WorldWideScience

Sample records for agua salina procedente

  1. a considerar. I. Aguas salinas o alcalinas

    Directory of Open Access Journals (Sweden)

    Fernando Ortega Sastriques

    2007-01-01

    Full Text Available El precio del agua potable es elevado y en muchas ciudades su disponibilidad está limitada y disminuirá en el futuro. La agricultura urbana es una concurrente en el uso del agua. En el futuro es muy probable que haya fuertes limitaciones para el riego con agua potable. Así es que para la producción de vegetales en medio urbano será necesario el empleo de agua de fuentes alternativas y no de los acueductos. La extracción de agua del manto freático para el riego es una práctica común que se incrementará en el futuro previsible. Casi todas las grandes urbes de Cuba tienen costas, es frecuente que los acuíferos subterráneos de estas ciudades presenten algún contenido de fácil solubilidad; o bien en otras ciudades interiores el agua puede ser alcalina. El riego con estos tipos de agua deprimen los rendimientos y pueden dañar los suelos y substratos. En este artículo se explican los aspectos que deben considerarse para poder emplear esta agua con seguridad.

  2. Calidad de las aguas de drenaje de procedentes de campos arroceros sobre suelos salinos en la Cuenca del Cauto

    Directory of Open Access Journals (Sweden)

    Julián Herrera Puebla

    2009-01-01

    Full Text Available La calidad química del agua de drenaje procedente de áreas sembradas con arroz en suelos salinos y beneficiada para su recuperación con drenaje sub superficial en la zona de Vado del Yeso en la Provincia de Granma, fue estudiada a través de las observaciones de 6 años sobre la composición salina y la descarga de aguas de drenaje. Se encontró una relación estrecha entre la salinidad del agua de drenaje y la salinidad del suelo de donde ellas provienen (R2=0.89; la concentración de sales en las aguas de drenaje, superó en más de diez veces la concentración de las aguas de drenaje superficial y a las de riego, las cuales presentan a su vez muy poca diferencia; entre el volumen de agua drenada y la Ce de la misma se encontró una relación potencial que permite a través de las variaciones en los gastos explicar alrededor del 57% de las variaciones en los tenores salinos del agua. De este modo, aun para los gastos máximos alcanzados en los drenajes, que corresponden generalmente a la época de lluvias (mayores de 0,2 lps, el agua tiene valores de conductividad eléctrica (Ce superiores a 2 dS/m, el cual es considerado como valor critico para su uso en el riego del arroz. A partir de estos resultados se analiza la capacidad contaminante de esta agua y la necesidad de un monitoreo continuo donde se incluya otros elementos.

  3. El Agua Salina y los Métodos de Riego

    Directory of Open Access Journals (Sweden)

    Bustamante Betancur Fabio

    1985-12-01

    Full Text Available La selección del método más adecuado de riego está notoriamente influenciado por las condiciones de salinidad que pueda haber en el suelo o en el agua que se usará para el riego. El objetivo principal del riego es el de abastecer el suelo con agua para que ella sea fácilmente disponible a los cultivos que en él se desarrollan o crecen. Bajo condiciones normales el método de riego que mejor se adapta, depende del cultivo, la topografía, las características del suelo y la disponibilidad del agua. Las condiciones de salinidad y sodicidad presentes en el suelo, están influenciadas por la concentración local de sales; la aplicación del riego, es una de las causas de la migración de sales y puede influenciar notoriamente el efecto salino del agua que con una determinada calidad sea aplicada.

  4. La electrolisis salina para el tratamiento de aguas de lastre

    OpenAIRE

    2014-01-01

    El objetivo principal del proyecto, es el desarrollo de equipos electrolíticos para el tratamiento de aguas de lastre, acorde con los requerimientos de la normativa, y los del sector. Para ello, los objetivos específicos, son:  Definición de los requerimientos de la tecnología, teniendo en consideración todas las normativas navales que afecten al proyecto.  Definición de los requerimientos de la tecnología, teniendo en consideración todas las especificaciones técnicas y comerciales qu...

  5. Salinas :

    Energy Technology Data Exchange (ETDEWEB)

    Reese, Garth M.; Walsh, Timothy; Bhardwaj, Manoj K.

    2009-02-01

    Salinas provides a massively parallel implementation of structural dynamics nite element analysis, required for high delity, validated models used in modal, vibration, static and shock analysis of structural systems. This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas , we refer the reader to Salinas, Users Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are speci c to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programmer notes manual, the user's notes and of course the material in the open literature.

  6. Crecimiento y distribución iónica en nueve accesiones de aguacate regadas con agua salina.

    OpenAIRE

    2011-01-01

    El presente estudio se realizó para conocer la respuesta en crecimiento y distribución iónica de nueve accesiones de aguacate, al estrés provocado por el riego con agua salina. Plantas originadas de semilla de las accesiones: Tochimilco S2, Criollo 38, Tepetl, Aquila S1, 257 PTB todas ellas de la raza Mexicana (var. drymifolia), Navideño y un Segregante de Hunucma de la raza Antillana (var. americana), Fuerte negro (Guatemalteco x Mexicano) y Persea nubigena 1/7 (Persea nubigena Will.), fuer...

  7. Dinámica de la interfase salina y calidad del agua en la costa nororiental de Yucatán

    OpenAIRE

    Eduardo Graniel C.; Irany Vera M.; Luis González Hita

    2004-01-01

    El desarrollo poblacional, turístico y agrícola han incrementado la extracción de agua subterránea para cubrir las demandas en Yucatán, México, por lo que la dinámica del acuífero costero está influenciada por estas extracciones, originando así la variación de la interfase agua dulce-agua salada. El estudio de la variación temporal de la interfase salina se llevó a cabo basándose en perfiles de calidad de agua, recolección de muestras de agua, medición de la superficie piezométrica y la deter...

  8. Optimización de la auto-biorremediación de aguas residuales procedentes de la industria del corcho.

    OpenAIRE

    Paredes Páliz, Karina

    2012-01-01

    Los compuestos fenólicos requieren una relevante atención en el estudio de la contaminación del ambiente, debido a su toxicidad y prevalencia en agua y suelo. En la naturaleza, estos contaminantes se generan por procesos de humificación y degradación de proteínas. Su incremento ambiental se ve reflejado por la quema de bosques (Morrison, 35698).

  9. Estudio de la mineralización en el suelo del nitrógeno de lodos procedentes de plantas depuradoras de aguas residuales

    OpenAIRE

    Garau, Ma. Antònia

    1983-01-01

    [spa] El incremento constante del consumo de agua potable hace necesaria la construcción de nuevas plantas depuradoras de aguas residuales; éstas, además de devolver a la naturaleza un producto más fácilmente reciclable, contribuyen a disminuir la contaminación del medio ambiente resultante de las actividades humanas. Como consecuencia se presenta el problema de eliminar el subproducto del proceso depurador, es decir, el lodo residual. El término “lodo residual” incluye una gran variedad ...

  10. La fotodegradación de contaminantes orgánicos presentes en aguas procedentes de escombreras de carbón.

    OpenAIRE

    Torres Pérez-Hidalgo, Trinidad José de

    2006-01-01

    La producción de los estériles de carbón en España rondó, durante la década de los 80, los 5 millo nes de toneladas. La mayor parte de estos estériles se han almacenado en escombreras, lo que plantea importantes problemas tanto desde el punto de vista económico (costes de almacenamiento y ocupa- ción de terrenos) como desde el medioambiental (alteración del paisaje y contaminación). La calidad del agua a largo plazo continúa siendo la causa de mayor preocupación en la minería del ...

  11. Análisis de residuos de herbicidas en aguas procedentes de Navarra mediante lc-ms/ms LC-MS/MS analysis of herbicide residues in waters from Navarre

    Directory of Open Access Journals (Sweden)

    P. Fraile

    2009-12-01

    Full Text Available Fundamento. El objetivo del trabajo fue obtener información acerca de los residuos de herbicidas (imazametabenz, simazina, isoproturon, clortoluron, metribuzina, atrazina, cianazina, terbutrina, propanil, terbutilazina, alacloro y pendimetalina presentes en aguas procedentes de Navarra. Material y métodos. Se tomó un total de 465 muestras de agua; de ellas, 378 se obtuvieron en 141 abastecimientos; las 87 restantes procedieron de 37 fuentes, manantiales y sondeos situados en zonas agrícolas del sur de Navarra. La técnica empleada fue LC-MS/MS. Resultados. Se detectaron residuos de herbicidas en el 33% de los abastecimientos, y su concentración superó el límite normativo en el 8% de ellos. Se encontraron residuos de herbicidas en el 86% de las muestras de pozos y fuentes de zonas agrícolas del sur de Navarra. El número de abastecimientos con residuos de herbicidas aumentó de norte a sur de Navarra. No obstante, el porcentaje de abastecimientos en los que la concentración de herbicidas superó los límites fue mayor en la zona centro de Navarra que en la zona sur y norte. Imazametabenz fue el herbicida más detectado en las muestras de las zonas norte, centro y sur. Atrazina, terbutilazina e imazametabenz se detectaron preferentemente en las muestras de la zona sur. Conclusiones. Las diferencias entre las tres zonas de Navarra pueden explicarse atendiendo a las diferentes prácticas agrícolas de cada región. No se detectaron concentraciones de herbicidas superiores a los límites normativos en ninguna de las muestras de agua procedentes de las poblaciones mayoritarias de Navarra.Background. The aim of the study was to obtain information on the residues of herbicides (imazametabenz, simazine, isoproturon, clortoluron, metribuzine, atrazine, cianazine, terbutrin, propanil, terbutilazine, alachlor and pendimetalin present in water proceeding from Navarre. Material and methods. A total of 465 samples of water were taken: 378 were taken

  12. de Salinas

    Directory of Open Access Journals (Sweden)

    Ma. Dolores París

    2003-01-01

    Full Text Available A diferencia de otros pueblos indígenas de Oaxaca como los mixtecos o los zapotecos que tienen una larga tradición migratoria en Estados Unidos, la migración de los triquis puede considerarse como un nuevo grupo migratorio. Por ejemplo, la mayoría de las familias asentadas en el Valle de Salinas, situado en la costa central de California, llegaron hace menos de cinco años. En otros lugares, como en los valles centrales o en las ciudades del sur (San Diego y Los Ángeles vivían unos pocos hombres triquis hacia los años ochenta. Algunos de esos contados pioneros lograron regularizar su situación migratoria a fines de esa misma década; muchos hombres y la enorme mayoría de las mujeres triquis que viven en California son indocumentados.

  13. Crecimiento e intensidad de necrosis de nueve accesiones de aguacate a condiciones de riego con agua salina Growth and intensity of necrosis in nine accessions of avocado under conditions of irrigation with saline water

    Directory of Open Access Journals (Sweden)

    Rafael Rojas-Rojas

    Full Text Available El riego con agua salinaes una de las principales formas de salinización de los suelos, al aumentar la concentración de sales en el suelo, se incrementa su absorción lo que reduce el crecimiento vegetativo y necrosis en plantas sensibles como el aguacate. El objetivo del trabajo fue estudiar la respuesta en crecimiento e intensidad de necrosis foliar en segregantes de nueve accesiones de aguacate pertenecientes a las razas antillana (2 y mexicana (5, un híbrido (guatemalteco x mexicano y de Persea nubigena 1/7 (1, este es un hibrido de P. nubigena original. Plantas de un año de edad fueron trasplantadas y crecieron en una cama de siembra con suelo franco arenoso, de noviembre de 2009 a junio de 2010 en un invernadero en Chapingo, Estado de México. Se utilizó un diseño experimental completamente al azar con 9 tratamientos y 15 repeticiones. El agua de riego fue con solución Steiner 25% más NaCl, la CE de 3 dS m-1 y un pH de 5.5. La intensidad de necrosis en la hoja se usó para determinar el porcentaje de individuos con necrosis foliar. Las plantas de la accesión Navideño presentaron mejor respuesta en incremento acumulado de altura (22.86 cm, número de hojas (27.93, incremento de diámetro en tallo (1.00 mm y bajo porcentaje de plantas con necrosis severa (37%. Fuerte negro mostró respuesta moderada en incremento de diámetro del tallo (0.5 mm y acumulado de altura (12.62 cm, número de hojas (22.66 pero tuvo un alto porcentaje de individuos con necrosis severa (64%; contrario a lo observado en segregantes de Hunucma (35%.The irrigation with saline waters is one of the principal forms of salinization of soils; upon increasing the concentration of salts in the soil, the soil absorption also increases, which reduces the vegetative growth and produces necrosis in sensitive plants like the avocado. The objective of this research was to study the response of growth and the intensity of foliar necrosis in nine avocado accessions

  14. Application of urban waste water sludge in revegetation of sanitary landfills; Aplicacion de lodos de depuradora procedentes de aguas residuales urbanas en la revegetacion de vertederos de RSU (II)

    Energy Technology Data Exchange (ETDEWEB)

    Ingelmo Sanchez, F.; Garcia Camarero, J.; Morenilla Martinez, J. J.; Bernacer Bonora, I.; Herrero Chamorro, O.; Amores Blasco, S.

    2000-07-01

    The use of forest soil for re vegetating sealed urban landfills is a practice leading to economic and environmental problems. Recently, it has been demonstrated a suitable technique for minimizing soil needs in the re-vegetation of a closed urban landfill which, the layer of fertile soil usually added for plants to settle and develop in such degraded substrate is replaced by a layer of the degraded soil amended with urban anaerobic sewage sludges. In this work we expose the firsts results of a pilot project for the re-vegetation with this procedure of a closed landfill of municipal solid wastes managed by the company Gestion Integral de Residuos in a collaborative research among the Centro de Investigaciones sobre Desertificacion, the Entidad Publica de Saneamiento de Aguas Residuales de la Comunidad Valenciana and the company Depuracion de Aguas del Mediterraneo. The closed landfill has a surface of 2,6 ha and its re-vegetation will be carried out by introducing native plants (annuals, busch and trees) after incorporation into the degraded soil of the anaerobic sewage sludge at the single dose of 60 tn/ha. (Author) 3 refs.

  15. The use of sewage sludges from waste water treatment plants for re-vegetation of sanitary landfills; Aplicacion de lodos de depuradora procedentes de aguas residuales urbanas en la revegetacion de vertederos de RSU

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez, F. I.; Camarero, J. G.; Morenilla Martinez, J. J.; Bernacer Bonora, I.; Herrero Chamorro, O.; Amores Blasco, S.; Fernandez, C.; Codoner, M. A.

    1999-08-01

    The use of forest soil for re vegetating sealed urban landfills is a practice leading to economic and environmental problems. Recently, it has been demonstrated a suitable technique for minimizing soil needs in re-vegetation of closed urban landfill in which, the layer of fertile soil usually added for plants to settle and develop in such degraded substrate is replaced by a layer of the degraded soil amended with anaerobic sewage sludge. In this work we expose the phases and the design for the implementation of a pilot project for the re-vegetation with this procedure of a closed landfill of municipal solid wastes managed by GIRSA, in a collaborative research between CIDE (CSIC-UVEG-GV), Entidad Publica de Saneamiento de Aguas Residuales de la Comunidad Valenciana and DAM, S.L. The closed landfill has a surface of 2,6 ha and its re-vegetation will be carried out by introducing native plants (annuals, bush and trees) after incorporation into the degrades soil of the anaerobic sewage sludge at the single dose of 60 tn/ha. Twelve plots of 20 m by 8 m will be employed to a quarterly research of the effects on the soil and on the introduced vegetation of three doses (0,60, 120 tn/ha) of the anaerobic sewage sludge. (Author) 17 refs.

  16. Salinas : theory manual.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas , we refer the reader to Salinas, User's Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are specific to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programer-notes manual, the user's notes and of course the material in the open literature.

  17. Salinas : theory manual.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2011-11-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis, required for high fidelity, validated models used in modal, vibration, static and shock analysis of structural systems. This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas, we refer the reader to Salinas, User's Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are specific to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programmer notes manual, the user's notes and of course the material in the open literature.

  18. Resiliencia a la degradación salina y sódica de algunos suelos pampeanos, regados complementariamente con aguas subterráneas bicarbonatadas sódicas

    OpenAIRE

    Génova, Leopoldo Julio

    2007-01-01

    La hipótesis planteada fue la siguiente: en la región pampeana húmeda, los suelos regados complementariamente con aguas bicarbonatadas sódicas, modifican su composición química, pero dicha degradación es variable y alcanza niveles umbrales de resiliencia edáfica, dada por la interrelación de procesos de recuperación físicos, químicos y biológicos, que determina el mantenimiento de la calidad del suelo y con ello, la sustentabilidad del sistema de manejo agronómico bajo riego. Con este enfoque...

  19. Radiactividad en aguas de consumo

    Directory of Open Access Journals (Sweden)

    José Luis Gutiérrez-Villanueva

    2011-12-01

    Full Text Available La directiva europea sobre calidad en el agua potable del año 2003 estableció los límites para los valores de los parámetros radiactivos. Esta directiva europea fue incorporada a la legislación 2003. Los parámetros a analizar son los índices alfa y beta total, el contenido en tritio y la dosis indicativa total. El correspondiente real decreto, en el caso de España, se comenzó a aplicar en el año 2008. No solamente el agua potable procedente de captaciones públicas está sujeta a control, sino que también se deben controlar las aguas comerciales. En ambos casos se han llevado a cabo estudios en todo el mundo. Existe un rango amplio de técnicas para la medida de la radiactividad en el agua de consumo. Este artículo describe tales técnicas e indica cuando se debe aplicar cada una de ellas. Por último, se muestran los resultados más importantes obtenidos tras el análisis de aguas potables y comerciales, tanto en aguas españolas como de fuera de España. Los resultados muestran que se superan los límites en algunos casos y por lo tanto se debe prestar especial atención a fin de reducir los niveles de radiactividad en las aguas potables todo lo posible.

  20. Agua(s) remisión de V. nivelador de (las) agua(s).

    OpenAIRE

    2011-01-01

    [ES] Definición del término Agua(s) remisión de V. nivelador de (las) agua(s). en el diccionario Dicter. [EN] Definition of the word Agua(s) remisión de V. nivelador de (las) agua(s). in the dictionary Dicter.

  1. TÓXICIDAD DE LA APITOXINA EN UN MODELO DE Artemia salina

    OpenAIRE

    Juan Manuel Pérez Agudelo; Juan Felipe Salazar Espinosa; Jorge Hernán Hernández Guevara

    2015-01-01

    Objetivo:Determinar la toxicidad del extracto acuoso de Apitoxina mediante bioprospección en el modelo de Artemia salina. Materiales y métodos: Previo montaje de Biorreactor, un grupo fue expuesto al extracto acuoso de Apitoxina (n=20) y el grupo control fue expuesto a agua destilada (n=20) la toxicidad se definió por la muerte de la Artemia salina a las 24 horas de administración del extracto. Se realizó análisis estadístico no paramétrico mediante la prueba de Chi cuadrado de homogeneidad (...

  2. El abastecimiento de agua a Cartagena

    Directory of Open Access Journals (Sweden)

    Miguel Borja Bernabé Crespo

    2015-01-01

    Full Text Available La escasez de agua en la región del sureste peninsular, en la que se ubica Cartagena y su comarca,ha obligado a buscar y traer recursos foráneos de agua para atender sus necesidades de abastecimiento.Inicialmente, al no existir cursos permanentes de agua, se recurre a pozos y aljibes, apequeños acueductos desde fuentes y manantiales de aforo escaso, y a alumbramientos de subálveasmediante galerías con lumbreras. Las demandas aumentan y se plantea la traída de aguas dela parte alta de la Cuenca del Segura. Mediante las infraestructuras de la Mancomunidad de losCanales del Taibilla (MCT, creada por Decreto Ley de 4 de octubre de 1927 llega el agua hastaCartagena en 1945. En los últimos treinta y cinco años, a estas aguas se han unido caudales delTrasvase Tajo-Segura y finalmente aguas procedentes de desaladoras. La gestión del abastecimientode agua, a lo largo de la historia de Cartagena (desde la fundación de Carthago Nova enel 229 a.C. hasta los primeros años del siglo XXI ha generado un rico patrimonio de infraestructurashidráulicas y una experimentada cultura de usos del agua.Se expone la situación del abastecimiento de Cartagena (ciudad y barrios como demandante derecursos propios y foráneos de agua. La inversión en las redes de distribución y la concienciaciónde la mayor parte de los usuarios en un uso sostenible, que permiten un continuado abastecimientode «agua de boca», así como la regeneración de las aguas residuales para otros usos. Eneste trabajo geográfico (espacial e histórico (diacrónico, las fuentes utilizadas han sido las entrevistasa los gestores de las empresas encargadas de la distribución del agua en alta (conduccionesde gran diámetro como las de la MCT y en baja (conducciones de pequeño diámetro como las deHIDROGEA, y el acceso a la documentación del Archivo Municipal de Cartagena, del Regionalde Murcia, de la Mancomunidad de Canales del Taibilla, y el de la Confederación Hidrográficadel Segura

  3. Sector agua

    OpenAIRE

    Mabel Scharfhausen

    2012-01-01

    El agua constituye un recurso esencial para muchos aspectos de la vida humana como son el desarrollo y el bienestar humano. Gracias a los importantes avances en TICs es posible avanzar hacia soluciones que ofrecen una gestión eficiente e integral de los recursos hídricos, proporcionando datos en tiempo real respecto a la calidad, al consumo y la demanda del agua que permiten. Esto, no solamente para tener un mejor control del recurso, sino para hacer seguimiento del mismo y, quizás lo más imp...

  4. Detección de mutacarcinógenos y genotoxicidad en aguas residuales que surten dos plantas de tratamiento de agua de consumo

    OpenAIRE

    Naranjo LC.; Zuleta M.; López C.; Orozco LY.

    2001-01-01

    Las aguas residuales están cargadas de gran variedad de mutacarcinógenos entre ellos Hidro-carburos Policíclicos aromáticos, nitrosaminas y aminas Heterocíclicas todos ellos formadosdurante la combustión de material orgánico y en alimentos proteicos cocidos a altas tempe-raturas. Dichos mutacarcinógenos llegan a las aguas residuales especialmente a través de laorina y heces. Las aguas residuales procedentes de la población del Retiro son vertidas al ríoPantanillo después de ser tratadas en un...

  5. TÓXICIDAD DE LA APITOXINA EN UN MODELO DE Artemia salina

    Directory of Open Access Journals (Sweden)

    Juan Manuel Pérez Agudelo

    2015-06-01

    Full Text Available Objetivo:Determinar la toxicidad del extracto acuoso de Apitoxina mediante bioprospección en el modelo de Artemia salina. Materiales y métodos: Previo montaje de Biorreactor, un grupo fue expuesto al extracto acuoso de Apitoxina (n=20 y el grupo control fue expuesto a agua destilada (n=20 la toxicidad se definió por la muerte de la Artemia salina a las 24 horas de administración del extracto. Se realizó análisis estadístico no paramétrico mediante la prueba de Chi cuadrado de homogeneidad (Pearson para determinar la diferencia en mortalidad de los grupos.Resultados:El Grupo Control no presentó mortalidad, en tanto el Grupo Apitoxina presentó una mortalidad del 95%. Se demostró una asociación estadísticamente significativa con un p<0,05(IC: 95% entre la mortalidad de la Artemia salina y la administración de apitoxina.Conclusión:El extracto acuoso de apitoxina presenta toxicidad a una concentración de 0.35 en el modelo de Artemia salina. Palabras Clave: Apitoxina, Artemia salina, Toxicidad

  6. Detección de mutacarcinógenos y genotoxicidad en aguas residuales que surten dos plantas de tratamiento de agua de consumo

    Directory of Open Access Journals (Sweden)

    Naranjo LC.

    2001-06-01

    Full Text Available Las aguas residuales están cargadas de gran variedad de mutacarcinógenos entre ellos Hidro-carburos Policíclicos aromáticos, nitrosaminas y aminas Heterocíclicas todos ellos formadosdurante la combustión de material orgánico y en alimentos proteicos cocidos a altas tempe-raturas. Dichos mutacarcinógenos llegan a las aguas residuales especialmente a través de laorina y heces. Las aguas residuales procedentes de la población del Retiro son vertidas al ríoPantanillo después de ser tratadas en una planta a base de lodos activados. Este río surte repre-sas que alimentan las plantas de tratamiento de agua de consumo la Ayurá y Rionegro quedistribuyen agua potable a más de 2’000.000 de habitantes.

  7. Carotenoid fluorescence in Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Es, van M.A.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2010-01-01

    Dunaliella salina is a halotolerant green alga that is well known for its carotenoid producing capacity. The produced carotenoids are mainly stored in lipid globules. For various research purposes, such as production and extraction kinetics, we would like to determine and/or localise the carotenoid

  8. EVALUACION DEL POTENCIAL DE LOS BIOSÓLIDOS PROCEDENTES DEL TRATAMIENTO DE AGUAS RESIDUALES PARA USO AGRÍCOLA Y SU EFECTO SOBRE EL CULTIVO DE RABANO ROJO (Raphanus sativus L.. EVALUATION OF THE POTENTIAL FOR BIOSOLIDS OBTAINED FROM WASTEWATER TREATMENT FOR AGRICULTURAL USE AND THEIR EFFECT ON CULTIVATION OF RED RADISH (Raphanus sativus L.

    Directory of Open Access Journals (Sweden)

    Ramiro Ramírez Pisco

    2006-12-01

    Full Text Available El trabajo se adelantó en predios de la planta de tratamiento de aguas residuales “El Salitre”, en la ciudad de Bogotá, con el propósito de evaluar el potencial del subproducto del tratamiento de aguas residuales “biosólido”, para su aplicación en la agricultura por medio de la valoración del crecimiento, desarrollo y producción del cultivo de rábano rojo, y establecer una posible alternativa al problema de disposición final de 3900 toneladas de este material generado mensualmente en las planta de tratamiento de aguas. El diseño experimental empleado correspondió a bloques completos al azar, con cinco tratamientos y tres repeticiones, dispuesto en parcelas de 2 m x 2 m. Los tratamientos correspondieron a mezclas de biosólidos con suelo en las siguientes proporciones: 100 % biosólido (equivalente a 294 ton ha-1, 75 % biosólido (220 ton Ha-1, 50 % biosólido (147 ton ha-1, 25 % biosólido (73 ton ha-1 y 100 % suelo como control. Se sembró rábano rojo Raphanus sativus L. Las variables evaluadas fueron: porcentaje de germinación, peso seco de hojas y raíz, longitud de la planta, área foliar y producción. Además, se midió la acumulación de elementos traza en los rábanos cosechados, para determinar su riesgo para el consumo. Los resultados evidenciaron que los tratamientos 50 % biosólido y 25 % biosólido, son los que favorecen el crecimiento, desarrollo y producción del cultivo de rábano, mientras que los tratamientos 75 % biosólido y 100% suelo presentaron un menor desarrollo, crecimiento y producción del cultivo. El tratamiento 100% biosólido provoco una baja germinación, además no presentó acumulación en la raíz, que es el producto cosechable. Los niveles de acumulación de metales pesados sobrepasaron los máximos permitidos con el tratamiento 75 % biosólido. Se evidenció como, la utilización del biosólido en la agricultura puede acarrear un gran riesgo, ya que a pesar de presentar una gran cantidad

  9. Salinas. Theory Manual Version 2.8

    Energy Technology Data Exchange (ETDEWEB)

    Reese, Garth M. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Walsh, Timothy [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bhardwaj, Manoj K. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2009-02-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis, required for high fidelity, validated models used in modal, vibration, static and shock analysis of structural systems. This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas , we refer the reader to Salinas, Users Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are specific to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programmer notes manual, the user's notes and of course the material in the open literature.

  10. CARACTERIZACIÓN DE LOS BIOSÓLIDOS DE AGUAS RESIDUALES DE LA ESTACIÓN DEPURADORA DE AGUAS RESIDUALES "QUIBÚ"

    OpenAIRE

    E. Utria; Inés Reynaldo; Cabrera, A; D. Morales; Ada Morúa; Nereida Álvarez

    2006-01-01

    Con el objetivo de evaluar la composición química y microbiológica de los biosólidos de aguas residuales urbanas procedentes de la Estación Depuradora de Aguas Residuales (EDAR) "Quibu", se realizó el presente trabajo en el Instituto Nacional de Ciencias Agrícolas (INCA). En él se evidenció que estos residuos orgánicos presentan niveles de materia orgánica (MO), nitrógeno (N), fósforo (P) y calcio (Ca) relativamente altos, y los niveles de magnesio (Mg) y potasio (K) se presentan en concentra...

  11. Reciclado de las aguas de decapado

    Directory of Open Access Journals (Sweden)

    López, F. A.

    1998-05-01

    Full Text Available Pickling liquors from steel industry, listed as hazardous wastes in most industrializated countries, have been treated by means of several procedures in order to recover the iron and other metals and to obtain an environmental friendly effluent. Depending on the treatment employed, different valuable ferrous products have been obtained. Ammoniojarosite and zinc ferrite were precipitated from the previously oxidised ferrous solutions.

    En la mayoría de los países industrializados, se incluyen las aguas de decapado, tanto las procedentes de los aceros al carbono como de aceros inoxidables, dentro de las listas de residuos tóxicos y peligrosos. Se presentan en este trabajo los resultados obtenidos en las investigaciones realizadas en los últimos años en los que se ha estudiado el tratamiento y recuperación de aguas de decapado de aceros comunes e inoxidables. Su tratamiento se ha enfocado hacia la consecución de dos objetivos: la recuperación del contenido total de metales y la obtención de un efluente de menor impacto ambiental. Se presentan los procedimientos estudiados para la obtención de compuestos de hierro, amoniojarosita y ferritas de zinc, con cierto valor añadido.

  12. Salinas - User's Notes

    Energy Technology Data Exchange (ETDEWEB)

    ALVIN,KENNETH F.; BHARDWAJ,MANOJ K.; DRIESSEN,BRIAN; REESE,GARTH M.; SEGALMAN,DANIEL J.

    1999-11-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis, required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. This document provides a users guide to the input for Salinas. Details of input specifications for the different solution types, output options, element types and parameters are included. The appendices contain detailed examples, and instructions for running the software on parallel platforms.

  13. ¡Aguas con el agua!

    OpenAIRE

    Iglesias, Enildo; Iglesias, Gerardo

    2014-01-01

    El 22 de marzo, se conmemoró el Día Mundial del Agua, un recurso que está en franco retroceso. Ya en 1516 Leonardo Da Vinci advertía sobre la falta de agua en el futuro. Hoy, muchos especialistas hablan del «oro azul», del «oro del mañana», «que el agua será el recurso más preciado del nuevo siglo», etc. Así mismo, un número importante de estudiosos, anticipan el estallido de conflictos regionales (incluyendo guerras) por el control de las reservas del vital elemento, el cual, como veremos má...

  14. La vulnerabilidad de los refugiados palestinos procedentes de Siria

    OpenAIRE

    Morrison, Leah

    2014-01-01

    Mientras que los refugiados sirios podrían al final retornar a su país natal, el futuro de los refugiados palestinos procedentes de Siria es cada vez más incierto. Entretanto, son más vulnerables, y reciben peor trato que la mayoría de los otros refugiados que huyen del conflicto en Siria.

  15. Manifestaciones hidrológicas e hidroquímicas de flujos subterráneos procedentes de formaciones poco permeables del terciario en el Somontano de Huesca

    Directory of Open Access Journals (Sweden)

    de Miguel Cabeza, J. L.

    1988-12-01

    Full Text Available Presence of groundwater flow in the «somontano Oscense» area, proceeding from low permeability detritic tertiary rocks, is considered. It's given a grounwater flow model for these tertiary rocks. This model explains both water flow through them and water chemical characteristics. Groundwater flow has clear surface manifestations: it causes wet-areas (which are called «paules» in the area with sodic waters; it makes appear saline, sodic or alkaline soils; and it modifies, too, water chemical composition of rivers in Somontano.Se considera la presencia en el Somontano Oscense de flujos de agua subterránea procedentes de materiales detríticos terciarios de baja permeabilidad. Se da un modelo de flujo de las aguas subterráneas en estos materiales que permite explicar tanto su fluencia hacia la superficie como sus características físico-químicas. Estos flujos se manifiestan en superficie, dando lugar a zonas húmedas naturales, paules, con aguas de composición sódica que provocan la formación de suelos salinos, sódicos o alcalinos; también se manifiestan modificando la composición química de las aguas de los ríos que atraviesan el Somontano.

  16. Diagnostico integrado de agua

    Directory of Open Access Journals (Sweden)

    Yanely de la Caridad Esquijarosa Abradelo

    2010-01-01

    Full Text Available Se aborda una metodología para el diagnóstico integrado del agua, basado en herramientas que brindan la información necesaria, teniendo en cuenta la necesidad de poner en práctica nuevas vías que posibiliten los índices cualitativos y cuantitativos de los servicios de agua, de acuerdo a la política energética y medioambiental y a las prioridades que demandan los objetivos sociales y económicos de cada territorio, que conllevan a la implantación de un sistema de gestión integral del agua.

  17. Las aguas de consumo envasadas en España. Trasvases muy rentables y nada cuestionados

    Directory of Open Access Journals (Sweden)

    Cayetano Espejo Marín

    2001-01-01

    Full Text Available El consumo de agua envasada en España ha ido en paralelo desde finales de los años ochenta al incremento en el nivel de vida de los españoles. Un reducido grupo de empresas, con una gran incidencia de las multinacionales, controla la mayor parte del mercado. Con este artículo se pretende destacar la importancia de este sector a través del análisis de los siguientes aspectos: tipos de agua envasada, evolución de la producción, localización de los manantiales, estructura de las empresas, y por último se estudia el caso de la ciudad de Murcia, ejemplo significativo de área de recepción de agua envasada procedente de varias provincias españolas.

  18. Acción bactericida de la laguna minero-medicinal "Santa Cruz de las Salinas" Chilca, Lima-Perú

    Directory of Open Access Journals (Sweden)

    Gloria Chacón Roldán

    2014-06-01

    Full Text Available El presente estudio trata de la acción bactericida in vitro e in vivo del agua de la laguna minero-medicinal "Santa Cruz de las Salinas", Chilca. Investigaciones realizadas en el período Febrero 1977 -Julio 1979 en el Instituto de Salud, Lima, han probado que esta agua ejerce acción bacteriostática y bactericida sobre un germen altamente patógeno para el organismo humano de tipo Gram negativo (Cepa So/mone/Ia typhy TY2. Pruebas de toxicidad de esta agua en el organismo animal se han hecho inoculando 2 grupos de ratones por vías endovenosa e intraperitoneal, demostrando que no ejerce acción tóxica, más bien produce una acción estimulante sobre las células sanguíneas. Se han elaborado 17 Cuadros y 37 figuras.

  19. Historical Notes on Artemia salina (L.)

    NARCIS (Netherlands)

    Kuenen, D.J.

    1938-01-01

    Although an abundant literature exists on Artemia salina, there are still interesting facts in the first history of the discovery of this remarkable animal and in the first study of its habits, which seem to be now forgotten. It is generally considered that Rackett (1812) was the first to give a dra

  20. Continuous production of carotenoids from Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2011-01-01

    During the in situ extraction of ß-carotene from Dunaliella salina, the causal relationship between carotenoid extraction and cell death indicated that cell growth and cell death should be at equilibrium for a continuous in situ extraction process. In a flat-panel photobioreactor that was operated a

  1. Estudio de los niveles de plomo, cadmio, zinc y arsénico, en aguas de la provincia de Salamanca

    Directory of Open Access Journals (Sweden)

    Blanco Hernández Angel Luis

    1998-01-01

    Full Text Available FUNDAMENTOS: Conocer el grado de contaminación por plomo, cadmio, cinc y arsénico de las aguas de la provincia de Salamanca y su relación con la zona de procedencia de las muestras y el punto de recogida de las mismas. MÉTODO: Estudio epidemiológico transversal, observacional y descriptivo. Se han estudiado aguas procedentes de redes de abastecimiento, fuentes, manantiales, pozos, ríos, riveras y lagunas de la provincia de Salamanca, analizándose los contenidos de plomo, cadmio, zinc y arsénico de 180 muestras, mediante espectroscopía de absorción atómica. Se han comparado los niveles de contaminación por los cuatro elementos de las muestras de agua entre las cuatro unidades comarcales de la provincia. Se han comparado los niveles de contaminación por los cuatro elementos entre las aguas procedentes de redes de abastecimiento y aquellas muestras de pozos, fuentes, manantiales y aguas de superficie. RESULTADOS: Los resultados indican que un 56% de las muestras analizadas superan las concentraciones máximas admisibles de cadmio, y un 28% del total de muestras analizadas supera las concentraciones máximas admisibles de plomo, según la legislación vigente presentando niveles tolerables de zinc y arsénico. No se han observado diferencias importantes en el grado de contaminación de las aguas por los elementos estudiados entre las cuatro unidades comarcales de la provincia. No se han observado diferencias en los niveles de contaminación por los cuatro elementos entre las aguas procedentes de redes de abastecimientos y aquellas muestras de pozos, fuentes, manantiales y aguas de superficie. CONCLUSIONES: Los resultados sugieren que las aguas de la provincia de Salamanca presentan de forma "natural" altos contenidos de cadmio y plomo, probablemente debido a las características geológicas del terreno.

  2. Radioactivity in drinking water Radiactividad en aguas de consumo

    Directory of Open Access Journals (Sweden)

    Enrique Estrada Vélez

    2011-12-01

    Full Text Available The European Directive on the quality of drinking water in 2003 establishing limits on the values of the radioactive parameters concerning the quality of drinking waters was translated to the Spanish legislation on 2003. These parameters are the gross alpha and beta indexes, tritium content and total indicative dose. The corresponding Spanish Royal Decree came into force in 2008. Not only tap drinking water is subjected to control of radioactivity but also commercial drinking water. Different estudies have been carried out all over the world in both cases. There is a wide range of techniques for the measurement of radioactivity in water. This article describes these techniques and shows when they must be applied. Finally the most important results obtained after analysis in tap water and commercial water are shown both in Spanish and non-Spanish waters. The results show that limits are overtaken in some cases and special care must be taken in order to reduce the levels of radioactivity in drinking water as much as possible.La directiva europea sobre calidad en el agua potable del año 2003 estableció los límites para los valores de los parámetros radiactivos. Esta directiva europea fue incorporada a la legislación 2003. Los parámetros a analizar son los índices alfa y beta total, el contenido en tritio y la dosis indicativa total. El correspondiente real decreto, en el caso de España, se comenzó a aplicar en el año 2008. No solamente el agua potable procedente de captaciones públicas está sujeta a control, sino que también se deben controlar las aguas comerciales. En ambos casos se han llevado a cabo estudios en todo el mundo. Existe un rango amplio de técnicas para la medida de la radiactividad en el agua de consumo. Este artículo describe tales técnicas e indica cuando se debe aplicar cada una de ellas. Por último, se muestran los resultados más importantes obtenidos tras el análisis de aguas potables y comerciales, tanto en

  3. Destilador de agua

    OpenAIRE

    Reynoso, Laura

    2016-01-01

    Este proyecto surge a partir del análisis del destilador construido por intiar y de la evaluación de las características del contexto en el cual se ubica, acotado en este caso al Noroeste Argentino (noa), zona que presenta en mayor medida el problema del agua contaminada con arsénico y que cuenta con una alta incidencia de radiación solar. Se arribó a la conclusión de que la cantidad de litros de agua que el antecedente producía por día (seis a ocho litros) no era suficiente para ab...

  4. Utilización de aguas regeneradas para el riego de dos especies de la familia de las mirtáceas (Myrtus Communis L. y Eugenia Myrtifolia L.

    OpenAIRE

    2014-01-01

    [ESP] La investigación realizada evalúa la posibilidad de la reutilización de aguas residuales de distinta calidad, que previamente han sido depuradas (ARD), para el riego de dos especies de la familia de las Mirtáceas (Myrtus communis L. y Eugenia myrtifolia L.) empleadas con usos y fines ornamentales. Las aguas utilizadas en este trabajo tienen una composición que varía estacionalmente ya que presentan orígenes distintos, aunque tienen en común que son aguas más o menos salinas: ARD1 (CE = ...

  5. Specific anion effects in Artemia salina.

    Science.gov (United States)

    Lo Nostro, Pierandrea; Ninham, Barry W; Carretti, Emiliano; Dei, Luigi; Baglioni, Piero

    2015-09-01

    The specific anion effect on the vitality of Artemia salina was investigated by measuring the Lethal Time LT50 of the crustaceans in the presence of different sodium salts solutions at room temperature and at the same ionic strength as natural seawater. Fluoride, thiocyanate and perchlorate are the most toxic agents, while chloride, bromide and sulfate are well tolerated. The rates of oxygen consumption of brine shrimps were recorded in mixed NaCl+NaF or NaCl+NaSCN solutions as a function of time. The results are discussed in terms of the Hofmeister series, and suggest that, besides the biochemical processes that involve F(-), SCN(-) and ClO4(-), the different physico-chemical properties of the strong kosmotropic and chaotropic anions may contribute in determining their strong toxicity for A. salina.

  6. Porting salinas to the windows platform.

    Energy Technology Data Exchange (ETDEWEB)

    Reese, Garth M.; Wilson, Christopher Riley

    2006-06-01

    The ASC program has enabled significant development of high end engineering applications on massively parallel machines. There is a great benefit in providing these applications on the desktop of the analysts and designers, at least insofar as the small models may be run on these platforms, thus providing a tool set that spans the application needs. This effort documents the work of porting Salinas to the WINDOWS{trademark} platform. Selection of the tools required to compile, link, test and run Salinas in this environment is discussed. Significant problems encountered along the way are listed along with an estimation of the overall cost of the port. This report may serve as a baseline for streamlining further porting activities with other ASC codes.

  7. Pedro Salinas: la letra y la persona

    Directory of Open Access Journals (Sweden)

    Escartín Gual, Montserrat

    2002-12-01

    Full Text Available This article is a Pedro Salinas's homage in the fifty anniversary of his death. Here, we analise his attitude in front of life and his securities through his poems, personal letters and essais. The poet criticizes the materialistic american stil of life, where he should live during his exile until his death (1936-1951. Against the hurry, the profitable things, the technology, the money..., Salinas believes in his language, slowness, friendship, contemplation of countryside, art, spiritualism, optimism, etc. Son of the Institución Libre de Enseñanza's ideas, his personal ethics looked for the biggest perfection trought the will.Este artículo es un homenaje a Pedro Salinas al cumplirse el cincuentenario de su muerte. En él, se analiza su actitud ante la vida y sus valores a través de sus poesías, cartas personales y ensayos. El poeta critica el materialismo del modelo americano en el que se vio obligado a vivir desde que se exilió hasta su muerte (1936-1951. Frente a la prisa, lo rentable, la tecnología, el dinero...; Salinas cree en su idioma, la lentitud, la amistad, la contemplación del paisaje, el arte, lo espiritual, el optimismo, etc. Hijo de las ideas de la Institución Libre de Enseñanza, su ética personal buscó la mayor perfección a través de la voluntad.

  8. Concesiones de aguas

    Directory of Open Access Journals (Sweden)

    Carlos Labaure Aliseris

    2014-07-01

    Full Text Available El objeto del estudio que nos proponemos realizar es el de las concesiones de aguas.Dicho tema se inscribe en el más amplio de las concesiones en general, y de las concesiones de bienes del dominio público en particular.El estudio especial de las concesiones de aguas se justifica, ya que como en el caso de las demás concesiones sobre bienes del dominio público y privado del Estado, presenta particularidades en su régimen jurídico.El tema planteado fue objeto de nuestro análisis hace unos años, ya que precisamente nuestra tesis para aspirar al título de Profesor Adscripto fue el Código de Aguas, en que uno de los capítulos era el "Uso de las Aguas", que incluía a los permisos y concesiones de uso

  9. Mejoras en el proceso industrial de extracción de lanolina del efluente procedente del lavado de la lana en base a un tratamiento físico-químico

    OpenAIRE

    Sánchez Patrocinio, Alberto

    2016-01-01

    [ES] El Trabajo que aquí se presenta consiste en la implantación de una instalación dedicada a la extracción de la lanolina presente en el efluente procedente del lavado de lana de oveja. La lanolina es una ceramida existente en la lana en jugo (sin lavar) y es la responsable de contribuir con la mayor parte de la carga contaminante al efluente del lavado de la lana. Por esta razón, su eliminación se puede considerar como parte del proceso de depuración o tratamiento de las aguas. Por...

  10. Calidad del agua y sedimento en el lago de Maracaibo, estado Zulia

    Directory of Open Access Journals (Sweden)

    Giovany José-Bracho

    2016-03-01

    Full Text Available Se analizó el agua y el sedimento del lago de Maracaibo en seis estaciones de muestreo distribuidas de norte a sur del lago. Los parámetros físicoquímicos y ambientales fueron determinados y establecidas las relaciones entre estos y las áreas afectadas por descargas de aguas residuales, depósitos de basura, residuos industriales líquidos y sólidos, actividad petrolera y agrícola y materiales orgánicos acarreados por ríos y drenajes pluviales. Se evidenció la contaminación por incremento de utrientes(nitrógeno y fósforo en las zonas influenciadas por los ríos y vertederos de agua residual y se validó la presencia de una cuña salina por la penetración al lago de las aguas del golfo de Venezuela. Las concentraciones de metalespesados están por debajo de los límites permisibles para el agua; en los sedimentos es muy heterogénea.

  11. Pedro Salinas y el teatro desde dentro (Pedro Salinas and Theatre from Within

    Directory of Open Access Journals (Sweden)

    Benítez Vega, Yolanda

    2013-12-01

    Full Text Available Resumen: Pedro Salinas y el teatro, desde dentro es el título de este artículo cuya finalidad consiste en realizar un recorrido por la vocación teatral de Pedro Salinas desde sus primeros años hasta el final de sus días: su asistencia a representaciones teatrales, sus contactos con el teatro y sus proyectos como autor dramático tanto los que se realizaron como los que no llegaron a materializarse. El propósito es adentrarnos en el alma teatral del poeta: cómo, cuándo, por qué surge su vocación por el arte escénico, insistiendo en la necesidad de rescatar la faceta de dramaturgo de Pedro Salinas como una constante más en la labor del poeta, profesor y crítico. Abstract: "Pedro Salinas and the theatre, from inside " it is the title of this article which purpose consists of realizing a tour for Pedro Salinas's theatrical vocation from his first years until the end of his days: his assistance to theatrical representations, his contacts with the theatre and his projects like dramatic author so much those who were realized as those who did not manage to materialize. The intention is to enter the theatrical soul of the poet: how, when, why his vocation arises for the scenic art, insisting on the need to rescue the playwright's facet of Pedro Salinas as one more constant in the labor of the poet, teacher and critic.

  12. Influencia del medio ambiente en los materiales de construcción III. Dinámica salina

    Directory of Open Access Journals (Sweden)

    Fernández Paris, José Manuel

    1978-06-01

    Full Text Available Las sales y la humedad son los dos factores que condicionan las alteraciones de los materiales de construcción. Los citados materiales, bien de por sí —piedras y ladrillos—, bien una vez endurecidos —morteros y hormigones—, están estructurados por partículas sólidas granulares, separadas por un sistema poroso, que constituye el medio -dinámico para el transporte de las disoluciones salinas procedentes del medio ambiente. La motilidad de las sales a través de la red de poros es función de tres variables físicoclimáticas: temperatura, humedad y condiciones de aireación. La dinámica salina se efectúa mediante procesos de difusión, unas veces de naturaleza química: difusión iónica, otras de naturaleza física: difusión capilar.

  13. Cuento: Agua rota

    Directory of Open Access Journals (Sweden)

    José Puben

    1966-04-01

    Full Text Available Ya avanzada la noche la lluvia empezó a caer, clara y sonora, en el empedrado del patio y sobre los amplios techos de la vieja casa. El ruido del aguacero lo despertó de un profundo sueño. La sensación de que la cañada aumentaba, a cada momento, venía del atronador y permanente cauce de las aguas vecinas.

  14. Potencial del agua del suelo

    OpenAIRE

    Bustamante Heliodoro

    2012-01-01

    La energía potencial del agua presenta diferencias de un punto del suelo a otro; esas diferencias son las que originan el movimiento del agua de acuerdo a la tendencia universal de la materia en el sentido de moverse de donde la energía potencial es mayor a donde dicha energía es menor. En el suelo el agua en consecuencia se mueve hacia donde su energía decrece hasta lograr su estado de equilibrio. Se desprende entonces que la cantidad de energía potencial absoluta contenida en el agua, no es...

  15. Groundwater recharge on east side soils of the Salinas Valley

    Science.gov (United States)

    After four years of drought, groundwater levels in the Salinas Valley are at historically low levels which threaten to adversely affect farming in the Salinas Valley. Given the prospect of a strong El Niño this coming winter, it seems prudent to plan to capture as much of the rainfall as possible to...

  16. Réplica a Maximiliano Salinas

    OpenAIRE

    2011-01-01

    En relación con la crítica que Maximialiano Salinas hace de mi libro Misticismo e Inquisición en el virreinato peruano. Los procesos a los alumbrados de Santiago de Chile 1710-1736, debo indicar que ella deja en evidencia una actitud bastante especial de parte de su autor. En el fondo, hace caso omiso de la tesis central del libro y se limita a señalar algunas obras que se habrían omitido y a reiterar su propia interpretación del fenómeno estudiado, que había expuesto de manera sucinta h...

  17. Dinucleosidasetetraphosphatase in rat liver and Artemia salina.

    Science.gov (United States)

    Vallejo, C G; Lobaton, C D; Quintanilla, M; Sillero, A; Sillero, M A

    1976-06-07

    A comparative study of an enzymatic activity present in Artemia salina and rat liver which specifically splits dinucleoside tetraphosphates is presented. All the purine and pyrimidine dinucleoside tetraphosphates tested, i.e. diadenosine, diguanosine, dixanthosine and diuridine tetraphosphates, were substrates of both enzymes with similar maximum velocities and Km values, (around 10 muM). The inhibition by nucleotides of the enzyme from the two sources is also similar. Particularly relevant is the strong inhibition caused by nucleoside tetraphosphates which have Ki values in the nanomolar range. The Artemia enzyme has a slightly lower molecular weight (17 500) than the liver enzyme (21 000) and is more resistant to acidic pH. Based on previous findings, the enzyme from Artemia salina was named diguanosinetetraphosphatase (EC 3.6.1.17) by the Enzyme Commission. The results presented in this paper show that the liver and Artemia enzymes are similar, and we propose to name this enzyme as dinucleosidetetraphosphatase or dinucleoside-tetraphosphate nucleotidehydrolase.

  18. Potencial del Agua del suelo

    Directory of Open Access Journals (Sweden)

    Bustamante Heliodoro

    1986-12-01

    Full Text Available La energía potencial del agua presenta diferencias de un punto del suelo a otro; esas diferencias son las que originan el movimiento del agua de acuerdo a la tendencia universal de la materia en el sentido de moverse de donde la energía potencial es mayor a donde dicha energía es menor. En el suelo el agua en consecuencia se mueve hacia donde su energía decrece hasta lograr su estado de equilibrio. Se desprende entonces que la cantidad de energía potencial absoluta contenida en el agua, no es importante por sí misma, sino por su relación con la energía en diferentes lugares dentro del suelo. El concepto Potencial de agua del suelo es un criterio para esta energía.

  19. Cyanobacterial cytotoxicity versus toxicity to brine shrimp Artemia salina.

    Science.gov (United States)

    Hisem, Daniel; Hrouzek, Pavel; Tomek, Petr; Tomšíčková, Jana; Zapomělová, Eliška; Skácelová, Kateřina; Lukešová, Alena; Kopecký, Jiří

    2011-01-01

    Heterocytous cyanobacteria from various habitats were screened for toxicity to brine shrimp Artemia salina and the murine lymphoblastic cell line Sp/2 in order to compare these two testing models for evaluation of risk posed by cyanobacteria to human health. Methanol extracts of biomass and cultivation media were tested for toxicity and selected extracts were fractionated to determine the active fraction. We found a significant toxic effect to A. salina and to Sp/2 cells in 5.2% and 31% of studied extracts, respectively. Only 8.6% of the tested strains were highly toxic to both A. salina and the Sp/2 cell line, and only two of the tested strains were toxic to A. salina and not to the murine cell line. Therefore, it is likely that the toxic effect of cyanobacterial secondary metabolites mostly targets basal metabolic pathways present in mammal cells and so is not manifested in A. salina. We conclude that it is insufficient to monitor cytotoxicity of cyanobacteria using only the brine shrimp bioassay as was usual in the past, since cytotoxicity is a more frequent feature in cyanobacteria in comparison with toxicity to A. salina. A. salina toxicity test should not be used when estimating the possible health risk for humans. We suggest that in vitro mammal cells be used for these purposes.

  20. Himno del agua

    OpenAIRE

    Donato Calderón, Fiorella

    2016-01-01

    El día 7 de octubre del 2003, se adoptó oficialmente la letra y la música del compositor costarricense Carlos Guzmán Bermúdez como el Himno al Agua de nuestro país, así lo confirma el siguiente decreto de la Ley General de la Administración Pública, publicado en La Gaceta N.° 78, 25 de abril de 2005

  1. Poema del agua

    OpenAIRE

    Chavarría, Lísimaco

    2016-01-01

    —Le doy, ioh, caminante!, cuando la sed te abruma, –el agua dijo alegre– frescura a tu garganta, refresco de las aves la seda de su pluma y en las riberas mías yo bordo con mi espuma tejidos de colores cuando mi lira canta. Soy grito y soy arrullo, quietud y movimiento, arrumbo a las llanuras para buscar descanso, retozo entre las quiebras y canto con el viento, reflejo en mis cristales el vasto firmamento y acorto mi carrera tomándome remanso.

  2. Proyecto y plan de marketing hacia salinas 2000

    OpenAIRE

    Merlo Veintimilla, Zenaida; Pastor, Bolivar

    2009-01-01

    El presente trabajo titulado “Proyecto y Plan de Marketing Hacia Salinas 2000”, es un plan de mercadotecnia turístico, que busca cultivar una cultura turística en el cantón Salinas, con miras a reactivar la actividad turística y comercial en el balneario. Salinas representa en la actualidad uno de los balnearios más visitados por turistas nacionales en la época de invierno, llegando incluso a su saturación total, provocando el colapso de los servicios básicos y a la degradación del medio ...

  3. Estudio de la contaminación por pesticidas en aguas ambientales de la provincia de Almería

    Directory of Open Access Journals (Sweden)

    J. L. Martínez Vidal

    2004-01-01

    Full Text Available En este estudio se han determinado más de cuarenta plaguicidas (organofosforados y organoclorados, de entre los más ampliamente utilizados en tratamientos agrícolas en la provincia de Almería (España, en aguas ambientales de ésta área. El análisis de los plaguicidas se realizó mediante microextracción en fase sólida (SPME acoplada a cromatografía de gases con detección en modo de espectrometría de masas en tándem (GC‐MS/MS. Se tomaron 9 muestras de aguas superficiales y 15 muestras de aguas subterráneas procedentes de pozos superficiales de las principales áreas agrícolas de la provincia de Almería. Los plaguicidas más comúnmente encontrados en las muestras analizadas fueron endosulfan alfa, endosulfan sulfato y clorpirifos etil en las aguas subterráneas y endosulfán alfa, beta y sulfato en las aguas superficiales. Aunque el plaguicida encontrado a un mayor nivel de concentración fue malatión.

  4. The swimming mechanics of Artemia Salina

    Science.gov (United States)

    Ruiz-Angulo, A.; Ramos-Musalem, A. K.; Zenit, R.

    2013-11-01

    An experimental study to analyze the swimming strategy of a small crustacean (Artemia Salina) was conducted. This animal has a series of eleven pairs of paddle-like appendices in its thorax. These legs move in metachronal-wave fashion to achieve locomotion. To quantify the swimming performance, both high speed video recordings of the legs motion and time-resolved PIV measurements of the induced propulsive jet were conducted. Experiments were conducted for both tethered and freely swimming specimens. We found that despite their small size, the propulsion is achieved by an inertial mechanism. An analysis of the efficiency of the leg wave-like motion is presented and discussed. A brief discussion on the mixing capability of the induced flow is also presented.

  5. Réplica a Maximiliano Salinas

    Directory of Open Access Journals (Sweden)

    RENÉ MILLAR C.

    2011-10-01

    Full Text Available En relación con la crítica que Maximialiano Salinas hace de mi libro Misticismo e Inquisición en el virreinato peruano. Los procesos a los alumbrados de Santiago de Chile 1710-1736, debo indicar que ella deja en evidencia una actitud bastante especial de parte de su autor. En el fondo, hace caso omiso de la tesis central del libro y se limita a señalar algunas obras que se habrían omitido y a reiterar su propia interpretación del fenómeno estudiado, que había expuesto de manera sucinta hace algún tiempo.

  6. Manual de tratamiento de agua

    OpenAIRE

    Pérez Parra, Jorge Arturo

    1981-01-01

    Este Manual de Tratamiento de Agua se ha hecho con la intención de ofrecer en forma conjunta una serie de principios y conocimientos sobre los diferentes procesos de tratamiento del agua, cuya descripción se hace no como operaciones unitarias sino siguiendo un orden práctico encaminado hacia el aspecto teórico y al diseño de las diferentes unidades que componen una planta de tratamiento para el acondicionamiento de las aguas utilizadas como fuente de abastecimiento

  7. Larvicidal activity of some marine macrophytes against Artemia salina

    Digital Repository Service at National Institute of Oceanography (India)

    PrabhaDevi; Wahidullah, S.; DeSouza, L.; Kamat, S.Y.

    and Microdictyon pseudohapteron, seagrasses (Halophila ovalis and Syringodium isoetifolium and lichens (Umbilicaria arpina) were tested for larvicidal activity using Artemia salina nauplii. The LC50 values for the PE-fraction of M. pseudohapteron and A. muscoides...

  8. Salinas River National Wildlife Refuge: Comprehensive Conservation Plan

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan (CCP) was written to guide management on Salinas River NWR for the next 15 years. This plan outlines the Refuge vision and...

  9. Studies on experimental culture of a marine ciliate Fabrea salina

    Digital Repository Service at National Institute of Oceanography (India)

    Rattan, R.; Ansari, Z.A.; Chatterji, A.

    Studies were conducted on the culture of a marine ciliate, Fabrea salina in the laboratory condition. Three types of inert feed; commercial yeast, fermented wheat bran and fermented rise bran were tested to study their suitability as artificial feed...

  10. The Trail Inventory of Salinas River NWR [Cycle 2

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of this report is to create a baseline inventory of all non-motorized trails on Salinas River National Wildlife Refuge. Trails in this inventory are...

  11. LOS BIOSÓLIDOS DE AGUAS RESIDUALES URBANAS APLICADOS CON DIFERENTES FRECUENCIAS EN LAS PROPIEDADES QUÍMICAS Y MICROBIOLÓGICAS DEL SUELO, EL RENDIMIENTO Y LA CALIDAD DE LOS FRUTOS DE TOMATE (Solanum lycopersicum Mill)

    OpenAIRE

    E. Utria; Inés M. Reynaldo; Cabrera, J A; D. Morales; Sandra Goffe

    2008-01-01

    Con el objetivo de evaluar el impacto del uso agrícola de los biosólidos de aguas residuales urbanas procedentes de la Estación Depuradora de Aguas Residuales "Quibú", se desarrolló el presente trabajo en el Instituto Nacional de Ciencias Agrícolas (INCA). Los biosólidos obtenidos mediante digestión anaeróbica y aplicados en un suelo Ferralítico Rojo compactado incrementaron los contenidos de materia orgánica oxidable, fósforo asimilable y calcio cambiable. Aumentaron los contenidos totales d...

  12. Una alabarda procedente del valle del Manzanares (Madrid

    Directory of Open Access Journals (Sweden)

    Miguel Ángel de BLAS CORTINA

    2009-12-01

    Full Text Available RESUMEN: Se estudia una alabarda metálica procedente —sin datos precisos de su localización— del valle del Manzanares (Madrid. Posiblemente apareciera con otros materiales (¿puntas Palmela?, pero el hecho no pudo ser comprobado. Fundida en un molde monovalvo que proporciona un acabado homogéneo a una sola de las caras, se integra metalúrgicamente en el grupo E 01 (cobres arsenicales propio de la Península Ibérica durante el Calcolítico y el Bronce Antiguo. Tipológicamente puede ser clasificada como integrante del grupo Carrapatas al que pertenecen un conjunto de alabardas procedentes del N.E. de Portugal (Bragança y Tras os Montes del que se conocen escasos testimonios fuera del área característica. Especialmente significativo es el hallazgo de la finca de la Paloma (Pantoja, Toledo que muestra la asociación entre las alabardas Carrapatas y elementos propios del campaniforme tardío de España y Portugal, circunstancia que permite fechar el tipo entre el 1700-1500 a. de J.C., datación similar a las fechas admitidas para las alabardas irlandesas con las que algunos autores ven posibles relaciones. La existencia de alabardas grabadas en estelas más tardías o en rocas al aire libre plantea el problema de su perduración. No obstante, el carácter simbólico de las armas grabadas puede hacer que sea solamente la imagen representada la que superviva, aunque el arma como tal haya perdido vigencia. La alabarda del Manzanares, junto con las de Pantoja, señala la presencia en la Meseta Sur de elementos metalúrgicos propios del N.W. de la Península en un momento sincrónico con las fases finales del campaniforme.ABSTRACT: We study a metallic halberd found in an indeterminate place in the valley of the river Manzanares (Madrid. It might have appeared with other materials (Palmela Points?, although this fact could not be confirmed. Made in a single-faced mould which allows a homogeneous finish to only one of the sides, it belongs from

  13. Evaluación de la salinidad potencial de aguas para riego en la cuenca del Cauto

    OpenAIRE

    Sandro Ricardo Palacio; Rolando Ramírez Olivera; Ramón Núñez Tablada; Vilma López Cruz

    2010-01-01

    Se presentó la evaluación de la Salinidad Potencial (SP) del agua procedente de la Estación de Bombeo Ingenio Viejo situada en la Cuenca del Cauto la que es utilizada para el riego en parte de las áreas agrícolas de la Empresa Antonio Maceo, a partir del análisis químico realizado por la Empresa de Aprovechamiento de Recursos Hidráulicos de Holguín. Se obtuvo un índice de (SP) de 8.77, el cual la metodología lo indica como aguas condicionales para el riego por lo que debe mantenerse control s...

  14. PERDIDA DE CARGA EN CONDUCTOS DE HIERRO GALVANIZADO CONDUCIENDO AGUA RESIDUAL DE INSTALACIONES DE GALLINAS PONEDORAS

    Directory of Open Access Journals (Sweden)

    JOSÉ ANTONIO RODRIGUES DE SOUZA

    2011-01-01

    Full Text Available Las operaciones relacionadas con la producción de aves de corral pueden generar efluentes procedentes de fuentes distintas, incluida la escorrentía originada en las jaulas, alimentación y abastecimiento de agua de las aves y de las instalaciones de almacenamiento y manejo de residuos. En todo proyecto de explotación de aves de corral, se debe tener en cuenta el manejo de residuos y aguas residuales, las cuales pueden ser conducidas en tuberías de hierro galvanizado. El objetivo de este trabajo, fue el ajustar ecuaciones para estimar la perdida de carga continua en conductos de hierro galvanizado en los diámetros comerciales, variando de 50 a 150 mm, operando con agua residual de gallinas ponedoras en diferentes concentraciones de sólidos totales. Los resultados indicaron que las metodologías de Duffy & Titchener y HazenWilliams modificadas presentaron ajustes cuyo coeficiente de determinación fue superior a 0,95, por lo que es considerado apropiado para el dimensionamiento de proyectos hidráulicos.

  15. Mutagenicidad en aguas de consumo mediante el test de reversión trp- en Escherichia coli

    Directory of Open Access Journals (Sweden)

    B. Granados

    2004-01-01

    Full Text Available Una de las principales fuentes de mutágenos ambientales se deriva de la cloración de las aguas de consumo público, ya que es bien conocido que el cloro reacciona con precursores del agua produciendo un grupo de compuestos que incluyen posibles carcinógenos humanos. Con el objeto de evaluar la actividad mutagénica de derivados orgánicos procedentes del agua de consumo de Madrid, nos planteamos utilizar el test de mutación reversa con Escherichia coli. Material y métodos: Se emplearon las cepas de Escherichia coli triptófano dependientes, WP2, WP2 uvrA– y WP2 uvrA– pKM 101. Cada experiencia se realizó con y sin activación metabólica (mezcla S9 y utilizando el método de incorporación en placa. Las muestras de agua fueron procesadas con el fin de concentrar los compuestos orgánicos clorados. Resultados y conclusiones: No hemos encontrado actividad mutagénica positiva con ninguna de las cepas de ensayo. Los mayores índices de mutación se obtuvieron con la cepa WP2 uvrA– pKM 101 y en las experiencias sin fracción microsomal (índice de mutación de 1,84

  16. El Parque de las Aguas

    OpenAIRE

    Damiá Giménez, Eva

    2010-01-01

    El Parque de las Aguas fue inaugurado en 1978 tras numerosas protestas vecinales para que fuera abierto al público después de estar cerrado durante más de 100 años, cuando era propiedad de la compañía de Aguas de Barcelona. Aún hoy, existe un área de 5.000m2 inaccesible ocupada por un jardín de estilo clásico perteneciente a la Casa de las Alturas y bajo el que se esconden los dos depósitos de DosRius con capacidad para 16.000m3 de agua. En la sección transversal del lugar se o...

  17. El agua y el arte

    OpenAIRE

    1999-01-01

    Not available.En el artículo «El agua y el arte» se analiza la importancia que tiene el agua en el mundo del arte, a través de los jardines y sus muchas variedades. El autor se refiere luego a los diversos aspectos que tienen el jardín francés, el jardín inglés, y el jardín español, de acuerdo con su geografía, pluviometría y cultura propias. El jardín español de abolengo musulmán es el jardín de los países secos que atesoran el agua como bien precioso, porque no lo regala la natu...

