WorldWideScience

Sample records for agglutinin-like sequence als

  1. Candida albicans Agglutinin-Like Sequence (Als) Family Vignettes: A Review of Als Protein Structure and Function

    Science.gov (United States)

    Hoyer, Lois L.; Cota, Ernesto

    2016-01-01

    Approximately two decades have passed since the description of the first gene in the Candida albicans ALS (agglutinin-like sequence) family. Since that time, much has been learned about the composition of the family and the function of its encoded cell-surface glycoproteins. Solution of the structure of the Als adhesive domain provides the opportunity to evaluate the molecular basis for protein function. This review article is formatted as a series of fundamental questions and explores the diversity of the Als proteins, as well as their role in ligand binding, aggregative effects, and attachment to abiotic surfaces. Interaction of Als proteins with each other, their functional equivalence, and the effects of protein abundance on phenotypic conclusions are also examined. Structural features of Als proteins that may facilitate invasive function are considered. Conclusions that are firmly supported by the literature are presented while highlighting areas that require additional investigation to reveal basic features of the Als proteins, their relatedness to each other, and their roles in C. albicans biology. PMID:27014205

  2. Dynamics of Agglutinin-Like Sequence (ALS) Protein Localization on the Surface of Candida Albicans

    Science.gov (United States)

    Coleman, David Andrew

    2009-01-01

    The ALS gene family encodes large cell-surface glycoproteins associated with "C. albicans" pathogenesis. Als proteins are thought to act as adhesin molecules binding to host tissues. Wide variation in expression levels among the ALS genes exists and is related to cell morphology and environmental conditions. "ALS1," "ALS3," and "ALS4" are three of…

  3. Salivary agglutinin, which binds Streptococcus mutans and Helicobacter pylori, is the lung scavenger receptor cysteine-rich protein gp-340.

    Science.gov (United States)

    Prakobphol, A; Xu, F; Hoang, V M; Larsson, T; Bergstrom, J; Johansson, I; Frängsmyr, L; Holmskov, U; Leffler, H; Nilsson, C; Borén, T; Wright, J R; Strömberg, N; Fisher, S J

    2000-12-22

    Salivary agglutinin is a high molecular mass component of human saliva that binds Streptococcus mutans, an oral bacterium implicated in dental caries. To study its protein sequence, we isolated the agglutinin from human parotid saliva. After trypsin digestion, a portion was analyzed by matrix-assisted laser/desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), which gave the molecular mass of 14 unique peptides. The remainder of the digest was subjected to high performance liquid chromatography, and the separated peptides were analyzed by MALDI-TOF/post-source decay; the spectra gave the sequences of five peptides. The molecular mass and peptide sequence information showed that salivary agglutinin peptides were identical to sequences in lung (lavage) gp-340, a member of the scavenger receptor cysteine-rich protein family. Immunoblotting with antibodies that specifically recognized either lung gp-340 or the agglutinin confirmed that the salivary agglutinin was gp-340. Immunoblotting with an antibody specific to the sialyl Le(x) carbohydrate epitope detected expression on the salivary but not the lung glycoprotein, possible evidence of different glycoforms. The salivary agglutinin also interacted with Helicobacter pylori, implicated in gastritis and peptic ulcer disease, Streptococcus agalactiae, implicated in neonatal meningitis, and several oral commensal streptococci. These results identify the salivary agglutinin as gp-340 and suggest it binds bacteria that are important determinants of either the oral ecology or systemic diseases.

  4. Llama-Derived Single Domain Antibodies Specific for Abrus Agglutinin

    Science.gov (United States)

    Goldman, Ellen R.; Anderson, George P.; Zabetakis, Dan; Walper, Scott; Liu, Jinny L.; Bernstein, Rachael; Calm, Alena; Carney, James P.; O’Brien, Thomas W.; Walker, Jennifer L.; Garber, Eric A. E.

    2011-01-01

    Llama derived single domain antibodies (sdAb), the recombinantly expressed variable heavy domains from the unique heavy-chain only antibodies of camelids, were isolated from a library derived from llamas immunized with a commercial abrin toxoid preparation. Abrin is a potent toxin similar to ricin in structure, sequence and mechanism of action. The selected sdAb were evaluated for their ability to bind to commercial abrin as well as abrax (a recombinant abrin A-chain), purified abrin fractions, Abrus agglutinin (a protein related to abrin but with lower toxicity), ricin, and unrelated proteins. Isolated sdAb were also evaluated for their ability to refold after heat denaturation and ability to be used in sandwich assays as both capture and reporter elements. The best binders were specific for the Abrus agglutinin, showing minimal binding to purified abrin fractions or unrelated proteins. These binders had sub nM affinities and regained most of their secondary structure after heating to 95 °C. They functioned well in sandwich assays. Through gel analysis and the behavior of anti-abrin monoclonal antibodies, we determined that the commercial toxoid preparation used for the original immunizations contained a high percentage of Abrus agglutinin, explaining the selection of Abrus agglutinin binders. Used in conjunction with anti-abrin monoclonal and polyclonal antibodies, these reagents can fill a role to discriminate between the highly toxic abrin and the related, but much less toxic, Abrus agglutinin and distinguish between different crude preparations. PMID:22174977

  5. Dielectronic Recombination of Al-Like Ions

    Science.gov (United States)

    Abdel-Naby, Shahin; Nikolic, Dragan; Gorczyca, Thomas W.; Badnell, Nigel R.; Savin, Daniel W.

    2008-05-01

    Accurate dielectronic recombination (DR) data are important for cosmic and laboratory plasma modeling. Over the past few years, our group has computed reliable DR data for all isoelectronic sequences up through Mg-like ions. Recently, we have focused our work on the complex third-row M-shell isoelectronic sequences, especially Al-like. Previous calculations for the DR rate coefficient for S^3+ were performed only within a non-relativistic LS-coupling approximation. Fe^13+ DR calculations, including semi-relativistic effects, have been completed and tested against the Heidelberg heavy-ion Test Storage Ring facility measurements. Here we present semi-relativistic DR rate coefficient calculations for a wide range of Al-like ions using AUTOSTRUCTURE, a level-resolved distorted-wave program package. The important effect of fine structure splitting in the Al-like ground state will be discussed. Finally, our results are fitted into a simple formula for use by astrophysical plasma modelers.This work was funded in part by NASA (APRA), NASA (SHP) SR&T, and UK PPARC grants.

  6. Seek and you shall find--but then what do you do? Cold agglutinins in cardiopulmonary bypass and a single-center experience with cold agglutinin screening before cardiac surgery.

    Science.gov (United States)

    Jain, Michael D; Cabrerizo-Sanchez, Rosa; Karkouti, Keyvan; Yau, Terrence; Pendergrast, Jacob M; Cserti-Gazdewich, Christine M

    2013-04-01

    Cardiopulmonary bypass (CPB) during cardiac surgery can involve deliberate hypothermia of the systemic (22-36 °C) and coronary circulations (as low as 8-12 °C). Adverse sequelae of cold-active antibodies have been feared and reported under such conditions, and some centers thus elect to screen for cold agglutinins before CPB. We reviewed the literature on cold agglutinins in cardiac surgery and described the yields and effects of cold agglutinin screening (CAS) in 14,900 cardiac surgery patients undergoing CPB over 8 years at a single institution. Cold agglutinin screening was positive in 47 cases (0.3%), at an annual testing cost of $17,000 CAD. The response of the surgical team to the preoperative discovery of a cold agglutinin was variable, with CPB modified to avoid hypothermia in approximately one-third of cases. In patients discovered to have a positive CAS, postoperative intensive care unit and hospital length of stay were marginally increased (54.6 vs. 42.8 hours, P = .02; 7 [6-14] vs. 7 [5-9] days, P = .04). However, the composite of mortality or severe morbidity (stroke, myocardial infarction, dialysis, low output syndrome, sepsis, and deep vein thrombosis) was not significantly different (14.9% vs. 9.2%, P = .2). Antibody verification found that only 43% of positive CAS patients had true cold agglutinins (20 patients). Furthermore, the rate of adverse events was low in both CAS-positive and true-positive cold agglutinin patients undergoing CPB and cardiac surgery. Finally, modification of CPB to attenuate hypothermia did not decrease adverse events. Based upon historical and local data, preclinical CAS is cost-substantial and nonspecific. Cold agglutinin screening does not promote an algorithm of care that meaningfully improves patient CPB outcomes. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Studies on chemical modification of cold agglutinin from the snail Achatina fulica.

    Science.gov (United States)

    Sarkar, M; Mitra, D; Sen, A K

    1987-01-01

    The cold agglutinin isolated from the albumin gland of the snail Achatina fulica was modified with various chemical reagents in order to detect the amino acids and/or carbohydrate residues present in its carbohydrate-binding sites. Treatment with reagents considered specific for modification of lysine, arginine and tryptophan residues of the cold agglutinin did not affect the carbohydrate-binding activity of the agglutinin. Modification of tyrosine residues showed some change. However, modification with carbodiimide followed by alpha-aminobutyric acid methyl ester causes almost complete loss of its binding activity, indicating the involvement of aspartic acid and glutamic acid in its carbohydrate-binding activity. The carbohydrate residues of the cold agglutinin were removed by beta-elimination reaction, indicating that the sugars are O-glycosidically linked to protein part of the molecule. Removal of galactose residues from the cold agglutinin by the action of beta-galactosidase indicated that the galactose molecules are beta-linked. These carbohydrate-modified glycoproteins showed a marked change in agglutination property, i.e. they agglutinated rabbit erythrocytes at both 10 degrees C and 25 degrees C, indicating that the galactose residues of the glycoprotein play an important role in the cold-agglutination property of the glycoprotein. The c.d. data showed the presence of an almost identical type of random-coil conformation in the native cold agglutinin at 10 degrees C and in the carbohydrate-modified glycoprotein at 10 degrees C and 25 degrees C. This particular random-coil conformation is essential for carbohydrate-binding property of the agglutinin. Images Fig. 1. PMID:3118867

  8. Biogenesis and fate of the cell-cell adhesion molecule, agglutinin, during gametogenesis and fertilization of Chlamydomonas reinhardtii

    International Nuclear Information System (INIS)

    Hunnicutt, G.R.

    1989-01-01

    Fertilization in Chlamydomonas begins with the species-specific recognition and adhesion between gametes of opposite mating types via agglutinin molecules on the flagellar surface. This adhesion generates a cAMP-mediated sexual signal that initiates the subsequent events of call wall release, mating structure activation, and cell fusion. Although flagella of paired gametes remain attached to each other until the zygote forms, the process is dynamic. Engaged agglutinins rapidly become inactivated and turnover, requiring the constant supply of new agglutinins to replace the lost molecules. A population of cell body associated agglutinins has been postulated to the pool of agglutinins recruited during this turnover. Cell body agglutinins, therefore were identified, purified, localized within the cells and compared to flagellar agglutinins. The relationship between these two agglutinin populations was also examined. Cell body agglutinins were biochemically indistinguishable from the flagellar form with respect to their M r , sedimentation coefficient, and hydrophobicity elution properties. Functionally, however, these molecules were inactive in situ. The calculated surface density of agglutinins in the cell body and flagellar domains was similar and thus could not explain their functional difference, but two domains contiguous and yet distinctive suggested they may be separated by a functional barrier. To test this, a method was developed, using a monoclonal antibody and cycloheximide, that removed the flagellar agglutinins so movement between the domains could be monitored. Mobilization of agglutinins onto the flagella did not occur unless sexual signaling was induced with cAMP and papaverine

  9. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  10. Isolation and purification of wheat germ agglutinin and analysis of its properties

    Science.gov (United States)

    Wang, Han

    2017-12-01

    In this paper, the wheat germ agglutinin was isolated and purified by affinity chromatography of chicken ovomucoid as ligand. The physicochemical properties were analyzed. The chicken ovomucoid was isolated from egg white and conjugated to affinity chromatography column agarose gel to prepare affinity adsorbent. The crude extract of wheat germ was freezedried by affinity chromatography. The physicochemical properties were analyzed by SDSpolyacrylamide gel electrophoresis and isoelectric focusing electrophoresis. And the relative molecular mass and isoelectric point of wheat germ agglutinin were obtained, and the high efficiency of purification of wheat germ agglutinin was proved by affinity chromatography.

  11. Beware Cold Agglutinins in Organ Donors! Ex Vivo Lung Perfusion From an Uncontrolled Donation After Circulatory-Determination-of-Death Donor With a Cold Agglutinin: A Case Report.

    Science.gov (United States)

    Venkataraman, A; Blackwell, J W; Funkhouser, W K; Birchard, K R; Beamer, S E; Simmons, W T; Randell, S H; Egan, T M

    2017-09-01

    We began to recover lungs from uncontrolled donation after circulatory determination of death to assess for transplant suitability by means of ex vivo lung perfusion (EVLP) and computerized tomographic (CT) scan. Our first case had a cold agglutinin with an interesting outcome. A 60-year-old man collapsed at home and was pronounced dead by Emergency Medical Services personnel. Next-of-kin consented to lung retrieval, and the decedent was ventilated and transported. Lungs were flushed with cold Perfadex, removed, and stored cold. The lungs did not flush well. Medical history revealed a recent hemolytic anemia and a known cold agglutinin. Warm nonventilated ischemia time was 51 minutes. O 2 -ventilated ischemia time was 141 minutes. Total cold ischemia time was 6.5 hours. At cannulation for EVLP, established clots were retrieved from both pulmonary arteries. At initiation of EVLP with Steen solution, tiny red aggregates were observed initially. With warming, the aggregates disappeared and the perfusate became red. After 1 hour, EVLP was stopped because of florid pulmonary edema. The lungs were cooled to 20°C; tiny red aggregates formed again in the perfusate. Ex vivo CT scan showed areas of pulmonary edema and a pyramidal right middle lobe opacity. Dissection showed multiple pulmonary emboli-the likely cause of death. However, histology showed agglutinated red blood cells in the microvasculature in pre- and post-EVLP biopsies, which may have contributed to inadequate parenchymal preservation. Organ donors with cold agglutinins may not be suitable owing to the impact of hypothermic preservation. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Complete Genome Sequence of the Largest Known Flavi-Like Virus, Diaphorina citri flavi-like virus, a Novel Virus of the Asian Citrus Psyllid, Diaphorina citri.

    Science.gov (United States)

    Matsumura, Emilyn E; Nerva, Luca; Nigg, Jared C; Falk, Bryce W; Nouri, Shahideh

    2016-09-08

    A novel flavi-like virus tentatively named Diaphorina citri flavi-like virus (DcFLV) was identified in field populations of Diaphorina citri through small RNA and transcriptome sequencing followed by reverse transcription (RT)-PCR. We report here the complete nucleotide sequence and genome organization of DcFLV, the largest flavi-like virus identified to date. Copyright © 2016 Matsumura et al.

  13. The Urtica dioica Agglutinin Is a Complex Mixture of Isolectins 1

    Science.gov (United States)

    Van Damme, Els J. M.; Broekaert, Willem F.; Peumans, Willy J.

    1988-01-01

    Rhizomes of stinging nettle (Urtica dioica) contain a complex mixture of isolectins. Ion exchange chromatography with a high resolution fast protein liquid chromatography system revealed six isoforms which exhibit identical agglutination properties and carbohydrate-binding specificity and in addition have the same molecular structure and virtually identical biochemical properties. However, since the U. dioica agglutinin isolectins differ definitely with respect to their amino acid composition, it is likely that at least some of them are different polypeptides coded for by different genes. Images Fig. 3 PMID:16665952

  14. Further characterization of the cold agglutinin from the snail Achatina fulica.

    Science.gov (United States)

    Mitra, D; Sarkar, M; Allen, A K

    1987-01-01

    The cold agglutinin from the albumin gland of the snail Achatina fulica was purified to homogeneity by using sheep gastric mucin-Sepharose 4B as affinity column followed by gel filtration on Bio-Gel P-300. The homogeneity was checked by alkaline gel electrophoresis, immunodiffusion and immunoelectrophoresis. The purified cold agglutinin is a glycoprotein of native M2 220,000 consisting of three non-covalently bound subunits of Mr 84,000, 74,000 and 62,000 and having a pI value of 4.5. The predominant amino acids are aspartic acid and glutamic acid (or amides) and serine, which account for 39% of the residues. About 3% of the residues are half-cystine. The lectin is a glycoprotein with about 30.7% carbohydrate, the most abundant sugars being galactose, N-acetylgalactosamine and N-acetylglucosamine. Mannose, xylose and fucose are also present. The inhibition of agglutination of human umbilical-cord erythrocytes by the cold agglutinin is specific for methyl beta-D-galactoside and also for glycolipids present on cord erythrocytes. The c.d. data show only negative ellipticity values in the far-u.v. region for the protein at various concentrations and temperatures and also in the presence of the hapten lactose (at different concentrations), indicating the presence of a random-coil conformation in the agglutinin that varies according to temperature. Images Fig. 2. Fig. 3. Fig. 5. Fig. 6. PMID:3593252

  15. Platelet cold agglutinins and thrombocytopenia: A diagnostic dilemma in the intensive care unit

    Directory of Open Access Journals (Sweden)

    TV Bharath Kumar

    2014-01-01

    Full Text Available We report a case of pseudo-thrombocytopenia due to cold agglutinins against platelets. These cold agglutinins were the cause for diagnostic confusion and resulted in extensive workup and unnecessary therapeutic precautions. A thirty two year old female with Guillain-Barre syndrome was admitted in the ICU and serial work-up showed markedly low levels of platelets. The patient had no symptoms of bleeding and patient was investigated extensively for deciphering the etiology of low platelet count. In-vitro clumping of platelets was suspected and in-vitro studies showed marked clumping of platelets with ethylene-diamine-tetra-acetic acid, citrate and heparinized samples. The manual platelet count was found to be within normal limits. Thrombocytopenia as a result of platelet cold agglutinins is a rare cause of in-vitro low platelet counts. No clinical problems have been reported due to the same.

  16. An example of auto-anti-A1 agglutinins.

    Science.gov (United States)

    Wright, J; Lim, F C; Freedman, J

    1980-10-01

    The serum of an elderly man, group A, Le(a+b-), contained an IgM antibody that agglutinated his own cells and the cells of random group A1 donors. Over a period of 5 months, the titre of these auto-anti-A1 agglutinins was 4 at 22 degrees C.

  17. Effect of in vivo γ-irradiation on the binding of wheat germ agglutinin on lymphocyte plasma membranes

    International Nuclear Information System (INIS)

    Moullier, P.; Daveloose, D.; Dubos, M.; Leterrier, F.; Hoebeke, J.

    1986-01-01

    Using quantitative fluorimetry with fluoresceinated wheat germ agglutinin, we have been able to investigate in vivo gamma radiation-induced damage at the outer membrane level of rat splenic lymphocytes, namely damage to the glucosidic moieties of membrane glycoproteins and glycolipids. This paper demonstrates that below an irradiation level of 1 gray (Gy), removal of sialic acid is the major feature leading to new exposed specific binding sites for wheat germ agglutinin, since this lectin is specific for sialic acid and N-acetyl-D-glucosamine. Our studies also suggest that above 1 Gy of irradiation more internal damage occurs, since we observed a striking decrease in wheat germ agglutinin binding sites. (orig.)

  18. Brucella abortus agglutinins in dogs in Zaria, Nigeria | Osinubi ...

    African Journals Online (AJOL)

    Serum samples from dogs brought for routine physical examination, vaccination and other complaints at the Veterinary Teaching Hospital (VTH) of Ahmadu Bello University and other parts of Zaria were tested for Brucella abortus antibodies. Forty-three (21.5%) of the 200 dogs studied were positive for B. abortus agglutinins ...

  19. Detection of Salmonella typhi agglutinins in sera of patients with ...

    African Journals Online (AJOL)

    Background and Purpose: Widal test is frequently applied for the detection of Salmonella agglutinins to diagnose Salmonella enterica serotype Typhi infection. There are however a number of controversies challenging the diagnostic utility of this test. This study was performed to determine the prevalence of Salmonella ...

  20. [Undifferentiated cutaneous angiosarcoma of the head: identification by the endothelial marker Ulex europaeus agglutinin I].

    Science.gov (United States)

    Bork, K; Fries, J; Hoede, N; Korting, G W; Dienes, P

    1985-06-01

    Cutaneous angiosarcoma of the head is a rare tumor of the elderly and can occur in an undifferentiated form without any clinical or histological signs of the vascular origin of this tumor. In these cases, the tumor can be identified by using endothelial cell markers, such as factor-VIII-related antigen and ulex europaeus agglutinin I, in an immunofluorescence technique or a peroxidase-antiperoxidase method. A 78-year-old patient is described who died within 18 months from such a tumor, which was diagnosed using the endothelial cell marker, ulex europaeus agglutinin I.

  1. A lectin histochemical study on carbohydrate moieties of the gonadotropin-like substance in the epithelial cells of Hatschek's pit of Branchiostoma belcheri

    Science.gov (United States)

    Fang, Y. Q.; Welsch, U.

    1997-03-01

    The present light microscopic lectin, histochemical study suggests for the first time that the vertebrate gonadotropin-like substance in the basal part of the epithelial cells of Hatschek's pit is a sialic acid-containing glycoprotein. The binding intensity of the epithelial cells in Hatschek's pit to 6 lectins ( Limulus polyphemus agglutinin (LPA), Wheat germ agglutinin (WGA), Helix pomatia agglutinin (HPA), Concanavalin A (Con A), Ulex europaeus agglutinin I (UEA I) and Ricinus communis agglutinin I (RCA I)) indicate that the carbohydrate composition of the gonadotrophic glycoprotein is similar to that of mammals and fish, and that N-acetyl-D-galactosamine, sialic acid, glucosamine, D-mannose and L-fucose are components of the carbohydrate portion.

  2. The frequency of ABO blood group maternal-fetal incompatibility, maternal iso-agglutinins, and immune agglutinins quantitation in Osogbo, Osun State, South-West of Nigeria

    Directory of Open Access Journals (Sweden)

    Oseni Bashiru

    2011-01-01

    Full Text Available Background : ABO incompatibility in maternal-fetal relationship has been shown to cause hemolytic disease of the newborn (HDNB; a survey which is not yet done in this locality. Aim: Frequency of ABO blood group maternal-fetal incompatibility, maternal iso-agglutinins, and immune agglutinins quantitation was carried out in Osogbo, Osun State, South-West of Nigeria. Settings and Designs : A total of 260 subjects comprising 130 postpartum mothers within the age range of 22-35 years having good obstetrics history and normal delivery, with their 130 neonate babies were used for the study. Materials and Methods : ABO cell and serum groupings were carried out on the subjects using standard antisera and cells with appropriate controls. Direct Coomb′s Test was carried out on neonate red cells. Antibody quantitation by double dilution on the maternal serum using red cells containing corresponding antigen to the antibody was determined. A titer, which is the reciprocal of the highest dilution showing agglutination by Indirect Coombs Test, was determined. Another batch of sera was pretreated with 2-mecarptoethanol before determining the titer. Statistical Analysis: The distribution study results obtained were compared in percentages, whereas the antibodies quantitation was expressed as titers using the mode of the titers for compariso-agglutininsn. Results and Conclusions : Thirty-eight percent (50 mothers were ABO incompatible with their babies, whereas 62% (80 mothers were compatible. The distribution of blood groups in the compatible population showed blood group O (45%; A (30%; B (20%; and AB (5%. Mothers O, A, and B carrying incompatible babies had a frequency of 24% each, whereas mothers AB had 28%. Serologist differences occur in maternal ABO antibodies of corresponding incompatible baby ABO antigens. A high incidence of ABO maternal-fetal incompatibility observed without detection of immune agglutinins is indicative of a rare incidence of HDNB due

  3. Validated thermodynamic prediction of AlP and eutectic (Si) solidification sequence in Al-Si cast alloys

    International Nuclear Information System (INIS)

    Liang, S M; Schmid-Fetzer, R

    2016-01-01

    The eutectic microstructure in hypoeutectic Al-Si cast alloys is strongly influenced by AlP particles which are potent nuclei for the eutectic (Si) phase. The solidification sequence of AlP and (Si) phases is, thus, crucial for the nucleation of eutectic silicon with marked impact on its morphology. This study presents this interdependence between Si- and P-compositions, relevant for Al-Si cast alloys, on the solidification sequence of AlP and (Si). These data are predicted from a series of thermodynamic calculations. The predictions are based on a self-consistent thermodynamic description of the Al-Si-P ternary alloy system developed recently. They are validated by independent experimental studies on microstructure and undercooling in hypoeutectic Al-Si alloys. A constrained Scheil solidification simulation technique is applied to predict the undercooling under clean heterogeneous nucleation conditions, validated by dedicated experimental observations on entrained droplets. These specific undercooling values may be very large and their quantitative dependence on Si and P content of the Al alloy is presented. (paper)

  4. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    Science.gov (United States)

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  5. Human salivary agglutinin binds to lung surfactant protein-D and is identical with scavenger receptor protein gp-340

    DEFF Research Database (Denmark)

    Ligtenberg, T J; Bikker, F J; Groenink, J

    2001-01-01

    bound in a similar way to Streptococcus mutans and surfactant protein-D. Histochemically, the distribution of gp-340 in the submandibular salivary glands was identical with the agglutinin distribution, as shown in a previous paper [Takano, Bogert, Malamud, Lally and Hand (1991) Anat. Rec. 230, 307......-318]. We conclude that agglutinin is identical with gp-340, and that this molecule interacts with S. mutans and surfactant protein-D....

  6. Next Generation Sequencing and ALS: known genes, different phenotyphes.

    Science.gov (United States)

    Campopiano, Rosa; Ryskalin, Larisa; Giardina, Emiliano; Zampatti, Stefania; Busceti, Carla L; Biagioni, Francesca; Ferese, Rosangela; Storto, Marianna; Gambardella, Stefano; Fornai, Francesco

    2017-12-01

    Amyotrophic lateral sclerosis (ALS) is fatal neurodegenerative disease clinically characterized by upper and lower motor neuron dysfunction resulting in rapidly progressive paralysis and death from respiratory failure. Most cases appear to be sporadic, but 5-10 % of cases have a family history of the disease, and over the last decade, identification of mutations in about 20 genes predisposing to these disorders has provided the means to better understand their pathogenesis. Next Generation sequencing (NGS) is an advanced high-throughput DNA sequencing technology which have rapidly contributed to an acceleration in the discovery of genetic risk factors for both familial and sporadic neurological and neurodegenerative diseases. These strategies allowed to rapidly identify disease-associated variants and genetic risk factors for both familial (fALS) and sporadic ALS (sALS), strongly contributing to the knowledge of the genetic architecture of ALS. Moreover, as the number of ALS genes grows, many of the proteins they encode are in intracellular processes shared with other known diseases, suggesting an overlapping of clinical and phatological features between different diseases. To emphasize this concept, the review focuses on genes coding for Valosin-containing protein (VPC) and two Heterogeneous nuclear RNA-binding proteins (HNRNPA1 and hnRNPA2B1), recently idefied through NGS, where different mutations have been associated in both ALS and other neurological and neurodegenerative diseases.

  7. Fluorescence Imaging of Streptococcus pneumoniae with the Helix pomatia agglutinin (HPA As a Potential, Rapid Diagnostic Tool

    Directory of Open Access Journals (Sweden)

    Mirian Domenech

    2017-07-01

    Full Text Available Streptococcus pneumoniae is a common human pathogen and a major causal agent of life-threatening infections that can either be respiratory or non-respiratory. It is well known that the Helix pomatia (edible snail agglutinin (HPA lectin shows specificity for terminal αGalNAc residues present, among other locations, in the Forssman pentasaccharide (αGalNAc1→3βGalNAc1→3αGal1→4βGal1→4βGlc. Based on experiments involving choline-independent mutants and different growth conditions, we propose here that HPA recognizes the αGalNAc terminal residues of the cell wall teichoic and lipoteichoic acids of S. pneumoniae. In addition, experimental evidence showing that pneumococci can be specifically labeled with HPA when growing as planktonic cultures as well as in mixed biofilms of S. pneumoniae and Haemophilus influenzae has been obtained. It should be underlined that pneumococci were HPA-labeled despite of the presence of a capsule. Although some non-pneumococcal species also bind the agglutinin, HPA-binding combined with fluorescence microscopy constitutes a suitable tool for identifying S. pneumoniae and, if used in conjunction with Gram staining and/or other suitable technique like antigen detection, it may potentially facilitate a fast and accurate diagnosis of pneumococcal infections.

  8. The presence of five nifH-like sequences in Clostridium pasteurianum: sequence divergence and transcription properties.

    OpenAIRE

    Wang, S Z; Chen, J S; Johnson, J L

    1988-01-01

    The nifH gene encodes the iron protein (component II) of the nitrogenase complex. We have previously shown the presence in Clostridium pasteurianum of two nifH-like sequences in addition to the nifH1 gene which codes for a protein identical to the isolated iron protein. In the present study, we report that there are at least five nifH-like sequences in C. pasteurianum. DNA sequencing data indicate that the six nifH (nifH1) and nifH-like (nifH2, nifH3, nifH4, nifH5 and nifH6) sequences are not...

  9. Effect of the lectins wheat germ agglutinin (WGA) and Ulex europaeus agglutinin (UEA-I) on the alpha-amylase secretion of rat pancreas in vitro and in vivo.

    Science.gov (United States)

    Mikkat, U; Damm, I; Schröder, G; Schmidt, K; Wirth, C; Weber, H; Jonas, L

    1998-05-01

    Lectins are able to bind to cholecystokinin (CCK) receptors and other glycosylated membrane proteins. The lectins wheat germ agglutinin (WGA) and Ulex europaeus agglutinin (UEA-I) are used for affinity chromatography to isolate the highly glycosylated CCK-A receptor of pancreatic acinar cells. According to the working hypothesis that lectin binding to the CCK receptor should alter the ligand-receptor interaction, the effect of WGA and UEA-I on CCK-8-induced enzyme secretion was studied on isolated rat pancreatic acini in vitro. In vitro both lectins showed a dosage-dependent inhibition of CCK-8-induced alpha-amylase secretion of acini over 60 min. WGA showed a strong inhibitory effect on amylase secretion, approximately 40%, in vitro. UEA-I caused a smaller, but significant decrease, approximately 20%, in enzyme secretion of isolated acini. Additionally, both lectins inhibited cerulein/secretin- or cerulein-induced pancreatic secretion of rats in vivo, but not after secretin alone. The results are discussed with respect to a possible influence of both lectins on the interaction of CCK or cerulein with the CCK-A receptor.

  10. A sheep hydatid cyst glycoprotein as receptors for three toxic lectins, as well as Abrus precatorius and Ricinus communis agglutinins.

    Science.gov (United States)

    Wu, A M; Song, S C; Wu, J H; Pfüller, U; Chow, L P; Lin, J Y

    1995-01-18

    The binding properties of a glycoprotein with blood group P1 specificity isolated from sheep hydatid cyst fluid with Gal and GalNAc specific lectins was investigated by quantitative precipitin and precipitin inhibition assays. The glycoprotein completely precipitated Ricinus communis agglutinin (RCA1), Abrus precatorius agglutinin (APA) and Mistletoe toxic lectin-I (ML-I). Only 1.0 microgram of P1 glycoprotein was required to precipitate 50% of 5.1 micrograms ML-I nitrogen. It also reacted well with abrin-a and ricin, precipitating over 73% of the lectin nitrogen added, but poorly or weakly with Dolichos biflorus (DBL), Vicia villosa (VVL, a mixture of A4, A2B2 and B4), VVL-B4, Arachis hypogaea (PNA), Maclura pomifera (MPL), Bauchinia purpurea alba (BPL) and Wistaria floribunda (WFL) lectins. When an inhibition assay in the range of 5.1 micrograms N to 5.9 micrograms N of lectins (ML-I, abrin-a; ricin, RCA1, and APA, and 10 micrograms P1 active glycoprotein interaction was performed; from 76 to 100% of the precipitations were inhibited by 0.44 and 0.52 mumol of Gal alpha 1-->4Gal and Gal beta 1-->4GlcNAc, respectively, but not or insignificantly with 1.72 mumol of GlcNAc. The Gal alpha 1-->4Gal disaccharide found in this P1 active glycoprotein is a frequently occurring sequence of many glycosphingolipids located at the surface of mammalian cell membranes, especially human erythrocytes and intestinal cells for ligand binding and microbial toxin attachment. The present finding suggests that the Gal alpha 1-->4Gal beta 1-->4GlcNAc sequence in this P1 active glycoprotein is one of the best glycoprotein receptors for three toxic lectins (ricin, abrin-a, and ML-I) as well as for APA, and RCA1, and the result of inhibition assay implies that these lectins are recognizing part or all of the Gal alpha 1-->4Gal beta 1-->4GlcNAc sequence in the P1 active glycoprotein.

  11. Synthesis and structural transformations of hydrotalcite-like materials Mg-Al and Zn-Al

    NARCIS (Netherlands)

    Prihod'ko, R.V.; Sychev, M.V.; Astrelin, I.M.; Erdmann, K.; Mangel, A.; Santen, van R.A.

    2001-01-01

    Mg-Al and Zn-Al hydrotalcite-like layered double hydroxides of various compositions were synthesized and characterized. A detailed comparative analysis of the structure and composition of starting and reconstructed layered double hydroxides was made

  12. Structural insights into the anti-HIV activity of the Oscillatoria agardhii agglutinin homolog lectin family.

    Science.gov (United States)

    Koharudin, Leonardus M I; Kollipara, Sireesha; Aiken, Christopher; Gronenborn, Angela M

    2012-09-28

    Oscillatoria agardhii agglutinin homolog (OAAH) proteins belong to a recently discovered lectin family. All members contain a sequence repeat of ~66 amino acids, with the number of repeats varying among different family members. Apart from data for the founding member OAA, neither three-dimensional structures, information about carbohydrate binding specificities, nor antiviral activity data have been available up to now for any other members of the OAAH family. To elucidate the structural basis for the antiviral mechanism of OAAHs, we determined the crystal structures of Pseudomonas fluorescens and Myxococcus xanthus lectins. Both proteins exhibit the same fold, resembling the founding family member, OAA, with minor differences in loop conformations. Carbohydrate binding studies by NMR and x-ray structures of glycan-lectin complexes reveal that the number of sugar binding sites corresponds to the number of sequence repeats in each protein. As for OAA, tight and specific binding to α3,α6-mannopentaose was observed. All the OAAH proteins described here exhibit potent anti-HIV activity at comparable levels. Altogether, our results provide structural details of the protein-carbohydrate interaction for this novel lectin family and insights into the molecular basis of their HIV inactivation properties.

  13. Demonstration of vascular endothelium in thyroid carcinomas using Ulex europaeus I agglutinin.

    Science.gov (United States)

    González-Cámpora, R; Montero, C; Martin-Lacave, I; Galera, H

    1986-03-01

    The usefulness of using peroxidase-labelled Ulex europaeus agglutinin I for the staining of small vessels and capillaries in the capsule of thyroid tumours is demonstrated. With this procedure the scanning for small tumour deposits in those vessels and, consequently, the diagnosis of follicular carcinoma of the thyroid is facilitated.

  14. De novo design of RNA-binding proteins with a prion-like domain related to ALS/FTD proteinopathies.

    Science.gov (United States)

    Mitsuhashi, Kana; Ito, Daisuke; Mashima, Kyoko; Oyama, Munenori; Takahashi, Shinichi; Suzuki, Norihiro

    2017-12-04

    Aberrant RNA-binding proteins form the core of the neurodegeneration cascade in spectrums of disease, such as amyotrophic lateral sclerosis (ALS)/frontotemporal dementia (FTD). Six ALS-related molecules, TDP-43, FUS, TAF15, EWSR1, heterogeneous nuclear (hn)RNPA1 and hnRNPA2 are RNA-binding proteins containing candidate mutations identified in ALS patients and those share several common features, including harboring an aggregation-prone prion-like domain (PrLD) containing a glycine/serine-tyrosine-glycine/serine (G/S-Y-G/S)-motif-enriched low-complexity sequence and rich in glutamine and/or asparagine. Additinally, these six molecules are components of RNA granules involved in RNA quality control and become mislocated from the nucleus to form cytoplasmic inclusion bodies (IBs) in the ALS/FTD-affected brain. To reveal the essential mechanisms involved in ALS/FTD-related cytotoxicity associated with RNA-binding proteins containing PrLDs, we designed artificial RNA-binding proteins harboring G/S-Y-G/S-motif repeats with and without enriched glutamine residues and nuclear-import/export-signal sequences and examined their cytotoxicity in vitro. These proteins recapitulated features of ALS-linked molecules, including insoluble aggregation, formation of cytoplasmic IBs and components of RNA granules, and cytotoxicity instigation. These findings indicated that these artificial RNA-binding proteins mimicked features of ALS-linked molecules and allowed the study of mechanisms associated with gain of toxic functions related to ALS/FTD pathogenesis.

  15. SAP-like ultrafine-grained Al composites dispersion strengthened with nanometric AlN

    International Nuclear Information System (INIS)

    Balog, M.; Krizik, P.; Yan, M.; Simancik, F.; Schaffer, G.B.; Qian, M.

