por doce informantes ...

  6. En torno al lenguaje, entornos del lenguaje

    Directory of Open Access Journals (Sweden)

    Carmen Carbone

    2011-12-01

    Full Text Available ¿Es demostrable alguna relación entre lengua y visión del mundo? Si se considera al individuo como ser al margen de su entorno, la visión del mundo es una facultad meramente individual, y la lengua no desempeñaría así ningún papel. En cambio, si el individuo no es concebible sino como fruto de su entorno, el sustento básico de tal visión sería la lengua. ------------------------------------------------ Is there a demonstrable relationship between language and world view? If we think of the individual as a being who is separate from his environment, his world view is merely a personal trait in which language would play no role. On the other hand, if the individual can only be understood as the product of his environment, then language would become the underlying basis of his world view.

  7. Wikipedia als Referenzorgan

    OpenAIRE

    Voß, Jakob

    2006-01-01

    Wikipedia wird inzwischen von vielen Nutzern regelmäßig als Nachschlagewerk genutzt. Aufgrund des offenen Charakters der Online-Enzyklopädie, bei der sich jeder direkt beteiligen kann, ist jedoch zusätzliche Medienkompetenz notwendig, um die Qualität einzelner Wikipedia-Artikel einschätzen zu können. Im Vortrag sollen Methoden zur Beurteilung von Wikipedia-Artikeln dargestellt und die Frage beleuchtet werden, unter welchen Umständen Wikipedia als Referenzorgan geeignet ist.

  8. Adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene: First principle calculations

    Energy Technology Data Exchange (ETDEWEB)

    Üzengi Aktürk, O., E-mail: ouzengi@adu.edu.tr [Department of Physics, Adnan Menderes University, Aydın 09100 (Turkey); Tomak, M. [Department of Physics, Middle East Technical University, Ankara 06800 (Turkey)

    2015-08-30

    Highlights: • Electronic properties of adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene are investigated. • It is found that RuSe, RuSe{sub 4}, RuSe{sub 5} adsorbate make substrate metallic. • RuSe{sub 2} makes it half metallic and RuSe{sub 3} makes semiconductor. - Abstract: We have investigated the adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene. The change of the adsorption energy with the number of Se atoms and magnetization values are investigated. Electronic properties of adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene are investigated. The highest adsorption energy belongs to RuSe adsorbate. The biggest magnetization value belongs to RuSe{sub 2} adsorbate. This adsorbate makes the substrate half metallic. This property is important in electronic device applications. It is observed that substitutional Se atom changes the electronic properties of graphene. This substitution makes graphene metallic. While RuSe, RuSe{sub 4}, RuSe{sub 5} adsorbate make substrate metallic, RuSe{sub 3} makes it semiconducting. Generally, it is found that there is a charge transfer from the substrate to clusters within the Löwdin analysis. This is in line with the charge difference results.

  9. 77Se nuclear magnetic resonance of topological insulator Bi2Se3

    Science.gov (United States)

    Georgieva, Nataliya M.; Rybicki, Damian; Guehne, Robin; Williams, Grant V. M.; Chong, Shen V.; Kadowaki, Kazuo; Garate, Ion; Haase, Jürgen

    2016-05-01

    Topological insulators constitute a new class of materials with an energy gap in the bulk and peculiar metallic states on the surface. We report on new features resulting from the bulk electronic structure, based on a comprehensive nuclear magnetic resonance (NMR) study of 77Se on Bi2Se3 and Cu0.15Bi2Se3 single crystals. First, we find two resonance lines and show that they originate from the two inequivalent Se lattice sites. Second, we observe unusual field-independent linewidths and attribute them to an unexpectedly strong internuclear coupling mediated by bulk electrons. In order to support this interpretation, we present a model calculation of the indirect internuclear coupling and show that the Bloembergen-Rowland coupling is much stronger than the Ruderman-Kittel-Kasuya-Yosida coupling. Our results call for a revision of earlier NMR studies and add information concerning the bulk electronic properties.

  10. ZnSe-ZnMnSe and CdTe-CdMnTe superlattices

    Science.gov (United States)

    Gunshor, R. L.; Kolodziejski, L. A.; Otsuka, N.; Datta, S.

    1986-08-01

    We report the growth and characterization of superiattices of a new wide-gap, zincblende material system, Zn 1 - xMn xSe. ZnSe exhibiting dominant free excitonic emission in photoluminescence (PL) is the well material, while wider-band-gap Zn 1 - xMn xSe (0.23 efficiency compared to films of the ZnSe well material, while transmission electron microscopy shows extremely abrupt interfaces by the presence of seventh-order satellite spots. Previously reported superiattices in the CdTe-CdMnTe material system were grown with the (111) orientation, and exhibit unique excitonic properties believed related to the (111) interfaces. Using various techniques to select (111) or (100) heteroepitaxy of CdTe on (100) GaAs, we report the first (100) superlattices of this material, and compare the optical properties to the previous (111) structures.

  11. Néo-libéralisme et minorités. Analyse comparative des écrits de Rachid Al-Ghanouchi et de Hassan Al-Tourabi

    OpenAIRE

    Moss'ad, Névine

    2013-01-01

    Cette étude se propose d'analyser les visions de deux grandes figures de la tendance islamiste concernant la question des minorités, dans le cadre du néolibéralisme. Une série de considérations objectives nous ont amenés à nous pencher sur les positions respectives du Hassan Al-Tourabi, leader du Front national islamique (FNI, Soudan), et de Rachid Al-Ghanouchi, fondateur du mouvement al-Nahda (Tunisie). Ce choix se justifie d'abord par le fait que les deux hommes ont plusieurs traits en comm...

  12. Presentación al Dossier de Historia Ambiental

    Directory of Open Access Journals (Sweden)

    Jairo Antonio Melo Flórez

    2014-06-01

    Full Text Available Entrando en el tema de este número, el Dossier de Historia Ambiental fue una propuesta que se presentó al Comité Editorial de la revista teniendo en cuenta la vigencia de un tema como este en las condiciones actuales de la sociedad que se debate entre el temor, la negación y la acción ambientalista. Pero más allá del activismo, la historia ambiental se ha constituido en una rama de la historia que entra en comunicación con las ciencias naturales y ambientales para insertar lo humano en la discusión actual, centrada en el cambio climático, pero que no es ajena a los “desastres naturales” ni a las transformaciones del paisaje para dar paso al desarrollo.

  13. Temperature dependence of excitonic transition in ZnSe/ZnCdSe quantum wells

    Institute of Scientific and Technical Information of China (English)

    GUO Zi-zheng; LIANG Xi-xia; BAN Shi-liang

    2005-01-01

    A theoretical calculation for the temperature dependence of the excitonic transition in ZnSe/ZnCdSe quantum wells is performed. The exciton binding energy is calculated with a variational technique by considering the temperature-dependence parameters. Our results show that the exciton binding energy reduces linearly with temperature increasing. We find that the strain due to lattice mismatch and differential thermal expansion decreases with the temperature increasing.

  14. V1.42In1.83Mo15Se19

    Directory of Open Access Journals (Sweden)

    Michel Potel

    2010-10-01

    Full Text Available The structure of the title compound, vanadium indium pentadecamolybdenum nonadecaselenide, V1.42In1.83Mo15Se19, is isotypic with In2.9Mo15Se19 [Grüttner et al. (1979. Acta Cryst. B35, 285–292]. It is characterized by two cluster units Mo6Sei8Sea6 and Mo9Sei11Sea6 (where i represents inner and a apical atoms that are present in a 1:1 ratio. The cluster units are centered at Wyckoff positions 2b and 2c and have point-group symmetry overline{3} and overline{6}, respectively. The clusters are interconnected through additional Mo—Se bonds. In the title compound, the V3+ cations replace the trivalent indium atoms present in In2.9Mo15Se19, and a deficiency is observed on the monovalent indium site. One Mo, one Se and the V atom are situated on mirror planes, and two other Se atoms and the In atom are situated on threefold rotation axes.

  15. El yo como límite al modelo perceptivo de conocimiento

    OpenAIRE

    Ricardo Gutiérrez Aguilar

    2010-01-01

    En este artículo se trata de presentar una panorámica general del problema del conocimiento cuando es aplicado a la temática del yo. Cuando su objeto goza de las características presupuestas que se le suelen adjudicar al ego personal, el material de que disponemos para juzgar los resultados que se obtienen con el modelo usual cognoscitivo, uno perceptivo, se vuelve obsoleto y se precisa del recurso a un nuevo modelo. Un lenguaje límite para la Ciencia que implica el concepto de certeza y el l...

  16. Programa de asesoramiento al profesorado de la ESO sobre Pisa y el aprendizaje por competencias

    OpenAIRE

    Presa Irazábal, Aida

    2015-01-01

    En este trabajo, se presenta una propuesta de asesoramiento a docentes de la etapa de cuarto curso de Educación Secundaria Obligatoria, en el que se informa a los mismos sobre las características de la prueba de evaluación externa PISA. La elaboración de este programa se fundamenta en las teorías sobre el aprendizaje por competencias, aprendizaje adaptado al siglo XXI y que se ve reflejado en los diferentes sistemas de evaluación externos internacionales. Por ello, se lleva a cabo una reflexi...

  17. Crystallization kinetics of overlapping phases in Se70Te15Sb15 using isoconversional methods

    OpenAIRE

    M.A. Abdel-Rahim; M.M. Hafiz; A.Z. Mahmoud

    2015-01-01

    The crystallization kinetics of Se70Te15Sb15 chalcogenide glass was studied by Differential Scanning Calorimetry (DSC) under non-isothermal conditions. This glass was found to have a double glass transition and double overlapped crystalline phases. The overlapped crystalline phases were successfully separated using the Gaussian fit model. The activation energy, Ec, and Avrami index, n, were determined by analyzing the data using the Matausita et. al. method. A strong heating rate depending on...

  18. El conocimiento "forma" cuando se sabe "deformado" por el suelo que habitamos

    OpenAIRE

    Carlos A. Cullen

    2014-01-01

    La tesis que sostiene este trabajo es que la formación es una cultura que busca su sujeto, para lo cual se intenta una breve genealogia del concepto, para delinear luego una presentación narrativa de su sentido hoy. La relación del conocimiento aparece así como resistencia al pensamiento único y a la pretensión de una sola forma de entender el sujeto cognoscente y la verdad.

  19. El conocimiento "forma" cuando se sabe "deformado" por el suelo que habitamos

    Directory of Open Access Journals (Sweden)

    Carlos A. Cullen

    2014-11-01

    Full Text Available La tesis que sostiene este trabajo es que la formación es una cultura que busca su sujeto, para lo cual se intenta una breve genealogia del concepto, para delinear luego una presentación narrativa de su sentido hoy. La relación del conocimiento aparece así como resistencia al pensamiento único y a la pretensión de una sola forma de entender el sujeto cognoscente y la verdad.

  20. Synthèse et caractérisation des propriétés structurales et magnétiques de nouveaux siliciures et germaniures à base d'uranium et de cuivre. Etude des propriétés physiques et d'hydruration de quelques composés appartenant aux systèmes Gd - Ni - X où X = Ga, Al, Sn.

    OpenAIRE

    Pechev, Stanislav

    1998-01-01

    Three novel phases, U3Cu4Si4, U3Cu4Ge4 and UCuGe1,77, were prepared in the U - Cu - X (X = Si or Ge) ternary system. Their structural and magnetic properties were investigated. The magnetic structures of the first two compounds were determined by neutron diffraction. Structural and magnetic behaviour transitions occur as copper substitutes silicon atoms in the UCuxSi2-x (0,28 ≤ x ≤ 0,96) solid solution. Thus, the structure of the compositions changes in the α-ThSi2(tetragonal) → AlB2(hexagona...

  1. Hidrogenación de m-dinitrobenceno con catalizadores de pt soportados en titania, alúmina y óxido mixto de titania/alúmina

    OpenAIRE

    Brijaldo Ramírez, María Helena

    2010-01-01

    Se estudió la reacción de hidrogenación de m-dinitrobenceno en fase líquida para la obtención de m-feniléndiamina, con catalizadores de Pt soportado en Nb2O5, SiO2, TiO2, Al2O3 y TiO2-Al2O3. Los catalizadores se prepararon por el método de impregnación húmeda al 1% en peso del metal Se analizó el efecto del soporte y de la temperatura de reducción (alta temperatura; HT: 773 K y baja temperatura; LT: 473 K). Los sólidos resultantes se caracterizaron mediante técnicas de difracción de rayos X...