  18. a considerar. II. Aguas residuales urbanas

    Directory of Open Access Journals (Sweden)

    Fernando Ortega Sastriques

    2007-01-01

    Full Text Available El precio del agua potable es elevado y en muchas ciudades su disponibilidad está limitada y disminuirá en el futuro. La agricultura urbana es una concurrente en el uso del agua, en el futuro es muy probable que haya fuertes limitaciones para el riego con agua potable. Así es que para la producción de vegetales en medio urbano será necesario el empleo de agua de fuentes alternativas y no de los acueductos. Por lo general, el agua del subsuelo en el entorno de las ciudades, así como las corrientes superficiales está contaminada. En este trabajo se señalan los aspectos a tomar en cuenta para el riego seguro con aguas residuales, incluyendo las aguas albañales.

  19. Agua Caliente and Their Music.

    Science.gov (United States)

    Ryterband, Roman

    1979-01-01

    Discusses the traditional music of the Agua Caliente band of California's Desert Cahuilla Indian tribe, including accompanying instruments, types of songs, thematic material, and performance routines. Exploring the structure of the music, the article describes meter, tempo, harmony and tonal gravitations, and use of words. (DS)

  20. Túnel bajo el agua

    Directory of Open Access Journals (Sweden)

    Stamhuis, E.

    1964-03-01

    Full Text Available This article describes the results obtained by the Dutch Central Institute of Scientific Research when studying the problem of underwater tunnels. This Institute has sought to establish general specifications for the design of this type of tunnels, so that they shall be more efficient than those at present in use. Firstly, a study was made of the strength, waterproof qualities, and most rational type of ventilation, with a view to drawing up of general principles on this aspect of the design. An analysis is given of the shape, suitable cross sections and constructive methods, and these are compared with those adopted in the construction of underwater tunnels at present in use in America. Particular attention has been given to designs which are largely based on prefabrication and the use of factory made structural parts, and also on the transport and erection of these at the site. The author goes on to discuss the interplay of soil and water pressures, buoyancy forces, and cases in which the tunnel is subjected to important bending and shear forces on particular sections of it. In this connection care is taken to give the theoretical considerations a ready practical interpretation. In particular, a description is given of special distance pieces which connect the two tubes making up a tunnel, also the system of joining two sections of the tube, and the measure of watertightness and flexibility which such joints provide. Finally, a summary is given of the theoretical foundations, as well as a number of observations and items of advise, which are applicable to these types of structures.El ingeniero A. Eggink describió, en un trabajo publicado últimamente, un nuevo tipo de túnel bajo el agua para canalizar la circulación rodada. En este trabajo se desarrolla un análisis sobre las consideraciones que han jugado un papel predominante en la redacción del proyecto de ejecución de un túnel subacuo. Acompañan al trabajo los resultados referentes

  1. Understanding Environmental Factors that Affect Violence in Salinas, California

    Science.gov (United States)

    2009-12-01

    Norteños are primarily second- or third-generation Mexican- American gangsters in northern California.9 The Nuestra Familia (NF) prison gang, which... Oriented Policing Service Youth Firearms Violence Initiative. Salinas used this grant to make their anti-gang task force a full-time effort and formed a

  2. Anaerobic biodegradation of lipids of the marine microalga Nannochloropsis salina

    NARCIS (Netherlands)

    Sinninghe Damsté, J.S.; Grossi, V.; Blokker, P.

    2001-01-01

    In order to determine the susceptibility to anaerobic biodegradation of the different lipid biomarkers present in a marine microalga containing algaenan, portions of one large batch of cultured Nannochloropsis salina (Eustigmatophyceae) were incubated in anoxic sediment slurries for various times. A

  3. Laboratory sulfurisation of the marine microalga Nannochloropsis salina

    NARCIS (Netherlands)

    Sinninghe Damsté, J.S.; Gelin, F.; Kok, M.D.; Leeuw, J.W. de

    1998-01-01

    To understand more fully the mode of preservation of organic matter in marine sediments, laboratory sulfurisation of intact cells of the cultured microalga Nannochloropsis salina was performed using inorganic polysulfides in seawater at 50°C. Solvent extractable and non-extractable materials were an

  4. Acute toxicity of organic solvents on Artemia salina

    Energy Technology Data Exchange (ETDEWEB)

    Barahona-Gomariz, M.V.; Sanz-Barrera, F.; Sanchez-Fortun, S. (Complutense Univ. of Madrid (Spain))

    1994-05-01

    Organic solvents can make their way into the environment as industrial wastes and components of pesticide formulation. In laboratory bioassays, the use of organic formulations. In laboratory bioassays, the use of organic solvents is often unavoidable, since many pesticides and organic pollutants have low water solubility and must be dissolved in organic solvents prior to addition into experimental systems. In the toxicant bioassays, invertebrates with special reference to aquatic arthropod species are of recent interest as test models due to the need for developing nonmammalian test systems. Toxic effects of organic solvents have been tested with a few aquatic species, but information on the comparative toxicity of solvents towards Artemia salina is not available. Artemia salina have, within recent years, gained popularity as test organisms for short-term toxicity testing. Because Artemia salina exhibit rapid development and growth within 48 hr after hatch, their potential as a model organism for toxicology screening has been considered. To do this, synchronous populations of Artemia salina at different development intervals must be available.

  5. Hypoosmotic shock induces a stateⅠtransition of photosynthetic apparatus in Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    LIU Xiande; SHEN Yungang

    2004-01-01

    The effects of hypoosmotic shock on statetransition in darkness in Dunaliella salina were studied.When the concentration of NaCl in culture medium wasdropped from 1.5 to 0.5 mol/L abruptly, the photosyntheticrate of D. salina declined, but the respiratory rate and in-tracellular ATP content increased in the dark. The FPSⅡ/FPSⅠratio at 77 K of D. salina cells exposed to hypoosmotic shockwas higher than that of control cells, indicating that moreexcitation energy was distributed to PSⅡ in stressedD. salina cells upon illumination. A decrease in LHCⅡ pho-sphorylation level was also observed when D. salina was exposed to hypoosmotic shock. Thus a stateⅠtransition ofphotosynthetic apparatus occurs when D. salina suffershypoosmotic shock in darkness, which is supposed to berelated to an enhancement of respiration and an increase inATP content in stressed D. salina cells.

  6. Optimización de la aplicación de lodos de depuración de aguas residuales al abonado o mejora de suelos

    OpenAIRE

    Cruz Quijada, Luz Graciela

    2015-01-01

    El objetivo de este trabajo de investigación fue evaluar el efecto de la aplicación de lodos residuales procedentes de una planta de tratamiento de aguas residuales acondicionados como biosólido para el abonado de tres cultivos agrícolas. Esto se realizó a través del estudio de las variables de producción (desarrollo vegetal de cada cultivo) y de la comparación de las características de los suelos utilizados antes y después de los ensayos experimentales. A través de la investigación se confir...

  7. Adaptación y monitoreo de microorganismos en procesos de nitrificación en aguas residuales de la industria petrolera

    OpenAIRE

    Madero, A.; Bravo, G.; F. Carvajal; Díaz, M.

    2011-01-01

    La remoción biológica de nitrógeno amoniacal se lleva a cabo en dos etapas sucesivas, la nitrificación y la desnitrificación. La nitrificación se estudió en un grupo de microorganismos aislados a partir de diferentes fuentes acuíferas: una ciénaga eutrificada y aguas residuales procedentes de dos plantas de tratamiento; una de tipo petroquímico y otra de origen doméstico. Los microorganismos se evaluaron en condiciones oxigénicas a 305K en un sistema semicontinuo. Se comprobó la buena adaptac...

  8. REVISIÓN LEGISLATIVA SOBRE EL ELEMENTO CONTAMINANTE BORO EN AGUAS RESIDUALES INDUSTRIALES (GALICIA, NOROESTE DE ESPAÑA

    Directory of Open Access Journals (Sweden)

    Mª JESÚS RODRÍGUEZ GUERREIRO

    2011-01-01

    Full Text Available El ácido bórico y sus derivados se utilizan en numerosas actividades industriales, de tal manera que las aguas residuales procedentes de vertidos industriales constituyen una de las fuentes de boro para los lodos de depuradora o para las rías en caso de vertido directo desde los colectores. Los compuestos borados en las aguas residuales no son retenidos por los procesos de tratamiento en las estaciones depuradoras (EDAR por lo que son reintegrados al medio natural. Además, las EDAR no poseen legislación que limite y controle los compuestos borados generados en las aguas residuales de los vertidos industriales. De forma general se puede decir que la tendencia del boro a acumularse en los tejidos animales y vegetales constituyen un riesgo potencial para la salud de aquellos que consuman alimentos y aguas con altos contenidos de boro. Debido a la preocupación existente en algunas Comunidades autónomas sobre la contaminación por boro en sus EDAR se ha realizado un análisis de la situación actual del boro en la Legislación de la Comunidad Económica Europea y en las disposiciones de ámbito estatal y autonómico. Se ha llegado a la conclusión de que Galicia es una de las Comunidades que presenta una de las normativas autonómicas más permisivas para el valor del boro en las aguas residuales (Canon de vertido mayor 10 mg/L mientras que otras Comunidades autónomas tienen rebajado este valor.

  9. Derecho humano al agua en el Ecuador

    OpenAIRE

    Buitrón Cisneros, Ricardo

    2010-01-01

    En el Ecuador existe un proceso histórico de concentración y acaparamiento del agua. La política de ajuste estructural llevó a que empresas de servicios de agua potable sean privatizadas. La constitución del 2008 modificó el marco normativo para el agua en el país, se reconoce el derecho humano al agua, los derechos de la naturaleza, el manejo exclusivo público y comunitario y su no privatización. El proceso de reorganización institucional y de construcción de la nueva propuesta de ley de ...

  10. Alcalinidad en muestras de aguas. Ejercicio interactivo.

    OpenAIRE

    Milla González, Miguel

    2013-01-01

    La alcalinidad de un agua se debe fundamentalmente a la presencia de las especies básicas carbonato, hidrogenocarbonato y iones hidroxilos libres. En las aguas naturales, la especie de mayor interés es el hidrogenocarbonato, encontrándose el anión carbonato en aquellas aguas más alcalinas y en contacto con suelos o sedimentos ricos en calizas. La presencia de una base fuerte indica contaminación. En este ejercicio se analiza una muestra de agua para determinar su alcalinidad. La muestra puede...

  11. El agua y el arte

    Directory of Open Access Journals (Sweden)

    Chueca Goitia, Fernando

    1999-10-01

    Full Text Available Not available.En el artículo «El agua y el arte» se analiza la importancia que tiene el agua en el mundo del arte, a través de los jardines y sus muchas variedades. El autor se refiere luego a los diversos aspectos que tienen el jardín francés, el jardín inglés, y el jardín español, de acuerdo con su geografía, pluviometría y cultura propias. El jardín español de abolengo musulmán es el jardín de los países secos que atesoran el agua como bien precioso, porque no lo regala la naturaleza y es necesario transportarlo y encerrarlo en el cofre de una arquitectura sugerente. Por eso el jardín español es un jardín recoleto y misterioso, enclaustrado y secreto, sin lejanías ni perspectivas. Se extiende luego el autor en los jardines de la Alhambra granadina, sin olvidar otros, principalmente andaluces. Jardines de los claustros monacales, de El Escorial y de los Sitios reales, también interesan, en suma, al articulista.

  12. El territorio, un bien que conviene ordenar: las salinas del litoral e interior de la Región de Murcia

    Directory of Open Access Journals (Sweden)

    Salvador Gil Guirado

    2010-01-01

    Full Text Available En regiones como Murcia, ha existido un gran interés por acondicionar y ordenar ciertos espacios para la obtención de la sal. Esta ordenación del territorio, ha creado unos paisajes propios: las salinas, distinguiendo entre las litorales y las de interior. La metodología de trabajo, nos ha permitido localizar, describir y explicar casi una treintena de salinas en toda la Región de Murcia. Algunas continúan funcionando desde época romana como las del Principal en Jumilla, otras junto a la explotación salinera también son humedales protegidos legalmente (San Pedro del Pinatar en el litoral y Cabezo de la Rosa y Rambla Salada en el interior, pero la mayor parte están en proceso de abandono. Por lo que urge planificar para poner en valor este rico patrimonio de la Cultura del Agua y la Sal, generando así una gestión sostenible de los paisajes salineros.

  13. Comportamiento del concreto con bajos porcentajes de ceniza volante (termopaipa IV y agua constante

    Directory of Open Access Journals (Sweden)

    Luz Elena Santaella Valencia

    2004-01-01

    Full Text Available Este artículo se realiza con base en el trabajo de grado titulado “Influencia de la ceniza volante procedente de Termopaipa IV adicionada en bajos porcentajes al concreto” desarrollada por los estudiantes Milena Puerta Guarín y Helbert Rivera Bernal de la Universidad Militar Nueva Granada y con patrocinio, mediante convenio con la empresa Concretos Premezclados S.A. del grupo Holcim. Cenizas volantes provenientes de la combustión del carbón en la planta IV de Termopaipa se utilizaron para sustituir 10%, 20% y 30% de contenidos de cemento o de arena triturada de los diseños originales, manteniendo constante la cantidad de agua de mezclado del concreto. De los resultados obtenidos se puede deducir que el asentamiento y la densidad del concreto disminuyen cuando se sustituye arena por ceniza que cuando se reemplaza cemento por ceniza, con respecto a la muestra patrón. La sustitución del cemento por cenizas conduce a resistencias menores que al sustituir parte de la arena, manteniendo constante la cantidad de cemento y el contenido de agua. Este mismo comportamiento se observa en relación con el módulo de elasticidad del material.

  14. Longitudinal Analysis of Microbiota in Microalga Nannochloropsis salina Cultures.

    Science.gov (United States)

    Geng, Haifeng; Sale, Kenneth L; Tran-Gyamfi, Mary Bao; Lane, Todd W; Yu, Eizadora T

    2016-07-01

    Large-scale open microalgae cultivation has tremendous potential to make a significant contribution to replacing petroleum-based fuels with biofuels. Open algal cultures are unavoidably inhabited with a diversity of microbes that live on, influence, and shape the fate of these ecosystems. However, there is little understanding of the resilience and stability of the microbial communities in engineered semicontinuous algal systems. To evaluate the dynamics and resilience of the microbial communities in microalgae biofuel cultures, we conducted a longitudinal study on open systems to compare the temporal profiles of the microbiota from two multigenerational algal cohorts, which include one seeded with the microbiota from an in-house culture and the other exogenously seeded with a natural-occurring consortia of bacterial species harvested from the Pacific Ocean. From these month-long, semicontinuous open microalga Nannochloropsis salina cultures, we sequenced a time-series of 46 samples, yielding 8804 operational taxonomic units derived from 9,160,076 high-quality partial 16S rRNA sequences. We provide quantitative evidence that clearly illustrates the development of microbial community is associated with microbiota ancestry. In addition, N. salina growth phases were linked with distinct changes in microbial phylotypes. Alteromonadeles dominated the community in the N. salina exponential phase whereas Alphaproteobacteria and Flavobacteriia were more prevalent in the stationary phase. We also demonstrate that the N. salina-associated microbial community in open cultures is diverse, resilient, and dynamic in response to environmental perturbations. This knowledge has general implications for developing and testing design principles of cultivated algal systems.

  15. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  16. Impacto de las instalaciones ganaderas sobre la calidad y seguridad del agua subterránea

    Directory of Open Access Journals (Sweden)

    OP Luzardo

    2014-01-01

    Full Text Available La posibilidad de que las actividades ganaderas supongan una fuente de contaminación para los recursos hídricos ha sido una preocupación desde hace ya mucho tiempo, en particular en términos de contaminación por nutrientes (carga nitrogenada, fosfatos, salinidad, etc…. Pero desde hace varias décadas el incremento exponencial de la ganadería intensiva ha magnificado este problema, ya que ha aumentado el número de animales en reducido espacio y ha diversificado la cantidad de contaminantes potenciales (por ejemplo, antibióticos y otros medicamentos veterinarios. Según los datos disponibles, las prácticas generalmente aceptadas de gestión de residuos ganaderos, aún en las mejores condiciones, no garantizan una protección efectiva de los recursos hídricos. De esta manera se ha demostrado que las fuentes de agua cercanas a las actividades ganaderas resultan frecuentemente contaminadas con nutrientes excesivos (N, P, Cl-, patógenos microbianos, productos farmacéuticos, hormonas, metales pesados, desinfectantes, y otros contaminantes de los clasificados como emergentes. La exposición inadvertida a estos residuos procedentes de las instalaciones ganaderas a través de las aguas de consumo puede tener un impacto real sobre la salud humana y del medio ambiente. Por este motivo este tema constituye un problema de preocupación para las autoridades con responsabilidades en materia de Salud Pública. En esta revisión se identifican los principales riesgos de las operaciones de alimentación de animales confinados (CAFO sobre la salubridad y calidad de las aguas subterráneas y se detallan cuáles son los efectos documentados sobre la salud humana y medioambiental que dichos residuos tienen.

  17. Separador de agua y aceite

    OpenAIRE

    Gracia Pérez, Antonio

    2007-01-01

    Este proyecto pretende responder a la demanda actual existente, en relación al reciclaje y la reutilización de los residuos generados por los seres humanos, concretamente para éste caso, el aceite usado (uso doméstico). Actualmente existen máquinas de separación de agua y aceite, pero únicamente de uso industrial. Igualmente existen contenedores de recogida de aceite de uso doméstico, pero éstos no realizan ningún tipo de discriminación entre la naturaleza de las mezclas que se vierten, p...

  18. AGUA TIBIA PRIMITIVE AREA, CALIFORNIA.

    Science.gov (United States)

    Irwin, William P.; Thurber, Horace K.

    1984-01-01

    The Agua Tibia Primitive Area in southwestern California is underlain by igneous and metamorphic rocks that are siilar to those widely exposed throughout much of the Peninsular Ranges. To detect the presence of any concealed mineral deposits, samples of stream sediments were collected along the various creeks that head in the mountain. As an additional aid in evaluating the mineral potential, an aeromagnetic survey was made and interpreted. A search for records of past or existing mining claims within the primitive area was made but none was found. Evidence of deposits of metallic or nonmetallic minerals was not seen during the study.

  19. Evaluación de la calidad físico-química y bacteriológica del agua subterránea en pozos criollos del municipio de Moa

    Directory of Open Access Journals (Sweden)

    Osvaldo Fernández-Urgellés

    2007-03-01

    Full Text Available Los pobladores de los repartos Las Coloradas y La Playa (municipio de Moa utilizan para el consumo humano agua subterránea procedente de pozos criollos cuando falla la distribución de agua potable a través de la red hidrológica. Para conocer los componentes generales, mayoritarios y no deseables se evaluó la calidad físico-química y bacteriológica de estas aguas. Se emplearon las técnicas analíticas convencionales así como métodos gráficos. Los resultados reflejaron la presencia de elementos no deseables, indicadores de contaminación, que sobrepasan los índices establecidos para el consumo humano como agua potable. Los resultados del análisis bacteriológico evidenciaron la presencia de bacilos de colis y colifecales, siendo fundamentalmente su composición fecal lo que determina su estado sanitario. Se concluye que las aguas de los pozos criollos estudiados no responden a los requisitos establecidos en las normas para consumo humano.

  20. Detección de mutacarcinógenos en aguas del Río Pantanillo y efecto genotóxico de esta agua en el DNA nuclear y mitocondrial de células eucarióticas

    OpenAIRE

    Margarita Zuleta; Luz Yaneth Orozco

    2000-01-01

    Las aguas negras procedentes de domicilios, hospitales, fábricas, estaciones de gasolina, etc, están cargadas de gran variedad de mutacarcinógenos, como el benzopireno y el antraceno que se forman durante la combustión y pirólisis del material orgánico y se agrupan como hidrocarburos policíclicos aromáticos (HPA), además de las nitrosaminas y aminas heterocíclicas que se generan por la descomposición térmica d...

  1. Optimization of photosynthesis, growth, and biochemical composition of the microalga Rhodomonas salina

    DEFF Research Database (Denmark)

    Thuy, Minh Vu Thi; Douëtte, Claire; Rayner, Thomas Allan

    2016-01-01

    The cryptophyte Rhodomonas salina is widely used as feed for copepod cultures. However, culturing conditions to obtain high-quality algae have not yet been efficiently optimized. Therefore, we aimed to develop a cultivation protocol for R. salina to optimize its nutritional value and provide tech...

  2. Debate sobre el agua : punto de partida

    OpenAIRE

    2013-01-01

    A lo largo de este número de la revista encontrarás artículos concretos sobre el uso del agua en la agricultura, las bondades e inconvenientes de diferentes sistemas agrícolas y advertencias a los riesgos de privatización del agua, entre otros. Son temas que, desde la perspectiva de la Soberanía Alimentaria, debemos abordar contestando una pregunta fundamental: para que las y los agricultores puedan alimentar al Planeta y mantenerlo fértil, ¿qué uso y gestión hacemos del Agua?

  3. Distribución espacial de la calidad de las aguas subterráneas utilizadas para el riego

    Directory of Open Access Journals (Sweden)

    José Ramón Cabrera Alfonso

    2015-01-01

    Full Text Available La sostenibilidad ambiental y económica del regadío con aguas subterráneas provenientes de acuíferos costeros requieren de monitoreo y análisis periódicos que alerten sobre las posibles afectaciones en su calidad y los efectos contraídos sobre el sistema suelo-planta. El objetivo de este trabajo es evaluar con carácter espacial mediante indicadores como Conductividad Eléctrica (CE, Relación de Adsorción de Sodio corregido (RASº e Iones Tóxicos la calidad química de las aguas subterráneas utilizadas para riego en la Llanura Sur Occidental de Pinar del Río. Los resultados indicaron que el 100% de las fuentes se clasifican como salinas, sin restricción en cuanto su utilización ante la RAS. La concentración de iones tóxicos Sodio y Cloro representan el mayor grado de restricción ante la utilización de las aguas, presentado ambos para el riego por aspersión más del 95% de las fuentes restricción severa, para el riego superficial el 86,4% de las fuentes presentan restricción moderada por sodio, en cuanto al cloro el 42,4% presentan restricción moderada y el 52,4% severa. El carácter espacial de los diferentes indicadores, acentuados en las zonas cercanas a la costa deja claro la influencia de la intrusión marina en la ionización de las aguas.

  4. Diseño de una instalación para tratar un agua residual textil combinando tratamiento físico-químico y oxidación avanzada (Qdiseño = 100 m3/d)

    OpenAIRE

    2016-01-01

    [ES] El presente Trabajo Final de Grado tiene como finalidad diseñar una instalación para tratar el agua residual procedente de la industria textil. El tratamiento consiste en aplicar un tratamiento físico-químico y un tratamiento de oxidación avanzada. Para definir los parámetros de ambos tratamientos, se han realizado ensayos a nivel de laboratorio empleando disoluciones modelo. En el tratamiento físico-químico se han ensayado diferentes coagulantes y floculantes, haciéndose ...

  5. Metabolic engineering of Dunaliella salina for production of ketocarotenoids.

    Science.gov (United States)

    Anila, N; Simon, Daris P; Chandrashekar, Arun; Ravishankar, G A; Sarada, R

    2016-03-01

    Dunaliella is a commercially important marine alga producing high amount of β-carotene. The use of Dunaliella as a potential transgenic system for the production of recombinant proteins has been recently recognized. The present study reports for the first time the metabolic engineering of carotenoid biosynthesis in Dunaliella salina for ketocarotenoid production. The pathway modification included the introduction of a bkt gene from H. pluvialis encoding β-carotene ketolase (4,4'β-oxygenase) along with chloroplast targeting for the production of ketocarotenoids. The bkt under the control of Dunaliella Rubisco smaller subunit promoter along with its transit peptide sequence was introduced into the alga through standardized Agrobacterium-mediated transformation procedure. The selected transformants were confirmed using GFP and GUS expression, PCR and southern blot analysis. A notable upregulation of the endogenous hydroxylase level of transformants was observed where the BKT expression was higher in nutrient-limiting conditions. Carotenoid analysis of the transformants through HPLC and MS analysis showed the presence of astaxanthin and canthaxanthin with maximum content of 3.5 and 1.9 µg/g DW, respectively. The present study reports the feasibility of using D. salina for the production of ketocarotenoids including astaxanthin.

  6. Geoquímica de las aguas subterráneas en rocas metamórficas al SE de Salamanca

    Directory of Open Access Journals (Sweden)

    García, A.

    1991-08-01

    Full Text Available This paper describes the results of 77 chemical analyses of groundwater from springs and wells in the «Complejo Esquisto Grauváquico» and other paleozoic materials from the south of Salamanca province. The types of groundwater are very diverse, usually bicarbonate dominant, with TDS (Total Dissolved Solids between 0.6 and 16 milimoles/l. Salinity is shown to be greater in the drilled wells than in the dug wells and springs, which confirms the existence of deep flow. Principal Component Analysis indicates that the chemical composition of groundwater must be the result of multiple reactions between the water and the minerals that occur in parallel, with none of the reactions being specially predominant. The organization and geographic distribution of sorne of the elements suggest the existence of regional flow systems.Se presentan los resultados de 77 análisis químicos de aguas subterráneas procedentes de manantiales, pozos excavados y sondeos en el Complejo Esquisto Grauváquico y otros materiales paleozoicos al Sur de la provincia de Salamanca. Se trata de aguas muy dispares, en general bicarbonatadas mixtas, con TSD (total de sólidos disueltos entre 0,6 y 16 milimoles/l. Se pone de manifiesto una mayor salinidad de las aguas de sondeos en relación con las de pozos y manantiales, lo que demuestra la existencia de una circulación a cierta profundidad. El análisis de componentes principales muestra que la composición química de las aguas debe ser el resultado de múltiples reacciones entre el agua y los minerales que se producen en paralelo, sin que destaque ninguna en especial. La distribución geográfica ordenada de algunos elementos obliga a plantear como posible la hipótesis de la existencia de un flujo regional.

  7. Artemia salina acute immobilization test: a possible tool for aquatic ecotoxicity assessment.

    Science.gov (United States)

    Kalčíková, Gabriela; Zagorc-Končan, Jana; Zgajnar Gotvajn, Andreja

    2012-01-01

    Despite the fact that the marine crustacean Artemia salina is extensively used in ecotoxicology, there is still a lack of information about its sensitivity to commonly used chemicals. In the presented study, acute toxicity of 18 commonly used chemicals - including organic solvents, industrial chemicals, metals and inorganic compounds - to A. salina was evaluated. A. salina showed a range of sensitivities to tested chemicals. Regarding all of the investigated organics, phenolic compounds expressed the highest toxicity to A. salina. Nitrite and mercury were the most toxic inorganic substances applied in the study. On the other hand, dimethyl sulfoxide, nitrate and ammonium were the least toxic. The possibility to use A. salina for interspecies correlation was assessed by comparison of sensitivities of different organisms (bacteria, fish, crustacean) to organic compounds. Correlation between various species was observed, especially between A. salina and fish. Due to the strong relation between toxicity and the logarithm of the octanol/water partition coefficient logP(OW,) lipophilicity was found to be the main factor influencing toxicity of the chosen organic compounds. No significant correlation between toxicity to A. salina and physico-chemical parameters of metals was observed.

  8. Antioxidant status of Penaeus monodon fed with Dunaliella salina supplemented diet and resistance against WSSV

    Directory of Open Access Journals (Sweden)

    M. MADHUMATHI

    2011-10-01

    Full Text Available The present study investigates the protection of shrimp Penaeus monodon against white spot syndrome virus (WSSV using Dunaliella salina algal cells which contains an antioxidant betacarotene for the shrimp nonspecific immunity. To determine the antioxidant activity, the shrimp were treated in vivo (orally with feed methods at the concentration of 0.5 %, 1.0 % and 2 % D. salina incorporated with pellet feed, respectively. In the present study, anti-WSSV activity of D. salina incorporated diet by in vivo methods showed strongantioxidant activity and the immunological parameters such as proPO, SOD,catalase were higher in the WSSVinfected shrimp treated with D. salina incorporated diet when compared to control groups. These results strongly indicate that in vivo of D. salina incorporated diet enhances immunity of the shrimp. Based on the present data and the advantages of harvesting D. salina at low price, we believe that oral administration of D. salina live cells along with the pellet feed is a potential prophylactic agent against WSSV infection of shrimp tosome extent.

  9. Propiedades reológicas y de adsorción de agua de harina extrudida de arroz y bagazo de cebada

    Directory of Open Access Journals (Sweden)

    Fernanda Ferreira Cardoso

    2014-06-01

    Full Text Available El bagazo de cebada procedente de la industria cervecera se utiliza comúnmente en la alimentación animal, pero por medio de un proceso adecuado puede servir como alternativa en las formulaciones de productos alimentares ricos en fibra y proteína. La combinación de bagazo de cebada y arroz (82:18 fue procesada por extrusión para obtener la harina mixta extrudida de bagazo y arroz, de la cual se determinaron las propiedades reológicas y de adsorción de agua, cuyos valores fueron comparados con la harina de arroz cruda. Los modelos matemáticos de Oswin, Smith, Peleg (1988 y Peleg (1993 fueron utilizados para explicar las propiedades de absorción en diferentes temperatura (25, 30, 35 y 45 ºC y actividades de agua (0.11 a 0.97. Peleg (1993 fue el modelo que mejor describe las curvas de absorción de agua. El perfil de viscosidad aparente de la harina extrudida es similar al de harina de arroz crudo; no presenta viscosidad inicial pero se caracteriza por tener menor temperatura de pasta, quiebra de viscosidad y tendencia a la retrogradación.

  10. Evaluación de la salinidad potencial de aguas para riego en la cuenca del Cauto

    Directory of Open Access Journals (Sweden)

    Sandro Ricardo Palacio

    2010-01-01

    Full Text Available Se presentó la evaluación de la Salinidad Potencial (SP del agua procedente de la Estación de Bombeo Ingenio Viejo situada en la Cuenca del Cauto la que es utilizada para el riego en parte de las áreas agrícolas de la Empresa Antonio Maceo, a partir del análisis químico realizado por la Empresa de Aprovechamiento de Recursos Hidráulicos de Holguín. Se obtuvo un índice de (SP de 8.77, el cual la metodología lo indica como aguas condicionales para el riego por lo que debe mantenerse control sobre el comportamiento químico del suelo ya que se encuentra dentro del rango 3-15 según la metodología empleada. El índice considera que se produjo la precipitación de las sales menos solubles, quedando en solución los cloruros y sulfatos, con lo que aumentó considerablemente la presión osmótica sobre el suelo a bajos niveles de humedad, representando un peligro para zonas tendentes a la salinidad como lo es la zona de estudio, debido a su origen geológico. Se recomienda un tratamiento adecuado para su uso y manejo en la agricultura si se pretenden alcanzar mejores resultados sin agredir al medio ambiente.

  11. Presence of helminth eggs in sewage sludge from waste water plants; Presencia de huevos de helmintos en lodos procedentes de la depuracion de aguas

    Energy Technology Data Exchange (ETDEWEB)

    Martinez Muro, J. L.; Garcia Orenes, F.; Nieto Asensio, N.; Bonora, I. B.; Morenilla Martinez, J. J.

    2003-07-01

    Land application of sewage sludge is a usual practice in wide areas of the Comunidad Valencia, due the low organic contents and nutrients of the soils, and the sewage sludge is a suitable material to use os organic amendment of soils. However the use of sewage sludge involves a very detailed characterization of sewage, to avoid sanitary hazards as the presence of helminth eggs and its high resistant to most of the treatment used to stabilize sewage sludge. The aim of this work was determine the parasitic contamination of helminths found in sewage sludge, stabilized by anaerobic digestion, from two waste water plants of Alicante (Alcoy y Benidorm) destined to agricultural land. Also it was studies the evolution of helminth eggs content of a sewage sludge subjected to composting process. (Author) 12 refs.

  12. Salinas - An implicit finite element structural dynamics code developed for massively parallel platforms

    Energy Technology Data Exchange (ETDEWEB)

    BHARDWAJ, MANLJ K.; REESE,GARTH M.; DRIESSEN,BRIAN; ALVIN,KENNETH F.; DAY,DAVID M.

    2000-04-06

    As computational needs for structural finite element analysis increase, a robust implicit structural dynamics code is needed which can handle millions of degrees of freedom in the model and produce results with quick turn around time. A parallel code is needed to avoid limitations of serial platforms. Salinas is an implicit structural dynamics code specifically designed for massively parallel platforms. It computes the structural response of very large complex structures and provides solutions faster than any existing serial machine. This paper gives a current status of Salinas and uses demonstration problems to show Salinas' performance.

  13. Hydrothermal liquefaction of Spirulina and Nannochloropsis Salina under subcritical and supercritical water conditions

    DEFF Research Database (Denmark)

    Toor, Saqib; Reddy, H.; Deng, S.

    2013-01-01

    Six hydrothermal liquefaction experiments on Nannochloropsis salina and Spirulina platensis at subcritical and supercritical water conditions (220-375 °C, 20-255 bar) were carried out to explore the feasibility of extracting lipids from wet algae, preserving nutrients in lipid-extracted algae solid...... on Nannochloropsis salina at 350 °C and 175 bar. For Spirulina platensis algae sample, the optimal hydrothermal liquefaction condition appears to be at 310 °C and 115 bar, while the optimal condition for Nannochloropsis salina is at 350 °C and 175 bar. Preliminary data also indicate that a lipid-extracted algae...

  14. Toxic Assessment of Triclosan and Triclocarban on Artemia salina.

    Science.gov (United States)

    Xu, Xiaolu; Lu, Yin; Zhang, Deyong; Wang, Yinyin; Zhou, Xianshan; Xu, Huiying; Mei, Yu

    2015-12-01

    In this study, we investigated the possible acute toxic and genotoxic effects of triclosan (TCS) and triclocarban (TCC) on Artemia salina. Genotoxicity was evaluated using single-cell gel electrophoresis and apoptotic frequency assays (Annexin V-FITC/PI assay). Acute toxicity test results showed that TCC (LC50-24 h = 17.8 µg/L) was more toxic than TCS (LC50-24 h = 171.1 µg/L). Significant increases in both genotoxic biomarkers were observed at 24 h after initial exposure, indicating that these two chemicals are potentially dangerous for this aquatic biological model. Although further studies are required, a comparison of data both in vitro and in vivo allowed us to suggest possible mechanisms of action for TCS and TCC in this sentinel organism.

  15. Continuous flocculation-sedimentation for harvesting Nannochloropsis salina biomass.

    Science.gov (United States)

    Chatsungnoen, Tawan; Chisti, Yusuf

    2016-03-20

    A continuous flow process is developed for recovery of the biomass of the marine microalga Nannochloropsis salina. Flocculation-sedimentation is used to recover the biomass from an algal suspension with an initial dry biomass concentration of 0.5 g L(-1), as would be typical of a raceway-based biomass production system. More than 85% of the biomass initially in suspension could be settled by gravity in a flocculation-sedimentation device with a total residence time of ∼148 min. Aluminum sulfate was used as an inexpensive, readily available and safe flocculant. The optimal flocculant dosage (as Al2(SO4)3) was 229 mg L(-1). Relative to a highly effective 62-min batch flocculation-sedimentation process for the same alga and flocculant, the continuous flow operation took longer and required nearly double the flocculant dose. The design of the flocculation-sedimentation system is explained.

  16. Iron metallodrugs: stability, redox activity and toxicity against Artemia salina.

    Science.gov (United States)

    Vitorino, Hector Aguilar; Mantovanelli, Luca; Zanotto, Flavia Pinheiro; Espósito, Breno Pannia

    2015-01-01

    Iron metallodrugs comprise mineral supplements, anti-hypertensive agents and, more recently, magnetic nanomaterials, with both therapeutic and diagnostic roles. As biologically-active metal compounds, concern has been raised regarding the impact of these compounds when emitted to the environment and associated ecotoxicological effects for the fauna. In this work we assessed the relative stability of several iron compounds (supplements based on glucoheptonate, dextran or glycinate, as well as 3,5,5-trimethylhexanoyl (TMH) derivatives of ferrocene) against high affinity models of biological binding, calcein and aprotransferrin, via a fluorimetric method. Also, the redox-activity of each compound was determined in a physiologically relevant medium. Toxicity toward Artemia salina at different developmental stages was measured, as well as the amount of lipid peroxidation. Our results show that polymer-coated iron metallodrugs are stable, non-redox-active and non-toxic at the concentrations studied (up to 300 µM). However, TMH derivatives of ferrocene were less stable and more redox-active than the parent compound, and TMH-ferrocene displayed toxicity and lipid peroxidation to A. salina, unlike the other compounds. Our results indicate that iron metallodrugs based on polymer coating do not present direct toxicity at low levels of emission; however other iron species (eg. metallocenes), may be deleterious for aquatic organisms. We suggest that ecotoxicity depends more on metal speciation than on the total amount of metal present in the metallodrugs. Future studies with discarded metallodrugs should consider the chemical speciation of the metal present in the composition of the drug.

  17. en el riego con aguas residuales

    Directory of Open Access Journals (Sweden)

    Reynaldo Roque R.

    2006-01-01

    Full Text Available Es una realidad mundial, actual, que el agua potable es cada día más escasa para todos los usos en las actividades diarias de la población. La agricultura es el mayor consumidor de agua, con marcado incremento en los países en vías de desarrollo donde a su vez se requiere de una mayor producción de alimentos. En áreas urbanas y periurbanas el agua que se requiere para los cultivos hortícolas y riego de campos deportivos y de jardines compite fuertemente por las necesidades crecientes de la población. El uso de aguas residuales de las plantas de tratamiento y lagunas de oxidación se presenta como una alternativa viable para ser utilizada como agua de riego, empleando los sistemas de riego de pivote central, tecnología de punta que ha evolucionado cualitativamente en los últimos años, ofreciendo paquetes integrales, desde los módulos de emisores hasta las posibilidades de programación de los riegos que la hacen grandemente atractivas, técnica y económicamente para estos fines.

  18. Stratigraphic and structural analysis of the Neogene sediments of the offshore portion of the Salina del Istmo Basin, southeastern Mexico

    Science.gov (United States)

    Gomez-Cabrera, Pedro Tomas

    2003-10-01

    Southeastern Mexico has been affected by regional and local tectonic events. Regional tectonic events are the Gulf of Mexico opening and the lateral movement of micro-plates on the Pacific margin. The local tectonic events are related to salt tectonics. Autochthonous Jurassic salt serves as the detachment level for the main compressional event in the late Miocene. Jurassic salt was allochthonously emplaced in the late Miocene, then partially displaced by a huge quantity of terrigenous sediments during the Plio-Pleistocene. This research is a study of the main geological processes that have influenced the structural and stratigraphic evolution of the Neogene sediments in the offshore portion of the Salina del Istmo basin known as the Marbella area. Owing to data availability, the project was divided into regional and local studies. The regional study is based on 2D multi-channel seismic reflection data, and the local study is based on a 3D seismic streamer survey. Structural analysis in the regional study permits the recognition of four buried fold belts (Agua Dulce, Catemaco, Marbella, and Marbella Norte) trending roughly NE. These fold belts are the result of tectonic convergence in the pacific margin during late Miocene. The Agua Dulce and Marbella Norte fold belts are separated by an enormous salt withdrawal basin called the Pescadores basin. The Pescadores basin is bounded on the north by a spectacular stepped, counter-regional structure. Beyond the Pescadores basin, a salt mini-basin area is recognized in the upper continental slope. Another important structural element is the Sal Somera canopy in the southern part of the study area. Sedimentation-rate analysis, based on isochore mapping in the local study area, indicates that from SB-2.4 to SB-2.6 Ma, deposition rate peaked with a maximum of 7.5 mm/yr. Regional and local structural restorations show that, in general, the maximum allochthonous salt mobilization was during the Plio-Pleistocene because of the

  19. DISTRIBUCIÓN DE DOS INDICADORES BACTERIANOS DE CALIDAD DE AGUA EN EL GOLFO DE URABÁ, CARIBE COLOMBIANO

    Directory of Open Access Journals (Sweden)

    GÓMEZ VELÁSQUEZ. FELIPE ANDRÉS

    2010-05-01

    Full Text Available Entre el 13 de Junio de 2006 y el 16 de Junio de 2007, las bacterias indicadoras de calidad ambiental y sanitaria, Coliformes Totales (CT y Coliformes Fecales (CF, fueron determinadas en las aguas del Golfo de Urabá, Colombia, empleando el método del NMP, mediante la técnica de tubos múltiples. El estudio fue realizado para evaluar la distribución de estos indicadores microbianos a nivel vertical y horizontal y la relación con algunas variables fisicoquímicas de temperatura del agua, salinidad, oxígeno disuelto y pH; y para así poder definir la relevancia de estos indicadores en ecosistemas marinos. La mayoría de las muestras colectadas presentó concentraciones de los indicadores menores o iguales a la norma. Las áreas donde se determinó la mayor concentración de bacterias coniformes, correspondieron a los sitios ubicados cerca de la desembocadura de los ríos Atrato y León, donde las concentraciones salinas fueron bajas. El análisis estadístico muestra la salinidad como el principal factor ambiental responsable de la concentración y distribución de las bacterias CT y CF para las estaciones evaluadas en el Golfo de Urabá, evidenciando un efecto inhibidor sobre estos dos indicadores.

  20. Phototoxicity activity of Psoralea drupacea L. using Atremia salina bioassay system

    Directory of Open Access Journals (Sweden)

    Mohammad Ramezani

    2011-07-01

    Conclusion: The result showed that P. drupacea methanolic extract and chloroform fraction have phototoxicity in A. salina bioassay system and their toxic effect is related to phototoxic constituents such as psoralen.

  1. THE BRINE SHRIMP (ARTEMIA SALINA) LETHALITY OF Brassica oleracea var. capitata

    OpenAIRE

    O.T. TÜZÜN, E. GÜRKAN, F. HIRLAK,

    2015-01-01

    This work covers up the bio-activities of the five fractions obtained from the ethanolic extract of Brassica oleracea var. capitata (Cruciferae).Key Words: Brassica oleracea var. capitata, Brine shrimp (Artemia salina)

  2. Nivel de arsénico en abastecimientos de agua de consumo de origen subterráneo en la comunidad de Madrid

    Directory of Open Access Journals (Sweden)

    Aragonés Sanz Nuria

    2001-01-01

    Full Text Available Fundamento: En 1998 se detectaron en la Comunidad de Madrid concentraciones de arsénico mayores de 50myg/l en algunos abastecimientos de agua de consumo de origen subterráneo, concentración máxima admisible en el agua de bebida en España. El objetivo de este trabajo fue determinar la concentración de arsénico en el agua procedente de abastecimientos subterráneos en la Comunidad de Madrid. Métodos: Se presentan los resultados de los dos primeros muestreos realizados en el plan de seguimiento de niveles de arsénico establecido. En la primera fase se analizaron muestras de agua de los 353 abastecimientos censados por la Dirección General de Salud Pública de la Comunidad de Madrid. Con estos primeros resultados se realizó una clasificación de riesgo de los abastecimientos. En una segunda fase, seis meses después, se repitieron los análisis en los 35 abastecimientos que se consideró podían suponer un riesgo para la salud pública. Resultados: El 74% de los abastecimientos estudiados en la primera fase presentaron una concentración de arsénico menor de 10myg/l; el 22,6% contenía niveles entre 10 y 50myg/l; y en el 3,7% eran superiores a 50myg/l. La mayoría de los abastecimientos con niveles de arsénico superiores a 10myg/l se encuentran situados en la misma zona geográfica. En el segundo muestreo (6 meses después se incluyeron los 35 abastecimientos clasificados de riesgo. De ellos, 26 presentaron el mismo nivel de arsénico (10-50myg/l y 9 cambiaron de categoría: 6 pasaron a tener menos de 10myg/l y 3 más de 50myg/l. Conclusiones: La vigilancia periódica de la calidad del agua realizada por la Dirección General de Salud Pública ha permitido detectar la presencia de 16 abastecimientos de agua de consumo de origen subterráneo con más de 50myg/l de arsénico, nivel máximo admisible según la legislación vigente en nuestro país. Se han adoptado medidas para evitar el consumo de agua en estos abastecimientos.

  3. NIVEL DE ARSÉNICO EN ABASTECIMIENTOS DE AGUA DE CONSUMO DE ORIGEN SUBTERRÁNEO EN LA COMUNIDAD DE MADRID

    Directory of Open Access Journals (Sweden)

    Nuria Aragonés Sanz

    2001-01-01

    Full Text Available Fundamento: En 1998 se detectaron en la Comunidad de Madrid concentraciones de ars nico mayores de 50 g/l en algunos abastecimientos de agua de consumo de origen subterr neo, concentraci n m xima admisible en el agua de bebida en Espa a. El objetivo de este trabajo fue determinar la concentraci n de ars nico en el agua procedente de abastecimientos subterr neos en la Comunidad de Madrid. M todos: Se presentan los resultados de los dos primeros muestreos realizados en el plan de seguimiento de niveles de ars nico establecido. En la primera fase se analizaron muestras de agua de los 353 abastecimientos censados por la Direcci n General de Salud P blica de la Comunidad de Madrid. Con estos primeros resultados se realiz una clasificaci n de riesgo de los abastecimientos. En una segunda fase, seis meses despu s, se repitieron los an lisis en los 35 abastecimientos que se consider pod an suponer un riesgo para la salud p blica. Resultados: El 74% de los abastecimientos estudiados en la primera fase presentaron una concentraci n de ars nico menor de 10 g/l.; el 22,6% conten a niveles entre 10 y 50 g/l.; y en el 3,7% eran superiores a 50 g/l.. La mayor a de los abastecimientos con niveles de ars nico superiores a 10 g/l. se encuentran situados en la misma zona geogr fica. En el segundo muestreo (6 meses despu s se incluyeron los 35 abastecimientos clasificados de riesgo. De ellos, 26 presentaron el mismo nivel de ars nico (10-50 g/l. y 9 cambiaron de categor a: 6 pasaron a tener menos de 10 g/l. y 3 m s de 50 g/l.. Conclusiones: La vigilancia peri dica de la calidad del agua realizada por la Direcci n General de Salud P blica ha permitido detectar la presencia de 16 abastecimientos de agua de consumo de origen subterr neo con m s de 50 g/l. de ars nico, nivel m ximo admisible seg n la legislaci n vigente en nuestro pa s. Se han adoptado medidas para evitar el consumo de agua en estos abastecimientos.

  4. Subproductos halogenados de la cloración en el agua de consumo público Halogenated by-products of chlorination in tap water

    Directory of Open Access Journals (Sweden)

    J. Calderón

    2002-06-01

    Full Text Available Objetivo: La presencia de trihalometanos en el agua de diversas ciudades españolas está demostrada. Este estudio pretende analizar sus concentraciones en el agua de la ciudad de Barcelona. Métodos: Se analizan 151 muestras de agua recogidas durante el año 1998. Los análisis se realizaron en el laboratorio municipal mediante purge and trap y posterior determinación por cromatografía de gases acoplada a espectrofotometría de masas. Los resultados se presentan según el origen del agua: ríos Llobregat, Ter o mezcla. Resultados: En aguas del Ter los valores son relativamente bajos y predominan cloroformo y bromodiclorometano, mientras que en las del Llobregat son más elevados y predominan bromoformo y dibromoclorometano. Las aguas de mezcla presentan valores intermedios. Los valores totales alcanzados en las muestras procedentes del Llobregat superan los 100 µg/l. Conclusiones: Estos resultados muestran la necesidad de seguir corrigiendo la contaminación orgánica y los compuestos halogenados en el agua captada para el consumo humano en Barcelona.Objective: The presence of trihalomethanes in the water systems of several Spanish cities has been demonstrated. The aim of this study was to analyze trihalomethane concentrations in the water provided for human consumption in the city of Barcelona. Methods: We analyzed 151 water samples collected in 1998. The analyses were performed in the Public Health Laboratory of Barcelona using the purge-and-trap method and subsequent determination by gas chromatography and mass spectrometry. The results are presented according to the source of the water: the rivers of Llobregat or Ter, or a mixture of these. Results: Thrihalomethane concentrations in the water from Ter were relatively low, with a predominance of chloroform and bromodichloromethane, while concentrations in the water from Llobregat were much higher, with a predominance of bromoform and dibromochloromethane. Mixed water showed intermediate

  5. Repercusiones sanitarias de la calidad del agua: los residuos de medicamentos en el agua

    OpenAIRE

    Cristina Postigo Rebollo; Meritxell Gros Calvo; María José López de Alda Villaizán; Mira Petrovic; Antoni Ginebreda Martí; Damià Barceló Culleres

    2011-01-01

    Este trabajo resume varios estudios de monitorización de fármacos y drogas de abuso llevados a cabo en el medio ambiente acuático de las cuencas de los ríos Llobregat y Ebro con el fin de evaluar la calidad del agua en relación a la presencia de estas substancias y su potencial riesgo para la salud ambiental y pública. La identificación de estos compuestos aguas abajo del punto de vertido de las plantas depuradoras apunta a la descarga de agua residual tratada como la principal fuente de emis...

  6. Pengaruh Medium Tercemar Logam Pb dan Cu terhadap Pertumbuhan Nannochloropsis Salina

    OpenAIRE

    Abd.Wahid Wahab; Yusafir Hala; Fibiyanthy

    2013-01-01

    Penelitian ini dilakukan dengan tujuan memanfaatkan fitoplankton Nannochloropsis salina sebagai biosorben untuk ion logam Pb dan Cu di perairan. Pada penelitian ini pemaparan ion logam Pb dan Cu dengan variasi konsentrasi masing-masing 10, 30, dan 50 ppm dilakukan di awal masa pertumbuhan fitoplankton N. salina dalam Medium Conwy pada salinitas 30 ???, aerasi dan pencahayaan kontinyu, serta suhu ruangan 20 ??C. Konsentrasi ion logam ditentukan dengan menggunakan spektrofotometer serapan atom ...

  7. Acute toxicity of furazolidone on Artemia salina, Daphnia magna, and Culex pipiens molestus larvae

    Energy Technology Data Exchange (ETDEWEB)

    Macri, A.; Stazi, A.V.; Dojmi di Delupis, G.

    1988-10-01

    As a result of evidence of the ecotoxicity of nitrofurans, the acute toxicity of furazolidone was tested in vivo on two aquatic organisms, Artemia salina and Daphnia magna, which are both crustaceans. Toxicity studies were also performed on larvae of Culex pipiens molestus. Results indicated a significant toxicity of the compound on Culex pipiens and Daphnia magna, while Artemia salina proved to be the least sensitive.

  8. [Determination of Pleurotus ostreatus, Pleurotus pulmonarius and Paxillus involutus toxicity over Artemia salina].

    Science.gov (United States)

    Nieto R, Ivonne J; Salama, Ahmed M; Cataño P, Jorge E; Chegwin A, Carolina

    2008-09-30

    We report the toxicity of ethanolic extracts in Pleurotus ostreatus, Pleurotus pulmonarius and Paxillus involutus over that obtained in Artemia salina. P. involutus showed the highest toxicity (LC50 = 94.4 microg/ml), similar to that detected using potassium dichromate pattern. P. pulmonarius and P. ostreatus did not show toxicity over A. salina in concentrations lower than 1,000 microg/ml.

  9. 用卤虫(Artemia salina L.)评价杀虫活性%Evaluate Insecticidal Activity Using Artemia salina L.

    Institute of Scientific and Technical Information of China (English)

    王再强; 周红; 韩俊; 何月秋; 录丽平

    2011-01-01

    [Aims]Artemia salina L.is general used for preliminary assessment of pharmacological activity.However,it is necessary to evaluate the suitability of A.salina L.before it is used as a model material for screening insecticidal activity.Here, 14 insecticides with 10 different action mechanisms were selected to evaluate insecticidal activity against A.salina L.used as a model material.[Results]13 Insecticides significantly killed A.salina L., Moulting hormone agonist and compound stimulating GABA release were the most active.[Conclusions]A.salina L.is a suitable organism to evaluate insecticidal activity and the method is simple having good sensitivity to many insecticides with different action mechanisms.%[目的]以卤虫(Artemia salina L.)为模式生物对化合物的药理活性进行初步评价.对10种不同作用机制的14种杀虫剂进行了生物筛选试验.[结果]14种供试杀虫剂中有13种对卤虫有显著的毒杀效果,作用于以γ-氨基丁酸为神经递质传导系统的化合物及蜕皮激素类似物效果最为显著.[结论]用卤虫筛选杀虫剂活性的方法简便,对多种作用机制的杀虫剂灵敏.

  10. Interspecific competition and allelopathic interaction between Karenia mikimotoi and Dunaliella salina in laboratory culture

    Science.gov (United States)

    He, Dong; Liu, Jiao; Hao, Qiang; Ran, Lihua; Zhou, Bin; Tang, Xuexi

    2016-03-01

    Algal allelopathy is a manifold ecological/physiological phenomenon that is focused on chemical interactions and autotoxicity. We investigated the allelopathic interactions between Karenia mikimotoi and Dunaliella salina in laboratory cultures based on diff erent temperature (15°C, 20°C, and 25°C) and lighting (40, 80, and 160 μmol/(m2·s)) conditions. The growth of D. salina in bi-algae culture (1:1 size/density) was significantly restrained. The results of cell-free filtrate culture indicate that direct cell-tocell contact was not necessary in interspecific competition. Further experimental results demonstrated that allelochemicals released from K. mikimotoi were markedly influenced by both temperature ( P =0.013) and irradiance ( P =0.003), resulting in diff erent growth characteristics of D. salina in filtrate mediums. Compared with the plateau period, K. mikimotoi exudates in the exponential phase had a stronger short-term inhibition effect on D. salina in normal conditions. A clear concentration-dependent relationship was observed in the effect of allelochemicals released from K. mikimotoi with low-promoting and high-repressing effects on D. Salina in a short time-scale. In addition, allelopathic substances remain stable and effective under high temperature and pressure stress. Many flocculent sediments adhering with D. salina cells were observed in all filtrate mediums, while the quantity and color depended on the original culture conditions.

  11. Potencial contaminante del mar por aguas residuales de las industrias de harinas y aceites de pescado

    Directory of Open Access Journals (Sweden)

    Mendiola, Santiago

    1998-02-01

    Full Text Available . In this study we addressed the polluting potential that constitutes the disposal of wastewater from the fish meal and oil Industries Into the sea. With this aim we have analysed some phisico-chemical and bacteriologic aspects of the effluents of these industries, including: weight percentage of organic matter, chemical oxygen load, fatty acids saturation, and presence of Salmonellas. The results suggest a low polluting potential for these effluents, although the acid pH and the high rate of saturation found In fatty acids of oil fishes could imply a certain toxicity for the marine environment.

    En este trabajo se evalúa el potencial contaminante que representa el vertido al mar de los desechos procedentes de las industrias de harinas y aceites de pescado. Para ello se han analizado algunos aspectos de la composición físico-química y bacteriológica de los efluentes residuales de estas industrias, incluyendo entre otros: porcentaje en peso de materia orgánica, demanda química de oxígeno, saturación de ácidos grasos y presencia de Salmonellas. Los resultados muestran en general un bajo potencial contaminante de estas aguas residuales, aunque su pH ácido y el alto grado de saturación encontrado en los ácidos grasos de los aceites de pescado podrían conllevar una cierta toxicidad para el medio marino.

  12. "Zaragoza,ciudad ahorradora de agua"

    Directory of Open Access Journals (Sweden)

    Viñuales Edo, Victor

    2000-02-01

    Full Text Available In the year before the project was initiated, 11 million Spaniards were undergoing daily water restrictions. There were serious inter-regional conflicts over this scarce commodity. There seemed to be only one solution: more reservoirs and more water trans-shipments, what means high costs and harm to the environment. In Zaragoza, a city of 700.000 inhabitants in the north -cast of Spain, as in other cities in Spain, a triple paradox was to emerge: rainfall was scarce and irregular. water was cheap, and it was being misused. February 1997 saw the beginning of the "Zaragoza, the water-saving city" project. This aimed to promote a new water-saving consciousness through a more efficient management of this resource. It emphasised, above all, the importance of simple technological change to achieve a sustainable reduction in water consumption. The project was to issue a challenge to the city: to save 1.000 million litres of domestic water consumption in one year The project has shown that it is possible to deal with the shortage of water incities, using a cheap, ecological, fast and contentious-free app roach, by increasing efficiency in consumption. The most important lesson to be learnt is that the shared responsibility between the main players (manufacturers, retailers, consumers, distributors. plumbers, etc. has managed to create a new synergy which favours water-use efficiency. 1176 million litres of water have been saved. Spanish cities now have a successful model to follow for the most ecologically-so und method of facing up to the next drought.EI año anterior al inicio del proyecto, 11 millones de españoles sufrieron restricciones diarias de agua. Los conflictos entre regiones por el agua escasa fueron muy graves. Parecía que solo había una solución: mas pantanos y mas trasvases. Y su consecuencia inevitable: inversiones multintillonarias, daños al medio ambiente, larguisimos plazos de ejecución. En Zaragoza, ciudad del nordeste de Espa

  13. TRATAMIENTO DE AGUAS RESIDUALES DE UNA INDUSTRIA PROCESADORA DE PESCADO EN REACTORES ANAERÓBICOS DISCONTINUOS

    Directory of Open Access Journals (Sweden)

    Julio César Marín Leal

    2015-01-01

    Full Text Available En el presente trabajo se evaluó el tratamiento de las aguas residuales de una industria procesadorade pescado de la ciudad de Manta (Ecuador, en reactores anaeróbicos discontinuos, y se estableciósu adecuación a las normas ambientales vigentes en materia de vertido. Para ello, se realizaronensayos de laboratorio en reactores discontinuos de 1 L, con un tiempo de contacto de 24 h yprovistos de un lodo anaerobio procedente de una planta de tratamiento de aguas residualesdomésticas. Dicho efluente fue diluido con agua destilada en proporciones de 33%, 66% y 100%,correspondientes a las etapas I, II y III, respectivamente. Durante cada etapa se monitorearon los siguientes parámetros, de acuerdo con los métodos estándares: pH, alcalinidad total, DBO5.20,DQO, nitrito, amonio, nitrógeno total Kjeldahl (NTK, ortofostato, sulfato, sólidos suspendidostotales (SST y sólidos suspendidos volátiles (SSV. Los resultados muestran porcentajes deremoción de materia orgánica, expresados como DBO5.20(37.9±4.1%; 41.8±7.6% y 46.2±3.2% yDQO (34.7±9.7%; 36.9±9.2% y 43.8±4.1%, para las etapas I, II y III, respectivamente, relativamentebajos como resultado del origen del inóculo usado, así como del contenido relativo de sales en elefluente industrial. Las remociones de amonio, NTK y ortofosfato estuvieron entre 60-95%, 25-37% y 6-25%, respectivamente. Bajo las condiciones de los ensayos realizados, el efluente tratadorequiriere de la aplicación de un postratamiento para reducir el contenido de materia orgánica ynutrientes a los límites permisibles de descarga establecidos en la República de Ecuador.

  14. Acuerdos, desacuerdos y conflictos sobre el agua. EL juez de agua en el Valle de Quibor, Venezuela

    OpenAIRE

    Canelón, Jesús Eduardo

    2008-01-01

    El siguiente artículo discute varios planteamientos realizados por expertos en el tema de los conflictos sobre el agua. Se hace un análisis psicosocial, de la producción de sentidos sobre los conflictos y acuerdos que se relacionan con el agua, en el Valle de Quibor, sobre todo, con el agua de riego y su manejo en época de sequía. Aparece la figura del juez del agua quien, sin tener un poder legal sino un poder que le otorga el ser electo por los usuarios del agua. Se concluye, entre otras co...

  15. Como una luna en el agua [Score

    Directory of Open Access Journals (Sweden)

    Francisco del Pino

    2014-12-01

    Full Text Available The title of the solo piano piece Como una luna en el agua, composed between June and July of 2014, refers to the end of the seventh chapter of the novel Rayuela (Hopscotch by the Argentine writer Julio Cortázar, in which an allegorical description of a kiss takes the form of a prose poem.

  16. Agua y tiempo en el arte

    Directory of Open Access Journals (Sweden)

    Juan Pando Despierto

    1993-01-01

    Full Text Available Elemento básico de la división simbólica del mundo antiguo, el agua sigue siéndolo en la modernidad, y con una autoridad indiscutible, a la que su propia potencia —y su rareza esencial tratándose de agua dulce—, proporcionan un vigor estético y una fuerza geoestratégica planetarias. El arte hizo siempre del agua un factor de meditación y de representación, de concreción de los sueños del hombre. Su ductilidad plástica, propia para todos los marcos, todas las facturas, la hizo servir también como vehículo expresivo de todas las culturas. Unida a la eclosión misma de la vida, el agua es símil igualmente de tiempo: mientras ella exista, aquél será «comprensible», esto es, habitado por la inteligencia humana.

  17. Trihalometanos en aguas de consumo humano

    Directory of Open Access Journals (Sweden)

    C Hernández Sánchez

    2011-01-01

    Full Text Available Los trihalometanos (THMs son subproductos de desinfección que resultan de la cloración de las aguas. Los THMs engloban a sustancias como el cloroformo (CHCl , el 3 bromodiclorometano (CHBrCl , el clorodibromometano (CHBr Cl 2 2 y el tribromometano (CHBr . La Agencia Internacional para la 3 Investigación del Cáncer ha clasificado al cloroformo y al bromodiclorometano en el grupo 2B que incluye a las sustancias posiblemente carcinogénicas en humanos. Debido a su toxicidad y a que el agua de consumo humano constituye la principal vía de exposición del hombre a estos compuestos, su presencia en las aguas de consumo humano está limitada por la Directiva Europea 98/83/CE a 100 ìg/L. En esta revisión se destacan los aspectos más relevantes sobre su toxicidad, reglamentación, determinación, concentración en aguas, variaciones estacionales y eliminación.

  18. Purification and characterization of a carboxymethyl cellulase from Artemia salina.

    Science.gov (United States)

    Zin, Hyun Woo; Park, Kwang-Hyun; Choi, Tae Jin

    2014-01-03

    Brine shrimp (Artemia salina) belong to a group of crustaceans that feed on microalgae and require a cellulase enzyme that can be used in ethanol production from marine algae. Protein with potential cellulase activity was purified and the activity analyzed under different conditions. After initial identification of cellulase activity by CMC cellulase, surface sterilization and PCR using 16s rRNA primers was conducted to confirm that the cellulase activity was not produced from contaminating bacteria. The enzyme was purified by ammonium sulfate fractionation, gel filtration, and ion exchange chromatography. After the final purification, a 70-fold increase in specific enzyme activity was observed. SDS-PAGE results revealed that the cellulase enzyme had a molecular mass of 96 kDa. Temperature, pH, and salinity values were found to be optimal at 55 °C, pH 8.0, and 600 mM NaCl, respectively. Specifically, the enzyme showed a fivefold increase in enzyme activity in seawater compared to 600 mM NaCl in phosphate buffer. Further analysis of the purified enzyme by molecular spectrometry showed no match to known cellulases, indicating this enzyme could be a novel halophilic cellulase that can be used for the production of bioethanol from marine macroalgae.

  19. Acute toxicity of TBT and IRGAROL in Artemia salina.

    Science.gov (United States)

    Panagoula, Bakoulia; Panayiota, Marcouli; Iliopoulou-Georgudaki, Joan

    2002-01-01

    A 24-hour LC(50) bioassay method was carried out to study acute toxicity of Tributyltin (TBT) and IRGAROL (C(11)H(19)N(5)S) in Artemia salina. Five graded levels of both biocides were tested. According to the range test, the doses of TBT were 11.6 ng x l(-1), 21.0 ng x l(-1), 37.3 ng x l(-1), 65.2 ng x l(-1), and 116.5 ng x l(-1), and for IRGAROL were 1.0 mg x l(-1), 1.8 mg x l(-1), 3.2 mg x l(-1), 5.6 mg x l(-1), and 10 mg x l(-1). The determined LC(50) values were 41.41 ng x l(-1) and 1.62 mg x l(-1) respectively. These results indicate that in this system TBT is acutely more toxic than IRGAROL; however, both are proven environmentally toxic substances.

  20. Modelado cinético y matemático de la reacción de gasificación catalítica de la glucosa en agua en condiciones supercríticas para la producción de hidrógeno

    OpenAIRE

    Zalamea, Silvana; Mejía, William; Serrano, José

    2016-01-01

    El Hidrógeno producido a partir de la biomasa procedente de los residuos de la planta de banano es considerado como un combustible altamente eficiente. Uno de los métodos más limpios para su obtención es la gasificación catalítica en agua en condiciones supercríticas, en donde se transforman los polisacáridos constitutivos de la biomasa (celulosa, hemicelulosa y lignina) en productos gaseosos de elevado valor. En el desarrollo de la reacción de gasificación es importante el dis...

  1. Un vaso de alabastro procedente de Adra conservado en el Museo de Almería

    Directory of Open Access Journals (Sweden)

    García Alfonso, Eduardo

    1998-12-01

    Full Text Available A previously unpublished alabaster jar from Adra, a coastal site some 50 km to the west of Almería is yet another example of a numerous class of Egyptian containers of the 8th-7th centuries BC discovered on the southern coast of the Iberian Peninsula. A casual find, the funerary character of this piece suggests that there may have been a cemetery of the Early Phoenician Period in the immediate neighbourhood of the colonial settlement of Abdera.Se estudia un vaso de alabastro inédito procedente de la localidad almeriense de Adra, pieza que se añade a la ya numerosa serie de recipientes de origen egipcio conocida en las costas meridionales de la Península durante los siglos VIII-VII a.C. El principal interés de este hallazgo casual radica en su carácter funerario, siendo indicio de una posible necrópolis de época fenicia arcaica en las inmediaciones del asentamiento colonial de Abdera.

  2. Nuevo registro de Leptosalenia barredai Forner, 2014 (Echinoidea, procedente del Albiense de la cuenca Vasco-Cantábrica

    Directory of Open Access Journals (Sweden)

    Aranguren, C., Moreno, A., Forner, E.