    2013-01-01

    This paper reports the development of novel Sinter-Aluminum-Pulver (SAP)-like Al–AlN nanocomposites via replacing the native Al 2 O 3 thin films on fine Al powder with a large volume fraction of in situ formed nanometric AlN dispersoids. Fine gas-atomized Al powder (d 50 =1.3 µm) compacts were first partially nitrided at 590 °C in flowing nitrogen, controlled by a small addition of Sn (0.3–0.4 wt%), and subsequently consolidated by hot direct extrusion. The resulting Al–AlN composites consisted of submicrometric Al grains reinforced with nanometric AlN dispersoids together with some nanometric Al 2 O 3 dispersoids. An Al–13 vol% AlN nanocomposite fabricated this way achieved exceptional ultimate tensile strength of 227 MPa, yield strength of 195 MPa and Young's modulus of 66 GPa at 300 °C, superior to typical SAP materials and coarse grained Al–AlN composites. In addition, the Al–13 vol% AlN nanocomposite exhibited good thermal stability up to 500 °C. The strengthening mechanism is discussed

  16. Stable structures of Al510–800 clusters and lowest energy sequence of truncated octahedral Al clusters up to 10,000 atoms

    International Nuclear Information System (INIS)

    Wu, Xia; He, Chengdong

    2012-01-01

    Highlights: ► The stable structures of Al 510–800 clusters are obtained with the NP-B potential. ► Al 510–800 clusters adopt truncated octahedral (TO) growth pattern based on complete TOs at Al 405 , Al 586 , and Al 711 . ► The lowest energy sequence of complete TOs up to the size 10,000 is proposed. -- Abstract: The stable structures of Al 510–800 clusters are obtained using dynamic lattice searching with constructed cores (DLSc) method by the NP-B potential. According to the structural growth rule, octahedra and truncated octahedra (TO) configurations are adopted as the inner cores in DLSc method. The results show that in the optimized structures two complete TO structures are found at Al 586 and Al 711 . Furthermore, Al 510–800 clusters adopt TO growth pattern on complete TOs at Al 405 , Al 586 , and Al 711 , and the configurations of the surface atoms are investigated. On the other hand, Al clusters with complete TO motifs are studied up to the size 10,000 by the geometrical construction method. The structural characteristics of complete TOs are denoted by the term “family”, and the growth sequence of Al clusters is investigated. The lowest energy sequence of complete TOs is proposed.

  17. 70-year old female patient with mismatch between hematocrit and hemoglobin values: the effects of cold agglutinin on complete blood count.

    Science.gov (United States)

    Ercan, Serif; Calışkan, Mustafa; Koptur, Erhan

    2014-01-01

    There are a number of pre-analytical and analytical factors, which cause false results in the complete blood count. The present case identifies cold agglutinins as the cause for the mismatch between hematocrit and hemoglobin values. 70-year old female patient had a history of cerebrovascular diseases and rheumatoid arthritis. During routine laboratory examination, the patient had normal leukocyte and platelet counts; however, the hemoglobin (Hb: 105 g/L) and hematocrit (HCT: 0.214 L/L) results were discordant. Hemolysis, lipemia and cold agglutinin were evaluated as possible reasons for the mismatch between hematocrit and hemoglobin values. First blood sample was slightly hemolysed. Redrawn sample without hemolysis or lipemia was analyzed but the mismatch became even more distinct (Hb: 104 g/L and HCT: 0.08 L/L). In this sample, the titration of the cold agglutinin was determined and found to be positive at 1:64 dilution ratios. After an incubation of the sample at 37°C for 2 hours, reversibility of agglutination was observed. We conclude that cold agglutinins may interfere with the analysis of erythrocyte and erythrocyte-related parameters (HCT, MCV, MCH and MCHC); however, Hb, leukocyte and platelet counts are not affected.

  18. Genome sequence of a novel Hobi-like pestivirus in China.

    Science.gov (United States)

    Mao, Li; Li, Wenliang; Zhang, Wenwen; Yang, Leilei; Jiang, Jieyuan

    2012-11-01

    Hobi-like pestivirus is a novel pestivirus species first isolated in 2004. Here, we report the genome sequence of a Hobi-like pestivirus strain isolated from contaminated MDBK cells in China. The sequence information is important for surveillance of this emerging animal infectious disease worldwide.

  19. Genome Sequence of a Novel Hobi-Like Pestivirus in China

    OpenAIRE

    Mao, Li; Li, Wenliang; Zhang, Wenwen; Yang, Leilei; Jiang, Jieyuan

    2012-01-01

    Hobi-like pestivirus is a novel pestivirus species first isolated in 2004. Here, we report the genome sequence of a Hobi-like pestivirus strain isolated from contaminated MDBK cells in China. The sequence information is important for surveillance of this emerging animal infectious disease worldwide.

  20. [Anti-Leptospira agglutinins in different professional groups in the city of Londrina, Paraná].

    Science.gov (United States)

    Vasconcelos, L M; Cisalpino, E O; Vieira, M N; Koury, M C

    1992-01-01

    Serum samples were obtained from 208 individuals in Londrina, Paraná, Brazil. The serum were analysed for leptospiral agglutinins by agglutination microscopic tests and 28.4% were positive. The highest positivity was found for the serum of garbage collector (46.7%).

  1. Distribution of Ds-like sequences in genomes of cereals

    International Nuclear Information System (INIS)

    Vershinin, A.V.; Salina, E.A.; Shumnii, V.K.; Svitashev, S.K.

    1986-01-01

    It has been suggested that insertions of Ds-elements may alter the effectiveness of transcription or translation of the genetic loci and the normal processing of introns and exons, and that they may impair coding frames, etc. The object of the present study was to determine the frequency of occurence of DNA sequences similar to the Ds-controlling elements of mazie (Ds-like sequences) among other representatives of cereals. The conservative feature of the primary structure of transposons from different eukaryotic species served as a basis in this investigation. By means of the ''nick-translation'' reaction with the aid of DNA-polymerase I (alpha- 32 P) dCTP or TTP was introduced into the Ds-element. The specific radioactivity of the preparations obtained was 5 x 10 7 to 1 x 10 8 cpm/gamma. From the results obtained, it is suggested that the genomes of cereals examined contain a collection of Ds-like sequences. The Ds-element may have a significant effect on gene expression in the presence of Ac-like or other sequences, which undergo transposition

  2. Testing Antifungal Vaccines in an Animal Model of Invasive Candidiasis and in Human Mucosal Candidiasis.

    Science.gov (United States)

    Segal, Esther

    2017-01-01

    The following article will concentrate on the NDV-3 anti-Candida and Staphylococcus vaccine. The vaccine is composed of the N-terminal portion of the Candida albicans agglutinin-like sequence 3 protein (Als3p) and aluminum hydroxide as adjuvant. The vaccine conferred protection to mice against experimental vaginal, oral, and intravenous challenge with C. albicans. Due to the sequence and structural homology of the Als3p with Staphylococcus aureus surface proteins, the vaccine also protected against experimental skin and IV infection with S. aureus. The vaccine has reached the stage of human trials: phase 1 clinical studies have shown that the vaccine is safe and immunogenic. The latest brief conference abstract reports of vaccination in women suffering from recurrent vaginal candidiasis, indicating that the recurrence rates were lower in the women receiving the vaccine.

  3. Wheat germ agglutinin-functionalised crosslinked polyelectrolyte microparticles for local colon delivery of 5-FU

    DEFF Research Database (Denmark)

    Glavas-Dodov,, Marija; Steffansen, Bente; Srcarevska, Maja

    2013-01-01

    We have previously reported the development and characterisation of wheat germ agglutinin (WGA)-functionalised chitosan-Ca-alginate (CTS-Ca-ALG) microparticles (MPs) loaded with acid-resistant particles of 5-fluorouracil (5-FU). In the present work, our goal was to evaluate the potential of these......We have previously reported the development and characterisation of wheat germ agglutinin (WGA)-functionalised chitosan-Ca-alginate (CTS-Ca-ALG) microparticles (MPs) loaded with acid-resistant particles of 5-fluorouracil (5-FU). In the present work, our goal was to evaluate the potential......-Ca-ALG MPs and WGA conjugates. The concentration of 5-FU associated with Caco-2 cells was significantly greater when delivered from MPs. By incorporation of 5-FU into MPs and further decoration with WGA, an increased [methyl-³H]thymidine uptake was observed few hours after continuous drug treatment followed...... by significantly reduced uptake after 6 h. Gastrointestinal distribution was in favour of increased localisation and concentration of the particles in colon region....

  4. Mouse mammary tumor virus-like gene sequences are present in lung patient specimens

    Directory of Open Access Journals (Sweden)

    Rodríguez-Padilla Cristina

    2011-09-01

    Full Text Available Abstract Background Previous studies have reported on the presence of Murine Mammary Tumor Virus (MMTV-like gene sequences in human cancer tissue specimens. Here, we search for MMTV-like gene sequences in lung diseases including carcinomas specimens from a Mexican population. This study was based on our previous study reporting that the INER51 lung cancer cell line, from a pleural effusion of a Mexican patient, contains MMTV-like env gene sequences. Results The MMTV-like env gene sequences have been detected in three out of 18 specimens studied, by PCR using a specific set of MMTV-like primers. The three identified MMTV-like gene sequences, which were assigned as INER6, HZ101, and HZ14, were 99%, 98%, and 97% homologous, respectively, as compared to GenBank sequence accession number AY161347. The INER6 and HZ-101 samples were isolated from lung cancer specimens, and the HZ-14 was isolated from an acute inflammatory lung infiltrate sample. Two of the env sequences exhibited disruption of the reading frame due to mutations. Conclusion In summary, we identified the presence of MMTV-like gene sequences in 2 out of 11 (18% of the lung carcinomas and 1 out of 7 (14% of acute inflamatory lung infiltrate specimens studied of a Mexican Population.

  5. Phaseolus vulgaris leuco-agglutinin immunohistochemistry. A comparison between autoradiographic and lectin tracing of neuronal efferents

    NARCIS (Netherlands)

    Horst, G.J. ter; Karst, H.; Luiten, P.G.M.

    1984-01-01

    The autoradiographic pattern of anterograde labeling as a result from injections with tritiated amino acids is compared to the labeling of efferents with Phaseolus vulgaris leuco-agglutinin after lectin injections in the same nucleus visualized by immunohistochemical methods. This comparison is made

  6. Exome sequencing reveals VCP mutations as a cause of familial ALS

    OpenAIRE

    Johnson, Janel O.; Mandrioli, Jessica; Benatar, Michael; Abramzon, Yevgeniya; Van Deerlin, Vivianna M.; Trojanowski, John Q.; Gibbs, J Raphael; Brunetti, Maura; Gronka, Susan; Wuu, Joanne; Ding, Jinhui; McCluskey, Leo; Martinez-Lage, Maria; Falcone, Dana; Hernandez, Dena G.

    2010-01-01

    Using exome sequencing, we identified a p.R191Q amino acid change in the valosin-containing protein (VCP) gene in an Italian family with autosomal dominantly inherited amyotrophic lateral sclerosis (ALS). Mutations in VCP have previously been identified in families with Inclusion Body Myopathy, Paget’s disease and Frontotemporal Dementia (IBMPFD). Screening of VCP in a cohort of 210 familial ALS cases and 78 autopsy-proven ALS cases identified four additional mutations including a p.R155H mut...

  7. TaALMT1 promoter sequence compositions, acid tolerance, and Al tolerance in wheat cultivars and landraces from Sichuan in China.

    Science.gov (United States)

    Han, C; Dai, S F; Liu, D C; Pu, Z J; Wei, Y M; Zheng, Y L; Wen, D J; Zhao, L; Yan, Z H

    2013-11-18

    Previous genetic studies on wheat from various sources have indicated that aluminum (Al) tolerance may have originated independently in USA, Brazil, and China. Here, TaALMT1 promoter sequences of 92 landraces and cultivars from Sichuan, China, were sequenced. Five promoter types (I', II, III, IV, and V) were observed in 39 cultivars, and only three promoter types (I, II, and III) were observed in 53 landraces. Among the wheat collections worldwide, only the Chinese Spring (CS) landrace native to Sichuan, China, carried the TaALMT1 promoter type III. Besides CS, two other Sichuan-bred landraces and six cultivars with TaALMT1 promoter type III were identified in this study. In the phylogenetic tree constructed based on the TaALMT1 promoter sequences, type III formed a separate branch, which was supported by a high bootstrap value. It is likely that TaALMT1 promoter type III originated from Sichuan-bred wheat landraces of China. In addition, the landraces with promoter type I showed the lowest Al tolerance among all landraces and cultivars. Furthermore, the cultivars with promoter type IV showed better Al tolerance than landraces with promoter type II. A comparison of acid tolerance and Al tolerance between cultivars and landraces showed that the landraces had better acid tolerance than the cultivars, whereas the cultivars showed better Al tolerance than the landraces. Moreover, significant difference in Al tolerance was also observed between the cultivars raised by the National Ministry of Agriculture and by Sichuan Province. Among the landraces from different regions, those from the East showed better acid tolerance and Al tolerance than those from the South and West of Sichuan. Additional Al-tolerant and acid-tolerant wheat lines were also identified.

  8. Transcriptional Signatures in Response to Wheat Germ Agglutinin and Starvation in Drosophila melanogaster Larval Midgut

    Science.gov (United States)

    One function of plant lectins such as wheat germ agglutinin (WGA) is to serve as defenses against herbivorous insects. The midgut is one critical site affected by dietary lectins. We observed marked cellular, structural, and gene expression changes in the midguts of Drosophila melanogaster third-i...

  9. Problems of Cold Agglutinins in Cardiac Surgery: How to Manage Cardiopulmonary Bypass and Myocardial Protection

    Directory of Open Access Journals (Sweden)

    Kambiz Alizadeh

    2014-02-01

    Full Text Available Cold agglutinins are of unique relevance in cardiac surgerybecause of the use of hypothermic cardiopulmonary bypass (CPB. Cold autoimmune diseases are defined by the presence of abnormal circulating proteins (usually IgM or IgA antibodies that agglutinate in response to a decrease in body temperature. These disorders include cryoglobulinemia and cold hemagglutinin disease.Immunoglobulin M autoantibodies to red blood cells, which activateat varying levels of hypothermia, can cause catastrophic hemagglutination,microvascular thrombosis, or hemolysis. Management of anesthesia in these patients includes strict maintenance of normothermia. Patients scheduled for the surgery requiring cardiopulmonary bypass present significant challenges. Use of systemic hypothermia may be contraindicated, and cold cardioplegia solutions may precipitate intracoronary hemagglutination with consequent thrombosis, ischemia, or infarction. Management of CPB andmyocardial protection requires individualized planning. We describea case of MV repair and CABG in a patient with high titercold agglutinins and high thermal amplitude for antibody activation.Normothermic CPB and continuous warm blood cardioplegia weresuccessfully used.

  10. Identification of the bacteria-binding peptide domain on salivary agglutinin (gp-340/DMBT1), a member of the scavenger receptor cysteine-rich superfamily

    DEFF Research Database (Denmark)

    Bikker, Floris J; Ligtenberg, Antoon J M; Nazmi, Kamran

    2002-01-01

    Salivary agglutinin is encoded by DMBT1 and identical to gp-340, a member of the scavenger receptor cysteine-rich (SRCR) superfamily. Salivary agglutinin/DMBT1 is known for its Streptococcus mutans agglutinating properties. This 300-400 kDa glycoprotein is composed of conserved peptide motifs: 14...... containing exclusively SRCR and SID domains that binds to S. mutans. To define more closely the S. mutans-binding domain, consensus-based peptides of the SRCR domains and SIDs were designed and synthesized. Only one of the SRCR peptides, designated SRCRP2, and none of the SID peptides bound to S. mutans....... Strikingly, this peptide was also able to induce agglutination of S. mutans and a number of other bacteria. The repeated presence of this peptide in the native molecule endows agglutinin/DMBT1 with a general bacterial binding feature with a multivalent character. Moreover, our studies demonstrate...

  11. Transitions in Al-like, Mg-like and Na-like Kr and Mo, observed in the JET tokamak

    Energy Technology Data Exchange (ETDEWEB)

    Jupen, C; Denne, B; Martinson, I [JET Joint Undertaking, Abingdon, Oxon (UK)

    1990-05-01

    Spectra of highly ionized Kr and Mo, emitted from the JET tokamak plasmas, have been recorded in the region 30-335 A. Detailed analysis of the n=3, {Delta}n=0 transitions in Kr XXIV-XXVI and Mo XXX-XXXII has resulted in a number of new spectral classifications. Some isoelectronic regularities for Al-like and Mg-like ions are discussed. (orig.).

  12. The bacteria binding glycoprotein salivary agglutinin (SAG/gp340) activates complement via the lectin pathway

    NARCIS (Netherlands)

    Leito, Jelani T. D.; Ligtenberg, Antoon J. M.; van Houdt, Michel; van den Berg, Timo K.; Wouters, Diana

    2011-01-01

    Salivary agglutinin (SAG), also known as gp-340 and Deleted in Malignant Brain Tumours 1, is a glycoprotein that is present in tears, lung fluid and mucosal surfaces along the gastrointestinal tract. It is encoded by the Deleted in Malignant Brain Tumours 1 gene, a member of the Scavenger Receptor

  13. Models of Prime-Like Sequences Generated by Least Element Sieve Operations Like the Sieve of Eratosthenes

    OpenAIRE

    Baum, Leonard E.

    2017-01-01

    We suggest other models of sieve generated sequences like the Sieve of Eratosthenes to explain randomness properties of the prime numbers, like the twin prime conjecture, the lim sup conjecture, the Riemann conjecture, and the prime number theorem.

  14. Molecular Cloning And Sequencing Of Disintegrin Like Domain ...

    African Journals Online (AJOL)

    Disintegrin-like domain was cloned and sequenced from Cerastes cerastes venom gland tissue. Nested RT-PCR was performed using initial primers designed based on the homology of disintegrins from Trimeresurus flavoviridis, Glodius halys , Agkistrodon halys and Trimeresurus macrosquamatus. The homology was ...

  15. Characterization of onion lectin (Allium cepa agglutinin) as an immunomodulatory protein inducing Th1-type immune response in vitro.

    Science.gov (United States)

    Prasanna, Vaddi K; Venkatesh, Yeldur P

    2015-06-01

    Onion (Allium cepa), a bulb crop of economic importance, is known to have many health benefits. The major objective of the present study is to address the immunomodulatory properties of onion lectin (A. cepa agglutinin; ACA). ACA was purified from onion extract by D-mannose-agarose chromatography (yield: ~1 mg/kg). ACA is non-glycosylated and showed a molecular mass of ~12 kDa under reducing/non-reducing SDS-PAGE; glutaraldehyde cross-linking indicated that ACA is a non-covalent tetramer of ~12 kDa subunits. Its N-terminal sequence (RNVLLNNEGL; UniProt KB Accn. C0HJM8) showed 70-90% homology to mannose-specific Allium agglutinins. ACA showed specific hemagglutination activity of 8200 units/mg and is stable in the pH range 6-10 and up to 45° C. The immunomodulatory activity of ACA was assessed using the macrophage cell line, RAW264.7 and rat peritoneal macrophages; at 0.1 μg/well, it showed a significant increase (6-8-fold vs. control) in the production of nitric oxide at 24h, and significantly stimulated (2-4-fold vs. control) the production of pro-inflammatory cytokines (TNF-α and IL-12) at 24h. ACA (0.1 μg/well) enhanced the proliferation of murine thymocytes by ~4 fold (vs. control) at 24h; however, ACA does not proliferate B cell-enriched rat splenocytes. Further, it significantly elevated the expression levels of cytokines (IFN-γ and IL-2) over the control in murine thymocytes. Taken together, purified ACA induces a Th1-type immune response in vitro. Though present in low amounts, ACA may contribute to the immune-boosting potential of the popular spice onion since considerable amounts are consumed on a daily basis universally. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Statistical learning of music- and language-like sequences and tolerance for spectral shifts.

    Science.gov (United States)

    Daikoku, Tatsuya; Yatomi, Yutaka; Yumoto, Masato

    2015-02-01

    In our previous study (Daikoku, Yatomi, & Yumoto, 2014), we demonstrated that the N1m response could be a marker for the statistical learning process of pitch sequence, in which each tone was ordered by a Markov stochastic model. The aim of the present study was to investigate how the statistical learning of music- and language-like auditory sequences is reflected in the N1m responses based on the assumption that both language and music share domain generality. By using vowel sounds generated by a formant synthesizer, we devised music- and language-like auditory sequences in which higher-ordered transitional rules were embedded according to a Markov stochastic model by controlling fundamental (F0) and/or formant frequencies (F1-F2). In each sequence, F0 and/or F1-F2 were spectrally shifted in the last one-third of the tone sequence. Neuromagnetic responses to the tone sequences were recorded from 14 right-handed normal volunteers. In the music- and language-like sequences with pitch change, the N1m responses to the tones that appeared with higher transitional probability were significantly decreased compared with the responses to the tones that appeared with lower transitional probability within the first two-thirds of each sequence. Moreover, the amplitude difference was even retained within the last one-third of the sequence after the spectral shifts. However, in the language-like sequence without pitch change, no significant difference could be detected. The pitch change may facilitate the statistical learning in language and music. Statistically acquired knowledge may be appropriated to process altered auditory sequences with spectral shifts. The relative processing of spectral sequences may be a domain-general auditory mechanism that is innate to humans. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. [Binding studies with Ulex europaeus agglutinin I (UEA-I) of the vascular endothelium of the synovial membrane].

    Science.gov (United States)

    Zschäbitz, A; Stofft, E

    1988-01-01

    The lectin binding sites of the synovium of patients with rheumatoid arthritis and osteoarthritis were investigated. It was shown that Ulex europaeus agglutinin is a constant marker of the vascular endothelium and is not induced during the course of inflammatory process in rheumatoid arthritis.

  18. Salivary agglutinin/DMBT1SAG expression is up-regulated in the presence of salivary gland tumors

    DEFF Research Database (Denmark)

    Bikker, F J; van der Wal, J E; Ligtenberg, A J M

    2004-01-01

    Salivary agglutinin (SAG) is encoded by the gene Deleted in Malignant Brain Tumors 1 (DMBT1) and represents the salivary variant of DMBT1 (DMBT1(SAG)). While SAG is a bona fide anti-caries factor, DMBT1 was proposed as a candidate tumor-suppressor for brain, digestive tract, and lung cancer. Thou...

  19. Staphylococcus aureus adherence to Candida albicans hyphae is mediated by the hyphal adhesin Als3p.

    Science.gov (United States)

    Peters, Brian M; Ovchinnikova, Ekaterina S; Krom, Bastiaan P; Schlecht, Lisa Marie; Zhou, Han; Hoyer, Lois L; Busscher, Henk J; van der Mei, Henny C; Jabra-Rizk, Mary Ann; Shirtliff, Mark E

    2012-12-01

    The bacterium Staphylococcus (St.) aureus and the opportunistic fungus Candida albicans are currently among the leading nosocomial pathogens, often co-infecting critically ill patients, with high morbidity and mortality. Previous investigations have demonstrated preferential adherence of St. aureus to C. albicans hyphae during mixed biofilm growth. In this study, we aimed to characterize the mechanism behind this observed interaction. C. albicans adhesin-deficient mutant strains were screened by microscopy to identify the specific receptor on C. albicans hyphae recognized by St. aureus. Furthermore, an immunoassay was developed to validate and quantify staphylococcal binding to fungal biofilms. The findings from these experiments implicated the C. albicans adhesin agglutinin-like sequence 3 (Als3p) in playing a major role in the adherence process. This association was quantitatively established using atomic force microscopy, in which the adhesion force between single cells of the two species was significantly reduced for a C. albicans mutant strain lacking als3. Confocal microscopy further confirmed these observations, as St. aureus overlaid with a purified recombinant Als3 N-terminal domain fragment (rAls3p) exhibited robust binding. Importantly, a strain of Saccharomyces cerevisiae heterologously expressing Als3p was utilized to further confirm this adhesin as a receptor for St. aureus. Although the parental strain does not bind bacteria, expression of Als3p on the cell surface conferred upon the yeast the ability to strongly bind St. aureus. To elucidate the implications of these in vitro findings in a clinically relevant setting, an ex vivo murine model of co-infection was designed using murine tongue explants. Fluorescent microscopic images revealed extensive hyphal penetration of the epithelium typical of C. albicans mucosal infection. Interestingly, St. aureus bacterial cells were only seen within the epithelial tissue when associated with the invasive

  20. Jump-and-return sandwiches: A new family of binomial-like selective inversion sequences with improved performance

    Science.gov (United States)

    Brenner, Tom; Chen, Johnny; Stait-Gardner, Tim; Zheng, Gang; Matsukawa, Shingo; Price, William S.

    2018-03-01

    A new family of binomial-like inversion sequences, named jump-and-return sandwiches (JRS), has been developed by inserting a binomial-like sequence into a standard jump-and-return sequence, discovered through use of a stochastic Genetic Algorithm optimisation. Compared to currently used binomial-like inversion sequences (e.g., 3-9-19 and W5), the new sequences afford wider inversion bands and narrower non-inversion bands with an equal number of pulses. As an example, two jump-and-return sandwich 10-pulse sequences achieved 95% inversion at offsets corresponding to 9.4% and 10.3% of the non-inversion band spacing, compared to 14.7% for the binomial-like W5 inversion sequence, i.e., they afforded non-inversion bands about two thirds the width of the W5 non-inversion band.

  1. Phaseolus vulgaris Leuco-Agglutinin Tracing of Intrahypothalamic Connections of the Lateral, Ventromedial, Dorsomedial and Paraventricular Hypothalamic Nuclei in the Rat

    NARCIS (Netherlands)

    Horst, G.J. ter; Luiten, P.G.M.

    Intrahypothalamic connections of the lateral (LHA), ventromedial (VMH), dorsomedial (DMH) and paraventricular (PVN) hypothalamic nuclei were studied with anterograde transport of iontophoretically injected Phaseolus vulgaris leuco-agglutinin and the immunocytochemical detection of labeled

  2. SWORDS: A statistical tool for analysing large DNA sequences

    Indian Academy of Sciences (India)

    Unknown

    These techniques are based on frequency distributions of DNA words in a large sequence, and have been packaged into a software called SWORDS. Using sequences available in ... tions with the cellular processes like recombination, replication .... in DNA sequences using certain specific probability laws. (Pevzner et al ...

  3. The Salivary Scavenger and Agglutinin in Early Life: Diverse Roles in Amniotic Fluid and in the Infant Intestine

    NARCIS (Netherlands)

    Reichhardt, M.P.; Jarva, H.; Been, de M.; Rodriguez, J.M.; Quintana, E.J.; Loimaranta, V.; Vos, de W.M.; Meri, S.

    2014-01-01

    The salivary scavenger and agglutinin (SALSA), also known as gp340 and dmbt1, is an antimicrobial and inflammation-regulating molecule located at the mucosal surfaces. The present study revealed that SALSA was present in the amniotic fluid (AF) and exceptionally enriched in both meconium and feces

  4. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.

    Science.gov (United States)

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-11-16

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Identification of rat serum alkaline phosphatase isoenzyme by means of wheat germ agglutinin.

    Science.gov (United States)

    Wada, H; Niwa, N; Hayakawa, T; Tsuge, H

    1997-01-01

    Wheat germ agglutinin (WGA) precipitates bone type serum alkaline phosphatase (sALP) isoenzyme specifically. The precipitates are composed of the macromolecules of WGA and "bone type sALP" (WGA-ALP complex). In order to use bone type sALP as a marker in polyacrylamide gel electrophoresis (PAGE), a method to separate "bone type sALP" from the "WGA-ALP complex" was established by using N-acetyl-D-glucosamine (GlcNAc)-Sepharose 6E column chromatography. It was concluded that this method is useful for clinical examination in the rat.

  6. Characterisation of cytotrophoblastic-like cells present in subinvolutioned placental sites of the bitch.

    Science.gov (United States)

    Fernández, P E; Portiansky, E L; Barbeito, C G; Gimeno, E J

    1998-10-01

    This paper describes an approach to study the cells present in the subinvolution of placental sites (SIPS), a pathological post partum condition of the bitch that causes persistent hemorrhage of the genital tract. The expression of intermediate filament proteins was examined to determine the fetal or maternal origin of the cytotrophoblastic-like cells found in this entity. Lectin binding on tissue sections were also studied to characterise cellular glycoconjugates. Image processing and morphometrical analysis of the histological images were done. The results revealed that the cells observed in bitches with SIPS expressed pancytokeratins but neither vimentin nor desmin, in coincidence with normal cytotrophoblasts. The lectin binding pattern of both types of cells was similar, with the only exception of Arachis hypogaea agglutinin (PNA) and Triticum vulgaris agglutinin (WGA). These observations, in addition to the non statistically significant differences between morphometrical characteristics of cytotrophoblastic and cytotrophoblastic-like cells in SIPS, might suggest the fetal origin of the latter cells which could play a role in the pathogenesis of this entity.

  7. Evidence for graphite-like hexagonal AlN nanosheets epitaxially grown on single crystal Ag(111)

    Energy Technology Data Exchange (ETDEWEB)

    Tsipas, P.; Kassavetis, S.; Tsoutsou, D.; Xenogiannopoulou, E.; Golias, E.; Giamini, S. A.; Dimoulas, A. [National Center for Scientific Research “Demokritos,” 15310 Athens (Greece); Grazianetti, C.; Fanciulli, M. [Laboratorio MDM, IMM-CNR, I-20864, Agrate Brianza (MB) (Italy); Dipartimento di Scienza dei Materiali, Università degli Studi di Milano Bicocca, I-20126, Milano (Italy); Chiappe, D.; Molle, A. [Laboratorio MDM, IMM-CNR, I-20864, Agrate Brianza (MB) (Italy)

    2013-12-16

    Ultrathin (sub-monolayer to 12 monolayers) AlN nanosheets are grown epitaxially by plasma assisted molecular beam epitaxy on Ag(111) single crystals. Electron diffraction and scanning tunneling microscopy provide evidence that AlN on Ag adopts a graphite-like hexagonal structure with a larger lattice constant compared to bulk-like wurtzite AlN. This claim is further supported by ultraviolet photoelectron spectroscopy indicating a reduced energy bandgap as expected for hexagonal AlN.

  8. Short peptides allowing preferential detection of Candida albicans hyphae.

    Science.gov (United States)

    Kaba, Hani E J; Pölderl, Antonia; Bilitewski, Ursula

    2015-09-01

    Whereas the detection of pathogens via recognition of surface structures by specific antibodies and various types of antibody mimics is frequently described, the applicability of short linear peptides as sensor molecules or diagnostic tools is less well-known. We selected peptides which were previously reported to bind to recombinant S. cerevisiae cells, expressing members of the C. albicans Agglutinin-Like-Sequence (ALS) cell wall protein family. We slightly modified amino acid sequences to evaluate peptide sequence properties influencing binding to C. albicans cells. Among the selected peptides, decamer peptides with an "AP"-N-terminus were superior to shorter peptides. The new decamer peptide FBP4 stained viable C. albicans cells more efficiently in their mature hyphal form than in their yeast form. Moreover, it allowed distinction of C. albicans from other related Candida spp. and could thus be the basis for the development of a useful tool for the diagnosis of invasive candidiasis.

  9. Growth of uniform lath-like α-(Fe,Al)OOH and disc-like α-(Fe,Al)2O3 nanoparticles in a highly alkaline medium

    International Nuclear Information System (INIS)

    Krehula, Stjepko; Music, Svetozar

    2010-01-01

    The effects of aluminium (Al 3+ )-dopant on the precipitation of uniform lath-like α-FeOOH particles, the obtention and growth of α-(Fe,Al)OOH and α-(Fe,Al) 2 O 3 solid solutions, particle size and shape were investigated using X-ray powder diffraction, Moessbauer and Fourier transform infrared spectroscopies, field emission scanning electron microscopy and energy dispersive X-ray spectroscopy. Acicular α-FeOOH particles, precipitated in a highly alkaline medium with the addition of tetramethylammonium hydroxide (TMAH), were used as reference material. The influence of Al-dopant was investigated by adding varying amounts of Al 3+ ions to the initial FeCl 3 solution. In the presence of lower concentrations of aluminium ions (up to 11.11 mol%) α-(Fe,Al)OOH as a single phase was formed, whereas higher concentrations led to an additional obtention and growth of α-(Fe,Al) 2 O 3 . Al-for-Fe substitution in the α-FeOOH and α-Fe 2 O 3 structures was confirmed by a decrease in the unit-cell dimensions, a decrease in the hyperfine magnetic field and an increase in the wave number of the infrared absorption bands. The presence of lower concentrations of aluminium ions (up to 11.11 mol%) in the precipitation system did not affect the size and shape of the α-(Fe,Al)OOH particles, whereas higher concentrations influenced a decrease in the length and aspect ratio. In the presence of 42.86 mol% Al 3+ ions fairly uniform disc-shaped α-(Fe,Al) 2 O 3 were formed.

  10. Preparative purification of a high-mannose type N-glycan from soy bean agglutinin by hydrazinolysis and tyrosinamide derivatization.

    Science.gov (United States)

    Evers, D L; Hung, R L; Thomas, V H; Rice, K G

    1998-12-15

    The N-linked oligosaccharide from soy bean agglutinin (Man9) was isolated on a preparative scale following derivatization with Boc-tyrosine. The procedure utilized preparative hydrazinolysis to release the oligosaccharide and yielded multi-micromol quantities of Boc-tyrosine-Man9 which was characterized by 1H NMR and ES-MS. Copyright 1998 Academic Press.

  11. Intercalation of diclofenac in modified Zn/Al hydrotalcite-like preparation

    Science.gov (United States)

    Heraldy, E.; Suprihatin, R. W.; Pranoto

    2016-02-01

    The intercalation of a pharmaceutically active material diclofenac into modified Zn/Al Hydrotalcite-like (Zn/Al HTlc) preparation has been investigated by the coprecipitation and ion exchange method, respectively. The synthetic materials were characterized using X- Ray Diffraction (XRD); Fourier transforms infrared spectroscopy (FTIR); Scanning Electron Microscope (SEM); X-Ray Fluorescence (XRF) and surface area analyzer. The results show that the basal spacing of the product was expanded to 11.03 A for direct synthesis and 10.68 A for indirect synthesis, suggesting that diclofenac anion was intercalated into Zn/Al HTlc and arranged in a tilted bilayer fashion and the specific surface area of material increased after the intercalation of diclofenac.

  12. Complete Genome Sequence of the Largest Known Flavi-Like Virus, Diaphorina citri flavi-like virus, a Novel Virus of the Asian Citrus Psyllid, Diaphorina citri

    OpenAIRE

    Matsumura, Emilyn E.; Nerva, Luca; Nigg, Jared C.; Falk, Bryce W.; Nouri, Shahideh

    2016-01-01

    A novel flavi-like virus tentatively named Diaphorina citri flavi-like virus (DcFLV) was identified in field populations of Diaphorina citri through small RNA and transcriptome sequencing followed by reverse transcription (RT)-PCR. We report here the complete nucleotide sequence and genome organization of DcFLV, the largest flavi-like virus identified to date.

  13. Biological safety assessment of mutant variant of Allium sativum leaf agglutinin (mASAL), a novel antifungal protein for future transgenic application.

    Science.gov (United States)

    Ghosh, Prithwi; Roy, Amit; Chakraborty, Joydeep; Das, Sampa

    2013-12-04

    Genetic engineering has established itself to be an important tool for crop improvement. Despite the success, there is always a risk of food allergy induced by alien gene products. The present study assessed the biosafety of mutant Allium sativum leaf agglutinin (mASAL), a potent antifungal protein generated by site directed mutagenesis of Allium sativum leaf agglutinin (ASAL). mASAL was cloned in pET28a+ and expressed in E. coli, and the safety assessment was carried out according to the FAO/WHO guideline (2001). Bioinformatics analysis, pepsin digestion, and thermal stability assay showed the protein to be nonallergenic. Targeted sera screening revealed no significant IgE affinity of mASAL. Furthermore, mASAL sensitized Balb/c mice showed normal histopathology of lung and gut tissue. All results indicated the least possibility of mASAL being an allergen. Thus, mASAL appears to be a promising antifungal candidate protein suitable for agronomical biotechnology.

  14. Low-grade parasitaemias and cold agglutinins in patients with hyper-reactive malarious splenomegaly and acute haemolysis.

    Science.gov (United States)

    Torres, J R; Villegas, L; Perez, H; Suarez, L; Torres V, M A; Campos, M

    2003-03-01

    A cluster of 16 cases of hyper-reactive malarious splenomegaly (HMS) with severe, acute haemolysis, from an isolated, Venezuelan, Yanomami population, was prospectively investigated. Nine (69%) of the 13 HMS sera investigated but only one (7%) of 14 control sera (P Yanomami population) were PCR-positive (P < 0.001). In some cases at least, the acute severe episodes of haemolysis occasionally seen in HMS appear to be associated with an auto-immune, cold-agglutinin-mediated response triggered by non-patent parasitaemias.

  15. Next-generation sequencing technology a new tool for killer cell immunoglobulin-like receptor allele typing in hematopoietic stem cell transplantation.

    Science.gov (United States)

    Maniangou, B; Retière, C; Gagne, K

    2018-02-01

    Killer cell Immunoglobulin-like Receptor (KIR) genes are a family of genes located together within the leukocyte receptor cluster on human chromosome 19q13.4. To date, 17 KIR genes have been identified including nine inhibitory genes (2DL1/L2/L3/L4/L5A/L5B, 3DL1/L2/L3), six activating genes (2DS1/S2/S3/S4/S5, 3DS1) and two pseudogenes (2DP1, 3DP1) classified into group A (KIR A) and group B (KIR B) haplotypes. The number and the nature of KIR genes vary between the individuals. In addition, these KIR genes are known to be polymorphic at allelic level (907 alleles described in July 2017). KIR genes encode for receptors which are predominantly expressed by Natural Killer (NK) cells. KIR receptors recognize HLA class I molecules and are able to kill residual recipient leukemia cells, and thus reduce the likelihood of relapse. KIR alleles of Hematopoietic Stem Cell (HSC) donor would require to be known (Alicata et al. Eur J Immunol 2016) because the KIR allele polymorphism may affect both the KIR + NK cell phenotype and function (Gagne et al. Eur J Immunol 2013; Bari R, et al. Sci Rep 2016) as well as HSCT outcome (Boudreau et al. JCO 2017). The introduction of the Next Generation Sequencing (NGS) has overcome current conventional DNA sequencing method limitations, known to be time consuming. Recently, a novel NGS KIR allele typing approach of all KIR genes was developed by our team in Nantes from 30 reference DNAs (Maniangou et al. Front in Immunol 2017). This NGS KIR allele typing approach is simple, fast, reliable, specific and showed a concordance rate of 95% for centromeric and telomeric KIR genes in comparison with high-resolution KIR typing obtained to those published data using exome capture (Norman PJ et al. Am J Hum Genet 2016). This NGS KIR allele typing approach may also be used in reproduction and to better study KIR + NK cell implication in the control of viral infections. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. Ulex europaeus agglutinin-I binds to developing gastrin cells.