  2. Energy dynamics in ZnSe/ZnMnSe double-quantum-well structures

    Energy Technology Data Exchange (ETDEWEB)

    Jankowski, Stephanie; Heimbrodt, Wolfram; Horst, Swantje; Chernikov, Alexej; Chatterjee, Sangam [Department of Physics and Material Sciences Center, Phillipps-University Marburg (Germany)

    2009-07-01

    Asymmetric ZnSe/ZnMnSe double-quantum-well (DQW) structures with different barrier width have been grown between dilute magnetic ZnMnSe cladding layers on a (100)GaAs substrate with a ZnSe buffer. The DQWs have been studied by cw and time resolved spectroscopy in external magnetic fields up to 7 Tesla. The ZnSe quantum wells are under tensile strain in these DQW structures yielding the light-hole exciton states to be the energetically lowest lying states. This is the main difference to earlier papers, where tunnelling of carriers and excitons have been studied in DQW structures with heavy hole excitons being the lowest lying states. In the magnetic field we were able to change the barrier height, to split the states of the wells due to the Giant-Zeeman-effect of the ZnMnSe barriers and to manipulate the radiationless energy transfer processes between the 3d-internal transitions and the excitonic states. As a result of the sophisticated interaction of these mechanisms a unique excitation energy dynamics was found and is discussed in detail.

  3. Tunnelling process in ZnSe/ZnMnSe double-quantum-well structures

    Energy Technology Data Exchange (ETDEWEB)

    Jankowski, Stephanie; Niebling, Tobias; Heimbrodt, Wolfram [Phillipps-University Marburg (Germany). Department of Physics and Matrial Science Center

    2008-07-01

    Asymmetric ZnSe/ZnMnSe double-quantum-well (DQW) structures with different barrier width have been grown between ZnMnSe cladding layers on a (100)GaAs substrate with a ZnSe buffer. The ZnSe wells are under tensile strain in these DQW structures yielding the light-hole exciton states to be the energetically lowest lying states. This is different to earlier papers, where tunnelling of carriers and excitons have been studied in DQW structures made of diluted magnetic semiconductors with heavy hole excitons to be the lowest lying states. In an external magnetic field we were able to manipulate the barrier height due to Giant Zeeman effect of the ZnMnSe barriers. Hence we can study the tunnelling processes in these structures in dependence of the height and width of the barrier by photoluminescence, photomodulated reflectivity as well as time resolved measurements. Surprisingly, very different results to heavy hole tunnelling have been found. The obtained results and differences will be discussed in detail.

  4. Optical properties of type-I PbSe/CdSe core/shell quantum dot

    International Nuclear Information System (INIS)

    Electronic properties and optical properties of exciton in a PbSe/CdSe core/shell quantum dot are investigated taking into account the spatial confinement effect. The present model is based on the PbSe/CdSe quantum dot for type-I confinement regime. The dielectric mismatch effect and the self polarization potential are taken into consideration in the PbSe/CdSe quantum dot nanostructure. Polarization charges are incorporated at the interface of the core/shell materials. Numerical calculations on the electronic and optical properties are found with the ratio of radius of inner and outer shell materials for various shell radii. The exciton binding energy and the interband optical transition energies are computed using variational formulism within the single band effective mass approximation. The oscillator strength and the recombination life time are determined with the ratio of radius of core to shell materials taking into account the dielectric mismatch between the materials. The nonlinear absorption coefficients and the changes of refractive index are computed for the ground and first excited state using compact density matrix method. The obtained results are found to be in good agreement with those reported by other investigators

  5. BERKELEY: ALS ring

    International Nuclear Information System (INIS)

    Everybody at Lawrence Berkeley Laboratory's Center for Beam Physics is pleased with the rapid progress in commissioning LBL's Advanced Light Source (ALS) electron storage ring, the foundation for this third-generation synchrotron radiation facility. Designed for a maximum current of 400 mA, the ALS storage ring reached 407 mA just 24 days after storing the first beam on 16 March. ALS construction as a US Department of Energy (DOE) national user facility to provide high-brightness vacuum ultra-violet and soft x-ray radiation began in October 1987. One technical requirement marking project completion was to accumulate a 50-mA current in the storage ring. The ALS passed this milestone on 24 March, a week ahead of the official deadline. Once injected, the electron beam decays quasi-exponentially primarily because of interactions with residual gas molecules in the storage-ring vacuum chamber. Eventually, when the pressure in the vacuum chamber with beam decreases toward the expected operating level of 1 nano Torr, it will only be necessary to refill the storage ring at intervals of four to eight hours. At present the vacuum is improving rapidly as surfaces are irradiated (scrubbed) by the synchrotron radiation itself. At 100 mA, beam lifetime was about one hour (9 April)

  6. Al Shanker Remembers.

    Science.gov (United States)

    American Educator, 2000

    2000-01-01

    In a 1996 interview shortly before his death, Al Shanker, longtime president of the American Federation of Teachers, discussed such topics as: his own educational experiences; how he learned about political fighting in the Boy Scouts; the appeal of socialism; multinational corporations and the nation state; teaching tough students; and John Dewey…

  7. Schilddrüse und Schwangerschaft

    Directory of Open Access Journals (Sweden)

    Zettinig G

    2009-01-01

    Full Text Available Kinderwunsch, Schwangerschaft und die Zeit nach einer Geburt sind besondere Lebensabschnitte bei Patientinnen mit Schilddrüsenerkrankungen. Bei jungen Frauen sind Autoimmunerkrankungen der Schilddrüse, die Einfluss auf die Fruchtbarkeit und die intellektuelle und körperliche Entwicklung des Fetus haben können, häufig. Schilddrüsenerkrankungen können sich in dieser Lebensphase auch erstmals manifestieren; besondere Beachtung verdient die Wechselwirkung von β-HCG mit dem TSH-Rezeptor. Diese Übersicht behandelt das aktuelle Management von Patientinnen mit Schilddrüsenerkrankungen bei Kinderwunsch, in der Schwangerschaft und Postpartalperiode.

  8. Polysemy in the Modern Arabic Lexicon An applied study on the al-Muˁjam al-ˁArabī al-ˀAsāsī

    OpenAIRE

    Madkūr, ˁAmr Muḥammad Faraǧ

    2011-01-01

    Polisemia en el léxico árabe contemporáneo. Un estudio aplicado sobre el Muˁǧam al- ˁArabī al-Asāsī. El presente estudio se divide en tres secciones. La primera de ellas aborda el concepto de polisemia y sus diferentes tipos en los autores árabes antiguos y modernos. La segunda sección estudia en detalle el Muˁǧam al-ˁArabī al-Asāsī y su método de presentación de las palabras de carácter polisémico, aportando numerosos ejemplos para aclarar la forma de abordar la cuestión en di...

  9. A study of the non-isothermal crystallization kinetic of Zn10Se90 glass

    Science.gov (United States)

    Abdel-Rahim, M. A.; Hafiz, M. M.; Abdel-Latief, A. Y.; Abd-Elnaiem, Alaa M.; Alwany, A. Elwhab. B.

    2015-06-01

    The glass transition and the crystallization kinetics of Zn10Se90 glass by differential thermal analysis (DTA) technique under non-isothermal conduction were studied. The effective activation energies of the glass transition and the crystallization have been evaluated on the basses of the Kissinger and Matusita et al. approximations. Kinetic parameters of the crystallization process are significantly influenced by the heating rate. We have compared the experimental DTA with the calculated data curves for Zn10Se90 system using the Johanson-Mehl-Avrami (JMA) and Sestak-Berggren SB( M, N) models. Simulation results indicated that the SB( M, N) model is more suitable for describing the crystallization kinetics for the studied composition. Furthermore, the crystalline phases of annealed Zn10Se90 were characterized by X-ray diffraction. The surface morphology of the annealed samples was examined using scanning electron microscopy.

  10. Chemical Excision of Tetrahedral FeSe2 Chains from the Superconductor FeSe: Synthesis, Crystal Structure, and Magnetism of Fe3Se4(en)2

    Science.gov (United States)

    Pak, Chongin; Kamali, Saeed; Pham, Joyce; Lee, Kathleen; Greenfield, Joshua T.; Kovnir, Kirill

    2014-01-01

    Fragments of the superconducting FeSe layer, FeSe2 tetrahedral chains, were stabilized in the crystal structure of a new mixed-valent compound Fe3Se4(en)2 (en = ethylenediamine) synthesized from elemental Fe and Se. The FeSe2 chains are separated from each other by means of Fe(en)2 linkers. Mössbauer spectroscopy and magnetometry reveal strong magnetic interactions within the FeSe2 chains which result in antiferromagnetic ordering below 170 K. According to DFT calculations, anisotropic transport and magnetic properties are expected for Fe3Se4(en)2. This compound offers a unique way to manipulate the properties of the Fe-Se infinite fragments by varying the topology and charge of the Fe-amino linkers. PMID:24299423

  11. SENSor foto-eléctrico aplicado al movimiento de los dedos de las manos

    OpenAIRE

    Jaime Leybón Ibarra; María del Rocío Ramírez Barba; Verónica Taboada Picazo

    2006-01-01

    Se presenta el desarrollo y aplicación de un guante instrumentado con dispositivos foto-eléctricos para diferenciar cuatro posiciones durante el movimiento flexor de los dedos de las manos, distinguiendo los queiremas que un signante realiza al comunicarse por medio de la lengua de señas mexicana (LSM).

  12. SENSor foto-eléctrico aplicado al movimiento de los dedos de las manos

    Directory of Open Access Journals (Sweden)

    Jaime Leybón Ibarra

    2006-01-01

    Full Text Available Se presenta el desarrollo y aplicación de un guante instrumentado con dispositivos foto-eléctricos para diferenciar cuatro posiciones durante el movimiento flexor de los dedos de las manos, distinguiendo los queiremas que un signante realiza al comunicarse por medio de la lengua de señas mexicana (LSM.

  13. La gran vida al aire libre PSA (:30) (The Great Outdoors)

    Centers for Disease Control (CDC) Podcasts

    2016-05-31

    Un hombre y una mujer se están alistando para irse a una caminata. La mujer le recuerda al hombre que se proteja del sol.  Created: 5/31/2016 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/31/2016.

  14. Alergia al latex en los trabajadores sanitarios (II: medidas de prevención

    Directory of Open Access Journals (Sweden)

    M. S. Gil Micharet

    2007-12-01

    Full Text Available Se presenta la segunda parte del artículo de revisión sobre alergia al látex en trabajadores sanitarios en el que se recogen las medidas de prevención.The second part of the revision article about latex allergy in the healthcare workers are presented, in which preventive measures are collected.

  15. Fabrication of FeSe1-x superconducting films with bulk properties

    International Nuclear Information System (INIS)

    We have fabricated high-quality FeSe1-x superconducting films with a bulk Tc of 11-12 K on different substrates, Al2O3(0 0 0 1), SrTiO3(1 0 0), MgO(1 0 0), and LaAlO3(1 0 0), by using a pulsed laser deposition technique. All the films were grown at a high substrate temperature of 610 oC, and were preferentially oriented along the (1 0 1) direction, the latter being to be a key to fabricating of FeSe1-x superconducting thin films with high Tc. According to the energy dispersive spectroscopy data, the Fe:Se composition ratio was 1:0.90 ± 0.02. The FeSe1-x film grown on a SrTiO3 substrate showed the best quality with a high upper critical magnetic field [Hc2(0)] of 56 T.

  16. Teoria de la deteccion de señales (tds y caracteristicas de la memoria transitoria

    Directory of Open Access Journals (Sweden)

    Paul Stephaneck

    1987-01-01

    Full Text Available Seis sujetos fueron sometidos a una tarea de memorización en la cual el sujeto conserva informaciones, recibe nuevos datos durante el intervalo de retención y elimina, al mismo tiempo, algunos aspectos antiguos de su memoria que se volvían inútiles. El material memorizado consistió en objetos abstractos que poseían varios atributos. Fueron establecidas dos condiciones experimentales. Condición V: numerosos atributos de pocos objetos. Condición U: un solo atrio buto de numerosos objetos. Los resultados obtenidos por la aplicación de la Teoría de la Detección de Señales (TDS muestran una leve superioridad del desempeño de los sujetos en la condición U. Reagrupando los datos se puede mostrar que el efecto principal en la degradación de la memoria se debe al número de aspectos conservados en la memoria en el momento de recordar

  17. Structure of Se-rich As-Se glasses by high-resolution x-ray photoelectron spectroscopy

    International Nuclear Information System (INIS)

    To establish the validity of various proposed structural models, we have investigated the structure of the binary AsxSe100-x chalcogenide glass family (x≤40) by high-resolution x-ray photoelectron spectroscopy. From the composition dependence of the valence band, the contributions to the density of states from the 4p lone pair electrons of Se and the 4p bonding states and 4s electrons of Se and As are identified in the top part of the band. The analysis of Se 3d and As 3d core-level spectra supports the so-called chain crossing model for the atomic structure of Se-rich AsxSe100-x bulk glasses. The results also indicate small deviations (∼3-8%) from this model, especially for glass compositions with short Se chains (2540Se60 and of Se-Se-Se fragments in a glass with composition x=30 is established

  18. The Pr2Se3-PrSe2 system: Studies of the phase relationships and the modulated crystal structure of PrSe1.85

    International Nuclear Information System (INIS)

    Thermochemical investigations have been carried out to elucidate the phase relationships in the system Pr2Se3-PrSe2 and to construct the pSe-T-x diagram. The result of the tensimetric and thermogravimetric studies showed the thermal decomposition of PrSe2 to be a step-wise process due to the formation of a sequence of discrete intermediate phases with the compositions PrSe1.9, PrSe1.85, PrSe1.8, and Pr2Se3. PrSe1.85 and PrSe1.8 have been previously considered as selenium-deficient non-stoichiometric phases. Conclusions derived from the thermodynamic study were verified by X-ray diffraction and electron microscopy studies on single crystals of PrSe1.85 which were obtained from reactions of praseodymium and selenium in stoichiometric amounts in a KCl flux at 1070K. A two-dimensional modulation could be observed for PrSe1.85 in X-ray and high-resolution transmission electron microscopy. The structure of PrSe1.85 was solved and refined in superspace group P4/n(αβ12)(β-α12)00 with lattice parameters of a=4.137(1)A, c=8.398(2)A of the basic unit cell and α=β=0.293(1). The origin of the modulation can be attributed to a site occupancy wave and a charge density wave in its planar selenium layer. The experimentally determined magnetic moments indicate Pr3+ for the polyselenides PrSe2, PrSe1.9 and PrSe1.85

  19. ZnSe-based white LEDs

    Science.gov (United States)

    Katayama, K.; Matsubara, H.; Nakanishi, F.; Nakamura, T.; Doi, H.; Saegusa, A.; Mitsui, T.; Matsuoka, T.; Irikura, M.; Takebe, T.; Nishine, S.; Shirakawa, T.