    2015-01-01

    Full Text Available Se da la segunda cita de Leptosalenia barredai Forner, 2014. El equínido, de la familia Saleniidae L. Agassiz 1838, se ha encontrado en el cabo de Ajo (Cantabria, procedente de una unidad de calizas y margocalizas marinas someras con corales del Albiense inferior de la cuenca Vasco-Cantábrica. La especie sólo se conocía en su localidad tipo de Traiguera (cuenca del Maestrat, procedente de las capas de arenisca estuarinas del Albiense inferior y medio. Asimismo se establecen las diferencias entre L. barredai y L. faringdonensis Smith - Wright, 1990. Paralelamente se ofrece también una nueva cita del coral Actinoseris sp., (Cnidaria del Albiense de Traiguera descrito con nomenclatura abierta por Reig (1993.

  3. Variación de 13C en el ambiente de Madrid (atmósfera, aguas superficiales y aguas subterráneas

    Directory of Open Access Journals (Sweden)

    Redondo, R.

    1995-08-01

    Full Text Available Stable isotopes of carbon are studied in atmosphere, freshwater (rivers and groundwater of the region of Madrid. Sampling and analytical techniques are adapted for the isotopic study of carbon in the environment. The atmosphere samples show δ13C values from -13.92 to -15.67 ‰, closely related to the polution level of air. The water from wells, to the Tertiary detritic aquifer, with δ13C among -13.92 and -15.67 ‰. The dissolution of carbonatic rocks and the biologic activity could be the origin of the wide variations δ13C from -7.07 to -11.85 %0 found in the waters from rivers Jarama, Guadalix and Guadarrama.Se analizan el 13C de la atmósfera, ríos y pozos del área de Madrid, al objeto de evaluar su distribución y origen, mediante adaptación y desarrollo de técnicas de muestreo y análisis. Las muestras atmosféricas presentan valores de δ13C situados entre -9,81 y -14,64 ‰, que se corresponden gradualmente con los puntos de menor a mayor grado de polución por aportes principalmente de C02 procedente de la quema de combustibles fósiles. Las aguas de los pozos analizados, pertenecientes al acuífero terciario del detrítico, muestran un estrecho margen de variación, entre δ13C -13,92 y -15,67 ‰, relacionado con los procesos geoquímicos naturales. Las aguas de los ríos Jarama, Guadalix y Guadarrama, presentan una amplia variación en su composición isotópica (δ13C entre -7,07 y -11,85 ‰ debido a la disolución de carbonatos a su paso por las formaciones de calizas del Mesozoico y, en menor medida, a los aportes de efluentes contaminados.

  4. Estudio de patentes sobre tecnologías para tratamiento de agua y el agua residual

    Directory of Open Access Journals (Sweden)

    Odonel González-Cabrera

    Full Text Available Se presenta un estudio de patentes sobre la temática tratamiento de agua y agua residual. Se localizan y descargan más de 2.500 documentos de patentes relacionados con la temática. Estos se procesan en software al efecto y herramientas de procesamiento. Se extraen indicadores de patentes para esta tecnología con alto valor para actividades comerciales y de investigación, tales como tecnologías emergentes sobre tratamiento de agua, países, entidades e inventores líderes a nivel mundial según el resultado de la tecnología patentada. Se presenta la evolución de las tecnologías de tratamiento del agua y el agua residual en los últimos veinte años a nivel mundial según el registro de las patentes. La entrega de todo el material se realiza enuna herramienta de visualización que logra hacer más atractivo el servicio, tener un producto más amigable y cómodo para el uso, constituyendo una información de alto nivel de actualización y eficacia para la toma de decisiones de una empresa de proyectos e investigaciones hidráulicas.

  5. Artemia Salina L. (Anostraca): uma opção para a aquicultura do Nordeste do Brasil

    OpenAIRE

    1982-01-01

    Inoculations made with cysts of Artemia salina from San Francisco Bay (California, USA) in Macau, Rio Grande do Norte, Brazil, in 1977, have dispersed this crustacean in all neighboring salt work areas. Favourable environmental conditions which have successfully contributed to this inoculation, together with suggestions for a rational utilization of similar areas for Artemia salina cultivation, are analyzed and commented.

  6. Toxicity of cylindrospermopsin to the brine shrimp Artemia salina: comparisons with protein synthesis inhibitors and microcystins.

    Science.gov (United States)

    Metcalf, J S; Lindsay, J; Beattie, K A; Birmingham, S; Saker, M L; Törökné, A K; Codd, G A

    2002-08-01

    The Artemia salina bioassay was successfully applied to the analysis of the hepatotoxic cyanobacterial alkaloid and protein synthesis inhibitor, cylindrospermopsin. A dose-dependent response in mortality was observed for purified cylindrospermopsin and LC(50) values decreased with time from 8.1 to 0.71 microg/ml(-1), between 24 and 72 h, respectively. Cylindrospermopsin was slightly less potent than micro cystin-LR, with similar LC(50) values on a gravimetric basis, but was more toxic to A.salina than the protein synthesis inhibitors, cycloheximide, chloramphenicol and tetracycline. Cylindrospermopsin-containing strains of the cyanobacterium Cylindrospermopsis raciborskii were found to be toxic to A.salina and the LC(50) concentration for these strains over time was greater than the LC(50) for purified cylindrospermopsin, with the exception of C. raciborskii strain CR1.

  7. Agua, población y desarrollo

    Directory of Open Access Journals (Sweden)

    del Campo Urbano, Salustiano

    1999-10-01

    Full Text Available Not available.A escala mundial, el problema del agua no consiste tanto en su volumen de existencias como en su reparto desigual. En este artículo, tras hacer algunas consideraciones acerca de la importancia del agua para la civilización y de su accesibilidad en general, se describen diversas limitaciones causadas por el hombre y cómo se utiliza ante las demandas provocadas por la presión demográfica. El trabajo concluye con una sección dedicada al Mediterráneo en la que se apuntan vías de solución para su escasez, sobre todo en la zona Sur.

  8. Minería del agua

    OpenAIRE

    Reynolds Vargas, Jenny

    2016-01-01

    En Costa Rica el recurso hídrico se ve amenazado ante una explotación sin control en actividades que implican la extracción o minería del agua, es decir, la fuente es empleada hasta que se agota, cuando ya es inútil para consumo, irrigación o recreación. Se señala en este artículo el agravamiento del problema por la falta de mecanismos de protección que promuevan un uso sotenible del agua y se brindan algunas recomendaciones en pro de mejorar la calidad del recurso.

  9. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    CHAI Yurong; LU Yumin; WANG Tianyun; HOU Weihong; XUE Lexun

    2006-01-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficientpromoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase (CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics.Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  10. Comportamiento de la sepsis procedente de la comunidad en la edad pediátrica

    Directory of Open Access Journals (Sweden)

    Beatriz Santos Lorenzo

    2015-11-01

    Full Text Available Se realizó un estudio descriptivo de corte transversal en el Hospital Pediátrico "Mártires de Las Tunas", que incluyó pacientes con diagnóstico de sepsis de la comunidad ingresados en la Unidad de Cuidados Intensivos, durante el período comprendido entre enero de 2009 y diciembre de 2011. Los objetivos del estudio fueron: caracterizar según la edad, lactancia materna, estado nutricional, foco infeccioso y forma clínica de presentación. El universo lo constituyeron los 259 pacientes ingresados con sepsis y la muestra los 109 procedentes de la comunidad. Los datos fueron obtenidos de historias clínicas, almacenados en base de datos Excel, procesados con cálculos totales - porcientos. El resultado fue que el 61% eran menores de un año, seguidos por el grupo de uno a cuatro años (22%; el 65% tenían la lactancia mixta; el 44% eran normopesos y el 37% estaban desnutridos; referido al foco de infección, en el 66% fueron los pulmones; 52% presentaron forma clínica de sepsis en fase inicial. Se concluyó que la sepsis predominó en las primeras edades (menores de cuatro años, en el sexo masculino, en menores que tenían lactancia mixta, normopesos y desnutridos. El foco pulmonar fue el más frecuente y el mayor porciento ingresó en fases iniciales de sepsis.

  11. ¿RESUCITAN AL INICIO DEL 2009 LAS CÉLULAS TRONCALES PROCEDENTES DE EMBRIONES?

    Directory of Open Access Journals (Sweden)

    Natalia López Moratalla

    2009-01-01

    Full Text Available La posibilidad legal en USA, desde marzo de 2009, de usar fondos federales para la investigación que crea y destruye embriones, no está relacionada con la Terapia Regenerativa sino con el interés de creación de bancos de células humanas. Sólo unos pocos científi cos, involucrados en las empresas de biotecnología, y en íntimo consorcio conlos centros de reproducción asistida, siguen potenciando la vía de conseguir embriones humanos ad hoc para generar materiales de investigación biomédica. Por otra parte, existe un sentir bastante general de la necesidad de usar las líneas celulares derivadas de embriones, e incluso de crear otras nuevas, para validar las células pluripotenciales reprogramadas desde células somáticas, sin destrucción de embriones ni uso de óvulos. Estas células conocidas como iPS (células troncales con pluripotencialidad inducida son de gran valor en la investigación biomédica y se plantea un posible uso en Terapia Celular en un futuro cercano. Se analizan los datos de la literatura de los últimos meses sobre el conocimiento alcanzado acerca de las células troncal de adulto y su reprogramación a pluripotenciales y se pone de manifi esto las alternativas racionales a la evaluación de las iPS con células procedentes de embriones.

  12. Circuito turístico Guayaquil – salinas – puerto cayo

    OpenAIRE

    Vaca Viteri, Maria Soledad; Ortiz Franco, Samantha

    2009-01-01

    Bajo el concepto de Circuito de Turismo, este documento, busca integrar a la cosmopolita y moderna ciudad de Guayaquil con el conjunto de balnearios que se recorre en la ruta Salinas – Puerto Cayo. Tal Circuito resultaría de gran competitividad, a nivel nacional e internacional, frente a otros destinos similares. Dado esto, la ciudad de Guayaquil y la ruta Salinas – Puerto Cayo serian un solo atractivo turístico. Otorgando a la ciudad de Guayaquil una imagen renovada para...

  13. Una punta de lanza decorada de la necrópolis de El Puntal (Salinas, Alicante)

    OpenAIRE

    2000-01-01

    Este trabajo pretende dar a conocer la decoración damasquinada presente en una punta de lanza de la necrópolis ibérica de El Puntal (Salinas, Alicante), datada en el s. IV a.C. Se señala asimismo la importancia que adquiere la sepultura en la que aparece, que sobresale del conjunto para convertirse en el lugar de enterramiento de un personaje destacado. Ce travail veut presenter la décoration damasquinée trouvée sur une lance de la nécropole ibérique du Puntal (Salinas, Alicant...

  14. Comparative effects and metabolism of two microcystins and nodularin in the brine shrimp Artemia salina.

    Science.gov (United States)

    Beattie, Kenneth A; Ressler, Judith; Wiegand, Claudia; Krause, Eberhard; Codd, Geoffrey A; Steinberg, Christian E W; Pflugmacher, Stephan

    2003-02-12

    The toxicity and metabolism of the cyanobacterial toxins microcystin-LR (MCLR), Dhb-microcystin-HtyR and nodularin were investigated in the cysts, nauplii and adults of the brine shrimp Artemia salina. The presence of the phase II detoxication system glutathione S-transferase (sGST) in these stages was shown using different substrates. Exposure of adult A. salina to the toxins led to an elevation of GST activity in vivo. All three toxins were conjugated to glutathione via GST, which has been shown as an initial step of microcystin and nodularin detoxication.

  15. [Detection of fungal metabolites showing toxic activity through Artemia salina bioassay].

    Science.gov (United States)

    González, Ana María; Presa, Maximiliano; Latorre, María Gabriela; Lurá, María Cristina

    2007-03-01

    The aim of this study was to detect toxic metabolites from fungi contaminating food and medicinal herbs by applying the toxicity assay to Artemia salina. According to toxicity percentages, the extracts were classified as nontoxic (NT), slightly toxic (ST), toxic (T) and highly toxic (HT). Those classified as T and HT were assayed for mycotoxins. Only 6 out of 71 strains were found to be T (8.5%) for A. salina. Penicillium brevicompactum Dierckx, isolated from sausages, was found to be HT, mainly due to the presence of ochratoxin A and two other unidentified metabolites.

  16. Herramienta metodológica para la gestión ambiental de las aguas subterráneas en microcuencas.

    Directory of Open Access Journals (Sweden)

    Sara Fernández Cruz

    2011-01-01

    Full Text Available Se abordó el diseño de un modelo para la gestión ambiental de las aguas subterráneas, ya que esta actividad en los diferentes contextos geográficos, se ha focalizado de forma muy puntual a la protección de las fuentes de abasto contra la contaminación y el agotamiento, sin contemplar suficientemente la incidencia de la cuenca hidrográfica, por lo que no se ha denotado un marcado efecto de sostenibilidad del recurso como tal. Con el objetivo de suplir estas insuficiencias, se diseñó el modelo GAIAS, el cual tiene como aporte fundamental la concepción de la cuenca hidrográfica como escenario de gestión para las aguas subterráneas. Está conformado por nueve elementos, los cuales fueron sometidos a criterios de expertos, procedentes diez países de Iberoamérica incluyendo Cuba. Actualmente se implementa en la microcuenca Holguín y se observan resultados satisfactorios validados a través del ISAAC.

  17. Pseudomonas salina sp. nov., isolated from a salt lake.

    Science.gov (United States)

    Zhong, Zhi-Ping; Liu, Ying; Hou, Ting-Ting; Liu, Hong-Can; Zhou, Yu-Guang; Wang, Fang; Liu, Zhi-Pei

    2015-09-01

    A Gram-staining-negative, facultatively aerobic bacterium, strain XCD-X85(T), was isolated from Xiaochaidan Lake, a salt lake (salinity 9.9%, w/v) in Qaidam basin, Qinghai province, China. Its taxonomic position was determined by using a polyphasic approach. Cells of strain XCD-X85(T) were non-endospore-forming rods, 0.4-0.6 μm wide and 1.0-1.6 μm long, and motile by means of a single polar flagellum. Strain XCD-X85(T) was catalase- and oxidase-positive. Growth was observed in the presence of 0-12.0% (w/v) NaCl (optimum, 1.0-2.0%) and at 4-35 °C (optimum, 25-30 °C) and pH 6.5-10.5 (optimum, pH 8.0-8.5). Strain XCD-X85(T) contained (>10%) summed feature 8 (C18 : 1ω7c and/or C18 : 1ω6c), C12 : 0, C16 : 0 and summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c) as the predominant fatty acids. The major respiratory quinone was ubiquinone 9 (Q-9). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content was 57.4 mol%. Phylogenetic trees based on 16S rRNA gene sequences showed that strain XCD-X85(T) was associated with the genus Pseudomonas, and showed highest 16S rRNA gene sequence similarities to Pseudomonas pelagia CL-AP6(T) (99.0%) and Pseudomonas bauzanensis BZ93(T) (96.8%). DNA-DNA relatedness of strain XCD-X85T to P. pelagia JCM 15562(T) was 19 ± 1%. On the basis of the data presented above, it is concluded that strain XCD-X85(T) represents a novel species of the genus Pseudomonas, for which the name Pseudomonas salina sp. nov. is proposed. The type strain is XCD-X85(T) ( = CGMCC 1.12482(T) = JCM 19469(T)).

  18. Acute toxicity of several organophosphorous insecticides and protection by cholinergic antagonists and 2-PAM on Artemia salina larvae.

    Science.gov (United States)

    Sánchez-Fortún, S; Sanz, F; Barahona, M V

    1996-10-01

    The acute toxicity of chlorpyrifos, methylchlorpyrifos, parathion and methylparathion to three age classes of Artemia salina was determined. In general, A. salina 24-h old was less sensitive to these organophosphorous insecticides (OPI) than A. salina 48-h old and A. salina 48-h old was significantly more tolerant than A. salina 72-h old, in contrast, chlorpyrifos was equally toxic to A. salina 48- and 72-h old. There were some differences among the three age classes of A. salina in the relative order of toxicity of OPI tested. The rank order of toxicity to A. salina 48-h old was methylparathion salina 24- and 72-h old it was methylparathion = parathion Artemia salina 24-h old was investigated. The lethal action of OPI tested was completely prevented by pretreatment of Artemia salina 24-h old with 2-PAM (10(-5) M) and atropine (10(-4 )M). However no concentration of hexamethonium, pirenzepine or AF-DX 116 protected 100% of the animals poisoned by LC84 of the OPI selected, maximum protection obtained was 71 to 88%. In contrast, the maximum inhibition of mortality obtained with AF-DX 116 pretreatment was about 55% because this compound was used at concentrations which were non toxic to control Artemia salina. Atropine, hexamethonium, pirenzepine, AF-DX 116 and 2-PAM afforded 50 % protection (IC50) of Artemia salina against mortality by LC84 of the OPI selected at concentrations in the range of 6.62x10(-7)-1.6x10(-6) M, 2. 38x10(-4)-2.05x10(-3)M, 8.91x10(-7)-1.24x10(-6) M, 9.66x10(-8)-1. 34x10(-7 )M, and 1.95x10(-8)-2.73x10(-8 )M, respectively. Pretreatment of atropine plus 2-PAM to determine whether this combination afforded greater inhibition of the lethality induced by four OPI tested than pretreatment with either atropine or 2-PAM alone was investigated. Atropine (10(-5) M) in combination with 2-PAM (10(-7 )M) inhibited completely the acute toxicity of all OPI tested, while the pretreatment with atropine (10(-6) M) plus 2-PAM at the same concentration gave a

  19. INFLUENCIA DE LAS CONDICIONES FISICOQUÍMICAS DEL SEDIMENTO Y LA INTERFASE AGUA-SEDIMENTO EN LA TRANSFERENCIA EXPERIMENTAL DEL O,O-DIETIL O?- 3,5,6 TRICLORO-2-PIRIDINIL FOSFOROTIATO (CLORPIRIFOS Y EL 3,5,6 TRICLORO-2-PIRIDINOL (TCP, EN EL EMBALSE RIOGRANDE II

    Directory of Open Access Journals (Sweden)

    Diana María Agudelo

    2013-12-01

    Full Text Available En esta investigación experimental se evaluó la influencia de algunas variables fisicoquímicas de sedimentos procedentes del embalse Riogrande II y de la interfase agua-sedimento en la transferencia de Clorpirifos y TCP. El análisis de clorpirifos y TCP en sedimentos y agua se realizó por extracción en fase sólida. Las muestras fueron detectadas por cromatografía de gases acoplada a espectrometría de masas (Trace GC Ultra MS 2030-Thermo Scientific. Se evidenció una fuerte adsorción de ambos compuestos en los sedimentos, dado el alto contenido de arcillas y de carbono orgánico, lo cual limitó su movilidad hacia la interfase. La interfase agua-sedimento se caracterizó por una condición de hipoxia durante toda la fase experimental, mientras que la conductividad eléctrica aumento en el tiempo. Se determinó que un pH neutro o ligeramente alcalino favoreció el aumento de la concentración de clorpirifos en la interfase agua-sedimento, lo cual sugiere un incremento de su transferencia desde el sedimento a la interfase, mientras que un pH ligeramente ácido favorece la transformación del compuesto parental en el sedimento.

  20. El agua como principio de sustentabilidad para el desarrollo urbano

    OpenAIRE

    Iván Cartes S.

    2015-01-01

    • El ciclo hidrológico. • Los procesos de Urbanización y Desarrollo Urbano. • Crisis ambiental y los recursos de agua. • Abastecimiento, consumo y tratamiento. • Proyectos emblemáticos y diseño urbano apropiado. • Tecnología y tratamiento de agua para la sustentabilidad urbana.

  1. Comportamiento geoquímico de las formaciones salinas bajo el efecto de la temperatura y la irradiación

    Directory of Open Access Journals (Sweden)

    Pueyo, J. J.

    1993-08-01

    Full Text Available The production of radiation induced defects, as well as fluid migration (brine and gases, are the most relevant phenomena due to the combined effects of heat and irradiation in repositories emplaced in rock salt. In order to gain knowledge of these phenomena, laboratory experiments on samples coming from the Sallent Mine (Barcelona have been performed. The water content ranges between 0.04 and 1.00 %. Nevertheless, smaller releases of brine are expected, since part of it is present in fluid inclusions of a size below 100 µm. The chemical composition of the brine, which is a key issue in the study of container corrosion, is in the case of the fluid inc1usions enriched in magnesium (1.15 mol/l and potassium (0.31 mol/l. The study of the gas content reveals the absence of toxic gases and the scarcity of hydrogen and methane. Finally, the amount of radiation induced defects, which are controlled by the mineralogical composition of the rock salt, is similar to those obtained with the Jain-Lidiard model.La generación de defectos cristalinos y la migración de las fases fluidas (salmueras y gases, son los efectos más relevantes de la irradiación y la temperatura sobre una formación salina, susceptible de albergar un almacenamiento de residuos radiactivos. Para determinar dichos efectos se ha puesto a punto la metodología necesaria y se ha verificado sobre muestras salinas de la mina de Sallent (Barcelona. El contenido en agua oscila entre 0,04 y 1 %. Sin embargo, la cantidad de salmuera susceptible de migrar será inferior a la total, debido a que parte de esta se encuentra en inclusiones fluidas inferiores a 100 µm. La composición química de la salmuera, factor clave para el estudio de corrosión de contenedores, es de carácter magnésico (1,15 moles/litro y potásico (0,31 moles/litro en el caso de las inclusiones. El análisis de los gases presentes indica la ausencia de gases tóxicos y concentraciones muy bajas de hidrógeno y metano

  2. Podosphaera xanthii but not Golovinomyces cichoracearum infects Cucurbits in a Greenhouse at Salinas, California

    Science.gov (United States)

    Two fungal species are the primary causes of cucurbit powdery mildew (CPM): Podosphaera xanthii and Golovinomyces cichoracearum. CPM on melon (Cucumis melo L.), cucumber (C. sativus L.) and summer squash (Cucurbita pepo L.) in a greenhouse at Salinas, California in winter 2011 was confirmed to be in...

  3. Neutral lipid production in Dunaliella salina during osmotic stress and adaptation

    DEFF Research Database (Denmark)

    Yao, Shuo; Lu, Jingquan; Sárossy, Zsuzsa

    2016-01-01

    in salt concentration did not significantly influence the overall fatty acid composition in D. salina cells. Although there shows both increased amounts of total lipids and neutral lipids in the cells grown in salinity higher than 9 % NaCl, lipid productivity is however compromised by the slower cell...

  4. Antioxidant activity of three microalgae Dunaliella salina, Tetraselmis chuii and Isochrysis galbana clone Tahiti

    Science.gov (United States)

    Widowati, Ita; Zainuri, Muhammad; Pancasakti Kusumaningrum, Hermien; Susilowati, Ragil; Hardivillier, Yann; Leignel, Vincent; Bourgougnon, Nathalie; Mouget, Jean-Luc

    2017-02-01

    Natural alternatives antioxidant source has become a trending topic in the past decades to replace synthetic antioxidant. Microalgae have been mentioned to show interesting bioactive properties and one of them is its antioxidant activity. This study aims to evaluate the potential of three microalgae Dunaliella salina, Tetraselmis chuii and Isochrysis galbanaas new source of natural antioxidant. Proximate analysis and total phenolic content of D. salina, T. chuii and I. galbanas were determined. Antioxidant activity of methanolic extracts of these three species prepared in different concentration (50, 100, 250, 500, and 1000 ppm) was performed through DPPH assay. I. galbana clone Tahiti demonstrated a highest antioxidant potential with 61.64 of inhibition at 50 ppm followed by D. salina with 58.45 % of inhibition and T. chuii with 52.58 % of inhibition. I. galbana clone Tahiti was the best antioxidant with total phenol content of 17.798 mg GAE g-1 extract at 50 ppm; followed by T. chuii 16.868 mg GAE g-1 extract and the lowest was D. salina with 4.672 mg GAE g-1 extract. Results suggest that these microalgae posses antioxidant potential which could be considered for future applications in medicine, dietary supplements, cosmetics or food industries.

  5. Selective extraction of carotenoids from microalga Dunadiella salina with retention of viability

    NARCIS (Netherlands)

    Hejazi, M.A.; Lamarliere, de C.; Rocha, J.M.S.; Vermuë, M.; Tramper, J.; Wijffels, R.H.

    2002-01-01

    Simultaneous production and selective extraction of -carotene from living cells of Dunaliella salina in a two-phase system of aqueous and organic phases has been investigated. Solvents with values of log Poctanol, which denotes hydrophobicity of a compound, ranging from 3 to 9 were used as organic p

  6. Milking microalga Dunaliella salina for Beta-carotene production in two-phase bioreactors

    NARCIS (Netherlands)

    Hejazi, M.; Holwerda, E.; Wijffels, R.H.

    2004-01-01

    A new method was developed for production of beta-carotene from Dunaliella salina. Cells were grown in low light intensity and then transferred to a production bioreactor illuminated at a higher light intensity. It was a two-phase bioreactor consisting of an aqueous and a biocompatible organic phase

  7. Evaluation of the photodynamic activity of Xanthene Dyes on Artemia salina described by chemometric approaches

    Directory of Open Access Journals (Sweden)

    Diogo S. Pellosi

    2013-10-01

    Full Text Available The development of drugs for photodynamic therapy (PDT is an important area of research due to their growing use in medical applications. Therefore, it is important to develop new bioassay methods for PDT photosensitizers that are inexpensive, easy to handle and highly sensitive to environmental conditions. Xanthene dyes (fluorescein, rose bengal B, erythrosine B and eosin Y with LED light sources were investigated using Artemia salina as a bioindicator of photodynamic activity. In this study, three factors were investigated: (i photosensitizers concentration, (ii the LED irradiation time and (iii the waiting time between the addition of the photosensitizers and the beginning of the irradiation. To analyze the photo-killing of A. salina, it was employed a 23 full factorial design. The death of A. salina was related to dye structure and the interaction between the irradiation time and the photosensitizers concentration. About 60% of crustaceans death was obtained using rose bengal B, which presentes the highest quantum yield of singlet oxygen due to the number of iodide substituents in the xanthenes ring. The proposed bioassay using A. salina, xanthene dyes and LED irradiation was found suitable for quantitative PDT drug evaluation.

  8. Spatial scale and the diversity of benthic cyanobacteria and diatoms in a salina

    DEFF Research Database (Denmark)

    Nübel, U.; Garcia-Pichel, F.; Kühl, Michael

    1999-01-01

    We characterized the richness of benthic cyanobacteria and diatoms in a salina system using traditional and molecular biological methods. After determining the different morphotypes and 16S rRNA genes present in various localities within this hypersaline system, an analysis of the increase...

  9. First report of plant-parasitic nematode Meloidoderita salina in the Netherlands

    NARCIS (Netherlands)

    Ashrafi, S.; Helder, J.; Elsen, van den S.J.J.; Jansen, M.; Karssen, G.

    2014-01-01

    After the description of the root-parasitic nematode Meloidoderita salina from a tidal salt marsh in France (1), an additional sampling was carried out to search for the presence of this unusual nematode in a tidal salt marsh area close to Sint-Annaland, province Zeeland in the Netherlands. In Augus

  10. Construction of a System for the Stable Expression of Foreign Genes in Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    GENGDe-Gui; HANYan; WANGYi-Qin; WANGPeng; ZHANGLi-Ming; LIWen-Bin; SUNYong-Ru

    2004-01-01

    A stable transformation system for the expression of foreign genes in the unicellular greenmarine alga (Dunaliella salina Teod.) was established. Using electroporation, the alga was transformed witha plasmid containing the hepatitis B surface antigen (HBsAg) gene and the chloramphenicol acetyltransferase(CAT) gene as a selectable gene. PCR and Southern blotting analysis indicated that the HBsAEgene wasintegrated into the D. salina genome. Northern dotting analysis showed that the HBsAg gene was expressedat the mRNA level. The stable expression of HBsAg protein in transformants was confirmed by HBsAgenzyme-linked immunosorbent assay (HBsAg EUSA) and Western blotting analysis. Also, PCR and Southernblotting analyses showed that the CA Tgene was integrated into the D, salina genome, and CAT EUSAindicated that CAT protein was stably expressed in the cells. The introduced HBsAg DNA and HBsAgprotein expression were stably maintained for at least 60 generations in media devoid of chloramphenicol.This is the first report of the stable expression of foreign genes in D. salina.

  11. Evaluation of the photodynamic activity of xanthene dyes on Artemia salina described by chemometric approaches.

    Science.gov (United States)

    Pellosi, Diogo S; Batistela, Vagner R; Souza, Vagner R de; Scarminio, Ieda S; Caetano, Wilker; Hioka, Noboru

    2013-01-01

    The development of drugs for photodynamic therapy (PDT) is an important area of research due to their growing use in medical applications. Therefore, it is important to develop new bioassay methods for PDT photosensitizers that are inexpensive, easy to handle and highly sensitive to environmental conditions. Xanthene dyes (fluorescein, rose bengal B, erythrosine B and eosin Y) with LED light sources were investigated using Artemia salina as a bioindicator of photodynamic activity. In this study, three factors were investigated: (i) photosensitizers concentration, (ii) the LED irradiation time and (iii) the waiting time between the addition of the photosensitizers and the beginning of the irradiation. To analyze the photo-killing of A. salina, it was employed a 2³ full factorial design. The death of A. salina was related to dye structure and the interaction between the irradiation time and the photosensitizers concentration. About 60% of crustaceans death was obtained using rose bengal B, which presentes the highest quantum yield of singlet oxygen due to the number of iodide substituents in the xanthenes ring. The proposed bioassay using A. salina, xanthene dyes and LED irradiation was found suitable for quantitative PDT drug evaluation.

  12. Mass marking of Leuciscus idus larvae using Artemia salina as a vector of fluorescent dyes.

    Science.gov (United States)

    Stańczak, K; Krejszeff, S; Dębowska, M; Mierzejewska, K; Woźniak, M; Hliwa, P

    2015-09-01

    A method for the mass marking of ide Leuciscus idus larvae by feeding them Artemia salina nauplii that were immersed in different solutions of alizarin red S, tetracycline hydrochloride and calcein was tested. The best quality marks were obtained after feeding fish for 4 days with nauplii that had been immersed in 200 mg l(-1) alizarin red S.

  13. Biological screening of selected Pacific Northwest forest plants using the brine shrimp (Artemia salina) toxicity bioassay.

    Science.gov (United States)

    Karchesy, Yvette M; Kelsey, Rick G; Constantine, George; Karchesy, Joseph J

    2016-01-01

    The brine shrimp (Artemia salina) bioassay was used to screen 211 methanol extracts from 128 species of Pacific Northwest plants in search of general cytotoxic activity. Strong toxicity (LC50  1000 µg/ml). Our subsequent studies of conifer heartwoods with strong activity confirm the assay's value for identifying new investigational leads for materials with insecticidal and fungicidal activity.

  14. Hepatoprotective and antioxidant activity of dunaliella salina in paracetamol-induced acute toxicity in rats

    Directory of Open Access Journals (Sweden)

    Fedekar F Madkour

    2013-01-01

    Full Text Available Paracetamol has a reasonable safety profile when taken in therapeutic doses. However, it could induce hepatotoxicity and even more severe fatal acute hepatic damage when taken in an overdose. The green alga, Dunaliella salina was investigated for hepatoprotective and antioxidant activity against paracetamol-induced liver damage in rats. Male albino Wistar rats overdosed with paracetamol showed liver damage and oxidative stress as indicated by significantly (P<0.05 increased serum levels of aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide. At the same time, there were decreased activities of serum superoxide dismutase and total antioxidant capacity compared with the control group. Treatment with D. salina methanol extract at doses of 500 and 1000 mg/kg body weight or silymarin could significantly (P<0.05 decrease the liver damage marker enzymes, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide levels and increase the activities of superoxide dismutase and total antioxidant capacity in serum when compared with paracetamol intoxicated group. Liver histopathology also showed that D. salina reduced the centrilobular necrosis, congestion and inflammatory cell infiltration evoked by paracetamol overdose. These results suggest that D. salina exhibits a potent hepatoprotective effect on paracetamol-induced liver damage in rats, which may be due to both the increase of antioxidant enzymes activity and inhibition of lipid peroxidation.

  15. Hepatoprotective and Antioxidant Activity of Dunaliella salina in Paracetamol-induced Acute Toxicity in Rats.

    Science.gov (United States)

    Madkour, Fedekar F; Abdel-Daim, M M

    2013-11-01

    Paracetamol has a reasonable safety profile when taken in therapeutic doses. However, it could induce hepatotoxicity and even more severe fatal acute hepatic damage when taken in an overdose. The green alga, Dunaliella salina was investigated for hepatoprotective and antioxidant activity against paracetamol-induced liver damage in rats. Male albino Wistar rats overdosed with paracetamol showed liver damage and oxidative stress as indicated by significantly (P<0.05) increased serum levels of aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide. At the same time, there were decreased activities of serum superoxide dismutase and total antioxidant capacity compared with the control group. Treatment with D. salina methanol extract at doses of 500 and 1000 mg/kg body weight or silymarin could significantly (P<0.05) decrease the liver damage marker enzymes, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide levels and increase the activities of superoxide dismutase and total antioxidant capacity in serum when compared with paracetamol intoxicated group. Liver histopathology also showed that D. salina reduced the centrilobular necrosis, congestion and inflammatory cell infiltration evoked by paracetamol overdose. These results suggest that D. salina exhibits a potent hepatoprotective effect on paracetamol-induced liver damage in rats, which may be due to both the increase of antioxidant enzymes activity and inhibition of lipid peroxidation.

  16. Groundwater quality in the Monterey Bay and Salinas Valley groundwater basins, California

    Science.gov (United States)

    Kulongoski, Justin T.; Belitz, Kenneth

    2011-01-01

    The Monterey-Salinas study unit is nearly 1,000 square miles and consists of the Santa Cruz Purisima Formation Highlands, Felton Area, Scotts Valley, Soquel Valley, West Santa Cruz Terrace, Salinas Valley, Pajaro Valley, and Carmel Valley groundwater basins (California Department of Water Resources, 2003; Kulongski and Belitz, 2011). These basins were grouped into four study areas based primarily on geography. Groundwater basins in the north were grouped into the Santa Cruz study area, and those to the south were grouped into the Monterey Bay, the Salinas Valley, and the Paso Robles study areas (Kulongoski and others, 2007). The study unit has warm, dry summers and cool, moist winters. Average annual rainfall ranges from 31 inches in Santa Cruz in the north to 13 inches in Paso Robles in the south. The study areas are drained by several rivers and their principal tributaries: the Salinas, Pajaro, and Carmel Rivers, and San Lorenzo Creek. The Salinas Valley is a large intermontane valley that extends southeastward from Monterey Bay to Paso Robles. It has been filled, up to a thickness of 2,000 feet, with Tertiary and Quaternary marine and terrestrial sediments that overlie granitic basement. The Miocene-age Monterey Formation and Pliocene- to Pleistocene-age Paso Robles Formation, and Pleistocene to Holocene-age alluvium contain freshwater used for supply. The primary aquifers in the study unit are defined as those parts of the aquifers corresponding to the perforated intervals of wells listed in the California Department of Public Health database. Public-supply wells are typically drilled to depths of 200 to 650 feet, consist of solid casing from the land surface to depths of about 175 to 500 feet, and are perforated below the solid casing. Water quality in the primary aquifers may differ from that in the shallower and deeper parts of the aquifer system. Groundwater movement is generally from the southern part of the Salinas Valley north towards the Monterey Bay

  17. Detección de mutacarcinógenos en aguas del Río Pantanillo y efecto genotóxico de esta agua en el DNA nuclear y mitocondrial de células eucarióticas

    Directory of Open Access Journals (Sweden)

    Margarita Zuleta

    2000-02-01

    Full Text Available

    Las aguas negras procedentes de domicilios, hospitales, fábricas, estaciones de gasolina, etc, están cargadas de gran variedad de mutacarcinógenos, como el benzopireno y el antraceno que se forman durante la combustión y pirólisis del material orgánico y se agrupan como hidrocarburos policíclicos aromáticos (HPA, además de las nitrosaminas y aminas heterocíclicas que se generan por la descomposición térmica de alimentos ricos en proteínas y creatina, como la carne asada y frita.  Estos mutágenos también se encuentran en las cenizas, el vapor del aceite de fritos y en la orina y las heces de personas que consumen alimentos fritos y asados (Felton y Knize 1990; Zuleta et al, sin publicar. Las aguas negras del Retiro son tratadas en una planta de lodos activados y luego son vertidas en el río Pantanillo, el cual es el principal afluente de la represa La Fe. Ésta surte la planta de tratamiento de aguas la Ayurá, que distribuye agua potable a más de 2.000.000 de personas. Con el fin de conocer el tipo de mutágenos que pueden llegar al río Pantanillo y si la planta de tratamiento a base de lodos activados es eficiente en su retención, identificamos los mutágenos contenidos en las aguas negras antes y después de pasar por la planta. Además evaluamos su mutagenicidad, genotoxicidad y la inhibición de la síntesis del DNA.

    Hasta el presente hemos obtenido los siguientes resultados:

    ·         

  18. Patrones de susceptibilidad antimicrobiana de aislados clínicos de Staphylococcus aureus procedentes de la comunidad

    OpenAIRE

    Estrella Alvarez Varela; María Espino Hernández; Rolando Contreras Alarcón

    2008-01-01

    Se estudió la resistencia antimicrobiana de 695 aislamientos clínicos de Staphylococcus aureus procedentes de infecciones de las vías respiratorias superiores, lesiones en piel, secreciones de heridas, exudados conjuntivales, óticos y sistema genitourinario de pacientes atendidos en consulta externa de cinco hospitales pediátricos, ubicados en diferentes ciudades y regiones de Cuba durante el período enero de 2002 a diciembre de 2004. Los datos fueron obtenidos por el Sistema DIRAMIC y proces...

  19. Esculturas de équidos procedentes de la colección de Alhonoz (Puente-Genil, Córdoba

    Directory of Open Access Journals (Sweden)

    Cuadrado, Emeterio

    1989-12-01

    Full Text Available This is a study of a group of reliefs and stone engravings made on sandstone plates, all from the Mesa de Luque (Córdoba. The discovery of these engravings raises the possibility that a new Iberian culture sanctuary existed near here.

    Se estudia un conjunto de relieves y grabados realizados en losas de arenisca procedentes de la Mesa de Luque (Córdoba. El hallazgo plantea la posible existencia de un nuevo santuario ibérico en las cercanías del lugar.

  20. Garcilaso de la Vega y Pedro Salinas: la voz a ti debida

    Directory of Open Access Journals (Sweden)

    Escarpín Gual, Montserrat

    2008-12-01

    Full Text Available This paper shows the relationship between two Spanish writers: Garcilaso de la Vega and Pedro Salinas; or better, the influence of the former over the latter. This influence may be noticed in different levels: the use of literary genres (eclogues, elegies or collections of verse, the conception of love, the use of myths and topics, the music of verse, etc. Some characteristics of Salinas’s style come clearly from Garcilaso (the intimacy, simplicity, orality, the dialogue, the use of the present tense and the first person, etc.. Our essay studies the influence of Garcilaso on the book Largo lamento, 1937?, written by Salinas at the same time as an essay about the renaissance poet —in addition of other unpublished works and his personal correspondence—, in order to show the presence of Garcilaso in his mind and all of his production.El artículo muestra la relación entre dos escritores españoles: Garcilaso de la Vega y Pedro Salinas; o mejor, la influencia del primero sobre el segundo. Esta puede observarse en diferentes niveles: el uso de géneros literarios (églogas, elegías o cancioneros, la concepción del amor, el uso de mitos y tópicos, la música del verso, etc. Algunas características del estilo de Salinas proceden claramente de Garcilaso (el intimismo, la sencillez, la oralidad, el empleo del diálogo, el presente verbal, la primera persona, etc.. Nuestro ensayo estudia la incidencia de Garcilaso en el libro Largo lamento, 1937?, que Salinas escribió en paralelo a un ensayo sobre el poeta renacentista —además de otros trabajos inéditos y su correspondencia personal—, para mostrar la presencia de Garcilaso en su pensamiento y en su producción.

  1. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca).

    Science.gov (United States)

    Muñoz, Joaquín; Gómez, Africa; Green, Andy J; Figuerola, Jordi; Amat, Francisco; Rico, Ciro

    2008-07-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading to their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South Africa) and to assess the extent of local endemism, the degree of population structure and the potential impact of traditional human saltpan management on this species. We also examined the phylogenetic relationships in the genus Artemia using COI sequences. Our results show extensive regional endemism and indicate an early Pleistocene expansion of A. salina in the Mediterranean Basin. Subsequent population isolation in a mosaic of Pleistocene refugia is suggested, with two or three refugia located in the Iberian Peninsula. Two instances of long-distance colonization were also observed. Surprisingly, given its strong phylogeographical structure, A. salina showed a signature of correlation between geographical and genetic distance. Owing to strong 'priority effects', extensive population differentiation is retained, despite dispersal via migrant birds and human management of saltpans. The foreseeable expansion of A. franciscana is likely to be followed by substantial loss of genetic diversity in Mediterranean A. salina. Large genetic divergences between Mediterranean and South African A. salina suggest that the latter deserves species status.

  2. Gente, tierra y agua en la Amazonia

    OpenAIRE

    Buitrago Garavito, Ana Isabel; Jiménez, Eliana; Tobón, Marco Alejandro; Gendrau Acho, Sheila; Ciro Rodríguez, Estefanía; Ciro Rodríguez, Alejandra; Trujillo Osorio, Catalina; Currea Dereser , Alejandra; Torres Zambrano, Nestor Ned; Serrato Hurtado, Clemencia; Duque, Santiago R.; Moreno Hurtado, Flavio; Peñuela, Maria Cristina; Lloyd, Jon; Patiño, Sandra

    2008-01-01

    Con el ánimo de contribuir a la comprensión social, histórica y económica de la gente que habita la región amazónica y al entendimiento del funcionamiento de sus ecosistemas surge el libro Gente, tierra y agua en la Amazonia. lmani mundo III. Este libro es el tercero de la serie Imani mundo, la cual expone trabajos de investigación en la región amazónica tanto en aspectos sociales como en aspectos ecológicos, realizados por el instituto Amazónico de Investigaciones IMANI de la Universidad Nac...

  3. La columna, el circulo y sus variantes en la poesia primera de Pedro Salinas (The Vertical Line, the Circle, and other Geometric Varieties in the Early Poetry of Pedro Salinas)

    Science.gov (United States)

    De Armas, Jose R.

    1970-01-01

    Interprets Salinas' use of geometric figures for depicting concepts of time and infinity, and for portraying idealism and realism (the vertical line is idealism, perfection; the circle stands for reality and imperfection). (DS)

  4. The Agua Salud Project, Central Panama

    Science.gov (United States)

    Stallard, R. F.; Elsenbeer, H.; Ogden, F. L.; Hall, J. S.

    2007-12-01

    The Agua Salud Project utilizes the Panama Canal's central role in world commerce to focus global attention on the ecosystem services provided by tropical forests. It will be the largest field experiment of its kind in the tropics aimed at quantifying the environmental services (water, carbon, and biodiversity) provided by tropical forests. The Agua Salud Watershed is our principal field site. This watershed and the headwaters of several adjacent rivers include both protected mature forests and a wide variety of land uses that are typical of rural Panama. Experiments at the scale of entire catchments will permit complete water and carbon inventories and exchanges for different landscape uses. The following questions will be addressed: (1) How do landscape treatments and management approaches affect ecosystem services such as carbon storage, water quality and quantity, dry- season water supply, and biodiversity? (2) Can management techniques be designed to optimize forest production along with ecosystem services during reforestation? (3) Do different tree planting treatments and landscape management approaches influence groundwater storage, which is thought to be critical to maintaining dry-season flow, thus insuring the full operation of the Canal during periods of reduced rainfall and severe climatic events such as El Niño. In addition we anticipate expanding this project to address biodiversity, social, and economic values of these forests.

  5. LECTURAS DEL AGUA (SÍMBOLOS, ECOCRÍTICA Y CULTURA DEL AGUA

    Directory of Open Access Journals (Sweden)

    Eloy Martos Núñez

    2012-08-01

    Full Text Available Existen diversos paradigmas sobre el estudio del agua que inciden en ella desde distintos puntos de vista. La gestión del agua es abordada desde las ciencias físicas y geológicas, y se soporta sobre tecnologías como la ingeniería hidráulica. En el aspecto histórico-social, se subraya la importancia de considerar el agua no como un recurso como parte esencial de una cosmovisión que vertebra el patrimonio cultural de una comunidad. Por ejemplo, en el estudio de los desastres (inundaciones, plagas, etc. se ha puesto el énfasis en los datos hidroclimáticos, las respuestas sociales o la vulnerabilidad social. Sin embargo, la ecocrítica ha subrayado el papel de las fabulaciones folklóricas y de los Imaginarios en general para aportar una comprensión holística del problema. Los discursos fabulados admonitorios sobre las aguas y sus riesgos subrayan la importancia de estos lugares de memoria y de reforzar las identidades a través de estas ecoficciones y rituales. Se convierten, pues, en tradiciones útiles porque en realidad hablan de la sostenibilidad, la ética y la necesidad de preservar la memoria y la identidad cultural de la comunidad, frente a la depredación de la Naturaleza. De este modo, el conocimiento de esta cultura del agua no sólo contribuye a la adquisición de las competencias básicas de la educación, y en particular, a la educación literaria y del patrimonio, sino que contribuye a la gobernanza del agua y a la gestión sostenible y responsable de los recursos hídricos. Como indica E. Morin, la lectura y la literatura son una escuela de complejidad, y estos mitos inciden siempre en la multicausalidad de las acciones humanas.http://dx.doi.org/10.14572/nuances.v22i23.1749

  6. [Ellicott Slough National Wildlife Refuge, Farallon National Wildlife Refuge, Salinas River National Wildlife Refuge: Annual Narrative Report: Calendar Year 2001

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Ellicott Slough National Wildlife Refuge, Farallon National Wildlife Refuge, and Salinas River National Wildlife Refuge outlines...

  7. Salt-induced redox-independent phosphorylation of light harvesting chlorophyll a/b proteins in Dunaliella salina thylakoid membranes.

    Science.gov (United States)

    Liu, Xian-De; Shen, Yun-Gang

    2005-02-17

    This study investigated the regulation of the major light harvesting chlorophyll a/b protein (LHCII) phosphorylation in Dunaliella salina thylakoid membranes. We found that both light and NaCl could induce LHCII phosphorylation in D. salina thylakoid membranes. Treatments with oxidants (ferredoxin and NADP) or photosynthetic electron flow inhibitors (DCMU, DBMIB, and stigmatellin) inhibited LHCII phosphorylation induced by light but not that induced by NaCl. Furthermore, neither addition of CuCl(2), an inhibitor of cytochrome b(6)f complex reduction, nor oxidizing treatment with ferricyanide inhibited light- or NaCl-induced LHCII phosphorylation, and both salts even induced LHCII phosphorylation in dark-adapted D. salina thylakoid membranes as other salts did. Together, these results indicate that the redox state of the cytochrome b(6)f complex is likely involved in light- but not salt-induced LHCII phosphorylation in D. salina thylakoid membranes.

  8. Precio y manejo del agua urbana en México

    Directory of Open Access Journals (Sweden)

    Gregorio Castro Rosales

    2015-01-01

    Full Text Available Este trabajo propone evaluar el potencial del precio que pagan los usuarios como ins - trumento para el manejo de la demanda urbana de agua en México. Nuestros resulta - dos basados en un análisis de datos provenientes de cientos de organismos operadores de agua potable del país, revelan que la demanda de agua sí es sensible al precio, tal y como se ha señalado en otros estudios. No obstante, encontramos también que la demanda es aún mucho más sensible al efecto del crecimiento poblacional y económi - co. Por lo tanto, considerando la dinámica demográfica, urbana y económica del país, un aumento en el precio del agua en sí no podría contribuir significativamente a la estabilización de los requerimientos nacionales de extracción de agua para uso urbano. Además, nuestro análisis de los determinantes del precio del agua urbana revela que los organismos operadores pasan sistemáticamente el costo de sus ineficiencias técnicas y financieras a los usuarios, por lo que un aumento en el precio del agua tampoco podría contribuir al saneamiento de sus finanzas. Concluimos que para un manejo efectivo, eficiente y sustentable del uso urbano de agua, resulta imprescindible un cambio de fondo en la manera en que operan los sistemas urbanos de agua.

  9. Arsenate toxicity and metabolism in the halotolerant microalga Dunaliella salina under various phosphate regimes.

    Science.gov (United States)

    Wang, Ya; Zheng, Yanheng; Liu, Cong; Xu, Pingping; Li, Hao; Lin, Qiaoyun; Zhang, Chunhua; Ge, Ying

    2016-06-15

    Microalgae play an important role in arsenic (As) biogeochemical cycles as they are capable of accumulating and metabolizing this metalloid efficiently. This study aimed to investigate the toxicity, accumulation and transformation of arsenate (As(v)) in Dunaliella salina, an exceptionally halotolerant microalga, under various phosphate (PO4(3-)) regimes. The results of the 72-h toxicity test showed that D. salina was tolerant to As(v). In addition, the toxicity of As(v) was mitigated by an increased PO4(3-) supply. D. salina resisted the adverse effects of As(v) through the suppression of As uptake, enhancement of As reduction, methylation in the cell and excretion from the cell. Our study revealed that D. salina reduced As(v) toxicity using different strategies, i.e., reduction of As uptake upon acute As stress (24 h) and increase of As efflux following chronic As exposure (9 day). Moreover, PO4(3-) strongly affected the adsorption, uptake and transformation of As(v) in D. salina. As(v) reduction, DMA production and As excretion were enhanced under P-limited conditions (0.112 mg L(-1)) or upon higher As(v) exposure (1120 μg L(-1)). Furthermore, PO4(3-) had a significant influence on the As removal ability of D. salina. A high As removal efficiency (>95.6%) was observed in the 5-day cultures at an initial As concentration of 11.2 μg L(-1) and PO4(3-) of 0.112 and 1.12 mg L(-1). However, only 10.9% of total As was removed under 11.2 mg L(-1) PO4(3-) after 9 days of incubation. The findings of this study illustrate the pivotal roles of extracellular PO4(3-) in As(v) toxicity and metabolism, and the results may be relevant for future research on the minimization of As contamination in algal products as well as on the enhancement of As removal from the environment.

  10. Calidad del agua de unidades odontológicas

    OpenAIRE

    Ávila de Navia, Sara; Estupiñán Torres, Sandra Mónica; Estupiñán Torres, Diana Milena

    2012-01-01

    El agua es una fuente importante de contaminación en pacientes odontológicos, esta contaminación se ha clasificado en dos clases: la primera, proveniente del suministro primario de agua, es decir, del agua pública y, la segunda, la que se encuentra adherida a las paredes de las mangueras de la unidad odontológica formando una biocapa, que se forma por los fluidos orales que son aspirados durante el procedimiento. La biocapa estará continuamente contaminando las mangueras de la unidad y expuls...

  11. El acceso al agua para consumo humano en Colombia

    Directory of Open Access Journals (Sweden)

    Martha Yánez Contreras

    2013-12-01

    Full Text Available El acceso al agua es un derecho humano que se debe garantizar sin ninguna discriminación. Este artículo examina la existencia de inequidades en el ejercicio de este derecho mediante un análisis discriminante que identifica los factores que explican las diferencias en la calidad del agua para consumo humano entre los municipios colombianos en 2009. Los resultados indican que existen inequidades en el acceso al agua potable. En particular, los municipios más pobres registran los niveles de calidad más bajos.

  12. Plan director de aguas pluviales de Jumilla (Murcia)

    OpenAIRE

    Rodríguez Tárraga, Alberto

    2009-01-01

    Debido a la necesidad de encauzamiento de las aguas pluviales en el casco urbano y zonas industriales cercanas se procede a realizar un estudio que sirva de plan director para los proyectos futuros, que de a conocer las necesidades en cuanto a diseño y planificación de una red de aguas pluviales separativa que hasta el momento no existe en la ciudad salvo casos muy puntuales y que tiene como objetivo la evacuación de las aguas pluviales del casco urbano y alrededores para pa...

  13. Los Floruros de Aguas Potables de Costa Rica

    OpenAIRE

    Chacón S., Bernardo; Acuña B., Armando; Ortiz C., Edgar

    2015-01-01

    El agua que se utiliza en los sistemas de abastecimientos para consumo de las poblaciones, contiene en disolucion proporciones variables de fluoruros, y por lo general, solo trazas debido ala poca solubilidad en agua de los minerales de fluor.La practica de adicionar fluoruros a las aguas potables se inicio a principios del presente siglo despues de muchos años de investigaciones, y hoy se ha superado la etapa experimental para convertirse en una operacion normal y valiosa en proyectos de sal...

  14. El agua es vida… ¡Cuídala!

    OpenAIRE

    Lobón Olmedo, Marta

    2015-01-01

    Mi intención con este proyecto sobre el agua: “EL AGUA ES VIDA…¡¡ CUÍDALA!!” es que los niños y niñas, mediante esas cualidades innatas a su edad, como son la curiosidad, la observación y la experimentación, sean capaces de apreciar la importancia de hacer un uso racional del agua, por lo tanto que sean capaces de “amar al agua” al ser un elemento tan cotidiano y cercano en su vida diaria.

  15. El futuro de la industria de agua en el mundo

    OpenAIRE

    Merkel, Wolfgang

    2003-01-01

    En el presente artículo se expone una visión personal, adquirida en buena medida desde la responsabilidad de dirigir la DVGW (la asociación alemana de compañías de distribución de agua y gas, que agrupa a varios miles de socios) sobre el futuro de la industria del agua en el mundo en general y en Europa en particular, a la luz de la Directiva Marco del Agua. La idea que preside el artículo es que cada país debe establecer los mecanismos necesarios para, a partir de sus peculiaridades y del co...

  16. Calidad sanitaria del agua del Parque Natural Chicaque

    OpenAIRE

    Ávila de Navia, Sara Lilia; Estupiñán Torres, Sandra Mónica

    2013-01-01

    La eutrofización es un proceso natural en los ecosistemas acuáticos, se produce por el enriquecimiento del cuerpo de agua con nutrientes. Durante los últimos años el ser humano ha acelerado estos procesos de eutrofización modificando tanto la calidad de las aguas como la estructura de las comunidades biológicas, debido al aumento en la carga orgánica e inorgánica de los cuerpos de agua. La eutrofización reduce los usos potenciales de los recursos hídricos ya que induce a la mortalidad de espe...

  17. El acceso al agua para consumo humano en Colombia

    OpenAIRE

    Martha Yánez Contreras; Karina Acevedo González

    2014-01-01

    El acceso al agua es un derecho humano que se debe garantizar sin ninguna discriminación. Este artículo examina la existencia de inequidades en el ejercicio de este derecho mediante un análisis discriminante que identifica los factores que explican las diferencias en la calidad del agua para consumo humano entre los municipios colombianos en 2009. Los resultados indican que existen inequidades en el acceso al agua potable. En particular, los municipios más pobres registran los niveles de cali...

  18. Directrices para una política sostenible del agua

    OpenAIRE

    Roldán Cañas, José; Cabrera, Emilio; Cobacho, R.; Cabrera Jr., E.

    2003-01-01

    Este artículo revisa, a la luz de la Directiva Marco del Agua (DMA) y de las conclusiones de las reuniones internacionales ligadas al agua celebradas en los últimos años, las directrices que debe seguir una política sostenible del agua. Al tiempo tiene vocación de sintetizar los artículos que completan el presente monográfico. Algunas de nuestras valoraciones están más desarrolladas en los artículos que siguen. Con todos guarda una buena sintonía. Por ello, lo más singular de esta contribució...

  19. Can the halophilic ciliate Fabrea salina be used as a bio-control of microalgae blooms in solar salterns?

    Science.gov (United States)

    Hong, Hyun Pyo; Choi, Joong Ki

    2015-09-01

    The microlage Dunaliella salina, a major producer in salterns, is a serious problem for salt production. In this study we tried to assess if Fabrea salina can control D. salina. By parameterising numerical and functional response (growth and grazing vs prey abundance, respectively) at 90 psu and 30°C, where the ciliate is abundant and grows well, we developed a predator-prey model. The model is used to explore how change in microalga growth rate affect the dynamics, and the functional response is used in combination with field data to assess the potential impact of F. salina on D. salina. Over the 20 d simulation the ciliate controlled the prey population under all prey growth rates; although once D. salina were exhausted below the threshold level, F. salina died due to starvation, allowing the alga to increase in abundance, resulting in one or two predatorprey cycle, depending on prey growth rate. In general, the model predicted trends observed by others in the field, suggesting that it provided a good prediction of what may occur under the conditions we examined. Likewise we show that the ciliate can have a high impact on microalgal populations in the field. Finally, a literature review indicated that F. salina could be a good competitor with other protozoa and metazoan in salterns, depending on salinity and temperature, which requires further study and attention. In summary, we encourage continued studies on this unique ciliate on solar salterns and suggest that it may be useful in the bio-control of micoalgae.

  20. Variation in fatty acid composition of Artemia salina nauplii enriched with microalgae and baker's yeast for use in larviculture.

    Science.gov (United States)

    Chakraborty, Rekha D; Chakraborty, Kajal; Radhakrishnan, E V

    2007-05-16

    The high content of the essential fatty acids in some microalgae and baker's yeast has made them excellent diets for boosting the fatty acid content of livefood Artemia. The influences of baker's yeast (Saccharomyces cerevisiae) and three microalgae, viz., Chlorella salina, Chaetoceros calcitrans, and Nannochloropsis salina, were tested as diet components in marine livefeed brine shrimp Artemia salina nauplii to improve the polyunsaturated fatty acid (PUFA) composition. Artemia nauplii submerged in these diets for four different enrichment intervals (3, 6, 8, and 24 h) were found to incorporate essential fatty acids, and the percentage composition of different fatty acids was measured in the enriched Artemia nauplii and enrichment diets. N. salina produced higher levels of arachidonic acid (AA, 20:4n6, 9.50%), eicosapentaenoic acid (EPA, 20:5n3, 25.80%), and docosahexaenoic acid (DHA, 22:6n3, 4.18%) as compared to other diets. The total PUFA content of the enriched Artemia by N. salina increased by 56.50% with enrichment periods up to 8 h, followed by a significant reduction in the final 24 h. N. salina yielded Artemia nauplii with considerable EPA (8.05%), AA (14.15%), and DHA (1.85%) after 8 h of enrichment, which are significantly higher levels than in nauplii fed with the other three diets (p = 0.05). The DHA/EPA values in Artemia enriched for 6 h by N. salina and C. calcitrans were found to be, respectively, 88.46 and 25% higher than freshly hatched Artemia. Artemia enriched by C. salina and baker's yeast exhibited a reduction in PUFA content even at 6 h of enrichment. Significant relative decreases in DHA, EPA, and total PUFA in Artemia enriched with all of the diets were apparent, with a corresponding increase in the total saturated fatty acid content (26.95 +/- 9.75%) in the final stages (24 h) of enrichment (p = 0.05).

  1. Una pequeña historia el cine: Sergio Salinas, promotor de la cultura cinematográfica en Chile

    OpenAIRE

    Hans Stange-Marcus; Claudio Salinas-Muñoz

    2013-01-01

    El crítico de cine Sergio Salinas afirmaba que no existen películas de arte sino "espacios" de arte, que propician una apreciación reflexiva y crítica de los filmes. El ensayo revisa tres de estos espacios desarrollados por el propio Salinas en Santiago de Chile: el cine club Nexo y las salas de cine arte Toesca y Normandie.

  2. Aguas diversas. Derechos de agua y pluralidad legal en las comunidades andinas

    Directory of Open Access Journals (Sweden)

    Boelens, Rutgerd

    2009-12-01

    Full Text Available Water rights and property relations have become pivotal issues in water debates, reforms and intervention programs. Governments, development agencies and expert centers tend to consider ‘water rights’ as merely standard black boxes that juxtapose the frameworks of positivist technical and economist water science. But far beyond universal manuals and irrigation regulations, there is another water world, entrenched in the everyday lives of real people, male and female water users. The paper makes clear how Andean user collectives practice an enormous variety of water rights and management forms, as localnational- international hybrids that are created and affirmed in local water territories, embedded in historical and cultural-political contexts.

    Por el aumento generalizado de los conflictos por el agua, los derechos a este recurso se han vuelto ejes en los debates, reformas y programas de intervención hídrica. Los gobiernos, las agencias de desarrollo y los centros expertos tienden a considerar los ‘derechos de agua’ como meras cajas negras estándar que se yuxtaponen a los marcos de las ciencias técnicas y económicas positivistas. Pero mucho más allá de los manuales y las regulaciones de riego, hay otro mundo del agua íntimamente ligado a la vida diaria de gente real, hombres y mujeres que usan ese agua. Este artículo estudia cómo los colectivos de usuarios en la región andina practican una enorme variedad de derechos de agua y formas de gestión, como híbridos locales-nacionales-internacionales que se crean y afirman en los territorios hídricos locales, embebidos en contextos históricos y cultural-políticos.

  3. Building Chinese Cars in Mexico: The Grupo Salinas-FAW Alliance

    Directory of Open Access Journals (Sweden)

    Álvaro Cuervo-Cazurra

    2014-09-01

    Full Text Available Ricardo Salinas Pliego was the CEO of Grupo Salinas, one of the largest business groups in Mexico, and in 2009 he faced a challenge. Two years earlier, he had negotiated with the Chinese car company FAW to import Chinese cars into Mexico as an initial step towards their manufacturing. However, the global crisis of 2008 made him question the viability of the project and he had to decide whether to close the operation or continue in the hope of a quick recovery. This was a difficult decision because the group had sold several thousand cars and established a network of car dealers. Closing the operation would mean not only losing the investment in the network while having to continue servicing the cars, but would also result in a blow to the reputation of the group. He was pondering what the best option would be.

  4. Comparison of the Artemia salina and Artemia fransiscana bioassays for toxicity of Indian medicinal plants

    Institute of Scientific and Technical Information of China (English)

    Thangapandi Veni; Thambusamy Pushpanathan

    2014-01-01

    Objective:To evaluate leaves extract of Azima tetracantha and Gmelina asiatica for lethality to brine shrimp larvae (Artemia salina and Artemia fransiscana). Methods: The plant materials were extracted based on polarity gradients of petroleum ether, benzene, chloroform, acetone, ethanol and methanol. The extracts were investigated for their cytotoxic potential. Results: In the brine shrimp lethality assay of all extracts, exception of acetone, ethanol and petroleum ether extracts Gmelina asiatica displayed 100%mortality at 1 000 μg/mL by Artemia salina and Artemia fransiscana. Chloroform extract was the most potent and presented the highest percentage of mortality with the lowest LC50 values by both assay too. Conclusions:The results of the present study suggest the presence of photochemical possessing cytotoxic agents.

  5. Facile sand enhanced electro-flocculation for cost-efficient harvesting of Dunaliella salina.

    Science.gov (United States)

    Xiong, Qiong; Pang, Qi; Pan, Xinwei; Chika, A Okonkwo; Wang, Liqing; Shi, Jia; Jia, Lishan; Chen, Changping; Gao, Yahui

    2015-01-01

    Energy consumption and water resource in the cultivation and harvesting steps still need to be minimized for the popularization of the microalgae-based products. An efficient electro-flocculation method for harvesting Dunaliella Salina integrated with local sand has been successfully applied. Sand was effective for speeding up the processes of flocculation and sedimentation of algal flocs and the electrolytic hydroxides was essential to bridge the sand and small flocs into large dense flocs. The maximal recovery effective improved from 95.13% in 6min to 98.09% in 4.5min and the optimal electrical energy consumption decreased 51.03% compared to conventional electro-flocculation in a laboratory ambient condition. Furthermore, reusing the flocculated medium in cultivation of the D. Salina with nitrogen supplemented performed no worse than using fresh medium. This sand enhanced electro-flocculation (SEF) technology provides a great potential for saving time and energy associated with improving microalgae harvesting.

  6. Bioactivity evaluation against Artemia salina Leach of medicinal plants used in Brazilian Northeastern folk medicine.

    Science.gov (United States)

    Arcanjo, D D R; Albuquerque, A C M; Melo-Neto, B; Santana, L C L R; Medeiros, M G F; Citó, Amgl

    2012-08-01

    The brine shrimp (Artemia salina Leach) lethality bioassay offers an advantage in standardization and quality control of botanical products. This test is well correlated with antitumor activity (cytotoxicity) and can be used to monitor the activity of bioactive natural products. This paper reports the bioactivity of ethanol extracts from seven medicinal plants from the Northeast of Brazil (Acmella uliginosa, Ageratum conyzoides, Eugenia uniflora, Plectranthus neochilus, Moringa oleifera, Justicia pectoralis and Equisetum sp.) against Artemia salina. Biological activity was evaluated for extracts at 1, 10, 100, and 1000 µg/mL in triplicate, and the mean lethal concentration values (LC50) were obtained by probit analysis. The species Acmella uliginosa showed the highest bioactivity, and its flower extract was more active than its leaf extract.

  7. Dunaliella salina as marine microalga highly tolerant to but a poor remover of cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Folgar, S. [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain); Torres, E., E-mail: torres@udc.es [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain); Perez-Rama, M.; Cid, A.; Herrero, C.; Abalde, J. [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain)

    2009-06-15

    Cadmium tolerance and removal in the marine microalga Dunaliella salina were studied in cultures exposed to different metal concentrations (5-120 mg Cd l{sup -1}) for 96 h. This microalga can be included in the group of microalgal species most tolerant to cadmium due to the high value of EC50 that it possesses (48.9 mg Cd l{sup -1} at 96 h of culture). The greater percentage of cadmium removed was obtained in cultures exposed to 5 mg Cd l{sup -1} at 96 h, but removing only 11.3% of the added cadmium. In all cultures, the quantity of cadmium removed intracellularly was much lower than the bioadsorbed quantity and it was proportional to the sulfhydryl group levels. Both the Freundlich and Langmuir adsorption models were suitable for describing the short-term biosorption of cadmium by living cells of D. salina.