    Science.gov (United States)

    Ge, Z H; Blom, J; Larsson, L I

    1998-03-01

    We have previously reported that antropyloric gastrin (G) and somatostatin (D) cells derive from precursor (G/D) cells that coexpress both hormones. We have now analyzed this endocrine cell pedigree for binding of Ulex europaeus agglutinin-I (UEA-I), which previously has been reported to represent a useful marker for cell differentiation. Subpopulations of G/D, D, and G cells were all found to express UEA-I binding. Labelling with bromodeoxyuridine showed that UEA-I positive G cells possessed a higher labelling index than UEA-I negative G cells. These data suggest that the UEA-I positive G cells represent maturing cells still involved in DNA synthesis and cell division. Electron microscopically, specific UEA-I binding sites were localized to the secretory granules and the apical cell membrane of G cells. We conclude that UEA-I represents a differentiation marker for G cells. Moreover, the presence of UEA-I binding sites in these cells may be relevant for Helicobacter pylori-mediated disturbances of gastric acid secretion and gastrin hypersecretion.

  17. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    Directory of Open Access Journals (Sweden)

    R. Lakshmi

    2016-06-01

    Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

  18. Difference in Ulex europaeus agglutinin I-binding activity of decay-accelerating factor detected in the stools of patients with colorectal cancer and ulcerative colitis.

    Science.gov (United States)

    Okazaki, Hiroaki; Mizuno, Motowo; Nasu, Junichirou; Makidono, Chiho; Hiraoka, Sakiko; Yamamoto, Kazuhide; Okada, Hiroyuki; Fujita, Teizo; Tsuji, Takao; Shiratori, Yasushi

    2004-03-01

    Expression of decay-accelerating factor (DAF, CD55), a complement-regulatory glycoprotein, is enhanced in colorectal-cancer (CC) cells and colonic epithelium in ulcerative colitis (UC), and stools from these patients contain increased amounts of DAF. Carbohydrate chains of glycoproteins are often altered during malignant transformation or inflammation. In this study, we investigated whether DAF molecules in patients with CC and those with UC differ with respect to oligosaccharide side chains. We analyzed DAF in stools and homogenates of colonic-tissue specimens obtained from patients with CC or UC using solid-phase enzyme-linked assay and Western blotting for reactivity with the lectins Ulex europaeus agglutinin I (UEA-I), wheat-germ agglutinin, peanut agglutinin, and concanavalin A. UEA-I bound to DAF in stools from patients with UC but not in that from the stools of CC patients, as demonstrated on the solid-phase enzyme-linked assay (P <.05, Mann-Whitney U test) and Western blotting. Binding of UEA-I was specifically inhibited by the addition of fucose. The difference in UEA-I reactivity with DAF was observed also in colonic-tissue homogenates from patients with UC and those with CC. DAF expressed in the mucosa and excreted into the stools of UC patients is different from that expressed in CC with regard to UEA-I reactivity. Future studies should be directed toward determining whether a qualitatively unique isoform of DAF is present, of which sugar chains are specific to CC in UC patients.

  19. Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.

    Science.gov (United States)

    Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique

    2014-10-01

    Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

  20. Highly conductive Al-doped tetra-needle-like ZnO whiskers prepared by a solid state method

    International Nuclear Information System (INIS)

    Wan Cuifeng; Tan Hairen; Jin Shengming; Yang Huaming; Tang Motang; He Jing

    2008-01-01

    Tetra-needle-like zinc oxide whiskers (T-ZnO W ) were doped with Al 3+ by a solid state method. In this study, modification conditions were thoroughly investigated to obtain low resistivity T-ZnO W , without destroying the tetra-needle-like structure. The Al-doped T-ZnO W was characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), Fourier transition infrared (FT-IR) spectra and electrical resistance measurement. The SEM and XRD results indicated that the tetra-needle-like structure of ZnO whiskers could be well maintained after modification and the doped (0 0 2) face was preferred. FT-IR results showed that the decrease of resistivity of Al-doped T-ZnO W resulted from formation of [AlO 4 ] configuration in T-ZnO W bulk. Experiment results showed that the annealing temperature, doping concentration and type of Al sources affected the resistivity of T-ZnO W considerably. The optimum Al-doped concentration was 7.0 at.% and the resistivity of T-ZnO W could be considerably decreased from 10 8 to 10 2 Ω cm

  1. Structural and sequence analysis of imelysin-like proteins implicated in bacterial iron uptake.

    Directory of Open Access Journals (Sweden)

    Qingping Xu

    Full Text Available Imelysin-like proteins define a superfamily of bacterial proteins that are likely involved in iron uptake. Members of this superfamily were previously thought to be peptidases and were included in the MEROPS family M75. We determined the first crystal structures of two remotely related, imelysin-like proteins. The Psychrobacter arcticus structure was determined at 2.15 Å resolution and contains the canonical imelysin fold, while higher resolution structures from the gut bacteria Bacteroides ovatus, in two crystal forms (at 1.25 Å and 1.44 Å resolution, have a circularly permuted topology. Both structures are highly similar to each other despite low sequence similarity and circular permutation. The all-helical structure can be divided into two similar four-helix bundle domains. The overall structure and the GxHxxE motif region differ from known HxxE metallopeptidases, suggesting that imelysin-like proteins are not peptidases. A putative functional site is located at the domain interface. We have now organized the known homologous proteins into a superfamily, which can be separated into four families. These families share a similar functional site, but each has family-specific structural and sequence features. These results indicate that imelysin-like proteins have evolved from a common ancestor, and likely have a conserved function.

  2. Immobilization of kojic acid in ZnAl-hydrotalcite like compounds

    Science.gov (United States)

    Ambrogi, Valeria; Perioli, Luana; Nocchetti, Morena; Latterini, Loredana; Pagano, Cinzia; Massetti, Elena; Rossi, Carlo

    2012-01-01

    Kojic acid (KOJ) is a melanin synthesis inhibitor widely used as skin lightening agent in topical preparations. Unfortunately it is easily susceptible to photo-oxidation, phenomenon responsible for chemical and organoleptic modifications. The aim of this work was the intercalation of KOJ in hydrotalcite-like compounds (HTlc) in order to stabilize KOJ and to reduce its photolability. Hydrotalcite containing Zn and Al (ZnAl-HTlc) was used as host to obtain the final compound ZnAl-HTlc-KOJ. The intercalation was carried out, after many attempts, by ionic exchange mechanism by means of the strong base EtO- in anhydrous ethanol/dimethylsulfoxide (DMSO) mixture as solvent in order to generate KOJ- anions. The final product was characterized by the X-ray powder diffraction (XRPD), FT-IR spectroscopy, thermogravimetric analysis (TGA), differential scanning calorimetry (DSC) and elemental analysis. The intercalated compound was formulated in a siliconic water free self-emulsifying ointment and the in vitro release profile was evaluated. All samples (intercalation compound and its formulation) were submitted also to spectrophotometric assays in order to evaluate the matrix protective effect towards ultraviolet rays.

  3. Comprehensive analysis of the mutation spectrum in 301 German ALS families.

    Science.gov (United States)

    Müller, Kathrin; Brenner, David; Weydt, Patrick; Meyer, Thomas; Grehl, Torsten; Petri, Susanne; Grosskreutz, Julian; Schuster, Joachim; Volk, Alexander E; Borck, Guntram; Kubisch, Christian; Klopstock, Thomas; Zeller, Daniel; Jablonka, Sibylle; Sendtner, Michael; Klebe, Stephan; Knehr, Antje; Günther, Kornelia; Weis, Joachim; Claeys, Kristl G; Schrank, Berthold; Sperfeld, Anne-Dorte; Hübers, Annemarie; Otto, Markus; Dorst, Johannes; Meitinger, Thomas; Strom, Tim M; Andersen, Peter M; Ludolph, Albert C; Weishaupt, Jochen H

    2018-04-12

    Recent advances in amyotrophic lateral sclerosis (ALS) genetics have revealed that mutations in any of more than 25 genes can cause ALS, mostly as an autosomal-dominant Mendelian trait. Detailed knowledge about the genetic architecture of ALS in a specific population will be important for genetic counselling but also for genotype-specific therapeutic interventions. Here we combined fragment length analysis, repeat-primed PCR, Southern blotting, Sanger sequencing and whole exome sequencing to obtain a comprehensive profile of genetic variants in ALS disease genes in 301 German pedigrees with familial ALS. We report C9orf72 mutations as well as variants in consensus splice sites and non-synonymous variants in protein-coding regions of ALS genes. We furthermore estimate their pathogenicity by taking into account type and frequency of the respective variant as well as segregation within the families. 49% of our German ALS families carried a likely pathogenic variant in at least one of the earlier identified ALS genes. In 45% of the ALS families, likely pathogenic variants were detected in C9orf72, SOD1, FUS, TARDBP or TBK1 , whereas the relative contribution of the other ALS genes in this familial ALS cohort was 4%. We identified several previously unreported rare variants and demonstrated the absence of likely pathogenic variants in some of the recently described ALS disease genes. We here present a comprehensive genetic characterisation of German familial ALS. The present findings are of importance for genetic counselling in clinical practice, for molecular research and for the design of diagnostic gene panels or genotype-specific therapeutic interventions in Europe. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  4. Cytology of cardiac myxomas: presence of Ulex europaeus agglutinin-I (UEA-I) lectin by immunoperoxidase staining.

    Science.gov (United States)

    Iwa, N; Yutani, C

    1993-12-01

    Cytological findings are presented of seven cases of cardiac myxomas. Avidin-biotin-peroxidase complex (ABC) method was employed to demonstrate Ulex europaeus agglutinin-I (UEA-I) lectin in imprint smears as well as in paraffin-embedded tissue sections in cardiac myxomas. The cytology was characterized by tumor cells with polyhedral or stellate and mucinous background with lymphocytes, neutrophils, and hemosiderin-laden macrophages. In smears as well as tissue sections, UEA-I lectin was detected throughout the cytoplasm of myxoma cells. This study established the applicability of the immunoperoxidase staining for cardiac myxoma as an aid in cytopathological diagnosis.

  5. Sequence Algebra, Sequence Decision Diagrams and Dynamic Fault Trees

    International Nuclear Information System (INIS)

    Rauzy, Antoine B.

    2011-01-01

    A large attention has been focused on the Dynamic Fault Trees in the past few years. By adding new gates to static (regular) Fault Trees, Dynamic Fault Trees aim to take into account dependencies among events. Merle et al. proposed recently an algebraic framework to give a formal interpretation to these gates. In this article, we extend Merle et al.'s work by adopting a slightly different perspective. We introduce Sequence Algebras that can be seen as Algebras of Basic Events, representing failures of non-repairable components. We show how to interpret Dynamic Fault Trees within this framework. Finally, we propose a new data structure to encode sets of sequences of Basic Events: Sequence Decision Diagrams. Sequence Decision Diagrams are very much inspired from Minato's Zero-Suppressed Binary Decision Diagrams. We show that all operations of Sequence Algebras can be performed on this data structure.

  6. Exchange-bias-like effect in Pr{sub 0.75}Tb{sub 0.25}Al{sub 2} and Pr{sub 0.7}Tb{sub 0.3}Al{sub 2} samples

    Energy Technology Data Exchange (ETDEWEB)

    Tedesco, J.C.G., E-mail: tedesco.jcg@gmail.com [Instituto de Física “Gleb Wataghin”, Universidade Estadual de Campinas—UNICAMP, 13083-859 Campinas, SP (Brazil); Pires, M.J.M. [Instituto de Ciência e Tecnologia—ICT, Universidade Federal dos Vales do Jequitinhonha e Mucuri—UFVJM, 39100-000 Diamantina, MG (Brazil); Carvalho, A. Magnus G. [Divisão de Metrologia de Materiais (DIMAT), INMETRO, 25250-020 Duque de Caxias, RJ (Brazil); Sousa, V.S.R. de [Instituto de Física “Armando Dias Tavares”, Universidade do Estado do Rio de Janeiro—UERJ, 20550-013 Rio de Janeiro, RJ (Brazil); Cardoso, L.P.; Coelho, A.A. [Instituto de Física “Gleb Wataghin”, Universidade Estadual de Campinas—UNICAMP, 13083-859 Campinas, SP (Brazil)

    2013-08-15

    The magnetic behavior of pseudobinary Pr{sub 0.7}Tb{sub 0.3}Al{sub 2} and Pr{sub 0.75}Tb{sub 0.25}Al{sub 2} compounds was studied, and a predominant ferrimagnetic ordering was observed. Noteworthy characteristics such as negative magnetization, compensation points and exchange-bias-like (EB-like) effect were found. This EB-like effect was observed at temperatures below the compensation points. The effect is somewhat different from the one already studied in similar systems combining light and heavy rare earths. The results indicate that the EB-like effect characteristics are related to the conduction electron magnetic polarization and an induced unidirectional anisotropy present in these compounds. - Highlights: ► Ferrimagnetic behavior is observed in Pr{sub 0.7}Tb{sub 0.3}Al{sub 2} and Pr{sub 0.75}Tb{sub 0.25}Al{sub 2} materials. ► Magnetic data indicate a strong unidirectional anisotropy in studied materials. ► Studied materials present the exchange-bias-like effect. ► Exchange-bias-like effect explained in analogy with the known mechanism of thin films.

  7. Characterization of the binding specificity of Anguilla anguilla agglutinin (AAA) in comparison to Ulex europaeus agglutinin I (UEA-I).

    Science.gov (United States)

    Baldus, S E; Thiele, J; Park, Y O; Hanisch, F G; Bara, J; Fischer, R

    1996-08-01

    Using immunochemical and immunohistochemical methods, the binding site of Anguilla anguilla agglutinin (AAA) was characterized and compared with the related fucose-specific lectin from Ulex europaeus (UEA-I). In solid-phase enzyme-linked immunoassays, the two lectins recognized Fuc alpha 1-2Gal beta-HSA. AAA additionally cross-reacted with neoglycolipids bearing lacto-N-fucopentaose (LNFP) I [H type 1] and II [Le(a)] and lactodifucotetraose (LDFT) as glycan moieties. UEA-I, on the other hand, bound to a LDFT-derived neoglycolipid but not to the other neoglycolipids tested. Binding of AAA to gastric mucin was competitively neutralized by Le(a)-specific monoclonal antibodies. UEA-I binding, on the other hand, was reduced after co-incubation with H type 2- and Le(y)-specific monoclonal antibodies. According to our results, AAA reacts with fucosylated type 1 chain antigens, whereas UEA-I binds only to the alpha 1-2-fucosylated LDFT-derived neoglycolipid. In immunohistochemical studies, the reactivity of AAA and UEA-I in normal pyloric mucosa from individuals with known Lewis and secretor status was analysed. AAA showed a broad reaction in the superficial pyloric mucosa from secretors and non-secretors, but AAA reactivity was more pronounced in Le(a+b-) individuals. On the other hand, UEA-I stained the superficial pyloric mucosa only from secretor individuals. A staining of deep mucous glands by the lectins was found in all specimens. Both reacted with most human carcinomas of different origin. Slight differences in their binding pattern were observed and may be explained by the different fine-specificities of the lectins.

  8. Effect of Sequence Blockiness on the Morphologies of Surface-grafted Elastin-like Polypeptides

    Science.gov (United States)

    Albert, Julie; Sintavanon, Kornkanok; Mays, Robin; MacEwan, Sarah; Chilkoti, Ashutosh; Genzer, Jan

    2014-03-01

    The inter- and intra- molecular interactions among monomeric units of copolymers and polypeptides depend strongly on monomer sequence distribution and dictate the phase behavior of these species both in solution and on surfaces. To study the relationship between sequence and phase behavior, we have designed a series of elastin-like polypeptides (ELPs) with controlled monomer sequences that mimic copolymers with various co-monomer sequence distributions and attached them covalently to silicon substrates from buffer solutions at temperatures below and above the bulk ELPs' lower critical solution temperatures (LCSTs). The dependence of ELP grafting density on solution temperature was examined by ellipsometry and the resultant surface morphologies were examined in air and under water with atomic force microscopy. Depositions performed above the LCST resulted in higher grafting densities and greater surface roughness of ELPs relative to depositions carried out below the LCST. In addition, we are using gradient substrates to examine the effect of ELP grafting density on temperature responsiveness.

  9. Discovery of viruses and virus-like pathogens in pistachio using high-throughput sequencing

    Science.gov (United States)

    Pistachio (Pistacia vera L.) trees from the National Clonal Germplasm Repository (NCGR) and orchards in California were surveyed for viruses and virus-like agents by high-throughput sequencing (HTS). Analyses of 60 trees including clonal UCB-1 hybrid rootstock (P. atlantica × P. integerrima) identif...

  10. Sequence Directionality Dramatically Affects LCST Behavior of Elastin-Like Polypeptides.

    Science.gov (United States)

    Li, Nan K; Roberts, Stefan; Quiroz, Felipe Garcia; Chilkoti, Ashutosh; Yingling, Yaroslava G

    2018-04-30

    Elastin-like polypeptides (ELP) exhibit an inverse temperature transition or lower critical solution temperature (LCST) transition phase behavior in aqueous solutions. In this paper, the thermal responsive properties of the canonical ELP, poly(VPGVG), and its reverse sequence poly(VGPVG) were investigated by turbidity measurements of the cloud point behavior, circular dichroism (CD) measurements, and all-atom molecular dynamics (MD) simulations to gain a molecular understanding of mechanism that controls hysteretic phase behavior. It was shown experimentally that both poly(VPGVG) and poly(VGPVG) undergo a transition from soluble to insoluble in aqueous solution upon heating above the transition temperature ( T t ). However, poly(VPGVG) resolubilizes upon cooling below its T t , whereas the reverse sequence, poly(VGPVG), remains aggregated despite significant undercooling below the T t . The results from MD simulations indicated that a change in sequence order results in significant differences in the dynamics of the specific residues, especially valines, which lead to extensive changes in the conformations of VPGVG and VGPVG pentamers and, consequently, dissimilar propensities for secondary structure formation and overall structure of polypeptides. These changes affected the relative hydrophilicities of polypeptides above T t , where poly(VGPVG) is more hydrophilic than poly(VPGVG) with more extended conformation and larger surface area, which led to formation of strong interchain hydrogen bonds responsible for stabilization of the aggregated phase and the observed thermal hysteresis for poly(VGPVG).

  11. Identification of human microRNA-like sequences embedded within the protein-encoding genes of the human immunodeficiency virus.

    Directory of Open Access Journals (Sweden)

    Bryan Holland

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the

  12. AGLUTININAS ANTILEPTÓSPIRA EM EQÜINOS NO ESTADO DE GOIÁS ANTILEPTOSPIRA AGGLUTININS IN EQUINES IN THE GOIÁS STATE, BRAZIL

    Directory of Open Access Journals (Sweden)

    Marly Francisca Cândido

    2007-09-01

    Full Text Available

    Foram analisados 694 hemossoros de eqüinos, procedentes de sete rnunicípios goianos, encontrando-se uma positividade para aglutininas antileptóspira que variou de 8,8 a 25,0%, com o valor médio de 14,4%. Diferentes sorotipos foram pesquisados, pela técnica de GALTON et alii (1962, encontrando-se positividade para os sorotipos grippotyphosa, wolffi, ballum e australis. Os autores concluíram pela necessidade de prosseguimento de novas pesquisas, com a finalidade de averiguar-se a presença ou não de diferentes sorotipos observados em outros Estados e não encontrados na presente pesquisa, além da realização de estudo epidemiológico local e regional.

    694 equine serum blood tests were made from horses of 7 counties of the State of Goiás. Positive rates of Leptospira agglutinins varied from 8.8 to 25.0% with an average of 14.4%. Different serum types were studied by the technique developed by GALTON et alii (1962 finding positiveness for the following serum types: grippotyphosa, wolffi, ballum and australis.

  13. Reconstruction of putative DNA virus from endogenous rice tungro bacilliform virus-like sequences in the rice genome: implications for integration and evolution

    Directory of Open Access Journals (Sweden)

    Kishima Yuji

    2004-10-01

    Full Text Available Abstract Background Plant genomes contain various kinds of repetitive sequences such as transposable elements, microsatellites, tandem repeats and virus-like sequences. Most of them, with the exception of virus-like sequences, do not allow us to trace their origins nor to follow the process of their integration into the host genome. Recent discoveries of virus-like sequences in plant genomes led us to set the objective of elucidating the origin of the repetitive sequences. Endogenous rice tungro bacilliform virus (RTBV-like sequences (ERTBVs have been found throughout the rice genome. Here, we reconstructed putative virus structures from RTBV-like sequences in the rice genome and characterized to understand evolutionary implication, integration manner and involvements of endogenous virus segments in the corresponding disease response. Results We have collected ERTBVs from the rice genomes. They contain rearranged structures and no intact ORFs. The identified ERTBV segments were shown to be phylogenetically divided into three clusters. For each phylogenetic cluster, we were able to make a consensus alignment for a circular virus-like structure carrying two complete ORFs. Comparisons of DNA and amino acid sequences suggested the closely relationship between ERTBV and RTBV. The Oryza AA-genome species vary in the ERTBV copy number. The species carrying low-copy-number of ERTBV segments have been reported to be extremely susceptible to RTBV. The DNA methylation state of the ERTBV sequences was correlated with their copy number in the genome. Conclusions These ERTBV segments are unlikely to have functional potential as a virus. However, these sequences facilitate to establish putative virus that provided information underlying virus integration and evolutionary relationship with existing virus. Comparison of ERTBV among the Oryza AA-genome species allowed us to speculate a possible role of endogenous virus segments against its related disease.

  14. Characterization of Ricin and R. communis Agglutinin Reference Materials

    Science.gov (United States)

    Worbs, Sylvia; Skiba, Martin; Söderström, Martin; Rapinoja, Marja-Leena; Zeleny, Reinhard; Russmann, Heiko; Schimmel, Heinz; Vanninen, Paula; Fredriksson, Sten-Åke; Dorner, Brigitte G.

    2015-01-01

    Ricinus communis intoxications have been known for centuries and were attributed to the toxic protein ricin. Due to its toxicity, availability, ease of preparation, and the lack of medical countermeasures, ricin attracted interest as a potential biological warfare agent. While different technologies for ricin analysis have been established, hardly any universally agreed-upon “gold standards” are available. Expert laboratories currently use differently purified in-house materials, making any comparison of accuracy and sensitivity of different methods nearly impossible. Technically challenging is the discrimination of ricin from R. communis agglutinin (RCA120), a less toxic but highly homologous protein also contained in R. communis. Here, we established both highly pure ricin and RCA120 reference materials which were extensively characterized by gel electrophoresis, liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI MS/MS), and matrix-assisted laser desorption ionization–time of flight approaches as well as immunological and functional techniques. Purity reached >97% for ricin and >99% for RCA120. Different isoforms of ricin and RCA120 were identified unambiguously and distinguished by LC-ESI MS/MS. In terms of function, a real-time cytotoxicity assay showed that ricin is approximately 300-fold more toxic than RCA120. The highly pure ricin and RCA120 reference materials were used to conduct an international proficiency test. PMID:26703723

  15. Characterization of Ricin and R. communis Agglutinin Reference Materials

    Directory of Open Access Journals (Sweden)

    Sylvia Worbs

    2015-11-01

    Full Text Available Ricinus communis intoxications have been known for centuries and were attributed to the toxic protein ricin. Due to its toxicity, availability, ease of preparation, and the lack of medical countermeasures, ricin attracted interest as a potential biological warfare agent. While different technologies for ricin analysis have been established, hardly any universally agreed-upon “gold standards” are available. Expert laboratories currently use differently purified in-house materials, making any comparison of accuracy and sensitivity of different methods nearly impossible. Technically challenging is the discrimination of ricin from R. communis agglutinin (RCA120, a less toxic but highly homologous protein also contained in R. communis. Here, we established both highly pure ricin and RCA120 reference materials which were extensively characterized by gel electrophoresis, liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI MS/MS, and matrix-assisted laser desorption ionization–time of flight approaches as well as immunological and functional techniques. Purity reached >97% for ricin and >99% for RCA120. Different isoforms of ricin and RCA120 were identified unambiguously and distinguished by LC-ESI MS/MS. In terms of function, a real-time cytotoxicity assay showed that ricin is approximately 300-fold more toxic than RCA120. The highly pure ricin and RCA120 reference materials were used to conduct an international proficiency test.

  16. Wheat germ agglutinin-conjugated liposomes incorporated with cardiolipin to improve neuronal survival in Alzheimer’s disease treatment

    Directory of Open Access Journals (Sweden)

    Kuo YC

    2017-03-01

    Full Text Available Yung-Chih Kuo,1 Che-Yu Lin,1 Jay-Shake Li,2 Yung-I Lou3 1Department of Chemical Engineering, 2Department of Psychology, National Chung Cheng University, Chia-Yi, 3Department of Accounting, Providence University, Taichung, Taiwan, Republic of China Abstract: Curcumin (CRM and nerve growth factor (NGF were entrapped in liposomes (LIP with surface wheat germ agglutinin (WGA to downregulate the phosphorylation of kinases in Alzheimer’s disease (AD therapy. Cardiolipin (CL-conjugated LIP carrying CRM (CRM-CL/LIP and also carrying NGF (NGF-CL/LIP were used with AD models of SK-N-MC cells and Wistar rats after an insult with β-amyloid peptide (Aβ. We found that CRM-CL/LIP inhibited the expression of phosphorylated p38 (p-p38, phosphorylated c-Jun N-terminal kinase (p-JNK, and p-tau protein at serine 202 and prevented neurodegeneration of SK-N-MC cells. In addition, NGF-CL/LIP could enhance the quantities of p-neurotrophic tyrosine kinase receptor type 1 and p-extracellular signal-regulated kinase 5 for neuronal rescue. Moreover, WGA-grafted CRM-CL/LIP and WGA-grafted NGF-CL/LIP significantly improved the permeation of CRM and NGF across the blood–brain barrier, reduced Aβ plaque deposition and the malondialdehyde level, and increased the percentage of normal neurons and cholinergic activity in the hippocampus of AD rats. Based on the marker expressions and in vivo evidence, current LIP carriers can be promising drug delivery systems to protect nervous tissue against Aβ-induced apoptosis in the brain during the clinical management of AD. Keywords: liposome, Alzheimer’s disease, β-amyloid, neurodegeneration, blood–brain barrier, wheat germ agglutinin

  17. Sequence diversity and copy number variation of Mutator-like transposases in wheat

    Directory of Open Access Journals (Sweden)

    Nobuaki Asakura

    2008-01-01

    Full Text Available Partial transposase-coding sequences of Mutator-like elements (MULEs were isolated from a wild einkorn wheat, Triticum urartu, by degenerate PCR. The isolated sequences were classified into a MuDR or Class I clade and divided into two distinct subclasses (subclass I and subclass II. The average pair-wise identity between members of both subclasses was 58.8% at the nucleotide sequence level. Sequence diversity of subclass I was larger than that of subclass II. DNA gel blot analysis showed that subclass I was present as low copy number elements in the genomes of all Triticum and Aegilops accessions surveyed, while subclass II was present as high copy number elements. These two subclasses seemed uncapable of recognizing each other for transposition. The number of copies of subclass II elements was much higher in Aegilops with the S, Sl and D genomes and polyploid Triticum species than in diploid Triticum with the A genome, indicating that active transposition occurred in S, Sl and D genomes before polyploidization. DNA gel blot analysis of six species selected from three subfamilies of Poaceae demonstrated that only the tribe Triticeae possessed both subclasses. These results suggest that the differentiation of these two subclasses occurred before or immediately after the establishment of the tribe Triticeae.

  18. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  19. An algorithm to find all palindromic sequences in proteins

    Indian Academy of Sciences (India)

    2013-01-20

    Jan 20, 2013 ... 1976; Karrer and Gall 1976; Vogt and Braun 1976) and (iii) in the formation of hairpin loops in the newly transcribed RNA. Palindromic sequences are observed in various classes of proteins like histones (Cheng et al. 1989), prion proteins (Sulkowski 1992; Kazim 1993),. DNA-binding proteins (Suzuki 1992; ...

  20. Isoelectronic comparison of the Al-like 3s23p 2P-3s3p24P transitions in the ions P III-Mo XXX

    International Nuclear Information System (INIS)

    Jupen, C.; Curtis, L.J.

    1996-01-01

    New observations of the 3s 2 3p 2 P-3s3p 2 4 P intercombination transitions in Al-like ions have been made for Cl V from spark spectra recorded at Lund and for Kr XXIV and Mo XXX from spectra obtained at the JET tokamak. The new results have been combined with other identifications of these transitions along the sequence and empirically systematized and compared with theoretical calculations. A set of smoothed and interpolated values for the excitation energies of the 3s3p 2 4 P levels in P III-Mo XXX is presented. (orig.)

  1. Retrograde and transganglionic transport of horseradish peroxidase-conjugated cholera toxin B subunit, wheatgerm agglutinin and isolectin B4 from Griffonia simplicifolia I in primary afferent neurons innervating the rat urinary bladder.

    Science.gov (United States)

    Wang, H F; Shortland, P; Park, M J; Grant, G

    1998-11-01

    In the present study, we investigated and compared the ability of the cholera toxin B subunit, wheat germ agglutinin and isolectin B4 from Griffonia simplicifolia I conjugated to horseradish peroxidase, to retrogradely and transganglionically label visceral primary afferents after unilateral injections into the rat urinary bladder wall. Horseradish peroxidase histochemical or lectin-immunofluorescence histochemical labelling of bladder afferents was seen in the L6-S1 spinal cord segments and in the T13-L2 and L6-S1 dorsal root ganglia. In the lumbosacral spinal cord, the most intense and extensive labelling of bladder afferents was seen when cholera toxin B subunit-horseradish peroxidase was injected. Cholera toxin B subunit-horseradish peroxidase-labelled fibres were found in Lissauer's tract, its lateral and medial collateral projections, and laminae I and IV-VI of the spinal gray matter. Labelled fibres were numerous in the lateral collateral projection and extended into the spinal parasympathetic nucleus. Labelling from both the lateral and medial projections extended into the dorsal grey commissural region. Wheat germ agglutinin-horseradish peroxidase labelling produced a similar pattern but was not as dense and extensive as that of cholera toxin B subunit-horseradish peroxidase. The isolectin B4 from Griffonia simplicifolia I-horseradish peroxidase-labelled fibres, on the other hand, were fewer and only observed in the lateral collateral projection and occasionally in lamina I. Cell profile counts showed that a larger number of dorsal root ganglion cells were labelled with cholera toxin B subunit-horseradish peroxidase than with wheat germ agglutinin- or isolectin B4-horseradish peroxidase. In the L6-S1 dorsal root ganglia, the majority (81%) of the cholera toxin B subunit-, and almost all of the wheat germ agglutinin- and isolectin B4-immunoreactive cells were RT97-negative (an anti-neurofilament antibody that labels dorsal root ganglion neurons with

  2. Anti-leptospirosis agglutinins in Brazilian capybaras (hydrochoerus hydrochaeris).

    Science.gov (United States)

    Langoni, Helio; Kuribara, Ivone Yumi; Ferreira Lopes Correa, Ana Paula; Ullmann, Leila Sabrina; Sánchez, Gabriela Pacheco; Lucheis, Simone Baldini

    2016-01-01

    The interest in commercial use of wild animals is increasing, especially regarding raising of capybaras. Although this wild species is potentially lucrative for the production of meat, oil and leather, it is suggested as a probable reservoir of leptospires. Due to the economic importance of this species and the lack of studies concerning leptospirosis, the presence of anti-leptospirosis agglutinins was assayed in 55 serum samples of capybaras (Hydrochoerus hydrochaeris) from commercial and experimental breeding flocks located in São Paulo state, Paraná state, and Rio Grande do Sul state, Brazil. Samples were obtained through cephalic or femoral venipunction (5 to 10 mL). Microscopic agglutination test was used according to the Brazilian Health Ministry considering as cut-off titer of 100. Out of the 55 samples analyzed, 23 (41.82 %) tested positive. The most prevalent serovar was Icterohaemorrhagiae (56.52 %) in 13 samples, followed by Copenhageni in nine samples (39.13 %), Pomona in four samples (17.39 %), Djasiman and Castellonis in three samples each (13.04 %), Grippotyphosa, Hardjo, Canicola, and Cynopteri in two samples each (8.7 %), and Andamana and Bratislava in one sample each (4.34 %). These results suggest the evidence of exposure to Leptospira spp. and the need of new studies to evaluate a higher number of capybaras from different regions to better understand the importance of leptospirosis infection in these animals and verify the zoonotic role of this species as a possible source of infection to humans and other animals.

  3. Synthesis of flower-like Boehmite (γ-AlOOH) via a one-step ionic liquid-assisted hydrothermal route

    International Nuclear Information System (INIS)

    Tang, Zhe; Liang, Jilei; Li, Xuehui; Li, Jingfeng; Guo, Hailing; Liu, Yunqi; Liu, Chenguang

    2013-01-01

    A simple and novel synthesis process, one-step ionic liquid-assisted hydrothermal synthesis route, has been developed in the work to synthesize Bohemithe (γ-AlOOH) with flower-like structure. The samples were characterized by X-ray Diffraction (XRD), Fourier Transform Infrared Spectroscopy (FT-IR) and Scanning Electron Microscope (SEM). Ionic liquid [Omim] + Cl − , as a template, plays an important role in the morphology and pore structure of the products due to its strong interactions with reaction particles. With the increase in the dosage of ionic liquid [Omim] + Cl − , the morphology of the γ-AlOOH was changed from initial bundles of nanosheets (without ionic liquid) into final well-developed monodispersed 3D flower-like architectures ([Omim] + Cl − =72 mmol). The pore structure was also altered gradually from initial disordered slit-like pore into final relatively ordered ink-bottle pore. Furthermore, the proposed formation mechanism and other influencing factors such as reaction temperature and urea on formation and morphology of the γ-AlOOH have also been investigated. - Graphical abstract: The flower-like γ-AlOOH architectures composed by nanosheets with narrow size distribution (1.6–2.2 μm) and uniform pore size (6.92 nm) have been synthesized via a one-step ionic liquid-assisted hydrothermal route. - Highlights: • The γ-AlOOH microflowers were synthesized via an ionic liquid-assisted hydrothermal route. • Ionic liquid plays an important role on the morphology and porous structure of the products. • Ionic liquid can be easily removed from the products and reused in recycling experiments. • A “aggregation–recrystallization–Ostwald Ripening“formation mechanism may occur

  4. Wear and Friction Characteristics of AlN/Diamond-Like Carbon Hybrid Coatings on Aluminum Alloy

    Science.gov (United States)

    Nakamura, Masashi; Kubota, Sadayuki; Suzuki, Hideto; Haraguchi, Tadao

    2015-10-01

    The use of diamond-like carbon (DLC) coatings has the potential to greatly improve the wear resistance and friction of aluminum alloys, but practical application has so far been limited by poor adhesion due to large difference in hardness and elasticity between the two materials. This study investigates the deposition of DLC onto an Al-alloy using an intermediate AlN layer with a graded hardness to create a hybrid coating. By controlling the hardness of the AlN film, it was found that the wear life of the DLC film could be improved 80-fold compared to a DLC film deposited directly onto Al-alloy. Furthermore, it was demonstrated through finite element simulation that creating a hardness gradient in the AlN intermediate layer reduces the distribution of stress in the DLC film, while also increasing the force of adhesion between the DLC and AlN layers. Given that both the DLC and AlN films were deposited using the same unbalanced magnetron sputtering method, this process is considered to represent a simple and effective means of improving the wear resistance of Al-alloy components commonly used within the aerospace and automotive industries.