    2000-06-01

    The first phosphor-free white LED based on II-IV compound materials is demonstrated. Our device utilizes a phenomenon unique to ZnSe homoepitaxy, where a portion of the main greenish-blue emission from the active layer of a pn junction diode is absorbed by the conductive substrate which in turn gives off an intense broad-band yellow emission centered around 585 nm by photoluminescence. These two emission bands combine to give a spectrum which appears white to the naked eye. A typical ZnSe-based white LED lamp exhibits a color temperature of approximately 3400 K with a CRI (color rendering index) of 68. The optical output power and operating voltage of such a device at a forward current of 20 mA is 2.0 mW and 2.7 V, respectively. The luminous efficiency estimated from these results is 10.4l m/W, which is comparable to the incandescent lamp as well as the commercial InGaN-based white LED. Device lifetimes (half-life) have exceeded 800 h at 20°C.

  20. Biorefinery pulp mill - BiSe

    Energy Technology Data Exchange (ETDEWEB)

    Henricson, K.; Saukkonen, E.; Nokkanen, T. (and others) (Lappeenranta Univ. of Technology (Finland). Lab. of Fiber and Paper Technology). Email: kaj.henricson@lut.fi

    2010-10-15

    A need to utilize woody material in a more efficient way to produce pulp, biofuels and energy is seen as a key factor in the development of new pulp mill biorefineries. There are many alternatives to execute the biorefinery concept. In the Biorefinery Pulp Mill (Biojalostamo Sellutehdas), BiSe project approach, prehydrolysis of wood chips and acid hydrolysis of logging residue for the production of bioethanol as well as the separation of lignin for the production of biodiesel are studied. The main goal of the project is to examine these new biofuel production methods and processes for the improvement of the competitiveness, energy effectiveness and economic profitability of domestic pulp mills, while keeping in mind the main product, chemical pulp. In the project, laboratory experiments on wood chip prehydrolysis prior to cooking, hydrolysis liquor treatment, cooking of prehydrolyzed chips, low power pulp bleaching and lignin separation are carried out. Based on these laboratory data, a simulation model of the biorefinery is created. The model is then used to assess the profitability of the BiSe biorefinery approach. (orig.)

  1. CULTURA ORGANIZACIONAL Y POSMODERNIDAD. UNA APROXIMACIÓN AL CASO VENEZUELA

    OpenAIRE

    Fredy R. Vallenilla Solórzano

    2006-01-01

    El objetivo del presente trabajo, es presentar una aproximación al estudio de la cultura organizacional y la posmodernidad, en todo caso si pudiera hablarse de la cultura organizacional posmoderna y como estos conceptos pudieran estar siendo interpretados en algunas organizaciones venezolanas. En tal sentido, se realiza una investigación descriptivadocumental, donde se analizan fuentes bibliográficas sobre el tema objeto de estudio. Se concluye que está claro el concepto de cultura organizaci...

  2. Esquema basado en Wavelet para la reducción de ruido online en señales industriales

    Directory of Open Access Journals (Sweden)

    Antonio Cedeño Pozo

    2014-07-01

    Full Text Available En este trabajo se propone un esquema para la reducción de ruido gaussiano online basado en wavelet con ventanas deslizantes para ser utilizado en señales industriales. Este tipo de técnicas se utilizan cuando la señal debe ser tratada a medida que se obtienen las muestras, funcionalidad necesaria en aplicaciones con requerimientos de tiempo real, por ejemplo en sistemas SCADA. El algoritmo introducido en el presente trabajo se diferencia de algoritmos similares en que: en primer término utiliza una selección adaptativa del umbral basada en NeighShrink; adicionalmente reutiliza en lo posible los coeficientes wavelet calculados en pasos anteriores para el procesamiento de cada punto; finalmente utiliza la wavelet Haar en lugar de otros filtros de mayor complejidad computacional. Para la comprobación experimental del nuevo esquema se utilizó un conjunto de señales sintéticas introducido por Donoho y Marron, complementadas por señales adquiridas en procesos reales de plantas industriales. Las pruebas realizadas revelan que el algoritmo propuesto mejora la reducción de ruido online respecto a esquemas similares reportados anteriormente y es computacionalmente menos complejo.

  3. Preparation and characterization of Bi2Se3(0001) and of epitaxial FeSe nanocrystals on Bi2Se3(0001)

    Science.gov (United States)

    Cavallin, Alberto; Sevriuk, Vasilii; Fischer, Kenia Novakoski; Manna, Sujit; Ouazi, Safia; Ellguth, Martin; Tusche, Christian; Meyerheim, Holger L.; Sander, Dirk; Kirschner, Jürgen

    2016-04-01

    Procedures to prepare clean Bi2Se3(0001) surfaces from bulk samples and epitaxial FeSe nanocrystals on Bi2Se3(0001) are reported. Bi2Se3(0001) substrates are prepared by in vacuo cleavage of bulk samples, followed by ion bombardment and annealing cycles. FeSe is prepared by Fe deposition onto Bi2Se3 at 303 K, followed by annealing at T ≈ 623 K. We use low-energy electron diffraction, surface X-ray diffraction, photoemission spectroscopy, scanning tunneling microscopy and spectroscopy, and stress measurements to elucidate the correlation between structural and electronic properties of the pristine Bi2Se3(0001) and FeSe covered surfaces. Our analysis reveals the formation of epitaxial FeSe nanocrystals with a thickness of three unit cells (1.5 nm). Electron diffraction experiments indicate an anisotropic epitaxial strain in FeSe. A negligible strain close to 0.0% and a tensile strain of + 2.1% are observed along the in-plane [ 01 1 bar 0 ] and [ 2 11 bar 0 ] Bi2Se3 directions, respectively. The out-of-plane strain is + 4.2%. The role of this strain state for the reported high-TC superconductivity in bulk FeSe is discussed.

  4. Fluorescence spectroscopy of electrochemically self-assembled ZnSe and Mn:ZnSe nanowires

    International Nuclear Information System (INIS)

    We report room temperature fluorescence spectroscopy (FL) studies of ZnSe and Mn-doped ZnSe nanowires of different diameters (10, 25, 50 nm) produced by an electrochemical self-assembly technique. All samples exhibit increasing blue-shift in the band edge fluorescence with decreasing wire diameter because of quantum confinement. The 10 nm ZnSe nanowires show four distinct emission peaks due to band-to-band recombination, exciton recombination, recombination via surface states and via band gap (trap) states. The exciton binding energy in these nanowires exhibits a giant increase (∼10-fold) over the bulk value due to quantum confinement, since the effective wire radius (taking into account side depletion) is smaller than the exciton Bohr radius in bulk ZnSe. The 25 and 50 nm diameter wires show only a single FL peak due to band-to-band electron-hole recombination. In the case of Mn-doped ZnSe nanowires, the band edge luminescence in 10 nm samples is significantly quenched by Mn doping but not the exciton luminescence, which remains relatively unaffected. We observe additional features due to Mn2+ ions. The spectra also reveal that the emission from Mn2+ states increases in intensity and is progressively red-shifted with increasing Mn concentration

  5. Opportunities and challenges for a sustainable energy policy in SE Europe: SE European Energy Community Treaty

    International Nuclear Information System (INIS)

    Energy demand continues to increase in turn raising concerns about energy supply. In this paper, the author has tried to systematize the role of the energy sector in South Eastern (SE) Europe in the context of the European energy policy process. This should make the energy sector in SE Europe more visible and open to substantial activities and appropriate funding. This is important to assure its full alignment with the European energy policy process, and in so doing, make it less fragile. According to the SE European Energy Community Treaty, parties to the Treaty are obliged to implement reforms in the energy and environmental sector in accordance with the European Union's respective policy. This paper raises awareness of the environmental requirements that have been set, of renewable energy and its implementation, at the same time pointing out that the response in SE Europe has been at a low level. It is believed that this paper could draw attention to the existing problems and could contribute to the establishment of a common integrated energy market in SE Europe and the EU. (author)

  6. Synthesis, characterization and properties of Se nanowires intercalated polyaniline/Se nanocomposites

    Directory of Open Access Journals (Sweden)

    M. Husain

    2013-09-01

    Full Text Available Present work reports novel synthesis of Polyaniline (PANI/Se nanocomposites. Se nanowires are prepared from SeO2 under assistance of vitamin C and polyaniline is synthesized through chemical oxidation. The effect of composition of Se nanowires on the properties of polyaniline was investigated and five orders increase in conductivity after doping has been observed. The electrical properties of nanocomposites show that conduction is through hopping process due to the wide range of localized states present near fermi level. FTIR (Fourier Transform Infrared spectroscopy and ultraviolet (UV-visible studies confirm the occurrence of polyaniline in conducting emeraldine salt form in the composites and suggest incorporation of Se in polymer. The optical studies indicate that absorption mechanism is due to indirect allowed transition and the optical band gap tends to decrease after doping. The thermal stability of composites has been ascertained on the basis of DSC (Differential Scanning Calorimetery measurements. TEM (Transmission Electron Microscopy and SEM (Scanning Electron Microscopy analysis have also been carried out for morphological studies.

  7. Derecho aplicable al fondo de la controversia en arbitrajes surgidos de tratados de inversión

    Directory of Open Access Journals (Sweden)

    Francisco Endara Flores

    2011-07-01

    Full Text Available En este trabajo se analizará cuál es el derecho aplicable al fondo de la controversia de un arbitraje surgido de un Tratado de Inversiones. A lo largo del artículo se tratará de demostrar que la fuente primaria aplicable al fondo de la controversia, será el mismo Tratado de Inversión, seguido por un análisis del rol que tendrá el derecho local al momento de resolver la controversia.Lo mismo se hará respecto al resto de normas del derecho internacional y la manera en como dichas normas se integran para ser aplicadas por los árbitros al momento de resolver la controversia.

  8. ALS insertion devices

    International Nuclear Information System (INIS)

    The Advanced Light Source (ALS), the first US third generation synchrotron radiation source, is currently under construction at the Lawrence Berkeley Laboratory. The low-emittance, 1.5 GeV electron storage ring and the insertion devices are specifically designed to produce high brightness beams in the UV to soft X-Ray range. The planned initial complement of insertion devices includes four 4.6 m long undulators, with period lengths of 3.9 cm, 5.0 cm (2) and 8.0 cm, and a 2.9 m long wiggler of 16 cm period length. Undulator design is well advanced and fabrication has begun on the 5.0 cm and 8.0 cm period length undulators. This paper discusses ALS insertion device requirements; general design philosophy; and design of the magnetic structure, support structure/drive systems, control system and vacuum system. 18 refs., 9 figs., 5 tabs

  9. Así es como se empezó a enseñar, a sacar la figura de lo que se conoce

    Directory of Open Access Journals (Sweden)

    Abel Rodríguez

    2014-09-01

    Full Text Available Abel Rodríguez cuenta como sus pinturas se inscriben en los procesos de reactualización de la creación cósmica narrada en la historia oral del pueblo nonuya. Esta reactualización se efectúa en la vida cotidiana, iniciándose con la enseñanza nocturna de las palabras del creador y desarrollándose durante el día, gracias al trabajo y el sudor de la gente que transforma las palabras en figuras y las materializa haciendo chagras, malocas y cuerpos de parientes reunidos en las fiestas. Las pinturas de Abel muestran diversos momentos de estos procesos.