  8. El agua, el TLC y el agro

    Directory of Open Access Journals (Sweden)

    Alfredo Suárez Mejía

    2006-01-01

    Full Text Available Este artículo de absoluta actualidad se re- fiere al tratamiento que el poder ejecutivo viene dando al tema del agro y los recursos de los cuales depende. Ya en prensa el tema de tierras, corrupción y violencia ha sido registrado en relación con el gobierno del presidente Uribe y el Incoder. Ahora se trata de examinar de qué manera el Incoder desmonta el manejo y propiedad de los distritos de adecuación de tierras de los cuales depende la actividad agropecuaria sin que para tal expropiación del recurso agua se requiera acudir a las instancias de un TLC. La hipertrofia de las posiciones contra el TLC ha permitido sin lugar a dudas que desde el derecho interno mientras se negocia se adelanten las normas que permiten las inversiones que interesan al espacio de la “integración comercial”

  9. Lahar hazards at Agua volcano, Guatemala

    Science.gov (United States)

    Schilling, S.P.; Vallance, J.W.; Matías, O.; Howell, M.M.

    2001-01-01

    At 3760 m, Agua volcano towers more than 3500 m above the Pacific coastal plain to the south and 2000 m above the Guatemalan highlands to the north. The volcano is within 5 to 10 kilometers (km) of Antigua, Guatemala and several other large towns situated on its northern apron. These towns have a combined population of nearly 100,000. It is within about 20 km of Escuintla (population, ca. 100,000) to the south. Though the volcano has not been active in historical time, or about the last 500 years, it has the potential to produce debris flows (watery flows of mud, rock, and debris—also known as lahars when they occur on a volcano) that could inundate these nearby populated areas.

  10. El mundo yanacona alrededor del agua

    Directory of Open Access Journals (Sweden)

    Sofía Camargo

    2013-09-01

    Full Text Available Este texto procura hacer una breve descripción del pueblo indígena Yanacona, que, a pesar de los atropellos que ha sufrido desde tiempos remotos, logra conservar su historia, y trabaja por el fortalecimiento de su cultura y el rescate de sus formas de vida. Los yanaconas han contrarrestado los distintos sincretismos culturales que representa el medio, conservan algunas características de los pueblos quechuas andinos y el vínculo que une al indígena con la naturaleza y su territorio, -el Macizo Colombiano-, y en particular, con el agua, concebida desde su cosmovisión como fuente de vida y punto de partida de la existencia.

  11. El agua, el TLC y el agro

    Directory of Open Access Journals (Sweden)

    Claudia Sampedro Torres

    2006-11-01

    Full Text Available Este artículo de absoluta actualidad se refiere al tratamiento que el poder ejecutivo viene dando al tema del agro y los recursos de los cuales depende. Ya en prensa el tema de tierras, corrupción y violencia ha sido registrado en relación con el gobierno del presidente Uribe y el Incoder. Ahora se trata de examinar de qué manera el Incoder desmonta el manejo y propiedad de los distritos de adecuación de tierras de los cuales depende la actividad agropecuaria sin que para tal expropiación del recurso agua se requiera acudir a las instancias de un

  12. Contaminación del agua

    OpenAIRE

    Abarca Monge, Sergio; Mora Brenes, Bernardo

    2016-01-01

    En este artículo se reflexiona acerca de los factores que inciden en la contaminación del recurso hídrico y sus efectos sobre la calidad de vida y la salud de la población. Se señala que el agua potable no solo se contamina de forma natural, sino también por diferentes sustancias introducidas por actividades humanas en campos como la industria y la agricultura. No obstante, el mayor riesgo para la salud de la población lo representan los diferentes patógenos causantes de enfermedades mediante...

  13. Integrated assessment of the impacts of agricultural drainwater in the Salinas River (California, USA)

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, B.S.; Hunt, J.W.; Phillips, B.M.; Nicely, P.A.; Vlaming, V. de; Connor, V.; Richard, N.; Tjeerdema, R.S

    2003-08-01

    Invertebrate mortality was correlated with levels of water and sediment contaminatioin in the Salinas River. - The Salinas River is the largest of the three rivers that drain into the Monterey Bay National Marine Sanctuary in central California. Large areas of this watershed are cultivated year-round in row crops and previous laboratory studies have demonstrated that acute toxicity of agricultural drainwater to Ceriodaphnia dubia is caused by the organophosphate (OP) pesticides chlorpyrifos and diazinon. In the current study, we used a combination of ecotoxicologic tools to investigate incidence of chemical contamination and toxicity in waters and sediments in the river downstream of a previously uncharacterized agricultural drainage creek system. Water column toxicity was investigated using a cladoceran C. dubia while sediment toxicity was investigated using an amphipod Hyalella azteca. Ecological impacts of drainwater were investigated using bioassessments of macroinvertebrate community structure. The results indicated that Salinas River water downstream of the agricultural drain is acutely toxic to Ceriodaphnia, and toxicity to this species was highly correlated with combined toxic units (TUs) of chlorpyrifos and diazinon. Laboratory tests were used to demonstrate that sediments in this system were acutely toxic to H. azteca, which is a resident genus. Macroinvertebrate community structure was moderately impacted downstream of the agricultural drain input. While the lowest macroinvertebrate abundances were measured at the station demonstrating the greatest water column and sediment toxicity and the highest concentrations of pesticides, macroinvertebrate metrics were more significantly correlated with bank vegetation cover than any other variable. Results of this study suggest that pesticide pollution is the likely cause of laboratory-measured toxicity in the Salinas River samples and that this factor may interact with other factors to impact the

  14. Una punta de lanza decorada de la necrópolis de El Puntal (Salinas, Alicante

    Directory of Open Access Journals (Sweden)

    Hernández Alcaraz, Laura

    2000-12-01

    Full Text Available Not Available

    Este trabajo pretende dar a conocer la decoración damasquinada presente en una punta de lanza de la necrópolis ibérica de El Puntal (Salinas, Alicante, datada en el s. IV a.C. Se señala asimismo la importancia que adquiere la sepultura en la que aparece, que sobresale del conjunto para convertirse en el lugar de enterramiento de un personaje destacado.

  15. Assessment of toxicity of Moringa oleifera flower extract to Biomphalaria glabrata, Schistosoma mansoni and Artemia salina.

    Science.gov (United States)

    Rocha-Filho, Cláudio A A; Albuquerque, Lidiane P; Silva, Luanna R S; Silva, Patrícia C B; Coelho, Luana C B B; Navarro, Daniela M A F; Albuquerque, Monica C P A; Melo, Ana Maria M A; Napoleão, Thiago H; Pontual, Emmanuel V; Paiva, Patrícia M G

    2015-08-01

    This study reports the effect of an aqueous extract from Moringa oleifera Lam. flowers on Biomphalaria glabrata embryos and adults and on Schistosoma mansoni adult worms. The extract contains tannins, saponins, flavones, flavonols, xanthones, and trypsin inhibitor activity. The toxicity of the extract on Artemia salina larvae was also investigated to determine the safety of its use for schistosomiasis control. After incubation for 24h, the flower extract significantly (p<0.05) delayed the development of B. glabrata embryos and promoted mortality of adult snails (LC50: 2.37±0.5mgmL(-1)). Furthermore, treatment with the extract disrupted the development of embryos generated by snails, with most of them remaining in the blastula stage while control embryos were already in the gastrula stage. Flower extract killed A. salina larvae with a LC50 value (0.2±0.015mgmL(-1)) lower than that determined for snails. A small reduction (17%) in molluscicidal activity was detected when flower extract (2.37mgmL(-1)) was exposed to tropical environmental conditions (UVI index ranging from 1 to 14, temperature from 25 to 30°C, and 65% relative humidity). Toxicity to A. salina was also reduced (LC50 value of 0.28±0.01mgmL(-1)). In conclusion, M. oleifera flower extract had deleterious effects on B. glabrata adults and embryos. However, unrestricted use to control schistosomiasis should be avoided due to the toxicity of this extract on A. salina.

  16. On the motility of living invertebrates The case of Artemia Salina

    Science.gov (United States)

    Huerta, R.; Hernández, A.; Alvarado-Gil, J. J.

    1998-08-01

    Using a laser beam deflection technique a non-destructive and non-invasive method is developed. This method is applied to monitor the motility of small invertebrates, in particular we study the important case of the crustacean Artemia Salina and the motion of its different parts. We find out that its dynamics can be explained as a superposition of several periodic motions with very well defined frequencies.

  17. Neutron flow exposure as a test for survival of Artemia salina spores.

    Science.gov (United States)

    Matveeva, I S; Smirnov, A N; Vodennikov, B D; Popov, I M; Semenov, D S; Kolesnikov, M V; Syroeshkin, A V

    2004-11-01

    Live and heat-inactivated Artemia salina spores (samples with the same mass and filling density) were exposed to a flow of thermal neutrons from a (252)Cf radioactive source at an equivalent dose power of about 1 microSv/h. Irradiation led to a 4-fold acceleration of nauplius development and to modification of the element profiles of live spores. The difference between absorption/diffusion of thermal neutrons by live and dead spores was revealed.

  18. Repercusiones sanitarias de la calidad del agua: los residuos de medicamentos en el agua

    Directory of Open Access Journals (Sweden)

    Cristina Postigo Rebollo

    2011-12-01

    Full Text Available Este trabajo resume varios estudios de monitorización de fármacos y drogas de abuso llevados a cabo en el medio ambiente acuático de las cuencas de los ríos Llobregat y Ebro con el fin de evaluar la calidad del agua en relación a la presencia de estas substancias y su potencial riesgo para la salud ambiental y pública. La identificación de estos compuestos aguas abajo del punto de vertido de las plantas depuradoras apunta a la descarga de agua residual tratada como la principal fuente de emisión de estos contaminantes en el medio acuático. El perfil de contaminación por fármacos fue bastante similar en ambas cuencas. No obstante, los índices de riesgo (HQ calculados para los fármacos en diferentes niveles tróficos (algas, dáfnidos y peces indican que los compuestos que presentan un mayor riesgo ecotóxico en el Llobregat son el sulfametoxazol (antibiótico sulfamida para las algas, el gemfibrozil (regulador de lípidos para las algas y los peces, el ácido clofíbrico (regulador de lípidos y la eritromicina (antibiótico macrólido para los dáfnidos, y el ibuprofeno (analgésico anti-inflamatorio para todos los eslabones tróficos. En el Ebro, los compuestos más problemáticos son el sulfametoxazol para las algas, y la eritromicina, el ácido clofíbrico y la fluoxetina (antidepresivo para los dáfnidos.Los niveles de drogas de abuso (y sus metabolitos determinados en la cuenca del Ebro son aproximadamente uno y dos órdenes de magnitud más bajos respectivamente que los determinados en las aguas de salida y de entrada a las depuradoras. Sin embargo, debido a la falta de datos sobre su ecotoxicidad, no se han podido calcular índices de riesgo.La presencia de estos compuestos (fármacos y drogas en aguas superficiales y de bebida aun no está regulada y, por lo tanto, no constituyen parámetros de obligado control. Aún es imprescindible seguir investigando para poder evaluar su posible efecto en la salud humana.

  19. El derecho al agua en las legislaciones nacionales

    OpenAIRE

    Smets, Henri

    2006-01-01

    Cuando sobreviene una catástrofe las víctimas reciben en primer lugar ayuda médica, agua potable, alimentación y un refugio. Todo el mundo está de acuerdo en reconocer que los servicios médicos, la alimentación y el alojamiento son derechos económicos y sociales que cada persona debería tener, pero aún hay quienes se preguntan sobre la naturaleza del acceso al agua. ¿Hoy en día puede dudarse de la existencia de un derecho al agua? ¿Es posible disociar de modo razonable el agua de otros bienes...

  20. Abasto del agua en la frontera norte de Tamaulipas

    Directory of Open Access Journals (Sweden)

    Jesús FRAUSTO ORTEGA

    2016-01-01

    Full Text Available El trabajo ref lexiona sobre el abasto de agua potable en los municipios fronterizos del norte de Tamaulipas, a partir de la perspectiva del derecho humano al agua ( DHA . Se responde la pregunta: ¿cómo se ha desarrollado la cobertura de agua potable en esos municipios? Se revisan estadísticas del Inegi de 1990 a 2010, ejemplares del Periódico o f icial del estado y diversas fuen - tes secundarias. Se encuentra que hay coberturas altas, tanto en agua potable como en drenaje, superiores a los promedios nacional y regional. Sin embargo, aún existe población sin acceso a estos servicios en sus viviendas y que, utilizando el DHA como una herramienta de gestión, puede demandar la dotación de esos servicios.

  1. Hydrothermal liquefaction of Spirulina and Nannochloropsis salina under subcritical and supercritical water conditions.

    Science.gov (United States)

    Toor, Saqib S; Reddy, Harvind; Deng, Shuguang; Hoffmann, Jessica; Spangsmark, Dorte; Madsen, Linda B; Holm-Nielsen, Jens Bo; Rosendahl, Lasse A

    2013-03-01

    Six hydrothermal liquefaction experiments on Nannochloropsis salina and Spirulina platensis at subcritical and supercritical water conditions (220–375 °C, 20–255 bar) were carried out to explore the feasibility of extracting lipids from wet algae, preserving nutrients in lipid-extracted algae solid residue, and recycling process water for algae cultivation. GC–MS, elemental analyzer, FT-IR, calorimeter and nutrient analysis were used to analyze bio-crude, lipid-extracted algae and water samples produced in the hydrothermal liquefaction process. The highest bio-crude yield of 46% was obtained on N. salina at 350 °C and 175 bar. For S. platensis algae sample, the optimal hydrothermal liquefaction condition appears to be at 310 °C and 115 bar, while the optimal condition for N. salina is at 350 °C and 175 bar. Preliminary data also indicate that a lipid-extracted algae solid residue sample obtained in the hydrothermal liquefaction process contains a high level of proteins.

  2. Monitoring the Effect of Metal Ions on the Mobility of Artemia salina Nauplii.

    Science.gov (United States)

    Kokkali, Varvara; Katramados, Ioannis; Newman, Jeffrey D

    2011-03-28

    This study aims to measure the effect of toxic aqueous solutions of metals on the mobility of Artemia salina nauplii by using digital image processing. The instrument consists of a camera with a macro lens, a dark chamber, a light source and a laptop computer. Four nauplii were inserted into a macro cuvette, which contained copper, cadmium, iron and zinc ions at various concentrations. The nauplii were then filmed inside the dark chamber for two minutes and the video sequence was processed by a motion tracking algorithm that estimated their mobility. The results obtained by this system were compared to the mortality assay of the Artemia salina nauplii. Despite the small number of tested organisms, this system demonstrates great sensitivity in quantifying the mobility of the nauplii, which leads to significantly lower EC50 values than those of the mortality assay. Furthermore, concentrations of parts per trillion of toxic compounds could be detected for some of the metals. The main novelty of this instrument relies in the sub-pixel accuracy of the tracking algorithm that enables robust measurement of the deterioration of the mobility of Artemia salina even at very low concentrations of toxic metals.

  3. Chronic toxicity bioassay with populations of the crustacean Artemia salina exposed to the organophosphate diazinon.

    Science.gov (United States)

    Bustos-Obregon, Eduardo; Vargas, Alvaro

    2010-01-01

    A chronic toxicity bioassay was conducted with the microcrustacean Artemia salina as the testing organism for the toxic organophosphate diazinon in order to determine if the species is an appropriate indicator of pollution in aquatic environments. Tests of animal exposure to different concentrations of the toxicant were performed for 24, 48 and 72 hours after larvae hatching. Registered mortality data was used to obtain the lethal dose 50 (LD50) of the organophosphate for each exposure time, considering the immobilization of A. salina larvae as the mortality parameter. The lethal concentration (LD50) in the same exposure times was calculated by evaluating morphological changes on the three initial stages of larval development. Both doses were determined by using probit statistical analysis. Results indicate greater dose-response exactitude after 24 hours of exposure to the toxicant. High sensitivity of the organism to the toxicant was determined, thus indicating that A. salina is an appropriate ecotoxicological bioindicator of aquatic environments polluted with pesticides, with the special consideration that this species is a natural resident of saline water bodies, and thus could be used to control pollution in these environments as a result of the unrestrained usage of such toxic substances.

  4. Toxicity and characterization of cholinesterase-inhibition induced by diisopropyl fluorophosphate in Artemia salina larvae.

    Science.gov (United States)

    Sánchez-Fortún, S; Barahona, M V

    2009-03-01

    The acute toxicity of diisopropyl fluorophosphate (DFP) on three age classes of Artemia salina was evaluated. An increase in toxicity of this organophosphorous (OP) compound was found following longer development of A. salina larvae. The effects of pretreatment with the non-selective muscarinic antagonist atropine, the two reversible acetylcholinesterase inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methoiodide (2-PAM), as individual and combined pretreatments, on DFP-induced lethality in 24h Artemia were also investigated. The lethal action of DFP was not prevented by pretreatment of 24h Artemia with atropine, physostigmine, and pyridostigmine, while 2-PAM proved effective against intoxication with this OP compound. The inhibitory effects of combinations of atropine (10(-5)M) plus 2-PAM or physostigmine were greater than those elicited by either drug alone, with the maximum protection afforded being 100%. Pretreatment with 2-PAM (10(-6)M) plus physostigmine or pyridostigmine was ineffective. These results suggest that the combinations of atropine plus 2-PAM or physostigmine are effective in the prevention of the lethal effects induced by DFP in A. salina larvae.

  5. Política descentralizadora del agua potable

    Directory of Open Access Journals (Sweden)

    María de los Ángeles Cienfuegos Velasco

    2012-01-01

    Full Text Available Hablar de política descentralizadora en relación con la gestión del agua potable implica aclarar el significado de descentralización y su aplicación en México. En este trabajo se ofrecen algunas aportaciones al concepto y se describe el proceso que, de hecho, ha ocurrido en la política de descentralización del agua en el país.

  6. Desarrollo sostenible y el agua como derecho en Colombia

    Directory of Open Access Journals (Sweden)

    Angélica-Paola Díaz-Pulido

    2010-03-01

    Full Text Available El agua como recurso ambiental, bien económico y bien social debería hacer parte de la agenda pública colombiana, no sólo en cuanto a su manejo y preservación, sino también en cuanto a las implicaciones sociales que se puedan generar en su tenencia y uso. Esta preocupación tiene sus orígenes en los años setenta, en los que se inició un proceso de preocupación mundial por los recursos naturales y su rápida disminución, escasez y extinción. Uno de los resultados fue el establecimiento de convenciones y acuerdos internacionales sobre el manejo responsable de los recursos naturales. En cuanto al agua como recurso ambiental, se encuentra intrínsecamente ligado al funcionamiento de los ecosistemas y a los ciclos naturales del planeta. Para el caso del contexto colombiano, este artículo analiza: el agua como parte del desarrollo sostenible, el agua como derecho y, finalmente, el agua como derecho en el contexto colombiano dentro del marco explicativo del Referendo del Agua.

  7. Estudio de la calidad del agua en cisternas de captación de agua de lluvia en escuelas rurales de Alagoas (Brasil)

    OpenAIRE

    Gonzalez Abelleira, Mafalda

    2014-01-01

    El presente trabajo se centra en el estudio de la calidad del agua de Sistemas de Recogida de agua de lluvia en escuelas del Semiárido Alagoano de Brasil. Aspectos de la obra civil también son incluidos. Los Sistemas principalmente están formados por un área de captación de agua de lluvia, cisternas de placas de cemento, canalizaciones que las unen y una bomba manual para la retirada del agua de la cisterna. Se analizaron 206 muestras de parámetros básicos de la calidad del agua – conducti...

  8. El régimen jurídico de las aguas para usos agrícolas: aguas subterráneas

    Directory of Open Access Journals (Sweden)

    Fernando Brebbia

    2015-01-01

    Full Text Available Como ha señalado el profesor Adolfo Gelsi Bidart la relación entre tierra yagua es alguno de los aspectos que el derecho agrario debe tener en cuenta y ello importa establecer si la regulación de las aguas compete al derecho agrario, constituye una disciplina autónoma, o bien si su estudio corresponde a diversas ramas del derecho cada una de las cuales debe ocuparse de examinar determinados aspectos, o mejor, de distintas formas de su uso y aprovechamientol (...Contenido: Derecho agrario y derecho de aguas. Algunos datos estadísticos acerca del agua. Los usos del agua. Aguas públicas y aguas privadas. La utilización del agua para la agricultura. El tratamiento legal de las aguas para la agricultura en los países del Mercosur: Argentina, Brasil, Paraguay, Uruguay. Evolución legislativa del régimen de las aguas subterráneas en el derecho agrario comparado. Modernas tendencias sobre el dominio de las aguas subterráneas. Las leyes de aguas de España e Italia

  9. Dos nuevas estelas funerarias con mención de origo procedentes del balneario de Archena (Murcia)

    OpenAIRE

    2007-01-01

    Hay constancia arqueológica del uso de las aguas mineromedicinales de Archena desde el bronce final, pero la primera gran transformación del lugar se lleva a cabo por los romanos de la colonia de Carthago Noua en la segunda mitad del siglo I a.C. Entre Tiberio y Nerón, la actividad constructiva es frenética. A finales del reinado de Nerón, comienza el abandono del lugar y durante Vespasiano sólo existe una ocupación residual y estacional que no genera urbanismo. Las instalaciones del balneari...

  10. LOS BIOSÓLIDOS DE AGUAS RESIDUALES URBANAS APLICADOS CON DIFERENTES FRECUENCIAS EN LAS PROPIEDADES QUÍMICAS Y MICROBIOLÓGICAS DEL SUELO, EL RENDIMIENTO Y LA CALIDAD DE LOS FRUTOS DE TOMATE (Solanum lycopersicum Mill

    Directory of Open Access Journals (Sweden)

    E. Utria

    2008-01-01

    Full Text Available Con el objetivo de evaluar el impacto del uso agrícola de los biosólidos de aguas residuales urbanas procedentes de la Estación Depuradora de Aguas Residuales "Quibú", se desarrolló el presente trabajo en el Instituto Nacional de Ciencias Agrícolas (INCA. Los biosólidos obtenidos mediante digestión anaeróbica y aplicados en un suelo Ferralítico Rojo compactado incrementaron los contenidos de materia orgánica oxidable, fósforo asimilable y calcio cambiable. Aumentaron los contenidos totales de bacterias, hongos y actinomicetos en el suelo, mientras que las poblaciones de patógenos fueron mínimas y en algunos casos nulas. Por otra parte, se observó que la aplicación de este residuo orgánico influyó positivamente en la producción de plantas de tomate y sus componentes, sin alterar la calidad de los frutos. De forma general, se demostró que el uso de los biosólidos con fines agrícolas es una alternativa viable en los sistemas de explotación agrícola.

  11. Modelización del proceso de degradación de envases metálicos para bebida, en el suelo, en el agua y en la interacción agua-suelo

    Directory of Open Access Journals (Sweden)

    Rieiro, I.

    2013-12-01

    Full Text Available This study asses the environmental pollution by metal release that takes place during prolonged exposures when metallic drink containers are accidentally settle in the soil in a uncontrolled way, For comparative purposes, the F111 steel and the aluminium alloy 3003, widely used for the fabrication of these containers, are also considered. A experimental design is proposed to simulate the environmental pollution during prolonged exposures. Analytical indicators have been obtained determining the metallic concentration from three types of mediums; water, water in presence of soil, and absorption-adsorption in soil. An analytical methodology has been developed by Atomic Emission Spectrometry with ICP as exciting source (ICP-OES for metallic quantification. The method was validated using Certified Reference Materials (CRMs of soil and water and the precision obtained varies from 5.39 to 5.86% and from 5.75 to 6.27%, respectively according to of the element studied. A statistical descriptive study followed by a factorial analysis (linear general model has been carried out for the treatment of the experimental data packages. The metallic quantification for the three mediums shows that the soil inhibits metallic solubility in water. The process to make packages reduces in both cases their metallic cession.En este estudio se evalúa la contaminación metálica que se produce a lo largo del tiempo al depositar en el suelo hojalata y hoja de aluminio, procedentes de envases comerciales de bebidas. Con el fin de evaluar el efecto del proceso de fabricación, se ha investigado el comportamiento del acero F111 y de la aleación de aluminio 3003, frecuentemente utilizados en la elaboración de estos envases. Para el estudio, se propone un diseño experimental que simula la degradación medioambiental a lo largo del tiempo de este tipo de envases cuando se depositan de forma incontrolada en el suelo. Los indicadores analíticos se han obtenido determinando la

  12. Comparative analysis on the key enzymes of the glycerol cycle metabolic pathway in Dunaliella salina under osmotic stresses.

    Science.gov (United States)

    Chen, Hui; Lu, Yan; Jiang, Jian-Guo

    2012-01-01

    The glycerol metabolic pathway is a special cycle way; glycerol-3-phosphate dehydrogenase (G3pdh), glycerol-3-phosphate phosphatase (G3pp), dihydroxyacetone reductase (Dhar), and dihydroxyacetone kinase (Dhak) are the key enzymes around the pathway. Glycerol is an important osmolyte for Dunaliella salina to resist osmotic stress. In this study, comparative activities of the four enzymes in D. salina and their activity changes under various salt stresses were investigated, from which glycerol metabolic flow direction in the glycerol metabolic pathway was estimated. Results showed that the salinity changes had different effects on the enzymes activities. NaCl could stimulate the activities of all the four enzymes in various degrees when D. salina was grown under continuous salt stress. When treated by hyperosmotic or hypoosmotic shock, only the activity of G3pdh in D. salina was significantly stimulated. It was speculated that, under osmotic stresses, the emergency response of the cycle pathway in D. salina was driven by G3pdh via its response to the osmotic stress. Subsequently, with the changes of salinity, other three enzymes started to respond to osmotic stress. Dhar played a role of balancing the cycle metabolic pathway by its forward and backward reactions. Through synergy, the four enzymes worked together for the effective flow of the cycle metabolic pathways to maintain the glycerol requirements of cells in order to adapt to osmotic stress environments.

  13. Panama Canal Watershed Experiment- Agua Salud Project

    Science.gov (United States)

    Stallard, Robert F.; Ogden, Fred L.; Elsenbeer, Helmut; Hall, Jefferson S.

    2010-01-01

    The Agua Salud Project utilizes the Panama Canal’s (Canal) central role in world commerce to focus global attention on the ecosystem services provided by tropical forests. The Canal was one of the great engineering projects in the world. Completed in 1914, after almost a decade of concerted effort, its 80 km length greatly shortened the voyage between the Atlantic and Pacific Oceans. An entire class of ships, the Panamax, has been constructed to maximize the amount of cargo that can be carried in a Canal passage. In today’s parlance, the Canal is a “green” operation, powered largely by water (Table 1). The locks, three pairs on each end with a net lift of 27 meters, are gravity fed. For each ton of cargo that is transferred from ocean to ocean, about 13 tons of water (m3) are used. Lake Gatún forms much of the waterway in the Canal transect. Hydroelectricity is generated at the Gatún dam, whenever there is surplus water, and at Madden Dam (completed in 1936) when water is transferred from Lake Alhajuela to Lake Gatún. The Canal watershed is the source of drinking water for Panama City and Colon City, at either end of the Canal, and numerous towns in between.

  14. Brine shrimp (Artemia salina Leach bioassay of extracts from Lychnophoriopsis candelabrum and different Lychnophora species

    Directory of Open Access Journals (Sweden)

    Z.S Ferraz Filha

    2012-01-01

    Full Text Available The present study aimed to evaluate on Artemia salina the citotoxicity of twenty-two extracts from five species of the genus Lychnophora and one species of the genus Lychnophoriopsis. The extracts solubilized in DMSO and prepared at the final concentrations of 100, 250, 375, 500 and 600 μg mL-1 were added to tubes containing Artemia salina nauplii (10 units each and filled to 5 mL total volume with artificial salt water. Lapachol and 5% DMSO were used as positive and negative controls, respectively. The samples were kept under light and dead larvae were counted after 24 hours of contact. LC50 was calculated by using Probit software. The crude ethanol extracts from five species showed low lethality in the following order: Lychnophora trichocarpha (LC50 = 672.38 μg mL-1 > Lychnophora pinaster (LC50 = 678.73 μg mL-1 > Lychnophora ericoides (LC50 = 738.09 μg mL-1 > Lychnophoriopsis candelabrum (LC50 = 812.57 μg mL-1 > Lychnophora passerina (LC50 = 921.78 μg mL-1. All tested extracts from L. candelabrum and chloroform extract from L. staavioides showed light toxicity on A. salina. Results indicated that there are substances with potential pharmacological activity in all tested species.O presente estudo teve como objetivo avaliar a citotoxicidade sobre Artemia salina de vinte e dois extratos de cinco espécies do gênero Lychnophora e de uma espécie de Lychnophoriopsis. Os extratos solubilizados em DMSO, preparados nas concentrações finais de 100, 250, 375, 500 e 600 μg mL-1, foram adicionados a recipientes contendo náuplios de Artemia salina (10 unidades cada e completou-se o volume para 5 mL com solução marinha. Lapachol e DMSO 5% foram usados como controles positivo e negativo, respectivamente. As amostras foram mantidas sob iluminação e as larvas mortas foram contadas após 24 horas de contato. O cálculo da LC50 foi feito utilizando-se o programa Probitos. Os extratos etanólicos brutos de cinco espécies apresentaram baixa

  15. LIPID PRODUCTION BY DUNALIELLA SALINA IN BATCH CULTURE: EFFECTS OF NITROGEN LIMITATION AND LIGHT INTENSITY

    Energy Technology Data Exchange (ETDEWEB)

    Weldy, C.S.; Huesemann, M.

    2007-01-01

    Atmospheric carbon dioxide (CO2) concentrations are increasing and may cause unknown deleterious environmental effects if left unchecked. The Intergovernmental Panel on Climate Change (IPCC) has predicted in its latest report a 2°C to 4°C increase in global temperatures even with the strictest CO2 mitigation practices. Global warming can be attributed in large part to the burning of carbon-based fossil fuels, as the concentration of atmospheric CO2 is directly related to the burning of fossil fuels. Biofuels which do not add CO2 to the atmosphere are presently generated primarily from terrestrial plants, i.e., ethanol from corn grain and biodiesel from soybean oil. The production of biofuels from terrestrial plants is severely limited by the availability of fertile land. Lipid production from microalgae and its corresponding biodiesel production have been studied since the late 1970s but large scale production has remained economically infeasible due to the large costs of sterile growing conditions required for many algal species. This study focuses on the potential of the halophilic microalgae species Dunaliella salina as a source of lipids and subsequent biodiesel production. The lipid production rates under high light and low light as well as nitrogen suffi cient and nitrogen defi cient culture conditions were compared for D. salina cultured in replicate photobioreactors. The results show (a) cellular lipid content ranging from 16 to 44% (wt), (b) a maximum culture lipid concentration of 450mg lipid/L, and (c) a maximum integrated lipid production rate of 46mg lipid/L culture*day. The high amount of lipids produced suggests that D. salina, which can be mass-cultured in non-sterile outdoor ponds, has strong potential to be an economically valuable source for renewable oil and biodiesel production.

  16. High temperatures and inverted metamorphism in the schist of Sierra de Salinas, California

    Science.gov (United States)

    Kidder, Steven; Ducea, Mihai N.

    2006-01-01

    New field and thermobarometric work in the Californian Salinian block clarifies current and pre-Tertiary relationships between the schist of Sierra de Salinas and Cretaceous arc-related granitic rocks. The contact is variably preserved as a brittle fault and high-temperature mylonite zone, the Salinas shear zone, which represents the contact between North America and sediments accreted above the Farallon slab between ˜ 76 Ma and ˜ 70 Ma. Near granulite facies, prograde replacement of hornblende with clinopyroxene is associated with deformation of plutonic rocks at the base of the upper plate. In the lower plate, the schist of Sierra de Salinas, garnet-biotite thermometry indicates decreasing temperatures down-section from at least 714 °C to ˜ 575 °C over an exposed thickness of ˜ 2.5 km, consistent with petrologic evidence of an inverted metamorphic gradient. The measured temperatures are significantly higher than observed at shallow levels above subducting slabs or predicted by 2D computational models assuming low shear stresses. Previous workers have called upon shear heating to explain similar observations in the correlative Pelona schist, an unlikely scenario given the results of recent rock deformation experiments which predict that feldspar-quartz-mica aggregates are far too weak to withstand stresses of ˜ 70 MPa required by the shear heating hypothesis. As an alternative, we propose that high temperatures resulted from conductive heating while the leading edge of the schist traveled ˜ 150 km beneath the recently active Salinian continental arc during the initiation of shallow subduction. Weakening of the schist due to high temperatures helped facilitate the collapse of the Salinian arc as the schist was emplaced. Schist emplacement coincided with loss of lower, mafic portions of the arc, and therefore evolution of the Southern California crust towards a more felsic composition.

  17. Gestión de la Hilandería Intercomunal Salinas. Proyecto de cooperación al desarrollo en la comunidad andina de Salinas de Guaranda, Ecuador

    OpenAIRE

    Kimball Zurbano, Mark

    2012-01-01

    En este proyecto final de carrera hago una descripción de los diferentes puntos de actuación en los que trabajé en la Hilandería Intercomunal Salinas (Ecuador). Al final hago una reflexión del mundo de la cooperación según mi experiencia vivida. Las nueve partes en las que he dividido mi trabajo son Salinas: un ejemplo de economía solidaria, estudio de los procesos productivos, cálculo de costes de producción, fijación de precios, plan de producción, medio ambiente, materia prima, e...

  18. Monitoramento dos extratos brutos de espécies de Polygala (Polygalaceae utilizando Artemia salina

    Directory of Open Access Journals (Sweden)

    A.B.P. Montanher

    2003-01-01

    Full Text Available Extratos de duas espécies de Polygala foram submetidos a um biomonitoramento utilizando o teste de toxicidade frente a Artemia salina, com a finalidade de detectar atividade citotóxica. Os resultados obtidos para o extrato bruto, frações hexânica e diclorometano de Polygala sabulosa Aw. Benn. mostraram-se promissores. No entanto, bioensaios mais específicos devem ser encorajados nos extratos vegetais que apresentam atividade diante deste bioensaio, a fim de confirmar estas conclusões.

  19. Atividade antibacteriana in vitro e toxicidade frente à Artemia salina Leach. de alguns compostos triazenos

    Directory of Open Access Journals (Sweden)

    Gustavo Luiz Paraginski

    2014-01-01

    Full Text Available Bacterial resistance to antibacterial agents is currently a major concern. We report the synthesis, in vitro antibacterial activity and toxicity toward Artemia salina of six diaryltriazene compounds bearing different substituent groups. Minimal Inhibitory Concentration (MIC and Minimal Bactericidal Concentration (MBC values against standard strains (ATCC and clinical isolates (including ESBL, MBL and AmpC strains were good to very good, in the range 8 to 128 mg mL-1. Results suggest that hydroxyl, 4-carboxyl and 4-phenyldiazenil groups attached to the diaryltriazenes provide enhanced activity. Toxicity results showed very low LC50 values for three compounds (10-fold lower than DTIC.

  20. Vigilancia de la calidad microbiológica de las aguas de consumo humano y que vayan a ser destinadas a su consumo en la provincia de Valencia durante el período 2002-2010

    Directory of Open Access Journals (Sweden)

    Pedro Martí Requena

    2013-12-01

    Full Text Available El presente trabajo tiene como objetivo la evaluación de la calidad microbiológica de las muestras de agua analizadas en la provincia de Valencia durante el período 2002-2010. Se observó la variación espacial, temporal y por origen de las muestras que no cumplían los requisitos especificados en el RD 140/2003 para los coliformes totales (CT, coliformes fecales (CF, Escherichia coli (EC, aerobios a 22 ºC (AB 22 ºC, estreptococos fecales (EF, enterococos (EN, Clostridium sulfito reductores (CS, y Clostridium perfringens (CP, estratificando las muestras en aquellas que cumplían la normativa “Conformes” y las que no “No Conformes”, y su relación con el grado de cloración.Se estudian un total de 10057 muestras de agua procedentes de fuentes que no manan de la red, aguas superficiales, aguas provenientes de plantas desnitrificadoras, pozos y redes de distribución. Se han agrupado en las 17 comarcas de la provincia de Valencia.Del total de las muestras, no cumplían los requisitos de calidad para CT el 34,0 %, para EF-EN el 16,0 %, para AB 22 ºC el 15.5 % para CF-EC el 13,0 % y para CS-CP el 5,6 %. Los porcentajes más elevados de muestras “No Conformes” se observaron situados en la zona interior, y en los años 2002-2004, 2008 y 2009. Respecto a la distribución por origen, se observaron en aguas superficiales, seguidas de fuentes y pozos.Del total de muestras estudiadas, el 39,8 % eran “No Conformes”, y de estas un 18,3 % procedían de abastecimientos que proveen a la población (redes de distribución.El 61,0 % de las muestras “Conformes” estaban cloradas, lo que demuestra que el cloro sigue siendo un tratamiento efectivo de desinfección.

  1. Los conflictos del agua en España

    Directory of Open Access Journals (Sweden)

    Gaspar Mairal Buil

    2005-04-01

    Full Text Available En este trabajo se analizan los conflictos producidos en España en los últimos años en torno a la construcción de grandes presas, tratando de mostrar cómo los afectados han forjado una noción compartida de riesgo y cómo ha surgido un movimiento social con un discurso proyectado hacia ámbitos más globales. Estos hechos se sitúan en relación con la política del agua de la nueva Directiva Marco del Agua (2000 de la Unión Europea para mostrar una insuficiencia, ya que ésta no toma en cuenta el significado cultural de los usos del agua.

  2. Defensa del agua desde la participación comunitaria

    Directory of Open Access Journals (Sweden)

    Martha Muñoz

    2013-09-01

    Full Text Available Las organizaciones comunitarias en Colombia defienden el mantenimiento de los páramos, indispensables para la provisión de agua en zonas rurales y urbanas. Se oponen a la idea del desarrollo económico que concibe al agua como servicio ambiental, vulnerando un derecho fundamental. Un ejemplo de organización es la que se lleva a cabo en el Santuario de Flora y Fauna de Iguaque. Ahí, los veedores saben que si no luchan por el agua perderán un derecho, como sucedió en las veredas de Olivos Alto y Bajo del municipio de Sanjuan de Rioseco, donde el Estado impuso sus políticas.

  3. Química recreativa con agua oxigenada

    OpenAIRE

    Aguilar Muñoz, Mª Luisa; Durán Torres, Carlos

    2011-01-01

    Con el objeto de despertar el interés por la química así como de tratar diversos conceptos químicos y biológicos, presentamos la reacción de descomposición catalítica del agua oxigenada (H2O2) en tres experiencias diferentes y con distintos catalizadores. Esta reacción es muy exotérmica, produciendo agua y oxigeno. En la primera experiencia, se mezclan en una probeta la disolución de agua oxigenada y un poco de lavavajillas. Al añadir yoduro de potasio, este actúa como catalizador y aparece g...

  4. La teoría armónica después de Francisco de Salinas

    OpenAIRE

    2014-01-01

    [ES] Francisco de Salinas ha sido considerado siempre como uno de los grandes teóricos musicales de todos los tiempos, aunque su mayor fama se debe a la famosa «Oda a Salinas» de fray Luis de León. Como buen humanista, nuestro autor pretende abarcar todos los aspectos musicales conocidos de su época. Para ello le asiste, no solo su pericia como instrumentista sino su conocimiento del latín y el griego, que le permitía acceder a las fuentes clásicas, muchas de las cuales estaban ap...

  5. Conjunto metálico con puntas de jabalina procedentes del yacimiento de La Pestaña (Badajoz

    Directory of Open Access Journals (Sweden)

    Enríquez Navascués, Juan Javier

    2013-12-01

    Full Text Available This paper presents an unpublished photograph whith metal pieces from La Pestaña (Badajoz, where two Pastora-type javelins stand out. The photo comes from the archive of Aurelio Cabrera (1870-1936, sculptor and archaeologist. Six of the pieces have been located in the Badajoz Provincial Archaeological Museum, three of which have elemental anaylises. The other six pieces are missing, including the Pastora-type javelins among them. The photograph attests to their existence and origin strengthens the southwestern distribution of this type of javelin point.Se amplía la corta serie de puntas tipo Pastora hasta ahora conocidas en la Península Ibérica, gracias a la localización de una fotografía inédita del archivo del escultor y arqueólogo Aurelio Cabrera Gallardo (1870-1936. La fotografía muestra 12 piezas metálicas procedentes de la Dehesa de la Pestaña, en la finca Los Fresnos (Badajoz. Seis de ellas han sido localizadas en el Museo Arqueológico Provincial de Badajoz y tres cuentan con análisis elemental. Otras seis, entre las que están las puntas, están desaparecidas. La fotografía testimonia su existencia y una procedencia que refuerza la distribución suroccidental de este tipo de puntas de jabalina.

  6. Aportación al conocimiento del Eneolítico-Bronce: un hacha pulimentada procedente de Cortos (Soria

    Directory of Open Access Journals (Sweden)

    José Alberto Bachiller Gil

    2013-10-01

    Full Text Available Con este estudio queremos dar a conocer un hallazgo arqueológico aparecido hace ya bastantes años, pero que aún permanecía inédito. Sólo una pequeña nota publicada por F. Morales en la Carta Arqueológica de Soria “La Altiplanicie Soriana” era toda la referencia que se tenía sobre la pieza. Se trata de un hacha pulimentada procedente de la localidad de Cortos (Soria, a pie de la Sierra del Almuerzo, y que se puede encuadrar cronológicamente en el Eneolítico-Bronce.In this work we present an archaeological find discovered many years ago but still not properly documented. The only reference to this piece comes from a short note published by F. Morales in the book “Carta Arqueológica de Soria: La Altiplanicie Soriana”. This piece is a polished stone axe found in Cortos (Soria, under Sierra del Almuerzo, that can be dated on the Eneolithic of the Bronze Age.

  7. IMPACTO DEL USO DE AGUA RESIDUAL EN LA AGRICULTURA

    Directory of Open Access Journals (Sweden)

    María E. Guadarrama-Brito

    2015-07-01

    Full Text Available La escasez de agua para uso urbano y la dependencia del riego para la producción agrícola en zonas de rápido crecimiento demográfico, han contribuido a que a nivel internacional aumente el interés en el reuso del agua. Existen riesgos para la salud debido a la presencia de microorganismos y contaminantes como los metales pesados y mutagénicos; los primeros impactan a corto plazo, debido a la contaminación de alimentos que pueden provocar, y los segundos impactan a largo plazo, contribuyendo a la salinización de suelos, lo que detrimenta la productividad para eventualmente derivar en el abandono de terrenos. El reuso del agua residual en la agricultura se ha convertido en una necesidad, la cual debe ser considerada como una alternativa, aunque no ha sido evaluada en los aspectos de contenido y migración de contaminantes, en particular de metales pesados. Algunos de los metales pesados pueden forman parte natural del suelo en cantidades que no resultan tóxicas para los seres vivos; sin embargo, la industrialización ha provocado un aumento de la presencia de estos en las aguas residuales que se utilizan para riego, con el consecuente riesgo para la salud humana y ambiental. El proceso de migración y fijación de contaminantes dentro de un sistema cerrado, dependerá de la capacidad de absorción por parte de los subsistemas agua-suelo-planta, aplicación de tasas de riego (concentración del contaminante, y de la persistencia y toxicidad de los contaminantes. El estudio aquí presentado, evalúa las tasas de migración de metales pesados presentes en un agua de riego, a través del sistema agua-suelo-planta; la evaluación se realizó con material del distrito de riego 028-Tulancingo que recibe aguas residuales de origen industrial, con presencia de Cobre, Manganeso y Zinc para diferentes grados de impacto.

  8. Microorganismos indicadores de la calidad del agua potable en cuba

    OpenAIRE

    2014-01-01

    Los agentes patógenos transmitidos por el agua constituyen un problema mundial que demanda un urgente control. Las bacterias, virus y parásitos causan enfermedades que varían en severidad. La determinación de microorganismos en el agua de consumo y su concentración proporcionan herramientas de control, indispensables para la toma de decisiones. Los controles rutinarios de todos los microorganismos, potencialmente riesgosos para la salud, resultan difíciles de llevar a cabo, debido a que ello ...

  9. INFRAESTRUCTURA SUSTENTABLE: LAS PLANTAS DE TRATAMIENTO DE AGUAS RESIDUALES

    OpenAIRE

    Virginia Lahera Ramón

    2010-01-01

    El tratamiento de las aguas servidas para reúso, reincorporación a los cuerpos de agua superficiales o reinfiltración a los mantos freáticos no es una opción generalizada en México. Las plantas de tratamiento que existen utilizan tecnologías contaminantes, son altas en uso de energía y producen desechos tóxicos como resultado de su operación. Para ir construyendo una infraestructura urbana sustentable, es necesario optar por tecnología alternativa que permita reutilizar los caudales y/o regre...

  10. Assessment of toxic potential of Cerrado fruit seeds using Artemia salina bioassay

    Directory of Open Access Journals (Sweden)

    Raíza Cavalcante Fonseca

    2013-06-01

    Full Text Available Artemia salina bioassay was used to assess toxicity of seeds and kernels of Brazilian fruits from cerrado (central high plains region and other inner regions of the country. Water extracts of the kernels were filtered and added to Artemia cultures containing ten individuals per mL. Dose - response curves were constructed, and LD50 values were calculated. Pure potassium cyanide standard was used to draw a calibration curve for comparison to detect the presence of cyanide in the samples tested. Extracts of the seeds of araticum, mangaba, cagaita, jatobá, and tucumã were found toxic to Artemia salina, and some of the dose - response curves were very similar in shape to those obtained with pure potassium cyanide standards, while the samples of baru, cajá-manga, siriguela, trauma, and veludo showed no toxicity at all. The Guignard test, specific for cyanide detection, showed negative results in all toxic samples, suggesting the presence of other toxic compounds rather than cyanide. The comparison of araticum dose - response curve with those of other annonaceous fruits suggests the presence acetogenins as the main toxic compounds in the seeds. These results could be useful to prevent poisoning by industrial derivatives of the fruits studied.

  11. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test

    Directory of Open Access Journals (Sweden)

    Sahgal Geethaa

    2013-01-01

    Full Text Available Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT] to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC 50 for the solvents were 8.5% (DMSO, 6.4% (methanol, 3.4% (ethanol and 2.5% (Tween 20. The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  12. Physiological responses of the eustigmatophycean Nannochloropsis salina to aqueous diesel fuel pollution

    Directory of Open Access Journals (Sweden)

    Rania Farag Mohammad

    2005-03-01

    Full Text Available The marine eustigmatophycean microalga Nannochloropsis(Monallantus salina Hibberd was cultivated in a batchculture in the presence of various concentrations (0, 25, 50, 75 and 100%of an aqueous extract of diesel fuel oil in order to assess the influenceof the pollutant on the growth and certain physiological responses of themicroalga. The growth data revealed a significant negative effect of thevarious pollutant concentrations on the algal cell number(p ≤ 0.05. However, at the mid-logarithmic growth phase (day 8,the algal cells were analysed for chlorophyll a, β-glucan,amino acid pool, C/N ratio and elemental composition. According to ourresults, N. salina was significantly affected by the pollution withregard to the different physiological parameters examined, and thissignificance may be negative, positive or variable. The effect of thepollutant on cellular β-glucan and the total amount of amino acidswas negative; however, the composition of the cellular amino acid poolremained unaffected. A positive effect of the pollutant on cellular chl aand the C/N ratio was observed. In addition, the pollutant showed variableeffects on the composition of different elements, as shown byenergy-dispersive X-ray microanalysis. Also, an existencecorrelation between different elements was statistically reported.

  13. Toxicity of some glucose/mannose-binding lectins to Biomphalaria glabrata and Artemia salina.

    Science.gov (United States)

    dos Santos, Aldenir Feitosa; Cavada, Benildo Sousa; da Rocha, Bruno Anderson Matias; do Nascimento, Kyria Santiago; Sant'Ana, Antônio Euzébio Goulart

    2010-01-01

    Schistosomiasis or bilharzia, which affects millions of people living in Africa, Asia and Latin America, is closely associated with certain species of aquatic snails. One way of attacking the disease is to eradicate the host snails. Molluscicidal activities of natural compounds are especially important in the widespread control of this tropical disease. As part of our search for natural compounds with molluscicidal properties for the vector control of schistosomiasis, we are now evaluating for the first time the toxicity of the plant lectins from Canavalia brasiliensis (ConBr), Cratylia floribunda (CFL), Dioclea guianensis (Dgui), Dioclea grandiflora (DGL) and Dioclea virgata (Dvir) to Biomphalaria glabrata Say and Artemia salina Leach. Results indicate that all the samples were toxic to A. salina Leach, some of them with values of lethal concentration that kills 90% of the population (LC(90))<10 microg mL(-1). They are also active against B. glabrata Say, killing 100% of adult snails, at a concentration of 50 microg mL(-1). The lectins CFL and Dgui possess properties lethal to mollusks, with values of LC(90)=50.3 microg mL(-1) and LC(90)=41.0 microg mL(-1), respectively.

  14. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test.

    Science.gov (United States)

    Geethaa, Sahgal; Thavamany, Priscilla Jayanthi; Chiew, Siah Poh; Thong, Ong Ming

    2013-10-01

    Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO) are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT]) to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v) for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC50 for the solvents were 8.5% (DMSO), 6.4% (methanol), 3.4% (ethanol) and 2.5% (Tween 20). The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  15. Toxicity of organophosphates on morphology and locomotor behavior in brine shrimp, Artemia salina.

    Science.gov (United States)

    Venkateswara Rao, J; Kavitha, P; Jakka, N M; Sridhar, V; Usman, P K

    2007-08-01

    The acute toxicity and hatching success of four organophosphorus insecticides--acephate (ACEP), chlorpyrifos (CPP), monocrotophos (MCP), and profenofos (PF)--was studied in a short-term bioassay using brine shrimp, Artemia salina. Fifty percent hatchability inhibition concentration and median lethal concentration (LC(50)) values were calculated after probit transformation of the resulting data. Among the insecticides tested, CPP is found to be the most toxic and also to inhibit hatching success of A. salina cysts in a concentration-dependent manner. In addition, the effect of these pesticides on locomotor behavior (swimming speed) and morphologic differences were studied in LC(50)-exposed nauplii after 24 hours. The in vivo effect of these insecticides on acetylcholinesterase (Enzyme commission number (EC 3.1.1.7) activity was also determined in LC(50)-exposed nauplii after 24 hours. Maximum percent decrease in their swimming speed and significant morphologic alterations were noticed in CPP-exposed brine shrimps. The order of toxicity was CPP > PF > MCP > ACEP in all the parameters studied.

  16. A bioassay using Artemia salina for detecting phototoxicity of plant coumarins.

    Science.gov (United States)

    Ojala, T; Vuorela, P; Kiviranta, J; Vuorela, H; Hiltunen, R

    1999-12-01

    Artemia salina (brine shrimp) has been successfully used for toxicity testing, and a screening test for phototoxicity has been developed based on this method. The ability of the method to test the phototoxic potential of seven known compounds was investigated. Athamantin (an angular furanocoumarin) and umbelliferone (a simple coumarin) showed no phototoxicity, while linear furanocoumarins exhibited phototoxic activity in the following order: psoralen > bergapten > peucedanin > xanthotoxin. The applicability of this method was also tested in screening the phototoxicity of plant material. Six plants from Apiaceae [Aegopodium podagraria L., Anethum graveolens L., Angelica archangelica L., Levisticum officinalis Koch, Petroselinum crispum (P. Mill) A. W. Hill., and Peucedanum palustre (L.) Moench] and one from Rutaceae (Ruta graveolens L.) were selected, all of them known to contain furanocoumarins. Extracts from leaves collected at different times during the growth period were used in the screening. Our results were in accordance with the furanocoumarin content of these plants and with the results of other phototoxicity tests. The Artemia salina method proved to be rapid, simple and inexpensive, and is therefore ideal in the initial biological screening of large numbers of samples for simultaneous detection of both toxicity and phototoxicity.

  17. F. Salinas y la teoría musical de finales del Renacimiento

    Directory of Open Access Journals (Sweden)

    Goldáraz Gaínza, J. Javier

    1998-04-01

    Full Text Available Not available.Si F. Salinas (1513-1590 es justamente famoso en el mundo literario debido a Fray Luis de León, en este artículo se intenta contextualizar y así mostrar su contribución a la teoría armónica occidental. Tal contribución estriba nada menos que en ser el primer expositor del llamado temperamento igual, es decir, la división de la octava en doce partes, doce semitonos iguales. Hacerlo de forma matemática, dentro del contexto musical de finales del Renacimiento, no era tarea fácil. Se trata de dividir la razón 2/1 en doce partes igualmente proporcionales, lo que con medios puramente aritméticos es imposible. Salinas está al final de una cadena de teóricos renacentistas enredados en este objetivo que únicamente pudo llevarse a cabo dentro de la corriente humanista.

  18. Anaerobic co-digestion of the marine microalga Nannochloropsis salina with energy crops.

    Science.gov (United States)

    Schwede, Sebastian; Kowalczyk, Alexandra; Gerber, Mandy; Span, Roland

    2013-11-01

    Anaerobic co-digestion of corn silage with the marine microalga Nannochloropsis salina was investigated under batch and semi-continuous conditions. Under batch conditions process stability and biogas yields significantly increased by microalgae addition. During semi-continuous long-term experiments anaerobic digestion was stable in corn silage mono- and co-digestion with the algal biomass for more than 200 days. At higher organic loading rates (4.7 kg volatile solids m(-3)d(-1)) inhibition and finally process failure occurred in corn silage mono-digestion, whereas acid and methane formation remained balanced in co-digestion. The positive influences in co-digestion can be attributed to an adjusted carbon to nitrogen ratio, enhanced alkalinity, essential trace elements and a balanced nutrient composition. The results suggest that N. salina biomass is a suitable feedstock for anaerobic co-digestion of energy crops, especially for regions with manure scarcity. Enhanced process stability may result in higher organic loading rates or lower digester volumes.

  19. Acerca de una nueva legislación de aguas las medidas sobre la conservación de las aguas

    OpenAIRE

    Salazar, Roxana

    2014-01-01

    La Ley General de Salud se refiere en forma muy clara a la contaminación de las aguas. Establece la prohibición de contaminar los abastos de agua. De la misma manera el Código Penal establece sanciones contra los que contaminan el agua. A pasar de ello, las sanciones, tanto administrativas como penales, son inadecuadas e insuficiencias, se requiere de todo un nuevo capítulo respecto a esto.

  20. La gestión del agua y la nueva Ley de Aguas

    Directory of Open Access Journals (Sweden)

    Pablo Lloret

    2013-09-01

    Full Text Available La intención de este artículo, al contrario de lo que se esperaría en estos días, no es el de realizar una crítica a los borradores de la nueva “Ley Orgánica de Recursos Hídricos, Uso y Aprovechamiento de las Aguas” o al Nuevo Código Ambiental propuesto, es más bien la de sensibilizar y alertar a quienes estamos involucrados con la gestión de los recursos hídricos, es un llamado a trabajar, de manera corresponsable, en la construcción de una nueva Ley de Aguas que tenga como base la Constitución, la participación, la técnica, lo público, lo privado, en definitiva, pensar en el bien colectivo y en el futuro de nuestros hijos.

  1. Empleo de microalga Scenedesmus obliquas en la eliminación de cromo presente en aguas residuales galvánicas

    Directory of Open Access Journals (Sweden)

    Pellón, A.

    2003-02-01

    Full Text Available Dumping wastewaters from plating industry with a high content in chromium is a potential hazard for people and environment. It is known that some metals, including the heavy metals, at low concentrations participate in different metabolic routes, but at high concentration are toxic for many living organisms. Some microorganism taking the heavy metals from the environment are capable of concentrating and accumulating large quantities of them in different citoplasmatic structures with no-toxic effects. Microalgae have affinity by the polyvalent metals making possible their use as depollutant agent in waters that contains dissolved metallic ions as alternative methods when others methods of recycle are unusable. In this report a chromium removal study from a plating wastewater, using scenedesmus obliquus culture was made. The removal efficiency of Cr (VI was 12 % and Cr (III was 27 % and for condition of algae's immobilization removal of Cr (III was 95 %.

    El vertido de aguas residuales con alto contenido de cromo, procedentes de las industrias galvanoplásticas, es un peligro potencial que se le presenta a la población y al medio ambiente. Se conoce que algunos metales, incluyendo los pesados, a concentraciones bajas participan en diferentes rutas metabólicas, pero en altas concentraciones pueden ser tóxicos para muchos organismos vivos. Algunos microorganismos toman los metales pesados del medio ambiente, siendo capaces de concentrar y acumular grandes cantidades de los mismos en diferentes estructuras citoplasmáticas, sin que lleguen a ocasionar efectos tóxicos en los mismos. Las microalgas son un ejemplo de este comportamiento, ya que tienen afinidad por los metales polivalentes, de ahí la posibilidad de su aplicación como agentes descontaminantes en aguas que contengan iones metálicos disueltos como método alternativo cuando no se pueda utilizar otro método de recuperación. En este trabajo se realizó un estudio de

  2. Diseño del sistema de seguridad y salud ocupacional de dos empresas del "Grupo Salinas". Proyecto de cooperación al desarrollo en la comunidad andina de Salinas de Guaranda, Bolívar, Ecuador

    OpenAIRE

    Casado Pascal, Roberto Carlos

    2014-01-01

    Este proyecto fin de carrera consiste en el diseño y elaboración de un Sistema de Seguridad y Salud Ocupacional (SSSO) para dos empresas pertenecientes al Gruppo Salinas. Estos sistemas deben ajustarse a un estándar nacional, que en Ecuador han denominado SART (Sistema de Auditoría de Riesgos del Trabajo).

  3. Abelhas (Hymenoptera: apoidea visitantes das flores de goiaba em pomar comercial in Salinas, MG Bee diversity in a commercial guava orchard in Salinas, Minas Gerais State, Brazil

    Directory of Open Access Journals (Sweden)

    Rosemeire Alves Guimarães

    2009-01-01

    Full Text Available As abelhas são responsáveis por cerca de 80% a 100% da polinização de culturas agrícolas, especialmente aquelas relacionadas com a produção de sementes e frutos. A investigação da diversidade de abelhas em pomares de goiaba pode ser subsídio para estratégias de incremento da produtividade. Nesta perspectiva, o objetivo deste estudo foi identificar a diversidade de abelhas visitantes das flores de goiaba (Psidium guajava, em pomar comercial em Salinas (MG. O trabalho foi desenvolvido em maio de 2005 e foram coletadas as abelhas visitantes das flores nos horários entre 6h e 18h, totalizando-se 44 horas de coleta. Coletaram-se 705 abelhas de 17 espécies, sendo Trigona spinipes a mais freqüente e dominante na cultura da goiaba. Apis mellifera, Melipona quadrifasciata e Tetragonisca angustula foram consideradas acessórias. Aproximadamente 84% dos indivíduos foram coletados da manhã, de 6h às 10h.Pollination is an important factor in agricultural systems, especially in growing fruits and seed production, which depend greatly on bee visiting during blossom season; highly successful gains within these activities varies between 80 and nearly 100 per cent, owing to the bees. The assessment of bee diversity in commercial orchards of guava may contribute to a more desirable strategic design and consequent improvement of production. The aim of the study was identify the diversity of visiting bees to guava flowers (Psidium guajava in a commercial orchard in Salinas, State of Minas Gerais, Brazil. The work was carried during blossom season of May - 2005. Field works occurred between 6:00 am to 6:00 pm, counting with 44 hours of collection, when 705 bees were collected. The richness observed was of 17 species, the most frequent and dominant being Trigona spinipes. Among the collection there were some considered accessory species: Apis mellifera, Melipona quadrifasciata and Tetragonisca angustula. Most of individual bees have been captured

  4. Zinc concentrations in the water column influenced by the oil spill in the vicinity of the Prestige shipwreck; Concentraciones de zinc en la columna de agua influida por el derrame de fuel en los alrededores a la zona de naufragio del Prestige

    Energy Technology Data Exchange (ETDEWEB)

    Prego, Ricardo; Cobelo-Garcia, Antonio [Marine Biogeochemistry Research Group, Instituto de Investigaciones Marinas CSIC, Vigo (Spain)

    2003-03-15

    Sixteen days after the Prestige tanker sank in the Northeast Atlantic (42 degrees 11 minutes North, 12 degrees 02 minutes West), a sampling campaign in the neighbouring water column was carried out in order to evaluate the possibility of zinc contamination due to the oil spill. Samples were taken in the water column (0-190 m) and in bottom waters -in the vicinity of the bow and stern- where the tanker lies (3520-3820 m). Total zinc concentrations found ranged from 14 to 571 nM, which are from one to two orders of magnitude higher than typical concentrations in these waters (0.2 - 3.2 nM). Therefore, a contamination by this metal, contained in the oil spilt from the tanks of the sunken ship, was detected. Zinc was also found to be a good tracer to detect the presence of fuel in those areas free of patches. [Spanish] Dieciseis dias despues del hundimiento del petrolero Prestige en el Atlantico Noreste (zona 42 grados 11 minutos Norte, 12 grados 02 minutos Este) se llevo a cabo una campana de muestreo en la columna de agua adyacente para evaluar la posible contaminacion de zinc debido al fuel derramado al agua. Para ello se tomaron muestras en la columna de agua (0-190m) y en el fondo marino -en las proximidades de la proa y la popa- donde yace el petrolero (3530-3820 m). Las concentraciones totales de zinc obtenidas oscilaron entre 14 y 571 nM, esto es, de uno a dos ordenes de magnitud superiores a las normales en esas aguas (0.2-3.2 nM). Se detecta, pues, una contaminacion por este metal contenido en el fuel vertido procedente de los tanques del buque hundido. El zinc resulta, ademas, un buen trazador para detectar la presencia de fuel en zonas limpias de manchas.

  5. Contaminantes en los cuerpos de agua del sur de Sonora

    Directory of Open Access Journals (Sweden)

    López-Ríos Olga

    2001-01-01

    Full Text Available Objetivo. Ahondar en el conocimiento sobre la incidencia de las actividades productivas del hombre en su medio, y el riesgo potencial que representa el deterioro ambiental para su propia salud y la sobrevivencia de especies animales. Material y métodos. Se utilizó el paquete informático Decision Support System for Industrial Pollution Control DSS (IPC, desarrollado por el Banco Mundial, la Organización Panamericana de la Salud (OPS y la Organización Mundial de la Salud (OMS, que se aplicó a un estudio de caso sobre los cuerpos de agua del sur de Sonora, durante 1996. Resultados. Estos sugieren que existen al menos tres factores que han contribuido a la desaparición de criaderos naturales de pescado y camarón en el municipio de Huatabampo: a la filtración de fertilizantes y pesticidas en las aguas de los drenes; b el asolvamiento producido por el depósito continuo, en el pasado, de agua de cola de la industria, c y la descarga inapropiada de aguas negras en los drenes. El texto completo en inglés de este artículo está disponible en: http://www.insp.mx/salud/index.html

  6. Uso Eficiente y Sustentable del agua. Implicancias y Condicionantes

    Directory of Open Access Journals (Sweden)

    Miguel Mathus Escorihuela

    2013-12-01

    Full Text Available El agua no es un recurso natural más, es un recurso vital que permite explicar integralmente los ciclos de la naturaleza y las interacciones entre las especies y el medio en que habitan en virtud del ciclo hidrológico. Pero el agua resiste al hombre, por lo que su aprovechamiento exige acciones concretas, que deben ser racionales y servir al bienestar de la sociedad, para poder alcanzar lo que hoy se llama calidad de vida en un ambiente sano. Para ello, el agua requiere de la Política Hídrica donde se determinan los fines; de la Planificación Hídrica racional y coherente que se encuentre volcada en Planes, Etapas y Programas; de la Legislación, que brinde el marco normativo, de la Administración que lleve a cabo la Política de la Gestión que es el ámbito neurálgico vinculado al uso eficiente del agua

  7. 78 FR 1210 - Grand River Dam Authority; Notice of Telephone Meeting To Discuss the Salina Pumped Storage...

    Science.gov (United States)

    2013-01-08

    ... Energy Regulatory Commission Grand River Dam Authority; Notice of Telephone Meeting To Discuss the Salina... Grand River Dam Authority. (An RSVP is required. See paragraph f below.) c. FERC Contact: Stephen Bowler... Grand River Dam Authority (GRDA) is holding a technical meeting to discuss the results of the...

  8. Effect of mixing rate on Beta-carotene production and extraction by dunaliella salina in two-phase bioreactors

    NARCIS (Netherlands)

    Hejazi, M.; Andrysiewicz, E.; Tramper, J.; Wijffels, R.H.

    2003-01-01

    beta-Carotene has many applications in the food, cosmetic, and pharmaceutical industries; Dunaliella salina is currently the main source for natural beta-carotene. We have investigated the effect of mixing rate and whether it leads to the facilitated release of beta-carotene from the cells of Dunali

  9. [Biological and biochemical quality of the Artemia (Anostraca: Artemiidae) population from Real de Salinas saltworks, Calkiní, Campeche, Mexico].

    Science.gov (United States)

    Rodríguez-Canché, Leticia G; Maldonado-Montiel, Teresita D N J; Carrillo Navarro, Luciano A

    2006-12-01

    Cysts of Artemia spp. collected from February 1997 to February 2000 in the Real de Salinas solar saltworks, Campeche, Mexico, were compared with Artemia franciscana (batch number 8,131 Microfeast Artemia Cysts, Texas, USA). The variables determined in these two populations were: number of cysts per gram, hatching percentage, hatching efficiency, hatching rate, hatching synchrony and hatching biomass, as well as diameter of the cysts and length of the nauplii (instar I). For Salinas, the average diameters of the encapsulated and decapsulated cysts were 230.5 +/- 4.14 and 221.8 +/- 3.39 microm, respectively. The thickness of the cyst shell was 4.35 +/- 0.68 microm and the length of the nauplii was 388.11 +/- 4.39 microm, this last value is among the smallest reported in the literature. For the commercial population of A. franciscana, the average diameters of the encapsulated and decapsulated cysts were 230.21 +/- 12.49 and 216.96 +/- 13.71, respectively. With respect to the corion thickness and length of the nauplii the values were 6.62 +/- 2.72 and 424.70 +/- 30.08, respectively. The protein value of the cysts (47.91 %) and nauplii (50.5 %) of Artemia population from Real de Salinas, are considered adequate to be used as food in aquaculture. The results indicate that the population from Real de Salinas presents positive features for its use in aquaculture in the region.