  5. Distribution of nitrogen fixation and nitrogenase-like sequences amongst microbial genomes

    Science.gov (United States)

    2012-01-01

    Background The metabolic capacity for nitrogen fixation is known to be present in several prokaryotic species scattered across taxonomic groups. Experimental detection of nitrogen fixation in microbes requires species-specific conditions, making it difficult to obtain a comprehensive census of this trait. The recent and rapid increase in the availability of microbial genome sequences affords novel opportunities to re-examine the occurrence and distribution of nitrogen fixation genes. The current practice for computational prediction of nitrogen fixation is to use the presence of the nifH and/or nifD genes. Results Based on a careful comparison of the repertoire of nitrogen fixation genes in known diazotroph species we propose a new criterion for computational prediction of nitrogen fixation: the presence of a minimum set of six genes coding for structural and biosynthetic components, namely NifHDK and NifENB. Using this criterion, we conducted a comprehensive search in fully sequenced genomes and identified 149 diazotrophic species, including 82 known diazotrophs and 67 species not known to fix nitrogen. The taxonomic distribution of nitrogen fixation in Archaea was limited to the Euryarchaeota phylum; within the Bacteria domain we predict that nitrogen fixation occurs in 13 different phyla. Of these, seven phyla had not hitherto been known to contain species capable of nitrogen fixation. Our analyses also identified protein sequences that are similar to nitrogenase in organisms that do not meet the minimum-gene-set criteria. The existence of nitrogenase-like proteins lacking conserved co-factor ligands in both diazotrophs and non-diazotrophs suggests their potential for performing other, as yet unidentified, metabolic functions. Conclusions Our predictions expand the known phylogenetic diversity of nitrogen fixation, and suggest that this trait may be much more common in nature than it is currently thought. The diverse phylogenetic distribution of nitrogenase-like

  6. Distribution of nitrogen fixation and nitrogenase-like sequences amongst microbial genomes

    Directory of Open Access Journals (Sweden)

    Dos Santos Patricia C

    2012-05-01

    Full Text Available Abstract Background The metabolic capacity for nitrogen fixation is known to be present in several prokaryotic species scattered across taxonomic groups. Experimental detection of nitrogen fixation in microbes requires species-specific conditions, making it difficult to obtain a comprehensive census of this trait. The recent and rapid increase in the availability of microbial genome sequences affords novel opportunities to re-examine the occurrence and distribution of nitrogen fixation genes. The current practice for computational prediction of nitrogen fixation is to use the presence of the nifH and/or nifD genes. Results Based on a careful comparison of the repertoire of nitrogen fixation genes in known diazotroph species we propose a new criterion for computational prediction of nitrogen fixation: the presence of a minimum set of six genes coding for structural and biosynthetic components, namely NifHDK and NifENB. Using this criterion, we conducted a comprehensive search in fully sequenced genomes and identified 149 diazotrophic species, including 82 known diazotrophs and 67 species not known to fix nitrogen. The taxonomic distribution of nitrogen fixation in Archaea was limited to the Euryarchaeota phylum; within the Bacteria domain we predict that nitrogen fixation occurs in 13 different phyla. Of these, seven phyla had not hitherto been known to contain species capable of nitrogen fixation. Our analyses also identified protein sequences that are similar to nitrogenase in organisms that do not meet the minimum-gene-set criteria. The existence of nitrogenase-like proteins lacking conserved co-factor ligands in both diazotrophs and non-diazotrophs suggests their potential for performing other, as yet unidentified, metabolic functions. Conclusions Our predictions expand the known phylogenetic diversity of nitrogen fixation, and suggest that this trait may be much more common in nature than it is currently thought. The diverse phylogenetic

  7. A measurement of disorder in binary sequences

    Science.gov (United States)

    Gong, Longyan; Wang, Haihong; Cheng, Weiwen; Zhao, Shengmei

    2015-03-01

    We propose a complex quantity, AL, to characterize the degree of disorder of L-length binary symbolic sequences. As examples, we respectively apply it to typical random and deterministic sequences. One kind of random sequences is generated from a periodic binary sequence and the other is generated from the logistic map. The deterministic sequences are the Fibonacci and Thue-Morse sequences. In these analyzed sequences, we find that the modulus of AL, denoted by |AL | , is a (statistically) equivalent quantity to the Boltzmann entropy, the metric entropy, the conditional block entropy and/or other quantities, so it is a useful quantitative measure of disorder. It can be as a fruitful index to discern which sequence is more disordered. Moreover, there is one and only one value of |AL | for the overall disorder characteristics. It needs extremely low computational costs. It can be easily experimentally realized. From all these mentioned, we believe that the proposed measure of disorder is a valuable complement to existing ones in symbolic sequences.

  8. Learning of Grammar-Like Visual Sequences by Adults with and without Language-Learning Disabilities

    Science.gov (United States)

    Aguilar, Jessica M.; Plante, Elena

    2014-01-01

    Purpose: Two studies examined learning of grammar-like visual sequences to determine whether a general deficit in statistical learning characterizes this population. Furthermore, we tested the hypothesis that difficulty in sustaining attention during the learning task might account for differences in statistical learning. Method: In Study 1,…

  9. Can Natural Proteins Designed with ‘Inverted’ Peptide Sequences Adopt Native-Like Protein Folds?

    Science.gov (United States)

    Sridhar, Settu; Guruprasad, Kunchur

    2014-01-01

    We have carried out a systematic computational analysis on a representative dataset of proteins of known three-dimensional structure, in order to evaluate whether it would possible to ‘swap’ certain short peptide sequences in naturally occurring proteins with their corresponding ‘inverted’ peptides and generate ‘artificial’ proteins that are predicted to retain native-like protein fold. The analysis of 3,967 representative proteins from the Protein Data Bank revealed 102,677 unique identical inverted peptide sequence pairs that vary in sequence length between 5–12 and 18 amino acid residues. Our analysis illustrates with examples that such ‘artificial’ proteins may be generated by identifying peptides with ‘similar structural environment’ and by using comparative protein modeling and validation studies. Our analysis suggests that natural proteins may be tolerant to accommodating such peptides. PMID:25210740

  10. Identification of a STOP1-like protein in Eucalyptus that regulates transcription of Al tolerance genes.

    Science.gov (United States)

    Sawaki, Yoshiharu; Kobayashi, Yuriko; Kihara-Doi, Tomonori; Nishikubo, Nobuyuki; Kawazu, Tetsu; Kobayashi, Masatomo; Kobayashi, Yasufumi; Iuchi, Satoshi; Koyama, Hiroyuki; Sato, Shigeru

    2014-06-01

    Tolerance to soil acidity is an important trait for eucalyptus clones that are introduced to commercial forestry plantations in pacific Asian countries, where acidic soil is dominant in many locations. A conserved transcription factor regulating aluminum (Al) and proton (H⁺) tolerance in land-plant species, STOP1 (SENSITIVE TOPROTON RHIZOTOXICITY 1)-like protein, was isolated by polymerase chain reaction-based cloning, and then suppressed by RNA interference in hairy roots produced by Agrobacterium rhizogenes-mediated transformation. Eucalyptus STOP1-like protein complemented proton tolerance in an Arabidopsis thaliana stop1-mutant, and localized to the nucleus in a transient assay of a green fluorescent protein fusion protein expressed in tobacco leaves by Agrobacterium tumefaciens-mediated transformation. Genes encoding a citrate transporting MULTIDRUGS AND TOXIC COMPOUND EXTRUSION protein and an orthologue of ALUMINUM SENSITIVE 3 were suppressed in transgenic hairy roots in which the STOP1 orthologue was knocked down. In summary, we identified a series of genes for Al-tolerance in eucalyptus, including a gene for STOP1-like protein and the Al-tolerance genes it regulates. These genes may be useful for molecular breeding and genomic selection of elite clones to introduce into acid soil regions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry

    Directory of Open Access Journals (Sweden)

    Javier Villacreses

    2015-04-01

    Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.

  12. Expression of Colocasia esculenta tuber agglutinin in Indian mustard provides resistance against Lipaphis erysimi and the expressed protein is non-allergenic.

    Science.gov (United States)

    Das, Ayan; Ghosh, Prithwi; Das, Sampa

    2018-06-01

    Transgenic Brassica juncea plants expressing Colocasia esculenta tuber agglutinin (CEA) shows the non-allergenic nature of the expressed protein leading to enhanced mortality and reduced fecundity of mustard aphid-Lipaphis erysimi. Lipaphis erysimi (common name: mustard aphid) is the most devastating sucking insect pest of Indian mustard (Brassica juncea L.). Colocasia esculenta tuber agglutinin (CEA), a GNA (Galanthus nivalis agglutinin)-related lectin has previously been reported by the present group to be effective against a wide array of hemipteran insects in artificial diet-based bioassays. In the present study, efficacy of CEA in controlling L. erysimi has been established through the development of transgenic B. juncea expressing this novel lectin. Southern hybridization of the transgenic plants confirmed stable integration of cea gene. Expression of CEA in T 0 , T 1 and T 2 transgenic plants was confirmed through western blot analysis. Level of expression of CEA in the T 2 transgenic B. juncea ranged from 0.2 to 0.47% of the total soluble protein. In the in planta insect bioassays, the CEA expressing B. juncea lines exhibited enhanced insect mortality of 70-81.67%, whereas fecundity of L. erysimi was reduced by 49.35-62.11% compared to the control plants. Biosafety assessment of the transgenic B. juncea protein containing CEA was carried out by weight of evidence approach following the recommendations by FAO/WHO (Evaluation of the allergenicity of genetically modified foods: report of a joint FAO/WHO expert consultation, 22-25 Jan, Rome, http://www.fao.org/docrep/007/y0820e/y0820e00.HTM , 2001), Codex (Codex principles and guidelines on foods derived from biotechnology, Food and Agriculture Organization of the United Nations, Rome; Codex, Codex principles and guidelines on foods derived from biotechnology, Food and Agriculture Organization of the United Nations, Rome, 2003) and ICMR (Indian Council of Medical Research, guidelines for safety assessment of

  13. Building energetic material from novel salix leaf-like CuO and nano-Al through electrophoretic deposition

    Energy Technology Data Exchange (ETDEWEB)

    Yin, Yan Jun; Li, Xueming [College of Chemistry and Chemical Engineering, Chongqing University, Chongqing (China)

    2016-11-15

    In this study, an energetic material was prepared by depositing nano-Al on CuO arrays via electrophoretic deposition (EPD), which offers a feasible route for nano-Al integration. The morphology and structure of the CuO arrays and Al/CuO composites were characterized by scanning electron microscopy and X-ray diffraction. The CuO arrays were homogenously salix leaf-like structure with a width of ⁓150 to 200 nm. The energy density of Al/CuO composites was approximate to 1454.5 J/g by integrating the differential scanning calorimetry (DSC) plot and the combustion performance was recorded by a high-speed camera. Moreover, the combustion flames were violent and the whole reaction process only lasted 72.2 ms, indicating that the energy of the Al/CuO nanothermite can be released effectively.

  14. Initial test of a T9-like P300-based speller by an ALS patient

    Science.gov (United States)

    Ron-Angevin, R.; Varona-Moya, S.; da Silva-Sauer, L.

    2015-08-01

    Objective. Visual P300-based brain-computer interface spellers offer a useful communication channel for locked-in patients, who are completely dependent in their daily lives. One of the research goals for these systems is to achieve greater communication rates by means of modifying some features of their interfaces, e.g., reducing the matrix size. However, such modifications may not work well with disabled end-users, such as patients of amyotrophic lateral sclerosis (ALS), due to a supposed reduction of their cognitive resources. The purpose of the present study was to provide a proof of concept that ALS patients could efficiently use a P300-based speller with a 4 × 3 symbol matrix based on the T9 interface developed for mobile phones. Approach. We conducted an experiment with a sample of 11 able-bodied participants and one locked-in patient with ALS. All participants tested our T9-like visual P300-based speller and also two different 7 × 6 matrix spellers based on Farwell and Donchin’s classic proposal—one of them included a word predictor system like the T9-like speller did. Main results. The performance analyses indicated that the locked-in patient benefited from using a reduced matrix size as much as healthy users did, spelling words almost 1.6 times faster and equally accurately when using the T9-like speller than when using the alternative spellers. Significance. Due to counting on only one locked-in patient, the current work constitutes a feasibility study. The actual usability of systems such as the one proposed in this paper should be determined by means of studies with a greater number of end-users in real-life conditions.

  15. Re-annotation of the physical map of Glycine max for polyploid-like regions by BAC end sequence driven whole genome shotgun read assembly

    Directory of Open Access Journals (Sweden)

    Shultz Jeffry

    2008-07-01

    Full Text Available Abstract Background Many of the world's most important food crops have either polyploid genomes or homeologous regions derived from segmental shuffling following polyploid formation. The soybean (Glycine max genome has been shown to be composed of approximately four thousand short interspersed homeologous regions with 1, 2 or 4 copies per haploid genome by RFLP analysis, microsatellite anchors to BACs and by contigs formed from BAC fingerprints. Despite these similar regions,, the genome has been sequenced by whole genome shotgun sequence (WGS. Here the aim was to use BAC end sequences (BES derived from three minimum tile paths (MTP to examine the extent and homogeneity of polyploid-like regions within contigs and the extent of correlation between the polyploid-like regions inferred from fingerprinting and the polyploid-like sequences inferred from WGS matches. Results Results show that when sequence divergence was 1–10%, the copy number of homeologous regions could be identified from sequence variation in WGS reads overlapping BES. Homeolog sequence variants (HSVs were single nucleotide polymorphisms (SNPs; 89% and single nucleotide indels (SNIs 10%. Larger indels were rare but present (1%. Simulations that had predicted fingerprints of homeologous regions could be separated when divergence exceeded 2% were shown to be false. We show that a 5–10% sequence divergence is necessary to separate homeologs by fingerprinting. BES compared to WGS traces showed polyploid-like regions with less than 1% sequence divergence exist at 2.3% of the locations assayed. Conclusion The use of HSVs like SNPs and SNIs to characterize BACs wil improve contig building methods. The implications for bioinformatic and functional annotation of polyploid and paleopolyploid genomes show that a combined approach of BAC fingerprint based physical maps, WGS sequence and HSV-based partitioning of BAC clones from homeologous regions to separate contigs will allow reliable de

  16. Sequence-based identification of inositol monophosphatase-like histidinol-phosphate phosphatases (HisN) in Corynebacterium glutamicum, Actinobacteria, and beyond.

    Science.gov (United States)

    Kulis-Horn, Robert Kasimir; Rückert, Christian; Kalinowski, Jörn; Persicke, Marcus

    2017-07-18

    The eighth step of L-histidine biosynthesis is carried out by an enzyme called histidinol-phosphate phosphatase (HolPase). Three unrelated HolPase families are known so far. Two of them are well studied: HAD-type HolPases known from Gammaproteobacteria like Escherichia coli or Salmonella enterica and PHP-type HolPases known from yeast and Firmicutes like Bacillus subtilis. However, the third family of HolPases, the inositol monophosphatase (IMPase)-like HolPases, present in Actinobacteria like Corynebacterium glutamicum (HisN) and plants, are poorly characterized. Moreover, there exist several IMPase-like proteins in bacteria (e.g. CysQ, ImpA, and SuhB) which are very similar to HisN but most likely do not participate in L-histidine biosynthesis. Deletion of hisN, the gene encoding the IMPase-like HolPase in C. glutamicum, does not result in complete L-histidine auxotrophy. Out of four hisN homologs present in the genome of C. glutamicum (impA, suhB, cysQ, and cg0911), only cg0911 encodes an enzyme with HolPase activity. The enzymatic properties of HisN and Cg0911 were determined, delivering the first available kinetic data for IMPase-like HolPases. Additionally, we analyzed the amino acid sequences of potential HisN, ImpA, SuhB, CysQ and Cg0911 orthologs from bacteria and identified six conserved sequence motifs for each group of orthologs. Mutational studies confirmed the importance of a highly conserved aspartate residue accompanied by several aromatic amino acid residues present in motif 5 for HolPase activity. Several bacterial proteins containing all identified HolPase motifs, but showing only moderate sequence similarity to HisN from C. glutamicum, were experimentally confirmed as IMPase-like HolPases, demonstrating the value of the identified motifs. Based on the confirmed IMPase-like HolPases two profile Hidden Markov Models (HMMs) were build using an iterative approach. These HMMs allow the fast, reliable detection and differentiation of the two

  17. High-affinity multivalent wheat germ agglutinin ligands by one-pot click reaction

    Directory of Open Access Journals (Sweden)

    Henning S. G. Beckmann

    2012-06-01

    Full Text Available A series of six mono-, di-, and trivalent N,N’-diacetylchitobiose derivatives was conveniently prepared by employing a one-pot procedure for Cu(II-catalyzed diazo transfer and Cu(I-catalyzed azide–alkyne cycloaddition (CuAAC starting from commercially available amines. These glycoclusters were probed for their binding potencies to the plant lectin wheat germ agglutinin (WGA from Triticum vulgaris by an enzyme-linked lectin assay (ELLA employing covalently immobilized N-acetylglucosamine (GlcNAc as a reference ligand. IC50 values were in the low micromolar/high nanomolar range, depending on the linker between the two disaccharides. Binding enhancements β up to 1000 for the divalent ligands and 2800 for a trivalent WGA ligand, compared to N,N’-diacetylchitobiose as the corresponding monovalent ligand, were observed. Molecular modeling studies, in which the chitobiose moieties were fitted into crystallographically determined binding sites of WGA, correlate the binding enhancements of the multivalent ligands with their ability to bind to the protein in a chelating mode. The best WGA ligand is a trivalent cluster with an IC50 value of 220 nM. Calculated per mol of contained chitobiose, this is the best WGA ligand known so far.

  18. Association of Ulex europaeus agglutinin I binding with invasion in endometrial carcinoma.

    Science.gov (United States)

    Ambros, R A; Kurman, R J

    1993-10-01

    Ulex europaeus agglutinin I (UEA-I), a lectin which specifically binds L-fucose, has been shown to extensively bind endometrial carcinoma cells but not benign endometrial glands. Patterns of UEA-I binding were examined in five cases of uteri containing proliferative endometrium, five cases of endometrial hyperplasia, and 54 cases of endometrioid (typical) carcinoma of the endometrium and correlated with the histologic features of the tumor and its behavior. Whereas proliferative endometrium showed luminal staining only, diffuse cytoplasmic staining was frequently seen in hyperplasia and carcinoma. Carcinomas with a high percentage of tumor cells staining with UEA-I tended to be high-grade with a greater tendency to deep myometrial and vascular invasion than tumors with little or no staining. By univariate survival analysis, the extent of UEA-I binding was found to correlate with patient survival. By multivariate analysis, however, survival correlated most closely with the presence of deep myometrial and vascular invasion, and UEA-I binding was not found to be an independent prognostic indicator. This study suggests that increased fucosylation of proteins in endometrioid cancer cells may play a role in myometrial and vascular invasion.

  19. A new phase modulated binomial-like selective-inversion sequence for solvent signal suppression in NMR.

    Science.gov (United States)

    Chen, Johnny; Zheng, Gang; Price, William S

    2017-02-01

    A new 8-pulse Phase Modulated binomial-like selective inversion pulse sequence, dubbed '8PM', was developed by optimizing the nutation and phase angles of the constituent radio-frequency pulses so that the inversion profile resembled a target profile. Suppression profiles were obtained for both the 8PM and W5 based excitation sculpting sequences with equal inter-pulse delays. Significant distortions were observed in both profiles because of the offset effect of the radio frequency pulses. These distortions were successfully reduced by adjusting the inter-pulse delays. With adjusted inter-pulse delays, the 8PM and W5 based excitation sculpting sequences were tested on an aqueous lysozyme solution. The 8 PM based sequence provided higher suppression selectivity than the W5 based sequence. Two-dimensional nuclear Overhauser effect spectroscopy experiments were also performed on the lysozyme sample with 8PM and W5 based water signal suppression. The 8PM based suppression provided a spectrum with significantly increased (~ doubled) cross-peak intensity around the suppressed water resonance compared to the W5 based suppression. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  20. Rescuing apoptotic neurons in Alzheimer’s disease using wheat germ agglutinin-conjugated and cardiolipin-conjugated liposomes with encapsulated nerve growth factor and curcumin

    Directory of Open Access Journals (Sweden)

    Kuo YC

    2015-04-01

    Full Text Available Yung-Chih Kuo, Ching-Chun Lin Department of Chemical Engineering, National Chung Cheng University, Chia-Yi, Taiwan, Republic of China Abstract: Liposomes with cardiolipin (CL and wheat germ agglutinin (WGA were developed to permeate the blood–brain barrier and treat Alzheimer’s disease. WGA-conjugated and CL-incorporated liposomes (WGA-CL-liposomes were used to transport nerve growth factor (NGF and curcumin (CUR across a monolayer of human brain-microvascular endothelial cells regulated by human astrocytes and to protect SK-N-MC cells against apoptosis induced by ß-amyloid1–42 (Aß1–42 fibrils. An increase in the CL mole percentage in lipids increased the liposomal diameter, absolute zeta potential value, entrapment efficiency of NGF and CUR, release of NGF, biocompatibility, and viability of SK-N-MC cells with Aß1–42, but decreased the atomic ratio of nitrogen to phosphorus and release of CUR. In addition, an increase in the WGA concentration for grafting enhanced the liposomal diameter, atomic ratio of nitrogen to phosphorus, and permeability of NGF and CUR across the blood–brain barrier, but reduced the absolute zeta potential value and biocompatibility. WGA-CL-liposomes carrying NGF and CUR could be promising colloidal delivery carriers for future clinical application in targeting the blood–brain barrier and inhibiting neurotoxicity. Keywords: Alzheimer’s disease, nerve growth factor, curcumin, wheat germ agglutinin, cardiolipin, liposome

  1. Classification of x-ray spectra of 2-3 transitions in the Ne-like and Na-like isoelectronic sequences of the elements from krypton to molybdenum

    International Nuclear Information System (INIS)

    Gordon, H.; Hobby, M.G.; Peacock, N.J.; Cowan, R.D.

    1979-01-01

    Plasmas produced by the laser irradiation of solid targets and in a plasma focus device have been employed as sources of x-ray spectra of the elements Kr(Z = 36)-Mo(Z = 42). The Ne-like isoelectronic sequence has been investigated by comparing observed wavelengths with ab initio atomic structure calculations and isoelectronic interpolation. Previous identifications in Ne-like ions have been extended to krypton, rubidium and strontium. The Na-like satellite structure of these elements has also been studied and a detailed classification of these satellites is presented. (author)

  2. A picorna-like virus from the red imported fire ant, Solenopsis invicta: initial discovery, genome sequence, and characterization

    International Nuclear Information System (INIS)

    Valles, Steven M.; Strong, Charles A.; Dang, Phat M.; Hunter, Wayne B.; Pereira, Roberto M.; Oi, David H.; Shapiro, Alexandra M.; Williams, David F.

    2004-01-01

    We report the first discovery and genome sequence of a virus infecting the red imported fire ant, Solenopsis invicta. The 8026 nucleotide, polyadenylated, RNA genome encoded two large open reading frames (ORF1 and ORF2), flanked and separated by 27, 223, and 171 nucleotide untranslated regions, respectively. The predicted amino acid sequence of the 5' proximal ORF1 (nucleotides 28 to 4218) exhibited significant identity and possessed consensus sequences characteristic of the helicase, cysteine protease, and RNA-dependent RNA polymerase sequence motifs from picornaviruses, picorna-like viruses, comoviruses, caliciviruses, and sequiviruses. The predicted amino acid sequence of the 3' proximal ORF2 (nucleotides 4390-7803) showed similarity to structural proteins in picorna-like viruses, especially the acute bee paralysis virus. Electron microscopic examination of negatively stained samples from virus-infected fire ants revealed isometric particles with a diameter of 31 nm, consistent with Picornaviridae. A survey for the fire ant virus from areas around Florida revealed a pattern of fairly widespread distribution. Among 168 nests surveyed, 22.9% were infected. The virus was found to infect all fire ant caste members and developmental stages, including eggs, early (1st-2nd) and late (3rd-4th) instars, worker pupae, workers, sexual pupae, alates ( male and female ), and queens. The virus, tentatively named S. invicta virus (SINV-1), appears to belong to the picorna-like viruses. We did not observe any perceptible symptoms among infected nests in the field. However, in every case where an SINV-1-infected colony was excavated from the field with an inseminated queen and held in the laboratory, all of the brood in these colonies died within 3 months

  3. Sequence and phylogenetic analyses of novel totivirus-like double-stranded RNAs from field-collected powdery mildew fungi.

    Science.gov (United States)

    Kondo, Hideki; Hisano, Sakae; Chiba, Sotaro; Maruyama, Kazuyuki; Andika, Ida Bagus; Toyoda, Kazuhiro; Fujimori, Fumihiro; Suzuki, Nobuhiro

    2016-02-02

    The identification of mycoviruses contributes greatly to understanding of the diversity and evolutionary aspects of viruses. Powdery mildew fungi are important and widely studied obligate phytopathogenic agents, but there has been no report on mycoviruses infecting these fungi. In this study, we used a deep sequencing approach to analyze the double-stranded RNA (dsRNA) segments isolated from field-collected samples of powdery mildew fungus-infected red clover plants in Japan. Database searches identified the presence of at least ten totivirus (genus Totivirus)-like sequences, termed red clover powdery mildew-associated totiviruses (RPaTVs). The majority of these sequences shared moderate amino acid sequence identity with each other (powdery mildew fungus populations infecting red clover plants in the field. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Implicit sequence learning in people with Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Katherine R Gamble

    2014-08-01

    Full Text Available Implicit sequence learning involves learning about dependencies in sequences of events without intent to learn or awareness of what has been learned. Sequence learning is related to striatal dopamine levels, striatal activation, and integrity of white matter connections. People with Parkinson’s disease (PD have degeneration of dopamine-producing neurons, leading to dopamine deficiency and therefore striatal deficits, and they have difficulties with sequencing, including complex language comprehension and postural stability. Most research on implicit sequence learning in PD has used motor-based tasks. However, because PD presents with motor deficits, it is difficult to assess whether learning itself is impaired in these tasks. The present study used an implicit sequence learning task with a reduced motor component, the Triplets Learning Task (TLT. People with PD and age- and education-matched healthy older adults completed three sessions (each consisting of 10 blocks of 50 trials of the TLT. Results revealed that the PD group was able to learn the sequence, however, when learning was examined using a Half Blocks analysis (Nemeth et al., 2013, which compared learning in the 1st 25/50 trials of all blocks to that in the 2nd 25/50 trials, the PD group showed significantly less learning than Controls in the 2nd Half Blocks, but not in the 1st. Nemeth et al. hypothesized that the 1st Half Blocks involve recall and reactivation of the sequence learned, thus reflecting hippocampal-dependent learning, while the 2nd Half Blocks involve proceduralized behavior of learned sequences, reflecting striatal-based learning. The present results suggest that the PD group had intact hippocampal-dependent implicit sequence learning, but impaired striatal-dependent learning. Thus, sequencing deficits in PD are likely due to striatal impairments, but other brain systems, such as the hippocampus, may be able to partially compensate for striatal decline to improve

  5. Transgene vaccination using Ulex europaeus agglutinin I (UEA-1) for targeted mucosal immunization against HIV-1 envelope.

    Science.gov (United States)

    Wang, Xinhai; Kochetkova, Irina; Haddad, Asmahan; Hoyt, Teri; Hone, David M; Pascual, David W

    2005-05-31

    Receptor-mediated gene transfer using an M cell ligand has been shown to be an efficient method for mucosal DNA immunization. To investigate further into alternative M cell ligands, the plant lectin, Ulex europaeus agglutinin I (UEA-1), was tested. UEA-1 binds to human intestinal Caco-2 cells, and these cells can be transfected with poly-l-lysine (PL)-conjugated UEA-1 for expression of reporter cDNAs. When tested in vivo, mice nasally immunized with UEA-1-PL complexed to plasmid encoding HIV-1 envelope showed elevated systemic and mucosal antibody responses, and these were supported by tissue antibody-forming cells. Likewise, elevated envelope-specific CTLs were induced. Thus, UEA-1 mediated DNA delivery represents an alternative mucosal formulation for inducing humoral and cellular immunity against HIV-1.

  6. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  7. Antinutritive effects of wheat-germ agglutinin and other N-acetylglucosamine-specific lectins.

    Science.gov (United States)

    Pusztai, A; Ewen, S W; Grant, G; Brown, D S; Stewart, J C; Peumans, W J; Van Damme, E J; Bardocz, S

    1993-07-01

    Incorporation of N-acetylglucosamine-specific agglutinins from wheat germ (Triticum aestivum; WGA), thorn apple (Datura stramonium) or nettle (Urtica dioica) rhizomes in the diet at the level of 7 g/kg reduced the apparent digestibility and utilization of dietary proteins and the growth of rats, with WGA being the most damaging. As a result of their binding and endocytosis by the epithelial cells of the small intestine, all three lectins were growth factors for the gut and interfered with its metabolism and function to varying degrees. WGA was particularly effective; it induced extensive polyamine-dependent hyperplastic and hypertrophic growth of the small bowel by increasing its content of proteins, RNA and DNA. Furthermore, an appreciable portion of the endocytosed WGA was transported across the gut wall into the systemic circulation, where it was deposited in the walls of the blood and lymphatic vessels. WGA also induced the hypertrophic growth of the pancreas and caused thymus atrophy. Although the transfer of the gene of WGA into crop plants has been advocated to increase their insect resistance, as the presence of this lectin in the diet may harm higher animals at the concentrations required to be effective against most pests, its use in plants as natural insecticide is not without health risks for man.

  8. The carbohydrate-binding module (CBM)-like sequence is crucial for rice CWA1/BC1 function in proper assembly of secondary cell wall materials.

    Science.gov (United States)

    Sato, Kanna; Ito, Sachiko; Fujii, Takeo; Suzuki, Ryu; Takenouchi, Sachi; Nakaba, Satoshi; Funada, Ryo; Sano, Yuzou; Kajita, Shinya; Kitano, Hidemi; Katayama, Yoshihiro

    2010-11-01

    We recently reported that the cwa1 mutation disturbed the deposition and assembly of secondary cell wall materials in the cortical fiber of rice internodes. Genetic analysis revealed that cwa1 is allelic to bc1, which encodes glycosylphosphatidylinositol (GPI)-anchored COBRA-like protein with the highest homology to Arabidopsis COBRA-like 4 (COBL4) and maize Brittle Stalk 2 (Bk2). Our results suggested that CWA1/BC1 plays a role in assembling secondary cell wall materials at appropriate sites, enabling synthesis of highly ordered secondary cell wall structure with solid and flexible internodes in rice. The N-terminal amino acid sequence of CWA1/BC1, as well as its orthologs (COBL4, Bk2) and other BC1-like proteins in rice, shows weak similarity to a family II carbohydrate-binding module (CBM2) of several bacterial cellulases. To investigate the importance of the CBM-like sequence of CWA1/BC1 in the assembly of secondary cell wall materials, Trp residues in the CBM-like sequence, which is important for carbohydrate binding, were substituted for Val residues and introduced into the cwa1 mutant. CWA1/BC1 with the mutated sequence did not complement the abnormal secondary cell walls seen in the cwa1 mutant, indicating that the CBM-like sequence is essential for the proper function of CWA1/BC1, including assembly of secondary cell wall materials.

  9. Draft Genome Sequence of a Picorna-Like Virus Associated with Gill Tissue in Clinically Normal Brook Trout, Salvelinus fontinalis

    OpenAIRE

    Iwanowicz, Luke R.; Iwanowicz, Deborah D.; Adams, Cynthia R.; Galbraith, Heather; Aunins, Aaron; Cornman, Robert S.

    2017-01-01

    ABSTRACT Here, we report a draft genome sequence of a picorna-like virus associated with brook trout, Salvelinus fontinalis, gill tissue. The draft genome comprises 8,681 nucleotides, excluding the poly(A) tract, and contains two open reading frames. It is most similar to picorna-like viruses that infect invertebrates.

  10. Draft Genome Sequence of a Picorna-Like Virus Associated with Gill Tissue in Clinically Normal Brook Trout, Salvelinus fontinalis.

    Science.gov (United States)

    Iwanowicz, Luke R; Iwanowicz, Deborah D; Adams, Cynthia R; Galbraith, Heather; Aunins, Aaron; Cornman, Robert S

    2017-10-12

    Here, we report a draft genome sequence of a picorna-like virus associated with brook trout, Salvelinus fontinalis , gill tissue. The draft genome comprises 8,681 nucleotides, excluding the poly(A) tract, and contains two open reading frames. It is most similar to picorna-like viruses that infect invertebrates.

  11. AlTiN layer effect on mechanical properties of Ti-doped diamond-like carbon composite coatings

    International Nuclear Information System (INIS)

    Pang Xiaolu; Yang Huisheng; Gao Kewei; Wang Yanbin; Volinsky, Alex A.

    2011-01-01

    Ti/Ti-doped diamond-like carbon (DLC) and Ti/AlTiN/Ti-DLC composite coatings were deposited by magnetron sputtering on W18Cr4V high speed steel substrates. The effect of the AlTiN support layer on the properties of these composite coatings was investigated through microstructure and mechanical properties characterization, including hardness, elastic modulus, coefficient of friction and wear properties measured by scanning electron microscopy, Raman spectroscopy, scratch and ball-on-disk friction tests. Ti and AlTiN interlayers have a columnar structure with 50-80 nm grains. The hardness and elastic modulus of Ti/Ti-DLC and Ti/AlTiN/Ti-DLC coatings is 25.9 ± 0.4, 222.2 ± 6.3 GPa and 19.3 ± 1, 205.6 ± 6.7 GPa, respectively. Adhesion of Ti-DLC, Ti/AlTiN/Ti-DLC and AlTiN/Ti-DLC coatings expressed as the critical lateral force is 26.5 N, 38.2 N, and 47.8 N, respectively. Substrate coefficient of friction without coatings is 0.44, and it is 0.1 for Ti/Ti-DLC and Ti/AlTiN/Ti-DLC coatings. Wear resistance of Ti/AlTiN/Ti-DLC composite coatings is much higher than Ti/Ti-DLC coatings based on the wear track width of 169.8 and 73.2 μm, respectively, for the same experimental conditions.

  12. Van der Waals stacks of few-layer h-AlN with graphene: an ab initio study of structural, interaction and electronic properties

    International Nuclear Information System (INIS)

    Dos Santos, Renato B; Mota, F de Brito; Rivelino, R; Kakanakova-Georgieva, A; Gueorguiev, G K

    2016-01-01

    Graphite-like hexagonal AlN (h-AlN) multilayers have been experimentally manifested and theoretically modeled. The development of any functional electronics applications of h-AlN would most certainly require its integration with other layered materials, particularly graphene. Here, by employing vdW-corrected density functional theory calculations, we investigate structure, interaction energy, and electronic properties of van der Waals stacking sequences of few-layer h-AlN with graphene. We find that the presence of a template such as graphene induces enough interlayer charge separation in h-AlN, favoring a graphite-like stacking formation. We also find that the interface dipole, calculated per unit cell of the stacks, tends to increase with the number of stacked layers of h-AlN and graphene. (paper)

  13. Complete sequences of glucagon-like peptide-1 from human and pig small intestine

    DEFF Research Database (Denmark)

    Orskov, C; Bersani, M; Johnsen, A H

    1989-01-01

    intestine of the proglucagon precursor were determined by pairs of basic amino acid residues flanking the two peptides. Earlier studies have shown that synthetic glucagon-like peptide-1 (GLP-1) synthesized according to the proposed structure (proglucagon 71-108 or because residue 108 is Gly, 72-107 amide......) had no physiological effects, whereas a truncated from of GLP-1, corresponding to proglucagon 78-107 amide, strongly stimulated insulin secretion and depressed glucagon secretion. To determine the amino acid sequence of the naturally occurring peptide we isolated GLP-1 from human small intestine...

  14. Detection of a Usp-like gene in Calotropis procera plant from the de novo assembled genome contigs of the high-throughput sequencing dataset

    KAUST Repository

    Shokry, Ahmed M.

    2014-02-01

    The wild plant species Calotropis procera (C. procera) has many potential applications and beneficial uses in medicine, industry and ornamental field. It also represents an excellent source of genes for drought and salt tolerance. Genes encoding proteins that contain the conserved universal stress protein (USP) domain are known to provide organisms like bacteria, archaea, fungi, protozoa and plants with the ability to respond to a plethora of environmental stresses. However, information on the possible occurrence of Usp in C. procera is not available. In this study, we uncovered and characterized a one-class A Usp-like (UspA-like, NCBI accession No. KC954274) gene in this medicinal plant from the de novo assembled genome contigs of the high-throughput sequencing dataset. A number of GenBank accessions for Usp sequences were blasted with the recovered de novo assembled contigs. Homology modelling of the deduced amino acids (NCBI accession No. AGT02387) was further carried out using Swiss-Model, accessible via the EXPASY. Superimposition of C. procera USPA-like full sequence model on Thermus thermophilus USP UniProt protein (PDB accession No. Q5SJV7) was constructed using RasMol and Deep-View programs. The functional domains of the novel USPA-like amino acids sequence were identified from the NCBI conserved domain database (CDD) that provide insights into sequence structure/function relationships, as well as domain models imported from a number of external source databases (Pfam, SMART, COG, PRK, TIGRFAM). © 2014 Académie des sciences.

  15. Defect-induced room temperature ferromagnetic properties of the Al-doped and undoped ZnO rod-like nanostructure

    CSIR Research Space (South Africa)

    Jule, L

    2017-07-01

    Full Text Available : 151-155 Defect-induced room temperature ferromagnetic properties of the Al-doped and undoped ZnO rod-like nanostructure Jule L Dejene F Ali AG Roro KT Mwakikunga BW ABSTRACT: In this work, electron paramagnetic resonance (EPR...

  16. Lectin Ulex europaeus agglutinin I specifically labels a subset of primary afferent fibers which project selectively to the superficial dorsal horn of the spinal cord.

    Science.gov (United States)

    Mori, K

    1986-02-19

    To examine differential carbohydrate expression among different subsets of primary afferent fibers, several fluorescein-isothiocyanate conjugated lectins were used in a histochemical study of the dorsal root ganglion (DRG) and spinal cord of the rabbit. The lectin Ulex europaeus agglutinin I specifically labeled a subset of DRG cells and primary afferent fibers which projected to the superficial laminae of the dorsal horn. These results suggest that specific carbohydrates containing L-fucosyl residue is expressed selectively in small diameter primary afferent fibers which subserve nociception or thermoception.

  17. Global transformation of erythrocyte properties via engagement of an SH2-like sequence in band 3.

    Science.gov (United States)

    Puchulu-Campanella, Estela; Turrini, Francesco M; Li, Yen-Hsing; Low, Philip S

    2016-11-29

    Src homology 2 (SH2) domains are composed of weakly conserved sequences of ∼100 aa that bind phosphotyrosines in signaling proteins and thereby mediate intra- and intermolecular protein-protein interactions. In exploring the mechanism whereby tyrosine phosphorylation of the erythrocyte anion transporter, band 3, triggers membrane destabilization, vesiculation, and fragmentation, we discovered a SH2 signature motif positioned between membrane-spanning helices 4 and 5. Evidence that this exposed cytoplasmic sequence contributes to a functional SH2-like domain is provided by observations that: (i) it contains the most conserved sequence of SH2 domains, GSFLVR; (ii) it binds the tyrosine phosphorylated cytoplasmic domain of band 3 (cdb3-PO 4 ) with K d = 14 nM; (iii) binding of cdb3-PO 4 to erythrocyte membranes is inhibited both by antibodies against the SH2 signature sequence and dephosphorylation of cdb3-PO 4 ; (iv) label transfer experiments demonstrate the covalent transfer of photoactivatable biotin from isolated cdb3-PO 4 (but not cdb3) to band 3 in erythrocyte membranes; and (v) phosphorylation-induced binding of cdb3-PO 4 to the membrane-spanning domain of band 3 in intact cells causes global changes in membrane properties, including (i) displacement of a glycolytic enzyme complex from the membrane, (ii) inhibition of anion transport, and (iii) rupture of the band 3-ankyrin bridge connecting the spectrin-based cytoskeleton to the membrane. Because SH2-like motifs are not retrieved by normal homology searches for SH2 domains, but can be found in many tyrosine kinase-regulated transport proteins using modified search programs, we suggest that related cases of membrane transport proteins containing similar motifs are widespread in nature where they participate in regulation of cell properties.