  10. Acarbose als Carbophor

    OpenAIRE

    Merettig, Nadine

    2014-01-01

    Das Pseudotetrasaccharid Acarbose ist seit 1990 als kompetitiver Inhibitor intestinaler α-Glucosidasen (GlucobayTM/PrecoseTM) in der medizinischen Anwendung bei der Therapie von Diabetes mellitus Typ-2. Charakteristisch für die Struktur der Acarbose ist die Acarviosyleinheit, bei der Valinamin und Desoxyglucose N-glycosidisch verknüpft sind; des Weiteren ist an die Acarviosyleinheit ein Maltosylrest gebunden. Der Inhibitoreffekt beruht auf der irreversiblen Bindung zwischen ...

  11. Augmented Reality als Bildungsenhancement?

    OpenAIRE

    Damberger, Thomas

    2015-01-01

    Die Realität, die sich mithilfe von Datenbrillen und Smartphone Applikationen in die virtuelle Welt hinein ausdehnt, erfährt eine Form des Enhancements. Ein solches Enhancement kann unter bestimmten Voraussetzungen als Bildungsenhancement verstanden werden. Der Text befasst sich mit Formen der erweiterten Realität, ferner mit dem, um was es wesentlich bei der Bildung geht und zuletzt mit den Bedingungen, die erforderlich sind, um diesem Wesentlichen mit Hilfe von augmented reality besser zum ...

  12. Carta al editor

    OpenAIRE

    Harry Pachajoa

    2012-01-01

    Recently, Valencia et al., published a very interesting article called «Lipid profile in a group of patients with Turner’s syndrome at Clínica Universitaria Bolivariana in the city of Medellín between 2000 and 2009". An article which evaluated lipid levels in patients withTurner syndrome in a Colombian clinic, the study associated results of lipid profile with karyotype and other risk factors for coronary heart disease.

  13. Simple microwave preparation of high activity Se-rich CoSe2/C for oxygen reduction reaction

    International Nuclear Information System (INIS)

    Carbon supported cobalt selenide (CoSe2/C) nanoparticles were prepared by a simple microwave method using cobalt acetate and selenium dioxide as precursors with different molar ratios of Se/Co. The effects of Se/Co ratios on surface morphology, crystal structure, chemical composition and electrocatalytic activity toward oxygen reduction reaction (ORR) of CoSe2/C catalyst nanoparticles were systematically investigated. It was found that the experimental compositions of CoSe1.8/C∼CoSe2.7/C with average crystallite sizes of 15.4∼12.9 nm were obtained with the Se/Co ratios of 2.0∼4.0. The major phases of CoSe2/C nanoparticles were identified to be orthorhombic CoSe2 with minor cubic CoSe2. The potentials corresponding to ORR (EORR) reached 0.6∼0.7 V, while the electron transfer numbers (n) were 3.1∼4.0 in oxygen saturated sulfuric acid solutions. The formation of Se-rich CoSe2/C nanoparticles was confirmed with Se/Co ≥ 2.5, and the best ORR activities with EORR = 0.705 V and n = 4.0 could be achieved with Se/Co = 3.0. Slightly excess amount of Se oxide presented in CoSe2/C would prevent CoSe2 nanoparticles from growing and smaller sizes with less agglomerated Se-rich CoSe2/C were obtained, resulting in good ORR activity. However, too much Se oxide would cause severe aggregation of CoSe2 nanoparticles, leading to poor ORR activity

  14. Absorption Spectra of CuGaSe 2 and CuInSe 2 Semiconducting Nanoclusters

    KAUST Repository

    Mokkath, Junais Habeeb

    2015-10-01

    The structural and optical properties of the chalcopyrite CunGanSe2n and CunInnSe2n nanoclusters (n = 2, 4, 6, and 8) are investigated as a function of the size using a combination of basin-hopping global optimization and time-dependent density functional theory. Although the lowest energy structures are found to show almost random geometries, the band gaps and absorption spectra still are subject to systematic blue shifts for decreasing cluster size in the case of CunGanSe2n, indicating strong electron confinement. The applicability of the nanoclusters in photovoltaics is discussed. © 2015 American Chemical Society.

  15. Deterioro de la memoria explícita versus memoria implícita asociado al alcoholismo

    OpenAIRE

    Sánchez Sánchez, Francisca

    2011-01-01

    [ES] En este trabajo se evalúan los posibles trastornos de la memoria vinculados directamente al consumo de alcohol. En primer lugar se trata el tema de la memoria y pérdida de la misma. En segundo lugar se analiza el tema del alcoholismo, metabolismo del alcohol etílico, mecanismos de acción y efectos neuropsicológicos del mismo. Se señalan cuáles son las regiones cerebrales más importantes afectadas por dicho consumo y las enfermedades que produce. Y en tercer y último lugar se trata de ver...

  16. Optical properties of thermally annealed CdZnSe/ZnSe quantum dots

    International Nuclear Information System (INIS)

    To analyse the diffusion characteristics, photoluminescence (PL) spectroscopy has been carried out in extensive detail on single, as well as, ensembles of thermally annealed (TA) CdSe/ZnSe QDs. For a series of QD-ensembles, each annealed for tA = 30 s at temperatures from TA = 300-550 C, the change in the QD-composition has been calculated from the blue-shift of the exciton ground-state PL-emission, using a concentration function based on Fick's laws of diffusion. The diffusion length (LD) and the activation energy (EA) have been determined thereof. For the studied QDs, EA has been evaluated to be 2.2 eV. Additionally, TA results also in an enhancement of the PL-intensity and reduction of the full-width-at-half maximum (FWHM) of the spectra. This point towards an increased homogeneity of the QD-size and composition, and decrease in the concentration of defects around the QDs. For single CdSe/ZnSe QDs, TA has been varied from 100-240 C, in steps for 20 C, with tA kept fixed at 30 s. Finally, the evolution of the magneto-optic response with post-growth thermal annealing has been studied for both individual QDs and QD-ensembles. An external magnetic field, applied perpendicular to the plane of the QDs (Faraday configuration), results in Zeeman spin splitting of the ground exciton state. The emissions from the Zeeman-split states are left and right circularly polarized and from the degree of circular polarization (DCP), as well as, the spectral separation of the PL-peaks, the g-factor can be estimated. For CdSe/ZnSe QD-ensembles, the g-factor has been observed to change sign with TA. (orig.).

  17. PbSe/PbSe xS1-x core-alloyed shell nanocrystals

    International Nuclear Information System (INIS)

    This work describes a novel synthetic method for the formation of PbSe core-shell nanocrystals. The PbSe show a special interest due to their strong quantum size effect and activity in the near IR spectral regime. Common colloidal procedure of semiconductor core-shell structures includes an initial preparation of the core, isolation of the NCs from the mother solution, dissolving in a new solution with a post injection of the shell constituents. This paper discusses an alternative procedure, utilizing a single-injection of the core and shell constituents, simultaneously. The faster reactivity of selenium to a lead precursor, directs a nucleation of a PbSe core, while the sulfur reagent participate at a later stage as a PbSe xS1-x shell. PbSe core-shell NCs, prepared by the discussed single-injection process, were compared with those prepared via a two-step injection, containing equimolar reagents and NCs size. Both cases showed a strong fluorescence (with quantum efficiency 30-60%), but with a pronounced red-shift of the band edge (30-120 meV), with respect to the core, upon an increase of the shell thickness. This red-shift was substantially larger for core-shell NCs prepared via a one-step injection. The red-shift corresponds to the formation of type II transition between E c,PbSe and E v,PbS. While the extra red-shift, upon preparation by a single injection, corresponds to the formation of shells with a tunable alloy composition

  18. Tee-se-itse-asenne tyyliblogeissa

    OpenAIRE

    Vartama, Saana

    2011-01-01

    Tämä opinnäytetyö käsittelee suomalaisten tyyliblogien tee-se-itse- eli DIY-asennetta esimerkkiblogien kautta. Aluksi määritellään, mitä eroa on muodilla ja tyylillä ja mitä DIY-kulttuuri on. Tyyliblogeissa on erilaisia DIY-sisältöjä; itse tehtyjä vaatteita ja asusteita, tuunattuja vaatteita ja asusteita sekä kierrätettyjä vaatteita ja asusteita. On tyyliblogeja, joissa käsitellään ainoastaan DIY-sisältöä ja jaetaan DIY-ohjeita, ja sellaisia DIY-tyyliblogeja, joissa käsitellään muutakin ty...

  19. ¿Cómo se ve afectada la sostenibilidad del sistema de pensiones español cuando se tienen en cuenta los efectos migratorios de la crisis?

    OpenAIRE

    Párraga Zambrano, Katherine

    2014-01-01

    El pasado 1 de enero de 2014 entró en vigor la ley 23/2013 de reforma del sistema de pensiones. Dicha reforma se basa en dos pilares importantes: el Índice de Revalorización y el Factor de sostenibilidad, estos pilares han sido elaborados por el Ministerio de Empleo y serán supervisados por un organismo conocido como “Autoridad Fiscal”, vinculado con el ministerio de Hacienda. Por un lado, nos encontramos con el Índice de Revalorización que sustituirá al IPC. No hay que olvidar que desde ...

  20. Pancreas Scanning with Se75-Selenomethionine

    International Nuclear Information System (INIS)

    Amino-acids show a high degree of localization in the pancreas during the first few hours after administration. This specificity is related to the rapid synthesis and turnover of the digestive enzymes. Since none of the elements in the structure of amino-acids (C,H, N,0 and S) have suitable gamma-emitting isotopes, they cannot be used for scanning. Several I131 derivatives of amino-acids were prepared and tested, but the pancreas-localizing property of the original amino-acid was lost in every case. The chemical similarity of selenium and sulphur suggested that the selenium analogue of methionine might resemble methionine closely enough to take its place in protein synthesis. Se75 (halflife, 128 d; principal gamma-ray, 0.27 MeV) is suitable for scanning. Selenium-75-selenomethionine was prepared by yeast biosynthesis. The yeast was grown on a low sulphur medium containing high specific activity Se75 as selenite. After extraction with ether and hot trichloracetic acid, the protein residue was hydrolysed with hydrochloric acid The resulting amino-acid mixture was separated by column chromatography. Selenium-75-selenomethionine prepared in this manner showed biological properties of a natural aminoacid. The uptake in pancreas was about 7% of the administered dose and the concentration in a gramme of pancreas was seven times that in a gramme of liver. Blood and other organs had even lower uptakes. The clinical usefulness of pancreas scanning is now being evaluated. Tumours of the pancreas have been found as areas of decreased uptake. There is no concentration of selenomethionine in cases of acute pancreatitis. It is too early to give a statistical estimate of our ability to find tumours of the pancreas by this technique. The estimated total body dose from this procedure is less than 1 rad. The selenium dose is only a. few microgrammes and represents no toxicity hazard. (author)

  1. Temperature dependent band offsets in PbSe/PbEuSe quantum well heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Simma, M.; Bauer, G.; Springholz, G. [Institut fuer Halbleiter und Festkoerperphysik, Johannes Kepler Universitaet, A-4040 Linz (Austria)

    2012-10-22

    The band offsets of PbSe/Pb{sub 1-x}Eu{sub x}Se multi-quantum wells grown by molecular beam epitaxy are determined as a function of temperature and europium content using temperature-modulated differential transmission spectroscopy. The confined quantum well states in the valence and conduction bands are analyzed using a k{center_dot}p model with envelope function approximation. From the fit of the experimental data, the normalized conduction band offset is determined as 0.45{+-}0.15 of the band gap difference, independently of Eu content up to 14% and temperature from 20 to 300 K.

  2. 'Cold' crystallization in nanostructurized 80GeSe 2 -20Ga 2 Se 3 glass

    OpenAIRE

    Klym, Halyna; Ingram, Adam; Shpotyuk, Oleh; Calvez, Laurent; Petracovschi, Elena; Kulyk, Bohdan; Serkiz, Roman; Szatanik, Roman

    2015-01-01

    'Cold' crystallization in 80GeSe 2-20Ga 2 Se 3 chalcogenide glass nanostructurized due to thermal annealing at 380°C for 10, 25, 50, 80, and 100 h are probed with X-ray diffraction, atomic force, and scanning electron microscopy, as well as positron annihilation spectroscopy performed in positron annihilation lifetime and Doppler broadening of annihilation line modes. It is shown that changes in defect-related component in the fit of experimental positron lifetime spectra for nanocrystallized...