  10. Improved synthesis of seven aromatic Baylis-Hillman adducts (BHA): evaluation against Artemia salina Leach. and Leishmania chagasi.

    Science.gov (United States)

    Barbosa, Ticiano P; Junior, Cláudio G L; Silva, Fábio P L; Lopes, Horacimone M; Figueiredo, Lucas R F; Sousa, Suervy C O; Batista, Guilherme N; da Silva, Thiago G; Silva, Tania M S; de Oliveira, Márcia R; Vasconcellos, Mário L A A

    2009-04-01

    We described a very efficient procedure to prepare seven aromatic compounds (1-7), a new class of antileishmanial substances, through Baylis-Hillman reaction (BHR). With one, all the Baylis-Hillman adducts were prepared in quantitative yields by reaction of the corresponding aromatic aldehydes in acrylonitrile at 0 degrees C in only 10-40min reaction time. We present our results about the toxicities of these compounds evaluated on the microcrustaceous Artemia salina Leach. and against promastigote Leishmania chagasi. All substances evaluated in this work have showed high bioactivity. The 3-hydroxy-2-methylene-3-(4-bromopheny)propanenitrile (4) (LC(50)=30.9 microg/mL on A. salina; IC(50)=25.2 microM on L. chagasi) was the most active compound evaluated on A. salina Leach. and on promastigote L. chagasi. The 2-[hydroxy(pyridin-4-yl)methyl]acrylonitrile (7) (LC(50)=30.9 microg/mL on A. salina Leach.; IC(50)=4.8 microg/mL on L. chagasi) was also a very active substance evaluated in this work on promastigote L. chagasi.

  11. The use of carbamates, atropine, and 2-pyridine aldoxime methoiodide in the protection of Artemia salina against poisoning by carbophenothion.

    Science.gov (United States)

    Sánchez-Fortún, S; Barahona, V

    2001-09-01

    The acute toxicity of carbophenothion to three age classes of Artemia salina was evaluated. An increase in toxicity of carbophenothion was found following longer development of A. salina. The effect of pretreatment with the nonselective muscarinic antagonist atropine, the two reversible acetylcholinesterase-inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methochloride (2-PAM) on carbophenothion-induced lethality in 24-h-old A. salina was also investigated. The lethal action of carbophenothion was completely prevented by pretreatment of A. salina with 2-PAM. Atropine and pyridostigmine afforded a maximal protection of approximately 87% and 72%, respectively, compared to control values. In contrast, physostigmine was ineffective. The inhibitory effects of combinations of 10(-5) M atropine with physostigmine, pyridostigmine, or 2-PAM were greater than those elicited by either drug alone, with the maximum protection afforded being 92.58%, 100%, and 100%, respectively. In the presence of 10(-7) M atropine, neither pyridostigmine nor 2-PAM provided additional inhibition of the lethality compared to that with either drug alone, whereas the protection afforded by 10(-7) M atropine plus physostigmine increased as the concentration of carbamate increased (up to 10(-3) M). Pretreatment with pyridostigmine or physostigmine plus 2-PAM (10(-6) M) slightly enhanced the maximal inhibition of carbophenothion lethality compared to that with either drug alone. It is suggested that the most active combined pretreatment studied here was physostigmine plus atropine.

  12. FRAKSINASI DAN IDENTIFIKASI SENYAWA ANTIKANKER EKSTRAK KULIT BATANG Rhizopora mucronata SERTA UJI TOKSISITASNYA TERHADAP LARVA UDANG (Artemia salina Leach

    Directory of Open Access Journals (Sweden)

    Hartiwi Diastuti

    2009-11-01

    Full Text Available Investigation the anticancer potency of R. mucronata has not been carried yet. This research were aimed to extract the bioactive compound of R. mucronata with various organic solvents, examine their toxicity againts A. salina Leach larv. and identify the toxic compounds from R. mucronata steam bark. The extraction of R. mucronata steam bark were peformed by maseration with n-hexane, chloroform, ethylacetate and methanol, repectively. The extracts were examined their toxicity againsts A. salina Leach larv. The highest activity extracts was fractionated performed by coloumn chromatography. The fractions respectively was examined their toxicity againts A. salina Leach larv. Identification of toxic compound was carry out using gas chromatography-mass spectrometry (GC-MS. The chloroform extracts of R. mucronata had toxic character. Toxicity test to A. salina Leach larv. The Result showed that the chloroform fraction 1 (C1 of R. mucronata steam bark had LC50 equal to 301.50 ppm. Phytochemical study showed that the active fractions contained terpenoid. Bioactive compound from R. mucronata steam bark were dioctyl phthalate and cyclopropyle azulene decahydro-1,1,7-trimethyl-4-methylene.

  13. Remoción de Metales de Aguas Residuales Industriales

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Guerrero Fajardo

    2009-10-01

    Full Text Available En este trabajo se evalúa la tasa de remoción de cuatro metales pesados, comúnmente encontrado en Aguas Residuales Industriales (A,R,I,: Cobre, Cromo, Mercurio y Plata, mediante el empleo de plantas acuáticas vasculares "Jacintos de Agua". Las investigaciones para cada metal se realizaron, acondicionando aguas con cinco concentraciones diferentes que oscilaran por encima y por debajo del valor promedio encontrado en A,R,1,Se adoptó un modelo de comportamiento del sistema debido a la similitud que muestra la remoción de metales por el Jacinto de Agua, con el estudio de cultivos puros de MONOD, Esto permite realizar los ajustes estadísticos a los datosexperimentales encontrados en el presente proyecto. La ecuación establecida para el estudio de remoción de metales por un método biológico es el siguiente: % Remoción = A x t / B + t A= Porcentaje de remoción máxima B= Tiempo mínimo para alcanzar la mitad de la remoción máxima, t =Tiempo de remoción Las constantes A y B, indican la tendencia a la remoción y el tiempo mínimo de recolección, respectivamente. El Jacinto de Agua presenta limitación en su capacidad de remoción de metales, esto determina concentraciones máximas permisibles de metales en el agua para poder utilizar estas plantas acuáticas. El estudio de selectividad en la remoción de metales, indica que la presencia de Cromo, Mercurio y Plata disminuyen el porcentaje de remoción de Cobre, Se observa disminución en el porcentaje de remoción de Cromo, cuando están presentes Cobre, Mercurio y Plata en el agua residual. El caso del Mercurio es diferente a los dos anteriores, observándose más bien un efecto sinergético.

  14. CARACTERIZACIÓN FENOTÍPICA DE AISLADOS DE RIZOBIOS PROCEDENTES DE LA LEGUMINOSA FORRAJERA Canavalia ensiformis

    Directory of Open Access Journals (Sweden)

    Ionel Hernández Forte

    2012-01-01

    Full Text Available El objetivo del presente trabajo fue caracterizar fenotípicamente aislados de rizobios procedentes de la leguminosa forrajera Canavalia ensiformis. Se caracterizaron doce aislados, cinco posibles miembros del género Rhizobium/ Sinorhizobium, siete posibles integrantes del género Bradyrhizobium y dos cepas comerciales, BR 2001 y BR 2003a. Para la caracterización fenotípica de los aislados bacterianos se estudió su capacidad de utilizar seis fuentes de carbono, la tolerancia a condiciones de acidez y a diferentes niveles de cloruro de sodio (NaCl, la resistencia a seis antibióticos así como su crecimiento en tres temperaturas de incubación. Se determinó además la capacidad de estos aislados de producir polihidroxibutiratos (PHB. Todos los aislados estudiados utilizaron la lactosa, glucosa y manitol como fuentes de carbono. Uno de los aislados de rápido crecimiento resultó el más tolerante a pH 4.5. Los aislados posibles miembros del género Rhizobium/ Sinorhizobium toleraron una mayor concentración de NaCl que los posibles integrantes del género Bradyrhizobium. Tres de los aislados de rápido crecimiento fueron resistentes a los seis antibióticos utilizados. Cuando los aislados fueron incubados a 370C todos, con excepción del el aislado CP3 y la cepa comercial BR 2001, presentaron un crecimiento similar al control. El aislado CP10, de lento crecimiento, tuvo la capacidad de producir las mayores concentraciones de PHB (0.023 g.L-1.

  15. Qualidade fisiológica e tratamentos de sementes de cedrela fissilis procedentes do sul do Brasil

    Directory of Open Access Journals (Sweden)

    Marília Lazarotto

    2013-04-01

    Full Text Available Os objetivos deste trabalho foram: avaliar a qualidade fisiológica de sementes de cedro (Cedrela fissilis, procedentes de localidades do sul do Brasil, através de testes de vigor e avaliar diferentes tratamentos nas sementes para controle de patógenos e para promoção da germinação da espécie. Para tanto, foram utilizadas seis amostras com procedências dos Estados do Rio Grande do Sul, Santa Catarina e Paraná, as quais foram submetidas à determinação de teor de água, teste de germinação e primeira contagem, envelhecimento acelerado (testando períodos de exposição às condições de envelhecimento, emergência em viveiro e tratamento de sementes. Os tratamentos utilizados para controle de patógenos foram: testemunha (T0; físico com calor seco a 70°C±3°C por 48 horas (T1; extrato aquoso de alho (Allium sativum (T2; biológico à base de Trichoderma spp. - Agrotich Plus® (T3; e químico com fungicida protetor Captan (T4. A germinação variou de 56 a 87%; o período de 48 h sob temperatura de 41 °C foi o mais eficiente para estratificar as amostras em níveis de vigor; a emergência variou de 51 a 88% e as variáveis de desempenho de plântulas analisadas conseguiram estratificar as amostras em níveis de vigor. Quanto ao tratamento de sementes, o calor seco e o tratamento à base de extrato de alho se mostram eficientes no controle de microrganismos em semente de cedro, sem prejuízos ao vigor destas.

  16. The ability of the branchiopod, Artemia salina, to graze upon harmful algal blooms caused by Alexandrium fundyense, Aureococcus anophagefferens, and Cochlodinium polykrikoides

    Science.gov (United States)

    Marcoval, M. Alejandra; Pan, Jerónimo; Tang, Yingzhong; Gobler, Christopher J.

    2013-10-01

    We present experiments that examined the grazing and survivorship of zooplankton native (Acartia tonsa) and non-native (Artemia salina) to NY (USA) estuaries when exposed to blooms and cultures of the three harmful algae native to NY, Alexandrium fundyense, Aureococcus anophagefferens (strains CCMP 1850 and CCMP 1984) and Cochlodinium polykrikoides. During experiments with cultures of A. anophagefferens, clearance rates (CR) of A. salina were significantly greater than those of A. tonsa for both algal strains examined. A. salina fed on cultures of C. polykrikoides at higher rates than all phytoplankton species examined, including the control diet (Rhodomonas salina), and faster than rates of A. tonsa fed C. polykrikoides. During experiments with A. fundyense, A. salina actively grazed all cell concentrations (250-1500 cells ml-1) while A. tonsa did not feed at any concentration. Percent mortality of A. salina and A. tonsa fed A. fundyense for 48 h were 43 ± 7.7% and 72 ± 7.8%, respectively, percentages significantly higher than those of individuals fed all other algal diets. During 25 field experiments using natural blooms of the three HAB species performed across six NY estuaries, A. salina significantly (p < 0.05) reduced cell densities of A. anophagefferens, C. polykrikoides, and A. fundyense relative to the control treatments in all but one experiment. The sum of these findings demonstrates that a failure to graze these HABs by the indigenous copepod, A. tonsa, may permit blooms to occur. In addition, the ability of A. salina to graze these HABs at densities that were inhibitory to A. tonsa suggests that A. salina could, in some circumstances, be considered as a part of mitigation strategy for these events.

  17. Análisis de subsidencia de la Cuenca de las Salinas, Sierras Pampeanas occidentales Subsidence analysis of the Las Salinas Basin, western Sierras Pampeanas

    Directory of Open Access Journals (Sweden)

    Edgardo A. Azeglio

    2008-06-01

    Full Text Available En el presente trabajo se ha evaluado la subsidencia total de la cuenca de Las Salinas mediante diagramas tiempo - profundidad, considerando la subsidencia inicial, por carga y termotectónica. También se calculó la velocidad de subsidencia interválica en función del tiempo geológico. El área en estudio se ubica aproximadamente entre los paralelos 31°17´S y 32°40´S y los meridianos 66°38´W y 67°48´W en las cercanías de la localidad de Marayes, en el sitio denominado cuenca de Las Salinas. Los diagramas tiempo - profundidad permitieron relacionar cambios en la velocidad de subsidencia de la cuenca durante el proceso distensivo del Mesozoico y el actualmente compresional a la cual esta sometida, obteniéndose valores concordantes con áreas circundantes. Como resultado del análisis se encontró que la velocidad de subsidencia inicial fue de 0,0017 mm/año en el Carbonífero, la que fue aumentando lentamente hasta alcanzar los 0,00875 mm/año en el Cretácico. Este incremento disminuye sensiblemente durante el Cretácico superior, para posteriormente incrementarse abruptamente en el Terciario (0,043 mm/año. Este régimen se mantiene durante el Plioceno a Mioceno, alcanzando valores promedios de 0,269 mm/año, culminando con valores de 0,0973 mm/año. De la comparación entre ambos diagramas de subsidencia se observan distintos ritmos de sedimentación entre el sector norte y sur de la cuenca que podría ser la consecuencia de un fallamiento en el basamento. La comparación de estos valores con los obtenidos en la cuenca de Beazley indican que si bien los valores de subsidencia inicial y ritmo de sedimentación fueron similares. El inicio de la subsidencia en la cuenca de Beazley, se produjo con posterioridad (en el Triásico. La componente termotectónica en ambas cuencas es similar a pesar que el gradiente térmico normal de la zona aumenta sensiblemente en dirección sur.In the present work the total subsidence of Las Salinas

  18. Analysis of toxicity of Anacardium occidentale L. extract submitted to ionizing radiation on embryos of Biomphalaria glabrata and Artemia salina

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Hianna A.M.F.; Sa, Jose L.F.; Lima, Claudia S.A.; Amancio, Francisco F.; Melo, Ana M.M.A., E-mail: hiannaamfs@gmail.com, E-mail: luismuma6@gmail.com, E-mail: claudia.salima@gmail.com, E-mail: amancioff@bol.com.br, E-mail: amdemelo@hotmail.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Biofisica e Radiobiologia; Ribeiro, Luanna R.S.; Santos, Gustavo H.F.; Silva, Edvane B., E-mail: luannaribeiro_lua@hotmail.com, E-mail: santosghf@hotmail.com, E-mail: edvborges@yahoo.com.br [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Energia Nuclear. Grupo de Estudos em Radioprotecao e Radioecologia

    2013-07-01

    The use of gamma radiation as a sterilization method for herbs, herbal medicines and foods, shows positive results regarding the retention of such products, economy and safety of the method. However, it is known that this method of processing plant material can cause chemical changes in these products related to the type of material, its components and the dose received. Evaluated, in the present study, the action of gamma radiation as a modifier of toxicity extract of Anacardium occidentale Linn. To evaluate the toxicity of the extract irradiated at doses of 5.0, 7.5 and 10.0 kGy and concentrations of 250, 500 and 1000 mg/L was used bioassays with Artemia salina and Biomphalaria glabrata. For the test to A. salina, 520 specimens were used divided into groups of 10 larvae. For the bioassay with B. glabrata, 3900 specimens were used divided into groups of, approximately, 100 embryos. Larvae of A. salina and embryos were subjected to extracts irradiated and unirradiated for 24 hours. The bioassay with A. salina, showed a decrease, compared to extract unirradiated and irradiated at doses of 5.0 and 7.5 kGy, of extract irradiated with 10 kGy, where the mortality did not differ from the control group. In tests with embryos was observed an increase in the toxicity of the extract at a dose of 7.5 kGy and a decrease in the dose of 10.0 kGy. The radiation promoted changes in the toxicity of leaves extracts of Anacardium occidentale Linn. on embryos of Biomphalaria glabrata and Artemia salina. (author)

  19. Characterisation of cholinesterases and evaluation of the inhibitory potential of chlorpyrifos and dichlorvos to Artemia salina and Artemia parthenogenetica.

    Science.gov (United States)

    Varó, I; Navarro, J C; Amat, F; Guilhermino, L

    2002-08-01

    In this study, the acute toxicity of the organophosphorous pesticides dichlorvos and chlorpyrifos to two different species of Artemia (A. salina and A. parthenogenetica) was evaluated. In addition, the in vivo effect of these two pesticides on cholinesterase (ChE) activity of both A. salina and A. parthenogenetica was also determined. The characterisation of the ChE, using different substrates and specific inhibitors, and the normal range of activity in non-exposed individuals were previously investigated for both species. The results obtained indicate that the ChE of A. salina is different from that of A. parthenogenetica and that both enzymes cannot be classified neither as acetylcholinesterase nor as butyrylcholinesterase since they show intermediary characteristics between the two vertebrate forms. The range of normal ChE activity was 2.65+/-0.15 U/mg protein for A. salina, and 3.69+/-0.17 U/mg protein for A. parthenogenetica. Significant in vivo effects of both pesticides on Artemia ChE activity were found, at concentrations between 5.38 and 9.30 mg/l for dichlorvos and between 1.85 and 3.19 mg/l for chlorpyrifos. Both Artemia species are resistant to these pesticides and they are able to survive with more than 80% ChE inhibition. However, A. parthenogenetica is more resistant than A. salina, with about a 95% reduction in its ChE activity respect to the control for nauplii exposed to the median lethal concentrations (LC50), without lethal effects after 24 h of exposure.

  20. Application of aerobic porous fixed packed towers for biological treatment of canned food industrial wastewater; Utilizacion de la arcilla expandida como relleno en lechos sumergidos aireados para el tratamiento de aguas residuales procedentes de la industria conservera

    Energy Technology Data Exchange (ETDEWEB)

    Garrido Escudero, A.; Torres Rojo, J. C.; Tejera de Torres, M.; Hontaria, E.; Osorio Robles, F.; Sabater Redondo, C.

    2005-07-01

    The main objective is to check the performance of aerobic porous fixed packed towers technology heavy COD duty in canned food industrial wastewater among the Murcia Region (South East Spain). The porous media used was an expanded clay manufactured by Optiroc-Filtralite with grain sizes form 2-5 mm and 3-7 mm. Waste water used for experiments was a COD content of 4.300 mg/l. A pilot plants was built to treat wastewater flows from 101/h to 80 l/h. The volumetric loads checked were from 7 to 140 COD kg/m''3/day. Different tower configurations were tested. Process was designed with different steps (up to 8 different). The results obtained in the phase with better yields shows to a mean performance of 83.05% for COD elimination. The obtained results indicated clearly the feasibility of the treatment for the application of aerobic porous fixed packet with expanded clay media for these heavy duty waste water. (Author) 11 refs.

  1. Sludge composting of waste water treatment plant. Compost plant of Vila-Seca (Tarragona); Compostaje de lodos procedentes de la depuracion de aguas residuales. Planta de compostaje de Vila- Seca

    Energy Technology Data Exchange (ETDEWEB)

    Marza Brillas, J.

    1995-12-01

    Composting is a very effective process in waste treatment. Very good results are obtained in mass and volume loss, moisture reduction, organic matter establization as well as making possible agricultural uses for the final product. Some parameters as nutrients (C/N ratio), pH, temperature and oxygen content are pointed as the most important for the process. Some composting systems are mentioned but finally tunnel system is shown as the best. Its great advantage is that measurements from main parameters are given continuously to the control computer, so process optimization is done at the moment. The Vila-Seca sludge composting plant is described. This plant can treat 30.000 tones/year from three water treatment plants. The expected 50% on organic matter reduction and 70% on dry matter content has been achieved after only 3 months since its starting up. Finally, in september 1995 will start the construction of another sludge composting plant were the same technology, belonging to GICOM and represented by G.T.R. in Spain, will be installed.

  2. First secondary metabolites from Herissantia crispa L (Brizicky and the toxicity activity against Artemia salina Leach

    Directory of Open Access Journals (Sweden)

    Danielly Albuquerque da Costa

    2009-01-01

    Full Text Available The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-β-D-glucopyranoside, stigmasterol 3-O-β-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol, 3,5,7,3',4'-pentahydroxyflavone (quercetin, unpublished in the genus Herissantia, besides β-sitosterol, kaempferol 3-O-β-D-(6''-E-p-coumaroil (tiliroside glucopyranoside and kaempferol 3,7-di-O-α-L-ramnopyranoside (lespedin, described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, ¹H and 13C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out.

  3. Preliminary results of the Artemia salina experiments in biostack on LDEF

    Science.gov (United States)

    Graul, E. H.; Ruether, W.; Hiendl, C. O.

    1992-01-01

    The mosaic egg of the brine shrimp, Artemia salina, resting in blastula or gastrula state represents a system that during further development, proceeds without any further development to the larval stage, the free swimming nauplius. Therefore, injury to a single cell of the egg will be manifest in the larvae. In several experiments, it was shown that the passage of a single heavy ion through the shrimp egg damaged a cellular area large enough to disturb either embryogenesis or further development of the larvae, or the integrity of the adult individual. Emergence from the egg shell was heavily disturbed by the heavy ions as was hatching. Additional late effects, due to a hit by a heavy ion, are delayed of growth and of sexual maturity, and reduced fertility. Anomalies in the body and the extremities could be observed more frequently for the nauplii which had developed from eggs hit by heavy ions.

  4. IDENTIFIKASI DAN UJI AKTIVITAS ANTIKANKER EKSTRAK SPONS Ianthella basta TERHADAP LARVA Artemia salina L.

    Directory of Open Access Journals (Sweden)

    Ni Wayan Sri Sukmarianti

    2013-05-01

    Full Text Available The main purpose of this research is to determine the toxicity of extracts sponge Ianthella basta against Artemia salina larvae and to identify the chemical compounds contained in those toxic isolates. The preliminary test of the anticancer activity has conducted by Brine Shrimp Letalithy (BST test. The results showed that the chloroform extract was the most toxic with LC50 value of 22,39 ppm. Futher, the cloroform extract was separated and purified by coloumn chromatography using eluent of solvent mixture of chloroform : ethyl acetate : n-hexane by 7 : 2 : 1 and 4 fractions were obtained. The most toxic fraction was the fraction C with LC50 value of 35,36 ppm. Based on the GC-MS results, the toxic isolate is allegedly containing chemicals compound of hexadecanoic methyl ester and hexadecanoic acid.

  5. Altered lipid accumulation in Nannochloropsis salina CCAP849/3 following EMS and UV induced mutagenesis

    Directory of Open Access Journals (Sweden)

    T.A. Beacham

    2015-09-01

    Full Text Available Microalgae have potential as a chemical feed stock in a range of industrial applications. Nannochloropsis salina was subject to EMS mutagenesis and the highest lipid containing cells selected using fluorescence-activated cell sorting. Assessment of growth, lipid content and fatty acid composition identified mutant strains displaying a range of altered traits including changes in the PUFA content and a total FAME increase of up to 156% that of the wild type strain. Combined with a reduction in growth this demonstrated a productivity increase of up to 76%. Following UV mutagenesis, lipid accumulation of the mutant cultures was elevated to more than 3 fold that of the wild type strain, however reduced growth rates resulted in a reduction in overall productivity. Changes observed are indicative of alterations to the regulation of the omega 6 Kennedy pathway. The importance of these variations in physiology for industrial applications such as biofuel production is discussed.

  6. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Gómez, Africa; Green, Andy J.;

    2008-01-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading...... to their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South Africa......) and to assess the extent of local endemism, the degree of population structure and the potential impact of traditional human saltpan management on this species. We also examined the phylogenetic relationships in the genus Artemia using COI sequences. Our results show extensive regional endemism and indicate...

  7. First secondary metabolites from Herissantia crispa L (Brizicky) and the toxicity activity against Artemia salina Leach

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Danielly Albuquerque da; Matias, Wemerson Neves; Lima, Igara Oliveira; Xavier, Aline Lira; Costa, Vivian Bruna Machado; Diniz, Margareth de Fatima Formiga Melo; Agra, Maria de Fatima; Batista, Leonia Maria; Souza, Maria de Fatima Vanderlei de [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Lab. de Tecnologia Farmaceutica Prof. Delby Fernandes de Medeiros; Silva, Davi Antas e [Universidade Federal Rural de Pernambuco, Serra Talhada, PE (Brazil). Dept. de Quimica

    2009-07-01

    The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-{beta}-D-glucopyranoside, stigmasterol 3-O-{beta}-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol), 3,5,7,3',4'-pentahydroxyflavone (quercetin), unpublished in the genus Herissantia, besides {beta}-sitosterol, kaempferol 3-O-{beta}-D-(6''-E-p-coumaroil) (tiliroside) glucopyranoside and kaempferol 3,7-di-O-{alpha}-L-ramnopyranoside (lespedin), described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, {sup 1}H and {sup 13}C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out. (author)

  8. Salimyxins and enhygrolides: antibiotic, sponge-related metabolites from the obligate marine myxobacterium Enhygromyxa salina.

    Science.gov (United States)

    Felder, Stephan; Kehraus, Stefan; Neu, Edith; Bierbaum, Gabriele; Schäberle, Till F; König, Gabriele M

    2013-07-22

    Unlike their terrestrial counterparts, marine myxobacteria are hardly investigated for their secondary metabolites. This study describes three new compounds (1-3), named salimyxins and enhygrolides, obtained from the obligate marine myxobacterium Enhygromyxa salina. These are the first natural products obtained from Enhygromyxa species. Their structures were elucidated by spectroscopic analysis, including NMR and CD spectroscopy. Enhygrolides are closely related to the nostoclides, which were initially isolated from a cyanobacterium of the genus Nostoc. The salimyxins, representing structurally most unusual degraded sterols, are close to identical to demethylincisterol from the sponge Homaxinella sp. Salimyxin B and enhygrolide A inhibit the growth of the Gram-positive bacterium Arthrobacter cristallopoietes (MIC salimyxin B, 8 μg mL⁻¹; enhygrolide A, 4 μg mL⁻¹).

  9. Evaluation of toxicity of polluted marine sediments from Bahia Salina Cruz, Mexico.

    Science.gov (United States)

    Gonzalez-Lozano, Maria Cristina; Mendez-Rodriguez, Lia C; Maeda-Martinez, Alejandro M; Murugan, Gopal; Vazquez-Botello, Alfonso

    2010-01-01

    Bahia Salina Cruz, Oaxaca, Mexico is a major center of oil and refined product distribution on the Mexican Pacific coast. From the start of oil industry operations in 1979, negative effects from discharges of treated effluents in the bay have been a constant concern for local communities. We analyzed 28 surface sediment samples obtained in June, 2002 to evaluate the level of toxicity in the littoral zone, port-harbor, and La Ventosa estuary in Bahia Salina Cruz. The extractable organic matter concentration was high (1,213 to 7,505 micro g g(-1)) in 5 of 7 stations from the port and harbor, whereas it was low in 12 of 16 stations in the littoral zone (36 to 98 micro g g(-1)). The total aromatic hydrocarbon concentration was highest (57 to 142 micro g g(-1)) in the port and harbor compared to the La Ventosa estuary and the littoral zone. Among the heavy metals analyzed, cadmium exceeded the effects range-low values associated with adverse biological effects. The geo-accumulation index of sediments was moderate to strong contamination at 5 stations in the nonlittoral and 6 stations in the littoral zone. The enrichment of lead, zinc, and cadmium at 5 stations from the littoral, port, and harbor suggest that these metals are of anthropogenic origin. Bioassay tests of elutriates of sediments on nauplii of Artemia franciscana and Artemia sp. showed that the port and harbor were more toxic than the La Ventosa estuary and the coastal zone. The Microtox test (Vibrio fischeri) did not show a similar response with the solid phase of the sediments. The results of this study indicate that the high levels of organic content and metals in the sediments of port-harbor and the La Ventosa estuary are mainly caused by anthropogenic activities.

  10. Agua y abastecimiento: gestión de cuerpos de agua en la ciudad de San Luis Potosí (México, 1831-1887

    Directory of Open Access Journals (Sweden)

    Yuritzi Hernández Fuentes

    2015-07-01

    Full Text Available Este trabajo plantea una aproximación sobre la gestión de cuerpos de agua y de los sistemas hidráulicos en la ciudad de San Luis Potosí (México, durante el período 1831-1887, a partir de las medidas que tomó el gobierno municipal para atender las necesidades de abastecimiento de agua. El texto analiza dos proyectos importantes en el manejo del agua: el acueducto La Cañada del Lobo y las acciones sobre las derivaciones de aguas a través de La Corriente. Los dos proyectos enfrentaron diversos problemas, entre ellos, el brote de enfermedades asociadas a los cuerpos de agua y la escasez del flujo de líquido a través del acueducto de La Cañada del Lobo

  11. Agua y abastecimiento: gestión de cuerpos de agua en la ciudad de San Luis Potosí (México, 1831-1887

    Directory of Open Access Journals (Sweden)

    Yuritzi Hernández Fuentes

    2015-01-01

    Full Text Available Este trabajo plantea una aproximación sobre la gestión de cuerpos de agua y de los sistemas hidráulicos en la ciudad de San Luis Potosí (México, durante el período 1831-1887, a partir de las medidas que tomó el gobierno municipal para atender las necesidades de abastecimiento de agua. El texto analiza dos proyectos importantes en el manejo del agua: el acueducto La Cañada del Lobo y las acciones sobre las derivaciones de aguas a través de La Corriente. Los dos proyectos enfrentaron diversos problemas, entre ellos, el brote de enfermedades asociadas a los cuerpos de agua y la escasez del flujo de líquido a través del acueducto de La Cañada del Lobo.

  12. Gestión y cultura del agua en Nuevo Laredo, Tamaulipas

    Directory of Open Access Journals (Sweden)

    Jesús FRAUSTO ORTEGA

    2015-01-01

    Full Text Available Este trabajo ref l exiona sobre la relación entre la gestión del agua urbana y la cultura del agua, bajo el supuesto de que hay una contradicción entre estos dos aspectos. Se enfoca en el servicio de agua potable de Nuevo Laredo. La metodología contempla la revisión de indi - cadores de gestión del servicio, consulta de fuentes bibliográf i cas sobre la cultura del agua y entrevistas a actores locales sobre la concientización de la gente en el cuidado del recurso. El trabajo encuentra prácticas inef i cientes de manejo del agua que contradicen los objetivos de la política de la cultura del agua.

  13. Recuperación de materias primas secundarias procedentes de residuos de aparatos eléctricos y electrónicos (RAEES)

    OpenAIRE

    Giménez San Andrés, Gerard

    2016-01-01

    Estudiar la viabilidad técnica y económica de la recuperación de materias primas secundarias, procedentes de los residuos de aparatos eléctricos y electrónicos. Para ello el proyecto se centrara en unos determinados tipos de RAEES y en la recuperación de ciertos materiales empleando unas tecnologías determinadas. Algunos de los factores que se tendrán en cuenta para realizar el análisis técnico y económico son el grado de recuperación, los recursos necesarios para lograrlo y la diferencia de ...

  14. Evaluación de la capacidad de la vid para asimilar compuestos procedentes de extractos vegetales y transmitirlos a los vinos

    OpenAIRE

    Pardo García, Ana Isabel

    2016-01-01

    Este trabajo supone un avance en el conocimiento sobre la capacidad de la vid para asimilar compuestos volátiles procedentes de extractos vegetales aplicados por pulverización foliar a las cepas, e influir en la calidad del vino. Desde hace varios años se están haciendo importantes avances en relación con el efecto en la uva de vinificación de determinados factores medioambientales, naturales o no, y su impacto en el vino. Así, viñedos cercanos a zonas incendiadas proporcionan vinos con ...

  15. Cultura, migración y arteterapia: migraciones mixtas procedentes del oeste de África en un centro de acogida

    OpenAIRE

    Kerfant Follana, Natalia Beatriz

    2014-01-01

    El presente escrito quiere investigar la manera de mejorar la intervención arteterapéutica con migrantes procedentes del oeste de África en un centro de acogida. Queremos averiguar cómo influyen la cultura y el lenguaje de pueblos a los que no conocemos suficientemente dentro del contexto occidental, en la práctica del arteterapeuta. Se pretende sensibilizar sobre el hecho de que cuando los emigrantes africanos se enfrentan a una terapia a través del arte, dentro de un marco occidental se pro...

  16. Autentificación de carnes procedentes de especies de caza mayor por técnicas genéticas

    OpenAIRE

    Fajardo Martín , Violeta

    2009-01-01

    El objetivo de esta tesis doctoral ha consistido en la identificación de carnes procedentes de las siguientes especies de caza mayor: ciervo (Cervus elaphus), gamo(Dama dama), corzo (Capreolus capreolus), rebeco (Rupicapra rupicapra), cabra montés (Capra pyrenaica), muflón (Ovis ammon) y jabalí (Sus scrofa) por técnicas genéticas tales como PCR-RFLP, PCR con cebadores específicos y PCR en tiempo real. Para el desarrollo de técnicas de PCR-RFLP, se emplearon los marcadores mitocondriales 12S A...

  17. Substratos de bronce en objetos férreos procedentes de la Necrópolis de La Hoya (Laguardia, Alava.

    Directory of Open Access Journals (Sweden)

    J. Alonso

    1996-01-01

    Full Text Available Se describe a continuación, brevemente y a modo de avance, un interesante detalle de procedimiento y tecnología aplicada en la elaboración de objetos férreos procedentes de la necrópolis de La Hoya (Laguardia, Alava, puesto en evidencia durante los trabajos de conservación y restauración, y que, por su novedad, sin duda debe abrir nuevas vías tanto en la investigación de las culturas del hierro prerromano, en particular, como en los estudios de arqueometalúrgica, en general.

  18. Tratamiento de aguas industriales mediante reactor biológico de membranas

    OpenAIRE

    Aznar Jiménez, Antonio

    2008-01-01

    El Laboratorio de Ingeniería para el Tratamiento de Aguas de la Universidad Carlos III de Madrid, de investigación y servicios en el tratamiento de aguas residuales, optimiza el diseño y puesta a punto de reactores biológicos de membranas (MBR), indicados para obtener agua depurada de alta calidad y/o aumentar la capacidad de tratamiento.

  19. H2O, una biografía del agua

    OpenAIRE

    García Olmedo, Francisco

    2008-01-01

    Adelantándose a este año 2008, en el que la ciudad de Zaragoza acogerá la “Exposición Agua y Desarrollo Sostenible”, aparece esta biografía de la molécula más importante de nuestro planeta, escrita por Philip Ball, químico y físico que ha desarrollado su carrera como editor de la prestigiosa revista “Nature” y colaborador asiduo de “New Scientist”. En contraste con la mayoría de los libros sobre el agua, que suelen centrarse en el análisis y gestión de los problemas que genera ésta como recur...

  20. Riesgos de escasez de agua en la ciudad de Huancayo al año 2030

    OpenAIRE

    Guillermo Carlos Gómez; Roy Grijalva Santos

    2012-01-01

    Objetivos: Estimar los riesgos de escasez de agua en la ciudad de Huancayo (distritos de Huancayo, El Tambo y Chilca) al año 2030, mediante la recopilación y análisis de datos de oferta y demanda de agua. Métodos: Se desarrolló una investigación de alcance descriptivo, diseño transversal. Se utilizó el método de análisis del peligro de escasez de agua, considerando la oferta de agua para abastecimiento urbano, demanda doméstica y su balance, para la vulnerabilidad fue observada la conducta de...

  1. Toma, transporte y metabolismo del agua y nutrientes en la planta

    OpenAIRE

    Arjona Díaz, Harvey

    2011-01-01

    Desde el punto de vista de la termodinámica, sistema es una región de espacio o cantidad de materia sobre la cual enfocamos nuestra atención. Los sistemas interactúan entre sí. El potencial hídrico de cualquier sistema o parte de un sistema que contiene agua o que puede contener agua es una medida de la máxima energía del agua en el sistema, disponible para hacer trabajo. EI agua en el sistema suelo-planta-atmosfera se mueve siguiendo un gradiente de potencial hídrico, el cual es mayor en el ...

  2. Dimensionamiento del sistema de tratamiento de aguas residuales industriales en la industria de la pintura

    OpenAIRE

    Guevara Gavilanes, Silvia; Parrales Baquerizo, Narcisa; Villamar Bajaña, Franklin

    2009-01-01

    Las aguas residuales en la Industria de la pintura son el conjunto de las aguas que son contaminadas durante su empleo en actividades de limpieza realizadas en el proceso de elaboración de las pinturas acuosas. Para reparar esta alteración a la naturaleza aplicaremos sistemas de tratamientos de aguas donde se realiza distintos procesos necesarios para poder llegar al estado inicial del agua sin contaminación, los sistemas de tratamiento no hacen otra cosa que separar todos los contaminante...

  3. Prospecção fitoquímica de Sonchus oleraceus e sua toxicidade sobre o microcrustáceo Artemia salina Phytochemical prospecting of Sonchus oleraceus and its toxicity to Artemia salina

    Directory of Open Access Journals (Sweden)

    J.M. Lima

    2009-03-01

    Full Text Available A espécie vegetal Sonchus oleraceus é uma planta daninha presente em diversas culturas no Brasil e de utilização na medicina popular. Neste trabalho, realizou-se a prospecção fitoquímica dessa espécie com extratos em etanol, água e diclorometano, bem como testes de toxicidade sobre o microcrustáceo Artemia salina. O extrato aquoso apresentou em sua composição açúcares redutores, compostos fenólicos, taninos, flavonóides e cumarinas. No extrato etanólico, observaram-se os mesmos compostos qualificados no extrato aquoso, com exceção de cumarinas. Em diclorometano, verificou se a presença de saponinas, derivados triterpênicos e esteróides. No teste de toxicidade sobre Artemia salina, os dados convergiram para frações de extrato aquoso de 5.117,2 ppm, indicando ser um extrato de baixa toxicidade.Sonchus oleraceus is a common weed in Brazil, also used as a medicinal plant. Phytochemical prospecting of this species was carried out in this work using extracts obtained in ethanol, water and dichloromethane. A toxicity study of the aqueous extract was also conducted, using the micro crustaceous Artemia salina. The aqueous extract presented sugar reducers, phenolic compounds, tannins, flavonoids and coumarins in its composition. The compounds found in the aqueous extract were also detected in the ethanol extract, except for the coumarins. Saponin, triterpenes and steroids were identified in the dichloromethane extract. The toxicity test on Artemia salina pointed to aqueous extract fractions of 5,117.2 ppm, indicative of low toxicity.

  4. Tratamiento de aguas residuales textiles mediante un biorreactor de membrana

    Directory of Open Access Journals (Sweden)

    Lorena Salazar Gámez

    2009-01-01

    Full Text Available En la actualidad, los investigadores dedicados al tratamiento de agua residual se han esforzado por obtener mejores rendimientos de depuración, reducción de costos de operación y mantenimiento en la generación de procesos que posean una elevada flexibilidad para soportar las variaciones en el afluente, que generen una mínima producción de lodos y que sean diseñados en condiciones mínimas de área. En este trabajo se expone una nueva tecnología en el tratamiento de agua residual, la de los Biorreactores de Membrana (BRM, que nace como respuesta de estas exigencias, ya que combina el sistema de fangos activados (FA convencional y la filtración por membrana. Así mismo evalúa comparativamente el proceso de fangos activados y Biorreactor de Membrana a escala piloto en aguas de difícil tratamiento como son los efluentes textiles. Los resultados indican que el proceso de BRM reduce un 82 - 92% de la materia orgánica (DQO, un 95% de los sólidos en suspensión totales (SST, mientras que el proceso de fangos activados reduce un 54- 70% de la materia orgánica (DQO y un 32- 43% de SST.

  5. MICROCONTAMINANTES EMERGENTES EN AGUAS: TIPOS Y SISTEMAS DE TRATAMIENTO

    Directory of Open Access Journals (Sweden)

    Yolanda Patiño

    2014-01-01

    Full Text Available En el presente artículo se revisan las distintas clases de contaminantes emergentes, su origen y uso, y su presencia en las cuencas españolas, tanto en aguas superficiales como subterráneas. Los microcontaminantes emergentes son compuestos de distinto origen y naturaleza que hasta ahora habían pasado inadvertidos debido a su baja concentración (en el orden de las ppb y sobre los que no hay regulación específica. Están divididos en seis grandes grupos y muchos de ellos se comportan como disruptores endocrinos, provocando efectos negativos sobre la salud humana y el medio ambiente. Se encuentran presentes en las aguas ya que las plantas de tratamiento de aguas residuales no están diseñadas para su eliminación, por lo que están siendo vertidos. Se discuten las distintas alternativas para su eliminación – tratamiento físico-químicos, biológicos y tecnologías híbridas - , destacando dentro de los procesos físico-químicos el empleo de procesos avanzados de oxidación (AOPs que están resultando muy prometedores.

  6. Screening of a Protein That Interacts with the Matrix Attachment Region-Binding Protein from Dunaliella salina

    Directory of Open Access Journals (Sweden)

    Rui Yang

    2013-01-01

    Full Text Available We isolated the matrix attachment region-binding protein (MBP DMBP-1 from Dunaliella salina in our previous studies. MBPs are part of the cis-acting protein family cluster. The regulatory function possibly works through the interaction of the MBPs with each other. In the present study, DMBP-1 was used as the bait in screening the D. salina cDNA library for DMBP-1 interactors that could potentially mediate the DMBP-1-regulated functions. A novel MBP, namely, DMBP-2, was identified as a DMBP-1 binding partner. The cDNA of DMBP-1 was 823 bp long and contained a 573 bp open reading frame, which encoded a polypeptide of 191 amino acids. The interaction between DMBP-2 and DMBP-1 was further confirmed through glutathione S-transferase pull-down assays.

  7. Effect of specific light supply rate on photosynthetic efficiency of Nannochloropsis salina in a continuous flat plate photobioreactor.

    Science.gov (United States)

    Sforza, Eleonora; Calvaruso, Claudio; Meneghesso, Andrea; Morosinotto, Tomas; Bertucco, Alberto

    2015-10-01

    In this work, Nannochloropsis salina was cultivated in a continuous-flow flat-plate photobioreactor, working at different residence times and irradiations to study the effect of the specific light supply rate on biomass productivity and photosynthetic efficiency. Changes in residence times lead to different steady-state cell concentrations and specific growth rates. We observed that cultures at steady concentration were exposed to different values of light intensity per cell. This specific light supply rate was shown to affect the photosynthetic status of the cells, monitored by fluorescence measurements. High specific light supply rate can lead to saturation and photoinhibition phenomena if the biomass concentration is not optimized for the selected operating conditions. Energy balances were applied to quantify the biomass growth yield and maintenance requirements in N. salina cells.

  8. Biodiesel Fuel Production from Marine Microalgae Isochrysis galbana, Pavlova lutheri, Dunaliella salina and Measurement of its Viscosity and Density

    Directory of Open Access Journals (Sweden)

    T. Sujin Jeba Kumar

    2013-01-01

    Full Text Available Biodiesel is a fuel derives from transesterification of fats and oils. It is renewable and non-toxic ecofriendly fuel with less CO2 and NO2 emissions. Microalgae are known to contain more lipid content than macroalgae and most other oil crops. In this study, we extracted biodiesel from three microalgae Isochrysis galbana, Pavlova lutheri, Dunaliella salina and also measured the density and viscosity of biofuel obtained from these microalgae. Pavlova lutheri yielded more oil than the other two algae with biomass left over Dunaliella salina was more. The density of biodiesel obtained from these microalgae was between 0.86 g/cm3 and 0.90 g/cm3 with viscosity in the range 3.92 mm2/sec to 4.5 mm2/sec showing high density than the other oils.

  9. Cloning and sequence analysis of the gene encoding 19-kD subunit of Complex I from Dunaliella salina.

    Science.gov (United States)

    Liu, Yi; Qiao, Dai Rong; Zheng, Hong Bo; Dai, Xu Lan; Bai, Lin Han; Zeng, Jing; Cao, Yi

    2008-09-01

    NADH:ubiquinone oxidoreductase (complex I ) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone coupled to proton translocation across the membrane. The cDNA sequence of Dunaliella salina mitochondrial NADH: ubiquinone oxidoreductase 19-kD subunit contains a 682-bp ORF encoding a protein with an apparent molecular mass of 19 kD. The sequence has been submitted to the GenBank database under Accession No. EF566890 (cDNA sequences) and EF566891 (genomic sequence). The deduced amino-acid sequence is 74% identical to Chlamydomonas reinhardtii mitochondrial NADH:ubiquinone oxidoreductase 18-kD subunit. The 19-kD subunit mRNA expression was observed in oxygen deficiency, salt treatment, and rotenone treatment with lower levels. It demonstrate that the 19-kD subunit of Complex I from Dunaliella salina is regulated by these stresses.

  10. Biotechnological potential of Synechocystis salina co-cultures with selected microalgae and cyanobacteria: Nutrients removal, biomass and lipid production.

    Science.gov (United States)

    Gonçalves, Ana L; Pires, José C M; Simões, Manuel

    2016-01-01

    Cultivation of microalgae and cyanobacteria has been the focus of several research studies worldwide, due to the huge biotechnological potential of these photosynthetic microorganisms. However, production of these microorganisms is still not economically viable. One possible alternative to improve the economic feasibility of the process is the use of consortia between microalgae and/or cyanobacteria. In this study, Chlorella vulgaris, Pseudokirchneriella subcapitata and Microcystis aeruginosa were co-cultivated with Synechocystis salina to evaluate how dual-species cultures can influence biomass and lipid production and nutrients removal. Results have shown that the three studied consortia achieved higher biomass productivities than the individual cultures. Additionally, nitrogen and phosphorus consumption rates by the consortia provided final concentrations below the values established by European Union legislation for these nutrients. In the case of lipid productivities, higher values were determined when S. salina was co-cultivated with P. subcapitata and M. aeruginosa.

  11. Laboratory scale photobioreactor for high production of microalgae Rhodomonas salina used as food for intensive copepod cultures

    DEFF Research Database (Denmark)

    Thuy, Minh Vu Thi; Jepsen, Per Meyer; Hansen, Benni Winding

    Introduction Microalgae are essential feeds for many cultured molluscs, larvae of marine fishes, crustaceans as well as other important live feeds including rotifers, Artemia and copepods (Muller-Feuga, 2000). Microalgae are grown either in open culture systems (ponds) or closed systems...... (photobioreactor - PBR). There is an increasing interest in using closed PBRs for algae cultivation since this culture system provides a better control of cultivation conditions and enables higher algae productivity. Among the marine microalgae, the cryptophyte Rhodomonas salina is one of the optimal feed...... for copepods (Støttrup and Jensen, 1990; Zhang et al., 2013). Despite the benefit of using R. salina in cultivation of copepods, to our knowledge, there is no report on the production of this microalga at industrial scale to supply sufficient food for mass production of copepods. We intend to conduct the basic...

  12. Toxicity of tannins towards the free-living nematode Caenorhabditis elegans and the brine shrimp Artemia salina.

    Science.gov (United States)

    Yamasaki, Toru; Sato, Masashi; Mori, Tomoaki; Mohamed, Ahmed S A; Fujii, Kyoko; Tsukioka, Junko

    2002-08-01

    Toxicities of gallo- and condensed tannins towards the free-living nematode Caenorhabditis elegans is dependent on the tannins' molecular sizes. In the present paper we investigate the toxicity of ellagitannins to C elegans and the toxicity of ellagi-, gallo-, and condensed tannins to the brine shrimpArtemia salina. Ellagitannins 1 and 2 were isolated from Euphorbia supina and identified as tellimagrandin I and rugosin A methyl ester, respectively. An ellagitannin preparation from Cornus officinalis was chromatographically fractionated into ellagitannins A through H, having different molecular weights and specific rotations. Three of the ten ellagitannins, 2, G, and H produced significant toxicity towards C. elegans, showing the presence of an activity-structure relationship, as opposed to the results from tests of gallo- and condensed tannins. Ellagi-, gallo-, and condensed tannins also produced toxicity in A. salina.

  13. Biodiesel Fuel Production from Marine Microalgae Isochrysis galbana, Pavlova lutheri, Dunaliella salina and Measurement of its Viscosity and Density

    OpenAIRE

    T. Sujin Jeba Kumar; C.K. Balavigneswaran; K.P. Srinivasakumar

    2013-01-01

    Biodiesel is a fuel derives from transesterification of fats and oils. It is renewable and non-toxic ecofriendly fuel with less CO2 and NO2 emissions. Microalgae are known to contain more lipid content than macroalgae and most other oil crops. In this study, we extracted biodiesel from three microalgae Isochrysis galbana, Pavlova lutheri, Dunaliella salina and also measured the density and viscosity of biofuel obtained from these microalgae. Pavlova lutheri yielded more oil than the other two...

  14. Microorganismos indicadores de la calidad del agua potable en cuba

    Directory of Open Access Journals (Sweden)

    Marlen Robert Pullés

    2014-01-01

    Full Text Available Los agentes patógenos transmitidos por el agua constituyen un problema mundial que demanda un urgente control. Las bacterias, virus y parásitos causan enfermedades que varían en severidad. La determinación de microorganismos en el agua de consumo y su concentración proporcionan herramientas de control, indispensables para la toma de decisiones. Los controles rutinarios de todos los microorganismos, potencialmente riesgosos para la salud, resultan difíciles de llevar a cabo, debido a que ello representa, varios días de análisis y costos elevados. Para hacer una evaluación sencilla, económica y fiable de la presencia de patógenos, la vigilancia de la calidad del agua se efectúa mediante indicadores de contaminación, aplicando diferentes enfoques técnicos, cada uno con sus cualidades, defectos y limitaciones. El objetivo de esta revisión fue analizar el enfoque actual existente a nivel nacional e internacional, en relación con los indicadores microbiológicos empleados para la evaluación del agua potable, como elementos clave, y a partir de estos, proponer un esquema de monitoreo en Cuba. Los resultados reflejaron, la alternativa de considerar, la aplicación de un esquema para monitoreo complementario en Cuba, que incluya como indicadores de contaminación del agua potable además de las bacterias, algunos agentes biológicos no considerados en la norma, como los virus y los parásitos. Asimismo indicaron la necesidad de establecer un valor de referencia y definir los microorganismos a emplear en los monitoreos de validación, operativo o verificación. Esta propuesta aportaría importante información para la actualización de la norma cubana sobre la base del conocimiento de los estándares internacionales más reconocidos.

  15. IMPACTO AMBIENTAL DE LOS CONTAMINANTES PROVENIENTES DE AGUAS RESIDUALES DE FEED-LOT SOBRE AGUAS SUBTERRÁNEAS

    Directory of Open Access Journals (Sweden)

    Walter M. Glessi

    2012-01-01

    Full Text Available En este trabajo se investigó el impacto de los contaminantes de efluentes líquidos generados por doce feedlot del sudeste de la Provincia de Buenos Aires, Argentina, con el objeto de determinar los aspectos significativos sobre la vulnerabilidad de las aguas subterráneas. Se utilizó la Guía metodológica de Evaluación de Impacto Ambiental propuesta por Conesa (2010 partiendo de do ce Estudios de Impacto Ambiental y analizando como influye la actividad sobre el agua subterránea. Se analizó la dimensión de los establecimientos partiendo del número de animales, el tipo de suelo, profundidad freática y tipo de práctica (estacional o continua, así como las doce matrices de impacto en la emisión de contaminantes sobre el medio físico agua. Se obtuvo que los parámetros de mayor incidencia son: el grado de Destrucción, el área de influencia, el momento de manifestación del efecto y la regularidad de la manifestación.

  16. Desenvolvimento de mudas de pinhão-manso irrigadas com água salina

    Directory of Open Access Journals (Sweden)

    Fábio Santos Matos

    2013-08-01

    Full Text Available O uso de água salina na irrigação torna-se importante alternativa diante daescassez de água de boa qualidade em todo o mundo. O pinhão-manso (Jatropha curcas L. possui baixa exigência hídrica, sobrevive e apresenta produção satisfatória em solos de baixa fertilidade. No entanto, a sua produção é maior em cultivos irrigados, o que reforça a necessidade de desenvolvimento de pesquisas para uso de água salina. Este trabalho objetivou avaliar o efeito de diferentes níveis de salinidade da água de irrigação nas características morfofisiológicas de mudas de pinhão-manso. Para isso, foi conduzido experimento em casa de vegetação com interceptação de 50 % da radiação solar, localizada na Universidade Estadual de Goiás, Ipameri, Goiás. O experimento foi conduzido em vasos com capacidade de 4 L de solo, utilizando-se o delineamento inteiramente casualizado, com quatro tratamentos e cinco repetições. As plantas foram irrigadas diariamente com 150 mL de água não salina, durante os 30 primeiros dias após a germinação das sementes. Do 31º ao 50º dia, as plantas foram submetidas a quatro tratamentos: plantas diariamente irrigadas com água de condutividade elétrica igual a 0,5; 8; 16 e 24 dS m-1. Aos 50 dias após a germinação, analisaram-se as seguintes características nas mudas de pinhão-manso: número de folhas; altura de planta; diâmetro de ramo; teor relativo de água; área foliar; clorofila total; razões de massa radicular, massa caulinar, massa foliar e parte aérea/sistema radicular; e biomassa total. Os resultados evidenciaram que as mudas de pinhão-manso irrigadas com água de condutividade elétrica 8 dS m-1 não apresentaram redução do crescimento vegetativo. Todavia, a água de irrigação com condutividade elétrica 16 dS m-1 causou redução no crescimento vegetativo e elevou a senescência e abscisão foliar. Água com condutividade elétrica elétrica de pinhão-manso na fase de mudas.

  17. Identifying primary stressors impacting macroinvertebrates in the Salinas River (California, USA): Relative effects of pesticides and suspended particles

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, B.S. [Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States)]. E-mail: anderson@ucdavis.edu; Phillips, B.M. [Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States); Hunt, J.W. [Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States); Connor, V. [Division of Water Quality, State Water Resources Control Board, 1001 I. Street, Sacramento, CA 95814 (United States); Richard, N. [Division of Water Quality, State Water Resources Control Board, 1001 I. Street, Sacramento, CA 95814 (United States); Tjeerdema, R.S. [Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States)

    2006-06-15

    Laboratory dose-response experiments with organophosphate and pyrethroid pesticides, and dose-response experiments with increasing particle loads were used to determine which of these stressors were likely responsible for the toxicity and macroinvertebrate impacts previously observed in the Salinas River. Experiments were conducted with the amphipod Hyalella azteca, the baetid mayfly Procloeon sp., and the midge Chironomus dilutus (Shobanov, formerly Chironomus tentans). The results indicate the primary stressor impacting H. azteca was pesticides, including chlorpyrifos and permethrin. The mayfly Procloeon sp. was sensitive to chlorpyrifos and permethrin within the range of concentrations of these pesticides measured in the river. Chironomus dilutus were sensitive to chlorpyrifos within the ranges of concentrations measured in the river. None of the species tested were affected by turbidity as high as 1000 NTUs. The current study shows that pesticides are more important acute stressors of macroinvertebrates than suspended sediments in the Salinas River. - Pesticides are the primary stressor impacting macroinvertebrates in sections of the lower Salinas River.

  18. Colorimetric Evaluation of the Viability of the Microalga Dunaliella Salina as a Test Tool for Nanomaterial Toxicity.

    Science.gov (United States)

    Golubev, Alexander A; Prilepskii, Artur Y; Dykman, Lev A; Khlebtsov, Nikolai G; Bogatyrev, Vladimir A

    2016-05-01

    A diagnostic test system was developed to determine the toxicity of nanomaterials to the saltwater microalga Dunaliella salina through evaluation of cell death and changes in the culture growth rate at various toxicant concentrations, providing LC50 and other toxicological metrics. The viability of cells was shown to decrease with decreasing chlorophyll absorption of red light by damaged cells. This correlation was confirmed by independent fluorescence microscopic measurements of live and dead cells in the population. Two standard colorless pollutants, hydrogen peroxide and formaldehyde, were used to validate the colorimetric method. The method's performance is exemplified with three Ag-containing preparations (Ag nitrate, Ag proteinate, and 20-nm Ag nanoparticles) and with cetyltrimethylammonium bromide (CTAB) mixed with colloidal 15-nm Au and 20-nm Ag nanoparticles. The toxicity of the Ag-containing preparations to D. salina decreased in the order Ag nitrate ≥ Ag proteinate ≫ colloidal Ag. The toxicity of colloidal Au-CTAB mixtures was found to depend mostly on the content of free CTAB. The toxicity of colloidal Ag increased substantially in the presence of CTAB. The results suggest that our D. salina-based colorimetric test system can be used for simple and rapid preliminary screening of the toxicity of different nanomaterials.

  19. Multicriteria analysis as a tool to investigate compatibility between conservation and development on Salina Island, Aeolian Archipelago, Italy

    Science.gov (United States)

    Bodini, Antonio; Giavelli, Giovanni

    1992-09-01

    Several multicriteria evaluation techniques have been developed since the 1970s. The need to compare different territorial policies has justified their introduction into environmental research. These methods are based on the numerical manipulation of heterogeneous information, which varies in terms of reference scale and type of measure (continuous, ordinal, qualitative, binary, etc.). During recent years, diverse investigations have focused on general conditions on Salina, the “green island” of the Aeolian archipelago. Such studies, within an interdisciplinary project, aimed to explore the possibility of implementing conservation strategies that are compatible with human needs, landscape preservation, and sustainable economic development. Three different evaluation techniques are applied, namely multicriteria weighted concordance and discordance analysis and a qualitative procedure. They are used to compare four alternative plans for the socioeconomic development of Salina Island. These plans lie between extreme alternatives: total protection of natural resources and maximizing economic development based on tourism. The plans are compared to each other on the basis of 14 criteria that reflect the socioenvironmental perception of Salina's inhabitants. The approach used in this research seems particularly fruitful because of its flexibility: it offers decision makers the chance to manage heterogeneous data and information that is not easily quantifiable. Such “soft” information helps to evaluate environmental conditions more precisely, and to make a less damaging choice among alternative development plans.

  20. Primary screening of the bioactivity of brackishwater cyanobacteria: toxicity of crude extracts to Artemia salina larvae and Paracentrotus lividus embryos.

    Science.gov (United States)

    Lopes, Viviana R; Fernández, Nuria; Martins, Rosário F; Vasconcelos, Vitor

    2010-03-05

    Cyanobacteria are a diverse group of Gram-negative bacteria that produce an array of secondary compounds with selective bioactivity against vertebrates, invertebrates, plants, microalgae, fungi, bacteria, viruses and cell lines. The aim of this study was to assess the toxic effects of aqueous, methanolic and hexane crude extracts of benthic and picoplanktonic cyanobacteria isolated from estuarine environments, towards the nauplii of the brine shrimp Artemia salina and embryos of the sea urchin Paracentrotus lividus. The A. salina lethality test was used as a frontline screen and then complemented by the more specific sea urchin embryo-larval assay. Eighteen cyanobacterial isolates, belonging to the genera Cyanobium, Leptolyngbya, Microcoleus, Phormidium, Nodularia, Nostoc and Synechocystis, were tested. Aqueous extracts of cyanobacteria strains showed potent toxicity against A. salina, whereas in P. lividus, methanolic and aqueous extracts showed embryo toxicity, with clear effects on development during early stages. The results suggest that the brackishwater cyanobacteria are producers of bioactive compounds with toxicological effects that may interfere with the dynamics of invertebrate populations.

  1. Protective effect induced by atropine, carbamates, and 2-pyridine aldoxime methoiodide Artemia salina larvae exposed to fonofos and phosphamidon.

    Science.gov (United States)

    Victoria Barahona, M; Sánchez-Fortún, Sebastián

    2007-01-01

    The acute toxicity of fonofos and phosphamidon on three age classes of Artemia salina was evaluated. An increase in toxicity of these organophosphorous (OP) insecticides was found following longer development of A. salina. The effects of pretreatment with the nonselective muscarinic antagonist atropine, the two reversible acetylcholinesterease inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methoiodide (2-PAM), as individual and combined pretreatments, on OP-induced lethality in 24 h Artemia were also investigated. The lethal action of both OP insecticides was prevented by pretreatment of 24 h Artemia with atropine and 2-PAM, while physostigmine proved ineffective against intoxication with both OP insecticides and pyridostigmine exhibited a low synergic effect. In both cases, the inhibitory effects of combinations of atropine (10(-5)M) plus 2-PAM were greater than those elicited by either drug alone, with the maximum protection afforded being 100%. Combined pretreatment of atropine (10(-5)M) plus physostigmine practically abolished the lethal effects induced by both insecticides. Pretreatment with 2-PAM (10(-6)M) plus physostigmine afforded maximal protection of 100% and 76% on the lethality induced by fonofos and phosphamidon, respectively. The data obtained suggest that the combination of atropine plus 2-PAM or physostigmine and the combined pretreatment of 2-PAM plus physostigmine are effective in the prevention of the lethal effects induced by fonofos and phosphamidon in A. salina larvae.

  2. Toxicity assessment of metabolites of fungal biocontrol agents using two different (Artemia salina and Daphnia magna) invertebrate bioassays.

    Science.gov (United States)

    Favilla, M; Macchia, L; Gallo, A; Altomare, C

    2006-11-01

    Fungal biocontrol agents (BCAs) have been marketed for control of crop pests, weeds, and diseases. However, BCAs may produce toxic metabolites, whose presence in the formulated products, in the crops and in the environment should be considered along with the associated risk. Two invertebrate models, viz. Artemia salina and Daphnia magna were used to assess the acute toxicity of seven BCA metabolites, characterized by different chemical nature and mode of action, namely alamethicin (ALA), paracelsin (PCS), antiamoebin (AAM), gliotoxin (GTX), destruxin A (DA), oosporein (OOS), and elsinochrome A (EA). The two invertebrates were very sensitive to all the metabolites examined, except OOS. The LC50s after 24 and 36 h exposures showed the following toxicity ranks: A. salina, DA > ALA > EA > GTX > AAM > PCS (LC50s ranging from 9.78 to 40.84 microg/ml at 24 h and from 2.92 to 18.56 microg/ml at 36 h); D. magna, DA > GTX = EA > ALA > PCS > AAM (LC50s ranging from 0.20 to 24.41 microg/ml at 24h and from 0.16 to 11.98 microg/ml at 36 h). LC50 of OOS to D. magna increased dramatically in 36 h exposure, compared to 24 h exposures (5.84 and 68.40 microg/ml, respectively). A. salina and D. magna proved to be suitable models for rapid and inexpensive screening of toxicity of BCAs at an early stage of product development.

  3. Primary Screening of the Bioactivity of Brackishwater Cyanobacteria: Toxicity of Crude Extracts to Artemia salina Larvae and Paracentrotus lividus Embryos

    Directory of Open Access Journals (Sweden)

    Viviana R. Lopes

    2010-03-01

    Full Text Available Cyanobacteria are a diverse group of Gram-negative bacteria that produce an array of secondary compounds with selective bioactivity against vertebrates, invertebrates, plants, microalgae, fungi, bacteria, viruses and cell lines. The aim of this study was to assess the toxic effects of aqueous, methanolic and hexane crude extracts of benthic and picoplanktonic cyanobacteria isolated from estuarine environments, towards the nauplii of the brine shrimp Artemia salina and embryos of the sea urchin Paracentrotus lividus. The A. salina lethality test was used as a frontline screen and then complemented by the more specific sea urchin embryo-larval assay. Eighteen cyanobacterial isolates, belonging to the genera Cyanobium, Leptolyngbya, Microcoleus, Phormidium, Nodularia, Nostoc and Synechocystis, were tested. Aqueous extracts of cyanobacteria strains showed potent toxicity against A. salina, whereas in P. lividus, methanolic and aqueous extracts showed embryo toxicity, with clear effects on development during early stages. The results suggest that the brackishwater cyanobacteria are producers of bioactive compounds with toxicological effects that may interfere with the dynamics of invertebrate populations.

  4. 76 FR 63614 - Agua Caliente Solar, LLC; Supplemental Notice That Initial Market-Based Rate Filing Includes...

    Science.gov (United States)

    2011-10-13

    ...-000] Agua Caliente Solar, LLC; Supplemental Notice That Initial Market-Based Rate Filing Includes... proceeding of Agua Caliente Solar, LLC's application for market-based rate authority, with an...

  5. Aguas dulces y derecho internacional : el agua como bien común y como derecho humano desde la perspectiva del desarrollo sostenible

    OpenAIRE

    2014-01-01

    Este trabajo tiene por objeto el análisis del régimen internacional de las aguas dulces como bien común y como derecho humano, desde una perspectiva del desarrollo sostenible. El análisis separado del régimen internacional de las aguas dulces compartidas y el régimen internacional del derecho humano al agua y al saneamiento nos permite detectar un cambio de paradigma en la regulación de la materia que puede apuntar una progresiva priorización de la garantía del DHAS y la gestió...