  18. Preparation and investigation of Ulex europaeus agglutinin I-conjugated liposomes as potential oral vaccine carriers.

    Science.gov (United States)

    Li, KeXin; Chen, DaWei; Zhao, XiuLi; Hu, HaiYang; Yang, ChunRong; Pang, DaHai

    2011-11-01

    We prepared and optimized Ulex europaeus agglutinin I (UEAI)-modified Bovine serum albumin (BSA)-encapsulating liposomes (UEAI-LIP) as oral vaccine carriers and examined the feasibility of inducing systemic and mucosal immune responses by oral administration of UEAILIP. The prepared systems were characterized in vitro for their average size, zeta potential, encapsulation efficiency (EE%) and conjugation efficiency (CE%). In vitro release studies indicated that the presence of UEAI around the optimized liposomes was able to prevent a burst release of loaded BSA and provide sustained release of the encapsulated protein. In vivo immune-stimulating results in KM mice showed that BSA given intramuscularly generated systemic response only but both systemic and mucosal immune responses could be induced simultaneously in the groups in which BSA-loaded liposomes (LIP) and UEAI-LIP were administered intragastrically. Furthermore, the modification of UEAI on the surface of liposomes could further enhance the IgA and IgG levels obviously. In conclusion, this study demonstrated the high potential of lectin-modified liposomes containing the antigen as carriers for oral vaccine.

  19. Protein chaperones Q8ZP25_SALTY from Salmonella typhimurium and HYAE_ECOLI from Escherichia coli exhibit thioredoxin-like structures despite lack of canonical thioredoxin active site sequence motif.

    Science.gov (United States)

    Parish, David; Benach, Jordi; Liu, Goahua; Singarapu, Kiran Kumar; Xiao, Rong; Acton, Thomas; Su, Min; Bansal, Sonal; Prestegard, James H; Hunt, John; Montelione, Gaetano T; Szyperski, Thomas

    2008-12-01

    The structure of the 142-residue protein Q8ZP25_SALTY encoded in the genome of Salmonella typhimurium LT2 was determined independently by NMR and X-ray crystallography, and the structure of the 140-residue protein HYAE_ECOLI encoded in the genome of Escherichia coli was determined by NMR. The two proteins belong to Pfam (Finn et al. 34:D247-D251, 2006) PF07449, which currently comprises 50 members, and belongs itself to the 'thioredoxin-like clan'. However, protein HYAE_ECOLI and the other proteins of Pfam PF07449 do not contain the canonical Cys-X-X-Cys active site sequence motif of thioredoxin. Protein HYAE_ECOLI was previously classified as a [NiFe] hydrogenase-1 specific chaperone interacting with the twin-arginine translocation (Tat) signal peptide. The structures presented here exhibit the expected thioredoxin-like fold and support the view that members of Pfam family PF07449 specifically interact with Tat signal peptides.

  20. Protein Chaperones Q8ZP25_SALTY from Salmonella Typhimurium and HYAE_ECOLI from Escherichia coli Exhibit Thioredoxin-like Structures Despite Lack of Canonical Thioredoxin Active Site Sequence Motif

    Energy Technology Data Exchange (ETDEWEB)

    Parish, D.; Benach, J; Liu, G; Singarapu, K; Xiao, R; Acton, T; Hunt, J; Montelione, G; Szyperski, T; et. al.

    2008-01-01

    The structure of the 142-residue protein Q8ZP25 SALTY encoded in the genome of Salmonella typhimurium LT2 was determined independently by NMR and X-ray crystallography, and the structure of the 140-residue protein HYAE ECOLI encoded in the genome of Escherichia coli was determined by NMR. The two proteins belong to Pfam (Finn et al. 34:D247-D251, 2006) PF07449, which currently comprises 50 members, and belongs itself to the 'thioredoxin-like clan'. However, protein HYAE ECOLI and the other proteins of Pfam PF07449 do not contain the canonical Cys-X-X-Cys active site sequence motif of thioredoxin. Protein HYAE ECOLI was previously classified as a (NiFe) hydrogenase-1 specific chaperone interacting with the twin-arginine translocation (Tat) signal peptide. The structures presented here exhibit the expected thioredoxin-like fold and support the view that members of Pfam family PF07449 specifically interact with Tat signal peptides.

  1. A thaumatin-like genomic sequence identification in Vitis vinifera l., stormy wines and musts based on direct pcr

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2018-03-01

    Full Text Available Normal 0 21 false false false MicrosoftInternetExplorer4 Direct polymerase chain reaction method was use to amplify a thaumatin-like sequence of Vitis vinifera L. in grapes as well as in stormy wines and musts. Thaumatin-like proteins (TLPs of Vitis vinifera possess beside its function in abiotic and biotic stress response another one - they are able to cause protein haze in wine unless removed prior to bottling. Direct PCR is an approach where omission of DNA extraction is typical prior the amplification of the target site of plant genome. Crude extract or small pieces of plant tissues are used in the analysis directly without steps of extraction and purification of gDNA. The biological material that was used in analysis was collected during August - October 2017 in local stores and winery Sabo and comprises from cultivars Iršai, Muškát, Savignon Blanc, Svätovavrinecké, Dornfelder and Pálava. Direct PCR was performed by a cutted piece of grape tissue and a dilution buffer was use in 1:2 for stormy wine or must, respectively. Direct amplification of thaumatin-like protein sequence of Vitis vinifera was performed along with the control reactions with the primers for conserved region of plant chloroplast. Possitive amplification of thaumatin-like allergen sequence resulted in 570 bp amplicon. The most abundant amplicons were amplified in stormy wines, followed by musts and the amplicons from grapes were weaker when comparing them to others. The amplicon specificity checking of obtained PCR product of thaumatin-like allergen was performed by restriction cleavage by Psi I and resulted in restriction amplicons of the 80 bp, 81 bp, 94 bp and 315 bp in length. Confirmation of the amplicon specificity by restriction cleavage support the potential of direct PCR to become a reproducible method that will be fully applicable in routine analysis of not only plant genomes in the future, but it was demonstrated, that it works in liquids, too.  

  2. Reprint of "Sequence and phylogenetic analyses of novel totivirus-like double-stranded RNAs from field-collected powdery mildew fungi".

    Science.gov (United States)

    Kondo, Hideki; Hisano, Sakae; Chiba, Sotaro; Maruyama, Kazuyuki; Andika, Ida Bagus; Toyoda, Kazuhiro; Fujimori, Fumihiro; Suzuki, Nobuhiro

    2016-07-02

    The identification of mycoviruses contributes greatly to understanding of the diversity and evolutionary aspects of viruses. Powdery mildew fungi are important and widely studied obligate phytopathogenic agents, but there has been no report on mycoviruses infecting these fungi. In this study, we used a deep sequencing approach to analyze the double-stranded RNA (dsRNA) segments isolated from field-collected samples of powdery mildew fungus-infected red clover plants in Japan. Database searches identified the presence of at least ten totivirus (genus Totivirus)-like sequences, termed red clover powdery mildew-associated totiviruses (RPaTVs). The majority of these sequences shared moderate amino acid sequence identity with each other (powdery mildew fungus populations infecting red clover plants in the field. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Killer Immunoglobulin-Like Receptor Allele Determination Using Next-Generation Sequencing Technology

    Directory of Open Access Journals (Sweden)

    Bercelin Maniangou

    2017-05-01

    Full Text Available The impact of natural killer (NK cell alloreactivity on hematopoietic stem cell transplantation (HSCT outcome is still debated due to the complexity of graft parameters, HLA class I environment, the nature of killer cell immunoglobulin-like receptor (KIR/KIR ligand genetic combinations studied, and KIR+ NK cell repertoire size. KIR genes are known to be polymorphic in terms of gene content, copy number variation, and number of alleles. These allelic polymorphisms may impact both the phenotype and function of KIR+ NK cells. We, therefore, speculate that polymorphisms may alter donor KIR+ NK cell phenotype/function thus modulating post-HSCT KIR+ NK cell alloreactivity. To investigate KIR allele polymorphisms of all KIR genes, we developed a next-generation sequencing (NGS technology on a MiSeq platform. To ensure the reliability and specificity of our method, genomic DNA from well-characterized cell lines were used; high-resolution KIR typing results obtained were then compared to those previously reported. Two different bioinformatic pipelines were used allowing the attribution of sequencing reads to specific KIR genes and the assignment of KIR alleles for each KIR gene. Our results demonstrated successful long-range KIR gene amplifications of all reference samples using intergenic KIR primers. The alignment of reads to the human genome reference (hg19 using BiRD pipeline or visualization of data using Profiler software demonstrated that all KIR genes were completely sequenced with a sufficient read depth (mean 317× for all loci and a high percentage of mapping (mean 93% for all loci. Comparison of high-resolution KIR typing obtained to those published data using exome capture resulted in a reported concordance rate of 95% for centromeric and telomeric KIR genes. Overall, our results suggest that NGS can be used to investigate the broad KIR allelic polymorphism. Hence, these data improve our knowledge, not only on KIR+ NK cell alloreactivity in

  4. The genome of flax (Linum usitatissimum) assembled de novo from short shotgun sequence reads.

    Science.gov (United States)

    Wang, Zhiwen; Hobson, Neil; Galindo, Leonardo; Zhu, Shilin; Shi, Daihu; McDill, Joshua; Yang, Linfeng; Hawkins, Simon; Neutelings, Godfrey; Datla, Raju; Lambert, Georgina; Galbraith, David W; Grassa, Christopher J; Geraldes, Armando; Cronk, Quentin C; Cullis, Christopher; Dash, Prasanta K; Kumar, Polumetla A; Cloutier, Sylvie; Sharpe, Andrew G; Wong, Gane K-S; Wang, Jun; Deyholos, Michael K

    2012-11-01

    Flax (Linum usitatissimum) is an ancient crop that is widely cultivated as a source of fiber, oil and medicinally relevant compounds. To accelerate crop improvement, we performed whole-genome shotgun sequencing of the nuclear genome of flax. Seven paired-end libraries ranging in size from 300 bp to 10 kb were sequenced using an Illumina genome analyzer. A de novo assembly, comprised exclusively of deep-coverage (approximately 94× raw, approximately 69× filtered) short-sequence reads (44-100 bp), produced a set of scaffolds with N(50) =694 kb, including contigs with N(50)=20.1 kb. The contig assembly contained 302 Mb of non-redundant sequence representing an estimated 81% genome coverage. Up to 96% of published flax ESTs aligned to the whole-genome shotgun scaffolds. However, comparisons with independently sequenced BACs and fosmids showed some mis-assembly of regions at the genome scale. A total of 43384 protein-coding genes were predicted in the whole-genome shotgun assembly, and up to 93% of published flax ESTs, and 86% of A. thaliana genes aligned to these predicted genes, indicating excellent coverage and accuracy at the gene level. Analysis of the synonymous substitution rates (K(s) ) observed within duplicate gene pairs was consistent with a recent (5-9 MYA) whole-genome duplication in flax. Within the predicted proteome, we observed enrichment of many conserved domains (Pfam-A) that may contribute to the unique properties of this crop, including agglutinin proteins. Together these results show that de novo assembly, based solely on whole-genome shotgun short-sequence reads, is an efficient means of obtaining nearly complete genome sequence information for some plant species. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  5. Severe acute hepatitis and cold agglutinin-related hemolytic anemia secondary to prime infection with Epstein-Barr virus

    Directory of Open Access Journals (Sweden)

    Guillermo Ontanilla-Clavijo

    Full Text Available Epstein-Barr virus, a member of the Herpesviridae family, is responsible for the infectious mononucleosis clinical syndrome, which mainly includes the pharyngitis, fever, and lymphadenopathy triad after incubation for 30-50 days. The liver is involved in 80-90% of patients in a self-limiting transient manner, with jaundice being much more uncommon (5%. From a hematological standpoint it may manifest aplastic anemia, neutropenia, and thrombocytopenia. We report a case of infectious mononucleosis that included severe acute hepatitis and was associated with severe hemolytic anemia secondary to cold agglutinins. After exclusion of other etiologies, and given the clinical suspicion of the above association, which was later confirmed by lab tests, empiric therapy was initiated with antiviral agents (aciclovir + valganciclovir and corticoids, which resulted in a progressive clinical improvement until complete remission. Therefore, we believe that this case report will reinforce the clinical evidence in support of the above combined therapy for serious infectious mononucleosis as a step prior to liver transplantation.

  6. Specific binding of Ulex europaeus agglutinin I lectin to sarcolemma of distal myopathy with rimmed vacuole formation.

    Science.gov (United States)

    Yatabe, K; Kawai, M

    1997-08-01

    Ulex europaeus agglutinin I (UEA I) binding was studied in 83 patients with various neuromuscular disorders. UEA I labelled endomysial capillaries and endothelial cells of perimysial blood vessels in all the examined muscles. There was no UEA I binding to muscle fibres except for all (9) cases of distal myopathy with rimmed vacuole formation (DMRV), 1 of 5 cases of inclusion body myositis and 1 of 36 cases of inflammatory myopathies. The UEA I binding was completely eliminated by preincubation of UEA I solution with L-fucose. Using electron microscopy, the UEA I binding was localized to sarcolemma and intrasarco-plasmic membranous organelles other than mitochondria. Myosatellite cells were not labelled. These findings revealed the existence of fucosylated proteins or lipids in a subset of skeletal muscles suffering from DMRV. Biochemical identification of the fucosylated substance and further detailed study on subcellular localization of UEA I binding may yield important clues to the unknown pathogenesis of DMRV.

  7. Sequencing of the Litchi Downy Blight Pathogen Reveals It Is a Phytophthora Species With Downy Mildew-Like Characteristics.

    Science.gov (United States)

    Ye, Wenwu; Wang, Yang; Shen, Danyu; Li, Delong; Pu, Tianhuizi; Jiang, Zide; Zhang, Zhengguang; Zheng, Xiaobo; Tyler, Brett M; Wang, Yuanchao

    2016-07-01

    On the basis of its downy mildew-like morphology, the litchi downy blight pathogen was previously named Peronophythora litchii. Recently, however, it was proposed to transfer this pathogen to Phytophthora clade 4. To better characterize this unusual oomycete species and important fruit pathogen, we obtained the genome sequence of Phytophthora litchii and compared it to those from other oomycete species. P. litchii has a small genome with tightly spaced genes. On the basis of a multilocus phylogenetic analysis, the placement of P. litchii in the genus Phytophthora is strongly supported. Effector proteins predicted included 245 RxLR, 30 necrosis-and-ethylene-inducing protein-like, and 14 crinkler proteins. The typical motifs, phylogenies, and activities of these effectors were typical for a Phytophthora species. However, like the genome features of the analyzed downy mildews, P. litchii exhibited a streamlined genome with a relatively small number of genes in both core and species-specific protein families. The low GC content and slight codon preferences of P. litchii sequences were similar to those of the analyzed downy mildews and a subset of Phytophthora species. Taken together, these observations suggest that P. litchii is a Phytophthora pathogen that is in the process of acquiring downy mildew-like genomic and morphological features. Thus P. litchii may provide a novel model for investigating morphological development and genomic adaptation in oomycete pathogens.

  8. Calculation of Gibbs energy of Zr-Al-Ni, Zr-Al-Cu, Al-Ni-Cu and Zr-Al-Ni-Cu liquid alloys based on quasiregular solution model

    International Nuclear Information System (INIS)

    Li, H.Q.; Yang, Y.S.; Tong, W.H.; Wang, Z.Y.

    2007-01-01

    With the effects of electronic structure and atomic size being introduced, the mixing enthalpy as well as the Gibbs energy of the ternary Zr-Al-Cu, Ni-Al-Cu, Zr-Ni-Al and quaternary Zr-Al-Ni-Cu systems are calculated based on quasiregular solution model. The computed results agree well with the experimental data. The sequence of Gibbs energies of different systems is: G Zr-Al-Ni-Cu Zr-Al-Ni Zr-Al-Cu Cu-Al-Ni . To Zr-Al-Cu, Ni-Al-Cu and Zr-Ni-Al, the lowest Gibbs energy locates in the composition range of X Zr 0.39-0.61, X Al = 0.38-0.61; X Ni = 0.39-0.61, X Al = 0.38-0.60 and X Zr = 0.32-0.67, X Al = 0.32-0.66, respectively. And to the Zr-Ni-Al-Cu system with 66.67% Zr, the lowest Gibbs energy is obtained in the region of X Al = 0.63-0.80, X Ni = 0.14-0.24

  9. Burden of rare variants in ALS genes influences survival in familial and sporadic ALS.

    Science.gov (United States)

    Pang, Shirley Yin-Yu; Hsu, Jacob Shujui; Teo, Kay-Cheong; Li, Yan; Kung, Michelle H W; Cheah, Kathryn S E; Chan, Danny; Cheung, Kenneth M C; Li, Miaoxin; Sham, Pak-Chung; Ho, Shu-Leong

    2017-10-01

    Genetic variants are implicated in the development of amyotrophic lateral sclerosis (ALS), but it is unclear whether the burden of rare variants in ALS genes has an effect on survival. We performed whole genome sequencing on 8 familial ALS (FALS) patients with superoxide dismutase 1 (SOD1) mutation and whole exome sequencing on 46 sporadic ALS (SALS) patients living in Hong Kong and found that 67% had at least 1 rare variant in the exons of 40 ALS genes; 22% had 2 or more. Patients with 2 or more rare variants had lower probability of survival than patients with 0 or 1 variant (p = 0.001). After adjusting for other factors, each additional rare variant increased the risk of respiratory failure or death by 60% (p = 0.0098). The presence of the rare variant was associated with the risk of ALS (Odds ratio 1.91, 95% confidence interval 1.03-3.61, p = 0.03), and ALS patients had higher rare variant burden than controls (MB, p = 0.004). Our findings support an oligogenic basis with the burden of rare variants affecting the development and survival of ALS. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  10. Draft Genome Sequence of Leuconostoc mesenteroides 213M0, Isolated from Traditional Fermented Mare Milk Airag in Bulgan Aimag, Mongolia.

    Science.gov (United States)

    Morita, Hidetoshi; Toh, Hidehiro; Oshima, Kenshiro; Nakano, Akiyo; Hano, Chihiro; Yoshida, Saki; Bolormaa, Tsognemekh; Burenjargal, Sedkhuu; Nguyen, Co Thi Kim; Tashiro, Kosuke; Arakawa, Kensuke; Miyamoto, Taku

    2016-03-31

    Leuconostoc mesenteroides213M0 was isolated from traditional fermented mare milk airag in Bulgan Aimag, Mongolia. This strain produces a listericidal bacteriocin-like inhibitory substance. Here, we report the draft genome sequence of this organism. Copyright © 2016 Morita et al.

  11. Efficient KF loaded on MgCaAl hydrotalcite-like compounds in the transesterification of Jatropha curcas oil

    International Nuclear Information System (INIS)

    Guzmán-Vargas, Ariel; Santos-Gutiérrez, Teresa; Lima, Enrique; Flores-Moreno, Jorge L.; Oliver-Tolentino, Miguel A.; Martínez-Ortiz, María de J.

    2015-01-01

    Highlights: • MgCaAl hydrotalcite-like compounds were synthetized. • After KF impregnation and calcination fluorinated species were detected. • Fluorinated species were stables and actives. • LDH composition and KF load effect were evaluated in biodiesel production. - Abstract: In this work a series of MgCaAl hydrotalcite-like compounds were synthetized by coprecipitation method at constant pH. In order to obtain the catalysts, the samples were modified with KF by incipient wetness impregnation at different wt%, after that, they were dried and calcined to obtain the mixed oxides. The effect of divalent cations ratio and KF load were studied in the transesterification reaction of Jatropha curcas oil to obtain biodiesel employing an inedible oil. XRD analysis showed typical diffraction patterns of LDH, by nitrogen physisorption the LDH mesoporous structure was also confirmed, 27 Al NMR spectra showed bands at 10 and 88 ppm attributed to the Al coordination before and after thermal treatment. While for the impregnated samples after calcination the profiles exhibited the mixed oxide formation, in addition, another peaks appeared associated to the formation of various fluorinated species as shown by XRD, additionally, 19 F NMR showed a main signal at −180 ppm indicating the presence of active tetrahedral aluminum fluoride species. The reaction evolution was monitoring calculating the oil conversion to biodiesel by integration of the signal spectra using 1 H NMR spectroscopy. The results of catalytic tests in transesterification reaction showed a direct correlation between Mg/Ca ratio and KF content in the oil conversion to biodiesel, the higher conversion was achieved (90%) when Mg/Ca = 1 and KF load was 30 wt%

  12. Efficient KF loaded on MgCaAl hydrotalcite-like compounds in the transesterification of Jatropha curcas oil

    Energy Technology Data Exchange (ETDEWEB)

    Guzmán-Vargas, Ariel, E-mail: aguzmanv@ipn.mx [ESIQIE-IPN, Departamento de Ingeniería Química, Laboratorio de Investigación en Materiales Porosos, Catálisis Ambiental y Química Fina, UPALM Edif.7 P.B. Zacatenco, México D.F. 07738 (Mexico); Santos-Gutiérrez, Teresa [ESIQIE-IPN, Departamento de Ingeniería Química, Laboratorio de Investigación en Materiales Porosos, Catálisis Ambiental y Química Fina, UPALM Edif.7 P.B. Zacatenco, México D.F. 07738 (Mexico); Lima, Enrique [IIM-Universidad Nacional Autónoma de México, Circuito exterior s/n, Cd. Universitaria, 04510 México DF (Mexico); Flores-Moreno, Jorge L. [UAM-Azcapotzalco, Área de Química de Materiales, Av. San Pablo 180, Col. Reynosa Tamaulipas, 02200 México DF (Mexico); Oliver-Tolentino, Miguel A.; Martínez-Ortiz, María de J. [ESIQIE-IPN, Departamento de Ingeniería Química, Laboratorio de Investigación en Materiales Porosos, Catálisis Ambiental y Química Fina, UPALM Edif.7 P.B. Zacatenco, México D.F. 07738 (Mexico)

    2015-09-15

    Highlights: • MgCaAl hydrotalcite-like compounds were synthetized. • After KF impregnation and calcination fluorinated species were detected. • Fluorinated species were stables and actives. • LDH composition and KF load effect were evaluated in biodiesel production. - Abstract: In this work a series of MgCaAl hydrotalcite-like compounds were synthetized by coprecipitation method at constant pH. In order to obtain the catalysts, the samples were modified with KF by incipient wetness impregnation at different wt%, after that, they were dried and calcined to obtain the mixed oxides. The effect of divalent cations ratio and KF load were studied in the transesterification reaction of Jatropha curcas oil to obtain biodiesel employing an inedible oil. XRD analysis showed typical diffraction patterns of LDH, by nitrogen physisorption the LDH mesoporous structure was also confirmed, {sup 27}Al NMR spectra showed bands at 10 and 88 ppm attributed to the Al coordination before and after thermal treatment. While for the impregnated samples after calcination the profiles exhibited the mixed oxide formation, in addition, another peaks appeared associated to the formation of various fluorinated species as shown by XRD, additionally, {sup 19}F NMR showed a main signal at −180 ppm indicating the presence of active tetrahedral aluminum fluoride species. The reaction evolution was monitoring calculating the oil conversion to biodiesel by integration of the signal spectra using {sup 1}H NMR spectroscopy. The results of catalytic tests in transesterification reaction showed a direct correlation between Mg/Ca ratio and KF content in the oil conversion to biodiesel, the higher conversion was achieved (90%) when Mg/Ca = 1 and KF load was 30 wt%.

  13. Superplasticity-like deformation of a coarse-grained Al5052 alloy

    International Nuclear Information System (INIS)

    Chow, K.K.; Chan, K.C.

    2000-01-01

    In the present paper, hot forming properties of a commercially available coarse-grained Al5052 alloy under uniaxial and biaxial stress states were examined. In hot tensile tests, the alloy exhibits a superplastic-like behaviour with a maximum tensile elongation of 194% at a temperature of 873 K and at an initial strain rate of 2.08 x 10 -1 s -1 . Dislocation slip and grain boundary sliding were considered to be the deformation mechanisms. The alloy was also bulged at a constant polar strain-rate of 2.0 x 10 -1 s -1 and at an optimum temperature of 873 K using elliptical dies with aspect ratios of 1:1, 4:3, 2:1, 8:3 and 4:1. The strain distributions revealed that the strain gradient obtained in the minor axis was much greater than that in major axis. Moreover, it was shown that the deformation behavior of the alloy was basically isotropic and the volume strain of the alloy sheet did not equal to zero which was considered to relate to its cavitation behaviour. (orig.)

  14. Loss of metal ions, disulfide reduction and mutations related to familial ALS promote formation of amyloid-like aggregates from superoxide dismutase.

    Directory of Open Access Journals (Sweden)

    Zeynep A Oztug Durer

    Full Text Available Mutations in the gene encoding Cu-Zn superoxide dismutase (SOD1 are one of the causes of familial amyotrophic lateral sclerosis (FALS. Fibrillar inclusions containing SOD1 and SOD1 inclusions that bind the amyloid-specific dye thioflavin S have been found in neurons of transgenic mice expressing mutant SOD1. Therefore, the formation of amyloid fibrils from human SOD1 was investigated. When agitated at acidic pH in the presence of low concentrations of guanidine or acetonitrile, metalated SOD1 formed fibrillar material which bound both thioflavin T and Congo red and had circular dichroism and infrared spectra characteristic of amyloid. While metalated SOD1 did not form amyloid-like aggregates at neutral pH, either removing metals from SOD1 with its intramolecular disulfide bond intact or reducing the intramolecular disulfide bond of metalated SOD1 was sufficient to promote formation of these aggregates. SOD1 formed amyloid-like aggregates both with and without intermolecular disulfide bonds, depending on the incubation conditions, and a mutant SOD1 lacking free sulfhydryl groups (AS-SOD1 formed amyloid-like aggregates at neutral pH under reducing conditions. ALS mutations enhanced the ability of disulfide-reduced SOD1 to form amyloid-like aggregates, and apo-AS-SOD1 formed amyloid-like aggregates at pH 7 only when an ALS mutation was also present. These results indicate that some mutations related to ALS promote formation of amyloid-like aggregates by facilitating the loss of metals and/or by making the intramolecular disulfide bond more susceptible to reduction, thus allowing the conversion of SOD1 to a form that aggregates to form resembling amyloid. Furthermore, the occurrence of amyloid-like aggregates per se does not depend on forming intermolecular disulfide bonds, and multiple forms of such aggregates can be produced from SOD1.

  15. Complete genome sequence of Cryptobacterium curtum type strain (12-3T)

    Energy Technology Data Exchange (ETDEWEB)

    Mavromatis, Konstantinos; Pukall, Rudiger; Rohde, Christine; Sims, David; Brettin, Thomas; Kuske, Cheryl; Detter, John C.; Han, Cliff; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ovchinnikova, Galina; Pati, Amrita; Ivanova, Natalia; Chen, Amy; Palaniappan, Krishna; Chain, Patrick; D' haeseleer, Patrik; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Rohde, Manfred; Klenk, Hans-Peter; Kyrpides, Nikos C.

    2009-05-20

    Cryptobacterium curtum Nakazawa et al. 1999 is the type species of the genus, and is of phylogenetic interest because of its very distant and isolated position within the family Coriobacteriaceae. C. curtum is an asaccharolytic, opportunistic pathogen with a typical occurrence in the oral cavity, involved in dental and oral infections like periodontitis, inflammations and abscesses. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the actinobacterial family Coriobacteriaceae, and this 1,617,804 bp long single replicon genome with its 1364 protein-coding and 58 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  16. Effect of recombinant human insulin-like growth factor-I on progression of ALS. A placebo-controlled study. The North America ALS/IGF-I Study Group.

    Science.gov (United States)

    Lai, E C; Felice, K J; Festoff, B W; Gawel, M J; Gelinas, D F; Kratz, R; Murphy, M F; Natter, H M; Norris, F H; Rudnicki, S A

    1997-12-01

    The objective of this study was to investigate the safety and efficacy of recombinant human insulinlike growth factor-I (rhIGF-I) in the treatment of sporadic ALS. A double-blind, placebo-controlled, randomized study of 266 patients was conducted at eight centers in North America. Placebo or rhIGF-I (0.05 mg/kg/day or 0.10 mg/kg/day) was administered for 9 months. The primary outcome measure was disease symptom progression, assessed by the rate of change (per patient slope) in the Appel ALS rating scale total score. The Sickness Impact Profile (SIP), a patient-perceived, health-related quality of life assessment, was a secondary outcome variable. Progression of functional impairment in patients receiving high-dose (0.10 mg/kg/day) rhIGF-I was 26% slower than in patients receiving placebo (p = 0.01). The high-dose treatment group was less likely to terminate the study due to protocol-defined markers of disease symptom progression, and members in this group exhibited a slower decline in quality of life, as assessed by the SIP. Patients receiving 0.05 mg/kg/day of rhIGF-I exhibited trends similar to those associated with high-dose treatment, suggesting a dose-dependent response. The incidence of clinically significant adverse experiences was comparable among the three treatment groups. Recombinant human insulin-like growth factor-I slowed the progression of functional impairment and the decline in health-related quality of life in patients with ALS with no medically important adverse effects.

  17. Relativistic multireference many-body perturbation theory calculations on F-, Ne-, Na-, Mg-, Al-, Si- and P-like xenon ions

    International Nuclear Information System (INIS)

    Vilkas, Marius J; Ishikawa, Yasuyuki; Traebert, Elmar

    2006-01-01

    Many-body perturbation theory (MBPT) has been employed to calculate with high wavelength accuracy the extreme ultraviolet (EUV) spectra of F-like to P-like Xe ions. We discuss the reliability of the new calculations using the example of EUV beam-foil spectra of Xe, in which n = 3, Δn = 0 transitions of Na-, Mg-, Al- and Si-like ions have been found to dominate. A further comparison is made with spectra from an electron beam ion trap, that is, from a device with a very different (low density) excitation balance

  18. Exome sequencing in amyotrophic lateral sclerosis identifies risk genes and pathways

    NARCIS (Netherlands)

    Cirulli, Elizabeth T.; Lasseigne, Brittany N.; Petrovski, Slavé; Sapp, Peter C.; Dion, Patrick A.; Leblond, Claire S.; Couthouis, Julien; Lu, Yi-Fan; Wang, Quanli; Krueger, Brian J.; Ren, Zhong; Keebler, Jonathan; Han, Yujun; Levy, Shawn E.; Boone, Braden E.; Wimbish, Jack R.; Waite, Lindsay L.; Jones, Angela L.; Carulli, John P.; Day-Williams, Aaron G.; Staropoli, John F.; Xin, Winnie W.; Chesi, Alessandra; Raphael, Alya R.; McKenna-Yasek, Diane; Cady, Janet; de Jong, J. M. B. Vianney; Kenna, Kevin P.; Smith, Bradley N.; Topp, Simon; Miller, Jack; Gkazi, Athina; Al-Chalabi, Ammar; van den Berg, Leonard H.; Veldink, Jan; Silani, Vincenzo; Ticozzi, Nicola; Shaw, Christopher E.; Baloh, Robert H.; Appel, Stanley; Simpson, Ericka; Lagier-Tourenne, Clotilde; Pulst, Stefan M.; Gibson, Summer; Trojanowski, John Q.; Elman, Lauren; McCluskey, Leo; Grossman, Murray; Baas, Frank; ten Asbroek, Anneloor L. M. A.

    2015-01-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurological disease with no effective treatment. We report the results of a moderate-scale sequencing study aimed at increasing the number of genes known to contribute to predisposition for ALS. We performed whole-exome sequencing of 2869 ALS

  19. High pressure studies of A2Mo3O12 negative thermal expansion materials (A2=Al2, Fe2, FeAl, AlGa)

    International Nuclear Information System (INIS)

    Young, Lindsay; Gadient, Jennifer; Gao, Xiaodong; Lind, Cora

    2016-01-01

    High pressure powder X-ray diffraction studies of several A 2 Mo 3 O 12 materials (A 2 =Al 2 , Fe 2 , FeAl, and AlGa) were conducted up to 6–7 GPa. All materials adopted a monoclinic structure under ambient conditions, and displayed similar phase transition behavior upon compression. The initial isotropic compressibility first became anisotropic, followed by a small but distinct drop in cell volume. These patterns could be described by a distorted variant of the ambient pressure polymorph. At higher pressures, a distinct high pressure phase formed. Indexing results confirmed that all materials adopted the same high pressure phase. All changes were reversible on decompression, although some hysteresis was observed. The similarity of the high pressure cells to previously reported Ga 2 Mo 3 O 12 suggested that this material undergoes the same sequence of transitions as all materials investigated in this paper. It was found that the transition pressures for all phase changes increased with decreasing radius of the A-site cations. - Graphical abstract: Overlay of variable pressure X-ray diffraction data of Al 2 Mo 3 O 12 collected in a diamond anvil cell. Both subtle and discontinuous phase transitions are clearly observed. - Highlights: • The high pressure behavior of A 2 Mo 3 O 12 (A=Al, Fe, (AlGa), (AlFe)) was studied. • All compounds undergo the same sequence of pressure-induced phase transitions. • The phase transition pressures correlate with the average size of the A-site cation. • All transitions were reversible with hysteresis. • Previously studied Ga 2 Mo 3 O 12 undergoes the same sequence of transitions.

  20. Genome Sequence of Australian Indigenous Wine Yeast Torulaspora delbrueckii COFT1 Using Nanopore Sequencing.

    Science.gov (United States)

    Tondini, Federico; Jiranek, Vladimir; Grbin, Paul R; Onetto, Cristobal A

    2018-04-26

    Here, we report the first sequenced genome of an indigenous Australian wine isolate of Torulaspora delbrueckii using the Oxford Nanopore MinION and Illumina HiSeq sequencing platforms. The genome size is 9.4 Mb and contains 4,831 genes. Copyright © 2018 Tondini et al.

  1. Electrostatic Self-Assembly of Sandwich-Like CoAl-LDH/Polypyrrole/Graphene Nanocomposites with Enhanced Capacitive Performance.

    Science.gov (United States)

    Zhang, Yu; Du, Dongfeng; Li, Xuejin; Sun, Hongman; Li, Li; Bai, Peng; Xing, Wei; Xue, Qingzhong; Yan, Zifeng

    2017-09-20

    A novel sandwich-like composite with ultrathin CoAl-layered double hydroxide (LDH) nanoplates electrostatically assembled on both sides of two-dimensional polypyrrole/graphene (PG) substrate has been successfully fabricated using facile hydrothermal techniques. The PG not only serves as an excellent conductive and structural scaffold to enhance the transmission of electrons and prevent aggregation of CoAl-LDH nanoplates but also contributes to the enhancement of the specific capacitance. Owing to the homogeneous dispersion of CoAl-LDH nanoplates and its intimate interaction with PG substrate, the resulting CoAl-LDH/PG nanocomposite material exhibits excellent capacitive performance, for example, enhanced gravimetric specific capacitance (864 F g -1 at 1 A g -1 ), high rate performance (75% retention at 20 A g -1 ), and excellent cycle life (almost no degradation in supercapacitor performance after 5000 cycles) in aqueous KOH solution. Furthermore, the assembled asymmetric capacitor is able to deliver a superhigh energy density of 46.8 Wh kg -1 at 1.2 kW kg -1 and maintain 90.1% of its initial capacitance after 10 000 cycles. These results indicate a rational assembly strategy toward a high-performance pseudocapacitive electrode material with excellent rate performance, high specific capacitance, and outstanding cycle stability.

  2. Identification of microRNA-Like RNAs in the filamentous fungus Trichoderma reesei by solexa sequencing.

    Directory of Open Access Journals (Sweden)

    Kang Kang

    Full Text Available microRNAs (miRNAs are non-coding small RNAs (sRNAs capable of negatively regulating gene expression. Recently, microRNA-like small RNAs (milRNAs were discovered in several filamentous fungi but not yet in Trichoderma reesei, an industrial filamentous fungus that can secrete abundant hydrolases. To explore the presence of milRNA in T. reesei and evaluate their expression under induction of cellulose, two T. reesei sRNA libraries of cellulose induction (IN and non-induction (CON were generated and sequenced using Solexa sequencing technology. A total of 726 and 631 sRNAs were obtained from the IN and CON samples, respectively. Global expression analysis showed an extensively differential expression of sRNAs in T. reesei under the two conditions. Thirteen predicted milRNAs were identified in T. reesei based on the short hairpin structure analysis. The milRNA profiles obtained in deep sequencing were further validated by RT-qPCR assay. Computational analysis predicted a number of potential targets relating to many processes including regulation of enzyme expression. The presence and differential expression of T. reesei milRNAs imply that milRNA might play a role in T. reesei growth and cellulase induction. This work lays foundation for further functional study of fungal milRNAs and their industrial application.