  3. Temperature dependence of the cyclotron mass in ZnCdSe/ZnSe multi-QWs

    International Nuclear Information System (INIS)

    The temperature dependence of the cyclotron resonance mass (CRM) of the magnetopolaron in ZnCdSe/ZnSe multi-quantum wells with strong magnetic field is investigated theoretically using the Lee-Low-Pines variational method. Contributions to the CRM, due to the nonparabolicity of the conduction band and the coupling of electron with both confined longitudinal optical and interface optical phonons, are considered. Results of our calculations are compared with the experimental data, and a qualitative agreement is found over a large temperature range. We show that these three contributions complement each other to determine the cyclotron mass as a function of the temperature. (author)

  4. Electron-impact ionization of the Se2+ and Se3+ atomic ions

    Science.gov (United States)

    Loch, S. D.; Pindzola, M. S.

    2016-05-01

    Semi-relativistic configuration-average distorted-wave (CADW) calculations are made for the electron-impact ionization of the Se2+ and Se3+ atomic ions. The CADW calculations are found to be in reasonable agreement with recent measurements made at the Multicharged Ion Research Facility at the University of Nevada in Reno. The CADW calculations for configurations near ionization thresholds are checked against level to level distorted-wave (LLDW) calculations. Work supported in part by Grants from NASA, NSF, and DOE.

  5. ¿De qué se habla cuando se habla de calidad de los servicios?

    OpenAIRE

    Rey, Carina

    2012-01-01

    En los últimos años, la calidad de los servicios y por ende de las bibliotecas se ha convertido en un tema estrella. En los medios de comunicación y en los foros profesionales se comentan las puntuaciones obtenidas en EFQM, los procesos de evaluación para optar a una certificación, o sobre las bondades de un modelo u otro; y surge la duda: ¿de qué estamos hablando?, ¿qué entendemos por calidad de servicio?, ¿cuáles son los aspectos a tener en cuenta en las valoraciones?, ¿qué elementos tenemo...

  6. Energy transfer processes in ZnSe/(Zn,Mn)Se double quantum wells

    Science.gov (United States)

    Jankowski, Stephanie; Horst, Swantje; Chernikov, Alexej; Chatterjee, Sangam; Heimbrodt, Wolfram

    2009-10-01

    The complex interplay of energy transfer and tunneling processes in a series of asymmetric ZnSe/(Zn,Mn)Se double quantum-well (DQW) structures is investigated. Steady-state and time-resolved photoluminescence at low temperatures and external magnetic fields up to 7 T in this system show remarkable differences to earlier studies on CdTe/(Cd,Mn)Te DQWs. The pure quantum-mechanical tunneling process is only a minor contribution to the magnetic field dependence of the emission even in case of small barriers and strong QW coupling. The experimental results are supported by quantum-well calculations.

  7. La prensa y la dictadura franquista. De la censura al 'Parlamento de papel'

    OpenAIRE

    Diego González, Álvaro de

    2016-01-01

    Los periódicos que defendían durante la Segunda Guerra Mundial el nuevo orden europeo impuesto por la Alemania nazi y se congratulaban del "lazo espiritual" que anudaba al Caudillo Franco con Hitler, se deshacían en elogios ante la “democratización” (sic) anunciada por el presidente Arias a principios de 1974. Entre ambos extremos, de la censura y la consigna establecidas por la Ley de Prensa del 38 al "Parlamento de papel" auspiciado por la Ley Fraga del 66, se dirimió la evolución del rég...

  8. Manga - anime: Una expresión artística que subjetiva al Otaku

    OpenAIRE

    David Parada Morales

    2012-01-01

    En la actualidad Oriente comparte elementos propios de su saber cultural con Occidente que se reflejan en nuevas formas de subjetivar la realidad. En el presente artículo se expone al manga anime como expresión artística en su relación con la persona denominada Otaku y se desarrolla el concepto de subjetividad y cultural desde los aportes del Psicoanálisis. Las conclusiones apuntan al Otaku como un estandarte del encuentro entre Occidente y Oriente. Su gusto por los dibujos animados japone...

  9. EXTRUIDOS DE AlFe-PILC EN LA OXIDACIÓN CATALÍTICA DE FENOL

    OpenAIRE

    Nancy R. Sanabria; Molina, Rafael A.; Sonia Moreno

    2010-01-01

    Extruidos de AlFe-PILC con forma de cilindro compacto se emplearon como catalizadores en la reacción de oxidación de fenol en medio acuoso. Debido a que el proceso de elaboración de los extruidos con fase activa AlFe-PILC afecta la actividad intrínseca del catalizador, en este trabajo se determinaron la resistencia mecánica y la estabilidad química del catalizador conformado, así como las limitaciones difusionales por efecto de la aglomeración. Los extruidos se elaboraron con la proporción má...

  10. Poverty as covered in the election bulletins during the 7 June Elections7 Haziran Seçimleri’nde parti bildirgelerine yansıyan yoksulluk

    Directory of Open Access Journals (Sweden)

    Kaan Taşbaşı

    2016-04-01

     Bu çalışmada öncelikle yoksulluk tanımlamaları ele alınmış ve Türkiye'de yoksulluk meselesi özetlenmiştir. Daha sonra yoksulluk-medya ilişkisi açıklanmış, 7 Haziran Seçimleri'ne katılan ve Meclis'te grubu bulunan partilerin seçim bildirgelerinde yoksulluk meselesinin yer alış biçimi ve seçim bildirgelerinden günlük ulusal gazetelere (Hürriyet, Sabah, Cumhuriyet yansıyanlar incelenerek, iki veri kümesi arasında bağlantı kurulmaya çalışılmıştır.

  11. APROXIMACIÓN AL CONSTITUCIONALISMO POPULAR

    Directory of Open Access Journals (Sweden)

    Daniel Eduardo Florez Muñoz

    2012-04-01

    Full Text Available RESUMOEn el presente trabajo se expondrán las principales líneas de pensamiento de la corriente de pensamiento iusconstitucional norteamericana conocida como Popular Constitutionalism. Al interior de la cual se realiza un frontal cuestionamiento de las bases democráticas que presuntamente detentan las lecturas del constitucionalismo soportadas en la desconfianza hacia la intervención de pueblo como instancia de decisión política concreta. Palavras- chave: Constitución, Pueblo, Tribunal Constitucional, Control de Constitucionalidad. APPROACH TO POPULAR CONSTITUTIONALISM ABSTRACT In this paper we will present the main lines of thought school of thought known as American iusconstitucional Popular Constitutionalism. Inside the front which makes a questioning of the alleged hold democratic foundations of constitutionalism readings supported the suspicion of the involvement of people, as an actual politic decision. Key-words: Constitution, People, Constitutional Court, Judicial Review. SUMÁRIO1. Introducción 2. Los Orígenes: La clausura del universo político. 3. La Objeción Contramayoritaria. 4. En qué se reconoce el Constitucionalismo Popular? 5. Tipología del Constitucionalismo Popular.

  12. Camino al hogar inteligente

    Directory of Open Access Journals (Sweden)

    Ferreira Gili, Marco

    2004-12-01

    Full Text Available Today there are many projects related to intelligent houses such as Casa Internet, Madrid 2001 or its british equivalent in Watford, and most recently the Solar Decathlon´s project. Thanks to these proposals the domotic market gently opens to one day become what we could call as the intelligent “home”. Thought out the last few years, huge technological improvements have provided the buildings with brand new senses. However ,the idea of a comfortable home where the coffee maker would notice our awakening or the entrance door would suggest it’s closure after we leave, is still far away. A new path is opening in front of us, one that won’t end until all the necessary steps will be taken in the same direction, the merging of interfaces in the field of domotics.There are many domotic tendencies and possibilities discussed in this article, many options for one very same goal, control. Or even better, the capability of decision of tiny parts or hour home or office for a better and richer living experience.En la actualidad ya se conocen numerosos proyectos de casas inteligentes como Casa Internet en Madrid [1] o su homónimo británico en Watford [2] , y más actual el proyecto Solar Decathlon [3]. Gracias a estas propuestas, el mercado de la domótica, poco a poco, se abre paso para llegar a ser lo que un día podríamos llegar a llamar, el “hogar” inteligente. Si bien es cierto que en los últimos años el crecimiento y avances tecnológicos han dotado a los edificios de nuevos sentidos, queda lejos la visión de un confortable hogar donde la cafetera advierta nuestro despertar o la puerta de entrada sugiera su cierre tras nuestra marcha. Un camino por recorrer se abre ante nosotros, que no terminará hasta que todos los pasos se tomen en una misma dirección.Existen muchas tendencias y posibilidades domóticas que desgranaremos en este artículo. Múltiples opciones para un mismo fin. El control, o, mejor dicho, la

  13. Carta al director

    Directory of Open Access Journals (Sweden)

    Carlos Tulio Medeiros

    2016-01-01

    Full Text Available Vivimos hoy bajo el concepto de la Globalización, lo que significa vivir en una Sociedad en/de Redes, donde el conocimiento es antes de todo circulante, múltiple, multidisciplinar, híbrido, interconectado, es decir, se alimenta y bebe de todas las fuentes disponibles y cruza las fronteras, sean estas geográficas o de conocimiento. No hay más un sentido o sentimiento de identidad único, pero hay algo que en la literatura llamamos de “pertenencia”, ya que estar en una red o hacer parte de ella es sentir que perteneces a algo.

  14. Derivados vinculados al seguro.

    OpenAIRE

    De Paz Cobo, Sonia

    2003-01-01

    El presente trabajo tiene como objetivo la presentación de los derivados financieros como instrumentos de cobertura de los riesgos del seguro, así como de los principales proyectos que se desarrollan a través de los mismos, como por ejemplo los derivados sobre el clima. Hay que tener presente las pérdidas multimillonarias ocasionadas en casos como el de la banca Baring’s, o el de Orange County, por citar algunas, que si bien ciertos autores afirman que están en relación directa con el us...

  15. Del relato al contacto

    OpenAIRE

    Bernete García, Francisco

    2010-01-01

    La desatención (cuando no el desdén) a los relatos que enseñan, y su sustitución por los que muestran inme- diatamente lo que ocurre, pero cuyo sentido no se explica, posiblemente tenga como consecuencia que la sociabilidad de muchos individuos sea una cualidad construida sobre bases más débiles. En todo caso, lo que pretendo sostener en las páginas que siguen es que, así como puede rastrearse y escribirse más de una histo- ria sobre cómo van apareciendo narraciones con alta capacidad de ayud...

  16. Photocatalytic Hydrogen Generation by CdSe/CdS Nanoparticles.

    Science.gov (United States)

    Qiu, Fen; Han, Zhiji; Peterson, Jeffrey J; Odoi, Michael Y; Sowers, Kelly L; Krauss, Todd D

    2016-09-14

    The photocatalytic hydrogen (H2) production activity of various CdSe semiconductor nanoparticles was compared including CdSe and CdSe/CdS quantum dots (QDs), CdSe quantum rods (QRs), and CdSe/CdS dot-in-rods (DIRs). With equivalent photons absorbed, the H2 generation activity orders as CdSe QDs ≫ CdSe QRs > CdSe/CdS QDs > CdSe/CdS DIRs, which is surprisingly the opposite of the electron-hole separation efficiency. Calculations of photoexcited surface charge densities are positively correlated with the H2 production rate and suggest the size of the nanoparticle plays a critical role in determining the relative efficiency of H2 production. PMID:27478995

  17. Distribution of Se and its species in Myriophyllum spicatum and Ceratophyllum demersum growing in water containing Se (VI).

    Science.gov (United States)

    Mechora, Spela; Cuderman, Petra; Stibilj, Vekoslava; Germ, Mateja

    2011-09-01

    The uptake of Se (VI) by two aquatic plants, Myriophyllum spicatum L. and Ceratophyllum demersum L., and its effects on their physiological characteristics have been studied. Plants were cultivated outdoors under semi-controlled conditions and in two concentrations of Na selenate solution (20 μg Se L(-1) and 10 mg Se L(-1)). The higher dose of Se reduced the photochemical efficiency of PSII in both species, while the lower dose had no effect on PSII. Addition of Se had no effect on the amounts of chlorophyll a and b. The concentration of Se in plants grown in 10 mg Se L(-1), averaged 212 ± 12 μg Seg(-1) DM in M. spicatum (grown from 8-13 d), and 492 ± 85 μg Se g(-1) DM in C. demersum (grown for 31 d). Both species could take up a large amount of Se. The amount of soluble Se compounds in enzyme extracts ranged from 16% to 26% in control, and in high Se solution from 48% to 36% in M. spicatum and C. demersum, respectively. Se-species were determined using HPLC-ICP-MS. The main soluble species in both plants was selenate (∼37%), while SeMet and SeMeSeCys were detected at trace levels. PMID:21703659

  18. Purification and identification of Se-containing antioxidative peptides from enzymatic hydrolysates of Se-enriched brown rice protein.