  6. Análisis de subsidencia de la Cuenca de las Salinas, Sierras Pampeanas occidentales

    Directory of Open Access Journals (Sweden)

    Edgardo A. Azeglio

    2008-06-01

    Full Text Available En el presente trabajo se ha evaluado la subsidencia total de la cuenca de Las Salinas mediante diagramas tiempo - profundidad, considerando la subsidencia inicial, por carga y termotectónica. También se calculó la velocidad de subsidencia interválica en función del tiempo geológico. El área en estudio se ubica aproximadamente entre los paralelos 31°17´S y 32°40´S y los meridianos 66°38´W y 67°48´W en las cercanías de la localidad de Marayes, en el sitio denominado cuenca de Las Salinas. Los diagramas tiempo - profundidad permitieron relacionar cambios en la velocidad de subsidencia de la cuenca durante el proceso distensivo del Mesozoico y el actualmente compresional a la cual esta sometida, obteniéndose valores concordantes con áreas circundantes. Como resultado del análisis se encontró que la velocidad de subsidencia inicial fue de 0,0017 mm/año en el Carbonífero, la que fue aumentando lentamente hasta alcanzar los 0,00875 mm/año en el Cretácico. Este incremento disminuye sensiblemente durante el Cretácico superior, para posteriormente incrementarse abruptamente en el Terciario (0,043 mm/año. Este régimen se mantiene durante el Plioceno a Mioceno, alcanzando valores promedios de 0,269 mm/año, culminando con valores de 0,0973 mm/año. De la comparación entre ambos diagramas de subsidencia se observan distintos ritmos de sedimentación entre el sector norte y sur de la cuenca que podría ser la consecuencia de un fallamiento en el basamento. La comparación de estos valores con los obtenidos en la cuenca de Beazley indican que si bien los valores de subsidencia inicial y ritmo de sedimentación fueron similares. El inicio de la subsidencia en la cuenca de Beazley, se produjo con posterioridad (en el Triásico. La componente termotectónica en ambas cuencas es similar a pesar que el gradiente térmico normal de la zona aumenta sensiblemente en dirección sur.

  7. [Immunocytochemical studies on the phase of differentiation of hatching gland cells in brine shrimp, Artemia salina].

    Science.gov (United States)

    Li, Ling; Fan, Ting Jun; Wang, Xiao Feng; Cong, Ri Shan; Yu, Qiu Tao; Zhong, Qi Wang

    2004-04-01

    Hatching enzyme (HE), synthesized in hatching gland cells (HGCs), plays vital roles in animal hatching. Immunocytochemical techniques employing anti-GST-UVS.2 antiserum, prepared from Xenopus HE and with specificity to brine shrimp HE, were first used to investigate the differentiation and variability of hatching gland cells (HGCs) in the hatching process of embryos of brine shrimp, Artemia salina, in this study. HGCs with immunoreactivity to anti-GST-UVS.2 antiserum were identified, for the first time, in brine shrimp embryos during hatching process. Immunocytochemical staining results showed that, (1) HE-positive immunoreactivity is really specific to Artemia HE, and its appearance and disappearance are closely correlated with the hatching process of Artemia salina. (2) Artemia HGCs, first appeared in embryos 5 hours before hatching and disappeared 4 hours after hatching, were also a transient type of cells, with an existence period of 9 hours. (3) The head portion of Artemia embryo is probably the initial position of HE secretion, and likely to be the main position of HE secretion as well. The detailed process and mechanism need to be studied. (4) The appearance of HGCs is in a synchronous mode from places all over the embryos, and their disappearance is also in a synchronous mode. (5) The number of HGCs increased gradually along with embryo development process and reached a maximum number at hatching. Contrarily, the number of HGCs decreased gradually after hatching, and HGCs disappeared 5 hours after hatching. However, the intensity of HE-positive reaction was almost at the same level at the period of HGCs'presence. (6) Artemia HGCs were distributed throughout the body of embryos at all time during their presence. Therefore, it can concluded that Artemia HGCs, as a transient type of cells, first appeared in embryos 4 hours before hatching and disappeared in embryos 5 hours after hatching, and with distinguished patterns of appearance, disappearance and

  8. Aplicación del permanganato potásico para la eliminación de cianuros de cobre en aguas residuales de la planta de lixiviación en una mina de oro (I

    Directory of Open Access Journals (Sweden)

    Sancho, J. P.

    2009-12-01

    Full Text Available The use of cyanide in the hydrometallurgical and chemical industries has led to the emergence of a major environmental problem due to its high toxicity. The wastewater generated at these plants is hazardous to the environment and therefore must be managed properly. For this purpose, they undergo detoxification processes after lodes from the plant are accumulated in waste-resistant containment ponds that mast be waterproof to prevent environmental disasters from leakages or massive flood. This work shows the results obtained in laboratory tests carried out with plant waters and demonstrates the efficacy of potassium permanganate as an oxidant of cyanide wastewater from a gold hydrometallurgical plant. In the process the destruction of the copper cyanide complexes in solution is achieved and copper metal ions are eliminated through precipitation mostly as hydroxide.

    La utilización de cianuro en las industrias químicas e hidrometalúrgicas ha supuesto la aparición de un importante problema medioambiental debido a su elevada toxicidad. Las aguas residuales generadas en estas empresas resultan peligrosas para el medio ambiente por lo que deben de ser gestionadas adecuadamente. Para ello, se tratan con procesos de detoxificación y se acumulan en balsas de contención impermeabilizadas donde pueden ser causa de desastres medioambientales. En este trabajo se presentan los resultados obtenidos en ensayos realizados en laboratorio y que demuestran la eficacia del permanganato potásico como agente oxidante de aguas residuales cianuradas, procedentes de una planta hidrometalúrgica de oro. En el proceso desarrollado se consigue la destrucción de los complejos cianurados de cobre presentes en solución y la posterior eliminación del metal por precipitación como hidróxido.

  9. Adaptación y monitoreo de microorganismos en procesos de nitrificación en aguas residuales de la industria petrolera Adaptation and monitoring of microorganisms in petroleum industry wastewater nitrification processes

    Directory of Open Access Journals (Sweden)

    Díaz M.

    1998-12-01

    Full Text Available

    La remoción biológica de nitrógeno amoniacal se lleva a cabo en dos etapas sucesivas, la nitrificación y la desnitrificación. La nitrificación se estudió en un grupo de microorganismos aislados a partir de diferentes fuentes acuíferas: una ciénaga eutrificada y aguas residuales procedentes de dos plantas de tratamiento; una de tipo petroquímico y otra de origen doméstico. Los microorganismos se evaluaron en condiciones oxigénicas a 305K en un sistema semicontinuo. Se comprobó la buena adaptación de los microorganismos en aguas residuales de origen petroquímico en procesos de remoción de nitrógeno amoniacal.

    Biological removal of ammonia nitrogen is carried out in two successive stages, nitrification and denitrification. This work studied the nitrification process on microorganisms isolated from different aquifer sources: a eutrophicate pond and residual waters from two treatment plants (petrochemical and domestic

  10. TOXIC ACTIVITIES OF HEXANE EXTRACT AND COLUMN CHROMATOGRAPHY FRACTIONS OF RODENT TUBER PLANT (Typhonium flagelliforme Lodd. ON Artemia salina

    Directory of Open Access Journals (Sweden)

    Nesti F. Sianipar

    2013-04-01

    Full Text Available Rodent tuber (Typhonium flagelliforme Lodd. is a medicinal plant  particularly found in Java. The plant is used as an ingredient for  conventional cancer treatment. The aim of this study was to determine the toxic activities of crude extracts and column chromatography fractions of  rodent tuber on Artemia salina larvae. Rodent tuber plant was obtained  from the Indonesian Spice and Medicinal Crops Research Institute in  Bogor, West Java. The experiment was conducted in the Biology  Laboratory of Universitas Pelita Harapan, Tangerang, Banten. Leaves and petioles of the plant were macerated with acetone and the filtrates were evaporated (40°C to obtain crude extracts. The crude extracts were partitioned with ethyl acetate, followed with hexane, chloroform and  butanol. Toxicity test of the extracts was performed using the Brine Shrimp Lethality Test (BSLT method on A. salina larvae. Extract showing the most toxic was fractioned using column chromatography and then tested on the larvae. The experiment was designed in a completely randomized  factorial, four replicates for crude extracts and two replicates for the fractions. Treatments were different types of extracts (hexane, chloroform and butanol at various concentrations (500, 1,000 and 1,500 μg ml-1 of 5% Tween solution. Fractions of the column chromatography used were taken from the column number 1, 3 and 10, and tested their toxicities at 200, 400, 600, 800 and 1,000 μg ml-1 of 5% Tween solution. Parameters observed were the death of A. salina expressed as LC50. The study  showed that hexane extract of the petioles had the most toxic to A. salina (LC50 = 762.08 μg ml-1. Fraction number 10 showed the highest toxic (LC50 = 381.07 μg ml-1, whereas the lowest was fraction number 3 (LC50 = 653.13 μg ml-1. The study indicates that rodent tuber plant from Bogor is toxic to A. salina and further test for its cytotoxic activity is justified.

  11. 75 FR 21034 - Notice of Availability of Record of Decision for the Agua Fria National Monument and Bradshaw...

    Science.gov (United States)

    2010-04-22

    ... Bureau of Land Management Notice of Availability of Record of Decision for the Agua Fria National... Agua Fria National Monument and Bradshaw-Harquahala Planning Area, located in central Arizona. The... occupied or used portions of the planning area during prehistoric or historic times. The Agua Fria...

  12. Aplicación del permanganato potásico para la eliminación de cianuros de cobre en aguas residuales de la planta de lixiviación en una mina de oro (II: Ensayos en planta piloto

    Directory of Open Access Journals (Sweden)

    Sancho, J. P.

    2011-06-01

    Full Text Available The search for a detoxification treatment of the wastewater generated during industrial processes, has been a constant for all companies in general and for gold mining in particular, whose wastewater generally contains high concentrations of cyanide compounds with high toxicity. In the previous research work, developed in the laboratory, the efficacy of potassium permanganate as an oxidizing agent for cyanidic wastewater, from a gold hydrometallurgical plant, has been demonstrated, achieving the destruction of copper cyanide complexes present in solution and the subsequent metal removal by precipitation as hydroxide. This paper presents the conclusions obtained after the implementation of the process developed in the laboratory, at pilot-plant scale.

    La búsqueda de un tratamiento que permita la detoxificación de las aguas residuales generadas durante los procesos industriales, ha sido una constante para todas las empresas en general y para las explotaciones mineras auríferas en particular, cuyas aguas residuales suelen contener elevadas concentraciones de compuestos cianurados con una elevada toxicidad. En el trabajo de investigación previo, desarrollado en el laboratorio, se demostró la eficacia del permanganato potásico como agente oxidante de aguas residuales cianuradas, procedentes de una planta hidrometalúrgica de oro, consiguiendo la destrucción de los complejos cianurados de cobre presentes en solución y la posterior eliminación del metal por precipitación como hidróxido. En este trabajo se presentan las conclusiones obtenidas tras la implantación del proceso desarrollado en el laboratorio, a escala de planta piloto.

  13. Effects of Light and Temperature on Fatty Acid Production in Nannochloropsis Salina

    Energy Technology Data Exchange (ETDEWEB)

    Van Wagenen, Jonathan M.; Miller, Tyler W.; Hobbs, Samuel J.; Hook, Paul W.; Crowe, Braden J.; Huesemann, Michael H.

    2012-03-12

    Accurate prediction of algal biofuel yield will require empirical determination of physiological responses to the climate, particularly light and temperature. One strain of interest, Nannochloropsis salina, was subjected to ranges of light intensity (5-850 {mu}mol m{sup -2} s{sup -1}) and temperature (13-40 C); exponential growth rate, total fatty acids (TFA) and fatty acid composition were measured. The maximum acclimated growth rate was 1.3 day{sup -1} at 23 C and 250 {mu}mol m{sup -2} s{sup -1}. Fatty acids were detected by gas chromatography with flame ionization detection (GC-FID) after transesterification to corresponding fatty acid methyl esters (FAME). A sharp increase in TFA containing elevated palmitic acid (C16:0) and palmitoleic acid (C16:1) during exponential growth at high light was observed, indicating likely triacylglycerol accumulation due to photo-oxidative stress. Lower light resulted in increases in the relative abundance of unsaturated fatty acids; in thin cultures, increases were observed in palmitoleic and eicosapentaenoeic acids (C20:5{omega}3). As cultures aged and the effective light intensity per cell converged to very low levels, fatty acid profiles became more similar and there was a notable increase of oleic acid (C18:1{omega}9). The amount of unsaturated fatty acids was inversely proportional to temperature, demonstrating physiological adaptations to increase membrane fluidity. This data will improve prediction of fatty acid characteristics and yields relevant to biofuel production.

  14. Growth and pigment development of Dunaliella salina Teod. in response to ammonium nitrate nutrition

    Directory of Open Access Journals (Sweden)

    Keramatollah Nikookar

    2013-09-01

    Full Text Available The microalgae, Dunaliella salina was isolated from Maharlu Salt Lake, south east of Shiraz, Iran. The isolated strain was identified by both morphological and physiological markers. The complete ITS region (ITS1 + ITS2 including the 5.8S rDNA gene used as molecular marker confirmed our identification. Growth and cell proliferation, total chlorophyll and carotenoid contents were determined in the presence of 0.125, 0.25, 0.50, 1.0 and 2.0 mM ammonium nitrate. After five weeks, a maximum cell density of about (4.4 ±0.21×106 mL-1 was observed in the growth medium containing 1mM NH4NO3. Increasing NH4NO3 concentrations up to 1mM, resulted in an increase in the cells total chlorophyll contents. The highest amount of cell carotenoid contents was produced in media containing the least amount of NH4NO3 (0.125 mM. Manipulating the type and amount of external nitrogen sources to induce the synthesis of the highest amounts of carotenoid compounds in this microalgae strain can be of great commercial values to food industries.

  15. Effects of Light and Temperature on Fatty Acid Production in Nannochloropsis Salina

    Directory of Open Access Journals (Sweden)

    Braden Crowe

    2012-03-01

    Full Text Available Accurate prediction of algal biofuel yield will require empirical determination of physiological responses to the environment, particularly light and temperature. One strain of interest, Nannochloropsis salina, was subjected to ranges of light intensity (5–850 μmol m−2 s−1 and temperature (13–40 °C and its exponential growth rate, total fatty acids (TFA and fatty acid composition were measured. The maximum acclimated growth rate was 1.3 day−1 at 23 °C and 250 μmol m−2 s−1. Fatty acids were detected by gas chromatography with flame ionization detection (GC-FID after transesterification to corresponding fatty acid methyl esters (FAMEs. A sharp increase in TFA containing elevated palmitic acid (C16:0 and palmitoleic acid (C16:1 during exponential growth at high light was observed, indicating likely triacylglycerol accumulation due to photo-oxidative stress. Lower light resulted in increases in the relative abundance of unsaturated fatty acids; in thin cultures, increases were observed in palmitoleic and eicosapentaenoic acids (C20:5ω3. As cultures aged and the effective light intensity per cell converged to very low levels, fatty acid profiles became more similar and there was a notable increase of oleic acid (C18:1ω9. The amount of unsaturated fatty acids was inversely proportional to temperature, demonstrating physiological adaptations to increase membrane fluidity. These data will improve prediction of fatty acid characteristics and yields relevant to biofuel production.

  16. Un carnaval para el yo lésbico: Los cuentos de Gilda Salinas

    Directory of Open Access Journals (Sweden)

    Elena Madrigal

    2011-01-01

    Full Text Available Gilda Salinas rompe las unidades cuentísticas tradicionales al hacer de cada texto de Del destete al desempance. Cuentos lésbicos y un colado un episodio en la vida de una lesbiana que, con “voz propia”, narra sus peripecias nocturnas por la ciudad de México, de los años setenta a la actualidad. Al ubicar las acciones en sitios de diversión lésbica que no existen más, la voz, cual cronista, rescata un ámbito de la vida homosexual a la vez que fija bromas y códigos lingüísticos que por su origen oral hubieran corrido el riesgo de perderse con las generaciones que los animaron. Sus estrategias carnavalizan el tema lésbico a la vez que legitiman la validez de las búsquedas expresivas y de comportamiento del ser lesbiana en un tiempo y en un lugar. Su aportación en los planos del género literario y de la formación de constantes en la narrativa homosexual mexicana indudablemente enriquece los medios expresivos, la visibilidad, la diversidad, las vidas y las historias de la y las lesbianas.

  17. Characterization of the fatty acid composition of Nannochloropsis salina as a determinant of biodiesel properties

    Energy Technology Data Exchange (ETDEWEB)

    Mohammady, Nagwa Gamal-EIDin [Alexandria Univ, Alexandria (Egypt). Dept. of Botany and Microbiology

    2011-07-15

    Nannochloropsis salina was cultured batch-wise to evaluate the potential of the alga to produce biodiesel. The cells were harvested at the end of the exponential growth phase when the concentration was 18 . 10{sup 6} cells/mL culture. The growth estimated as dry weight from this cell number was (3.8 {+-} 0.7) mg/L. The lipid and triglyceride contents were 40% and 12% on a dry weight basis, respectively. The amount of the ratio triglycerides/total lipids was approximately 0.3. The composition of triglyceride fatty acid methyl esters (biodiesel) was analysed by gasliquid chromatography and identified as: C14:0, C16:0, C16:1, C18:0, C18:1, C18:2, C18:3, C20:1, and C20:5. The ratio of unsaturated to saturated fatty acid contents was approximately 4.4. Additionally, the characterization of each individual fatty acid ester was discussed with regard to the fuel properties of biodiesel produced by the alga.

  18. Synthesis and coating of nanosilver by vanillic acid and its effects on Dunaliella salina Teod.

    Directory of Open Access Journals (Sweden)

    Hajar Zamani

    2013-09-01

    Full Text Available Plant phenolics have high reducing capacity which can be exploited in the synthesis of nanomaterials. In the present study, phytoreductant vanillic acid is used to produce and coat silver nanoparticles. The effects of Ag nanoparticles on the unicellular green algae D. Salina were then investigated. Under optimum pH and temperature, silver ions were reduced to silver metal by vanillic acid. The absorption spectra of the silver nanoparticles showed a maximum band of 410 nm, which is characteristic of the surface plasmon resonance of silver nanoparticles. Dynamic light scattering (DLS showed a narrow distribution size with an average of 52 nm. High concentrations of Ag nanoparticles reduced growth, total carotenoids, chlorophyll content, phenolics and antioxidant activity of the algae. Based on these results, phytoreductant vanillic acid can be used for synthesis and coating of nanosilver. Due to the projected increase in quantities and types of nanomaterials which leads to their elevated release into the environment and also because of the toxicity of nanomaterials, an urgent need to evaluate the impacts of nano-sized particles on the environment and living organisms is felt.

  19. The Rhodomonas salina mitochondrial genome: bacteria-like operons, compact gene arrangement and complex repeat region.

    Science.gov (United States)

    Hauth, Amy M; Maier, Uwe G; Lang, B Franz; Burger, Gertraud

    2005-01-01

    To gain insight into the mitochondrial genome structure and gene content of a putatively ancestral group of eukaryotes, the cryptophytes, we sequenced the complete mitochondrial DNA of Rhodomonas salina. The 48 063 bp circular-mapping molecule codes for 2 rRNAs, 27 tRNAs and 40 proteins including 23 components of oxidative phosphorylation, 15 ribosomal proteins and two subunits of tat translocase. One potential protein (ORF161) is without assigned function. Only two introns occur in the genome; both are present within cox1 belong to group II and contain RT open reading frames. Primitive genome features include bacteria-like rRNAs and tRNAs, ribosomal protein genes organized in large clusters resembling bacterial operons and the presence of the otherwise rare genes such as rps1 and tatA. The highly compact gene organization contrasts with the presence of a 4.7 kb long, repeat-containing intergenic region. Repeat motifs approximately 40-700 bp long occur up to 31 times, forming a complex repeat structure. Tandem repeats are the major arrangement but the region also includes a large, approximately 3 kb, inverted repeat and several potentially stable approximately 40-80 bp long hairpin structures. We provide evidence that the large repeat region is involved in replication and transcription initiation, predict a promoter motif that occurs in three locations and discuss two likely scenarios of how this highly structured repeat region might have evolved.

  20. Analyzing the movement of the Nauplius 'Artemia salina' by optical tracking of plasmonic nanoparticles.

    Science.gov (United States)

    Kirchner, Silke R; Fedoruk, Michael; Lohmüller, Theobald; Feldmann, Jochen

    2014-07-15

    We demonstrate how optical tweezers may provide a sensitive tool to analyze the fluidic vibrations generated by the movement of small aquatic organisms. A single gold nanoparticle held by an optical tweezer is used as a sensor to quantify the rhythmic motion of a Nauplius larva (Artemia salina) in a water sample. This is achieved by monitoring the time dependent displacement of the trapped nanoparticle as a consequence of the Nauplius activity. A Fourier analysis of the nanoparticle's position then yields a frequency spectrum that is characteristic to the motion of the observed species. This experiment demonstrates the capability of this method to measure and characterize the activity of small aquatic larvae without the requirement to observe them directly and to gain information about the position of the larvae with respect to the trapped particle. Overall, this approach could give an insight on the vitality of certain species found in an aquatic ecosystem and could expand the range of conventional methods for analyzing water samples.

  1. Comparative evaluation of short-term toxicity of inorganic arsenic compounds on Artemia salina.

    Science.gov (United States)

    GuŢu, Claudia Maria; Olaru, Octavian Tudorel; Purdel, Nicoleta Carmen; Ilie, Mihaela; NeamŢu, Marius Cristian; Dănciulescu Miulescu, Rucsandra; Avramescu, Elena Taina; Margină, Denisa Marilena

    2015-01-01

    The study aimed to assess the short-term effects exerted by two inorganic arsenic species (arsenite and arsenate) on Artemia salina after 24, 48 and 72 h. The dose-lethality curves obtained indicate that the lethality induced by arsenite was higher than by arsenate. The lowest observed effect concentration for arsenite (0.5 μg/mL) is similar with the no observed effect concentration for arsenate, thus indicating that the toxicity of arsenite is higher compared with arsenate. Also, the lethal concentration 50 values confirm that arsenite induced about 1.24-fold higher toxicity than arsenate at 24 h and about three-fold higher toxicity at 48 h and 72 h of exposure. Both LC50 (lethal concentration 50) values are indicating negligible effects exhibited by arsenic at this trophic level after short-term exposure. The predicted no effect concentration in the surface aquatic compartment corresponds to 10.38 μg/L, similar to the limit imposed by Directive 98/83/EC.

  2. Toxicity assessment of fumonisins using the brine shrimp (Artemia salina) bioassay.

    Science.gov (United States)

    Hartl, M; Humpf, H U

    2000-12-01

    The Fusarium mycotoxins fumonisin B(1) (FB(1)) (1) and B(2) (FB(2)) (2), their hydrolysed analogues HFB(1) (3) and HFB(2) (4) and the recently discovered fumonisin derivatives N-palmitoyl-HFB(1) (5) and N-carboxymethyl-FB(1) (6) were compared for their toxicity in a short term bioassay using brine shrimp (Artemia salina). The brine shrimp were hatched in artificial sea water and exposed to the fumonisins in microwell plates with a mortality endpoint after 48 hours. LC(50) values were calculated after Probit transformation of the resulting data. Of the substances tested, fumonisin B(1) emerged to be the most toxic whereas its N-carboxymethyl analogue was 100-fold less effective. The hydrolysed fumonisins showed a four- to sixfold reduced toxicity compared to FB(1). N-Palmitoyl-HFB(1) had a higher LC(50) value than its precursor HFB(1). The brine shrimp assay proved to be a convenient and rapid system for toxicity assessment of this group of mycotoxins.

  3. Artemia salina as test organism for assessment of acute toxicity of leachate water from landfills.

    Science.gov (United States)

    Svensson, B M; Mathiasson, L; Mårtensson, L; Bergström, S

    2005-03-01

    Artemia salina has, for the first time, been used as test organism for acute toxicity of leachate water from three landfills (the municipal landfills at Kristianstad, Sweden and Siauliai, Lithuania, and an industrial landfill at Stena fragmenting AB, Halmstad, as well as for leachate from Kristianstad treated in different ways in a pilot plan). Artemia can tolerate the high concentrations of chloride ions found in such waters. Large differences in toxicities were found, the leachate from Siauliai being the most toxic one. To increase the selectivity in the measurements, a fractionation was done by using ion exchange to separate ammonium/ammonia and metal ions from the leachate, and activated carbon adsorbents for organic pollutants. The influence of some metals and phenol compounds on the toxicity was investigated separately. It was found that most of the toxicity emanated from the ammonium/ammonia components in the leachate. However, there was also a significant contribution n from organic pollutants, other than phenol compounds, since separate experiments had in this latter case indicated negligible impact. The concentrations of metals were at a level, shown by separate experiments, where only small contribution to the toxicity could be expected.

  4. Purification and characterization of hatching enzyme from brine shrimp Artemia salina.

    Science.gov (United States)

    Fan, Tingjun; Wang, Jing; Yuan, Wenpeng; Zhong, Qiwang; Shi, Ying; Cong, Rishan

    2010-02-01

    By using Artemia chorion as a specific substrate, the hatching enzyme from Artemia salina (AHE) was purified by gel-filtration and ion-exchange chromatography, and characterized biochemically and enzymatically in this study. It was found that the AHE had a molecular weight of 82.2 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and often contained 73.3 kDa molecules in preparation. The AHE had obvious choriolytic activity, which was optimal at pH 7.0 and a temperature of 408C. The Km value of the AHE for dimethyl casein was 8.20 mg/ml. The AHE activity was almost completely inhibited by soybean trypsin inhibitor and p-amidinophenyl methane sulfonyl fluoride hydrochloride, greatly inhibited by N-tosyl-L-lysyl chloromethyl ketone, phenylmethanesulfonyl fluoride, and lima bean trypsin inhibitor, slightly inhibited by pepstatin, N-tosyl-L-phenylalanyl chloromethyl ketone, leupeptin, N-ethylmaleimide, and iodoacetamide, and not inhibited by chymostatin and bestatin. All these results imply that AHE is most probably a trypsin-type serine protease. Besides of these, AHE was also sensitive to EDTA and Zn21. Combined with the results that the EDTA-pre-treated HE activity could be perfectly recovered by Zn21, it is indicated that AHE might be also a kind of Zn-metalloprotease.

  5. Toxicity of four antifouling biocides and their mixtures on the brine shrimp Artemia salina.

    Science.gov (United States)

    Koutsaftis, A; Aoyama, I

    2007-11-15

    Zinc pyrithione (ZPT), Copper pyrihione (CPT), Chlorothalonil and Diuron are four of the most widely used as alternative to tributlytin (TBT) antifouling biocides in boat paints. As most previous laboratory bioassays for these biocides have been conducted solely based on acute tests with a single compound, information on the possible combined toxicity of these common biocides to marine organisms are limited. In this study, the toxicity of binary (in several proportions), ternary and quaternary mixtures were evaluated using the brine shrimp Artemia salina as test organism. Mixture toxicities were studied using the concentration addition model (isobolograms and toxic unit summation), and the mixture toxicity index (MTI). The ZPT-CPT combination had a strictly synergistic effect which requires attention because the coexistence of ZPT and CPT in the marine environment, due to transchelation of ZPT, may occur. The binary mixtures of Diuron with the metal pyrithiones exhibited various interactive effects (synergistic, antagonistic or additive) depending on concentration ratios, whereas all binary mixtures that contained Chlorothalonil exhibited antagonistic effects. The different types of combined effects subsequent to proportion variation of binary mixtures underline the importance of the combined toxicity characterization for various ratios of concentrations. The four ternary mixtures tested, also exhibited various interactive effects, and the quaternary mixture exhibited synergism. The models applied were in agreement in most cases. The observed synergistic interactions underline the requirement to review water quality guidelines, which are likely underestimating the adverse combined effects of these chemicals.

  6. Tolerance to cadmium and cadmium-binding ligands in Great Salt Lake brine shrimp (Artemia salina)

    Energy Technology Data Exchange (ETDEWEB)

    Jayasekara, S.; Drown, D.B.; Sharma, R.P.

    1986-02-01

    Information on the accumulation of cadmium in cytosolic proteins of Great Lake brine shrimp (Artemia salina) was obtained from animals collected directly from the lake and also from animal hatched and maintained in three sublethal concentrations of cadmium (0.5, 2.0, 5.0 ppm) in saltwater aquaria. Brine shrimp growth under these conditions was monitored by measuring body lengths during a 7-day exposure period. Heat-stable, cadmium-binding ligands were isolated and identified by Sephadex G-75 chromatography and atomic absorption spectrophotometry. Cadmium was found to be equally distributed between high and low molecular weight proteins in animals collected from the lake and the 0.5 ppm cadmium group. There was also a slight growth stimulation noted in the 0.5-pm group. Higher cadmium incorporation was noted in low molecular weight fractions with increasing cadmium concentration in the exposure media. Low molecular weight fractions were also found to have high uv absorption characteristics at 250 nm and low absorption at 280 nm. Molecular weight of the cadmium-binding ligands was found to be 11,000 as estimated by the gel filtration method. De novo synthesis of this protein was increased as a function of cadmium concentration in the media. However, slow accumulation of cadmium in other protein fractions was also noticed in higher cadmium exposure groups, suggesting the existence of possible tolerance mechanisms in brine shrimp exposed to suspected acute cadmium concentrations.

  7. LOCALIZACIÓN Y AFECTACIÓN DE COSTES MEDIOAMBIENTALES Y NO MEDIOAMBIENTALES EN LAS EMPRESAS DE AGUAS: EL COSTE DEL AGUA DESALADA

    Directory of Open Access Journals (Sweden)

    Jerónimo Pérez Alemán

    2005-12-01

    Full Text Available La Directiva 2000/60/EC del Parlamento Europeo y del Consejo establece un marco de acción comunitaria en el ámbito de la política de aguas. Esta norma indica, en su artículo 9, que los miembros de los Estados tendrán en cuenta el principio de recuperación de los costes de los servicios de aguas, incluidos los medioambientales. Así pues, las empresas de tratamiento y abastecimiento urbano de aguas tienen la necesidad de generar información sobre los costes en general, y sobre los costes (y otras magnitudes medioambientales en particular. En el presente trabajo centramos nuestra atención en el coste de uno de los outputs de tales empresas: el agua desalada.

  8. Siete lecciones de la experiencia de Chile en materia de mercados del agua

    OpenAIRE

    Dourojeanni, Axel; Jouraviev, Andrei

    2001-01-01

    A principios de la década de los ochenta, Chile adoptó un nuevo Código de Aguas cuyo objeto central fue fortalecer la propiedad privada, limitar el rol del Estado en la gestión del agua y generar un mercado del agua bajo el supuesto de que ello promovería la inversión privada y llevaría a la eficiencia en la asignación del agua. Estas reformas, especialmente las tendentes a la creación de un mercado del agua, han despertado gran interés en todo el mundo. En algunos países, los anteproyectos d...

  9. Acuaporinas: proteínas mediadoras del transporte de agua.

    Directory of Open Access Journals (Sweden)

    Julio César Sánchez

    2009-11-01

    Full Text Available Introducción. Todos los organismos vivos están compuestos en su mayoría por agua, siendo ésta fundamental para la homeostasis celular a todo nivel. Por esta razón su transporte a través de las membranas biológicas ha sido siempre un campo de gran interés en la fisiología. La investigación acerca de este tópico se ha incrementado notablemente en los últimos años a partir del descubrimiento de las acuaporinas, las cuales han permitido comprender mejor los mecanismos que la célula utiliza para el control de los flujos de agua a través de la membrana y por ende, la regulación de su osmolaridad interna. Tema general. Hasta el momento se han descrito 11 subtipos de acuaporinas (AQP0-10, las cuales comparten similitudes estructurales y se han relacionado con una gran diversidad de enfermedades en diversos sistemas, desde cataratas hasta diabetes insípida. Objetivo. Se presenta una visión del estado actual del conocimiento acerca de estas importantes proteínas y su relación con diversos procesos fisiológicos y patológicos. Conclusiones. Las acuaporinas son proteínas mediadoras del transporte de agua y las alteraciones en su funcionamiento pueden conducir a una gran diversidad de enfermedades, por lo cual deben ser un objeto prioritario de investigación en el futuro próximo para ayudar a comprender mejor su fisiopatología.

  10. La fundamentalidad del derecho al agua en Colombia

    Directory of Open Access Journals (Sweden)

    Mies Sutorius

    2015-12-01

    Full Text Available El agua es un recurso natural finito de vital importancia para el ser humano, lo que explica que con el paso del tiempo se busque con mayor fuerza su protección, no solo en el ámbito internacional sino también en el orden jurídico interno. De ahí el interés en realizar una revisión normativa y especialmente jurisprudencial que permita evidenciar la evolución del derecho al agua, los matices y las diversas formas de protección del mismo, profundizando en su dimensión personal. La Constitución Política colombiana omite enunciar el derecho al agua como derecho individual, razón por la cual se procede a estudiar la jurisprudencia constitucional, seleccionándose algunas sentencias en donde existen sujetos de especial protección, en tanto al reconocerse a estos la vulneración y garantía de derechos se prevé la protección de los derechos del resto de la población; así como algunos casos en donde existen condiciones particulares, a partir de la suspensión del servicio por falta de pago a la empresa encargada del suministro, conexión fraudulenta y reconexión ilegal; para concluir que se han presentado dos tendencias en el amparo de este derecho, que ha pasado de ser protegido por vía de la “teoría de la conexidad” a ser catalogado como fundamental con una tutela restringida a la cantidad mínima necesaria para sobrevivir.

  11. Hormigón en aguas y terrenos agresivos

    Directory of Open Access Journals (Sweden)

    García de Paredes y Gaibrois, Pablo

    1962-09-01

    Full Text Available Not availableEl Dr. Ingeniero H. J. Wierig, del Laboratorio de la Industria del Cemento de Westfalia, ha publicado, en la revista «Bau und Bauindustrie» (núm. 6 de 1961, un interesante artículo acerca de la Preparación del hormigón en aguas y suelos agresivos, de~ cual entresacamos las siguientes notas con la complacencia que supone encontrar totalmente coincidentes, las opiniones del Dr. Wierig con el contenido de las «Recomendaciones» publicadas en la Instrucción sobre hormigón armado H. A. 61 de este Instituto.

  12. CAMPANA DE AGUA [Material gráfico

    OpenAIRE

    1990-01-01

    Antiguedad: SIGLO XIX CAMPANA HECHA EN PIEDRA Y CAL DE UNOS 3 METROS DE DIAMETRO Y 15 DE PROFUNDIDAD. LA ENTRADA ES DE FORMACUADRADA CON UNAS DIMSENSIONES DE UN METRO POR UN METRO. Calificación del suelo: RÚSTICO DE PROTECCIÓN HIDROLÓGICA Clasificación del suelo: RÚSTICO Declaración BIC:No ES PRECEPTIVO RECUPERAR EL CANAL DE CAPTACIÓN Y EXTRACCIÓN DE AGUA, PARA LO QUE SE HACE NECESARIO UTILIZAR METODOLOGÍA ARQUEOLÓGICA.LAS CAMPANAS DEL CAUCE DEL BARRANCO DE TELDE HAN ENTRADO E...

  13. Control de ph para planta de tratamiento de aguas residuales

    OpenAIRE

    Wilson Fabián Amaya; Óscar Alberto Cañón; Óscar F. Avilés

    2004-01-01

    En este trabajo se presenta el problema de controlar el pH en una planta de tratamiento de aguas residuales (PTAR), la cual recibe soluciones ácidas provenientes de la producción de jugos (pH 2-5) que se dosifica con la sustancia usada para aseo (soda cáustica 0.04%) con valores oscilatorios de pH 9-11. Se desarrolló e implementó un controlador clásico PI en un PLC comercial y se automatiza la PTAR mostrando el resultado obtenido en simulación en MatLAB.

  14. Control de ph para planta de tratamiento de aguas residuales

    Directory of Open Access Journals (Sweden)

    Wilson Fabián Amaya

    2004-01-01

    Full Text Available En este trabajo se presenta el problema de controlar el pH en una planta de tratamiento de aguas residuales (PTAR, la cual recibe soluciones ácidas provenientes de la producción de jugos (pH 2-5 que se dosifica con la sustancia usada para aseo (soda cáustica 0.04% con valores oscilatorios de pH 9-11. Se desarrolló e implementó un controlador clásico PI en un PLC comercial y se automatiza la PTAR mostrando el resultado obtenido en simulación en MatLAB.

  15. Agua de lastre y especies exóticas

    OpenAIRE

    Correa, N; Almada, P.S.

    2013-01-01

    El agua que los navíos embarcan como lastre cuando deben atravesar el océano sin carga suele contener organismos vivos. Al ser descargada aquella, estos ingresan en un medio al que son ajenos y pueden convertirse en plagas y en muchos casos originan serios trastornos ambientales. Los organismos descargados son especies exóticas. Se muestra un estudio en 5 puertos argentinos (océano Atlántico sudoccidental), formas de mitigar los trastornos y el estado de la situación actual de la problemática...

  16. EFECTOS COOPERATIVOS EN HETEROTETRÁMEROS (ETANOL3-AGUA

    Directory of Open Access Journals (Sweden)

    Sol M. Mejía

    2009-06-01

    Full Text Available La teoría de funcionales de la densidad (DFT: B3LYP/6-31+G(d fue empleada para la optimización de agregados estables sobre la superficie de energía potencial de los heterotetrámeros (etanol3-agua.  Las energías de tetramerización pueden llegar a valores hasta de −21,00 kcal/mol.  Esta energía no se puede obtener considerando solo contribuciones de interacciones entre dos moléculas del agregado, lo cual sugiere la presencia de efectos cooperativos globales (positivos.  Tales efectos son reflejados en distancias menores de los puentes de hidrógeno y distancias menores oxígeno-oxígeno, lo mismo que en elongaciones mayores del enlace O-H en la molécula dadora de protón con un corrimiento hacia el rojo mayor en los heterotetrámeros comparado con los heterodímeros de etanol-agua y el dímero de etanol.  La mayor cooperatividad fue observada en los cuatro puentes de hidrógeno dispuestos en el patrón geométrico cíclico más grande posible, actuando todas las moléculas como aceptoras y dadoras de protón simultáneamente.  Un análisis similar al de la caracterización de heterotetrámeros de (etanol3-agua se llevó a cabo para los heterotetrámeros  (metanol3-agua y tetrámeros de etanol y metanol.  La comparación de estos valores mostró que existe una gran similitud entre todos los parámetros analizados para agregados con el mismo patrón geométrico.  

  17. Ejercicio de autoevaluación sobre alcalinidad en agua.

    OpenAIRE

    Milla González, Miguel

    2011-01-01

    El ejercicio de autoevaluación contiene 12 cuestiones de entrada múltiple que pueden responderse por páginas (en este caso la corrección es página a página) o de forma global (la calificación se obtiene al finalizar el test). Se pueden hacer correcciones en las dos modalidades antes de obtener la calificación del ejercicio. Las cuestiones tratan sobre la determinación ácido-base de la alcalinidad del agua.

  18. Gente de agua: Comunidades negras en el Bajo Atrato

    Directory of Open Access Journals (Sweden)

    Daniel Ruíz Serna

    2010-05-01

    Full Text Available “Gente de agua” es un conjunto de imágenes sobre el universo social de las comunidades negras del Bajo Atrato chocoano. Ilustra de forma sensible el sistema de texturas de la vida negra en el río. Desde las pieles brillantes bajo el sol, pasando por todos los colores del agua, hasta la ignominiosa condena del racismo y la exclusión son objeto del lente del etnógrafo que ha encontrado en las imágenes una opción para hacer antropología.

  19. Diseño preliminar evaporador de agua dulce

    OpenAIRE

    Escudero Puente, Pablo

    2014-01-01

    En el presente proyecto se diseña un evaporador del tipo sumergido que aprovecha la energía térmica del motor propulsor de una embarcación de recreo. El evaporador diseñado trata de ser competitivo dentro del mercado existente de instalaciones de generación de agua dulce para embarcaciones de recreo, monopolizado en la actualidad por plantas de desalinización por ósmosis inversa. Durante el proyecto se desarrolla el diseño de un prototipo de baja potencia y alimentado eléctr...

  20. Estudio del mecanismo de falla de terraplenes debido a la infiltración de aguas lluvias mediante el monitoreo de presiones de poros y contenidos de agua

    Directory of Open Access Journals (Sweden)

    EDWIN GARCÍA

    2007-01-01

    Full Text Available El presente artículo muestra experimentos realizados utilizando modelos a escala para estudiar el proceso de infiltración en terraplenes sometidos a aguas lluvias. Varios modelos a escala fueron construidos usando un suelo arenoso con alto contenido de finos; para aplicar la lluvia artificial y observar el proceso de infiltración del agua se utilizó un tubo de irrigación. Para monitorear los cambios en succión ocasionados por los ciclos de humedecimiento y secado se instalaron dentro del suelo varios sensores de presión de poros, contenido de agua y de desplazamiento en diferentes puntos. El cambio de la presión de poros en el tiempo, el contenido de agua y las relaciones entre las mediciones de presión de poros y desplazamientos del suelo son presentados. Este estudio muestra que el movimiento del suelo en un talud está directamente relacionado con el contenido de agua del suelo y las presiones de poros existentes en él, sugiriendo que por medio del monitoreo de estos dos parámetros es posible predecir fallas locales inducidas por infiltración de aguas lluvias en los taludes.

  1. Thorium mobilization in groundwaters from Aguas da Prata, Sao Paulo state; Mobilizacao de torio em aguas subterraneas de Aguas da Prata, estado de Sao Paulo

    Energy Technology Data Exchange (ETDEWEB)

    Tonetto, Erica Martini [Universidade Estadual Paulista (UNESP), Rio Claro, SP (Brazil). Area de Concentracao Geociencias e Meio Ambiente. Pos-Graduacao em Geociencias]. E-mail: etonetto@rc.unesp.br; Bonotto, Daniel Marcos [Universidade Estadual Paulista (UNESP), Rio Claro, SP (Brazil). Dept. de Petrologia e Metalogenia]. E-mail: dbonotto@rc.unesp.br

    2002-09-15

    The paper describes and discusses results of the determination, by alpha spectrometry, of the natural thorium isotopes in groundwaters associated with different rock types in Aguas da Prata spa, state of Sao Paulo. The dissolved Thorium is relatively low (0.003 to 1.72 mg.L{sup -1} for {sup 232}Th), while the {sup 22}'8Th/{sup 232}Th isotopic ratios for dissolved thorium were higher than unity (1.8 to 34). The thorium concentration in suspended solids of these waters ranged between 183 up and 3445 mug.g{sup -1} and indicates that significant thorium transport occurs under this condition. The obtained results allowed to calculate the factor for preferential mobilization of thorium in particulate matter relative to the liquid phase, an important parameter for understanding the geochemical behaviour of this element in hydrosphere. (author)

  2. Proyecto EDAR de Huesca: Proyecto de una Estación Depuradora de Aguas Residuales en Huesca

    OpenAIRE

    Gracia Paricio, Félix

    2015-01-01

    El objeto del presente proyecto es el diseño, construcción y explotación inicial de las obras de la Estación Depuradora de Aguas Residuales de Huesca. Las obras de las que se compone la estación depuradora de Huesca engloban: toma de entrada de las aguas residuales a la estación de tratamiento; instalaciones de tratamiento de las aguas residuales (Estación Depuradora de Aguas Residuales); restitución al río Isuela del efluente tratado; instalaciones de energía eléctrica, agua potable y telefo...

  3. Riesgos microbiológicos en agua de bebida: una revisión clínica

    OpenAIRE

    Estela Ruiz B.; Maribel Cervantes F.; José Luis Ortega S.; Gerardo Álvarez H.; José de Jesús Alba R.; Norma Urtiz E.; Aurora Martínez R.

    2013-01-01

    La contaminación microbiológica y química del agua potable origina efectos adversos a la salud. Un suministro adecuado de agua potable es universalmente reconocido como una necesidad humana básica. El objetivo de la presente revisión fue conocer los riesgos microbiológicos en agua de bebida. Calidad del agua, es garantizar que los consumidores no estén expuestos a agentes patógenos que puedan causar enfermedades. El agua natural puede contener una gran variedad de microorganismos patógenos, b...

  4. Relato de caso de Lagochilascariose humana procedente do Estado do Pará, Brasil Report a case of human lagochilascariasis coming from the Pará State, Brazil

    Directory of Open Access Journals (Sweden)

    Miguel Alípio Vieira

    2000-02-01

    Full Text Available Mais um caso de lagochilascariose em criança procedente do Município de Xinguara PA. No Hospital das Clínicas da UFG, foi feita drenagem do abscesso localizado na região cervical direita, constatando-se a presença de ovos e vermes adultos de Lagochilascaris minor. Instituída terapia com albendazol 400mg/dia (durante 30 dias e antibioticoterapia, houve regressão do quadro clinico.A new case of lagochilascariasis is reported in a child from Xinguara PA, Brazil. The patient had an abscess in the right cervical region, which was drained at the Clinical Hospital of UFG. Eggs and adult stages of Lagochilascaris minor were found in the secretion of the abscess. Treatment with albendazol, at a dosage of 400mg/day for 30 days, associated with antibiotics promoted regression of the lesion.

  5. Hepatite fulminante e febre negra de Lábrea: estudo de 5 casos procedentes de Codajás, Amazonas, Brasil

    Directory of Open Access Journals (Sweden)

    José Carlos Ferraz da Fonseca

    1983-09-01

    Full Text Available São descritas as manifestações clinicas, laboratoriais e aspectos evolutivos de cinco pacientes procedentes de Codajás-Amazonas, atendidos no Instituto de Medicina Tropical de Manaus devido ao quadro de hepatopatia grave, com período médio de doença de quatro dias. Quatro destes pacientes evoluiram para óbito, com uma média de cinco dias desde o inicio dos pródromos. A sorologia para hepatite B mostrou que o Ag HBs estava presente em quatro e o Anti - HBc em todos. Dos pacientes que foram ao óbito, através da necropsia a histopatologia do fígado revelou quadro de hepatite fulminante em dois e de febre de Lábrea nos outros dois.

  6. Avaliação da bioatividade dos extratos de cúrcuma (Curcuma longa L., Zingiberaceae em Artemia salina e Biomphalaria glabrata Bioactivity evaluation of the turmeric (Curcuma longa L., Zingiberaceae extracts in Artemia salina and Biomphalaria glabrata

    Directory of Open Access Journals (Sweden)

    Carlos R. M. da Silva Filho

    2009-12-01

    Full Text Available A cúrcuma é o rizoma limpo, em boas condições, seco e moído da Curcuma longa L., uma planta herbácea da família Zingiberaceae. Visando novas alternativas para o controle da esquistossomose, os extratos de Curcuma longa L. foram testados para a avaliação da atividade moluscicida contra caramujos adultos da espécie Biomphalaria glabrata, e toxicidade (ensaio de letalidade com Artemia salina. A oleoresina e o óleo essencial de cúrcuma foram ativos contra Artemia salina (CL50 = 80,43 e CL50 = 319,82 μg/mL, respectivamente e também ativos contra os indivíduos adultos de Biomphalaria glabrata (CL50 = 58,3 e CL50 = 46,73 μg/mL, respectivamente. A partir dos resultados obtidos pôde ser concluído que ambos os extratos podem constituir uma alternativa no controle da população desses caramujos e na redução da esquistossomose.The turmeric is the clean rhizome at good conditions, dried and powdered of Curcuma longa L., an herbaceous plant of Zingiberaceae family. Aiming new alternatives for Schistosomiasis control, the Curcuma longa L. extracts were tested for molluscicidal activity evaluation against adult snails of Biomphalaria glabrata specie, and the toxicity (Brine Shrimp Lethality-BSL-bioassay. The oleoresin and the essential oil of turmeric were active against Artemia salina (CL50 = 80.43 and CL50 = 319.82 μg.mL-1, respectively and also active against the adult snails of Biomphalaria glabrata (CL50 = 58.3 and CL50 = 46.73 μg.mL-1, respectively. From the obtained results it was concluded that both extracts can constitute an alternative to population control of these snails and in the reduction of Schistosomiasis.

  7. Análisis de impactos ambientales producidos durante la fase de ejecución en edificación: operaciones de limpieza y recuperación de aguas de lavado de hormigones en España

    Directory of Open Access Journals (Sweden)

    Flores-Alés, V.

    2015-06-01

    Full Text Available The aim of this work is to assess the environmental aspects arising during the execution phase of building construction and to analyse the possibilities of reducing the negative impacts. We have studied the environmental factors associated with the use and handling of the materials, focusing the research on two of the most qualitatively significant processes: operations to clean the works and the recovery of concrete-washing water. In both cases, a qualitative analysis of environmental impact has been made. In the wash-water study, basic parameters (density by differential weighing, pH by pHmeter and chemical composition by X ray fluorescence of ten samples were analysed to evaluate the quality of the discharges and thus be able to propose solutions and technological improvements (filtering, neutralization,… applicable to construction works with the aim of decreasing the volume of dislodged solids and improve the quality of water discharged.El presente trabajo evalúa aspectos ambientales durante la fase de ejecución de obra de edificación y analiza las posibilidades de reducción de impactos negativos. Se han estudiado factores ambientales asociados al uso y manipulación de los materiales, centrando la investigación en dos de los procesos cualitativamente más relevantes: las limpiezas de la obra y la recuperación de aguas de lavado de hormigones. En ambos casos se hace un análisis cualitativo de la incidencia ambiental; en el estudio de aguas de lavado se han analizado parámetros básicos (densidad por pesada diferencial, pH mediante pHmetría y composición química por fluorescencia de rayos X de diez muestras procedentes de distintas obras para evaluar la calidad de los vertidos. Se proponen soluciones aplicables y mejoras tecnológicas (filtrado, neutralización,.. en obra con el fin de disminuir el volumen de sólidos arrastrados y mejorar la calidad del agua vertida.

  8. Efeito do meio Erd Schreiber no cultivo das microalgas Dunaliella salina, Tetraselmis chuii e Isochrysis galbana = Erd Schreiber medium effect in culture of microalgae Dunaliella salina, Tetraselmis chuii and Isochrysis galbana

    Directory of Open Access Journals (Sweden)

    Vera Lucia Mota Klein

    2006-04-01

    Full Text Available As microalgas são utilizadas como fonte de alimento em aqüicultura. Neste trabalho cultivaram-se D. salina, T. chuii e I. galbana. O objetivo do trabalho consistiu em determinar o efeito do meio Erd Schreiber sobre o seu crescimento. Iniciou-se o cultivo com a mistura de 200 mg de Na2HPO4,7H2O, 100 mg de NaNO3 e 50 mL de extrato de solo. No monitoramento, manteve-se a temperatura entre 24 - 28 oC, a salinidade a 34 ppt, à iluminação constante, a densidade celular com uma câmara de Neubauer e um microscópio binocular modelo ZEISS. Como resultado, I. galbana, D. salina e T. chuii atingiram 969 104 cel/mL, 457 x 104 cel/mL e 258,66 x 104 cel/mL, respectivamente, e oscoeficientes angulares b foram 3,76 x 104 cel./mL/dia, 6,84 x 104 cel./mL/dia e 2,08 x 104 cel./mL/dia respectivamente, indicando bom desempenho de todas as microalgas no meio Erd Shreiber.The microalgae is used as food source in aqüicultura. In this work they had cultivated D. salina , T. chuii and I. galbana . The objective of the work is to determine the effect of Erd Schreiber´s culture medium on the microalgae growth. The culture initiated mixting 200mg of Na2HPO4,7H2O, 100 mg of NaNO3 and 50 mL of soil extract. During the culture the temperature had varied between 24 and 28oC, the salinity was fixed on 34 %o, and the illumination was maintained constant. The assessment of the culture was made by a chamber of Neubauer and a binocular microscope ZEISS model. As result I. galbana D. salina and T.chuii reached 969 104 cel/mL, 457 x 104cel/mL and 258,66 x 104 cel/mL respectively and as angular coefficient 3,76 x 104 cel/mL/dia, 6,84 x 104 cel/mL/dia and 2,08 104 x cel/mL/dia respectively, showing good answer of the microalgae to the effect of Erd Schreiber´ s medium.

  9. Prospecção fitoquímica de Sonchus oleraceus e sua toxicidade sobre o microcrustáceo Artemia salina Phytochemical prospecting of Sonchus oleraceus and its toxicity to Artemia salina

    OpenAIRE

    LIMA, J.M. de; SILVA, C. A.; Rosa, M. B.; J.B. Santos; OLIVEIRA, T. G. de; Silva,M.B.

    2009-01-01

    A espécie vegetal Sonchus oleraceus é uma planta daninha presente em diversas culturas no Brasil e de utilização na medicina popular. Neste trabalho, realizou-se a prospecção fitoquímica dessa espécie com extratos em etanol, água e diclorometano, bem como testes de toxicidade sobre o microcrustáceo Artemia salina. O extrato aquoso apresentou em sua composição açúcares redutores, compostos fenólicos, taninos, flavonóides e cumarinas. No extrato etanólico, observaram-se os mesmos compostos qual...

  10. Estudos quimiométricos da pheo formulada em pluronics®: ação fotodinâmica Sobre Artemia salina Chemometric studies of pheo formulated in pluronics®: photodynamic action against Artemia salina

    Directory of Open Access Journals (Sweden)

    Adriana Passarella Gerola

    2013-01-01

    Full Text Available The self-aggregation of pheophytin, a possible photosensitizer for Photodynamic Therapy, is solved by formulation in polymeric surfactant as P-123. The photosensitizer incorporation was found to be time dependent, exhibiting two steps: a partition at the micellar interface followed by an incorporation into the micelle core. The photodynamic efficiency of the formulation was tested by the bioassays against Artemia salina. In order to evaluate how the experimental parameters: pheophytin concentration, P-123 percentage and illumination time influenced the death of artemia, the factorial design 2³ was chosen. The illumination time was found to be the main factor contributing to the mortality of artemia.

  11. El cultivo de alfalfa utilizando agua de perforación, agua residual urbana y precipitaciones The cultivation of alfalfa using artesian well water, urban wastewater and rainfall

    Directory of Open Access Journals (Sweden)

    José O. Plevich

    2012-12-01

    Full Text Available El objetivo de este trabajo fue analizar la producción de biomasa aérea, la eficiencia del uso de agua y el valor nutritivo de alfalfa cultivada aplicando riego con agua residual urbana, agua de perforación y un testigo (precipitaciones, en el Campus de la Universidad Nacional de Rio Cuarto (Córdoba-Argentina. Los tratamientos de riego tuvieron un efecto positivo sobre la producción de biomasa aérea obteniéndose un 24% más de producción de biomasa que en la situación de secano (precipitaciones. Entre los tratamientos con riego también se manifestaron diferencias estadísticamente significativas. La alfalfa regada con aguas residuales urbana supero en un 19% a la cultivada con agua de perforación. La eficiencia del uso del agua por parte del cultivo se incrementó cuando el riego se realizó con aguas residuales urbanas. Además, se determinó que la alfalfa regada con agua residual, supera los valores nutritivos del cultivo que crece en condiciones sin riego; encontrándose 39% más de proteínas, 14% más de digestibilidad e igual porcentaje de energía metabólica. Se puede concluir que el agua residual urbana representa otra posible fuente de agua, factible de ingresar al suelo y estar a disposición para el cultivo de alfalfa.The objective of this study was to analyse the production of alfalfa biomass, the efficiency of water use and the nutritional value of forage, inside an irrigation structure of an experimental facility that uses treated urban wastewater, artesian well water and rainfall, at the campus of the Universidad National de Rio Cuarto (Córdoba-Argentina. The irrigation treatment had a positive effect on the production of biomass of alfalfa. On an average 24% increase in production was observed when compared to dry-land farming. Regarding the quality of the irrigation water, statistical differences in production were observed, the irrigation with urban wastewater produced 19% more than that of well water. The

  12. Biodisponibilidad, acumulación y traslocación de arsénico y metales pesados en plantas autóctonas procedentes de suelos afectados por la actividad minera

    OpenAIRE

    Garcia Salgado, Sara; Garcia Casillas, David; Quijano Nieto, M. Angeles; Bonilla Simon, M. Milagros

    2010-01-01

    Se han evaluado los factores de biodisponibilidad, acumulación y traslocación de arsénico y metales pesados, en plantas autóctonas procedentes de suelos contaminados por actividades mineras, mediante el análisis de dichas muestras por ICP-AES.

  13. EFECTOS REDISTRIBUTIVOS DE LAS TARIFAS DE AGUA POTABLE

    Directory of Open Access Journals (Sweden)

    VÉLEZ GOMEZ LUIS DIEGO

    2010-05-01

    Full Text Available Aunque para Colombia la situación no es tan dramática, se avizora un problema de cobertura y escasez de agua potable para los niveles más desprotegidos de la población, en razón de su incapacidad de pago. La consecuencia inmediata es una acentuación de los índices de pobreza y de su manifestación más clara: el hambre. Este trabajo pretende mostrar que los niveles de pobreza son muy sensibles al precio de los servicios públicos domiciliarios, entre ellos, del agua, y atribuye a las fallas de inclusión y exclusión de los subsidios parte del grueso número de personas que hoy están por debajo de la línea de pobreza, aunque ésta no sea la única causa. Dada, entonces, la prominencia de las empresas de servicios públicos en la economía, los gobiernos tienen la obligación de resolver parte del difícil problema de equidad a través de las tarifas, sin dejar de garantizar la sostenibilidad económica de los proveedores del recurso.

  14. El agua en Segobriga (Saelices, Hispania Citerior: Las fistulae plumbeae

    Directory of Open Access Journals (Sweden)

    Cebrián, Rosario

    2014-12-01

    Full Text Available In the present article the lead pipes found in the archaeological site of Segobriga and in its surroundings are presented. Some of these fistulae are related to the siphon aqueduct that brought drinking water from Fuente la Mar in Saelices, while others correspond to the internal water supply in the city. Both epigraphic references containing the abbreviated name of the municipality, r(es p(ublica S(egobrigensis vel Segobrigensium, identified on a fistula and in a lead cover, show the public property of the Segobriga hydraulic network.En este artículo presentamos las tuberías de plomo halladas en el yacimiento arqueológico de Segobriga y su entorno. Algunas de estas fistulae están relacionadas con el sifón del acueducto que condujo el agua potable desde la Fuente de la Mar en Saelices, mientras que otras corresponden a la red de distribución del agua en el interior de la ciudad. Las dos menciones epigráficas con el nombre abreviado del municipio, r(es p(ublica S(egobrigensis vel Segobrigensium, documentadas en una fistula y en la tapa de un registro ponen de manifiesto la propiedad pública del sistema hidráulico de Segobriga.

  15. Toxicоlogical evaluation of the plant products using Brine Shrimp (Artemia salina L. model

    Directory of Open Access Journals (Sweden)

    Меntor R. Hamidi

    2014-04-01

    Full Text Available Many natural products could serve as the starting point in the development of modern medicines because of their numerous biological and pharmacological activities. However, some of them are known to carry toxicological properties as well. In order to achieve a safe treatment with plant products, numerous research studies have recently been focused on both pharmacology and toxicity of medicinal plants. Moreover, these studies employed efforts for alternative biological assays. Brine Shrimp Lethality Assay is the most convenient system for monitoring biological activities of various plant species. This method is very useful for preliminary assessment of toxicity of the plant extracts. Rapidness, simplicity and low requirements are several advantages of this assay. However, several conditions need to be completed, especially in the means of standardized experimental conditions (temperature, pH of the medium, salinity, aeration and light. The toxicity of herbal extracts using this assay has been determined in a concentration range of 10, 100 and 1000 µg/ml of the examined herbal extract. Most toxicity studies which use the Brine Shrimp Lethality Assay determine the toxicity after 24 hours of exposure to the tested sample. The median lethal concentration (LC50 of the test samples is obtained by a plot of percentage of the dead shrimps against the logarithm of the sample concentration. LC50 values are estimated using a probit regression analysis and compared with either Meyer’s or Clarkson’s toxicity criteria. Furthermore, the positive correlation between Meyer’s toxicity scale for Artemia salina and Gosselin, Smith and Hodge’s toxicity scale for higher animal models confirmed that the Brine Shrimp Lethality Assay is an excellent predictive tool for the toxic potential of plant extracts in humans.

  16. Effect of osmotic shock on the redox system in plasma membrane of Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    CHENSIXUE; CHICHIONGYEN; 等

    1996-01-01

    The unicellular halotolerant alga Dunaliella salina had the ability to oxidize NADH and reduce Fe(CN)63-.The redox reactions were to some extent stimulated by slight hyperosmotic shock (2.0mol/L→2.6mol/L NaCl),but markably inhibited by abrupt hyperosmotic shock (2.0mol/L→3.5mol/L NaCl) and hypoosmotic shock (2.0mol/L→1.0mol/L NaCl;2.0mol/L→0.67mol/L NaCl).With the adaptation of algal cells to osmotic shock by accumulating or degraging intracellular grycerol,the plasmalemma redox activities were also restored.The O2 uptake stimulated by NADH could be promoted by FA and SHAM.Hypoosmotic shock increases the basal respiration rate of alga cells,but weakened the stimulating effects of NADH,FA and SHAM on O2 uptake.On the other hand,hyperosmotic shock reduced the basal respiration rate,but relatively enhanced the above effects of NADH,FA and SHAM.H+ extrusion of alga cells was inhibited by NADH and stimulated by Fe(CN)63-.Vanadate and DES could inhibit H+ efflux,but had little effect in the presence of NADH and Fe(CN)63-.Both hyperand hypoosmotic shock stimulated H+ extrusion.This effect could be totally inhibited by vanadate and DES,but almost unaffected by 8-hydroxyquinoline.It was suggested that H+-ATPase probably played a more important role in H+ extrusion and osmoregulation under the conditions of osmotic shock.

  17. Evaluation of alpha and gamma aluminum oxide nanoparticle accumulation, toxicity, and depuration in Artemia salina larvae.

    Science.gov (United States)

    Ates, Mehmet; Demir, Veysel; Arslan, Zikri; Daniels, James; Farah, Ibrahim O; Bogatu, Corneliu

    2015-01-01

    In this study, Artemia salina (crustacean filter feeders) larvae were used as a test model to investigate the toxicity of aluminum oxide nanoparticles (Al2O3 NPs) on marine microorganisms. The uptake, toxicity, and elimination of α-Al2O3 (50 nm and 3.5 μm) and γ-Al2O3 (5 nm and 0.4 μm) NPs were studied. Twenty-four and ninety-six hour exposures of different concentrations of Al2O3 NPs to Artemia larvae were conducted in a seawater medium. When suspended in water, Al2O3 NPs aggregated substantially with the sizes ranging from 6.3 nm to >0.3 µm for spherical NPs and from 250 to 756 nm for rod-shaped NPs. The phase contrast microscope images showed that NPs deposited inside the guts as aggregates. Inductively coupled plasma mass spectrometry analysis showed that large particles (3.5 μm α-Al2O3) were not taken up by Artemia, whereas fine NPs (0.4 μm γ-Al2O3) and ultra-fine NPs (5 nm γ-Al2O3 and 50 nm α-Al2O3) accumulated substantially. Differences in toxicity were detected as changing with NP size and morphology. The malondialdehyde levels indicated that smaller γ-Al2O3 (5 nm) NPs were more toxic than larger γ-Al2O3 (0.4 µm) particulates in 96 h. The highest mortality was measured as 34% in 96 h for γ-Al2O3 NPs (5 nm) at 100 mg/L (LC50 > 100 mg/L). γ-Al2O3 NPs were more toxic than α-Al2O3 NPs at all conditions.

  18. Oxidative stress is a mediator for increased lipid accumulation in a newly isolated Dunaliella salina strain.

    Science.gov (United States)

    Yilancioglu, Kaan; Cokol, Murat; Pastirmaci, Inanc; Erman, Batu; Cetiner, Selim

    2014-01-01

    Green algae offer sustainable, clean and eco-friendly energy resource. However, production efficiency needs to be improved. Increasing cellular lipid levels by nitrogen depletion is one of the most studied strategies. Despite this, the underlying physiological and biochemical mechanisms of this response have not been well defined. Algae species adapted to hypersaline conditions can be cultivated in salty waters which are not useful for agriculture or consumption. Due to their inherent extreme cultivation conditions, use of hypersaline algae species is better suited for avoiding culture contamination issues. In this study, we identified a new halophilic Dunaliella salina strain by using 18S ribosomal RNA gene sequencing. We found that growth and biomass productivities of this strain were directly related to nitrogen levels, as the highest biomass concentration under 0.05 mM or 5 mM nitrogen regimes were 495 mg/l and 1409 mg/l, respectively. We also confirmed that nitrogen limitation increased cellular lipid content up to 35% under 0.05 mM nitrogen concentration. In order to gain insight into the mechanisms of this phenomenon, we applied fluorometric, flow cytometric and spectrophotometric methods to measure oxidative stress and enzymatic defence mechanisms. Under nitrogen depleted cultivation conditions, we observed increased lipid peroxidation by measuring an important oxidative stress marker, malondialdehyde and enhanced activation of catalase, ascorbate peroxidase and superoxide dismutase antioxidant enzymes. These observations indicated that oxidative stress is accompanied by increased lipid content in the green alga. In addition, we also showed that at optimum cultivation conditions, inducing oxidative stress by application of exogenous H2O2 leads to increased cellular lipid content up to 44% when compared with non-treated control groups. Our results support that oxidative stress and lipid overproduction are linked. Importantly, these results also suggest that

  19. Crescimento de mudas de mamoeiro em condições controladas com água salina

    Directory of Open Access Journals (Sweden)

    Debora Cristina Coelho

    2015-02-01

    Full Text Available Diante a importância socioeconômica e alimentar do mamoeiro para a região nordeste, onde naturalmente ocorrem águas com teores elevados de sais, objetivou-se avaliar o crescimento de mudas de mamoeiro em casa de vegetação sob irrigação com água salina. Neste sentido, foi realizado um experimento, em ambiente protegido da Universidade Federal de Campina Grande, UFCG, Campus de Pombal, PB onde foram estudados, cinco níveis de salinidade da água de irrigação em uma cultivar de mamoeiro (Tainung-1. O delineamento experimental foi inteiramente casualizado, sendo a unidade experimental composta por quatro plantas úteis; as mudas de mamoeiro foram formadas em sacolas plásticas de 500 ml de volume; avaliou-se o crescimento e a massa seca da parte aérea das plantas. Sendo as variáveis submetidas ao teste F, e realizando análise de regressão polinomial para o fator salinidade da água. Sendo assim; A salinidade reduz o crescimento das mudas de mamoeiro; A altura de planta e diâmetro de caule foi afetado com o incremento unitário da salinidade da água; A variável que melhor expressa o efeito da salinidade nas mudas de mamoeiro é massa seca da parte aérea, por haver maior redução com aumento unitário da salinidade.