  3. Identification and chromosomal distribution of copia-like retrotransposon sequences in the coffee (Coffea L. genome

    Directory of Open Access Journals (Sweden)

    Juan-Carlos Herrera

    2013-12-01

    Full Text Available The presence of copia-like transposable elements in seven coffee (Coffea sp. species, including the cultivated Coffea arabica, was investigated. The highly conserved domains of the reverse transcriptase (RT present in the copia retrotransposons were amplified by PCR using degenerated primers. Fragments of roughly 300 bp were obtained and the nucleotide sequence was determined for 36 clones, 19 of which showed good quality. The deduced amino acid sequences were compared by multiple alignment analysis. The data suggested two distinct coffee RT groups, designated as CRTG1 and CRTG2. The sequence identities among the groups ranged from 52 to 60% for CRTG1 and 74 to 85% for CRTG2. The multiple alignment analysis revealed that some of the clones in CRTG1 were closely related to the representative elements present in other plant species such as Brassica napus, Populus ciliata and Picea abis. Furthermore, the chromosomal localization of the RT domains in C. arabica and their putative ancestors was investigated by fluorescence in situ hybridization (FISH analysis. FISH signals were observed throughout the chromosomes following a similar dispersed pattern with some localized regions exhibiting higher concentrations of those elements, providing new evidence of their relative conservation and stability in the coffee genome

  4. Novel Au- and Ge-based two-dimensional materials formed through topotactic transitions of AlB2-like structures

    Science.gov (United States)

    Tsetseris, Leonidas

    2016-07-01

    The topotactic reaction of a layered compound, for example CaGe2, with HCl solution is a common and facile method to produce two-dimensional (2D) materials. In this work we demonstrate with first-principles calculations that this technique can potentially lead to a whole new family of 2D materials starting from three-dimensional crystals with AlB2-like structures. As representative cases, we show here that the de-intercalation of Sc and Ca atoms from ScAuGe and Ca2AuGe3 crystals is strongly exothermic and produces the stable 2D monolayers AuGeH and AuGe3H3, respectively. Remarkably, both metals (AuGeH) and semiconductors (AuGe3H3) can be prepared by this method. Based on the broad availability of AlB2-like structures with varying stoichiometries, there are several possibilities to prepare novel functional 2D materials with suitable topotactic transitions.

  5. Hydrodeoxygenation of furfuryl alcohol over Cu/MgAl and Cu/ZnAl catalysts derived from hydrotalcite-like precursors

    Directory of Open Access Journals (Sweden)

    Natalia Andrea Pino

    2017-01-01

    Full Text Available The aqueous phase hydrodeoxygenation (HDO of furfuryl alcohol over Cu/MgAl and Cu/ZnAl catalysts with different Mg/Al and Zn/Al molar ratios, were investigated. Mg-Al and Zn-Al mixed oxides derived from hydrotalcites precursors were used as supports, which were impregnated with an aqueous solution of copper nitrate by incipient wetness impregnation. The HDO reaction was carried out in a typical batch reactor at 5 MPa of H2 and 200 °C for 4 h. Among the catalysts studied, the Cu/MgAl-0.5 catalyst exhibited the higher furfuryl alcohol conversion (86% and yield of cyclopentanol (35%, which is the reaction product with the highest hydrogen-carbon (H/C ratio. With the Cu/MgAl-3 catalyst a high cyclopentanone yield (67% was achieved. The results obtained, showed that copper supported on mixed oxides catalysts derived from hydrotalcite precursors are a promising alternative to improve the bio-oil quality.

  6. Formation of AlFeSi phase in AlSi12 alloy with Ce addition

    Directory of Open Access Journals (Sweden)

    S. Kores

    2012-04-01

    Full Text Available The influence of cerium addition on the solidification sequence and microstructure constituents of the Al-Si alloys with 12,6 mass % Si was examined. The solidification was analyzed by a simple thermal analysis. The microstructures were examined with conventional light and scanning electron microscopy. Ternary AlSiCe phase was formed in the Al-Si alloys with added cerium during the solidification process. AlSiCe and β-AlFeSi phases solidified together in the region that solidified the last. Cerium addition influenced on the morphology of the α-AlFeSi phase solidification.

  7. Dynamic Sequence Assignment.

    Science.gov (United States)

    1983-12-01

    D-136 548 DYNAMIIC SEQUENCE ASSIGNMENT(U) ADVANCED INFORMATION AND 1/2 DECISION SYSTEMS MOUNTAIN YIELW CA C A 0 REILLY ET AL. UNCLSSIIED DEC 83 AI/DS...I ADVANCED INFORMATION & DECISION SYSTEMS Mountain View. CA 94040 84 u ,53 V,..’. Unclassified _____ SCURITY CLASSIFICATION OF THIS PAGE REPORT...reviews some important heuristic algorithms developed for fas- ter solution of the sequence assignment problem. 3.1. DINAMIC MOGRAMUNIG FORMULATION FOR

  8. Deposition and properties of Al-containing diamond-like carbon films by a hybrid ion beam sources

    International Nuclear Information System (INIS)

    Dai Wei; Wang Aiying

    2011-01-01

    Research highlights: → Weak carbide former, Al element, was incorporated into DLC films using a hybrid ion beams system comprising an anode-layer ion source and a magnetron sputtering unit. → The structure disorder of the films tended to decrease with Al atoms doping, which resulted in the distinct reduction of the film internal stress and hardness, but the internal stress dropped faster than the hardness. → The DLC films with low internal stress and high hardness can be acquired by Al incorporation. - Abstract: Metal incorporation is one of the most effective methods for relaxing internal stress in diamond-like carbon (DLC) films. It was reported that the chemical state of the incorporated metal atoms has a significant influence on the film internal stress. The doped atoms embedding in the DLC matrix without bonding with C atoms can reduce the structure disorder of the DLC films through bond angle distortion and thus relax the internal stress of the films. In present paper, Al atoms, which are inert to carbon, were incorporated into the DLC films deposited by a hybrid ion beams system comprising an anode-layer ion source and a magnetron sputtering unit. The film composition, microstructure and atomic bond structure were characterized using X-ray photoelectron spectroscopy, transmission electron microscopy and Raman spectroscopy. The internal stress, mechanical properties and tribogoical behavior were studied as a function of Al concentration using a stress-tester, nanoindentation and ball-on-disc tribo-tester, respectively. The results indicated that the incorporated Al atoms were dissolved in the DLC matrix without bonding with C atoms and the films exhibited the feature of amorphous carbon. The structure disorder of the films tended to decrease with Al atoms incorporation. This resulted in the distinct reduction of the internal stress in the films. All Al-DLC films exhibited a lower friction coefficient compared with pure DLC film. The formation of the

  9. Phase transformations, heat evolution, and atomic diffusion during slow heating of Al-rich Al/Zr multilayered foils

    Energy Technology Data Exchange (ETDEWEB)

    Fisher, Kaitlynn; Barron, S. C.; Knepper, R.; Weihs, T. P., E-mail: weihs@jhu.edu [Department of Materials Science and Engineering, Johns Hopkins University, Baltimore, Maryland 21218-2689 (United States); Bonds, M. A.; Browning, N. D. [Department of Chemical Engineering and Materials Science, University of California, Davis, California 95616 (United States); Condensed Matter and Materials Division, Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Livi, K. J. T. [High-Resolution Analytical Electron Microbeam Facility, Integrated Imaging Center, Johns Hopkins University, Baltimore, Maryland 21218 (United States); Campbell, G. H. [Condensed Matter and Materials Division, Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)

    2013-12-28

    We describe the energy and sequence of phase transformations in multilayered Al/Zr foils with atomic ratios of 3 Al:1 Zr during low temperature (<350 °C) heat treatments in a differential scanning calorimeter. The initial phase formed is an Al-rich amorphous phase that appears to grow by Zr diffusion through the amorphous phase. The subsequent nucleation and growth of tetragonal Al{sub 3}Zr along the Al/amorphous layer interface is mediated by Al diffusion through the crystalline intermetallic phase. Diffusion coefficients associated with these processes are higher than expected from reports of diffusivities measured at higher temperatures. The inferred heat of formation of the tetragonal Al{sub 3}Zr phase is 1240 ± 40 J/g (53 ± 2 kJ/mol atom). No anomalous variation in the energy or sequence of phase transformations is found with bilayer thickness for samples with bilayer thickness in the range of 17 nm to 90 nm despite anomalies in the bilayer dependence of self-propagating reaction velocities in the same foils.

  10. Complete genome sequence of N2-fixing model strain Klebsiella sp. nov. M5al, which produces plant cell wall-degrading enzymes and siderophores

    Directory of Open Access Journals (Sweden)

    Zhili Yu

    2018-03-01

    Full Text Available The bacterial strain M5al is a model strain for studying the molecular genetics of N2-fixation and molecular engineering of microbial production of platform chemicals 1,3-propanediol and 2,3-butanediol. Here, we present the complete genome sequence of the strain M5al, which belongs to a novel species closely related to Klebsiella michiganensis. M5al secretes plant cell wall-degrading enzymes and colonizes rice roots but does not cause soft rot disease. M5al also produces siderophores and contains the gene clusters for synthesis and transport of yersiniabactin which is a critical virulence factor for Klebsiella pathogens in causing human disease. We propose that the model strain M5al can be genetically modified to study bacterial N2-fixation in association with non-legume plants and production of 1,3-propanediol and 2,3-butanediol through degradation of plant cell wall biomass.

  11. Characterization of Al/Ni multilayers and their application in diffusion bonding of TiAl to TiC cermet

    International Nuclear Information System (INIS)

    Cao, J.; Song, X.G.; Wu, L.Z.; Qi, J.L.; Feng, J.C.

    2012-01-01

    The Al/Ni multilayers were characterized and diffusion bonding of TiAl intermetallics to TiC cermets was carried out using the multilayers. The microstructure of Al/Ni multilayers and TiAl/TiC cermet joint was investigated. The layered structures consisting of a Ni 3 (AlTi) layer, a Ni 2 AlTi layer, a (Ni,Al,Ti) layer and a Ni diffusion layer were observed from the interlayer to the TiAl substrate. Only one AlNi 3 layer formed at the multilayer/TiC cermet interface. The reaction behaviour of Al/Ni multilayers was characterized by means of differential scanning calorimeter (DSC) and X-ray diffraction. The initial exothermic peak of the DSC curve was formed due to the formation of Al 3 Ni and Al 3 Ni 2 phases. The reaction sequence of the Al/Ni multilayers was Al 3 Ni → Al 3 Ni 2 → AlNi → AlNi 3 and the final products were AlNi and AlNi 3 phases. The shear strength of the joint was tested and the experimental results suggested that the application of Al/Ni multilayers improved the joining quality. - Highlights: ► Diffusion bonding of TiAl to TiC cermet was realized using Al/Ni multilayer. ► The reaction sequence of the Al/Ni multilayers was Al 3 Ni → Al 3 Ni 2 → AlNi → AlNi 3 . ► The interfacial microstructure of the joint was clarified. ► The application of Al/Ni multilayers improved the joining quality.

  12. Endothelial markers in malignant vascular tumours of the liver: superiority of QB-END/10 over von Willebrand factor and Ulex europaeus agglutinin 1.

    Science.gov (United States)

    Anthony, P P; Ramani, P

    1991-01-01

    A new monoclonal antibody, QB-END/10, raised against the CD34 antigen in human endothelial cell membranes and haemopoietic progenitor cells, was studied for its usefulness as a marker of neoplastic vascular cells in 21 angiosarcomas and seven malignant haemangioendotheliomas of the liver. QB-END/10 was both more sensitive and more specific than Von Willebrand factor (VWF) and Ulex europaeus 1 agglutinin (UEA-1) in labelling endothelial cells and it did not cross react with epithelia as UEA-1 often does. Staining was uniformly strong and clear in all histological variants of these two tumours. QB-END/10 should prove particularly useful in the differential diagnosis of malignant vascular tumours of the liver.

  13. Learning of grammar-like visual sequences by adults with and without language-learning disabilities.

    Science.gov (United States)

    Aguilar, Jessica M; Plante, Elena

    2014-08-01

    Two studies examined learning of grammar-like visual sequences to determine whether a general deficit in statistical learning characterizes this population. Furthermore, we tested the hypothesis that difficulty in sustaining attention during the learning task might account for differences in statistical learning. In Study 1, adults with normal language (NL) or language-learning disability (LLD) were familiarized with the visual artificial grammar and then tested using items that conformed or deviated from the grammar. In Study 2, a 2nd sample of adults with NL and LLD were presented auditory word pairs with weak semantic associations (e.g., groom + clean) along with the visual learning task. Participants were instructed to attend to visual sequences and to ignore the auditory stimuli. Incidental encoding of these words would indicate reduced attention to the primary task. In Studies 1 and 2, both groups demonstrated learning and generalization of the artificial grammar. In Study 2, neither the NL nor the LLD group appeared to encode the words presented during the learning phase. The results argue against a general deficit in statistical learning for individuals with LLD and demonstrate that both NL and LLD learners can ignore extraneous auditory stimuli during visual learning.

  14. The N-terminal of a heparin-binding sperm membrane mitogen possess lectin-like sequence

    International Nuclear Information System (INIS)

    Mor, Visesato; Chatterjee, Tapati

    2007-01-01

    Glycosaminoglycans like heparin and heparin sulfate in follicular fluid induce changes in the intracellular environment during the spermatozoal functional maturation. We previously reported the isolation, purification and partial characterization of a heparin binding sperm membrane protein (HBSM). In the present study, the amino acids analysis provided evidence of a single sequence, which suggest the homogeneity of the purified HBSM. Fourteen amino acids- 1 A D T I V A V E L D T Y P N 14 -correspond to the amino terminal sequence of Concanavalin A (Con A) and contain 45.2% carbohydrate by weight. HBSM possess mitogenic property on lymphocytes with comparable magnitude to the well-known mitogen; Con A, inducing 83% radiolabel thymidine incorporation in growing lymphocytes. Unlike Con A, there was no agglutination of cell by HBSM upto 5 ng/ml concentration. Interestingly, we found that heparin and chondroitin sulfate-conjugated HBSM inhibit the proliferative activity. Similar effect was also found with an in-house isolate sulfated glycans; G-I (28% sulfate). In contrast, there was no inhibition by the desulfated form; G-ID. Altogether, our data suggest that the mechanism of cell proliferative pathway may be different for HBSM and Con A

  15. Table-like magnetocaloric effect in Gd56Ni15Al27Zr2 alloy and its field independence feature

    International Nuclear Information System (INIS)

    Agurgo Balfour, E.; Ma, Z.; Fu, H.; Wang, L.; Luo, Y.; Hadimani, R. L.; Jiles, D. C.; Wang, S. F.

    2015-01-01

    In order to obtain “table-like” magnetocaloric effect (MCE), multiple-phase Gd 56 Ni 15 Al 27 Zr 2 alloy was prepared by arc-melting followed by suck-casting method. Powder x-ray diffraction and calorimetric measurements reveal that the sample contains both glassy and crystalline phases. The fraction of the glassy phase is about 62%, estimated from the heat enthalpy of the crystallization. The crystalline phases, Gd 2 Al and GdNiAl further broadened the relatively wider magnetic entropy change (−ΔS M ) peak of the amorphous phase, which resulted in the table-like MCE over a maximum temperature range of 52.5 K to 77.5 K. The plateau feature of the MCE was found to be nearly independent of the applied magnetic field from 3 T to 5 T. The maximum −ΔS M value of the MCE platforms is 6.0 J/kg K under applied magnetic field change of 5 T. Below 3 T, the field independence of the table-like feature disappears. The relatively large constant values of −ΔS M for the respective applied magnetic fields have promising applications in magnetic refrigeration using regenerative Ericsson cycle

  16. Cyclic architecture of a carbonate sequence, early Aptian Shuaiba formation, Al Huwaisah field, Oman

    Energy Technology Data Exchange (ETDEWEB)

    Groetsch, J. (Shell Research, Rijswijk (Netherlands))

    1993-09-01

    Sequence stratigraphy of carbonates is a topic of ongoing controversy. In particular, small-scale shallowing-upward cycles can provide some key information needed for interpretation of carbonate sequences and/or third-order sea level changes. The early Aptian Shuaiba Formation in the Al Huwaisah field consists of about 90 m of shallow-water limestones. Throughout the formation, an overall decreasing influx of fine detritus is notable toward the top. The sequence can be subdivided into a basal unit and an overlying unit. Both units are composed of meter-scale shallowing-upward cycles of different composition, which can be recognized in core and well logs. Fourier analysis of the first principle component of a set of well logs (GR, FDC, CNL, Sonic) revealed an abrupt change in spectral behavior between the two units. Toward the top, the spectra are [open quotes]cleaning upward[close quotes] with an increasing pronunciation of a peak grouping of 1: 2: 5, suggesting a better preservation of orbital variations in the upper unit. Preservation of orbital forcing in shallowing-upward cycles requires rapid rates of sedimentation. In addition, increased shallow-water carbonate production on the platform is indicated by the appearance of reefal organisms. Hence, a higher rate of sedimentation and therefore a faster aggradation of the platform is inferred for the upper unit, which could have resulted from an increased rate of relative sea level rise. The sudden facies differentiation on the broad Arabian shelf in the upper part of the early Aptian reflects the development of an intrashelf basin. Changes in rate of relative sea level rise on the Arabian shelf might explain the repeated alternation from an easily correlatable ramp-type sedimentation, with slightly higher input of fine terrigenous sediment (e.g., lower unit of Shuaiba Formation) and a differentiation into platform and intrashelf basin facies due to faster aggradation (e.g., upper unit of Shuaiba Formation).

  17. Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining

    2013-08-01

    Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

  18. [The significance of Ulex europaeus agglutinin I lectin binding fibers in various muscular diseases].

    Science.gov (United States)

    Yatabe, K; Hiraguri, M; Sueishi, M; Takeuchi, M; Nonaka, I; Kawai, M

    1998-05-01

    In the present study, we have reported that Ulex europaeus agglutinin I (UEA I) lectin labeled muscle fibers in distal myopathy with rimmed vacuole formation (DMRV). UEA I binding to muscle fibers was also observed in a small number of biopsies with inflammatory myopathy, but not in other diseases, including neurogenic muscular atrophies and muscular dystrophies. In order to elucidate the relationship between this UEA I binding, rimmed vacuole formation and active autophagocytosis, we examined the UEA I binding fibers in other myopathies which frequently showed rimmed vacuoles, including adult onset acid maltase deficiency, oculo-pharyngo-distal type myopathy and oculopharyngeal muscular dystrophy. No UEA I lectin labeling fiber was observed in the diseases examined. We then studied UEA I binding behavior on 70 biopsies of inflammatory myopathy to characterize the clinical features of UEA I binding positive patients. UEA I binding fibers were observed in 3 of 28 patients (11%) with other collagen diseases, 11 of 36 (31%) without these disorders, and 2 of 6 (33%) with inclusion body myositis. There were no common clinical histories, complications or laboratory findings among the UEA I binding positive patients. In conclusion, a common process may exist between the muscle fiber degeneration in DMRV and subgroups of inflammatory myopathy patients, but the basic mechanism remains to be elucidated.

  19. [Enhancing effect of Ulex europaeus agglutinin I modified liposomes on oral insulin absorption in mice].

    Science.gov (United States)

    Zhang, Na; Ping, Qi-neng; Xu, Wen-fang

    2004-12-01

    To investigate the enhancing effect on insulin absorption through GI. tract in mice by using the Ulex europaeus agglutinin I (UEA1) modified liposomes as the carrier. UEA1 modified phosphatidylethanolamine (PE) was prepared by conjugating method of 1-ethyl-3-(3'-dimethylaminopropyl) carbodiimide (EDC), then the modified compound (PE-UEA1) was incorporated into the conventional liposomes of insulin to obtain UEA1 modified liposomes. The agglutination test was performed to examine the UEA1 biological activities after synthesis and modification. When liposomes were applied to healthy mice or diabetic mice at insulin dose of 350 u x kg(-1) orally, the hypoglycemic effect was investigated according to the blood glucose level determination. The blood glucose levels of the healthy mice reduced by UEA1 modified liposomes were (84 +/- 15)% at 4 h, (78 +/- 11)% at 8 h and (90 +/- 12)% at 12 h after oral administration. The conventional liposomes and saline showed no effect. The blood glucose levels of the diabetic mice reduced by UEA1 modified liposomes were (73 +/- 7)% at 4 h, (74 +/- 9)% at 8 h, (86 +/- 9)% at 12 h after oral administration. The UEA1 modified liposomes promote the oral absorption of insulin due to the specific-site combination on M cell membrane.

  20. Deoxygenation of palm kernel oil to jet fuel-like hydrocarbons using Ni-MoS_2/γ-Al_2O_3 catalysts

    International Nuclear Information System (INIS)

    Itthibenchapong, Vorranutch; Srifa, Atthapon; Kaewmeesri, Rungnapa; Kidkhunthod, Pinit; Faungnawakij, Kajornsak

    2017-01-01

    Highlights: • The Ni-MoS_2/γ-Al_2O_3 catalysts synthesized using thiourea solution processing. • The Ni-MoS_2 showed semi-amorphous crystallinity with crystallite size of 5–10 nm. • The Ni K-edge XANES and EXAFS indicated the Ni substitution in MoS_2 structure. • A high yield of jet fuel-like hydrocarbon (>90%) from the palm kernel oil feedstock. • The HDO pathway was highly selective, while the DCO_2 and DCO pathways were minor. - Abstract: In the current study, palm kernel oil was used as a renewable feedstock for production of jet fuel-like hydrocarbons via the deoxygenation over the Ni-MoS_2/γ-Al_2O_3 catalyst. The dominant C12 fatty acid content in palm kernel oil makes it promising for jet fuel application. Synthesized by a liquid processing method with thiourea organosulfur agent, the catalyst revealed MoS_2 structure with low stacking, while Ni substitution in the MoS_2 structure and interaction with the Al_2O_3 support were determined based on the Ni K-edge XANES and EXAFS results. A high hydrodeoxygenation (HDO) activity, which as the major pathway in the deoxygenation, was observed upon application of a H_2 pressure of 30–50 bar over Ni-MoS_2/γ-Al_2O_3. The optimum product yield of approximately 92% was obtained mainly from the HDO pathway (∼60%) with 58% selectivity to C10–C12 jet fuel hydrocarbons. The flow property of the jet fuel-like hydrocarbons was more desirable than those obtained from palm olein oil-derived fuel.

  1. RECONCILING THE OBSERVED STAR-FORMING SEQUENCE WITH THE OBSERVED STELLAR MASS FUNCTION

    International Nuclear Information System (INIS)

    Leja, Joel; Van Dokkum, Pieter G.; Franx, Marijn; Whitaker, Katherine E.

    2015-01-01

    We examine the connection between the observed star-forming sequence (SFR ∝ M α ) and the observed evolution of the stellar mass function in the range 0.2 < z < 2.5. We find that the star-forming sequence cannot have a slope α ≲ 0.9 at all masses and redshifts because this would result in a much higher number density at 10 < log (M/M ☉ ) < 11 by z = 1 than is observed. We show that a transition in the slope of the star-forming sequence, such that α = 1 at log (M/M ☉ ) < 10.5 and α = 0.7-0.13z (Whitaker et al.) at log (M/M ☉ ) > 10.5, greatly improves agreement with the evolution of the stellar mass function. We then derive a star-forming sequence that reproduces the evolution of the mass function by design. This star-forming sequence is also well described by a broken power law, with a shallow slope at high masses and a steep slope at low masses. At z = 2, it is offset by ∼0.3 dex from the observed star-forming sequence, consistent with the mild disagreement between the cosmic star formation rate (SFR) and recent observations of the growth of the stellar mass density. It is unclear whether this problem stems from errors in stellar mass estimates, errors in SFRs, or other effects. We show that a mass-dependent slope is also seen in other self-consistent models of galaxy evolution, including semianalytical, hydrodynamical, and abundance-matching models. As part of the analysis, we demonstrate that neither mergers nor hidden low-mass quiescent galaxies are likely to reconcile the evolution of the mass function and the star-forming sequence. These results are supported by observations from Whitaker et al

  2. Characterization of Al/Ni multilayers and their application in diffusion bonding of TiAl to TiC cermet

    Energy Technology Data Exchange (ETDEWEB)

    Cao, J., E-mail: cao_jian@hit.edu.cn [State Key Lab of Advanced Welding Production Technology, Harbin Institute of Technology, Harbin, 150001 (China); Center for Composite Materials and Structures, Harbin Institute of Technology, Harbin, 150001 (China); Song, X.G. [State Key Lab of Advanced Welding Production Technology, Harbin Institute of Technology, Harbin, 150001 (China); Wu, L.Z. [Center for Composite Materials and Structures, Harbin Institute of Technology, Harbin, 150001 (China); Qi, J.L.; Feng, J.C. [State Key Lab of Advanced Welding Production Technology, Harbin Institute of Technology, Harbin, 150001 (China)

    2012-02-29

    The Al/Ni multilayers were characterized and diffusion bonding of TiAl intermetallics to TiC cermets was carried out using the multilayers. The microstructure of Al/Ni multilayers and TiAl/TiC cermet joint was investigated. The layered structures consisting of a Ni{sub 3}(AlTi) layer, a Ni{sub 2}AlTi layer, a (Ni,Al,Ti) layer and a Ni diffusion layer were observed from the interlayer to the TiAl substrate. Only one AlNi{sub 3} layer formed at the multilayer/TiC cermet interface. The reaction behaviour of Al/Ni multilayers was characterized by means of differential scanning calorimeter (DSC) and X-ray diffraction. The initial exothermic peak of the DSC curve was formed due to the formation of Al{sub 3}Ni and Al{sub 3}Ni{sub 2} phases. The reaction sequence of the Al/Ni multilayers was Al{sub 3}Ni {yields} Al{sub 3}Ni{sub 2} {yields} AlNi {yields} AlNi{sub 3} and the final products were AlNi and AlNi{sub 3} phases. The shear strength of the joint was tested and the experimental results suggested that the application of Al/Ni multilayers improved the joining quality. - Highlights: Black-Right-Pointing-Pointer Diffusion bonding of TiAl to TiC cermet was realized using Al/Ni multilayer. Black-Right-Pointing-Pointer The reaction sequence of the Al/Ni multilayers was Al{sub 3}Ni {yields} Al{sub 3}Ni{sub 2} {yields} AlNi {yields} AlNi{sub 3}. Black-Right-Pointing-Pointer The interfacial microstructure of the joint was clarified. Black-Right-Pointing-Pointer The application of Al/Ni multilayers improved the joining quality.

  3. Temperature behavior of SNS-like Nb/Al-AlO x/Nb Josephson junctions

    International Nuclear Information System (INIS)

    Lacquaniti, V.; Andreone, D.; Maggi, S.; Rocci, R.; Sosso, A.; Steni, R.

    2006-01-01

    Overdamped Nb/Al-AlO x /Nb Josephson junctions are an intermediate state between the SIS and SNS Josephson junctions. Stable and reproducible non-hysteretic current-voltage characteristics have been obtained with a proper choice of the fabrication parameters, featuring critical current densities J c up to 25 kA/cm 2 and characteristic voltages up to 450 μV. While these values make the junctions interesting for RSFQ electronic circuits, their response to an RF signal at 70 GHz has demonstrated their suitability for both programmable and ac voltage standard. In these work we analyse the temperature behavior of these junctions up to T/T c = 1, T c being the niobium critical temperature, which gives relevant information on the junction structure and, especially, on the oxide insulator/metallic film barrier, which is the key for the reproducible transition from an hysteretic to a non-hysteretic behavior. The results are also compared with other data of hysteretic and overdamped junctions

  4. Complete Genome Sequence of a Recombinant NADC30-Like Strain, SCnj16, of Porcine Reproductive and Respiratory Syndrome Virus in Southwestern China

    Science.gov (United States)

    Kang, Runmin; Xie, Bo; Tian, Yiming; Yang, Xin; Yu, Jifeng

    2018-01-01

    ABSTRACT The NADC30-like strains of porcine reproductive and respiratory syndrome virus (PRRSV) are characterized by a 131-amino-acid deletion in nonstructural protein 2 (NSP2). Here, we report the complete genome sequence of a recombinant NADC30-like PRRSV strain, SCnj16, that exhibits the molecular marker of the Chinese highly pathogenic PRRSV (HP-PRRSV) in NSP2. PMID:29439029

  5. Near-Complete Genome Sequence of a Novel Single-Stranded RNA Virus Discovered in Indoor Air.

    Science.gov (United States)

    Rosario, Karyna; Fierer, Noah; Breitbart, Mya

    2018-03-22

    Viral metagenomic analysis of heating, ventilation, and air conditioning (HVAC) filters recovered the near-complete genome sequence of a novel virus, named HVAC-associated R NA v irus 1 (HVAC-RV1). The HVAC-RV1 genome is most similar to those of picorna-like viruses identified in arthropods but encodes a small domain observed only in negative-sense single-stranded RNA viruses. Copyright © 2018 Rosario et al.

  6. Yeast prions and human prion-like proteins: sequence features and prediction methods.

    Science.gov (United States)

    Cascarina, Sean M; Ross, Eric D

    2014-06-01

    Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis. This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms.

  7. Anchoring of ulex europaeus agglutinin to chitosan nanoparticles-in-microparticles and their in vitro binding activity to bovine submaxillary gland mucin.

    Science.gov (United States)

    Li, Feng-Qian; Fei, Yi-Bo; Chen, Xu; Qin, Xian-Ju; Liu, Ji-Yong; Zhu, Quan-Gang; Hu, Jin-Hong

    2009-10-01

    Focused on the natural biodegradable material of chitosan (CS), this investigation concerned its spray-dried nanoparticles-in-microparticles (NiMPs) modified with ulex europaeus agglutinin (UEA). Chitosan nanoparticles were obtained by ionotropic gelation process with pentasodium tripolyphosphate as gelatinizer. Then UEA lectin was bound onto the CS nanoparticles activated by glutaraldehyde. The conjugated spherical UEA-CS-NiMPs, prepared by spray drying method, exhibited 12-85% coupling efficiency of UEA depending upon the amount of activator glutaraldehyde. And the UEA-grafted particles showed additional higher binding tendency with bovine submaxillary gland mucin as compared to the plain chitosan microparticles. Furthermore, the activity and intrinsic fucose-specificity of UEA were still maintained after the covalent modification. It is thus evident that the UEA anchored CS-NiMPs might be used as a potential drug delivery system targeted to the specific regions of gastrointestinal tract.

  8. The formation mechanism of eutectic microstructures in NiAl-Cr composites.

    Science.gov (United States)

    Tang, Bin; Cogswell, Daniel A; Xu, Guanglong; Milenkovic, Srdjan; Cui, Yuwen

    2016-07-20

    NiAl-based eutectic alloys, consisting of an ordered bcc matrix (B2) and disordered bcc fibers (A2), have been a subject of intensive efforts aimed at tailoring the properties of many of the currently used nickel-based superalloys. A thermodynamic phase field model was developed on a thermodynamic foundation and fully integrated with a thermo-kinetic database of the Ni-Al-Cr ternary system to elucidate the resulting peculiar eutectic microstructure. Invoking a variation of the liquid/solid interfacial thickness with temperature, we simulated the characteristic sunflower-like eutectic microstructures in the NiAl-Cr composites, consistent with experimental observations. The mechanism that governs the formation of the peculiar eutectic morphology was envisioned from the modeled evolutions associated with six sequential steps. Our calculations show that the conditional spinodal decomposition occurring in sequence could further trim and revise the microstructure of the eutectics by generating fine-domain structures, thereby providing an additional method to explore the novel NiAl-based eutectic composites with tunable properties at elevated temperatures.

  9. Early stages of interface reactions between AlN and Ti thin films

    CERN Document Server

    Pinkas, M; Froumin, N; Pelleg, J; Dariel, M P

    2002-01-01

    The early stages of interface reactions between AlN and Ti thin films were investigated using x-ray diffractions, Auger electron spectroscopy, cross section transmission electron microscopy (XTEM), and high resolution XTEM. The AlN/Ti bilayers were deposited on a molybdenum substrate using reactive and nonreactive magnetron sputtering techniques. After deposition, the bilayers were heat treated for 1-10 h at 600 deg. C in a nitrogen atmosphere. Decomposition of the AlN layer took place at the AlN/Ti interface and its products, Al and N, reacted with Ti to produce a AlN/Al sub 3 Ti/Ti sub 2 N/Ti sub 3 Al/alpha-(Ti, Al)ss phase sequence. This phase sequence is not consistent with the Ti-Al-N phase diagram and is believed to be the outcome of the particular conditions that prevail in the thin film and correspond to a particular set of kinetic parameters. A model that explains the development of the phase sequence and predicts its evolution after prolonged heat treatments is put forward. The applicability of such...

  10. Rambutan-like CNT-Al2O3 scaffolds for high-performance cathode catalyst layers of polymer electrolyte fuel cells

    Science.gov (United States)

    Chang, KwangHyun; Cho, Seonghun; Lim, Eun Ja; Park, Seok-Hee; Yim, Sung-Dae

    2018-03-01

    Rambutan-like CNT-Al2O3 scaffolds are introduced as a potential candidate for CNT-based catalyst supports to overcome the CNT issues, such as the easy bundling in catalyst ink and the poor pore structure of the CNT-based catalyst layers, and to achieve high MEA performance in PEFCs. Non-porous α-phase Al2O3 balls are introduced to enable the growth of multiwalled CNTs, and Pt nanoparticles are loaded onto the CNT surfaces. In a half-cell, the Pt/CNT-Al2O3 catalyst shows much higher durability than those of a commercial Pt/C catalyst even though it shows lower oxygen reduction reaction (ORR) activity than Pt/C. After using the decal process for MEA formation, the Pt/CNT-Al2O3 shows comparable initial performance characteristics to Pt/C, overcoming the lower ORR activity, mainly due to the facile oxygen transport in the cathode catalyst layers fabricated with the CNT-Al2O3 scaffolds. The Pt/CNT-Al2O3 also exhibits much higher durability against carbon corrosion than Pt/C owing to the durable characteristics of CNTs. Systematic analysis of single cell performance for both initial and after degradation is provided to understand the origin of the high initial performance and durable behavior of Pt/CNT-Al2O3-based catalyst layers. This will provide insights into the design of electrocatalysts for high-performance MEAs in PEFCs.

  11. Defining carbohydrate specificity of Ricinus communis agglutinin as Gal beta 1-->4GlcNAc (II) > Gal beta 1-->3GlcNAc (I) > Gal alpha 1-->3Gal (B) > Gal beta 1-->3GalNAc (T).

    Science.gov (United States)

    Wu, J H; Herp, A; Wu, A M

    1993-03-01

    To define carbohydrate specificity of Ricinus communis agglutinin (RCA1), the combining site of RCA1 was further characterized by quantitative precipitin (QPA) and precipitin-inhibition assays (QPIA). Among the oligosaccharides tested for QPIA, Gal beta 1-->4GlcNAc (II, human blood group type II precursor sequence) was found to be 7.1 times more active than Gal beta 1-->3GalNAc (T, Thomsen-Friedenreich sequence) and about 1.7 times more active than the other three disaccharides tested--Gal beta 1-->4Man, Gal beta 1-->3DAra and Gal beta 1-->6GalNAc. Gal alpha 1-->4Gal, the receptor of the uropathogenic E. coli ligand was 3.6 times less active than the II sequence. These results indicate that the beta 1-->4 linkage of the terminal Gal to subterminal GlcNAc is important as this beta 1-->4GlcNAc sequence is at least 1.6 times more active than other types of disaccharides. Among the glycoproteins examined for QPA, native and desialized bovine submandibular glycoproteins, native and desialized human plasma alpha 1-acid glycoproteins, as well as crude hog stomach mucin and its three mild acid hydrolyzed products reacted well with the lectin. These glycoproteins precipitated over 75% of the lectin nitrogen added indicating that RCA1 has the ability to recognize Gal beta 1-->4/3GlcNAc and/or the related residues at the non-reducing ends and at positions in the interior of the chains. However, Tn (GalNAc alpha 1-->Ser/Thr sequence) rich glycoproteins such as desialized ovine submandibular glycoprotein and desialized armadillo salivary glycoprotein, in which over 90% of the carbohydrate side chains are Tn determinants with none or only a trace of I/II or T determinants, precipitated poorly with RCA1. From the present and previous results obtained, the carbohydrate specificity of RCA1 can be constructed and summarized in decreasing order by lectin determinants as follows: II (Gal beta 1-->4GlcNAc) > I (Gal beta 1-->3GlcNAc) > E (Gal alpha 1-->4Gal) and B (Gal alpha 1-->3Gal

  12. Static multiplicities in heterogeneous azeotropic distillation sequences

    DEFF Research Database (Denmark)

    Esbjerg, Klavs; Andersen, Torben Ravn; Jørgensen, Sten Bay

    1998-01-01

    In this paper the results of a bifurcation analysis on heterogeneous azeotropic distillation sequences are given. Two sequences suitable for ethanol dehydration are compared: The 'direct' and the 'indirect' sequence. It is shown, that the two sequences, despite their similarities, exhibit very...... different static behavior. The method of Petlyuk and Avet'yan (1971), Bekiaris et al. (1993), which assumes infinite reflux and infinite number of stages, is extended to and applied on heterogeneous azeotropic distillation sequences. The predictions are substantiated through simulations. The static sequence...

  13. Perfil dos cães sororreagentes para aglutininas anti-Leptospira interrogans em Belo Horizonte, Minas Gerais, 2001/2002 Serological profile of seropositive dogs to anti-Leptospira interrogans agglutinins in Belo Horizonte, Minas Gerais, Brazil, 2001-2002

    Directory of Open Access Journals (Sweden)

    D.F. Magalhães

    2007-10-01

    Full Text Available The serological profile of seropositive dogs according to anti-Leptospira agglutinins was checked in Belo Horizonte including variables such as race, sex, age and whether the dog had an owner or not. The dogs were captured by the Zoonosis Control Center in nine neighborhoods around the city and were separated in two categories - with owners or captured on the streets. The prevalence of anti-Leptospira agglutinins was evaluated in 3,417 blood samples using the microscopic agglutination test (MAT from September 2001 to September 2002. It was found that 13.1% of the dogs had seropositive results with the most reactive serovars being Canicola (7.0%, Ballum (6.1%, Pyrogenes (3.2% and Icterohaemorrhagiae (2.9%. The prevalence of other serovars was less than 1.0%. Greater prevalence was found in male, crossbred dogs, without owners. There were no significant results due to age in 95% (P=0.808 of the cases. According to the results, more research should be done in order to isolate and classify the serovars in positive dogs, especially Ballum and Pyrogenes, which will suggest their inclusion in the commercial vaccines against leptospira used in dogs in this city.