    Science.gov (United States)

    Liu, Kunlun; Zhao, Yan; Chen, Fusheng; Fang, Yong

    2015-11-15

    As a further study of Se-containing proteins (Se-Pro) derived from Se-enriched brown rice (Se-BR), this paper aimed to purify and identify Se-containing antioxidative peptides (Se-antioxi-Peps) from Se-Pro hydrolysates. The total Se content in Se-BR was 6.26μg/g DW, and selenocystine, Se-methylselenocysteine, and selenomethionine were identified as the main organic Se species by high-performance liquid chromatography-inductively coupled plasma mass spectrometry. Se-Pro was extracted and hydrolyzed by four types of proteases, and Alcalase was chosen as the optimum enzyme according to the degree of hydrolysis (DH). The hydrolysate with 17.08% DH possessing the highest DPPH radical scavenging activity was separated into five fractions (F1 to F5). Fractions F3 to F5, which had high antioxidative activities, were further separated. Sub-fractions F3-3, F4-2, and F5-1 were chosen to evaluate antioxidative activities and analyze Se species. The Se-antioxi-Pep with the sequence SeMet-Pro-Ser was identified by electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry. PMID:25977046

  19. Does lipophilicity per se induce adjuvant effects?

    DEFF Research Database (Denmark)

    Hansen, Jitka Stilund; Larsen, Søren Thor; Poulsen, Lars K.;

    2007-01-01

    ) or on lung function parameters. Thus, MP did not possess irritant or inflammatory properties, which may be a precursive stimulus for adjuvant effects. Second, mice were exposed to aerosols of MP, 6 or 323 mg/m3, for 1 h followed by a 20-min low-dose ovalbumin (OVA) inhalation. OVA only and OVA + Al......Anthopogenically introduced substances and pollutants are suspected to promote sensitization and development of allergic airway diseases, that is, acting as adjuvants. Lipophilicity may serve as an immunological warning signal, promoting adjuvant effects. Whether the lipophilicity of an inhaled...... compound induces immunomodulatory effects was investigated in a murine inhalation model with the highly lipophilic methyl palmitate (MP) as model substance. First, studies of acute effects following a 1-h exposure of up to 348 mg/m3 MP showed no effects on cell composition in bronchoalveolar lavage (BAL...

  20. Não se preocupe, durma bem!

    OpenAIRE

    Soares, Catarina Alexandra Pereira

    2014-01-01

    Objectivo: Explorar as relações entre traços de personalidade, aspectos relacionados com o comportamento de sono-vigília, stresse, coping, humor/afecto, auto-percepção de saúde e perturbação do sono devido a preocupações, em estudantes universitários. Metodologia: Vários instrumentos de auto-resposta foram utilizados na recolha dos dados: Questionário do Sono-vigília (Azevedo, 2008); Escala de Sonolência de Epworth (Johns, 1991); activação pré-sono (Nicassio et al., 1985), Inventário de Pe...

  1. CdSe nanocrystals ingrained dielectric nanocomposites: synthesis and photoluminescence properties

    International Nuclear Information System (INIS)

    Cadmium selenide (CdSe) nanocrystals ingrained dielectric nanocomposites in a B2O3–SiO2–Al2O3–Na2O–K2O borosilicate glass system were synthesized by a single step in situ melt quenching technique. The sizes of the nanocrystals as well as the band gap of the nanocomposites were controlled by both concentration of CdSe and post thermal treatment duration. The nanocomposites were characterized by different instrumental techniques including detailed photoluminescence studies. The sizes of the CdSe nanocrystals were found to alter in the range 4–16 nm as estimated from the effective mass approximation model and optical absorption spectroscopy. However, the TEM analysis revealed the generation of two different size ranges, 3–4 and 23–45 nm, of the particles within the dielectric matrix. Selected area diffraction (SAED) and x-ray diffraction (XRD) patterns authenticate the formation of hexagonal nanostructures of CdSe. These nanocomposites were found to be capable of exhibiting strong visible red luminescence around 715 nm on excitation at 446 nm. This has originated from the electron–hole recombination of CdSe nanocrystal and defects or traps related transitions. The properties of these nanocomposites advocate their significant applications as semiconductor based luminescent materials. (paper)

  2. The Se sensitivity of metals under swift-heavy-ion irradiation: a transient thermal process

    International Nuclear Information System (INIS)

    In the framework of the thermal-spike model the present paper deals with the effect of the electronic stopping power (Se) in metals irradiated by swift heavy ions. Using the strength of the electron-phonon coupling g(z) with the number of valence electrons z as the unique free parameter, the increment of lattice temperature induced by swift-heavy-ion irradiation is calculated. Choosing z = 2, the calculated threshold of defect creation by Se for Ti, Zr, Co and Fe is about 11, 27.5, 28 and 41 keV nm-1, in good agreement with experiment. Taking the same z value, the calculation shows that Al, Cu, Nb and Ag are Se insensitive. Moreover, in Fe, the differences in the damage created by U ions of different energies but exhibiting the same value of Se may be interpreted by a velocity effect. These examples put the stress on the effect of the physical parameters governing the electron-phonon coupling constant apart from z determination: the sound velocity linked to the Debye temperature and the lattice thermal conductivity. Furthermore, a simple criterion is proposed in order to predict the Se sensitivity of metals. (author)

  3. Theory of zeolite supralattices: Se in zeolite Linde type A

    International Nuclear Information System (INIS)

    We study theoretically properties of Se clusters in zeolites, and choose zeolite Linde type A (LTA) as a prototype system. The geometries of free-space Se clusters are first determined, and we report the energetics and electronic and vibrational properties of these clusters. The work on clusters includes an investigation of the energetics of C3-C1 defect formation in Se rings and chains. The electronic properties of two Se crystalline polymorphs, trigonal Se and -monoclinic Se, are also determined. Electronic and vibrational properties of the zeolite LTA are investigated. Next we investigate the electronic and optical properties of ring-like Se clusters inside the large -cages of LTA. We find that Se clusters inside cages of silaceous LTA have very little interaction with the zeolite, and that the HOMO-LUMO gaps (HOMO standing for highest occupied molecular orbital and LUMO for lowest unoccupied molecular orbital) are nearly those of the isolated cluster. The HOMO-LUMO gaps of Se6, Se8, and Se12 are found to be similar, which makes it difficult to identify them experimentally by absorption spectroscopy. We find that the zeolite/Se8 nanocomposite is lower in energy than the two separated systems. We also investigate two types of infinite chain encapsulated in LTA. Finally, we carry out finite-temperature molecular dynamics simulations for an encapsulated Se12 cluster, which shows cluster melting and formation of nanoscale Se droplets in theα-cages of LTA. (author)

  4. Polimorfismo y divergencia en genes implicados en la resistencia al frío en "Drosophila".

    OpenAIRE

    Arboleda Bustos, Carlos Eduardo

    2008-01-01

    El objetivo principal de la tesis doctoral es analizar la evolución molecular de genes implicados en la tolerancia y aclimatación al frío en Drosophila, ya que estos genes son buenos candidatos de haber sufrido cambios adaptativos. Los genes elegidos fueron Frost(Fst) y Drosophila cold acclimation gene(Dca) que en D. melanogaster se sobreexpresan tras someter a los individuos a un estrés por frío. Posteriormente, el estudio se amplió al gen CG6296, que al igual que Fst codifica una proteína c...

  5. La orientación al mercado como estrategia competitiva de la organización

    OpenAIRE

    Rivera Camino, Jaime

    1999-01-01

    Considerando que la literatura sobre marketing y estrategia aún mantienen discrepancias sobre la definición de la orientación al mercado, el presente artículo expone un marco teórico para definir la orientación al mercado como una estrategia organizacional. El estudio se ha realizado en muestras representativas de dos países para analizar la identidad de la orientación al mercado en un contexto no estadounidense, En esta investigación también se ha validado la relación positiva en...

  6. Materiales de Al2O3 - MgAl2O4 - CaAl12O19 - Ca2Mg2Al28O46 obtenidos mediante un proceso de sinterización reactiva entre Al2O3 y CaMg(CO32

    Directory of Open Access Journals (Sweden)

    Pena, P.

    2002-08-01

    Full Text Available Taking into account the system Al2O3-MgO-CaO, refractory materials containing Al2O3-MgAl2O4-CaAl12O19-Ca2Mg2Al28O46 has been obtained by reaction-sintering of appropriate mixtures of Al2O3 and CaMg(CO32. The study of the mechanism of reaction was carried out by differential thermal analysis (DTA and thermogravimetry (TG, followed by dilatometric and xray diffraction (XRD studies. A static study of the reaction was performed at different temperatures. After each thermal treatment a XRD analysis of the phases present was made, as well as a microestructural study by scanning electron microscopy (SEM coupled with energy-dispersive spectroscopy (EDS. From the results obtained, and taking into account the free energy of formation of the different compounds, the mechanism of reaction was established.Utilizado la información suministrada por el diagrama de equilibrio de fases Al2O3-MgO-CaO se ha diseñado y obtenido un material de Al2O3-MgAl2O4-CaAl12O19-Ca2Mg2Al28O46 mediante sinterización reactiva de una mezcla de Al2O3 y CaMg(CO32. Las reacciones que tienen lugar en la mezcla durante el proceso se han estudiado usando técnicas de análisis térmico diferencial, termogravimetrico y dilatometría. Muestras reaccionadas a temperaturas seleccionadas se han estudiado por difracción de rayos X y microscopía electrónica de barrido con microanálisis mediante dispersión de energías. Los resultados obtenidos revelan que la reacción entre las materias primas tiene lugar en varias etapas con formación de fases transitorias, dando lugar a una microestructura final con granos aciculares de CaAl12O19 y partículas de la fase ternaria Ca2Mg2Al28O46 formadas en aquellos puntos en los que entran en contacto las fases de MgAl2O4 y CaAl12O19.

  7. Aspectos biopsicosociales asociados al embarazo adolescente

    Directory of Open Access Journals (Sweden)

    Regina Cogollo Jiménez

    2012-12-01

    Full Text Available Introducción: El embarazo en la adolescencia, es un evento inesperado, sorpresivo. Este artículo establece la importancia de identificar los aspectos biopsicosociales asociados al embarazo adolescente en las embarazadas asistentes al programa de Control Prenatal de una Empresa Social del Estado de nivel 1 en Montería en 2009, para comprender las actitudes y los comportamientos asociados a esta etapa tan temprana. Materiales y Métodos: Es un estudio descriptivo, cuantitativo, de corte transversal. Población y muestra: 30 adolescentes embarazadas asistentes al Programa, el muestreo por conveniencia. Se utilizó la encuesta y la observación directa, previa autorización del Director de la empresa. Resultados: Caracterización de la población: predominó la edad de 15 a 19 años (adolescencia tardía, uniones libres, baja escolaridad debido a la deserción escolar, ingreso económico menor al salario mínimo legal vigente. Aspectos Biológicos: la menarquía a temprana edad (9 a 14 años, y en ella la mitad de los embarazos. La mayoría de los segundos embarazos terminaron en parto, la minoría en cesárea y aborto. La captación para los controles prenatales fue tardía, algunas no cumplieron con las citas programadas. Aspectos Psicológicos: inestabilidad con la pareja al enterarse del embarazo, tuvieron soporte familiar moral y económico, abandonaron sus estudios y presentaron malestares como estrés, depresión y tristeza. Aspectos Sociales: predominó la convivencia con la familia extensa. Hubo aceptación en el colegio y en los amigos. Discusión y Conclusiones: Se plantean estrategias para disminuir estos aspectos: elaboración de una cartilla sobre “Cuidado de la adolescente embarazada”, creación de espacios de reflexión, jornadas lúdicas educativas, entre otros. (Rev Cuid 2012; 3(3:385-93.Palabras clave: Embarazo en Adolescencia, Bienestar Materno, Atención Prenatal. (Fuente: De

  8. Hexagonal CoSe formation in mechanical alloyed Co 75Se 25 mixture

    Science.gov (United States)

    Campos, C. E. M.; de Lima, J. C.; Grandi, T. A.; Machado, K. D.; Drago, V.; Pizani, P. S.

    2004-07-01

    A hexagonal CoSe alloy with NiAs-type structure was obtained by mechanical alloying starting from a mixture of pure crystalline powders with nominal composition Co 75Se 25. X-ray diffraction (XRD), differential scanning calorimetry (DSC), Mössbauer spectroscopy (MS) and Raman scattering (RS) techniques were used to follow the structural, thermal, magnetic and optical properties of the binary mixture as a function of milling time. XRD results show the formation of a nanometric hexagonal CoSe phase between 3 and 70 h of milling coexisting with non-reacted Co phases, also in nanometric scale. DSC and RS results showed some changes in the thermal and optical properties of the crystalline phases when the milling time increases. The Raman active modes of the CoSe and Co oxide phases were observed. MS results showed practically no iron in the samples milled up to 15 h, while for extended milling times (70 h), they showed the presence of some α-Fe and the formation of other iron alloys due to the contamination by the milling media.