  20. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    Science.gov (United States)

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  1. Toxic effects of Microgramma vacciniifolia rhizome lectin on Artemia salina, human cells, and the schistosomiasis vector Biomphalaria glabrata.

    Science.gov (United States)

    de Albuquerque, Lidiane Pereira; Pontual, Emmanuel Viana; Santana, Giselly Maria de Sá; Silva, Luanna Ribeiro Santos; Aguiar, Jaciana dos Santos; Coelho, Luana Cassandra Breitenbach Barroso; Rêgo, Moacyr Jesus Barreto de Melo; Pitta, Maira Galdino da Rocha; da Silva, Teresinha Gonçalves; Melo, Ana Maria Mendonça de Albuquerque; Napoleão, Thiago Henrique; Paiva, Patrícia Maria Guedes

    2014-10-01

    The present study evaluated the toxicity of Microgramma vacciniifolia rhizome lectin (MvRL) to Artemia salina, human tumour cell lines (larynx epidermoid carcinoma Hep-2, NCI-H292 lung mucoepidermoid carcinoma, and chronic myelocytic leukaemia K562), and normal peripheral blood mononuclear cells (PBMCs), as well as to Biomphalaria glabrata embryos and adults. MvRL was toxic to A. salina (LC50=159.9 μg/mL), and exerted cytotoxic effects on NCI-H292 cells (IC50=25.23 μg/mL). The lectin (1-100 μg/mL) did not affect the viability of K562 and Hep-2 tumour cells, as well as of PBMCs. MvRL concentration of 1, 10, and 100 μg/mL promoted malformations (mainly exogastrulation) in 7.8%, 22.5%, and 27.7% of embryos, respectively, as well as delayed embryo development in 42.0%, 69.5%, and 54.7% of embryos, respectively. MvRL at a concentration of 100 μg/mL killed B. glabrata embryos (17.7%) and adults (25%). Further, MvRL damaged B. glabrata reproductive processes, which was evidenced by observations that snails exposed to the lectin (100 μg/mL) deposited fewer eggs than those in the control group, and approximately 40% of the deposited eggs exhibited malformations. Comparison of these results with that from A. salina assay indicates that MvRL is adulticidal at the concentration range which is toxic to environment. In conclusion, the cytotoxicity of MvRL on tumour cell and absence of toxicity to normal cell indicate its potential as chemotherapeutic drug. Also, the study revealed that the lectin is able to promote deleterious effects on B. glabrata embryos at environmentally safe concentrations.

  2. High-EPA Biomass from Nannochloropsis salina Cultivated in a Flat-Panel Photo-Bioreactor on a Process Water-Enriched Growth Medium

    DEFF Research Database (Denmark)

    Safafar, Hamed; Hass, Michael Z.; Møller, Per

    2016-01-01

    Nannochloropsis salina was grown on a mixture of standard growth media and pre-gasified industrial process water representing effluent from a local biogas plant. The study aimed to investigate the effects of enriched growth media and cultivation time on nutritional composition of Nannochloropsis...... salina biomass, with a focus on eicosapentaenoic acid (EPA). Variations in fatty acid composition, lipids, protein, amino acids, tocopherols and pigments were studied and results compared to algae cultivated on F/2 media as reference. Mixed growth media and process water enhanced the nutritional quality...... of Nannochloropsis salina in laboratory scale when compared to algae cultivated in standard F/2 medium. Data from laboratory scale translated to the large scaleusing a 4000 L flat panel photo-bioreactor system. The algae growth rate in winter conditions in Denmark was slow, but results revealed that large...

  3. Actitudes y comportamiento para el uso sostenible del agua en pobladores de Huancayo

    Directory of Open Access Journals (Sweden)

    Luis Yarlequé Chocas

    2013-06-01

    Full Text Available Objetivos: Establecer si el Programa de Gestión Sostenible del Agua (PROGESA mejora el comportamiento y las actitudes de estudiantes del nivel inicial y padres de familia para el uso sostenible del agua en seis instituciones educativas de Huancayo. Métodos: Se empleó el diseño cuasi experimental de grupos no equivalentes con pre y posprueba. El tamaño muestral fue de 160 estudiantes y 160 padres. Los instrumentos utilizados fueron cuestionarios estructurados, listas de cotejo y guías de entrevista para identificar las principales conductas y mecanismos de pérdida del agua y de actitudes hacia su cuidado. Resultados: El 98% de la población infantil tiene actitudes de rechazo hacia el uso sostenible del agua sin la influencia de PROGESA ni del área de Ciencia y Ambiente; el 79,7% de los adultos acepta el uso sostenible del agua. Los principales mecanismos de pérdida de agua en hogares e instituciones educativas de Huancayo son los inodoros y caños malogrados y mal cerrados. Conclusiones: PROGESA sí hace posible el desarrollo de actitudes y el comportamiento hacia el uso sostenible del agua en los niños y a través de ellos en sus padres; el área de Ciencia y Ambiente tiene también un efecto positivo al respecto, pero menor que el de PROGESA; los adultos saben qué se debería hacer, pero no siempre lo hacen; los inodoros y caños malogrados son las principales fuentes de pérdida del agua; en las instituciones y en los hogares no se reusa ni cosecha agua.

  4. El abastecimiento de agua en las ciudades del Mediterráneo

    Directory of Open Access Journals (Sweden)

    Pulido Bosch, Antonio

    1999-10-01

    Full Text Available Not available.En las ciudades costeras, como en las no costeras, una buena parte del agua captada se pierde en las redes de distribución; además, el usuario no es siempre consciente de la necesidad de ahorrar al máximo este recurso. Hay que tener en cuenta igualmente que el agua residual, una vez depurada, puede constituir un buen recurso que permite satisfacer parte de la demanda y a la vez reducir los problemas planteados por la eliminación de las aguas usadas directamente en el mar. Las soluciones a los problemas de la escasez de agua deben pasar por el ahorro de agua, la reducción de las pérdidas en las redes de distribución, la reutilización y, a veces, la importación de agua de lugares excedentarios, sin olvidar la desalación de las aguas saladas o salobres. El desarrollo sostenible exige una planificación partiendo de la demanda máxima admisible, compatible con el respeto a los equilibrios ambientales; esto puede exigir la limitación del crecimiento de las ciudades, lo que no es siempre aceptado. Por último, se comentan dos ejemplos, uno representativo de una ciudad donde no existe gran competencia por el agua entre la demanda agrícola y la demanda urbana (Almería; y el otro relativo a una ciudad donde el turismo de verano aumenta casi diez veces la población, con una agricultura para la que la demanda de agua alcanza en verano también su máximo (Almuñécar, Granada.

  5. Cultural heritage and food identity: The pre-Hispanic salt of Zapotitlán Salinas, Mexico

    OpenAIRE

    Renard, Marie-Christine; Thomé Ortiz, Humberto

    2016-01-01

    Salt production in Zapotitlán de las Salinas (Puebla, Mexico) dates back to pre-Hispanic times when the Popolocas inhabiting the Tehuacán Valley paid it as tribute to the Aztecs. The technique to obtain salt has changed little over the past 500 years and know-how continues to be transmitted from generation to generation of salters (salineros). It is a resource that is deeply anchored in the identity of the inhabitants of Zapotitlán and regional cuisine. Salt has endured over the centuries as ...

  6. Actividad de la falla la salina a partir de instrumentación sismológica

    Directory of Open Access Journals (Sweden)

    Gómez Ernesto

    2003-08-01

    Full Text Available

    The "La Salina" Fault, located in a region of high seismicity was studied in an area of 294 km2 in the Santander Department, it's defined as an inverse fault. In general it doesn't present clear morphological or actual activity evidences. In the area of the Hydroelectrical Project of the Sogamoso River by ISAGEN SA., a six stations seismic network was installed in an area near to the fault. During 124 days, 2.367 seismic events were evaluated; from these, 339 acceptable quality events were chosen for doing maps and profiles. Most of the seismicity is related to the "Bucaramanga Nest", other 131 seismic events ware related to the mapped faults. Only two events were related to the "La Salina" Fault, defining a indicating low activity.

    La falla La Salina se ubica en el departamento de Santander, en una región de alta sismicidad y es definida como de tipo inversa. En general, no presenta claras evidencias morfológicas ni de actividad reciente, por lo cual en el presente trabajo se investiga un área de 294 km2 de la misma.

    Dentro del Proyecto hidroeléctrico del rio Sogamoso, desarrollado por ISAGEN S.A, se estableció una red sismológica de seis estaciones en un área cercana a la falla. Durante 124 días se evaluaron 2.367 sismos, de los cuales se seleccionaron 339 de calidad aceptable para la elaboración de mapas y perfiles. De estos sismos, la mayor parte están asociados al "Nido de Bucaramanga" y 131 eventos están relacionados a fallas cartografiadas en la región; y de ellos

  7. Estudio multiescalar de la formación de costras salinas sobre sedimentos amorfos silíceos lacustres.

    OpenAIRE

    Camargo Hernández, Aidé

    2010-01-01

    Sobre los suelos/sedimentos (lacustres, eólicos y fluviales) del antiguo Lago de Texcoco se desarrollan costras salinas con diferentes morfologías. La mayor diversidad de costras se presenta sobre los sedimentos amorfos silíceos lacustres. Las costras e interfase costra-sedimento fueron analizadas mediante métodos físicos y químicos, difracción de rayos-X (DRX), microscopía petrográfica (MP) y microscopía electrónica de barrido (MEB/EDS). Se encontró que la morfología está relacionada princ...

  8. High-EPA Biomass from Nannochloropsis salina Cultivated in a Flat-Panel Photo-Bioreactor on a Process Water-Enriched Growth Medium

    Directory of Open Access Journals (Sweden)

    Hamed Safafar

    2016-07-01

    Full Text Available Nannochloropsis salina was grown on a mixture of standard growth media and pre-gasified industrial process water representing effluent from a local biogas plant. The study aimed to investigate the effects of enriched growth media and cultivation time on nutritional composition of Nannochloropsis salina biomass, with a focus on eicosapentaenoic acid (EPA. Variations in fatty acid composition, lipids, protein, amino acids, tocopherols and pigments were studied and results compared to algae cultivated on F/2 media as reference. Mixed growth media and process water enhanced the nutritional quality of Nannochloropsis salina in laboratory scale when compared to algae cultivated in standard F/2 medium. Data from laboratory scale translated to the large scale using a 4000 L flat panel photo-bioreactor system. The algae growth rate in winter conditions in Denmark was slow, but results revealed that large-scale cultivation of Nannochloropsis salina at these conditions could improve the nutritional properties such as EPA, tocopherol, protein and carotenoids compared to laboratory-scale cultivated microalgae. EPA reached 44.2% ± 2.30% of total fatty acids, and α-tocopherol reached 431 ± 28 µg/g of biomass dry weight after 21 days of cultivation. Variations in chemical compositions of Nannochloropsis salina were studied during the course of cultivation. Nannochloropsis salina can be presented as a good candidate for winter time cultivation in Denmark. The resulting biomass is a rich source of EPA and also a good source of protein (amino acids, tocopherols and carotenoids for potential use in aquaculture feed industry.

  9. La importancia del agua en la crianza de remplazos de lechería

    OpenAIRE

    Monge-Rojas, Cynthia Rebeca; Elizondo-Salazar, Jorge Alberto

    2016-01-01

    El agua, además de ser indispensable para la vida, es el nutriente esencial más importante en el ganado de leche, representa la mayoría de peso vivo del animal, y es el medio en el cual se llevan a cabo todas las reacciones químicas del organismo. Una cantidad importante de agua es necesaria para la fermentación, el metabolismo, la digestión y la absorción de nutrientes, así como la excreción de productos de desecho. La cantidad y disponibilidad de agua para los animales es de vital importanc...

  10. Compuestos orgánicos presentes en aguas de escombreras de carbón.

    OpenAIRE

    Llamas Borrajo, Juan F.; Canoira López, Laureano; García-Martínez, Mª Jesús; Ortega Romero, Marcelo; Llamas Lois, Alberto; Diaz Bautista, Maria Aranzazu

    2008-01-01

    Se ha realizado un estudio de la influencia de las aguas acidas de mina en la movilización de los hidrocarburos policidicos aromáticos (PAHs) presentes en las escombreras de carbón. Se observa como dichas aguas acidas disuelven preferentemente a los PAHs de menor peso molecular. También se ha realizado un análisis de riesgos que indica que existe un riesgo real por uso y consumo, en el interior de las viviendas, del agua subterránea. Por último, se han establecido las bases para una técnica p...

  11. ECOFICCIONES E IMAGINARIOS DEL AGUA Y SU IMPORTANCIA PARA LA MEMORIA CULTURAL Y LA SOSTENIBILIDAD

    OpenAIRE

    Eloy Martos Núñez; Alberto Martos García

    2013-01-01

    La cultura del agua debe ser vinculada de forma especial a las manifestaciones del patrimonio cultural intangible de los pueblos, como las tradiciones orales o escritas, la simbología o los rituales, que conforman lo que llamamos los Imaginarios del Agua. Estos deben ser analizados y deconstruidos a la luz de los nuevos paradigmas, como la hermenéutica y la ecocrítica. De este modo, la mitografía ayuda a perfilar el significado profundo de la cultura del agua ante las nuevas demandas medioamb...

  12. PRODUCTIVIDAD DEL AGUA EN EL CULTIVO DE NOPAL CON RIEGO POR GOTEO EN LA COMARCA LAGUNERA

    OpenAIRE

    2003-01-01

    Ante la escasez de agua en la Comarca Lagunera, situada en la zona árida del norte de México, se requiere encontrar cultivos que, combinados con tecnologías de ahorro de agua, hagan un uso eficiente de este recurso. El objetivo de este trabajo es mostrar la productividad del agua en variedades de nopal hortícola (Opuntia spp.) con riego por goteo, utilizando cintilla colocada en forma superficial y subsuperficial, para lo cual se evaluaron cuatro variedades de nopal que pueden destinarse al c...

  13. Memorias del proyecto cultural Agua: un patrimonio que circula de mano en mano

    Directory of Open Access Journals (Sweden)

    Sandra Concha Roldan

    2013-09-01

    Full Text Available El interés de Banco de la República en trabajar un proyecto cultural sobre el agua tiene varios orígenes. Las inundaciones del 2010 le recordaron a Colombia que pase lo que pase, el agua vuelve a su cauce y recuerda su camino. Esos cauces se organizan en cuencas hidrográficas que conectan y estructuran la vida de quienescomparten el territorio. Las cuencas unen y afectan sin atender a las fronteras políticas y por ello la sostenibilidad del agua es una responsabilidad compartida, su mal uso nos afecta a todos y su futuro es una responsabilidad prioritaria del presente.

  14. Gestión sostenible del agua y de los residuos en zonas urbanas

    OpenAIRE

    Otterpohl, Ralf; Grottker, Matthias; Lange, Jörg

    2016-01-01

    El sistema habitual de alcantarillado y las estaciones de depuración aerobia de aguas residuales (EDAR), no deberían considerarse como la única solución posible para el saneamiento. Los sistemas con separación en origen pueden evitar muchos problemas de la tecnología empleada en el vertido, al tener en cuenta las diferentes calidades de las aguas residuales y darles un tratamiento adecuado para su reutilización.Las diferentes calidades de los residuos y de las aguas residuales en los asentami...

  15. Biomateriales sorbentes para la limpieza de derrames de hidrocarburos en suelos y cuerpos de agua

    OpenAIRE

    2010-01-01

    Este estudio esta encaminado a identificar y evaluar materiales orgánicos naturales que puedan ser utilizados como sorbentes en las operaciones de limpieza de derrames de hidrocarburos tanto en suelos como en cuerpos de agua. Se evaluó la capacidad de sorción de tres materiales: fibra de caña, fibra de coco y buchón de agua, con tres hidrocarburos: 35, 30 y 25°API, y dos tipos de agua: destilada y marina artificial, adaptando la norma ASTM F-726 y siguiendo la metodología sugerida por el pr...

  16. Derechos emergentes en regiones emergentes: el derecho al agua potable y al saneamiento en Asia Central

    OpenAIRE

    Saura Estapà, Jaume

    2011-01-01

    El derecho humano al agua potable y al saneamiento viene afirmándose de manera cada vez más rotunda en el plano internacional. Supone la capacidad de cada ser humano de acceder a agua limpia y segura de manera asequible, y la obligación correlativa de los Estados de garantizar y proteger este derecho. Los Estados de Asia Central disponen de agua suficiente para garantizar este derecho a todos sus ciudadanos, pero la mala gestión y el despilfarro hace que algunas zonas, sobre todo rurales, ten...

  17. Bacterias resistentes a antibióticos en aguas grises como agentes de riesgo sanitario

    OpenAIRE

    Nuñez,Lidia; Tornello,Carina; Puentes,Noel; Moretton, Juan

    2012-01-01

    La eliminación y disposición final de las aguas residuales originadas por las actividades domésticas constituye un importante problema sanitario en áreas urbanas densamente pobladas. En muchas zonas del Gran Buenos Aires las aguas grises se eliminan en zanjas a cielo abierto cuyo riesgo potencial no ha sido adecuadamente cuantificado. El objetivo de este trabajo fue evaluar la prevalencia de bacterias resistentes y el perfil de resistencia a antibióticos, en muestras de aguas grises de canale...

  18. Plan estratégico sectorial de agua potable y saneamiento de Paraguay

    OpenAIRE

    Diego Fernández; Carlos Arturo Aguilera; Juan Bóbeda; Julio Giménez

    2010-01-01

    Esta nota técnica contiene la exposición del Plan Estratégico Sectorial de Agua Potable y Saneamiento de Paraguay elaborado para la Unidad de los Servicios de Agua Potable y Alcantarillado Sanitario (USAPAS) del Ministerio de Obras Públicas y Comunicaciones (MOPC) del gobierno paraguayo. El documento presenta en primer lugar datos sobre la situación administrativa y el contexto socioeconómico del país, así como de sus recursos hídricos. Luego analiza el marco institucional del sector de agua ...

  19. Modelo de distribución de agua en suelo regado por goteo

    OpenAIRE

    Ramírez de Cartagena Bisbe, Francesc; Sáinz Sánchez, Miguel A.

    1997-01-01

    Se desarrolla un modelo de simulación de la dinámica del agua en el suelo en riego localizado, denominado SIMDAS. Para el desarrollo del procedimiento numérico, se utiliza la teoría de flujo de agua en condiciones de no saturación, sin efecto histerético, resolviendo la ecuación de flujo axisimétrico sin y con extracción de agua por la planta a partir de un método en diferencias finitas, con la consideración de los distintos horizontes del suelo. Verificado el modelo en campo, los resultados ...

  20. Protection against the toxicity of microcystin-LR and cylindrospermopsin in Artemia salina and Daphnia spp. by pre-treatment with cyanobacterial lipopolysaccharide (LPS).

    Science.gov (United States)

    Lindsay, J; Metcalf, J S; Codd, G A

    2006-12-15

    Purified cyanobacterial lipopolysaccharide (LPS) was not acutely toxic to three aquatic invertebrates (Artemia salina, Daphnia magna and Daphnia galeata) in immersion trials. However, pre-exposure (24 h) to 2 ngmL(-1) LPS increased the LC(50) of microcystin-LR significantly in all 3 species. Similar results were observed with A. salina pre-treated with the same concentration of cyanobacterial LPS and subsequently exposed to cylindrospermopsin, increasing the LC(50) by 8. The findings indicate the need to include exposures to defined combinations of cyanotoxins, and in defined sequences, to understand the contributions of individual cyanotoxins in accounting for cyanobacterial toxicity to invertebrates in natural aquatic environments.

  1. Algunas notas sobre la proyección literaria en el epistolario de Pedro Salinas a Katherine Whitmore

    Directory of Open Access Journals (Sweden)

    Peragón López, Clara Eugenia

    2004-12-01

    Full Text Available Pedro Salinas' lover with no name that appears in his trilogy in loving poetry (La voz a ti debida. Razón de amor, Largo lament is presented with her own name in the group of letters sent by the poet to Katherine Whitmore. Through the analysis of these fascinating texts we will be able to establish tight relationship between his real world and his poetic world. Their content will reveal us a double documental and literary aspect of one of the best poems of love of the XX century.La amada innombrada en la trilogía de poesía amorosa de Pedro Salinas (La voz a ti debida. Razón de amor, Largo lamento se presenta con nombre propio en el conjunto de cartas enviadas por el poeta a Katherine Whitmore. A través del análisis de este fascinante epistolario podremos establecer una estrecha relación entre el mundo real y el mundo poético saliniano. Su contenido nos revelará un doble aspecto documental y literario y nos acercará a uno de los mejores poemarios de temática amorosa del siglo XX.

  2. Non-photochemical quenching in cryptophyte alga Rhodomonas salina is located in chlorophyll a/c antennae.

    Science.gov (United States)

    Kaňa, Radek; Kotabová, Eva; Sobotka, Roman; Prášil, Ondřej

    2012-01-01

    Photosynthesis uses light as a source of energy but its excess can result in production of harmful oxygen radicals. To avoid any resulting damage, phototrophic organisms can employ a process known as non-photochemical quenching (NPQ), where excess light energy is safely dissipated as heat. The mechanism(s) of NPQ vary among different phototrophs. Here, we describe a new type of NPQ in the organism Rhodomonas salina, an alga belonging to the cryptophytes, part of the chromalveolate supergroup. Cryptophytes are exceptional among photosynthetic chromalveolates as they use both chlorophyll a/c proteins and phycobiliproteins for light harvesting. All our data demonstrates that NPQ in cryptophytes differs significantly from other chromalveolates - e.g. diatoms and it is also unique in comparison to NPQ in green algae and in higher plants: (1) there is no light induced xanthophyll cycle; (2) NPQ resembles the fast and flexible energetic quenching (qE) of higher plants, including its fast recovery; (3) a direct antennae protonation is involved in NPQ, similar to that found in higher plants. Further, fluorescence spectroscopy and biochemical characterization of isolated photosynthetic complexes suggest that NPQ in R. salina occurs in the chlorophyll a/c antennae but not in phycobiliproteins. All these results demonstrate that NPQ in cryptophytes represents a novel class of effective and flexible non-photochemical quenching.

  3. Non-photochemical quenching in cryptophyte alga Rhodomonas salina is located in chlorophyll a/c antennae.

    Directory of Open Access Journals (Sweden)

    Radek Kaňa

    Full Text Available Photosynthesis uses light as a source of energy but its excess can result in production of harmful oxygen radicals. To avoid any resulting damage, phototrophic organisms can employ a process known as non-photochemical quenching (NPQ, where excess light energy is safely dissipated as heat. The mechanism(s of NPQ vary among different phototrophs. Here, we describe a new type of NPQ in the organism Rhodomonas salina, an alga belonging to the cryptophytes, part of the chromalveolate supergroup. Cryptophytes are exceptional among photosynthetic chromalveolates as they use both chlorophyll a/c proteins and phycobiliproteins for light harvesting. All our data demonstrates that NPQ in cryptophytes differs significantly from other chromalveolates - e.g. diatoms and it is also unique in comparison to NPQ in green algae and in higher plants: (1 there is no light induced xanthophyll cycle; (2 NPQ resembles the fast and flexible energetic quenching (qE of higher plants, including its fast recovery; (3 a direct antennae protonation is involved in NPQ, similar to that found in higher plants. Further, fluorescence spectroscopy and biochemical characterization of isolated photosynthetic complexes suggest that NPQ in R. salina occurs in the chlorophyll a/c antennae but not in phycobiliproteins. All these results demonstrate that NPQ in cryptophytes represents a novel class of effective and flexible non-photochemical quenching.

  4. The use of a brine shrimp (Artemia salina) bioassay to assess the toxicity of diatom extracts and short chain aldehydes.

    Science.gov (United States)

    Caldwell, Gary S; Bentley, Matthew G; Olive, Peter J W

    2003-09-01

    Water soluble algal extracts, the aldehydes 2E,4E-decadienal, decanal, undecanal and the fatty acid eicosapentaenoic acid (EPA) were assayed for toxicity to hatching success and larval mortality of the brine shrimp Artemia salina. Both crude cellular extracts of the diatoms Skeletonema costatum and Nitzschia commutata and the diatom-derived short chain aldehyde decadienal were found to inhibit hatching success of A. salina cysts in a dose-dependent manner. Decadienal also significantly affected larval mortality rates in 24 and 72 h exposure incubations. The Artemia hatching success assay was the least sensitive of the three (EC50=3.94 microg ml(-1)). A greater sensitivity was observed for the 72 h compared with the 24 h exposure trials (EC50 for 24h=2.14, 72 h=0.023 microg ml(-1)). Decanal did not significantly affect survival or hatching success at the concentrations tested. Undecanal and EPA showed a limited toxic effect in naupliar mortality trials. We suggest that 72 h Artemia exposure trials represent an acceptable bioassay for diatom toxicity where alternative bioassays are unavailable.

  5. Evaluation of Culture Conditions to Obtain Fatty Acids from Saline Microalgae Species: Dunaliella salina, Sinecosyfis sp., and Chroomonas sp.

    Science.gov (United States)

    Castilla Casadiego, D. A.; Albis Arrieta, A. R.; Angulo Mercado, E. R.; Cervera Cahuana, S. J.; Baquero Noriega, K. S.; Suárez Escobar, A. F.; Morales Avendaño, E. D.

    2016-01-01

    The use of the saline microalgae, Dunaliella salina, Sinecosyfis sp., and Chroomonas sp., was explored as an alternative source for the production of fatty acids using fertilizer and glycerol as culture media. The nutrient medium used contained “Nutrifoliar,” a commercial fertilizer, and/or glycerol, in natural sea water. The microalgae were placed in cultures with different conditions. The parameters that favored the largest production of fatty acids were 24 hours of agitation and illumination, 1620 L/day of air supply, 2.25 L of air/min, and a temperature of 32°C using “Nutrifoliar” as the culture media. Results indicated that, from 3 g of microalgae in wet base of Chroomonas sp., 54.43 mg of oil was produced. The chromatographic characterization of oil obtained revealed the presence of essential fatty acids such as 9,12,15-octadecatrienoic acid (omega-3) and 4,7,10-hexadecatrienoic acid (omega-6) from the species Dunaliella salina. On the other hand, 9,12-octadecadienoic acid (omega-6) and cis-11-eicosenoic acid (omega-9) were identified from the species Chroomonas sp. The temperature variations played an important role in the velocity of growth or the production of the algae biomass, the amount of oil, and the ability to produce fatty acids. PMID:27376085

  6. Evaluation of Culture Conditions to Obtain Fatty Acids from Saline Microalgae Species: Dunaliella salina, Sinecosyfis sp., and Chroomonas sp.

    Directory of Open Access Journals (Sweden)

    D. A. Castilla Casadiego

    2016-01-01

    Full Text Available The use of the saline microalgae, Dunaliella salina, Sinecosyfis sp., and Chroomonas sp., was explored as an alternative source for the production of fatty acids using fertilizer and glycerol as culture media. The nutrient medium used contained “Nutrifoliar,” a commercial fertilizer, and/or glycerol, in natural sea water. The microalgae were placed in cultures with different conditions. The parameters that favored the largest production of fatty acids were 24 hours of agitation and illumination, 1620 L/day of air supply, 2.25 L of air/min, and a temperature of 32°C using “Nutrifoliar” as the culture media. Results indicated that, from 3 g of microalgae in wet base of Chroomonas sp., 54.43 mg of oil was produced. The chromatographic characterization of oil obtained revealed the presence of essential fatty acids such as 9,12,15-octadecatrienoic acid (omega-3 and 4,7,10-hexadecatrienoic acid (omega-6 from the species Dunaliella salina. On the other hand, 9,12-octadecadienoic acid (omega-6 and cis-11-eicosenoic acid (omega-9 were identified from the species Chroomonas sp. The temperature variations played an important role in the velocity of growth or the production of the algae biomass, the amount of oil, and the ability to produce fatty acids.

  7. Las matemáticas limpian el agua

    Directory of Open Access Journals (Sweden)

    Ana Elena Narro Ramírez

    2009-01-01

    Full Text Available En la ciudad de León es preocupante el problema del agua que es contaminada, principalmente, por curtidores de piel, fabricantes de calzado y agroindustriales. Por ley, las autoridades ambientales han presionado a cada infractor para que disminuya su contaminación, pero el esfuerzo ha resultado inútil. El objetivo de este trabajo es demostrar que este problema tiene solución. Para encontrarla se construye un programa no lineal dinámico que a partir de los procesos tradicionalmente utilizados en la limpieza proporciona como solución una estrategia innovadora de costo moderado que se prorratea entre los infractores usando jerarquización analítica.

  8. Acuaporinas: proteínas mediadoras del transporte de agua.

    OpenAIRE

    Julio César Sánchez

    2009-01-01

    Introducción. Todos los organismos vivos están compuestos en su mayoría por agua, siendo ésta fundamental para la homeostasis celular a todo nivel. Por esta razón su transporte a través de las membranas biológicas ha sido siempre un campo de gran interés en la fisiología. La investigación acerca de este tópico se ha incrementado notablemente en los últimos años a partir del descubrimiento de las acuaporinas, las cuales han permitido comprender mejor los mecanismos que la célula utiliza para e...

  9. Pasado, presente y futuro del agua: compartiendo una responsabilidad

    OpenAIRE

    Fournier Solano, María Elena

    2016-01-01

    En este artículo se reflexiona sobre la importancia del agua, su relación con aspectos económicos y políticos relevantes para la población civil, y sobre la esperanza del poder popular responsable y organizado para el rescate del recurso. Asimismo, se señalan ciertas relaciones del recurso hídrico con el Banco Mundial, el Plan Puebla Panamá, los corredores biológicos mesoamericanos privados, los tratados de libre comercio y la privatización de las áreas silvestres protegidas. Se destaca el he...

  10. Efectos cooperativos en heterotetrámeros (etanol)3-agua

    OpenAIRE

    2009-01-01

    La teoría de funcionales de la densidad (DFT: B3LYP/6-31+G(d)) fue empleada para la optimización de agregados estables sobre la superficie de energía potencial de los heterotetrámeros (etanol)3-agua.  Las energías de tetramerización pueden llegar a valores hasta de −21,00 kcal/mol.  Esta energía no se puede obtener considerando solo contribuciones de interacciones entre dos moléculas del agregado, lo cual sugiere la presencia de efectos cooperativos globales (positivos).  Tales efectos son re...

  11. Accumulation of mercury by Artemia populations of different salinas of Portugal

    Energy Technology Data Exchange (ETDEWEB)

    Boia, C.M.; Duarte, A.C. [Univ. of Aveiro (Portugal)

    1995-12-31

    The total mercury content in samples of the brine shrimp Artemia, sediments, water, suspended matter and, when available, algae, from nine salines of Portugal, was evaluated, to find out how mercury present in its natural habitat accumulates in Artemia. This study, carried out between 1990 and 1993, was part of a larger research project aiming to contribute to the knowledge on mercury accumulation and its effects on Artemia. This crustacean is used worldwide for marine species feeding in aquafarms, including in Portugal. The following sampling sites were chosen: some salinas of the lagoon of Aveiro, situated in the northern region of Portugal and partially contaminated with mercury-, the salt-mines of Rio Maior, in the interior of the central region of the country, where there are no sediments (the floor is cemented); and salt-marshes in the Algarve, in the south of Portugal. Mercury was determined by cold vapor absorption espectrofotometry after digestion of samples with sulfuric acid and potassium permanganate, and reference materials have been used to control the analytical performance. The concentrations of total Hg varied from 0.014 to 0.36 mg/Kg in the sediments, 0 to 0.30 {micro}g/g in the Artemia, 0.17 to 0.84 {micro}g/l in the suspended matter and 0.09 to 0.56 {micro}g/l in the water. The content of mercury in the artemias was strongly related to the concentration in the sediments, except when the algae were present, because they also accumulate a significantly percentage of the mercury. No relationships could be established with the Hg in water or in suspended matter (in mass of Hg/volume of filtered water), because their, content in Hg varied a lot with time and weather conditions, such as the wind strength. The presence of Hg in the sediments was due either to significant containing Hg discharges or to the composition of the sediments, being more important in the case of clays.

  12. Mitos y realidades sobre la crisis del agua en España

    Directory of Open Access Journals (Sweden)

    Llamas Madurga, M. Ramón

    1999-10-01

    Full Text Available Not available.Los problemas del agua están con tanta frecuencia en los periódicos que se ha hecho usual hablar de la existencia de una crisis del agua. Esos problemas se caracterizan por su complejidad y por su variabilidad, debida ésta tanto a la irregularidad climática, como a los rápidos cambios en la percepción social de estos problemas. Se analizan los principales paradigmas que rigen la política del agua en España. Se clasifican en tres grupos: éticos, estéticos y tecnológicos. Se da prioridad al análisis del primer grupo ya que los paradigmas éticos son los que más influyen en la gestión del agua.

  13. La hidrología y su papel en ingeniería del agua

    OpenAIRE

    Amanda García-Marín; José Roldán-Cañas; Javier Estévez; Fátima Moreno-Pérez; Aleix Serrat-Capdevila; Javier González; Félix Francés; Francisco Olivera; Oscar Castro-Orgaz; Giráldez, Juan V.

    2014-01-01

    La Hidrología es una ciencia esencial en Ingeniería del Agua, la cual abarca un amplio abanico de temas de investigación que engloban los diversos estadios del agua en el ciclo Hidrológico, tanto en atmósfera, superficie y suelo. Con motivo del relanzamiento de la revista Ingeniería del Agua se presenta un breve artículo de carácter introductorio en el que se muestran algunas de la líneas de investigación actuales en Hidrología, dedicadas a lluvia, interceptación de agua por la vegetación, se...

  14. Servicios ambientales, agua y economía

    Directory of Open Access Journals (Sweden)

    Juan Pablo Ruiz Soto

    2007-11-01

    Full Text Available Los servicios ambientales (SA asociados a los ecosistemas naturales están seriamente amenazados por acciones locales y por el calentamiento global. El SA asociado al agua y su efecto sobre calidad y cantidad en cuencas hidrográficas aportantes a acueductos y sistemas de riego, son de gran importancia económica y social. Para Bogotá-Colombia el SA de los páramos y bosque nublado en la cuenca de Chingaza representa US$18,2 millones anuales. Para el abastecimiento de agua a la ciudad de Quito-Ecuador, el efecto negativo del cambio climático (CC asociado a la contracción de los glaciares representa un incremento en la inversión de un 31% versus el escenario sin CC. Se deben tomar medidas para asegurar la permanencia de los SA y mitigar los efectos del CC./ Environmental services (ES related to natural ecosystems are seriously threatened by local activities and global warming. The ES related to water and its effect on quality and quantity in watersheds that supply aqueducts and irrigation systems has great social and economic importance. For Bogotá-Colombia the ES of páramos and cloudy forest in the Chingaza basin represents US$18.2 million per year. For water supply in the city of Quito-Ecuador, the negative effect of climate change (CC related to the contraction of glaciers represents a 31% increase in investments versus the scenario without CC. Measures must be taken to ensure the permanence of ES and mitigate the effects of CC.

  15. Respuesta productiva del cafeto al manejo del riego. Función agua-rendimiento

    Directory of Open Access Journals (Sweden)

    Enrique Cisneros Zayas

    2015-01-01

    Full Text Available La disponibilidad de agua para la agricultura está disminuy endo progresivamente, debido a la competencia entre dif erentes usuarios, lo que impone una utilización eficiente de este importante recurso. Para lograr elevar la productividad del agua es imprescindible el estudio de las f unciones agua-rendimiento. E l presente trabaj o tiene como obj etivo determinar las distintas f ormas de ex presió n de la f unció n agua-rendimiento, así como la productividad del agua (WP para el caf eto. Como resultado se tiene q ue el modelo lineal f ue el de mej or aj uste para las relaciones rendimiento/ evapotranspiración y rendimiento/agua aplicada por riego del cafeto, con coeficientes de determinación superiores a 0,70 y una eficiencia del agua evapotranspirada alrededor de 0,75 k g de caf é oro por cada milí metro adicional de agua. L os resultados del aná lisis de las f unciones usando valores relativos mostraron q ue si se satisf acen al 100% las necesidades del caf eto durante todo el ciclo del cultivo se puede esperar un rendimiento má x imo de 2,78 t· h a-1, y si se logra satisf acer en má s del 8 0% podrían ser superiores a 2,6 t· h a-1. E l f actor de respuesta del rendimiento Ky para el cafeto en las condiciones de este estudio resultó ser de 0,52. Por cada metro cú bico de agua consumida y agua aplicada por riego el caf eto produce como promedio 1,9 2 y 3 ,8 k g de caf é oro, respectivamente. L a productividad máxima se obtuvo con 5 3 9 9 m3 · h a-1 de agua consumida durante todo el año.

  16. Productividad del agua en algunos cultivos agrícolas en Cuba

    Directory of Open Access Journals (Sweden)

    Felicita González Robaina

    2014-01-01

    Full Text Available Para el mejor uso económico y social del agua se requieren de métodos para evaluar su productividad, a fin de tomar mejores decisiones en cuanto a políticas y estrategias de utilización de manera sostenible. Los administradores del agua para el riego necesitan iden- tificar tendencias en los patrones de uso y niveles de eficiencia con vistas a fijar metas y mejorar la productividad por unidad de volumen utilizado y/o consumido. El objetivo de este trabajo fue presentar los indicadores de productividad agronómica del agua de 17 cultivos a partir de la información obtenida en más de 100 experimentos de campo disponibles en la base de datos sobre necesidades hídricas del Instituto de Investigaciones de Ingeniería Agrícola. Se determinaron los rendimientos máximo y mínimo y sus respectivos valores de consumo, agua aplicada por riego y la productividad agronómica del agua aplicada para los 17 cultivos estudiados. Cultivos como los frijoles, maíz, boniato y los plátanos obtienen incrementos de rendimiento superiores al 100% cuando se aplica el agua necesaria para satisfacer su demanda hídrica, mientras que la yuca obtuvo valores menores del 50%. Los altos valores obtenidos de productividad en base al agua utilizada como riego no son un buen indicador del uso eficiente del agua por las plantas para las condiciones de la zona de estudio, donde se informan para los años analizados, porcentajes de lluvia aprovechable de hasta el 41%, supliendo ésta una parte importante de las necesidades de los cultivos agrícolas.

  17. Rehabilitación de la Casa del Agua (Trinitat Nova, Barcelona)

    OpenAIRE

    Duarte Fernández-Cueto, Íñigo

    2016-01-01

    EL proyecto propone la rehablitación de la casa del Agua en Trinitat Nova, un antiguo depósito de agua en este barrio de Barcelona. Se proyecta un sistema de cerramientos que comparten la luz y las solicitaciones técnicas, respetando la naturaleza del depósito y poniendo en valor su arquitectura. El nuevo programa responde a biblioteca + centro cívico.

  18. La privatización del agua en la Comunidad de Madrid

    OpenAIRE

    Fernández Yunquera, Rebeca; Rodríguez Sebastián, Alejandro

    2014-01-01

    Índice general:El gobierno especula: se cierra el grifo del agua pública.Los expertos opinan: razones contra la privatización.El pueblo habla: consulta social sobre el agua.La derecha ataca: intento de desprestigio público a Ladislao Martínez, promotor de la consulta.La oposición responde: políticos y sindicatos se posicionan.

  19. Plan director red de abastecimiento de agua potable en la localidad de Gestalgar (Valencia)

    OpenAIRE

    HERRERA AGUILAR, MANUEL JOSÉ

    2011-01-01

    El objeto de este proyecto es definir las características técnicas necesarias para aumentar la eficiencia de las redes de alta de suministro de agua potable en la localidad de Gestalgar (Valencia) Herrera Aguilar, MJ. (2011). Plan director red de abastecimiento de agua potable en la localidad de Gestalgar (Valencia). http://hdl.handle.net/10251/12468. Archivo delegado

  20. ¿Qué tan importante es el agua? Desarrollo sustentable y recursos naturales

    OpenAIRE

    Kras, Eva; Simonsen, Ove

    2001-01-01

    A partir de una definición de desarrollo sustentable, se presenta el modelo de desarrollo global como filosofía imperante en torno al agua, y las realidades globales del agua, particularmente en torno a la contaminación, la salud, y la sustentabilidad y seguridad. Se analizan las oportunidades y retos para los países en desarrollo de América Latina, y se proponen acciones puntuales.

  1. Los Catastros y Registros de Aguas como herramientas indispensables para garantizar la gestión integrada y desarrollo ambientalmente sustentable de las aguas subterráneas

    Directory of Open Access Journals (Sweden)

    Diego De Rosa

    2013-12-01

    Full Text Available Los catastros y registros de aguas resultan ser herramientas indispensables para garantizar la  gestión integrada y desarrollo ambientalmente sustentable de las aguas subterráneas.  Ellos constituyen instrumentos fundamentales ya no solo para asegurar el control y vigilancia respecto a quién o quienes se otorgan estos permisos, derechos o usos -y a quienes éstos son transmitidos-; sino también, y fundamentalmente, para determinar  qué cantidad, qué calidad y qué regularidad se tiene o posee del recurso hídrico subterráneo. A pesar de estar legislados en normas provinciales, no en todas se hallan implementados.  He aquí unos breves contrastes surgidos entre un  análisis comparativo de legislación sobre aguas de la Provincia de Buenos Aires y Mendoza.

  2. La hidrología y su papel en ingeniería del agua

    Directory of Open Access Journals (Sweden)

    Amanda García-Marín

    2014-07-01

    Full Text Available La Hidrología es una ciencia esencial en Ingeniería del Agua, la cual abarca un amplio abanico de temas de investigación que engloban los diversos estadios del agua en el ciclo Hidrológico, tanto en atmósfera, superficie y suelo. Con motivo del relanzamiento de la revista Ingeniería del Agua se presenta un breve artículo de carácter introductorio en el que se muestran algunas de la líneas de investigación actuales en Hidrología, dedicadas a lluvia, interceptación de agua por la vegetación, sensores en Hidrología, agua subterránea, entre otras. Dicha revisión no pretende ser exhaustiva, dado el tamaño limitado de este formato de publicación, sino motivar la publicación en Ingeniería del Agua de artículos dentro de la temática Hidrología.

  3. ECOFICCIONES E IMAGINARIOS DEL AGUA Y SU IMPORTANCIA PARA LA MEMORIA CULTURAL Y LA SOSTENIBILIDAD

    Directory of Open Access Journals (Sweden)

    Eloy Martos Núñez

    2013-07-01

    Full Text Available La cultura del agua debe ser vinculada de forma especial a las manifestaciones del patrimonio cultural intangible de los pueblos, como las tradiciones orales o escritas, la simbología o los rituales, que conforman lo que llamamos los Imaginarios del Agua. Estos deben ser analizados y deconstruidos a la luz de los nuevos paradigmas, como la hermenéutica y la ecocrítica. De este modo, la mitografía ayuda a perfilar el significado profundo de la cultura del agua ante las nuevas demandas medioambientales, educativas y culturales del siglo XXI, en un contexto donde el agua ya no es solo un recurso estratégico, sino un bien cultural ligado al desarrollo local y a las políticas de sostenibilidad. Por ello, al conocer las tradiciones ancestrales y los imaginarios en torno al agua, y al sensibilizar a los alumnos con los valores plurales de estas manifestaciones culturales --que siempre van encaminados al respeto y al conocimiento del patrimonio natural y cultural--, contribuimos de forma decisiva a la gobernanza del agua y a la gestión sostenible y responsable de los recursos hídricos, pues sin duda el principal problema de la sostenibilidad será la educación de los ciudadanos.

  4. Investigation of environmental factors on the prevalence of free bacteriophages against Shiga toxin-producing Escherichia coli strains in produce pre-harvest environment in Salinas, California

    Science.gov (United States)

    Investigation of environmental factors on the prevalence of free bacteriophages against Shiga toxin-producing Escherichia coli strains in produce pre-harvest environment in Salinas, California Yen-Te Liaoa, Irwin Quintelab, Kimberly Nguyena, Alexandra Salvadora, Michael Cooleya, and Vivian C.H. Wu*a...

  5. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine) : The use of Brine Shrimp Artemia salina in a variably saline lagoon complex

    NARCIS (Netherlands)

    Verkuil, Y.I.; Van der Have, TM; Van der Winden, J; Chernichko, [No Value

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  6. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine): the use of brine shrimp Artemia salina in a variably saline lagoon complex.

    NARCIS (Netherlands)

    Verkuil, Y.; Have, van der T.M.; Winden, van der J.; Chernichko, I.I.

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  7. High surface adsorption properties of carbon-based nanomaterials are responsible for mortality, swimming inhibition, and biochemical responses in Artemia salina larvae

    Energy Technology Data Exchange (ETDEWEB)

    Mesarič, Tina, E-mail: tina.mesaric84@gmail.com [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Gambardella, Chiara, E-mail: chiara.gambardella@ge.ismar.cnr.it [Institute of Marine Sciences, National Research Council, Genova (Italy); Milivojević, Tamara, E-mail: milivojevictamara@gmail.com [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Faimali, Marco, E-mail: marco.faimali@ismar.cnr.it [Institute of Marine Sciences, National Research Council, Genova (Italy); Drobne, Damjana, E-mail: damjana.drobne@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Centre of Excellence in Nanoscience and Nanotechnology (CO Nanocentre), Ljubljana (Slovenia); Centre of Excellence in Advanced Materials and Technologies for the Future (CO NAMASTE), Ljubljana (Slovenia); Falugi, Carla, E-mail: carlafalugi@hotmail.it [Department of Earth, Environment and Life Sciences, University of Genova, Genova (Italy); Makovec, Darko, E-mail: darko.makovec@ijs.si [Jožef Stefan Institute, Jamova 39, 1000 Ljubljana (Slovenia); Jemec, Anita, E-mail: anita.jemec@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Sepčić, Kristina, E-mail: kristina.sepcic@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia)

    2015-06-15

    Highlights: • Carbon-based nanomaterials adsorb onto the body surface of A. salina larvae. • Surface adsorption results in concentration–dependent inhibition of larval swimming. • Carbon-based nanomaterials induce no significant mortality of A. salina larvae. - Abstract: We investigated the effects of three different carbon-based nanomaterials on brine shrimp (Artemia salina) larvae. The larvae were exposed to different concentrations of carbon black, graphene oxide, and multiwall carbon nanotubes for 48 h, and observed using phase contrast and scanning electron microscopy. Acute (mortality) and behavioural (swimming speed alteration) responses and cholinesterase, glutathione-S-transferase and catalase enzyme activities were evaluated. These nanomaterials were ingested and concentrated in the gut, and attached onto the body surface of the A. salina larvae. This attachment was responsible for concentration–dependent inhibition of larval swimming, and partly for alterations in the enzyme activities, that differed according to the type of tested nanomaterials. No lethal effects were observed up to 0.5 mg/mL carbon black and 0.1 mg/mL multiwall carbon nanotubes, while graphene oxide showed a threshold whereby it had no effects at 0.6 mg/mL, and more than 90% mortality at 0.7 mg/mL. Risk quotients calculated on the basis of predicted environmental concentrations indicate that carbon black and multiwall carbon nanotubes currently do not pose a serious risk to the marine environment, however if uncontrolled release of nanomaterials continues, this scenario can rapidly change.

  8. La posible creación de mercados de agua y la gobernabilidad de este recurso en Colombia. Comentarios sobre el proyecto de ley del agua

    OpenAIRE

    Manuel Rodríguez Becerra

    2005-01-01

    En la actualidad se está tramitando un proyecto de Ley del Agua en el Congreso de la República, presentado a su consideración por el Gobierno Nacional, mediante el cual "se establecen medidas para orientar la planificación y administración del recurso hídrico en el territorio nacional." Se trata de la segunda reforma del gobierno del Presidente Alvaro Uribe relacionada con la gestión del agua en Colombia. En efecto, al principio de su gobierno se expidió la Ley de 2003 de creación del Ministe...

  9. El agua no cae del cielo: gobernación y gestión del agua en el Pacífico Sur

    OpenAIRE

    2013-01-01

    La seguridad hídrica se está volviendo una preocupación central en el cotidiano de muchas comunidades rurales por todo el mundo y se relaciona con cada una de las siete dimensiones de la seguridad humana, ampliando todo tipo de vulnerabilidades. De acuerdo con el informe del Foro Económico Mundial sobre el nexo agua-alimentos-energía-clima, la gestión del agua se está volviendo una materia política urgente en el debate de la sostenibilidad y de la seguridad humana a escala global. Asimismo, h...

  10. Volúmenes molales parciales de transferencia de algunas sulfonamidas desde el agua hasta la mezcla agua-etanol (X = 0.5)

    OpenAIRE

    2002-01-01

    A partir de valores de densidad de soluciones de diferentes concentraciones, determinados a 25,00 °C, se calcularon los volúmenes molales parciales de transferencia a dilución infinita de algunas sulfonamidas estructuralmente relacionadas, como especies moleculares y como sales sódicas, desde el agua hasta la mezcla agua-etanol de composición 0.5 en fracción molar; adicionalmente se calcularon los volúmenes de los grupos sustituyentes. Los resultados se discuten en términos de interacciones e...

  11. Huella energética del agua y manejo sustentable urbano del agua: diagnóstico estratégico aplicado a la vivienda de Tamaulipas.

    OpenAIRE

    Fernando Córdova Canela

    2012-01-01

    El presente trabajo tiene como objetivo general el proponer un diagnóstico estratégico aplicable a la vivienda del Estado de Tamaulipas, en cinco ciudades elegidas para tal fin, que vincule los conceptos de huella energética del agua en la vivienda con el manejo sustentable del agua en la ciudad. Dicho diagnóstico identificará las relaciones sistémicas entre los conceptos citados a partir de la interpretación de la información generada desde instrumentos que califiquen la huella energética de...

  12. Determinación de la concentración de metales pesados en agua, suelo y cultivos regados con agua de la Presa Manuel Avila Camacho.

    OpenAIRE

    Larenas Bazán, Nelli Natalia

    2011-01-01

    La presa Manuel Ávila Camacho se construyó para aprovechar los escurrimientos de los ríos Atoyac y Alseseca, con propósitos de riego. La contaminación de estos ríos tiene su origen en las descargas de aguas residuales urbanas e industriales, y el uso de aguas residuales no tratadas para la irrigación de cultivos agrícolas, ha contribuido en la contaminación de suelos y plantas por metales pesados (MP), lo cual representa un riesgo para la salud humana y animal. En este sentido, el objetivo de...

  13. Comparative study on toxicity of ZnO and TiO2 nanoparticles on Artemia salina: effect of pre-UV-A and visible light irradiation.

    Science.gov (United States)

    Bhuvaneshwari, M; Sagar, Bhawana; Doshi, Siddharth; Chandrasekaran, N; Mukherjee, Amitava

    2017-02-01

    This study evaluated the toxicity potential of ZnO and TiO2 nanoparticles under pre-UV-A irradiation and visible light condition on Artemia salina. The nanoparticle suspension was prepared in seawater medium and exposed under pre-UV-A (0.23 mW/cm(2)) and visible light (0.18 mW/cm(2)) conditions. The aggregation profiles of both nanoparticles (NPs) and dissolution of ZnO NPs under both irradiation conditions at various kinetic intervals (1, 24, 48 h) were studied. The 48-h LC50 values were found to be 27.62 and 71.63 mg/L for ZnO NPs and 117 and 120.9 mg/L for TiO2 NPs under pre-UV-A and visible light conditions. ZnO NPs were found to be more toxic to A. salina as compared to TiO2 NPs. The enhanced toxicity was observed under pre-UV-A-irradiated ZnO NPs, signifying its phototoxicity. Accumulation of ZnO and TiO2 NPs into A. salina depends on the concentration of particles and type irradiations. Elimination of accumulated nanoparticles was also evident under both irradiation conditions. Other than ZnO NPs, the dissolved Zn(2+) also had a significant effect on toxicity and accumulation in A. salina. Increased catalase (CAT) activity in A. salina indicates the generation of oxidative stress due to NP interaction. Thus, this study provides an understanding of the toxicity of photoreactive ZnO and TiO2 NPs as related to the effects of pre-UV-A and visible light irradiation.

  14. Comparing cestode infections and their consequences for host fitness in two sexual branchiopods: alien Artemia franciscana and native A. salina from syntopic-populations.

    Science.gov (United States)

    Redón, Stella; Amat, Francisco; Sánchez, Marta I; Green, Andy J

    2015-01-01

    The American brine shrimp Artemia franciscana is invasive in the Mediterranean region where it has displaced native species (the sexual A. salina, and the clonal A. parthenogenetica) from many salt pond complexes. Artemia populations are parasitized by numerous avian cestodes whose effects have been studied in native species. We present a study from the Ebro Delta salterns (NE Spain), in a salt pond where both A. franciscana and native A. salina populations coexist, providing a unique opportunity to compare the parasite loads of the two sexual species in syntopy. The native species had consistently higher infection parameters, largely because the dominant cestode in A. salina adults and juveniles (Flamingolepis liguloides) was much rarer in A. franciscana. The most abundant cestodes in the alien species were Eurycestus avoceti (in adults) and Flamingolepis flamingo (in juveniles). The abundance of E. avoceti and F. liguloides was higher in the A. franciscana population syntopic with A. salina than in a population sampled at the same time in another pond where the native brine shrimp was absent, possibly because the native shrimp provides a better reservoir for parasite circulation. Infection by cestodes caused red colouration in adult and juvenile A. salina, and also led to castration in a high proportion of adult females. Both these effects were significantly stronger in the native host than in A. franciscana with the same parasite loads. However, for the first time, significant castration effects (for E. avoceti and F. liguloides) and colour change (for six cestode species) were observed in infected A. franciscana. Avian cestodes are likely to help A. franciscana outcompete native species. At the same time, they are likely to reduce the production of A. franciscana cysts in areas where they are harvested commercially.

  15. Comparing cestode infections and their consequences for host fitness in two sexual branchiopods: alien Artemia franciscana and native A. salina from syntopic-populations

    Directory of Open Access Journals (Sweden)

    Stella Redón

    2015-07-01

    Full Text Available The American brine shrimp Artemia franciscana is invasive in the Mediterranean region where it has displaced native species (the sexual A. salina, and the clonal A. parthenogenetica from many salt pond complexes. Artemia populations are parasitized by numerous avian cestodes whose effects have been studied in native species. We present a study from the Ebro Delta salterns (NE Spain, in a salt pond where both A. franciscana and native A. salina populations coexist, providing a unique opportunity to compare the parasite loads of the two sexual species in syntopy. The native species had consistently higher infection parameters, largely because the dominant cestode in A. salina adults and juveniles (Flamingolepis liguloides was much rarer in A. franciscana. The most abundant cestodes in the alien species were Eurycestus avoceti (in adults and Flamingolepis flamingo (in juveniles. The abundance of E. avoceti and F. liguloides was higher in the A. franciscana population syntopic with A. salina than in a population sampled at the same time in another pond where the native brine shrimp was absent, possibly because the native shrimp provides a better reservoir for parasite circulation. Infection by cestodes caused red colouration in adult and juvenile A. salina, and also led to castration in a high proportion of adult females. Both these effects were significantly stronger in the native host than in A. franciscana with the same parasite loads. However, for the first time, significant castration effects (for E. avoceti and F. liguloides and colour change (for six cestode species were observed in infected A. franciscana. Avian cestodes are likely to help A. franciscana outcompete native species. At the same time, they are likely to reduce the production of A. franciscana cysts in areas where they are harvested commercially.

  16. Resistencia antimicrobiana de cepas de Bartonella bacilliformis procedentes de regiones endémicas de la Enfermedad de Carrión en EL Perú

    Directory of Open Access Journals (Sweden)

    Giovanna Mendoza-Mujica

    Full Text Available Objetivos. Evaluar la susceptibilidad antimicrobiana in vitro a cloranfenicol (CHL y ciprofloxacino (CIP de cepas de Bartonella bacilliformis procedentes de áreas endémicas de la enfermedad de Carrión (EC en el Perú, mediante tres métodos de laboratorio. Materiales y métodos. Se evaluó la susceptibilidad antimicrobiana a CHL y CIP de 100 cepas de Bartonella bacilliformis, los aislamientos procedieron de pacientes de los departamentos de Ancash, Cusco, Cajamarca, Lima y La Libertad; las cepas se evaluaron mediante: disco difusión, E-Test y dilución en agar. Resultados. El 26% de las cepas de Bartonella bacilliformis evaluadas, presentaron resistencia a CIP y 1% a CHL. Se obtuvieron patrones similares de sensibilidad/resistencia antimicrobiana en los tres métodos utilizados. Conclusiones. Las cepas de Bartonella bacilliformis circulantes en el Perú, presentan elevados niveles de resistencia in vitro a CIP, por lo que se recomienda ampliar la investigación sobre la utilización del fármaco en los esquemas de tratamiento de la EC. Los métodos de E-test y disco difusión resultaron más convenientes para la evaluación de la susceptibilidad antimicrobiana in vitro del microorganismo

  17. Degradación microbiana de cianuro procedente de plantas de beneficio de oro mediante una cepa nativa de P. fluorecens

    Directory of Open Access Journals (Sweden)

    OSCAR JAIME RESTREPO

    2006-01-01

    Full Text Available El cianuro es el compuesto lixiviante más utilizado en la industria metalúrgica de metales preciosos. El cianuro presenta efectos nocivos, entre los que se destacan su alta toxicidad y su efecto inhibitorio en la respiración celular. En este trabajo se probó la alternativa biotecnológica de degradar cianuro empleando una cepa nativa de P. fluorescens, aislada a partir de muestras de arenas procedentes de plantas de beneficio de oro que utilizan la cianuración ubicadas en municipio de Segovia, Colombia. En la mayor parte de las plantas de tratamiento no se controlan técnicamente los procesos, lo cual lleva a la utilización de cantidades de NaCN por encima de las necesarias, generando altas descargas del exceso tanto en solución como en las arenas descartadas. Las pruebas de toxicidad realizadas con D. pulex indican que una concentración de cianuro mayor o igual a 54 ppm es suficiente para intoxicar e inhibir su sobrevivencia. Los tratamientos convencionales para degradación de cianuro, suelen ser muy comunes y eficientes, sin embargo presentan desventajas por el alto costo que conlleva la compra de los reactivos necesarios. El tratamiento microbiano por su parte, demuestra eliminar grandes cantidades de cianuro de una manera eficiente y económica.

  18. Estudios sobre leishmaniasis tegumentaria en el Perú. I. Infección experimental de perros con cepas de leishmanias procedentes de casos de Uta

    Directory of Open Access Journals (Sweden)

    Arístides Herrer

    1951-01-01

    Full Text Available Se han inoculado varias series de perros con cepas de leishmanias procedentes de la forma clínica de la leishmaniasis tegumentaria conocida en el Perú con el nombre de uta, usando con tal objeto material tomado directamente de las lesiones utosas así como también cultivos del parásito. Los principales resultados obtenidos en tales inoculaciones son los siguientes: 1. Ha sido imposible infectar al perro con cultivos mantenidos solamente in vitro por espacio de cinco a ocho años, no obstante de haberse ensayado en tres series distintas de inoculaciones. 2. Se ha conseguido infecciones experimentales en el 87 por ciento de los perros que fueron inoculados con cultivos de reciente aislamiento. Aunque las inoculaciones fueran hechas bajo las mismas circunstancias en el dorso del hocico y la cara interna de una de las orejas, la infección se ha obtenido principalmente en el hocico. 3. También se ha logrado infectar perros inoculándoles material tomado directamente de las lesiones leishmaniásicas, ya sea de casos de uta o de lesiones producidas experimentalmente en otros perros.

  19. Estudio de la resistencia a compresión simple del adobe elaborado con suelos procedentes de Crescencio Valdés, Villa Clara, Cuba

    Directory of Open Access Journals (Sweden)

    Barroso, I. J.

    2008-09-01

    Full Text Available In this article we study the resistance to simple compression of the adobe bricks with building purposes. The study was carried out with various clay soils from Crescencio Valdés village, municipality of Camajuaní, Villa Clara, Cuba. In order to select the best soils to construction we have considered 1 MPa (10 kg/cm2 as minimum resistance to simple compression. So the soils that do not verify that requirement have been improved only by adding sand.En este artículo se estudia la resistencia a compresión simple que presenta el adobe elaborado con diferentes suelos procedentes del pueblo de Crescencio Valdés, situado en el municipio de Camajuaní, Villa Clara, Cuba. Se valora la idoneidad de la utilización de cada suelo estudiado bajo la premisa de alcanzar con el adobe elaborado una resistencia a compresión simple de 1 MPa (10 kg/cm2, ya que dicho adobe será utilizado posteriormente para edificación en dicho pueblo

  20. Broncística y Poblamiento post-orientalizante en la Alta Extremadura: a partir de unos materiales procedentes de El Risco (Sierra de Fuentes, Cáceres

    Directory of Open Access Journals (Sweden)

    F. Javier JIMÉNEZ ÁVILA

    2009-12-01

    Full Text Available RESUMEN: Se presenta un conjunto de objetos procedentes del poblado de El Risco (Sierra de Fuentes, Cáceres, fundamentalmente de bronce, que por su morfología permiten ir conociendo la broncística de la Alta Extremadura durante la Primera Edad del Hierro y las relaciones que estas tierras mantienen con otros territorios peninsulares, particularmente con el Suroeste. El carácter de objetos de lujo de la mayor parte de la muestra (vajilla, asadores, arreos de caballo, objetos cultuales lleva a preguntarse sobre la función que desempeñaría este poblado en el panorama del mal conocido Hierro Antiguo (ss. VII-V a.C. de la Alta Extremadura.ABSTRACT: A whole of archaeologial finds from the site of El Risco (Sierra de Fuentes, Cáceres is presented. They are esentially a serie of bronzes that makes possible to know for the first time the appearance of the regional bronzework at the Early Iron Age, and the relationship between this area and others regions, specially, the Southwestern Iberian Peninsula. The luxurious nature of the objects (jugs, bassins, spits, horse-bits, incense-burners... involves some reflexions about the function of this site in the unknown scene of the Early Iron (7th-5th centuries B.C. at North-Extremadura.

  1. Dispositivo electrónico de medición del caudal de agua para canales abiertos

    OpenAIRE

    Julio Cesar Ayala López; Roberto Albóniga Gil

    2015-01-01

    El método de riego por inundación, que desplaza el agua mediante canales abiertos y surcos ha sido usado durante años en la producción agrícola, aunque requiere una gran cantidad de agua y su eficacia no es muy alta ya que la mayoría del agua no se puede extraer directamente en las raíces de las plantas. Siendo de vital importancia lograr datos de campo confiables y lo suficientemente precisos que nos permitan estudiar y proyectar manejos del agua con el menor grado de incertidumbre posi...

  2. Funciones agua rendimiento para 14 cultivos agrícolas en condiciones del sur de La Habana

    OpenAIRE

    Felicita González Robaina; Julián Herrera Puebla; Teresa López Seijas; Greco Cid Lazo

    2013-01-01

    El estudio de las funciones agua rendimiento y su uso dentro de la planificación del uso del agua es una vía importante para trazar estrategias de manejo que contribuyan al incremento en la producción agrícola. Utilizando los datos de consumo de agua, agua aplicada por riego, precipitaciones y los rendimientos obtenidos en más de 100 experimentos de campo realizados fundamentalmente en suelo Ferralítico Rojo de la zona sur de La Habana y con ayuda de herramientas de análisis de regresión en e...

  3. Modelaje estocástico de la variabilidad espacial de la calidad de agua en un ecosistema lacustre

    OpenAIRE

    Celia de la Mora Orozco; J. Germán Flores Garnica; J. Ariel Ruiz Corral; Javier García Velasco

    2004-01-01

    Por su importancia como fuente abastecedora de agua de la zona metropolitana de Guadalajara, el Lago de Chapala requiere de estrategias de manejo adecuadas. Esto implica la evaluación de la calidad de agua, lo cual incluye varios parámetros físicos, químicos y biológicos, que por sí mismos no proporcionan un diagnóstico adecuado. Por lo que, para caracterizar los niveles de calidad de agua en el Lago de Chapala, en este proyecto se usó el concepto de Índice de Calidad del Agua (ICA). Para cap...

  4. Mercado de derechos de agua para uso agrícola en el noroeste de México

    OpenAIRE

    Lorenzo Fidel Cota-Verdugo; Alfredo Beltrán-Morales; Enrique Troyo-Diéguez; José Luís García-Hernández; Luis Felipe Beltrán-Morales; Víctor Ángel Hernández-Trejo; Alfredo Ortega-Rubio; Agustín Navarro Bravo

    2013-01-01

    El estado de Baja California sur, es una zona árida y la provisión de agua para la agricultura y demás usos, se sustenta en acuíferos subterráneos. La legislación en materia de agua se ha modificado acorde al problema evidente del crecimiento en el consumo, especialmente para uso agrícola, incluyendo la figura de mercados de derechos de agua. El objetivo de este trabajo, es buscar mecanismos de mercado que legalicen las transacciones de agua entre usuarios agrícolas, proponer la implementaci...

  5. Nutritional Composition, in vitro Antioxidant Activity and Artemia salina L. Lethality of Pulp and Seed of Tamarindus indica L. Extracts.