  14. A united refinement technology for commercial pure Al by Al-10Ti and Al-Ti-C master alloys

    International Nuclear Information System (INIS)

    Ma Xiaoguang; Liu Xiangfa; Ding Haimin

    2009-01-01

    Because flake-like TiAl 3 particles in Al-Ti-C master alloys prepared in a melt reaction method dissolve slowly when they are added into Al melt at 720 deg. C, Ti atoms cannot be released rapidly to play the assistant role of grain refinement, leading to a poor refinement efficiency of Al-Ti-C master alloys. A united refinement technology by Al-10Ti and Al-Ti-C master alloys was put forward in this paper. The rational combination of fine blocky TiAl 3 particles in Al-10Ti and TiC particles in Al-Ti-C can improve the nucleation rate of α-Al. It not only improves the grain refinement efficiency of Al-Ti-C master alloys, but also reduces the consumption

  15. TCS: a web server for multiple sequence alignment evaluation and phylogenetic reconstruction.

    Science.gov (United States)

    Chang, Jia-Ming; Di Tommaso, Paolo; Lefort, Vincent; Gascuel, Olivier; Notredame, Cedric

    2015-07-01

    This article introduces the Transitive Consistency Score (TCS) web server; a service making it possible to estimate the local reliability of protein multiple sequence alignments (MSAs) using the TCS index. The evaluation can be used to identify the aligned positions most likely to contain structurally analogous residues and also most likely to support an accurate phylogenetic reconstruction. The TCS scoring scheme has been shown to be accurate predictor of structural alignment correctness among commonly used methods. It has also been shown to outperform common filtering schemes like Gblocks or trimAl when doing MSA post-processing prior to phylogenetic tree reconstruction. The web server is available from http://tcoffee.crg.cat/tcs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Structural comparisons of two allelic variants of human placental alkaline phosphatase.

    Science.gov (United States)

    Millán, J L; Stigbrand, T; Jörnvall, H

    1985-01-01

    A simple immunosorbent purification scheme based on monoclonal antibodies has been devised for human placental alkaline phosphatase. The two most common allelic variants, S and F, have similar amino acid compositions with identical N-terminal amino acid sequences through the first 13 residues. Both variants have identical lectin binding properties towards concanavalin A, lentil-lectin, wheat germ agglutinin, phytohemagglutinin and soybean agglutinin, and identical carbohydrate contents as revealed by methylation analysis. CNBr fragments of the variants demonstrate identical high performance liquid chromatography patterns. The carbohydrate containing fragment is different from the 32P-labeled active site fragment and the N-terminal fragment.

  17. Chlamydia trachomatis Mip-like protein

    DEFF Research Database (Denmark)

    Lundemose, AG; Rousch, DA; Birkelund, Svend

    1992-01-01

    A 27 kDa Chlamydia trachomatis Mip-like protein with homology of a 175-amino-acid C-terminal fragment to the surface-exposed Legionella pneumophila mip-gene product has previously been described. In this paper the entire chlamydia Mip-like sequence of C. trachomatis serovar L2 (lymphogranuloma...... venereum (LGV) biovar) is presented. The sequence shows high similarity to the legionella Mip protein and its C-terminal region, like that of the legionella Mip, has high amino acid similarity to eukaryotic and prokaryotic FK506-binding proteins. The chlamydial mip-like gene was detected by polymerase...... chain reaction (PCR) in other C. trachomatis serovars and by sequencing of the mip-like genes of serovars B and E (trachoma biovar) was shown to be highly conserved within the two major biovars of C. trachomatis. Monoclonal and polyclonal antibodies raised against the recombinant Mip-like protein failed...

  18. Calculations for energies, transition rates, and lifetimes in Al-like Kr XXIV

    Science.gov (United States)

    Zhang, C. Y.; Si, R.; Liu, Y. W.; Yao, K.; Wang, K.; Guo, X. L.; Li, S.; Chen, C. Y.

    2018-05-01

    Using the second-order many-body perturbation theory (MBPT) method, a complete and accurate data set of excitation energies, lifetimes, wavelengths, and electric dipole (E1), magnetic dipole (M1), electric quadrupole (E2), and magnetic quadrupole (M2) line strengths, transition rates, and oscillator strengths for the lowest 880 levels arising from the 3l3 (0 ≤ l ≤ 2), 3l2 4l‧ (0 ≤ l ≤ 2, 0 ≤l‧ ≤ 3), 3s2 5 l (0 ≤ l ≤ 4), 3p2 5 l (0 ≤ l ≤ 1), and 3s3p5 l (0 ≤ l ≤ 4) configurations in Al-like Kr XXIV is provided. Comparisons are made with available experimental and theoretical results. Our calculated energies are expected to be accurate enough to facilitate identifications of observed lines involving the n = 4 , 5 levels. The complete data set is also useful for modeling and diagnosing fusion plasma.

  19. The Staphylococcus aureus α-Acetolactate Synthase ALS Confers Resistance to Nitrosative Stress

    Directory of Open Access Journals (Sweden)

    Sandra M. Carvalho

    2017-07-01

    Full Text Available Staphylococcus aureus is a worldwide pathogen that colonizes the human nasal cavity and is a major cause of respiratory and cutaneous infections. In the nasal cavity, S. aureus thrives with high concentrations of nitric oxide (NO produced by the innate immune effectors and has available for growth slow-metabolizing free hexoses, such as galactose. Here, we have used deep sequencing transcriptomic analysis (RNA-Seq and 1H-NMR to uncover how S. aureus grown on galactose, a major carbon source present in the nasopharynx, survives the deleterious action of NO. We observed that, like on glucose, S. aureus withstands high concentrations of NO when using galactose. Data indicate that this resistance is, most likely, achieved through a distinct metabolism that relies on the increased production of amino acids, such as glutamate, threonine, and branched-chain amino acids (BCAAs. Moreover, we found that under NO stress the S. aureus α-acetolactate synthase (ALS enzyme, which converts pyruvate into α-acetolactate, plays an important role. ALS is proposed to prevent intracellular acidification, to promote the production of BCAAs and the activation of the TCA cycle. Additionally, ALS is shown to contribute to the successful infection of murine macrophages. Furthermore, ALS contributes to the resistance of S. aureus to beta-lactam antibiotics such as methicillin and oxacillin.

  20. Functional analysis of bipartite begomovirus coat protein promoter sequences

    International Nuclear Information System (INIS)

    Lacatus, Gabriela; Sunter, Garry

    2008-01-01

    We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters

  1. Microstructure and property of diamond-like carbon films with Al and Cr co-doping deposited using a hybrid beams system

    International Nuclear Information System (INIS)

    Dai, Wei; Liu, Jingmao; Geng, Dongsen; Guo, Peng; Zheng, Jun; Wang, Qimin

    2016-01-01

    Highlights: • Diamond-like carbon films with Al and Cr doping were deposited. • Alternate multilayered structure consisted of Al-poor layer and Al-rich layer was formed. • The periodic Al-rich layers can greatly improve the residual stress and elastic resilience of the films. - Abstract: DLC films with weak carbide former Al and carbide former Cr co-doping (Al:Cr-DLC) were deposited by a hybrid beams system comprising an anode-layer linear ion beam source (LIS) and high power impulse magnetron sputtering using a gas mixture of C 2 H 2 and Ar as the precursor. The doped Al and Cr contents were controlled via adjusting the C 2 H 2 fraction in the gas mixture. The composition, microstructure, compressive stress, mechanical properties and tribological behaviors of the Al:Cr-DLC films were researched carefully using X-ray photoelectron spectroscopy, transmission electron microscopy, Raman spectroscopy, stress-tester, nanoindentation and ball-on-plate tribometer as function of the C 2 H 2 fraction. The results show that the Al and Cr contents in the films increased continuously as the C 2 H 2 fraction decreased. The doped Cr atoms preferred to bond with the carbon while the Al atoms mainly existed in metallic state. Structure modulation with alternate multilayer consisted of Al-poor DLC layer and Al-rich DLC layer was found in the films. Those periodic Al-rich DLC layers can effectively release the residual stress of the films. On the other hand, the formation of the carbide component due to Cr incorporation can help to increase the film hardness. Accordingly, the residual stress of the DLC films can be reduced without sacrificing the film hardness though co-doping Al and Cr atoms. Furthermore, it was found that the periodic Al-rich layer can greatly improve the elastic resilience of the DLC films and thus decreases the film friction coefficient and wear rate significantly. However, the existence of the carbide component would cause abrasive wear and thus

  2. A united refinement technology for commercial pure Al by Al-10Ti and Al-Ti-C master alloys

    Energy Technology Data Exchange (ETDEWEB)

    Ma Xiaoguang [Key Laboratory of Liquid Structure and Heredity of Materials, Ministry of Education, Shandong University, Jinan 250061 (China); Liu Xiangfa [Key Laboratory of Liquid Structure and Heredity of Materials, Ministry of Education, Shandong University, Jinan 250061 (China)], E-mail: xfliu@sdu.edu.cn; Ding Haimin [Key Laboratory of Liquid Structure and Heredity of Materials, Ministry of Education, Shandong University, Jinan 250061 (China)

    2009-03-05

    Because flake-like TiAl{sub 3} particles in Al-Ti-C master alloys prepared in a melt reaction method dissolve slowly when they are added into Al melt at 720 deg. C, Ti atoms cannot be released rapidly to play the assistant role of grain refinement, leading to a poor refinement efficiency of Al-Ti-C master alloys. A united refinement technology by Al-10Ti and Al-Ti-C master alloys was put forward in this paper. The rational combination of fine blocky TiAl{sub 3} particles in Al-10Ti and TiC particles in Al-Ti-C can improve the nucleation rate of {alpha}-Al. It not only improves the grain refinement efficiency of Al-Ti-C master alloys, but also reduces the consumption.

  3. Testing Scaling Relations for Solar-like Oscillations from the Main Sequence to Red Giants Using Kepler Data

    DEFF Research Database (Denmark)

    Huber, D.; Bedding, T.R.; Stello, D.

    2011-01-01

    ), and oscillation amplitudes. We show that the difference of the Δν-νmax relation for unevolved and evolved stars can be explained by different distributions in effective temperature and stellar mass, in agreement with what is expected from scaling relations. For oscillation amplitudes, we show that neither (L/M) s......We have analyzed solar-like oscillations in ~1700 stars observed by the Kepler Mission, spanning from the main sequence to the red clump. Using evolutionary models, we test asteroseismic scaling relations for the frequency of maximum power (νmax), the large frequency separation (Δν...... scaling nor the revised scaling relation by Kjeldsen & Bedding is accurate for red-giant stars, and demonstrate that a revised scaling relation with a separate luminosity-mass dependence can be used to calculate amplitudes from the main sequence to red giants to a precision of ~25%. The residuals show...

  4. Phylogenetic position of the yeast-like symbiotes of Tagosodes orizicolus (Homoptera: Delphacidae based on 18S ribosomal DNA partial sequences

    Directory of Open Access Journals (Sweden)

    Ana M Xet-Mull

    2004-09-01

    Full Text Available Tagosodes orizicolus Muir (Homoptera: Delphacidae, the endemic delphacid species of tropical America carries yeast-like symbiotes (YLS in the abdominal fat bodies and the ovarial tissues, like other rice planthoppers of Asia. These YLS are obligate symbiotes, which are transmitted transovarially, and maintain a mutualistic relationship with the insect host. This characteristic has made in vitro culture and classification of YLS rather difficult using conventional methods. Nevertheless, microorganisms of similar characteristics have been successfully classified by using molecular taxonomy. In the present work, the YLS of Tagosodes orizicolus(YLSTo were purified on Percoll® gradients, and specific segments of 18S rDNA were amplified by PCR, cloned and sequenced. Sequences were aligned by means of the CLUSTAL V (DNASTAR program; phylogenetic trees were constructed with the Phylogeny Inference Package (PHYLIP, showing that YLSTo belong to the fungi class Pyrenomycetes, phylum Ascomycota. Similarities between 98% and 100% were observed among YLS of the rice delphacids Tagosodes orizicolus, Nilaparvata lugens, Laodelphax striatellus and Sogatella furcifera, and between 89.8% and 90.8% when comparing the above to YLS of the aphid Hamiltonaphis styraci. These comparisons revealed that delphacid YLS are a highly conserved monophyletic group within the Pyrenomycetes and are closely related to Hypomyces chrysospermus. Rev. Biol. Trop. 52(3: 777-785. Epub 2004 Dic 15.Tagosodes orizicolus Muir (Homoptera: Delphacidae es una especie endémica de América tropical que al igual que otros saltahojas de Asia, tiene simbiontes levaduriformes (YLS, por sus siglas en Inglés en los cuerpos grasos del abdomen y en los tejidos de los ovarios. Los YLS son simbiontes obligados que se transmiten transovarialmente y que mantienen relaciones mutualística con el insecto hospedero. Esta característica ha hecho muy difícil su cultivo in vitro y por ende su clasificaci

  5. Deciphering the mode of action of a mutant Allium sativum Leaf Agglutinin (mASAL), a potent antifungal protein on Rhizoctonia solani.

    Science.gov (United States)

    Ghosh, Prithwi; Roy, Amit; Hess, Daniel; Ghosh, Anupama; Das, Sampa

    2015-10-26

    Mutant Allium sativum leaf agglutinin (mASAL) is a potent, biosafe, antifungal protein that exhibits fungicidal activity against different phytopathogenic fungi, including Rhizoctonia solani. The effect of mASAL on the morphology of R.solani was monitored primarily by scanning electron and light microscopic techniques. Besides different fluorescent probes were used for monitoring various intracellular changes associated with mASAL treatment like change in mitochondrial membrane potential (MMP), intracellular accumulation of reactive oxygen species (ROS) and induction of programmed cell death (PCD). In addition ligand blot followed by LC-MS/MS analyses were performed to detect the putative interactors of mASAL. Knowledge on the mode of function for any new protein is a prerequisite for its biotechnological application. Detailed morphological analysis of mASAL treated R. solani hyphae using different microscopic techniques revealed a detrimental effect of mASAL on both the cell wall and the plasma membrane. Moreover, exposure to mASAL caused the loss of mitochondrial membrane potential (MMP) and the subsequent intracellular accumulation of reactive oxygen species (ROS) in the target organism. In conjunction with this observation, evidence of the induction of programmed cell death (PCD) was also noted in the mASAL treated R. solani hyphae. Furthermore, we investigated its interacting partners from R. solani. Using ligand blots followed by liquid chromatography tandem mass spectrometry (LC-MS/MS) analyses, we identified different binding partners including Actin, HSP70, ATPase and 14-3-3 protein. Taken together, the present study provides insight into the probable mode of action of the antifungal protein, mASAL on R. solani which could be exploited in future biotechnological applications.

  6. MIPS: a database for genomes and protein sequences.

    Science.gov (United States)

    Mewes, H W; Frishman, D; Güldener, U; Mannhaupt, G; Mayer, K; Mokrejs, M; Morgenstern, B; Münsterkötter, M; Rudd, S; Weil, B

    2002-01-01

    The Munich Information Center for Protein Sequences (MIPS-GSF, Neuherberg, Germany) continues to provide genome-related information in a systematic way. MIPS supports both national and European sequencing and functional analysis projects, develops and maintains automatically generated and manually annotated genome-specific databases, develops systematic classification schemes for the functional annotation of protein sequences, and provides tools for the comprehensive analysis of protein sequences. This report updates the information on the yeast genome (CYGD), the Neurospora crassa genome (MNCDB), the databases for the comprehensive set of genomes (PEDANT genomes), the database of annotated human EST clusters (HIB), the database of complete cDNAs from the DHGP (German Human Genome Project), as well as the project specific databases for the GABI (Genome Analysis in Plants) and HNB (Helmholtz-Netzwerk Bioinformatik) networks. The Arabidospsis thaliana database (MATDB), the database of mitochondrial proteins (MITOP) and our contribution to the PIR International Protein Sequence Database have been described elsewhere [Schoof et al. (2002) Nucleic Acids Res., 30, 91-93; Scharfe et al. (2000) Nucleic Acids Res., 28, 155-158; Barker et al. (2001) Nucleic Acids Res., 29, 29-32]. All databases described, the protein analysis tools provided and the detailed descriptions of our projects can be accessed through the MIPS World Wide Web server (http://mips.gsf.de).

  7. The salivary scavenger and agglutinin (SALSA binds MBL and regulates the lectin pathway of complement in solution and on surfaces

    Directory of Open Access Journals (Sweden)

    Martin eParnov Reichhardt

    2012-07-01

    Full Text Available The scavenger receptor cysteine-rich (SRCR protein SALSA, also known as gp340, salivary agglutinin (SAG and deleted in malignant brain tumor 1 (DMBT1, is a 340 kDa glycoprotein expressed on mucosal surfaces and secreted into several body fluids. SALSA binds to a broad variety of microbes and endogenous ligands, such as complement factor C1q, surfactant proteins D and A (SP-D and SP-A and IgA. Our search for novel ligands of SALSA by direct protein-interaction studies led to the identification of mannan binding lectin (MBL as a new binding partner. We observed that surface-associated SALSA activates complement via binding of MBL. On the other hand, soluble SALSA was found to inhibit C. albicans-induced complement activation. Thus, SALSA has a dual complement regulatory function. It activates the lectin pathway when bound to a surface and inhibits it when free in the fluid-phase. These activities are mediated via a direct interaction with MBL.

  8. Lectin Histochemical Study of Cell Surface Glycoconjugate in Gastric Carcinoma Using Helix Pomatia Agglutinin

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Arab

    2010-07-01

    Full Text Available "nAltered glycosylation of proteins in cancer cells is one of the main processes responsible for anaplasia, invasion and metastatic potential of neoplastic cells. Lectins are nonimmunogenetic compounds which specifically detect certain terminal sugars of glycoconjugates. The aim of the present study was to identify the N-acetylgalactosamine (GalNac containing glycoconjugates in cancer cells in all grades of gastric carcinoma. Paraffin blocks belong to 30 patients of gastric carcinoma (10 cases from each grade was collected from pathology file of Ali-Ebn-Abitaleb Hospital in Zahedan during 2005-2007. Prepared sections (5-7μm in thickness were stained by Alcian Blue, hematoxylin and eosin (H&E and helix pomatia agglutinin (HPA conjugated lectin. Lectin diluted up to 10μg/ml in PBS (0.1M, pH=6.8. Lectin reactivity was visualized by 0.03% diaminobenzidine (DAB solution. Sections were graded according to staining intensity to lectin (0-4+. Although there was some difference for lectin staining intensity between cancer cells in different grades of gastric carcinoma, statistical analysis showed that there was only a significant difference for cancer cells reactivity between histopathological grades of II and III. The pattern of reactivity to HPA lectin were also different from all histopathological grades. It seems that in cancer cells, the amount and distribution of GalNac containing glycoconjugate differ from neoplastic cells of different histopathological grades in gastric carcinoma.

  9. Lectin Histochemical Study of Cell Surface Glycoconjugate in Gastric Carcinoma Using Helix Pomatia Agglutinin

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Arab

    2010-08-01

    Full Text Available Altered glycosylation of proteins in cancer cells is one of the main processes responsible for anaplasia, invasion and metastatic potential of neoplastic cells. Lectins are nonimmunogenetic compounds which specifically detect certain terminal sugars of glycoconjugates. The aim of the present study was to identify the N-acetylgalactosamine (GalNac containing glycoconjugates in cancer cells in all grades of gastric carcinoma. Paraffin blocks belong to 30 patients of gastric carcinoma (10 cases from each grade was collected from pathology file of Ali-Ebn-Abitaleb Hospital in Zahedan during 2005-2007. Prepared sections (5-7μm in thickness were stained by Alcian Blue, hematoxylin and eosin (H&E and helix pomatia agglutinin (HPA conjugated lectin. Lectin diluted up to 10μg/ml in PBS (0.1M, pH=6.8. Lectin reactivity was visualized by 0.03% diaminobenzidine (DAB solution. Sections were graded according to staining intensity to lectin (0-4+. Although there was some difference for lectin staining intensity between cancer cells in different grades of gastric carcinoma, statistical analysis showed that there was only a significant difference for cancer cells reactivity between histopathological grades of II and III. The pattern of reactivity to HPA lectin were also different from all histopathological grades. It seems that in cancer cells, the amount and distribution of GalNac containing glycoconjugate differ from neoplastic cells of different histopathological grades in gastric carcinoma.

  10. Mg/Al HYDROTALCITE-LIKE SYNTHESIZED FROM BRINE WATER FOR EOSIN YELLOW REMOVAL

    Directory of Open Access Journals (Sweden)

    Eddy Heraldy

    2011-11-01

    Full Text Available Attempts to synthesis of Mg/Al HTlc using magnesium from several raw material resources are widely investigated. One of raw material would purpose as source of magnesium to synthesis of Mg/Al HTlc is brine water which is well known as the desalination process wastewater. Mg/Al HTlc are widely investigated for their potential applications in research and industrial processes as adsorbents, anionic exchange, catalysts and /or catalyst precursors for the preparation of inorganic materials and pharmaceutical industry excipients. As adsorbents, Mg/Al HTlc are receiving greater interests in the environmental community due to their high adsorption capacity. However, there is no literature available on the synthesis of Mg/Al HTlc from brine water except from artificial seawater. The objective of this research is to synthesis of Mg/Al HTlc from brine water and its ability tested for eosin yellow (EY removal. Characterization of the Mg/Al HTlc synthesized was confirmed through X-ray Diffraction and FT-IR Spectroscopy. The effect of various experimental parameters was investigated using a batch adsorption technique. In this manner, the adsorption isotherms, adsorption kinetics, and pH effects upon EY adsorption on Mg/Al HTlc were examined. The result showed that EY data fit well with the pseudo-second order kinetic model. The isothermal data could be well described by the Freundlich equation. The adsorption capacity was 2.41 × 10-1 mol g-1, and adsorption energy of EY was 24.89 kJ mol-1.

  11. Stress-induced accumulation of wheat germ agglutinin and abscisic acid in roots of wheat seedlings

    International Nuclear Information System (INIS)

    Cammue, B.P.A.; Broekaert, W.F.; Kellens, J.T.C.; Peumans, W.J.; Raikhel, N.V.

    1989-01-01

    Wheat germ agglutinin (WGA) levels in roots of 2-day-old wheat seedlings increased up to three-fold when stressed by air-drying. Similar results were obtained when seedling roots were incubated either in 0.5 molar mannitol or 180 grams per liter polyethylene glycol 6,000, with a peak level of WGA after 5 hours of stress. Longer periods of osmotic treatment resulted in a gradual decline of WGA in the roots. Since excised wheat roots incorporate more [ 35 S]cysteine into WGA under stress conditions, the observed increase of lectin levels is due to de novo synthesis. Measurement of abscisic acid (ABA) levels in roots of control and stressed seedlings indicated a 10-fold increase upon air-drying. Similarly, a five- and seven-fold increase of ABA content of seedling roots was found after 2 hours of osmotic stress by polyethylene glycol 6,000 and mannitol, respectively. Finally, the stress-induced increase of WGA in wheat roots could be inhibited by growing seedlings in the presence of fluridone, an inhibitor of ABA synthesis. These results indicate that roots of water-stressed wheat seedlings (a) contain more WGA as a result of an increased de novo synthesis of this lectin, and (b) exhibit higher ABA levels. The stress-induced increase of lectin accumulation seems to be under control of ABA

  12. Ulex Europaeus Agglutinin-1 Is a Reliable Taste Bud Marker for In Situ Hybridization Analyses.

    Science.gov (United States)

    Yoshimoto, Joto; Okada, Shinji; Kishi, Mikiya; Misaka, Takumi

    2016-03-01

    Taste signals are received by taste buds. To better understand the taste reception system, expression patterns of taste-related molecules are determined by in situ hybridization (ISH) analyses at the histological level. Nevertheless, even though ISH is essential for determining mRNA expression, few taste bud markers can be applied together with ISH. Ulex europaeus agglutinin-1 (UEA-1) appears to be a reliable murine taste bud marker based on immunohistochemistry (IHC) analyses. However, there is no evidence as to whether UEA-1 can be used for ISH. Thus, the present study evaluated UEA-1 using various histochemical methods, especially ISH. When lectin staining was performed after ISH procedures, UEA-1 clearly labeled taste cellular membranes and distinctly indicated boundaries between taste buds and the surrounding epithelial cells. Additionally, UEA-1 was determined as a taste bud marker not only when used in single-colored ISH but also when employed with double-labeled ISH or during simultaneous detection using IHC and ISH methods. These results suggest that UEA-1 is a useful marker when conducting analyses based on ISH methods. To clarify UEA-1 staining details, multi-fluorescent IHC (together with UEA-1 staining) was examined, resulting in more than 99% of cells being labeled by UEA-1 and overlapping with KCNQ1-expressing cells. © 2016 The Histochemical Society.

  13. Location of the carbohydrates present in the HK-ATPase vesicles isolated from hog gastric mucosa

    International Nuclear Information System (INIS)

    Hall, K.; Perez, G.; Anderson, D.; Gutierrez, C.; Munson, K.; Hersey, S.J.; Kaplan, J.H.; Sachs, G.

    1990-01-01

    The glycosylation of H+K(+)-ATPase vesicles isolated from hog gastric mucosa was investigated by various methods. Following protein separation on sodium dodecyl sulfate reducing gels and transfer to poly(vinyl difluoride) membranes, binding of concanavalin A was confined to the 94-kDa band which corresponds to the catalytic subunit. In contrast, wheat germ agglutinin binding occurred in a region below the 94-kDa subunit, corresponding to the 60-85-kDa region, and also to protein just above the catalytic subunit. Treatment with glycopeptidase F removed most of the concanavalin A staining and also the wheat germ agglutinin staining found below the 94-kDa region, but spared the higher molecular weight wheat germ agglutinin reactive material. During the deglycosylation experiments a protein of 35-kDa was produced. Sequencing analysis of V8 protease generated peptide fragments of the 35-kDa protein show at least 30% homology with the Na+K(+)-ATPase beta-subunits. Labeling of the carbohydrates by galactosyltransferase and [3H]uridine diphosphate-galactose showed that the sites of labeling were extracellular and were confined to the wheat germ agglutinin staining regions. Two molecular weight regions, below the 94-kDa region, of 60 and 85 kDa were identified. Electron microscopy using postembedding staining techniques showed that both concanavalin A and wheat germ agglutinin staining occurred on the extracellular face of the gastric vesicles

  14. Identification of retrotransposon-like sequences in Iranian river buffalo

    African Journals Online (AJOL)

    ONOS

    2010-03-29

    % of a genome (Waterston et al., 2002). Mobile elements can be divided into two classes: Class I includes retrotransposons and class II includes DNA tran- sposons ... including dog, cat, horse, cattle, donkey, kangaroo, etc.

  15. The constitution of alloys in the Al-rich corner of the Al-Si-Sm ternary system

    International Nuclear Information System (INIS)

    Markoli, B.; Spaic, S.; Zupanic, F.

    2001-01-01

    The constitution of alloys and the liquidus surface in the Al-rich corner of the Al-Si-Sm ternary system were determined by the examination of controlled heated and cooled specimens, as well as heat-treated specimens by means of optical and scanning electron microscopy, energy-dispersive X-ray spectroscopy, differential thermal analysis and X-ray diffraction. The Al-rich corner of the Al-Si-Sm ternary system comprises five regions of primary crystallisation (α Al , β Si , Al 3 Sm, Al 2 Si 2 Sm and AlSiSm) with following characteristic invariant reaction sequences: ternary eutectic reaction L → α Al + β Si + Al 2 Si 2 Sm, and two liquidus transition reactions, i. e., L + Al 3 Sm → α Al + AlSiSm, and L + AlSiSm → α Al + Al 2 Si 2 Sm. Along with the position of ternary eutectic and both interstitial points in the Al-rich corner of the Al-Si-Sm ternary system, the temperatures for each reaction were determined. (orig.)

  16. Effect of Al-5Ti-0.62C-0.2Ce Master Alloy on the Microstructure and Tensile Properties of Commercial Pure Al and Hypoeutectic Al-8Si Alloy

    Directory of Open Access Journals (Sweden)

    Wanwu Ding

    2017-06-01

    Full Text Available Al-5Ti-0.62C-0.2Ce master alloy was synthesized by a method of thermal explosion reaction in pure molten aluminum and used to modify commercial pure Al and hypoeutectic Al-8Si alloy. The microstructure and tensile properties of commercial pure Al and hypoeutectic Al-8Si alloy with different additions of Al-5Ti-0.62C-0.2Ce master alloy were investigated. The results show that the Al-5Ti-0.62C-0.2Ce alloy was composed of α-Al, granular TiC, lump-like TiAl3 and block-like Ti2Al20Ce. Al-5Ti-0.62C-0.2Ce master alloy (0.3 wt %, 5 min can significantly refine macro grains of commercial pure Al into tiny equiaxed grains. The Al-5Ti-0.62C-0.2Ce master alloy (0.3 wt %, 30 min still has a good refinement effect. The tensile strength and elongation of commercial pure Al modified by the Al-5Ti-0.62C-0.2Ce master alloy (0.3 wt %, 5 min increased by roughly 19.26% and 61.83%, respectively. Al-5Ti-0.62C-0.2Ce master alloy (1.5 wt %, 10 min can significantly refine both α-Al grains and eutectic Si of hypoeutectic Al-8Si alloy. The dendritic α-Al grains were significantly refined to tiny equiaxed grains. The morphology of the eutectic Si crystals was significantly refined from coarse needle-shape or lath-shape to short rod-like or grain-like eutectic Si. The tensile strength and elongation of hypoeutectic Al-8Si alloy modified by the Al-5Ti-0.62C-0.2Ce master alloy (1.5 wt %, 10 min increased by roughly 20.53% and 50%, respectively. The change in mechanical properties corresponds to evolution of the microstructure.

  17. Microstructure and property of diamond-like carbon films with Al and Cr co-doping deposited using a hybrid beams system

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Wei, E-mail: popdw@126.com [School of Electromechanical Engineering, Guangdong University of Technology, Guangzhou 510006 (China); Liu, Jingmao; Geng, Dongsen [School of Electromechanical Engineering, Guangdong University of Technology, Guangzhou 510006 (China); Guo, Peng [Key Laboratory of Marine Materials and Related Technologies, Zhejiang Key Laboratory of Marine Materials and Protective Technologies, Ningbo Institute of Materials Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Zheng, Jun [Science and Technology on Surface Engineering Laboratory, Lanzhou Institute of Physics, Lanzhou 730000 (China); Wang, Qimin, E-mail: qmwang@gdut.edu.cn [School of Electromechanical Engineering, Guangdong University of Technology, Guangzhou 510006 (China)

    2016-12-01

    Highlights: • Diamond-like carbon films with Al and Cr doping were deposited. • Alternate multilayered structure consisted of Al-poor layer and Al-rich layer was formed. • The periodic Al-rich layers can greatly improve the residual stress and elastic resilience of the films. - Abstract: DLC films with weak carbide former Al and carbide former Cr co-doping (Al:Cr-DLC) were deposited by a hybrid beams system comprising an anode-layer linear ion beam source (LIS) and high power impulse magnetron sputtering using a gas mixture of C{sub 2}H{sub 2} and Ar as the precursor. The doped Al and Cr contents were controlled via adjusting the C{sub 2}H{sub 2} fraction in the gas mixture. The composition, microstructure, compressive stress, mechanical properties and tribological behaviors of the Al:Cr-DLC films were researched carefully using X-ray photoelectron spectroscopy, transmission electron microscopy, Raman spectroscopy, stress-tester, nanoindentation and ball-on-plate tribometer as function of the C{sub 2}H{sub 2} fraction. The results show that the Al and Cr contents in the films increased continuously as the C{sub 2}H{sub 2} fraction decreased. The doped Cr atoms preferred to bond with the carbon while the Al atoms mainly existed in metallic state. Structure modulation with alternate multilayer consisted of Al-poor DLC layer and Al-rich DLC layer was found in the films. Those periodic Al-rich DLC layers can effectively release the residual stress of the films. On the other hand, the formation of the carbide component due to Cr incorporation can help to increase the film hardness. Accordingly, the residual stress of the DLC films can be reduced without sacrificing the film hardness though co-doping Al and Cr atoms. Furthermore, it was found that the periodic Al-rich layer can greatly improve the elastic resilience of the DLC films and thus decreases the film friction coefficient and wear rate significantly. However, the existence of the carbide component would

  18. Compositionally modulated multilayer diamond-like carbon coatings with AlTiSi multi-doping by reactive high power impulse magnetron sputtering

    Science.gov (United States)

    Dai, Wei; Gao, Xiang; Liu, Jingmao; Kwon, Se-Hun; Wang, Qimin

    2017-12-01

    Diamond-like carbon (DLC) coatings with AlTiSi multi-doping were prepared by a reactive high power impulse magnetron sputtering with using a gas mixture of Ar and C2H2 as precursor. The composition, microstructure, compressive stress, and mechanical property of the as-deposited DLC coatings were studied systemically by using SEM, XPS, TEM, Raman spectrum, stress-tester, and nanoindentation as a function of the Ar fraction. The results show that the doping concentrations of the Al, Ti and Si atoms increased as the Ar fraction increased. The doped Ti and Si preferred to bond with C while the doped Al mainly existed in oxidation state without bonding with C. As the doping concentrations increased, TiC carbide nanocrystals were formed in the DLC matrix. The microstructure of coatings changed from an amorphous feature dominant AlTiSi-DLC to a carbide nanocomposite AlTiSi-DLC with TiC nanoparticles embedding. In addition, the coatings exhibited the compositionally modulated multilayer consisting of alternate Al-rich layer and Al-poor layer due to the rotation of the substrate holder and the diffusion behavior of the doped Al which tended to separate from C and diffuse towards the DLC matrix surface owing to its weak interactions with C. The periodic Al-rich layer can effectively release the compressive stress of the coatings. On the other hand, the hard TiC nanoparticles were conducive to the hardness of the coatings. Consequently, the DLC coatings with relatively low residual stress and high hardness could be acquired successfully through AlTiSi multi-doping. It is believed that the AlCrSi multi-doping may be a good way for improving the comprehensive properties of the DLC coatings. In addition, we believe that the DLC coatings with Al-rich multilayered structure have a high oxidation resistance, which allows the DLC coatings application in high temperature environment.

  19. TESTING SCALING RELATIONS FOR SOLAR-LIKE OSCILLATIONS FROM THE MAIN SEQUENCE TO RED GIANTS USING KEPLER DATA

    Energy Technology Data Exchange (ETDEWEB)

    Huber, D.; Bedding, T. R.; Stello, D. [Sydney Institute for Astronomy (SIfA), School of Physics, University of Sydney, NSW 2006 (Australia); Hekker, S. [Astronomical Institute ' Anton Pannekoek' , University of Amsterdam, Science Park 904, 1098 XH Amsterdam (Netherlands); Mathur, S. [High Altitude Observatory, NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Mosser, B. [LESIA, CNRS, Universite Pierre et Marie Curie, Universite Denis, Diderot, Observatoire de Paris, 92195 Meudon cedex (France); Verner, G. A.; Elsworth, Y. P.; Hale, S. J.; Chaplin, W. J. [School of Physics and Astronomy, University of Birmingham, Birmingham B15 2TT (United Kingdom); Bonanno, A. [INAF Osservatorio Astrofisico di Catania (Italy); Buzasi, D. L. [Eureka Scientific, 2452 Delmer Street Suite 100, Oakland, CA 94602-3017 (United States); Campante, T. L. [Centro de Astrofisica da Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal); Kallinger, T. [Department of Physics and Astronomy, University of British Columbia, Vancouver (Canada); Silva Aguirre, V. [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Str. 1, 85748 Garching (Germany); De Ridder, J. [Instituut voor Sterrenkunde, K.U.Leuven (Belgium); Garcia, R. A. [Laboratoire AIM, CEA/DSM-CNRS, Universite Paris 7 Diderot, IRFU/SAp, Centre de Saclay, 91191, Gif-sur-Yvette (France); Appourchaux, T. [Institut d' Astrophysique Spatiale, UMR 8617, Universite Paris Sud, 91405 Orsay Cedex (France); Frandsen, S. [Danish AsteroSeismology Centre (DASC), Department of Physics and Astronomy, Aarhus University, DK-8000 Aarhus C (Denmark); Houdek, G., E-mail: dhuber@physics.usyd.edu.au [Institute of Astronomy, University of Vienna, 1180 Vienna (Austria); and others

    2011-12-20

    We have analyzed solar-like oscillations in {approx}1700 stars observed by the Kepler Mission, spanning from the main sequence to the red clump. Using evolutionary models, we test asteroseismic scaling relations for the frequency of maximum power ({nu}{sub max}), the large frequency separation ({Delta}{nu}), and oscillation amplitudes. We show that the difference of the {Delta}{nu}-{nu}{sub max} relation for unevolved and evolved stars can be explained by different distributions in effective temperature and stellar mass, in agreement with what is expected from scaling relations. For oscillation amplitudes, we show that neither (L/M){sup s} scaling nor the revised scaling relation by Kjeldsen and Bedding is accurate for red-giant stars, and demonstrate that a revised scaling relation with a separate luminosity-mass dependence can be used to calculate amplitudes from the main sequence to red giants to a precision of {approx}25%. The residuals show an offset particularly for unevolved stars, suggesting that an additional physical dependency is necessary to fully reproduce the observed amplitudes. We investigate correlations between amplitudes and stellar activity, and find evidence that the effect of amplitude suppression is most pronounced for subgiant stars. Finally, we test the location of the cool edge of the instability strip in the Hertzsprung-Russell diagram using solar-like oscillations and find the detections in the hottest stars compatible with a domain of hybrid stochastically excited and opacity driven pulsation.