  9. ofrece al mundo

    Directory of Open Access Journals (Sweden)

    Ana Reventós Gil de Biedma

    2007-01-01

    Full Text Available Barcelona es hoy una ciudad de referencia en el mapa turístico mundial. Ello ha sido fruto de un proceso de terciarización de su economía y de la construcción de una potente imagen de marca, desde los JJOO y hasta nuestros días. En este contexto, la cultura ha sido colocada en el eje de la estrategia global de desarrollo, tratando de construir un “espectáculo cultural” destinado a diferenciar a la ciudad en el mercado. Se promueven además unos iconos específicos, orientados a apoyar una visión catalana, cosmopolita y moderna, añadiéndoles además valores simbólicos como la diversidad, la tolerancia o la mediterraneidad. Para ello, se fomentan hasta la saciedad una serie de elementos patrimoniales, mientras otros quedan relegados e incluso escondidos. Barcelona aparece pues como el resultado de una planificación estratégica perfectamente orquestada desde el poder politico, y disimulada bajo la apariencia del consenso social y la participación ciudadana.

  10. Disordered La3Cu4.88Se7.

    Science.gov (United States)

    Gulay, L D; Daszkiewicz, M; Strok, O M; Pietraszko, A

    2011-03-01

    The crystal structure of copper(I) lanthanum selenide, La(3)Cu(4.88)Se(7), obtained from the La(2)Se(3)-Cu(2)Se quasi-binary system, has been investigated using X-ray single-crystal diffraction. The positions of the La and Se atoms are ordered and lie on mirror planes, whereas all positions for the Cu atoms are partially occupied. The crystal is built from edge-sharing [LaSe(6)] and [LaSe(7)] polyhedra. The five positions for the Cu atoms determine an ionic diffusion pathway in the structure. PMID:21368401

  11. Wallada Bint al Mustakfi entre dos culturas

    Directory of Open Access Journals (Sweden)

    shreen Mahmoud Al Refai

    2013-10-01

    Full Text Available La princesa cordobesa Wallada Bint al Mustakfi bil-lah, hija del califa al Mustakfi Muhammad Ibn Abdel Rahman Ibn Obaidil-lah Ibn Al Nasir lidin Al-lah era una poetisa estimable, a quien los grandes poetas no podían superar. Era una mujer única, guapa y decente. Mantenía una relación sentimental con el  poeta y visir Ibn Zaydún. Dicha pasión, narrada por los poemas escritos por ambos amantes, se terminó por la separación debida a los celos, también de ambos;  al poeta le gustó la voz de una esclava de la princesa. Eso dio rabia a la última. Movido también por los celos, Ibn Zaydún dedicó una epístola satírica al visir Ibn Abdús, que estaba enamorado de Wallada. Tal hecho también irritó a la princesa. A pesar de tener amantes y admiradores, Wallada murió sin casarse al  día 2 de safar de 480 (o 484 de la Híjira pasando los ochenta años Me han llamado la atención el carácter tan culto, independiente y liberal de aquella mujer, su relación amorosa con Ibn Zaydún que no acabó felizmente y los muchos años que vivió sin casasre. Parece que la vida de la princesa hispano-musulmana llamó también la atención de muchos escritores árabes y españoles. Prueba de ello son varias obras literarias escritas en árabe y en español sobre Wallada e Ibn Zaydún. Por consiguiente, me resulta muy interesante realizar un estudio comparativo sobre este tema averiguando si, o no, la diferencia de culturas influiría en las opiniones  de los autores sobre la vida sentimental de aquella poetisa cordobesa.

  12. AL-USRCRN Station Information

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Documentation of United States Alabama Regional Climate Reference Network (AL-USRCRN) installations in 2006. Installations documented are for AL-USRCRN pilot...

  13. Direct observation of a gap opening in topological interface states of MnSe/Bi2Se3 heterostructure

    International Nuclear Information System (INIS)

    High-quality MnSe(111) film was bilayer-by-bilayer grown epitaxially onto the Bi2Se3(111) surface using molecular beam epitaxy. Reversal scenario with quintuple layer-by-layer growth of Bi2Se3 onto the MnSe film was also realized. Angle-resolved photoemission spectroscopy measurements of Bi2Se3 capped with two bi-layers of MnSe revealed that an energy gap of about 90 meV appears at the Dirac point of the original Bi2Se3 surface, possibly due to breaking the time-reversal symmetry on the Bi2Se3 surface by magnetic proximity effect from MnSe

  14. Crystal structure of Sc1.91In1.39Mo15Se19, containing Mo6 and Mo9 clusters.

    Science.gov (United States)

    Gougeon, Patrick; Gall, Philippe; Salloum, Diala

    2015-07-01

    The structure of scandium indium penta-deca-molybdenum nona-deca-selenide, Sc1.91In1.39Mo15Se19, is isotypic with In2.9Mo15Se19 [Grüttner et al. (1979 ▸). Acta Cryst. B35, 285-292]. It is characterized by two cluster units Mo6Se (i) 8Se (a) 6 and Mo9Se (i) 11Se (a) 6 (where i represents inner and a apical atoms) that are present in a 1:1 ratio. The cluster units are centered at Wyckoff positions 2b and 2c and have point-group symmetry -3 and -6, respectively. The clusters are inter-connected through additional Mo-Se bonds. Sc-Se and In-Se bonds complete the structural set-up. In the title compound, the Sc(3+) cations replace the trivalent indium atoms present in In2.9Mo15Se19, and a deficiency is observed at the monovalent indium site. One Mo, one Se and the Sc atom are situated on mirror planes, whereas two other Se atoms and the In atom are situated on threefold rotation axes. PMID:26279861

  15. Dificultades en el aprendizaje de problemas que se modelan con ecuaciones lineales: El caso de estudiantes de octavo nivel de un colegio de Heredia

    OpenAIRE

    Gilberto Chavarría Arroyo

    2014-01-01

    Se presentan los resultados de una investigación, cuyo propósito fue analizar las dificultades de estudiantes de octavo año, al aprender el tema de resolución de problemas algebraicos modelados mediante ecuaciones lineales con una incógnita. Los protagonistas fueron estudiantes con bajo rendimiento en matemática de un colegio de Heredia. La investigación se desarrolló desde el paradigma naturalista y se utilizó el estudio de caso como método, mediante un enfoque cualitativo. Se aplicaron técn...

  16. Señalización de Ca2+intracelular en endotelio in situ de aorta de rata con diabetes mellitus tipo II

    OpenAIRE

    Paredes Juárez, Genaro Alberto

    2008-01-01

    La diabetes mellitus es la primera causa de muerte en nuestro país, debido a las alteraciones que provoca en la función y estructura de los vasos sanguíneos, aumentando el riesgo de hipertensión, infarto miocárdico y derrame cerebral. Las alteraciones vasculares se han correlacionado con disfunción endotelial. La señal de Ca2+ es un mecanismo clave en la función de las actividades endoteliales. A la fecha no se cuenta con información respecto a la señalización de Ca2+ en ...

  17. Chemical synthesis of Cu2Se nanoparticles at room temperature

    International Nuclear Information System (INIS)

    Graphical abstract: The Cu2Se nanoparticles were synthesized by a simple and rapid method at room temperature. The TEM and SEM images show that the Cu2Se nanoparticles were spherical. Highlights: ► Cu2Se nanoparticles were synthesized by the reaction of nanoSe0 sol with Cu+ ions. ► The Cu2Se nanoparticles were spherical with cubic structure and well crystallized. ► Optical and electrochemical properties of Cu2Se nanoparticles were observed. ► The formation mechanism of Cu2Se nanoparticles was proposed. -- Abstract: A simple and rapid method has been developed to synthesize cuprous selenide (Cu2Se) nanoparticles by the reaction of selenium nanoparticles sol with copper sulfate solution containing ascorbic acid at room temperature. Cu2Se nanoparticles were characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray diffraction (XRD), and energy dispersive X-ray analysis (EDX). The results indicated that Cu2Se nanoparticles were cubic crystal structure and spherical with the diameter about 75 nm. The ultraviolet–visible absorption spectrum (UV–vis) and cyclic voltammetry of Cu2Se nanoparticles were also investigated. The optical band gap energy of Cu2Se nanoparticles was 1.94 eV. On the basis of a series of experiments and characterizations, the formation mechanism of Cu2Se nanoparticles was discussed.

  18. Desarrollo de un aroma de mamey similar al natural.

    OpenAIRE

    Muñoz, Y. M.; Pino, J. A.; Ortega, A. G.; Montelongo, I.; Ronca, E.

    2008-01-01

    Se desarrolló un sabor de mamey similar al natural a partir de aromáticos químicos, para esto fueron aislados los compuestos volátiles de la fruta y analizados mediante GC y GC-MS. En total fueron identificados 24 compuestos volátiles en la fruta, destacándose como componentes mayoritarios el benzaldehído, hexanal y ácido hexadecanoico. Se desarrollaron 16 formulaciones, que fueron evaluadas sensorialmente, mediante prueba hedónica de calificación de la calidad, por 12...

  19. Evaluación de la tendencia al esfuerzo cognitivo

    OpenAIRE

    Gutiérrez Maldonado, José; Bajén García, María José; Sintas, Francisco; Amat, Maria

    1993-01-01

    Se analizan las características psicométricas de la Escala de Necesidad Cognitiva, traducida y adaptada al español a partir de la original en lengua inglesa de Petty y Cacioppo (1986). El constructo Necesidad de Cognición se requiere a una motivación intrínseca para implicarse y disfrutar con tareas que suponen esfuerzo cognitivo. La escala fue administrada a un total de 232 sujetos, obteniendo fiabilidad y validez aceptables y una estructura jactoriai que descubre cuatro dimensiones: anticip...

  20. Adaptación de pilotos al glass-cockpit

    OpenAIRE

    Sorin, Jacques

    2003-01-01

    Se presenta una propuesta de diseño de cabina de pilotaje de aviones cuyo objetivo es ayudar la adaptación de los pilotos al pilotaje de los aviones de pasajeros de tipo glass-cockpit. Se acompaña esta propuesta de una descripción de conjunto de la relación piloto-avión tal como evoluciona desde que el piloto aprende a pilotar la primera avioneta de escuela hasta que aborda los aviones de transporte de pasajeros. Esta descripción abarca elementos cognitivos y afectivo-emocionales de la relaci...

  1. Bioadhesión sobre Alúmina. Propiedades superficiales

    OpenAIRE

    Donoso, M.G.; González-Martín, M.L.; Gallardo Moreno, A.M.; Vilas, A. M.; Bruque, J.M.; González-Carrasco, J. L.

    2008-01-01

    La alúmina es uno de los materiales cerámicos de mayor relevancia en usos biomédicos. Así, este trabajo hace una completa caracterización de su superficie a través de propiedades que son de especial importancia en aquellos procesos de interacción con superficies biológicas como son células y microorganismos. Tensión superficial, potencial zeta y rugosidad superficial se analizan utilizando métodos diversos. La tensión superficial se muestra en torno a 35 mJ m-2 aunque los valores dependen en ...

  2. Reflexiones en torno al sonido y la música

    OpenAIRE

    Friedmann, Susana

    2014-01-01

    Para la gran mayoría de la gente, la omnipresencia del sonido no merece consideración especial; es aparentemente tan transparente al escrutiniocomo lo es el aire que lo conduce. Sólo se tiene en cuenta como un fin para la comunicación, para el lenguaje, y por si acaso, para la recreación. Sin embargo, sus actividades menos organizadas que el lenguaje y la música casi no se toman en cuenta, a pesar de que el ruido de las hojas, de la lluvia, y del contexto urbano son vitales para nuestro senti...

  3. Cuando alguien habla la maya, se nota que son pobres

    Directory of Open Access Journals (Sweden)

    Elizabeth Bellon Cárdenas

    2010-06-01

    Full Text Available En este trabajo se examinan las narrativas de identidad de los receptores culturalesde la radiodifusora indigenista “La Voz de los Mayas, Xepet”, respecto de su relacióncon la oferta radiofónica de esta emisora ubicada en la cabecera municipal de Peto,al sur de Yucatán, México. El propósito es, por un lado, sistematizar, desde el análisisargumentativo, el uso, estructura y estrategias argumentativas de los maya hablantesradioescuchas de Xepet (bilingües o monolingües en torno a la oferta cultural de lamisma, así como a la presencia cotidiana de esta emisora en su mundo de vida; y, porotro, reflexionar acerca de la radio indigenista en México como un recurso que podríacontribuir a la “cultura de paz”.“U chíikul u t’aan maayao’ob” o “La voz de los mayas”, salió al aire el 29 de noviembrede 1982, en la frecuencia de los 740 khz de AM y fue reubicada al 730 en enero de2001. Su área de cobertura abarca unos 100 km a la redonda, alcanzando cerca de milcomunidades de la península y parte de Quintana Roo, con una audiencia potencial de500 mil personas. Su programación incluye géneros musicales y no musicales, compuestosestos últimos por programas informativos, de difusión cultural, servicio e infantiles.Xepet ha sido una de las radiodifusoras pioneras del sistema indigenista promovido porel Estado mexicano desde 1979, modelo que habría de extenderse en las más de veinteemisoras que aparecieron después. Hoy en día, la crítica respecto de la función, contenidosy operación de estas emisoras “oficiales” o “voceras del Gobierno” permanence,debido a que tanto la práctica indigenista como su experiencia radiofónica parecieranestar rebasadas por las demandas de los pueblos indios que reivindican su derecho a lalibre determinación y a la autonomía, así como a la propiedad y gestión de sus propiosmedios de comunicación. Lo anterior reitera la necesidad de una propuesta radiofónicaque se constituya en

  4. Maltrato al anciano: "una realidad oculta en nuestra sociedad"

    Directory of Open Access Journals (Sweden)

    Rodríguez H. Shirley Catherine

    1996-06-01

    Full Text Available

    El maltrato al anciano es un hecho cotidiano, no reconocido socialmente como tal, por el contrario, el maltrato es considerado un cuento normal al que se ve expuesto un gran número de personas; que afecta el sistema familiar y a cada uno de sus miembros. Conscientes de la importancia del reconocimiento, identificación, manejo oportuno y adecuado y la intervención que enfermería realice en la situación del maltrato al anciano, se podrá forjar un camino hacia el cambio. La concepción de envejecimiento que tiene la sociedad favorece el maltrato al anciano, situación tan común como el maltrato de esposas y niños. Sumado a ello, los casos de maltrato al anciano son poco reconocidos y denunciados; las situaciones que evidencian el maltrato son negadas o justificadas por la familia, lo cual dificulta el reconocimiento de este hecho.