    Science.gov (United States)

    Khairunnuur, F A; Zulkhairi, A; Azrina, A; Moklas, Ma M; Khairullizam, S; Zamree, M S; Shahidan, M A

    2009-03-01

    This study was designed to examine the nutritional composition, antioxidant activity and medium lethal concentration (LC50 value) of Tamarindus indica L. pulp and seed extracts in vitro. The extraction was set at 40◦C, 60◦C and 100◦C for 12 hours, 6 hours and 15 minutes respectively to determine the optimum extraction parameter whereas the anti-oxidant activity of the extracts was measured using iron (III) reduction (FRAP) assay. Total phenolic content (TPC) of the extracts was estimated as gallic acid equivalent by Folin-Ciocalteau method. Toxicity potential of the extract was assessed in vitro by Artemia salina lethality test both in seed and pulp samples. The results showed that tamarind seed contained a higher percentage of carbohydrate, protein, fat and energy (15%, 82%, 95% and 33.13% respectively) than the pulp. On the other hand, the pulp demonstrated a high moisture (51.1%) and ash (34.84%) content than the seed. For the mineral analysis, tamarind seed contained higher Ca and C (1.0% and 50.73% respectively) than the pulp (0.27% and 40.40% respectively). No heavy metals were detected in both samples. Seed extracted at 60◦C/6 hours and 100◦C/15 minutes showed the highest TPC value and were significantly different (pseed extracted at 40◦C/12 hours. Anti-oxidant activity is positively correlated to the TPC value of the extracts (R=0.991). The pulp and seed extracted at 100◦C/15 minutes showed the highest FRAP value among its groups (216.17 ± 14.06 μmol (Fe)/g and 659.74 ± 16.40 μmol (Fe)/g respectively). This study indicates that tamarind pulp and seed extracts possess beneficial antioxidant properties and the optimum extraction parameter is 100◦C for 15 minutes. In Artemia salina lethality test, tamarind pulp caused significant mortality of the crustacean larvae with LC50 in the range of 26-28 μL/mL. Tamarind seed were not toxic to Artemia salina since the LC50 of the extracts was higher than 1000 μL/mL.

  6. Influence of PbS nanoparticle polymer coating on their aggregation behavior and toxicity to the green algae Dunaliella salina

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hajar [Department of Biology, Faculty of Sciences, Shiraz University, Shiraz 71454 (Iran, Islamic Republic of); Moradshahi, Ali, E-mail: moradshahi@susc.ac.ir [Department of Biology, Faculty of Sciences, Shiraz University, Shiraz 71454 (Iran, Islamic Republic of); Jahromi, Hamed Dehdashti; Sheikhi, Mohammad Hosein [Nanotechnology Research Institute, Shiraz University, Shiraz 71454 (Iran, Islamic Republic of)

    2014-09-15

    Highlights: • Lead sulfide nanoparticles (PbS NPs) are toxic to D. salina. • Gum-Arabic coating alters the toxicity of PbS NPs. • Cell-NPs agglomerates and lipid peroxidation could explain the toxicity of PbS NPs. • Shading effect and dissolution do not seem to contribute to the toxicity of PbS NPs. • Particle–particle interaction was reduced by coating; therefore, PbS NPs were stabilized in the culture media. - Abstract: The potential hazards of nanoparticles (NPs) to the environment and to living organisms need to be considered for a safe development of nanotechnology. In the present study, the potential toxic effects of uncoated and gum Arabic-coated lead sulfide nanoparticles (GA-coated PbS NPs) on the growth, lipid peroxidation, reducing capacity and total carotenoid content of the hypersaline unicellular green algae Dunaliella salina were investigated. Coatings of PbS NPs with GA, as confirmed by Fourier transform infrared spectroscopy, reduced the toxicity of PbS NPs. Uncoated PbS NP toxicity to D. salina was attributed to higher algal cell-NP agglomerate formation, higher lipid peroxidation, lower content of total reducing substances and lower total carotenoid content. Low levels of Pb{sup 2+} in the growth culture media indicate that PbS NP dissolution does not occur in the culture. Also, the addition of 100 μM Pb{sup 2+} to the culture media had no significant (P > 0.05) effect on algal growth. The shading of light (shading effect) by PbS NPs, when simulated using activated charcoal, did not contribute to the overall toxic effect of PbS NPs which was evident by insignificant (P > 0.05) reduction in the growth and antioxidant capacity of the algae. When PbS NP aggregation in culture media (without algal cells) was followed for 60 min, uncoated form aggregated rapidly reaching aggregate sizes with hydrodynamic diameter of over 2500 nm within 60 min. Effective particle–particle interaction was reduced in the GA-coated NPs. Aggregates of about

  7. Fatty acid profile of "bottled butter fat" produced in the region of Salinas, Minas Gerais Perfil dos ácidos graxos de "manteigas de garrafa" produzidas na região de Salinas - Minas Gerais

    Directory of Open Access Journals (Sweden)

    Maria das Graças Clemente

    2009-12-01

    Full Text Available The economic history of Salinas, Minas Gerais is largely based on cattle-breeding. The discoverers found in the city's region a large potential for the progress of their activities, either in agriculture or in cattle-breeding (OLIVEIRA, 2000. Even today, milk production plays an important role in family farming activities, which besides raw milk, provides curdal cheese, cottage cheese, and "bottled butter fat", which is manufactured with fat extracted from whey. Therefore, this study was conducted to analyze the fatty acid profile of "bottled butter fat" produced in Salinas, in the northern region of Minas Gerais , and also to analyze the ratio of saturated to unsaturated fatty acid of these butters. The fatty acid profile of the "bottled butter fat" was determined by chromatographic analysis, according to methodology advanced by Luddy et al. (1960, and later modified by Abreu (1993. Analysis of variance was applied for comparison of the averages by the Tukey test at 5% probability. The fatty acid profiles of all the "bottled butter fat" were found to be similar. The concentration of saturated fatty acids was higher than that of the unsaturated, with averages of 60,36% and 39,64%, respectively.A história econômica de Salinas apóia-se em grande parte na pecuária. Os desbravadores encontraram na região do município, um grande potencial para o desenvolvimento de suas atividades, seja na lavoura de mantimentos, seja na pecuária (OLIVEIRA, 2000. Até hoje, a produção de leite ocupa certo destaque nas atividades da agricultura familiar que, além do leite "in natura", fornece também o queijo de coalho, o requeijão e, dos soros obtidos desses produtos elabora-se a manteiga de garrafa. Assim, esse estudo foi realizado com o objetivo de analisar o perfil dos ácidos graxos de manteigas de garrafa produzidas em Salinas, norte de Minas Gerais e análise da relação de ácidos graxos saturados: ácidos graxos insaturados dessas manteigas. O

  8. Avaliação ambiental do município de Salinas da Margarida, Bahia, Brasil

    OpenAIRE

    Nazar Ramos, María Loreto

    2013-01-01

    [Resumo] linas da Margarida é um município localizado na parte sul da Bahia de Todos os Santos, caracteriza-se por ser um município netamente costeiro que abarca uma área continental de 65 Km2, e é constituído por seis comunidades, sendo elas Encarnação, Dendê, Salinas Sede, Conceição, Cairu, e Barra do Paraguaçu. Poucos são os estudos que integram dados químicos, biológicos e sociais visando melhorar as políticas de desenvolvimento pesqueiro. A pesca no município é basicamente de subsistênci...

  9. Geology of the Delta, Escalante, Price, Richfield and Salina 1 deg x 2 deg NTMS quadrangles, Utah

    Science.gov (United States)

    Thayer, P. A.

    1981-11-01

    The National Uranium Resource Evaluation (NURE) program was established to evaluate domestic uranium resources in the continental United States and to identify areas favorable for uranium exploration. The Grand Junction Office of the Department of Energy is responsible for administering the program. The Savannah River Laboratory (SRL) is responsible for hydrogeochemical and stream-sediment reconnaissance (HSSR) of 3.9 million sq km (1,500,000 mi(2)) in 37 eastern and western states. This document provides geologic and mineral resources reports for the Delta, Escalante, Price, Richfield, and Salina 1 deg x 2 deg National Topographic Map Series quadrangles, Utah. The purpose of these reports is to provide background geologic and mineral resources information to aid in the interpretation of NURE geochemical reconnaissance data. Except for the Escalante Quadrangle, each report is accompanied by a geologic map and a mineral locality map (Plates 1-8, in pocket).

  10. Groundwater-quality data in the Monterey–Salinas shallow aquifer study unit, 2013: Results from the California GAMA Program

    Science.gov (United States)

    Goldrath, Dara A.; Kulongoski, Justin T.; Davis, Tracy A.

    2016-09-01

    Groundwater quality in the 3,016-square-mile Monterey–Salinas Shallow Aquifer study unit was investigated by the U.S. Geological Survey (USGS) from October 2012 to May 2013 as part of the California State Water Resources Control Board Groundwater Ambient Monitoring and Assessment (GAMA) Program’s Priority Basin Project. The GAMA Monterey–Salinas Shallow Aquifer study was designed to provide a spatially unbiased assessment of untreated-groundwater quality in the shallow-aquifer systems in parts of Monterey and San Luis Obispo Counties and to facilitate statistically consistent comparisons of untreated-groundwater quality throughout California. The shallow-aquifer system in the Monterey–Salinas Shallow Aquifer study unit was defined as those parts of the aquifer system shallower than the perforated depth intervals of public-supply wells, which generally corresponds to the part of the aquifer system used by domestic wells. Groundwater quality in the shallow aquifers can differ from the quality in the deeper water-bearing zones; shallow groundwater can be more vulnerable to surficial contamination.Samples were collected from 170 sites that were selected by using a spatially distributed, randomized grid-based method. The study unit was divided into 4 study areas, each study area was divided into grid cells, and 1 well was sampled in each of the 100 grid cells (grid wells). The grid wells were domestic wells or wells with screen depths similar to those in nearby domestic wells. A greater spatial density of data was achieved in 2 of the study areas by dividing grid cells in those study areas into subcells, and in 70 subcells, samples were collected from exterior faucets at sites where there were domestic wells or wells with screen depths similar to those in nearby domestic wells (shallow-well tap sites).Field water-quality indicators (dissolved oxygen, water temperature, pH, and specific conductance) were measured, and samples for analysis of inorganic

  11. Toxicity of lapachol and isolapachol and their potassium salts against Biomphalaria glabrata, Schistosoma mansoni cercariae, Artemia salina and Tilapia nilotica.

    Science.gov (United States)

    Lima, Nadja Maria Fernandes; dos Santos, Aldenir Feitosa; Porfírio, Zenaldo; Goulart, Marília O F; Sant'Ana, Antônio Euzébio G

    2002-07-01

    The toxicity of soluble derivatives (potassium salt) of lapachol and isolapachol in different stages of the life cycle of Schistosoma mansoni is evaluated. The potassium salts of isolapachol and lapachol showed significant molluscicidal activity against the adult snail (LC90Artemia salina Leach) indicated very high toxicity for the potassium salt of isolapachol (LC90=1.54 ppm), differently from the potassium salt of lapachol that can be considered non toxic (LC90=176.3 ppm). The same tendency is observed with piscicidal activity, for which the isolapachol salt has showed higher toxicity. The obtained selectivity ratios concerning LC50 and LC90 for lapachol, in relation to Tilapia nilotica lethality assay are 2.33 and 1.26, respectively. Despite the piscicidal toxicity, the use of the salt of lapachol can be recommended for field tests in Schistosomiasis, with caution.

  12. A butyrylcholinesterase in the early development of the brine shrimp (Artemia salina) larvae: a target for phthalate ester embryotoxicity?

    Science.gov (United States)

    Acey, Roger A; Bailey, Stacie; Healy, Patricia; Jo, Chang; Unger, Thomas F; Hudson, Richard A

    2002-12-13

    The phthalate ester insensitive blue-green algae (Synechococcus lividus) were used as a food source to extend the survival of synchronously hatched brine shrimp (Artemia salina) larvae allowing measurement of a reduced toxic response to phthalate esters at late post-hatching stages of development. The maximum acute toxicity due to di-n-butyl phthalate (DNBP) correlated with the expression of a phthalate ester-hydrolyzing enzyme. The purified enzyme was identified as a butyrylcholinesterase due to its rapid inactivation by low concentrations (10(-7)M) of diisopropyl fluorophosphate and inhibition by physostigmine (IC(50)=6 x 10(-7)M) and tetraisopropylpyrophosphoramide (I-OMPA, IC(50)=x 10(-6)M) but not by BW284c5. Apparently competition of the phthalates with the endogenous substrates of the enzyme led to development-dependent toxicity.

  13. The lethality of Euphorbia conspicua to adults of Biomphalaria glabrata, cercaria of Schistosoma mansoni and larvae of Artemia salina.

    Science.gov (United States)

    dos Santos, Aldenir F; de Azevedo, Denise P L; dos Santos Mata, Rosalina da C; de Mendonça, Dina I M Dinis; Sant'Ana, Antônio E Goulart

    2007-01-01

    Leaf extracts of Euphorbia conspicua (Euphorbiaceae), together with the latex and fractions derived therefrom, were evaluated for their molluscicidal and cercaricidal activities and their toxicities to brine shrimps. Whilst the leaf extracts were inactive against Biomphalaria glabrata, the latex, its triterpenic fraction and irritant fractions I and II exhibited high activities against adult snails with LC90 values of 4.87, 10.55, 0.64 and 0.10 microg/mL, respectively. The latex and its derived fractions were considered lethal to the cercaria of Schistosoma mansoni at concentrations of 100 microg/mL. The toxicities of the latex and the irritant fractions, but not of the triterpenic fraction, against Artemia salina were high with LC50 values < 10 microg/mL. The possible application of the latex of E. conspicua as an alternative natural molluscicide is considered.

  14. Evaluation of metabolic responses of Artemia salina to oil and oil dispersant as a potential indicator of toxicant stress

    Energy Technology Data Exchange (ETDEWEB)

    Verriopoulos, G.; Moraitou-Apostolopoulou, M.; Xatzispirou, A.

    1986-03-01

    Oil represents an obvious hazard for the coastal environment and studies on its impact on marine organisms are necessary. Solvent based oil dispersants constitute one of the most important means for removing oil from shores. Although recently new dispersants have been developed, which are much less toxic than the first ones, dispersants still remain toxic substances. Since in the case of oil pollution treatment, oils and detergents are acting in combination, a realistic approach of laboratory studies must also include the combined action of these substances on marine organisms. Although acute toxicity studies are very useful for the determination of the range of animal tolerance, other effects causing physiological alterations may be detrimental to a population's survival. This paper concerns research on the effects of an oil, an oil dispersant and of the mixture of oil and dispersant on a physiological process, the respiration of the brine shrimp Artemia salina.

  15. Temperature-dose relationships with aflatoxin M1 in milk on the brine shrimp (Artemia salina larvae

    Directory of Open Access Journals (Sweden)

    Lejla Duraković

    2011-06-01

    Full Text Available Temperature-dose relationships with aflatoxin M1 (AFM1 were studied using the brine shrimp Artemia salina larvae as an biological indicator in the temperature range from 20 °C to 40 °C. Increase in the incubation temperature resulted in sensitivity increase by the brine shrimp to AFM1. Optimum sensitivity occured at 30 °C. Positive results were obtained at 0.18 μg AFM1 x L-1 of whole pasteurized milk with a mortality of over 15%. Greater than 90 % mortality occurred at dose levels of 0.9 μg AFM1 x L-1 and above. The test can be conducted during 30-60 hours.

  16. La competencia por el agua en el valle de Izúcar, Puebla. Los repartimientos de agua y los ingenios, 1550-1650

    Directory of Open Access Journals (Sweden)

    Gloria Camacho Pichardo

    2010-01-01

    Full Text Available El eje principal de este artículo consiste en analizar el proceso de adquisición de derechos, distribución y uso del agua por parte de los labradores españoles e indígenas, en torno al río Nexapa en el valle de Izúcar, Puebla, entre 1550 y 1650, en un período de expansión de la propiedad de los españoles, de la introducción de nuevos cultivos que implicaban riego y de una baja considerable de población indígena. Se analizan los conflictos entre los regantes de aguas arriba con los de aguas abajo, así como las formas de solucionar las tensiones a través de los diversos repartimientos de agua en torno al Nexapa, como instrumento que les permitió a los regantes "resolver" sus diferencias.

  17. La posible creación de mercados de agua y la gobernabilidad de este recurso en Colombia. Comentarios sobre el proyecto de ley del agua

    Directory of Open Access Journals (Sweden)

    Manuel Rodríguez Becerra

    2005-11-01

    Full Text Available En la actualidad se está tramitando un proyecto de Ley del Agua en el Congreso de la República, presentado a su consideración por el Gobierno Nacional, mediante el cual "se establecen medidas para orientar la planificación y administración del recurso hídrico en el territorio nacional." Se trata de la segunda reforma del gobierno del Presidente Alvaro Uribe relacionada con la gestión del agua en Colombia. En efecto, al principio de su gobierno se expidió la Ley de 2003 de creación del Ministerio del Ambiente, Vivienda y Desarrollo Territorial (MAVDT, a partir del anterior Ministerio del Medio Ambiente, al cual se le trasladaron las funciones de vivienda, agua potable, saneamiento básico y desarrollo territorial, antes en cabeza del Ministerio de Desarrollo que se clausuró. Este ensayo tiene como objetivo hacer un examen de algunos aspectos críticos del proyecto de ley, tal como fue aprobado en primer debate en al Comisión Quinta de la Cámara de Representantes, y también efectuar algunas consideraciones sobre la marcha del MAVDT como autoridad nacional del agua, debido a que ambas reformas están encaminadas a fortalecer la gobernabilidad de este recurso en Colombia.

  18. Ahorro de agua y materia prima en los procesos de pelambre y curtido del cuero mediante precipitación y recirculación de aguas

    Directory of Open Access Journals (Sweden)

    SANDRA AGUDELO A.

    2007-01-01

    Full Text Available El principio del proceso de recuperación de cromo, consiste en precipitar el cromo contenido en el licor residual como hidróxido utilizando un álcali; este precipitado se separa por sedimentación y se disuelve nuevamente con ácido sulfúrico. De los resultados obtenidos, se observaron porcentajes de remoción superiores al 99%. Con la recirculación directa de aguas de pelambre fue posible obtener ahorros de agua del 64% y ahorros en materia prima del 32 %, además, con una adecuada selección del tamizador es posible recircular el agua un número máximo de tres veces, sin afectar la calidad del producto final. Así mismo, se comprobó la viabilidad de la recirculación directa de aguas de curtido, con ahorros de materia prima del 17%. Con medidas de este tipo, prácticas y fáciles de implementar, la industria del curtido del cuero podría disminuir considerablemente la contaminación, operar de una forma mas segura y con mayor eficiencia de producción.

  19. The influence of photoperiod and light intensity on the growth and photosynthesis of Dunaliella salina (chlorophyta) CCAP 19/30.

    Science.gov (United States)

    Xu, Yanan; Ibrahim, Iskander M; Harvey, Patricia J

    2016-09-01

    The green microalga Dunaliella salina survives in a wide range of salinities via mechanisms involving glycerol synthesis and degradation and is exploited for large amounts of nutraceutical carotenoids produced under stressed conditions. In this study, D. salina CCAP 19/30 was cultured in varying photoperiods and light intensities to study the relationship of light with different growth measurement parameters, with cellular contents of glycerol, starch and carotenoids, and with photosynthesis and respiration. Results show CCAP 19/30 regulated cell volume when growing under light/dark cycles: cell volume increased in the light and decreased in the dark, and these changes corresponded to changes in cellular glycerol content. The decrease in cell volume in the dark was independent of cell division and biological clock and was regulated by the photoperiod of the light/dark cycle. When the light intensity was increased to above 1000 μmol photons m(-2) s(-1), cells displayed evidence of photodamage. However, these cells also maintained the maximum level of photosynthesis efficiency and respiration possible, and the growth rate increased as light intensity increased. Significantly, the intracellular glycerol content also increased, >2-fold compared to the content in light intensity of 500 μmol photons m(-2) s(-1), but there was no commensurate increase in the pool size of carotenoids. These data suggest that in CCAP 19/30 glycerol stabilized the photosynthetic apparatus for maximum performance in high light intensities, a role normally attributed to carotenoids.

  20. Progress of Ambiente & Agua Journal after three years of life

    Directory of Open Access Journals (Sweden)

    Getulio Teixeira Batista

    2009-08-01

    Full Text Available After completing three years since its first issue was published on August 2006, we are proud to report the development of Ambiente & Agua - An Interdisciplinary Journal of Applied Science, ISSN:1980-993X, doi:10.4136/1980-993X that is publishing its 10th issue with 17 peer reviewed articles. Thanks to the great support of the scientific community, especially to the authorse and peer reviewers, all issues have been published on-time, i.e. at the end of April, August and December. Missions and goals are progressively being achieved. We have two new metadata harvester agencies listing the journal: the Portal of the Brazilian Agency from the Ministry of Education concerned with the graduate level education, known as CAPES in its service “Portal de Periódicos da CAPES” accessed by most of the scientific community in Brazil and the Summary of Brazilian Journals (Sumarios.org. We report in this current issue the growing international interest in the journal, by monitoring the access of readers, using several tools. Therefore, we anticipate a growing interest in the journal from not only the Brazilian but also from the global scientific community.

  1. Progress of Ambiente & Agua Journal after three years of life

    Directory of Open Access Journals (Sweden)

    Getulio Teixeira Batista

    2009-08-01

    Full Text Available After completing three years since its first issue was published on August 2006, we are proud to report the development of Ambiente & Agua - An Interdisciplinary Journal of Applied Science, ISSN:1980-993X, doi:10.4136/1980-993X that is publishing its 10th issue with 17 peer reviewed articles. Thanks to the great support of the scientific community, especially to the authors e peer reviewers, all issues have been published on-time, i.e. at the end of April, August and December. Missions and goals are progressively being achieved. We have two new metadata harvester agencies listing the journal: the Portal of the Brazilian Agency from the Ministry of Education concerned with the graduate level education, known as CAPES in its service “Portal de Periódicos da CAPES” accessed by most of the scientific community in Brazil and the Summary of Brazilian Journals (Sumarios.org. We report in this current issue the growing international interest in the journal, by monitoring the access of readers, using several tools. Therefore, we anticipate a growing interest in the journal from notonly the Brazilian but also from the global scientific community.

  2. Bioética del derecho al agua potable

    Directory of Open Access Journals (Sweden)

    Bohórquez Caldera, Luis Alfredo

    2016-02-01

    Full Text Available Resumen. Se observa también, que en la prestación del servicio domiciliario de agua potable en Colombia, servicio que ha de ser asumido como derechos humanos fundamental, hoy en Colombia se conrroboran aspectos preocupantes en relación a la prestación de este servicio fundamental en los que se evidencia improvisación, manejo bajo la lógica del negocio y aplicación por ende de modelos inequitativos de prestación de servicios públicos. Abstract. It is observed that in the provision of the service of drinking water in Colombia, a service that has to be taken as a fundamental human right. Today in Colombia, worrying aspects as for the provision of this key service are corroborated, in which improvisation is made evident, which is carried out under the logics of business and the application, therefore, of inequitable models of the provision of public utilities.

  3. Maracaibo: De pueblo de Agua a Ciudad, Puerto siglos XVIXVII

    Directory of Open Access Journals (Sweden)

    Ileana Parra Grazzina

    2006-01-01

    Full Text Available El pueblo de Maracaibo aborigen y sus términos antecedió a lo que fue la ciudad-puerto de Maracaibo en los siglos XVI y XVII inserta en la expansión capitalista europea. La ventajosa situación de Maracaibo en el intermedio del agua lacustre y marítimas, propició la alternativa de comunicación entre los centros productores andinos-lacustres con el Caribe y el Atlántico. Factor aprovechado por las poblaciones del norte del Lago de Maracaibo para el dominio de la navegación lacustre que derivó en rivalidades económicas y políticas, tanto en los tiempos aborígenes como en los tiempos de sometimiento hispánico. Se trata de interpretar el crecimiento del puerto y su competitividad con los otros puertos lacustres como Moporo, Tomoporo, Gibraltar y Zulia por el control comercial, de los cuales dependió paradójicamente para su abastecimiento en razón de la esterilidad de las tierras maracaiberas. Tal proceso se estudió en el marco de la política mercantilista de los Austrias, a través del análisis histórico de las fuentes documentales del Archivo General de Indias.

  4. Derecho ambiental legislación nacional e internacional sobre calidad de aguas

    Directory of Open Access Journals (Sweden)

    Gastón Casaux

    2015-09-01

    Full Text Available Contenido: Antecedentes. Principios esenciales. El criterio general de Naciones Unidas. La costumbre en Uruguay. Competencias nacionales. Código Civil y Código Penal. Código Rural. Código de Aguas. Ley 13.667 de 18.6.68 sobre Suelos y Aguas y su modificativa decreto-ley 15.239 de 23-12-81 o Ley de Suelos. Ley de Riego Nº16.858 y reglamentación posterior. Ministerio de Transporte y Obras Públicas (Dirección de Hidrografía, Ministerio de Ganadería, Agricultura y Pesca (Dirección de Suelos yAguas, Ministerio de Medio Ambiente (DINAMA, Ministerio de Salud Pública (Ley 9.202 de 1934, Ministerio de Relaciones Exteriores (Dirección de Asuntos Internacionales, Ministerio de Industria y Energía (Dirección de Minería y Geología Municipios.  Obras Sanitarias del Estado (OSE Universidad de la República. Panorama jurídico de la región. Tratados internacionales. Normas. Mercosur. Derecho Ambiental y Obras de la zona. Pasivo y activo del Mercosur. El Derecho Comparado. Conclusiones. La importancia económica, jurídica y ambiental del agua. Las diferenteslegislaciones y su trascendencia para el desarrollo. El recurso agua como fuente de poder

  5. Concepto y trascendencia del derecho de aprovechamiento en materia de aguas (Propiedad y Aprovechamiento

    Directory of Open Access Journals (Sweden)

    Enrique Guerra Daneri

    2013-12-01

    Full Text Available La disciplina de las aguas se encuentra estructurada jurídicamente, sólo en base a dos derechos: el de propiedad y el de aprovechamiento. La caracterización que posee el agua como cosa, impide que puedan ejercerse otros derechos sobre ella.El punto de partida para explicar este fenómeno, radica en que el agua responde a dos hechos técnicos que ofician como fuente material o factor de calificación jurídica: el principio de territorialidad y la unidad del ciclo hidrológico. Estos dan motivo a su comportamiento universal y en ellos se asienta su disciplina, más allá de la regulación particular que cada derecho positivo quiera desarrollar, imponiendo una política en la materia.  En síntesis, el agua es un bien cuyas particularidades determinan que en definitiva, el derecho de propiedad sea desplazado en su trascendencia patrimonial por otro derecho que ocupa su lugar en jerarquía e individualidad: el derecho de aprovechamiento. Sin embargo y a pesar de los sólidos fundamentos que lo sustentan, la identidad de este derecho parece todavía opacada por los reflejos de una propiedad, que en materia de aguas, es inoperante.       

  6. Nematodos en las plantas de tratamiento de agua para consumo humano en Costa Rica

    Directory of Open Access Journals (Sweden)

    Mariano Peinador

    2000-12-01

    Full Text Available Los nematodos acuáticos son habitantes frecuentes en las plantas de tratamiento de agua para consumo humano. Su presencia en ellas y el grado en que son removidos por dichas plantas puede ser utilizado como un parámetro de funcionamiento y de calidad de agua, ya que muchos organismos patógenos pueden pasar a los sistemas de distribución de agua dentro del cuerpo de los nematodos. Para analizar esta problemática se realizaron 1356 muestreos en el agua cruda y tratada de 27 plantas de tratamiento. Los resultados demuestran la alta incidencia de nematodos y la baja taza de remoción que presentan varias plantas de tratamiento, llegando a ser de 0. 5 en el 11% de las plantas, 0.4 en el 18% y 0.3 en el 29%. Este hecho se agrava si se toma en cuenta que dentro de las plantas de tratamiento que tienen una menor taza de remoción se encuentran las de mayor producción de agua para consumo.

  7. [Water birds from Agua Dulce lake and El Ermitaño estuary, Jalisco, Mexico].

    Science.gov (United States)

    Hernández Vázquez, Salvador

    2005-01-01

    Waterbird abundance, and seasonal and spatial distribution, were studied in two natural water pools at Jalisco, Mexico, from December 1997 through November 1998. Maximum monthly abundance in Agua Dulce lake and El Ermitaño estuary was 86 471 birds (29 686 in Agua Dulce and 56 785 in Ermitaño), with a total cummulative abundance of 179 808 individuals (66 976 in Agua Dulce and 112 832 in Ermitaño). A total of 87 waterbirds species were recorded, 78 in Agua Dulce and 73 in Ermitaño. The higher species richness and abundance was observed during winter, when migratory species arrived. Most species prefered shallow waters, except seabirds which prefered protected areas such as dunes in Agua Dulce. Other groups, like clucks and related species. prefered low salinity areas, for example in the south-east area of Ermitaño. The higher abundance of the shorehirds was found when the water level on the estuary was low. Herons were seen often at areas with high salinity and influenced by tides (e.g. mouth of Ermitaño).

  8. Pueblos indígenas de Sonora: el agua, ¿es de todos?

    Directory of Open Access Journals (Sweden)

    Diana Luque

    2012-01-01

    Full Text Available La diversidad cultural y la problemática ambiental del agua en el estado de Sonora convergen en el presente trabajo, abordadas desde la perspectiva de la ecología política y la diversidad biocultural mediante un análisis transdisciplinario. Se distingue entre el acceso al agua para la subsistencia tradicional del agua para el desarrollo. Se advierten tendencias generalizadas de despojo de los territorios indígenas y sus recursos naturales, en las que los conflictos por el agua para la subsistencia son cada vez más graves, que exacerban la vulnerabilidad de las comunidades y la desorganización del complejo biocultural. El servicio del agua potable no tiene las condiciones para impulsar el desarrollo comunitario sustentable. Estas tendencias no son homogéneas, y se observan posibilidades de reconfiguración. Se requiere precisar el análisis para aportar al desarrollo de los pueblos indígenas, desde una plataforma biocultural contemporánea, en pleno respeto de sus derechos humanos individuales y colectivos.

  9. Los Imaginarios del agua y sus lecturas pansemióticas

    Directory of Open Access Journals (Sweden)

    Alberto E. Martos García

    2012-12-01

    Full Text Available Los Imaginarios del Agua constituyen un conjunto de etnotextos, ritos y símbolos que son susceptibles de ser leídos desde muy diferentes perspectivas. En este artículo se profundiza en dos aspectos concretos: la totemización o personificación que suponen los genios del agua y sus lecturas plurisimbólicas, y la necesidad de establecer una lectura poética y pansemiótica del agua, conforme a los postuladosde la Ecocrítica. En segundo lugar, se exponen las virtualidades de la cultura del agua en la educación en cuanto a contribuir a la adquisición de las competencias básicas educativas, y en particular, a la educación literaria y del patrimonio, además de ayudar a comprenderla gobernanza del agua y a la gestión sostenible y responsable de los recursos hídricos. Como indica E. Morin, la lectura y la literatura son una escuela de complejidad, y estos mitos inciden siempre en lacomplejidad del sentido de las acciones humanas.

  10. Determination of dissolved oxygen in saline waters applying mathematical methods and as a membrane electrode sensor; Determinacion de oxigeno disuelto en aguas salinas aplicando modelos matematicos y como sensor electrodo de membrana

    Energy Technology Data Exchange (ETDEWEB)

    Mayari, R.; Espinosa, M. C.; Ruiz, M. [Centro Nacional de Investigaciones Ceintificas. La Habana (Cuba); Romero, E. [Universidad de Huelva (Spain)

    2000-07-01

    This work shows as specific methodology for the determination of dissolved oxygen in saline waters that allows to consider the variations of temperature and of concentration of salts. Both factors influence the solubility of the gases in water, making possible in place measurements, in bodies of water with content of salts unto of the concentration of sea water, with greater dependability. The mathematical models obtained are shown, the errors due to equipment, as well as the results obtained when applying this methodology in saline waters with diverse levels of contamination this allows to discern when the decrease of dissolved oxygen levels is due to an increase in the salinity or to an increase in the contamination of the water body. (Author) 7 refs.

  11. New health and environmental risks in water for a new centry Nuevo siglo, nuevos riesgos sanitarios y ambientales en el agua

    Directory of Open Access Journals (Sweden)

    Rafael J. García-Villanova Ruiz

    2003-12-01

    diez mil casos de síndrome melanodérmico y cáncer cutáneo. La abundante documentación de este suceso y la aplicación de una metodología singular de estimación de riesgos (la toxicología del arsénico no ha encontrado un modelo experimental animal impulsó recientemente el nuevo estándar de 10 μg/l por OMS y EPA reflejado en nuestra nueva legislación. Pero el caso más reciente y trágico es el de Bangla-Desh, con más de 40 millones de afectados de intoxicación crónica.La eutrofización de las aguas continentales y costeras es un fenómeno muy generalizado, que alcanza también a nuestro país. Preocupa en la actualidad porque son cada vez más frecuentes las llamadas floraciones (“blooms” de algas cianofíceas toxigénicas. Se estima que más de la mitad de ellos han producido neuro o hepatoxinas en embalses y aguas remansadas. La acumulación superficial (“mantas” de algunas especies de cianofíceas o de costras y espumas en las orillas han sido causa de intoxicación letal del ganado. Más corriente es la irritación de ojos, erupciones cutáneas, vómitos, diarrea, fiebre y dolor en músculos y articulaciones en personas que han bebido o bañado en lugares con espumas procedentes de algas. Aunque no lo estipula la Directiva Europea, la nueva legislación española prescribe acertadamente el control de una de ellas: microcistina, 1ppb.En las aguas residuales urbanas pueden estar presentes hasta 100 especies de virus patógenos para el hombre. Suelen pasar las plantas depuradoras de residuales sin verse afectados y sobrevivir en el medio acuático durante largos períodos, y así llegan a las plantas de potabilización convencionales, donde generalmente resisten la cloración. Sin embargo, sólo de unos pocos se ha demostrado su transmisión por el agua. Es el caso del de la Hepatitis A y, más recientemente, el de la Hepatitis E, endémicos en la región mediterránea. De otra parte, en la actualidad la gastroenteritis viral es la segunda causa

  12. Calidad y aptitud de uso agrícola y doméstico del agua del acuífero del río Sinaloa, porción costera Quality and suitability of the agricultural and domestic water use of the Sinaloa river aquifer, coastal zone

    Directory of Open Access Journals (Sweden)

    Héctor José Peinado-Guevara

    2011-04-01

    Full Text Available El valle de Guasave, Sinaloa, es eminentemente agrícola y cuenta con comunidades rurales que se abastecen de agua para su uso doméstico mediante pozos ubicados en sus predios. La actividad económica y social de dicho valle demanda agua para ambas actividades, por lo que su extracción se ha desplazado hacia la zona costera, siendo importante conocer los mecanismos naturales que controlan la composición química del agua, su calidad, su variación temporal atendiendo a la aptitud de uso agrícola o doméstica. Para determinar el mecanismo que controla la composición química del agua se utilizó el diagrama de Gibbs, encontrándose que el mecanismo dominante es por evaporización-meteorización. Respecto al agua para uso doméstico se utilizó el índice de calidad PHASECH, encontrándose que el agua cumple con el mismo sólo en las proximidades del río Sinaloa. En cuanto a la aptitud de uso agrícola del agua se utilizó el diagrama de Wilcox, encontrándose que sólo el 48% del agua de la zona se clasifica como buena a admisible. En cuanto al riesgo de salinización o sodificación del suelo por el uso del agua de riego, se usó el diagrama de salinidad del Departamento de Agricultura de Estados Unidos de Norteamérica, encontrándose que el 35% del agua se ubica en la zona C3S1. La relación obtenida entre los sólidos totales disueltos y la conductividad eléctrica del agua, fue EC = 1.65 STD. Se concluye además, que el acuífero del río Sinaloa es altamente sensible a la salinización por su carácter costero y presencia de cuerpos evaporíticos alejados de la línea de costa, por lo que, el peligro de intrusión salina ante un periodo de sequía es latente. La presencia del río Sinaloa es un elemento relevante de recarga que permite mantener el agua subterránea en condiciones aptas para la agricultura y muy cercanas a las requeridas para uso doméstico.The Guasave valley, Sinaloa is mainly agricultural. There are rural communities

  13. CARACTERIZACIÓN BROMATOLÓGICA Y MICROBIOLÓGICA DE CARNES PROCEDENTES DE ESPECIES DE ANIMALES REGIONALES DE LA AMAZONIA PERUANA PARA CONSUMO HUMANO

    Directory of Open Access Journals (Sweden)

    Ronald Lozano

    2012-12-01

    Full Text Available La investigación consistió en la caracterización bromatológica y determinación microbiológica de muestras de carnes procedentes de ocho especies de animales silvestres: huangana (Tayassu pecari, majaz o picuro (Agouti paca, sajino (Tayassu tajacu, venado colorado (Mazama americana, tapir (Tapirus terrestris, añuje (Dasyprota fuliginosa, ronsoco (Hydrochaeris hydrochaeris y armadillo (Dasypus novemcinctus; en las localidades de Puerto Belén-Roya-Utucuro, Santa Rosa de Aguaytía, Santa Luz de Abujao, Tacshitea–Sector Parinari en dos ocasiones, ubicadas en las márgenes del río Ucayali y sus afluentes, que fueron analizarlas por la empresa Servicios de Asesoramiento Técnico S.A.C. en Lima.  La caracterización bromatológica indicó que el añuje (Dasyprota fuliginosa mostró el mayor contenido en Proteína cruda seguido de la huangana (Tayassu pecari; en el contenido de grasa destacaron las especies  armadillo (Dasypus novemcinctus y la sachavaca (Tapirus terrestris así también en su contenido calórico.  La especie venado colorado (Mazama americana mostró un mayor valor en cenizas y en carbohidratos la especie huangana (Tayassu pecari.  La determinación microbiológica indicó que todas las muestras presentaron niveles de contaminación dentro de los límites permitidos para aerobios mesófilos viables y niveles de contaminación por coliformes totales, coliformes fecales, algunos muy elevados y también de mohos y levaduras.  Todos presentaron ausencia de Salmonella.

  14. Determinación de la resistencia a insecticidas en Aedes aegypti, Anopheles albimanus y Lutzomyia peruensis procedentes del Norte Peruano

    Directory of Open Access Journals (Sweden)

    Franklin Vargas V

    2006-10-01

    Full Text Available Objetivo: Determinar los niveles de resistencia a temephos y deltametrina en cinco poblaciones naturales de Aedes aegypti del norte de Perú (La Libertad y Piura, dos cepas de Anopheles albimanus (Sullana y Tambogrande y una cepa de Lutzomyía spp (Santiago de Chuco, La Libertad. Materiales y métodos: Se realizaron bioensayos en larvas y adultos siguiendo la metodología de la Organización Mundial de la Salud. La visualización de bandas de B-esterasas se hizo por electroforesis en gel de poliacrilamida en larvas de cuarto estadio. Resultados: Las poblaciones de Ae. aegypti de Sullana y Tambogrande (Piura presentaron factores de resistencia (FR a temephos de 6,84 con un KDT50 = 160,42 minutos y 70% de mortalidad a las 24 horas; en tanto en la población de Tambogrande se observó un FR de 5,60, KDT50 = 107,20 y 80% de mortalidad, a diferencia de las cepas de La Esperanza, El Porvenir y Florencia de Mora (La Libertad que fueron susceptibles. Se identificó resistencia en las poblaciones de Ae. aegypti y A. albimanus procedentes de Piura (Tambogrande y Sullana para deltametrina, a diferencia de las poblaciones de Ae.aegypti y Lutzomyia spp de La Libertad que fueron susceptibles. Se identificó la esterasa B2 con un Rf de 0,23 en la población de Ae. aegypti de Sullana. Conclusiones: Dada la susceptibilidad de la población de La Libertad al insecticida temephos, puede seguir siendo usado en el control vectorial de Aedes aegypti; por lo contrario, dada la resistencia observada en poblaciones de Anopheles en Sullana y Tambogrande se debe evaluar el uso de la deltametrina en estas poblaciones. Finalmente, la población de Lutzomyia spp. no presentó resistencia a deltametrina.

  15. Hepatite fulminante e febre negra de Lábrea: estudo de 5 casos procedentes de Codajás, Amazonas, Brasil

    Directory of Open Access Journals (Sweden)

    José Carlos Ferraz da Fonseca

    1983-09-01

    Full Text Available São descritas as manifestações clinicas, laboratoriais e aspectos evolutivos de cinco pacientes procedentes de Codajás-Amazonas, atendidos no Instituto de Medicina Tropical de Manaus devido ao quadro de hepatopatia grave, com período médio de doença de quatro dias. Quatro destes pacientes evoluiram para óbito, com uma média de cinco dias desde o inicio dos pródromos. A sorologia para hepatite B mostrou que o Ag HBs estava presente em quatro e o Anti - HBc em todos. Dos pacientes que foram ao óbito, através da necropsia a histopatologia do fígado revelou quadro de hepatite fulminante em dois e de febre de Lábrea nos outros dois.We have described the clinical and laboratory manifestations and evolutiortal aspects of five patients from Codajás, state of Amazonas, Brasil. These patients were treated at the Instituto de Medicina Tropical de Manaus with a picture of acute liver failure with an average period of evolution of 4 days. Of these patients, four died, within an average time of five days since the prodromal phase. Serology for hepatitis B showed that HBAg was present in four, and the HBc antigen in all patients. An autopsy was perfomed on the four patients who died, and the liver histopathology revealed a picture of fulminant hepatitis in two, and Lábrea fever (febre negra, in the other two.

  16. 盐藻的诱变育种及光合反应器培养的初步研究%PRELIMINARY STUDIES ON THE MUTAGEN BREEDING OF Dunaliella salina AND ITS CULTIVATION IN SIMPLE AXIS PHOTOBIOREACTOR

    Institute of Scientific and Technical Information of China (English)

    姜建国; 周世水; 姚汝华

    2001-01-01

    A optimum started strain collected from 3 strains of Dunaliella salina was mutagenized by UV light. A new strain with content of β  carotene 5% higher than that of original strain was obtained. The strain was cultivated with a simple phorobioreactor in the optimum condition of cell growth. The result showed that the biomass of D. salina cultivated in the bioreactor over the triangular flask had a marked increase and the growth period shortened greatly.

  17. Reutilización de aguas grises: grupo de viviendas en el municipio de Victoria de Acentejo

    OpenAIRE

    Ysún Barrio, Mª Teresa

    2009-01-01

    Esta tesina analiza el potencial de la reutilización de las aguas grises generadas en las viviendas para devenir una fuente no convencional de agua, y ofrecer así una opción adicional con la que paliar los déficits hídricos.

  18. Estudio cinético del proceso de biometanización de las aguas de condensación del proceso de concentración térmica del alpechín

    Directory of Open Access Journals (Sweden)

    Borja Padilla, R.

    1991-12-01

    Full Text Available A kinetic study of biomethanation has been carried out by using condensed water from the thermal concentration process of olive mill wastewater, which contained an organic load (6 g/l COD that prevented it from reusing or spillage. Two fluidized-bed bioreactors were used, one of them containing suspend biomass for reference, and the other with biomass supported on Sepiolite for the immobilization of microorganisms effecting anaerobic digestion. The Chen-Hashimoto model of methane production has been applied, obtaining the values of the kinetic parameters μmax and K for each case studied. The results showed an increase in the kinetic constants for the reactor with Sepiolite in relation to the one used as reference, and the value for K kinetic constant was duplicated.

    Se ha efectuado un estudio cinético del proceso de biometanización de las aguas de condensación procedentes del proceso de concentración térmica del alpechín, cuya carga orgánica (6,0 g/l de DQO impide su posible vertido o reutilización. Para ello, se utilizan dos reactores de lecho fluidizado, uno con biomasa suspendida (testigo y otro con biomasa soportada sobre Sepiolita para inmovilización de las bacterias responsables del proceso. Se aplica el modelo de Chen-Hashimoto de producción de metano obteniéndose los valores de los parámetros cinéticos μmax y K casos estudiados. Se obtiene un aumento de las constantes cinéticas en el reactor que contiene Sepiolita respecto al testigo, llegando a duplicarse el valor de la constante K en el reactor con biomasa soportada.

  19. Valoración de la calidad del agua del arroyo Guachinango, con fines de riego

    OpenAIRE

    Jeny Pérez Petitón; Geisy Hernández Cuello

    2007-01-01

    El estudio se realizó en la finca «La Conchita» perteneciente a la Cooperativa de Créditos y Servicios (CCS) «Lidia Doce». Se valoró la posible utilización del agua del arroyo Guachinango para el riego del cultivo del guayabo. Se da una explicación detallada de las condiciones constructivas del área, desde la toma de agua en el río hasta el punto de muestreo. Se realizaron muestreos mensuales de agua a la salida del cabezal de riego a los que se le realizó análisis químico-físico y m...

  20. El agua en discordia: balance cualitativo de la situación.

    Directory of Open Access Journals (Sweden)

    Paula Mussetta

    2013-06-01

    Full Text Available 0 0 1 95 523 Agustin 4 1 617 14.0 96 800x600 Normal 0 21 false false false ES-TRAD JA X-NONE Partiendo de una selección de situaciones conflictivas y problemas por agua en algunos países latinoamericanos, el trabajo establece un balance cualitativo de la situación del campo de los conflictos por agua en la región latinoamericana. Esto implica un doble objetivo. Por un lado, esbozar las dimensiones más importantes que se repiten en el escenario: los motivos y temas, actores, definiciones de la situación. Por otro lado, partiendo de ese escenario reseñado, sentar las bases analíticas definiendo la importancia del Estado como eje desde donde orientar a futuro los estudios sobre los conflictos por agua

  1. Usos y riesgos del agua en la cuenca La Antigua, Veracruz, México

    OpenAIRE

    Ana Rita Román-Jiménez; Martín Alfonso Mendoza-Briseño; Alejandro Velázquez-Martínez; Mario Roberto Martínez-Ménez; Juan Manuel Torres-Rojo; Hugo Ramírez-Maldonado

    2011-01-01

    El agua en México se considera un recurso escaso y valioso. Este trabajo es un ensayo que toma como caso de estudio la cuenca del río La Antigua, en Veracruz, México. En este lugar la condición y manejo de las tierras se relacionó con atributos del agua en función de usos varios. La cuenca de La Antigua capta una gran cantidad de agua y aún así se perciben problemas relacionados con el vital líquido. Las evidencias y el análisis en este estudio revelan la existencia de un imaginario colectiv...

  2. TRATAMIENTO DE AGUAS DE ESCORRENTÍA MEDIANTE HUMEDALES ARTIFICIALES: ESTADO DEL ARTE

    Directory of Open Access Journals (Sweden)

    Carlos Andrés Peña Guzmán

    2012-01-01

    Full Text Available La concentración de contaminantes en aguas lluvia es un tema que preocupa a las entidades gubernamentales porque deterioran la calidad hídrica de las fuentes receptoras. En varios países, se han iniciado investigaciones y desarrollo de metodologías para tratar este tipo de aguas. Una de estas técnicas es la ejecución de humedales artificiales, y es una de las más aceptadas por su gran eficiencia en la remoción de contaminantes. El presente artículo expondrá el estado del conocimiento, estudiando los métodos de diseño, eficiencias y las nuevas tendencias en la investigación de humedales artificiales que tratan aguas lluvia y/o escorrentía urbana.

  3. Distribución del agua en el Perú desde una perspectiva de cuenca

    OpenAIRE

    2011-01-01

    El artículo plantea la importancia de integrar el concepto de cuenca a la distribución de los recursos. Se propone integrar un trabajo detallado por cuenca que involucre el cálculo del caudal de agua, la variación de la napa freática, el caudal ecológico, los volúmenes de erosión y la distribución actual del agua, para de allí plantear la distribución del agua en la cuenca. El aprovechamiento y distribución de los recursos naturales se encuentran estrechamente vinculados a la distribución del...

  4. Las características del mercado de derechos de agua en España

    Directory of Open Access Journals (Sweden)

    Antonio Embid Irujo

    2013-12-01

    Full Text Available Por diversas circunstancias el derecho español conoce desde 1999 de una regulación jurídica de los mercados de derechos de uso de aguas. De ellos se ha hecho bastante utilización durante la última gran sequía (2005-2009 y la experiencia ha sido favorable. La regulación de los mercados intenta evitar la especulación y el acaparamiento de derechos. Sin que sea gran cantidad de agua la que se mueve por razón de los mercados, sí que es suficiente para evitar graves inconvenientes y, con el adecuado control, deseable para conseguir recursos hídricos que sirvan para satisfacer las nuevas necesidades y producir una gestión más eficaz del agua

  5. El arte de aforar: del nilómetro a la paja de agua cordobesa

    OpenAIRE

    Roldán Cañas, José

    2014-01-01

    Esta ponencia pretende describir la evolución diacrónica del aforo desde los orígenes hasta la paja de agua cordobesa, o medida de agua que se usó en la ciudad de Córdoba entre los siglos XVI y XIX. También se presenta la determinación de su valor expresándolo en unidades del sistema métrico decimal. El aforo de corrientes de agua ha tenido un gran interés para la humanidad desde sus albores. Las grandes civilizaciones han nacido y crecido a la orilla de los grandes ríos, y ...

  6. Riesgos a la salud por presencia del aluminio en el agua potable

    Directory of Open Access Journals (Sweden)

    Rodolfo Trejo Vázquez

    2004-01-01

    Full Text Available En la actualidad el aluminio tiene una amplia aplicación en la industria alimenticia, farmacéutica, del papel, de la construcción y en el tratamiento de agua para beber y agua residual. Sin embargo, no se ha dado énfasis a los posibles daños a la salud originados por el consumo de este elemento. Una de las enfermedades que ha sido asociada a la ingesta de este elemento es el Alzheimer y se corre el riesgo de desarrollar otros padecimientos. En el presente documento se resumen los resultados obtenidos de una investigación bibliográfica relacionada con los daños a la salud originados por el consumo de aluminio y compuestos fluoroaluminados, la finalidad es poner de manifiesto la importancia que tiene vigilar y controlar el contenido del aluminio en el agua potable

  7. Agua y Plan Hidrológico en la Región de Murcia

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Tobarra González

    2002-01-01

    Full Text Available En este trabajo se plantea la necesidad de contemplar el agua como un activo social y no sólo como un mero factor de producción, admitiendo que esta última concepción proporciona un alto valor a la producción final agraria regional. Se hace, además, un análisis de las demandas y consumos de agua, se estudian las causas y consecuencias de la escasez de recursos hídricos que conduce inevitablemente a la sobreexplotación de los acuíferos. Finalmente se estudian los precios y problemas de los distintos tipos de agua que se consumen en la región de Murcia y las razones por las cuales es necesario que cuanto antes se culmine el Plan Hidrológico Nacional.

  8. Efectos de la calidad del agua en la resistencia del concreto

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Rodríguez F.

    2012-05-01

    Full Text Available Este es el segundo proyecto de una serie que estudia los "Efectos de la calidad del agua en la resistencia del concreto". En el primer proyecto se analizan los efectos producidos por diferentes concentraciones de sulfatos, sólidos disueltos y materia orgánica en el agua de mezcla, sobre la resistencia y manejabilidad del concreto. En esta segunda parte se estudia únicamente el efecto del sulfato de magnesio en un rango de concentraciones en el agua de mezcla de 600 a 1.200 mg/lt. con variación de 100 mg/lt en las concentraciones, según la recomendación dada en la primera parte.

  9. Gobernanza del agua residual en Aguascalientes: captura regulatoria y arreglos institucionales complejos

    Directory of Open Access Journals (Sweden)

    Raul Pacheco-Vega

    2015-01-01

    Full Text Available El manejo de agua en Aguascalientes se ha estudiado desde la perspectiva del suministro, pero no se ha analizado la gobernanza del agua residual. En este artículo se examina el manejo de efluentes del municipio de Aguascalientes utilizando las teorías del neoinstitucionalismo histórico, de la gobernanza y de la captura regulatoria. Se explica los factores que han influido en la operación reciente (2010-2013 del tratamiento y reuso de agua municipal. El análisis está fundamentado en los debates contemporáneos sobre priva - tización del recurso hídrico, y enfocado en el periodo de la administración priista de Lorena Martínez, y sus proyectos emblemáticos: Línea Verde y Líneas Moradas.

  10. The Salinas formation in the type-area, Northeastern Minas Gerais: a proposal to review the stratigraphy of the Aracuai belt on sedimentary, metamorphic and U-Pb SHRIMP evidences; A formacao Salinas na area-tipo, NE de Minas Gerais: uma proposta de revisao da estratigrafia da faixa Aracuai com base em evidencias sedimentares, metamorficas e idades U-Pb SHRIMP

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Sirlene A. de Abreu [Universidade Federal de Ouro Preto, MG (Brazil). Escola de Minas. Dept. de Geologia; Martins Neto, Marcelo A. [Universidade Federal de Ouro Preto, MG (Brazil). Escola de Minas. Nucleo de Geologia do Petroleo (NUPETRO)]. E-mail: mamneto@uai.com.br; Pedrosa Soares, Antonio C. [Minas Gerais Univ., Belo Horizonte (Brazil). Inst. de Geociencias. Centro de Pesquisa Manuel Teixeira da Costa]. E-mail: pedrosa@igc.ufmg.br; Cordani, Umberto G. [Universidade de Sao Paulo, SP (Brazil). Inst. de Geociencias; Nutman, Allen [Australian National Univ., Canberra (Australia). Research School of Earth Sciences

    2002-12-15

    The Salinas Formation has been considered to be a stratigraphic unit of the Macaubas Group. This group comprises the rift to passive margin sequences of the precursor basin of the Neo proterozoic Aracuai Orogeny, eastern Brazil. However, new road cuts show extensive and spectacular outcrops with very well-preserved sedimentary structures, allowing detailed studies in the type-locality of this formation, located in the Salinas town and surroundings, northeast Minas Gerais State. In its type-locality, the Salinas Formation consists of graywacke, pelite and clast-supported conglomerate, metamorphosed in the green schist facies. The sedimentary lithofacies are grouped into three facies association (shelf, slope and deep-sea), indicating sedimentation from shelf deposits to deep-water turbidites. The shelf sedimentation was influenced by storm-wave during deposition. The slump and deep-sea deposits were generated by gravitational flows and high- to low-concentration turbidity currents. Shelf sandstone, clast-supported conglomerate and proximal to distal turbidites outline a submarine fan system. U-Pb SHRIMP data from detrital zircons of graywacke samples indicate a maximum sedimentation age of ca. 568 Ma. Thus, the Salinas Formation is much younger than the Macaubas Group, and represents late orogenic deposits (ca. 568- 500 Ma). The distal, passive margin unit of the Macaubas Group is now called Ribeirao da Folha Formation (ca. 800 Ma). (author)

  11. Síntese de 1,3,5-triazinas substituídas e avaliação da toxicidade frente a Artemia Salina leach Synthesis of substituted 1,3,5-triazines and toxicity evaluation against Artemia Salina leach

    Directory of Open Access Journals (Sweden)

    Márcia Ferreira Cavalcante

    2000-02-01

    Full Text Available The synthesis of ten symmetrically and unsymmetrically substituted 1,3,5-triazines by Phase Transfer Catalysis (PTC method is described. Their toxicities were determined against Artemia salina Leach. The LD50 values have also been obtained for these compounds.

  12. Vigilancia sanitaria del agua: un nuevo enfoque para municipalidades de Costa Rica

    Directory of Open Access Journals (Sweden)

    Carmen Valiente

    1999-12-01

    Full Text Available Los programas de vigilancia sanitaria constituyen el nuevo enfoque para complementar los programas de control de calidad del agua y consisten en la aplicación de una metodología que permite determinar el grado de riesgo para la salud que presentan los sistemas de agua para consumo humano. En el presente trabajo se presenta el desarrollo y adaptación de un Programa de Vigilancia Sanitaria para ser utilizado en Costa Rica. Este programa se basa principalmente en determinar el grado de riesgo para la salud que posee un acueducto, relacionando el nivel de contaminación fecal con el grado de la inspección sanitaria obtenido a partir de encuestas de campo. Los alcances del programa son proveer una plataforma para dar prioridad racional a las inversiones en el sector agua y unifica esfuerzos entre los dos roles importantes en esta área, el de las instituciones encargadas del abastecimiento de agua y el ente rector o autoridad reguladora en el campo del agua y la salud. Inicialmente, para implementar este programa se seleccionaron las Municipales de Costa Rica, de las 81 municipalidades existentes, 37 operan sistemas de suministro de agua para un total de 243 acueductos. El programa fue implementado durante los años 1996 y 1997. Se presentan para ilustración los resultados obtenidos en dos acueductos pertenecientes a las municipalidades de Cartago y San Marcos de Tarrazú. La ventaja de este tipo de programas sobre otros de control de calidad, radica principalmente en poder determinar el estado en que se encuentran las estructuras del acueducto y no solo su calidad, con el fin de establecer las prioridades para una inversión eficiente de los recursos existentes y así evitar la exposición de los usuarios a enfermedades de transmisión hídrica.

  13. Genotoxicidad del agua contaminada por plaguicidas en un área de Antioquia

    Directory of Open Access Journals (Sweden)

    Flor Tobón M.

    2011-05-01

    Full Text Available Objetivo. Determinar genotoxicidad del extracto orgánico de recursos hídricos de la vereda Monterredondo (Antioquia, contaminados por el uso de pesticidas en la agricultura, en la producción porcina y avícola como un diagnóstico de su calidad para entender su influencia en estas fuentes de agua en el municipio de San Pedro de Los Milagros (Antioquia. Materiales y métodos. Se empleó el ensayo cometa para establecer fragilidad osmótica de eritrocitos, viabilidad celular y alteración del ADN de linfocitos humanos al incubar estas células en agua recogida de tres fuentes hídricas de la vereda Monterredondo en el laboratorio de Bioquímica de la Facultad de Medicina de la Universidad de Antioquia. Resultados. El análisis de los datos de la longitud del cometa del extracto orgánico de las tres muestras, indicaron genotoxicidad. Este efecto fue dependiente de la concentración del extracto y del sitio de muestreo (p<0.001. La muestra de agua de la quebrada el Hato, presentó el mayor efecto genotóxico a 4 y 37ºC; la muestra de agua de la planta de tratamiento de la Hacienda La Montaña, presentó una alta genotoxicidad relativa, comparada con la muestra de agua de la quebrada Fray Juana. Conclusiones. El análisis de las tres muestras de agua recogidas en la vereda Monterredondo reveló genotoxicidad. Sin embargo, se sugiere en el futuro evaluar el grado de toxicidad de los componentes orgánicos concentrados y la genotoxicidad en personas que la consumen.

  14. Aguaclara, una alternativa para el tratamiento de agua para consumo humano. Aguaclara - an alternativefor drinking water treatment.

    Directory of Open Access Journals (Sweden)

    Gilberto Arturo Díaz Ordóñez

    2011-05-01

    Full Text Available Agua Para el Pueblo con el apoyo técnico del Programa AguaClara de la Universidad de Cornell, facilita asistencia técnica a comunidades rurales mayores de 2,000 habitantes y pequeñas y medianas ciudades con poblaciones menores de 50,000 habitantes, para la construcción de plantas de tratamiento denominadas AguaClara. Este esfuerzo institucional es una respuesta para optimizar la desinfección del agua con cloro en aquellos sistemas de agua ya construidos y que por razones naturales o antropicas se han visto afectados con problemas de alta turbiedad en los suministros de agua. La tecnología consiste en la floculación hidráulica, la sedimentación de alto rendimiento y la desinfección con alta eficiencia, sin el uso de la filtración o energía eléctrica para asegurar una entrega de agua de acuerdo a la Norma Técnica Nacional de Calidad del Agua de Honduras. La gestión de las plantas de tratamiento AguaClara va más allá de los aspectos constructivos y enfatiza simultáneamente la organización comunitaria, la capacitación de los diferentes actores, la readecuación de las tarifas, la operación y mantenimiento del sistema incluyendo la planta de tratamiento, así como la mitigación de las vulnerabilidades del sistema de agua y la protección sanitaria y ambiental en general de los entornos comunitarios donde se construyen las plantas de tratamiento.

  15. Dispositivo electrónico de medición del caudal de agua para canales abiertos

    Directory of Open Access Journals (Sweden)

    Julio Cesar Ayala López

    2015-01-01

    Full Text Available El método de riego por inundación, que desplaza el agua mediante canales abiertos y surcos ha sido usado durante años en la producción agrícola, aunque requiere una gran cantidad de agua y su eficacia no es muy alta ya que la mayoría del agua no se puede extraer directamente en las raíces de las plantas. Siendo de vital importancia lograr datos de campo confiables y lo suficientemente precisos que nos permitan estudiar y proyectar manejos del agua con el menor grado de incertidumbre posible. Para poder aplicar conocimientos actuales de la relación agua-suelo-planta debemos conocer la cantidad de agua en el campo o en regiones específicas del mismo, para así poder prever un uso eficiente del agua mediante la aplicación en el momento oportuno y en volúmenes adecuados, Por lo que en el Centro de Mecanización Agropecuaria (CEMA diseñ ó un dispositivo electrónico de medición e indicación de caudales y consumo de agua para canales abiertos, apli - cable para cualquier estructura hidráulica que relacione el nivel de agua de una sección de área conocida, con el caudal de agua que pasa por la misma sección, con el propósito de crear un dispositivo preciso y económico, capaz de realizar mediciones en el campo.

  16. Effects of UV/Ag-TiO2/O3 advanced oxidation on unicellular green alga Dunaliella salina: Implications for removal of invasive species from ballast water

    Institute of Scientific and Technical Information of China (English)

    Donghai Wu; Hong You; Jiaxuan Du; Chuan Chen; Darui Jin

    2011-01-01

    The UV/Ag-TiO2/O3 process was investigated for ballast water treatment using Dunaliella salina as an indicator.Inactivation curves were obtained, and the toxicity of effluent was determined.Compared with individual unit processes using ozone or UV/Ag-TiO2, the inactivation efficiency of D.salina by the combined UV/Ag-TiO2/O3 process was enhanced.The presence of ozone caused an immediate decrease in chlorophyll a (chi-a) concentration.Inactivation efficiency and chl-a removal efficiency were positively correlated with ozone dose and ultraviolet intensity.The initial total residual oxidant (TRO) concentration of effluent increased with increasing ozone dose, and persistence of TRO resulted in an extended period of toxicity.The results suggest that UV/Ag-Ti02/03 has potential for ballast water treatment.

  17. Characterization and alternative splicing of the complex I 19-kD subunit in Dunaliella salina: expression and mutual correlation of splice variants under diverse stresses.

    Science.gov (United States)

    Cao, Yu; Jin, Nan; Xu, Hui; Liu, Yi; Zhu, Wei Hua; Li, Xin Ran; Qiao, Dai Rong; Cao, Yi

    2010-01-01

    Complex I is the first enzyme in the mitochondrial respiratory chain. It extracts energy from NADH, which is produced by the oxidation of sugars and fats, and traps the energy by virtue of a potential difference or voltage across the mitochondrial inner membrane. Herein, the genomic sequence and four splice variants encoding the complex I 19-kD subunit were isolated from Dunaliella salina. There were four transcripts coding for the complex I 19-kD subunit due to alternative splicing in algae, and the four transcripts were translated to two protein isoforms with varying C-terminals. We report the splicing pattern in the 3'-region of the D. salina 19-kD subunit, in which three of the exons (5, 6, and 7) could be alternatively spliced. Moreover, we found that four alternatively spliced variants were subject to coordinated transcription in response to different stresses by real-time quantitative PCR.

  18. The efficiency of a new hydrodynamic cavitation pilot system on Artemia salina cysts and natural population of copepods and bacteria under controlled mesocosm conditions.

    Science.gov (United States)

    Cvetković, Martina; Grego, Mateja; Turk, Valentina

    2016-04-15

    A study of the efficiency of hydrodynamic cavitation and separation was carried out to evaluate an innovative, environmentally safe and acceptable system for ballast water treatment for reducing the risk of introducing non-native species worldwide. Mesocosm experiments were performed to assess the morphological changes and viability of zooplankton (copepods), Artemia salina cysts, and the growth potential of marine bacteria after the hydrodynamic cavitation treatment with a different number of cycles. Our preliminary results confirmed the significant efficiency of the treatment since more than 98% of the copepods and A. salina cysts were damaged, in comparison with the initial population. The efficiency increased with the number of the hydrodynamic cavitation cycles, or in combination with a separation technique for cysts. There was also a significant decrease in bacterial abundance and growth rate, compared to the initial number and growth potential.

  19. A Formação Salinas, Orógeno Araçuaí (MG): história deformacional e significado tectônico

    OpenAIRE

    Santos, Reginato Fernandes dos; Alkmim, Fernando Flecha de; Soares, Antônio Carlos Pedrosa

    2009-01-01

    A Formação Salinas, constituída de meta-arenitos, metapelitos e metaconglomerados, tem como principal área de ocorrência as vizinhanças da cidade homônima (norte de MG), onde jaz em discordância sobre rochas do Grupo Macaúbas, a oeste, e é intrudida por corpos graníticos neoproterózicos e cambrianos, a leste. Quatro gerações de estruturas deformacionais foram caracterizadas nessa região e três delas afetam as rochas da Formação Salinas. Os elementos da fase mais antiga, DD, correspondem a dob...

  20. Tratabilidad de aguas residuales de matadero con filtros

    Directory of Open Access Journals (Sweden)

    Jesús Mario Ortiz A.

    2011-06-01

    Full Text Available Para estudiar la tratabilidad anaeróbica de las aguas residuales provenientes de un matadero de ganado vacuno, se emplearon un sistema de dos filtros en serie y un tercer filtro único como testigo. Con valores promedio de carga orgánica volumétrica y tiempo de retención de 1.6 kg/(m3*d y 26 horas respectivamente, las eficiencias de remoción de DQO total fueron similares en el filtro único y en el sistema en serie, del orden del 64% en promedio. Así mismo, la retención y acumulación de sólidos biológicos en el lecho, se mostro como la vía principal de remoción de la DQO. La diferenciación del proceso lograda con los dos filtros en serie permitió establecer que la mayor parte de la acumulación ocurrió en el filtro primario, en tanto que lo fundamental de la bioconversion en metano se produjo en el filtro secundario del sistema en serie. EI bajo nivel relativo de metanogenización obtenido podría explicarse por las limitaciones a la actividad de la biomasa metanogénica impuestas por las bajas temperaturas, aunque no se podría descartar una probable inhibición por los productos de hidrolisis de las grasas acumuladas: Resumen del Proyecto de Tesis Presentado por el autor Para optar al titulo de Magister en Ambiental. Dirección: Consuelo Díaz, Bióloga; M.S.c. U.N. Facultad de Ingenieria.1992.