  5. Study of crystal structure of ternary compounds CuIn3Se5 and CuIn5Se8

    International Nuclear Information System (INIS)

    The structures of monocrystals of CuIn3Se5 and CuIn5Se8 ternary compounds have been studied by X-ray diffraction for the first time. The lattice parameters of CuIn3Se5 and CuIn5Se8 crystals are determined. It is established that CuIn3Se5 has a thiogallate lattice with c = 2a, which leads to the domain structure formation. CuIn5Se8 has a hexagonal lattice and exhibits cleavage along the (001) plane. The interrelation between the atomic composition and crystal structure of these new ternary semiconductor compounds is discussed

  6. Hiperalgesia asociada al tratamiento con opioides

    Directory of Open Access Journals (Sweden)

    A. Gil Martín

    2014-10-01

    opioide o la asociación al tratamiento de otro tipo de analgésico. Otras opciones son los antagonistas del receptor NMDA o la terapia combinada con los inhibidores de la COX-2. En el presente trabajo se revisan los avances recientes en el conocimiento de los mecanismos subyacentes que la producen, los estudios clínicos realizados así como las diferentes estrategias de tratamiento disponibles.

  7. Li2Se:Te as a neutron scintillator

    International Nuclear Information System (INIS)

    We show that Li2Se:Te is a potential neutron scintillator material based on density functional calculations. Li2Se exhibits a number of properties favorable for efficient neutron detection, such as a high Li concentration for neutron absorption, a small effective atomic mass and a low density for reduced sensitivity to background gamma rays, and a small band gap for a high light yield. Our calculations show that Te doping should lead to the formation of deep acceptor complex VLi–TeSe, which can facilitate efficient light emission, similar to the emission activation in Te doped ZnSe. - Highlights: • Te doped Li2Se is proposed as a promising neutron scintillator based on density functional calculations. • Li2Se has a high Li concentration, a low density, and a small band gap, favorable for neutron detection. • Li2Se can be activated by VLi–TeSe

  8. ASPECTOS AMBIENTALES EN LA EXPERIMENTACIÓN QUÍMICA PARA PREVENIR RIESGOS A LA SALUD Y AL AMBIENTE

    OpenAIRE

    María O. Peña O.; Esperanza González Q.; Walter Ramírez M.; Sergio A. Franco Ch.

    2011-01-01

    Un aspecto ambiental se considera como cualquier material o elemento físico o químico que el hombre arroja al agua, al aire y al suelo o que interactúe con el ambiente y propicie un riesgo para la salud y para el medio ambiente. Los residuos originados durante el desarrollo de actividades relacionadas con la experimentación química, aunque en una proporción menor que en un proceso industrial, ellos pueden ser residuos peligrosos al medio ambiente. Los aspectos ambientales se asocian con las a...

  9. Expression and crystallization of SeDsbA, SeDsbL and SeSrgA from Salmonella enterica serovar Typhimurium

    International Nuclear Information System (INIS)

    The cloning, purification, crystallization and preliminary crystallographic studies of three DsbA-like proteins present in S. enterica serovar Typhimurium, SeDsbA, SeDsbL and SeSrgA, are reported. Pathogens require protein-folding enzymes to produce functional virulence determinants. These foldases include the Dsb family of proteins, which catalyze oxidative folding in bacteria. Bacterial disulfide catalytic processes have been well characterized in Escherichia coli K-12 and these mechanisms have been extrapolated to other organisms. However, recent research indicates that the K-12 complement of Dsb proteins is not common to all bacteria. Importantly, many pathogenic bacteria have an extended arsenal of Dsb catalysts that is linked to their virulence. To help to elucidate the process of oxidative folding in pathogens containing a wide repertoire of Dsb proteins, Salmonella enterica serovar Typhimurium has been focused on. This Gram-negative bacterium contains three DsbA proteins: SeDsbA, SeDsbL and SeSrgA. Here, the expression, purification, crystallization and preliminary diffraction analysis of these three proteins are reported. SeDsbA, SeDsbL and SeSrgA crystals diffracted to resolution limits of 1.55, 1.57 and 2.6 Å and belonged to space groups P21, P21212 and C2, respectively

  10. Efficiency enhancement of Sb2Se3 thin-film solar cells by the co-evaporation of Se and Sb2Se3

    Science.gov (United States)

    Li, Zhiqiang; Zhu, Hongbing; Guo, Yuting; Niu, Xiaona; Chen, Xu; Zhang, Chong; Zhang, Wen; Liang, Xiaoyang; Zhou, Dong; Chen, Jingwei; Mai, Yaohua

    2016-05-01

    In this work, we present an alternative route to supply excessive selenium (Se) for the deposition of Sb2Se3 thin films by the co-evaporation of Se and Sb2Se3. Scanning electron microscopy (SEM) images showed that additional Se modified the growth process and surface morphology of Sb2Se3 thin films. X-ray diffraction (XRD) patterns confirmed that this co-evaporation process enhanced the beneficiary preferred orientations, and capacitance–voltage (C–V) measurement showed that the carrier concentration of the Sb2Se3 absorber increased with the additional evaporation of Se. Accordingly, the efficiency of the devices employing co-evaporated Sb2Se3 absorber layers increased significantly from 2.1 to 3.47% with a open-circuit voltage (V OC) of 364 mV, a short-circuit current density (J SC) of 23.14 mA/cm2, and a fill factor (FF) of 41.26%.

  11. Alergia al espárrago Allergy to the asparagus

    OpenAIRE

    A.I. Tabar; M.J. Álvarez; E. Celay; López, R; Esteban, B; Gómez, B.

    2003-01-01

    El espárrago (Asparagus officinalis), ampliamente cultivado a escala mundial, forma parte, junto con el ajo, la cebolla y el puerro de la familia de Liliáceas. Se ha descrito hipersensibilidad al espárrago en forma de reacciones retardadas mediadas por células, y de reacciones inmediatas mediadas por IgE. Mientras que las primeras (dermatitis alérgica de contacto) son una causa relativamente frecuente de patología ocupacional, la literatura sólo muestra casos puntuales de alergia IgE mediada....

  12. Evolución: de la especie humana al cyborg

    OpenAIRE

    Francesc Mestres

    2011-01-01

    Resumen: Gracias a la evolución biológica y cultural el ser humano ha sido capaz de adaptarse al ambiente. Una opción para mejorar las prestaciones humanas podría ser la obtención de un cyborg o ser humano biónico en el cual la parte inorgánica fuese un chip computacional conectado directamente al cerebro. Esta y otras posibilidades se debaten en el presente artículo. Palabras clave: Evolución biológica, selección natural, evolución cultural, cyborg, biónico, inteligencia.

  13. Del uno de la forma al eros del ser.

    OpenAIRE

    Jorge Ivan Zapata.

    1999-01-01

    La dínamis erótica, se aborda en esta ocasión a luz del magistral texto de Freud "La negación". Parménides, en su demostración de lo uno en sí, aporta al planteamiento posible de una erótica, como aquella alteridad que mueve al sujeto a perseverar en su ser, una vía a la reflexión psicoanalítica sobre el tema.

  14. El acceso al agua para consumo humano en Colombia

    OpenAIRE

    Martha Yánez Contreras; Karina Acevedo González

    2013-01-01

    El acceso al agua es un derecho humano que se debe garantizar sin ninguna discriminación. Este artículo examina la existencia de inequidades en el ejercicio de este derecho mediante un análisis discriminante que identifica los factores que explican las diferencias en la calidad del agua para consumo humano entre los municipios colombianos en 2009. Los resultados indican que existen inequidades en el acceso al agua potable. En particular, los municipios más pobres registran los niveles de cali...

  15. Lo siniestro, el pasaje al acto y el acting out

    OpenAIRE

    Barberis, Osmar

    2007-01-01

    El seminario que Lacan dedica a la angustia se ha convertido para los analistas, en una importante referencia en lo que a los conceptos de pasaje al acto y acting out respecta. Sabemos que no es la primera vez que estos términos han sido nombrados, pero sí consideramos que en El Seminario 10, hay un importante esfuerzo de formalización que hace de ellos, referencias ineludibles de la clínica psicoanalítica. Intentaremos ubicar y desarrollar las relaciones entre la angustia, el pasaje al...

  16. La señalización como determinante de la satisfacción del turista español en un territorio: el caso de Quintana Roo

    OpenAIRE

    Rafael Fabricio Matos Cámara; Alfredo Jiménez Palmero; Martha Verónica Ocampo Franco; Mariana Recio López

    2014-01-01

    Se investiga la satisfacción experimentada por el turista que es determinada por las señales que los diferentes agentes en un territorio envían al mercado. Se utiliza el método de ecuaciones estructurales. Los resultados obtenidos muestran que la reputación, el precio, la calidad percibida, los activos específicos y la preservación del medioambiente son determinantes de la satisfacción; al contrario que la publicidad, la cual no ha sido corroborada. Se comentan las implicaciones profesionales...

  17. Optical band gap study of a-Se and Se-Sb thin films

    Science.gov (United States)

    Kaur, Ramandeep; Singh, Palwinder; Thakur, Anup

    2016-05-01

    Amorphous selenium (a-Se) and a-Se95Sb5 alloy were prepared using melt quenching technique. X-ray diffraction (XRD) pattern confirmed the amorphous nature of the prepared samples. Composition of the prepared samples has been determined using Energy dispersive X-ray fluorescence (EDXRF) technique. Differential thermal analysis (DTA) confirmed the glassy nature of the prepared samples. Thin films of the prepared samples were deposited on glass substrate using thermal evaporation method. Amorphous nature of the deposited films was confirmed using XRD. Optical properties of these films were obtained from the UV-VIS transmission spectra, at normal incidence, over 200-1100 nm spectral range. The optical absorption edge was described by using the model given by the Tauc. Optical band gap of the deposited films was calculated using Tauc plot. Optical characterization showed that average transmission and optical band gap decreased with the addition of antinomy.

  18. SE-72/AS-72 generator system based on Se extraction/ As reextraction

    Energy Technology Data Exchange (ETDEWEB)

    Fassbender, Michael Ernst; Ballard, Beau D

    2013-09-10

    The preparation of a .sup.72Se/.sup.72As radioisotope generator involves forming an acidic aqueous solution of an irradiated alkali bromide target such as a NaBr target, oxidizing soluble bromide in the solution to elemental bromine, removing the elemental bromine, evaporating the resulting solution to a residue, removing hydrogen chloride from the residue, forming an acidic aqueous solution of the residue, adding a chelator that selectively forms a chelation complex with selenium, and extracting the chelation complex from the acidic aqueous solution into an organic phase. As the .sup.72Se generates .sup.72As in the organic phase, the .sup.72As may be extracted repeatedly from the organic phase with an aqueous acid solution.

  19. 21 CFR 118.4 - Salmonella Enteritidis (SE) prevention measures.

    Science.gov (United States)

    2010-04-01

    ... National Poultry Improvement Plan's standards for “U.S. S. Enteritidis Clean” status (9 CFR 145.23(d)) or... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Salmonella Enteritidis (SE) prevention measures....4 Salmonella Enteritidis (SE) prevention measures. You must follow the SE prevention measures...

  20. Calculation of half-life for 79Se decay

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The half-life for 79Se decay is calculated by using the Logf1ut systematics method. Based on the data analysis and comparison with experimental data the 79Se half-life is recommended. The scheme for 79Se decay is also shown and the radiation data are calculated in the text.