  20. Genome-wide cloning and sequence analysis of leucine-rich repeat receptor-like protein kinase genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Yuan Tong

    2010-01-01

    Full Text Available Abstract Background Transmembrane receptor kinases play critical roles in both animal and plant signaling pathways regulating growth, development, differentiation, cell death, and pathogenic defense responses. In Arabidopsis thaliana, there are at least 223 Leucine-rich repeat receptor-like kinases (LRR-RLKs, representing one of the largest protein families. Although functional roles for a handful of LRR-RLKs have been revealed, the functions of the majority of members in this protein family have not been elucidated. Results As a resource for the in-depth analysis of this important protein family, the complementary DNA sequences (cDNAs of 194 LRR-RLKs were cloned into the GatewayR donor vector pDONR/ZeoR and analyzed by DNA sequencing. Among them, 157 clones showed sequences identical to the predictions in the Arabidopsis sequence resource, TAIR8. The other 37 cDNAs showed gene structures distinct from the predictions of TAIR8, which was mainly caused by alternative splicing of pre-mRNA. Most of the genes have been further cloned into GatewayR destination vectors with GFP or FLAG epitope tags and have been transformed into Arabidopsis for in planta functional analysis. All clones from this study have been submitted to the Arabidopsis Biological Resource Center (ABRC at Ohio State University for full accessibility by the Arabidopsis research community. Conclusions Most of the Arabidopsis LRR-RLK genes have been isolated and the sequence analysis showed a number of alternatively spliced variants. The generated resources, including cDNA entry clones, expression constructs and transgenic plants, will facilitate further functional analysis of the members of this important gene family.

  1. Dynamic stabilities of icosahedral-like clusters and their ability to form quasicrystals

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Xiaogang; Hamid, Ilyar; Duan, Haiming, E-mail: dhm@xju.edu.cn [College of Physics Science and Technology. Xinjiang University, Urumqi 830046 (China)

    2016-06-15

    The dynamic stabilities of the icosahedral-like clusters containing up to 2200 atoms are investigated for 15 metal elements. The clusters originate from five different initial structures (icosahedron, truncated decahedron, octahedron, closed-shell fragment of an HCP structure, and non-closed-shell fragment of an HCP structure). The obtained order of the dynamic stabilities of the icosahedral-like clusters can be assigned to three groups, from stronger to weaker, according to the size ranges involved: (Zr, Al, Ti) > (Cu, Fe, Co, Ni, Mg, Ag) > (Pb, Au, Pd, Pt, Rh, Ir), which correspond to the predicted formation ability of the quasicrystals. The differences of the sequences can be explained by analyzing the parameters of the Gupta-type many-body inter-atomic potentials.

  2. Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing.

    Directory of Open Access Journals (Sweden)

    Alexander C Outhred

    Full Text Available Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways.We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants.Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade.Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster.

  3. An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library

    Directory of Open Access Journals (Sweden)

    Wallis James G

    2007-07-01

    Full Text Available Abstract Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12 gene that is responsible for ricinoleate biosynthesis. The role(s of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2 gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at

  4. In-situ investigation of the icosahedral Al-Cu-Fe phase formation in thin films

    Energy Technology Data Exchange (ETDEWEB)

    Haidara, F., E-mail: fanta.haidara@im2np.fr [IM2NP, UMR 6242 CNRS - Universite Aix-Marseille, Av. Escadrille Normandie-Niemen, Case 142, 13397 Marseille Cedex 20 (France); Duployer, B. [Universite Paul Sabatier CIRIMAT-LCMIE 2R1, 118, Route de Narbonne, 31062 Toulouse Cedex 09 (France); Mangelinck, D.; Record, M.-C. [IM2NP, UMR 6242 CNRS - Universite Aix-Marseille, Av. Escadrille Normandie-Niemen, Case 142, 13397 Marseille Cedex 20 (France)

    2012-09-05

    Highlights: Black-Right-Pointing-Pointer We investigated the phase formation of i-Al{sub 62.5}Cu{sub 25}Fe{sub 12.5} in thin films. Black-Right-Pointing-Pointer We characterized the samples by DSC and in-situ XRD and resistance measurements. Black-Right-Pointing-Pointer The resistivity value for i-Al{sub 62.5}Cu{sub 25}Fe{sub 12.5} was determined. - Abstract: This work is an investigation of the formation by reactive diffusion at high temperatures of the icosahedral phase, i-Al{sub 62.5}Cu{sub 25}Fe{sub 12.5}, in thin films. The samples were prepared by sputtering at room temperature. The elements Al, Cu and Fe were sequentially deposited onto oxidized silicon substrates. The two following stacking sequences, Al/Cu/Fe and Al/Fe/Cu, were investigated. The phase formation was studied using in situ resistivity, in situ X-ray Diffraction and Differential Scanning Calorimetry measurements. Whatever the stacking sequence, the sequences of phase formation evidenced during the heating treatment are similar. However the temperatures of formation for the first phases that are formed are different; they are higher in the case of the Al/Fe/Cu stacking sequence.

  5. Carcinoma-specific Ulex europaeus agglutinin-I binding glycoproteins of human colorectal carcinoma and its relation to carcinoembryonic antigen.

    Science.gov (United States)

    Matsushita, Y; Yonezawa, S; Nakamura, T; Shimizu, S; Ozawa, M; Muramatsu, T; Sato, E

    1985-08-01

    Glycoproteins binding to Ulex europaeus agglutinin-I (UEA-I) lectin, which recognizes the terminal alpha-L-fucose residue, were analyzed in 18 cases of human colorectal carcinoma by sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by the Western blotting method. In the distal large bowel (descending and sigmoid colon and rectum), high-molecular-weight glycoproteins binding to UEA-I existed in carcinoma tissue but not in normal mucosa. In the proximal large bowel (ascending and transverse colon), high-molecular-weight glycoproteins binding to UEA-I were found both in normal mucosa and in carcinoma tissue, whereas those from the carcinoma tissue had an apparently lower molecular weight as compared to the weight of those from the normal mucosa. Thus there is a biochemical difference in UEA-I binding glycoproteins between the normal mucosa and the carcinoma tissue, although in our previous histochemical study no difference was observed in UEA-I binding glycoproteins of the proximal large bowel between the carcinoma tissue and the normal mucosa. Furthermore, carcinoembryonic antigen from the carcinoma tissue was found to have the same electrophoretical mobility as the UEA-I binding glycoproteins.

  6. Enhanced photocatalytic properties of the 3D flower-like Mg-Al layered double hydroxides decorated with Ag{sub 2}CO{sub 3} under visible light illumination

    Energy Technology Data Exchange (ETDEWEB)

    Ao, Yanhui, E-mail: andyao@hhu.edu.cn; Wang, Dandan; Wang, Peifang; Wang, Chao; Hou, Jun; Qian, Jin

    2016-08-15

    Highlights: • 3D flower-like Ag{sub 2}CO{sub 3}/Mg-Al layered double hydroxide composite was prepared. • The nanocomposites exhibited high photocatalytic activities on different organic pollutants. • The mechanism of the enhanced activity were investigated. - Abstract: A facile anion-exchange precipitation method was employed to synthesize 3D flower-like Ag{sub 2}CO{sub 3}/Mg-Al layered double hydroxide composite photocatalyst. Results showed that Ag{sub 2}CO{sub 3} nanoparticles dispersed uniformly on the petals of the flower-like Mg-Al LDH. The obtained nanocomposites exhibited high photocatalytic activities on different organic pollutants (cationic and anionic dyes, phenol) under visible light illumination. The high photocatalytic activity can be ascribed to the special structure which accomplishes the wide-distribution of Ag{sub 2}CO{sub 3} nanoparticles on the surfaces of the 3D flower-like nanocomposites. Therefore, it can provide much more active sites for the degradation of organic pollutant. Then the photocatalytic mechanism was also verified by reactive species trapping experiments in detail. The work would pave a facile way to prepare LDHs based hierarchical photocatalysts with high activity for the degradation of wide range organic pollutants under visible light irradiation.

  7. Genesis of flake-like morphology and dye-sensitized solar cell performance of Al-doped ZnO particles: a study

    International Nuclear Information System (INIS)

    Sengupta, D.; Mondal, B.; Mukherjee, K.

    2017-01-01

    In dye-sensitized solar cell (DSSC) application, the particulate morphologies of photo-anode facilitate efficient dye loading and thus lead to better photo-conversion efficiency than their thin film counterpart. However, till date, the electronic and optical properties as well as the DSSC application of Al-doped ZnO (AZO) particles as photo-anode material is studied less than thin films. Herein, phase formation behavior, morphology evolution, optical properties, and dye-sensitized solar cell performance of wet chemically prepared ZnO and AZO (dopant level: 1–4 mol%) particles are studied. It is found that Al doping modulates significantly the ZnO morphology which in turn results the maximum dye adsorption as well as best photo-conversion efficiency at optimum dopant concentration. Specifically, the nanoparticle of ZnO turns predominantly to flake-like morphology with a higher surface area when 2 mol% Al is doped. Such morphology modulation is expected, since the crystallinity, lattice parameters, and lattice strain of ZnO changes appreciably with Al doping. The variations of optical properties (absorbance, diffused reflectance, and band gap) of AZO materials as compared to primitive ZnO are also identified through UV-vis studies. An attempt is made here to correlate the structural features with the photovoltaic performances of ZnO and AZO.

  8. Genesis of flake-like morphology and dye-sensitized solar cell performance of Al-doped ZnO particles: a study

    Energy Technology Data Exchange (ETDEWEB)

    Sengupta, D.; Mondal, B.; Mukherjee, K., E-mail: kalisadhanm@yahoo.com [CSIR-Central Mechanical Engineering Research Institute, Centre for Advanced Materials Processing (India)

    2017-03-15

    In dye-sensitized solar cell (DSSC) application, the particulate morphologies of photo-anode facilitate efficient dye loading and thus lead to better photo-conversion efficiency than their thin film counterpart. However, till date, the electronic and optical properties as well as the DSSC application of Al-doped ZnO (AZO) particles as photo-anode material is studied less than thin films. Herein, phase formation behavior, morphology evolution, optical properties, and dye-sensitized solar cell performance of wet chemically prepared ZnO and AZO (dopant level: 1–4 mol%) particles are studied. It is found that Al doping modulates significantly the ZnO morphology which in turn results the maximum dye adsorption as well as best photo-conversion efficiency at optimum dopant concentration. Specifically, the nanoparticle of ZnO turns predominantly to flake-like morphology with a higher surface area when 2 mol% Al is doped. Such morphology modulation is expected, since the crystallinity, lattice parameters, and lattice strain of ZnO changes appreciably with Al doping. The variations of optical properties (absorbance, diffused reflectance, and band gap) of AZO materials as compared to primitive ZnO are also identified through UV-vis studies. An attempt is made here to correlate the structural features with the photovoltaic performances of ZnO and AZO.

  9. Plant lectins as carriers for oral drugs: Is wheat germ agglutinin a suitable candidate?

    International Nuclear Information System (INIS)

    Dalla Pellegrina, Chiara; Rizzi, Corrado; Mosconi, Silvia; Zoccatelli, Gianni; Peruffo, Angelo; Chignola, Roberto

    2005-01-01

    Wheat germ agglutinin (WGA) is a plant protein that binds specifically to sugars expressed also by gastrointestinal epithelial cells. WGA is currently investigated as an anti-tumor drug and as a carrier for oral drugs. Information on whether it can cross the gastrointestinal epithelium and on its possible effects on the integrity of the epithelial layer is however scanty or lacking, and herein we address these issues. Differentiated Caco2 cells have been used as a model of polarized intestinal epithelium. WGA concentration at both the apical and the basolateral side of the epithelium has been quantified using a sensitive ELISA assay (sensitivity threshold 0.84 nM). Trans epithelial electrical resistance (TEER) has been measured to evaluate the integrity of the epithelium upon treatments with WGA. 3 H-Mannitol (182.2 Da) and FITC-dextran (3000 Da) have been used to measure the permeability of the epithelium. Cell viability has been measured by the MTT, by 7-AAD uptake, and Annexin-V binding assays. Up to a concentration of 5.6 μM, ∼0.1% of intact WGA molecules only could cross the epithelial layer. WGA perturbed the integrity of the epithelium and increased the permeability of the tissue in a dose- and time-dependent manner. WGA did not induce cell death but increased the permeability of individual cells to 7-AAD which is normally not uptaken by viable cells. These data allowed us to define a toxicity threshold for WGA on epithelial cells. WGA suitability as a carrier for oral drugs can therefore be evaluated on a rational basis

  10. Ulex europaeus agglutinin II (UEA-II) is a novel, potent inhibitor of complement activation.

    Science.gov (United States)

    Lekowski, R; Collard, C D; Reenstra, W R; Stahl, G L

    2001-02-01

    Complement is an important mediator of vascular injury following oxidative stress. We recently demonstrated that complement activation following endothelial oxidative stress is mediated by mannose-binding lectin (MBL) and activation of the lectin complement pathway. Here, we investigated whether nine plant lectins which have a binding profile similar to that of MBL competitively inhibit MBL deposition and subsequent complement activation following human umbilical vein endothelial cell (HUVEC) oxidative stress. HUVEC oxidative stress (1% O(2), 24 hr) significantly increased Ulex europaeus agglutinin II (UEA-II) binding by 72 +/- 9% compared to normoxic cells. UEA-II inhibited MBL binding to HUVEC in a concentration-dependent manner following oxidative stress. Further, MBL inhibited UEA-II binding to HUVEC in a concentration-dependent manner following oxidative stress, suggesting a common ligand. UEA-II (< or = 100 micromol/L) did not attenuate the hemolytic activity, nor did it inhibit C3a des Arg formation from alternative or classical complement pathway-specific hemolytic assays. C3 deposition (measured by ELISA) following HUVEC oxidative stress was inhibited by UEA-II in a concentration-dependent manner (IC(50) = 10 pmol/L). UEA-II inhibited C3 and MBL co-localization (confocal microscopy) in a concentration-dependent manner on HUVEC following oxidative stress (IC(50) approximately 1 pmol/L). Finally, UEA-II significantly inhibited complement-dependent neutrophil chemotaxis, but failed to inhibit fMLP-mediated chemotaxis, following endothelial oxidative stress. These data demonstrate that UEA-II is a novel, potent inhibitor of human MBL deposition and complement activation following human endothelial oxidative stress.

  11. The constitution of alloys in the Al-rich corner of the Al-Si-Sm ternary system

    Energy Technology Data Exchange (ETDEWEB)

    Markoli, B.; Spaic, S. [Ljubljana Univ. (Slovenia). Faculty of Natural Science and Engineering; Zupanic, F. [Maribor Univ. (Slovenia). Faculty of Mechanical Engineering

    2001-09-01

    The constitution of alloys and the liquidus surface in the Al-rich corner of the Al-Si-Sm ternary system were determined by the examination of controlled heated and cooled specimens, as well as heat-treated specimens by means of optical and scanning electron microscopy, energy-dispersive X-ray spectroscopy, differential thermal analysis and X-ray diffraction. The Al-rich corner of the Al-Si-Sm ternary system comprises five regions of primary crystallisation ({alpha}{sub Al}, {beta}{sub Si}, Al{sub 3}Sm, Al{sub 2}Si{sub 2}Sm and AlSiSm) with following characteristic invariant reaction sequences: ternary eutectic reaction L {yields} {alpha}{sub Al} + {beta}{sub Si} + Al{sub 2}Si{sub 2}Sm, and two liquidus transition reactions, i. e., L + Al{sub 3}Sm {yields} {alpha}{sub Al} + AlSiSm, and L + AlSiSm {yields} {alpha}{sub Al} + Al{sub 2}Si{sub 2}Sm. Along with the position of ternary eutectic and both interstitial points in the Al-rich corner of the Al-Si-Sm ternary system, the temperatures for each reaction were determined. (orig.)

  12. Identification of the Ulex europaeus agglutinin-I-binding protein as a unique glycoform of the neural cell adhesion molecule in the olfactory sensory axons of adults rats.

    Science.gov (United States)

    Pestean, A; Krizbai, I; Böttcher, H; Párducz, A; Joó, F; Wolff, J R

    1995-08-04

    Histochemical localization of two lectins, Ulex europaeus agglutinin-I (UEA-I) and Tetragonolobus purpureus (TPA), was studied in the olfactory bulb of adult rats. In contrast to TPA, UEA-I detected a fucosylated glycoprotein that is only present in the surface membranes of olfactory sensory cells including the whole course of their neurites up to the final arborization in glomeruli. Immunoblotting revealed that UEA-I binds specifically to a protein of 205 kDa, while TPA stains several other glycoproteins. Affinity chromatography with the use of a UEA-I column identified the 205 kDa protein as a glycoform of neural cell adhesion molecule (N-CAM), specific for the rat olfactory sensory nerves.

  13. Malamih al-Ashwat al-'Arabiyyah wa Makharijaha

    Directory of Open Access Journals (Sweden)

    Amrah Muhammad Kasim

    2015-12-01

    Full Text Available This writing discusses on al-ashwat al-‘arabiyyah that is known with “phonetic” term. It talks and interprets makharij al-huruf or place for producing sounds and also processing production of sounds by parts of mouth in Arabic language. The problems of sounds and its systems in Arabic language have been conducted by the scholars of al-ashwat al-‘arabiyyah attractively, neatly, and detail and gotten ahead the phonetic western scholars. Part of their analysis results formulate the study about al-ashwat al-sakinah (al-Shamit is known with vocal and consonant sounds in research questions shawait – shawamit. Ibnu Jinni has formulated “harakat”(wowel in Arabic language and dimension of letter  mad and liyn on alif  letter - waw - ya’ (ا و ي, from these letters create  harakat fathah, dammah, and kasrah. Moreover, in this writing also exist the description of hija’i letters and its makhraj that are correct from parts of mouth and the unity of coordinative sounds that produce sounds in morphemes arrangement, in one word that produces meaning. The result of phonological study has divided al-ashwat to be kinds of sound like the pronounced sounds, produced sounds from mouth, and heard sound.

  14. Candida biofilms: is adhesion sexy?

    Science.gov (United States)

    Soll, David R

    2008-08-26

    The development of Candida albicans biofilms requires two types of adhesion molecule - the Als proteins and Hwp1. Mutational analyses have recently revealed that these molecules play complementary roles, and their characteristics suggest that they may have evolved from primitive mating agglutinins.

  15. Sequence and structural characterization of great salt lake bacteriophage CW02, a member of the T7-like supergroup.

    Science.gov (United States)

    Shen, Peter S; Domek, Matthew J; Sanz-García, Eduardo; Makaju, Aman; Taylor, Ryan M; Hoggan, Ryan; Culumber, Michele D; Oberg, Craig J; Breakwell, Donald P; Prince, John T; Belnap, David M

    2012-08-01

    Halophage CW02 infects a Salinivibrio costicola-like bacterium, SA50, isolated from the Great Salt Lake. Following isolation, cultivation, and purification, CW02 was characterized by DNA sequencing, mass spectrometry, and electron microscopy. A conserved module of structural genes places CW02 in the T7 supergroup, members of which are found in diverse aquatic environments, including marine and freshwater ecosystems. CW02 has morphological similarities to viruses of the Podoviridae family. The structure of CW02, solved by cryogenic electron microscopy and three-dimensional reconstruction, enabled the fitting of a portion of the bacteriophage HK97 capsid protein into CW02 capsid density, thereby providing additional evidence that capsid proteins of tailed double-stranded DNA phages have a conserved fold. The CW02 capsid consists of bacteriophage lambda gpD-like densities that likely contribute to particle stability. Turret-like densities were found on icosahedral vertices and may represent a unique adaptation similar to what has been seen in other extremophilic viruses that infect archaea, such as Sulfolobus turreted icosahedral virus and halophage SH1.

  16. Effect of the heating rate on the microstructure of in situ Al2O3 particle-reinforced Al matrix composites prepared via displacement reactions in an Al/CuO system

    International Nuclear Information System (INIS)

    Zhao, Ge; Shi, Zhiming; Ta, Na; Ji, Guojun; Zhang, Ruiying

    2015-01-01

    Highlights: • The heating rate has a significant effect on the microstructures of composites. • The microstructure is determined by the diffusion rate of O and Cu in the heating stage. • The diffusion of Cu and O atoms is influenced by the heating rate. • With increasing heating rate, the Al 2 O 3 particle distribution becomes more uniformly. • With increasing heating rate, the form of Al 2 Cu changes from network to block-like. - Abstract: In this study, an in situ Al 2 O 3 particle-reinforced Al(Cu) matrix composite was successfully synthesized using a displacement reaction between Al and CuO powders. The powders were mixed at a weight ratio of 4:1 Al to CuO, cold-pressed and holding time at 900 °C for 1 h using varying heating rates. The effects of the heating rate on the microstructures of the composites were investigated using differential scanning calorimetry (DSC), X-ray diffraction (XRD), optical microscopy (MO), scanning electron microscopy (SEM) and energy dispersive spectrometry (EDS). The results indicate that all of the composites contain Al, Al 2 O 3 particles and Al 2 Cu phases. Although the heating rate does not significantly affect the phase compositions of the composites, it has a significant effect on their microstructures, most likely because it strongly influences the diffusion rates of the Cu and O atoms. As the heating rate is increased, the Al 2 O 3 particles become more dispersed, and they have a more uniform particle size distribution. Meanwhile, the Al 2 Cu structure transforms from the network (Al + Al 2 Cu) eutectic to the block-like Al 2 Cu phase. The ∼2 μm Al 2 O 3 particles and the block-like Al 2 Cu phase are distributed uniformly in the Al matrix when the sample is placed directly into a 900 °C furnace. This sample has a relative higher Rockwell hardness B (HRB) value of 87

  17. Recognition factors of Ricinus communis agglutinin 1 (RCA(1)).

    Science.gov (United States)

    Wu, Albert M; Wu, June H; Singh, Tanuja; Lai, Li-Ju; Yang, Zhangung; Herp, Anthony

    2006-04-01

    Ricinus communis agglutinin (RCA1) is one of the most important applied lectins that has been widely used as a tool to study cell surfaces and to purify glycans. Although the carbohydrate specificity of RCA1 has been described, the information obtained was mainly focused on inhibition of simple Galbeta1-related oligosaccharides and simple clusters. Here, all possible recognition factors of RCA1 of glycan binding were examined by enzyme-linked lectinosorbent (ELLSA) and inhibition assays, using known mammalian Gal/GalNAc carbohydrate structural units and natural polyvalent glycans. Among the glycoproteins (gps) tested and expressed as 50% nanogram inhibition, the high-density polyvalent Galbeta1-4GlcNAc (II) glycotopes occurring in natural gps, such as Pneumococcus type 14 capsular polysaccharide which is composed of repeating poly II residues, resulted in 9.0 x 10(4), 1.5 x 10(5), 2.3 x 10(4) and 2.1 x 10(4)-fold higher affinities to RCA1 than the monomeric Gal, linear I/II and Tri-antennary-II (Tri-II). Of the ligands tested and expressed as nanomoles of 50% inhibition, Tri-II was the best, being about 2, 4, 25.6 and 33.3 times better inhibitor than Di-II, II, I (Galbeta1-3GlcNAc) and Gal, respectively. From the results of this study, it is concluded that: (a) Galbeta1-4GlcNAc and other Galbeta1-related oligosaccharides are essential for lectin binding and their polyvalent form in macromolecules should be the most important recognition factor for RCA1; (b) the combining site of RCA1 may be a groove type, recognizing Galbeta1-4GlcNAc (II) as the major binding site; (c) its combining size may be large enough to accommodate a tetrasaccharide of beta-anomeric Gal at the non-reducing end and most complementary to human blood group I Ma active trisaccharide (Galbeta1-4GlcNAcbeta1-6Gal) and lacto-N-neotetraose (Galbeta1-4GlcNAcbeta1-3Galbeta1-4Glc); (d) RCA1 has a preference for the beta-anomer of Gal oligosaccharides with a Galbeta1-4 linkage > Galbeta1-6 > or = Galbeta

  18. The Glycoprofile Patterns of Endothelial Cells in Usual Interstitial Pneumonia

    Directory of Open Access Journals (Sweden)

    A Barkhordari

    2014-09-01

    Full Text Available [THIS ARTICLE HAS BEEN RETRACTED FOR DUPLICATE PUBLICATION] Background: The pathological classification of cryptogenic fibrosing alveolitis has been a matter of debate and controversy for histopathologists. Objective: To identify and specify the glycotypes of capillary endothelial cells in usual interstitial pneumonia (UIP compared to those found in normal tissue. Methods: Sections of formalin-fixed, paraffin-embedded blocks from 16 cases of UIP were studied by lectin histochemistry with a panel of 27 biotinylated lectins and an avidin-peroxidase revealing system. Results: High expression of several classes of glycan was seen de novo in capillary endothelial cells from patients with UIP including small complex and bi/tri-antennary bisected complex N-linked sequences bolund by Concanavalin A and erythro-phytohemagglutinin, respectively, GalNAca1 residues bound by Helix pomatia and Maclura pomifera agglutinins, and L-fucosylated derivatives of type II glycan chains recognized by Ulex europaeus agglutinin-I. Glycans bound by agglutinins from Lycopersicon esculentum (β1,4GlcNAc and Wisteria floribunda (GalNAc as well as GlcNAc oligomers bound by Phytolacca americana and succinylated Wheat Germ agglutinin were also seen in the capillary endothelial cells of UIP. In contrast, L-fucosylated derivatives of type I glycan chains were absent in cells from cases of UIP when Anguilla anguilla agglutinin was applied, unlike the situation in normal tissue. Conclusion: These results may indicate existence of two distinct populations of endothelial cell in UIP with markedly different patterns of glycosylation, reflecting a pattern of differentiation and angiogenesis, which is not detectable morphologically.

  19. Universal sequence map (USM of arbitrary discrete sequences

    Directory of Open Access Journals (Sweden)

    Almeida Jonas S

    2002-02-01

    Full Text Available Abstract Background For over a decade the idea of representing biological sequences in a continuous coordinate space has maintained its appeal but not been fully realized. The basic idea is that any sequence of symbols may define trajectories in the continuous space conserving all its statistical properties. Ideally, such a representation would allow scale independent sequence analysis – without the context of fixed memory length. A simple example would consist on being able to infer the homology between two sequences solely by comparing the coordinates of any two homologous units. Results We have successfully identified such an iterative function for bijective mappingψ of discrete sequences into objects of continuous state space that enable scale-independent sequence analysis. The technique, named Universal Sequence Mapping (USM, is applicable to sequences with an arbitrary length and arbitrary number of unique units and generates a representation where map distance estimates sequence similarity. The novel USM procedure is based on earlier work by these and other authors on the properties of Chaos Game Representation (CGR. The latter enables the representation of 4 unit type sequences (like DNA as an order free Markov Chain transition table. The properties of USM are illustrated with test data and can be verified for other data by using the accompanying web-based tool:http://bioinformatics.musc.edu/~jonas/usm/. Conclusions USM is shown to enable a statistical mechanics approach to sequence analysis. The scale independent representation frees sequence analysis from the need to assume a memory length in the investigation of syntactic rules.

  20. Electricity sequence control

    International Nuclear Information System (INIS)

    Shin, Heung Ryeol

    2010-03-01

    The contents of the book are introduction of control system, like classification and control signal, introduction of electricity power switch, such as push-button and detection switch sensor for induction type and capacitance type machinery for control, solenoid valve, expression of sequence and type of electricity circuit about using diagram, time chart, marking and term, logic circuit like Yes, No, and, or and equivalence logic, basic electricity circuit, electricity sequence control, added condition, special program control about choice and jump of program, motor control, extra circuit on repeat circuit, pause circuit in a conveyer, safety regulations and rule about classification of electricity disaster and protective device for insulation.

  1. Characterization and complete genome sequence of a novel N4-like bacteriophage, pSb-1 infecting Shigella boydii.

    Science.gov (United States)

    Jun, Jin Woo; Yun, Sae Kil; Kim, Hyoun Joong; Chai, Ji Young; Park, Se Chang

    2014-10-01

    Shigellosis is one of major foodborne pathogens in both developed and developing countries. Although antibiotic therapy is considered an effective treatment for shigellosis, the imprudent use of antibiotics has led to the increase of multiple-antibiotic-resistant Shigella species globally. In this study, we isolated a virulent Podoviridae bacteriophage (phage), pSb-1, that infects Shigella boydii. One-step growth analysis revealed that this phage has a short latent period (15 min) and a large burst size (152.63 PFU/cell), indicating that pSb-1 has good host infectivity and effective lytic activity. The double-stranded DNA genome of pSb-1 is composed of 71,629 bp with a G + C content of 42.74%. The genome encodes 103 putative ORFs, 9 putative promoters, 21 transcriptional terminators, and one tRNA region. Genome sequence analysis of pSb-1 and comparative analysis with the homologous phage EC1-UPM, N4-like phage revealed that there is a high degree of similarity (94%, nucleotide sequence identity) between pSb-1 and EC1-UPM in 73 of the 103 ORFs of pSb-1. The results of this investigation indicate that pSb-1 is a novel virulent N4-like phage infecting S. boydii and that this phage might have potential uses against shigellosis. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  2. Comparative genomics beyond sequence-based alignments

    DEFF Research Database (Denmark)

    Þórarinsson, Elfar; Yao, Zizhen; Wiklund, Eric D.

    2008-01-01

    Recent computational scans for non-coding RNAs (ncRNAs) in multiple organisms have relied on existing multiple sequence alignments. However, as sequence similarity drops, a key signal of RNA structure--frequent compensating base changes--is increasingly likely to cause sequence-based alignment me...

  3. Identification of a novel herpes simplex virus type 1 transcript and protein (AL3) expressed during latency.

    Science.gov (United States)

    Jaber, Tareq; Henderson, Gail; Li, Sumin; Perng, Guey-Chuen; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

    2009-10-01

    The herpes simplex virus type 1 (HSV-1) latency-associated transcript (LAT) is abundantly expressed in latently infected sensory neurons. In small animal models of infection, expression of the first 1.5 kb of LAT coding sequences is necessary and sufficient for wild-type reactivation from latency. The ability of LAT to inhibit apoptosis is important for reactivation from latency. Within the first 1.5 kb of LAT coding sequences and LAT promoter sequences, additional transcripts have been identified. For example, the anti-sense to LAT transcript (AL) is expressed in the opposite direction to LAT from the 5' end of LAT and LAT promoter sequences. In addition, the upstream of LAT (UOL) transcript is expressed in the LAT direction from sequences in the LAT promoter. Further examination of the first 1.5 kb of LAT coding sequences revealed two small ORFs that are anti-sense with respect to LAT (AL2 and AL3). A transcript spanning AL3 was detected in productively infected cells, mouse neuroblastoma cells stably expressing LAT and trigeminal ganglia (TG) of latently infected mice. Peptide-specific IgG directed against AL3 specifically recognized a protein migrating near 15 kDa in cells stably transfected with LAT, mouse neuroblastoma cells transfected with a plasmid containing the AL3 ORF and TG of latently infected mice. The inability to detect the AL3 protein during productive infection may have been because the 5' terminus of the AL3 transcript was downstream of the first in-frame methionine of the AL3 ORF during productive infection.

  4. Non-invasive glucagon-like peptide-1 receptor imaging in pancreas with (18)F-Al labeled Cys(39)-exendin-4.

    Science.gov (United States)

    Mi, Baoming; Xu, Yuping; Pan, Donghui; Wang, Lizhen; Yang, Runlin; Yu, Chunjing; Wan, Weixing; Wu, Yiwei; Yang, Min

    2016-02-26

    Glucagon-like peptide-1 receptor (GLP-1R) is abundantly expressed on beta cells and may be an ideal target for the pancreas imaging. Monitoring the GLP-1R of pancreas could be benefit for understanding the pathophysiology of diabetes. In the present study, (18)F-Al labeled exendin-4 analog, (18)F-Al-NOTA-MAL-Cys(39)-exendin-4, was evaluated for PET imaging GLP-1R in the pancreas. The targeting of (18)F-Al labeled exendin-4 analog was examined in healthy and streptozotocin induced diabetic rats. Rats were injected with (18)F-Al-NOTA-MAL-Cys(39)-exendin-4 and microPET imaging was performed at 1 h postinjection, followed by ex vivo biodistribution. GLP-1R expression in pancreas was determined through post mortern examinations. The pancreas of healthy rats was readily visualized after administration of (18)F-Al-NOTA-MAL-Cys(39)-exendin-4, whereas the pancreas of diabetic rats, as well as those from rats co-injected with excess of unlabeled peptides, was barely visible by microPET. At 60 min postinjection, the pancreatic uptakes were 1.02 ± 0.15%ID/g and 0.23 ± 0.05%ID/g in healthy and diabetic rats respectively. Under block, the pancreatic uptakes of non-diabetic rats reduced to 0.21 ± 0.07%ID/g at the same time point. Biodistribution data and IHC staining confirmed the findings of the microPET imaging. The favorable preclinical data indicated that (18)F-Al-NOTA-MAL-Cys(39)-exendin-4may be suitable for non-invasive monitoring functional pancreatic beta cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. The disordering phase transformation in (Ni/sub 70/Fe/sub 30/)/sub 3/(V/sub 98-x/Al/sub x/Ti/sub 2/) alloys with O ≤ x ≤ 80

    International Nuclear Information System (INIS)

    Das Gupta, A.; Horton, J.A.

    1985-01-01

    The sequence of disordering transformation processes in the A/sub 3/B type alloy series (Ni/sub 70/Fe/sub 30/)/sub 3/(V/sub 98-x/Al/sub x/Ti/sub 2/), currently under development for high-temperature structural applications, was studied by differential scanning calorimetry (DSC), x-ray diffraction, optical microscopy, and transmission electron microscopy (TEM). Results of DSC show that in all alloys there are two endothermic stages of phase transformation from the ordered to the disordered state. With increasing chi, the disordering transition temperature, T/sub c/, reaches a maximum --1000 0 C at chi ≅ 50 and then decreases. Interrupted heating, followed by water quenching, was used to characterize the crystal structure and the microstructure of the intermediate phases. For the x = 20 alloy, TEM observations showed ordered regions of DO/sub 22/ phase in a matrix of disordered fcc (Al) phase at intermediate temperatures. The ordered domains transformed morphologically into cuboid like regions at higher temperatures. From a combined study by all the techniques, the authors conclude that in alloy with x between 0 and 20, the sequence of phase transformations from heating is: DO/sub 2/ → DO/sub 22/ + AlAl, whereas in alloys with x > 40, the major sequence is Ll/sub 2/ + B/sub 2/ → Ll/sub 2/ + AlAl

  6. Measurement of projectile-like fragments produced by 80. 6 MeV /sup 16/O on /sup 27/Al

    Energy Technology Data Exchange (ETDEWEB)

    Wen-Qing, SHEN; Shu-Zhi, YIN; Zhong-Yan, GUO; Wen-Long, ZHAN; Yong-Tai, ZHU; Gen-Ming, JIN; Wei-Min, QIAO; En-Chiu, WU; Cheng-Lie, JIANG

    1985-05-01

    The projectile-like fragments produced by 80.6 MeV /sup 16/O on /sup 27/Al were measured using the large area position sensitive ionization chamber. The energy spectra, angular distributions, contour plots of d/sup 2/sigma/d..cap omega..dE in the E-theta plane of the reaction products from Li to Na and the Z-distribution were obtained. The cross sections of the quasi and deep inelastic scattering were introduced. A brief discussion of the experimental results is also given.

  7. First-time characterization of JY-1-like sequence in goats

    African Journals Online (AJOL)

    2015-07-11

    Jul 11, 2015 ... Material and Methods. Nine well-recognized .... available, the bovine JY-1 gene sequence (GenBank accession no. .... Since no phenotypes on fecundity and sexual precocity are currently available for goats, it may not be ...

  8. Construction of RNAi Expressed Vector of Soybean Agglutinin le2 Gene and Transform Research%大豆凝集素le2基因RNA干扰表达载体构建及转化的研究

    Institute of Scientific and Technical Information of China (English)

    魏强; 李鲁华; 王春艳; 付永平; 马建; 曲静; 王丕武

    2013-01-01

    For the purpose of constructing RNAi expressed vector,and discussing the method to improve soybean quality,according to known conserved sequence(AY342212)of soybean agglutinin le2 gene in GenBank,right primer was designed and the conserved sequence was cloned.And the homology was 99.77% contrast to the original sequence.Herein,using P3301-PF-NA-α'as the basic vector,the expression vector pCAMBIA3301-le2RNAi was constructed which contained RNA interference vector and bar gene through subcolone.The RNA interference expression vector was then transformed into cotyledon nodes of soybean Jinong 28 by Agrobacterium-mediated method.5 positive transgenic plants in T1 generation were confirmed by PCR detection and 23 seeds were harvested from T1 transgenic plants.The results provided a basis for soybean quality improvement.%以构建RNA干扰表达体系,探索改良大豆品质方法为目的,根据GenBank中已知的大豆凝集素le2基因核酸保守序列(AY342212),设计相应引物,克隆le2基因核心保守序列,测序并与原序列比对同源性为99.77%.以质粒p3301-PFNZ-α'作为基础载体,通过亚克隆构建含有RNA干扰元件和bar基因的表达载体pCAMBIA3301-le2RNAi.通过农杆菌转化法将RNA干扰表达载体导人受体大豆吉农28,获得PCR阳性T1代植株5株,种子23粒.研究结果为大豆品质改良奠定了基础.

  9. Sequence dependent aggregation of peptides and fibril formation

    Science.gov (United States)

    Hung, Nguyen Ba; Le, Duy-Manh; Hoang, Trinh X.

    2017-09-01

    Deciphering the links between amino acid sequence and amyloid fibril formation is key for understanding protein misfolding diseases. Here we use Monte Carlo simulations to study the aggregation of short peptides in a coarse-grained model with hydrophobic-polar (HP) amino acid sequences and correlated side chain orientations for hydrophobic contacts. A significant heterogeneity is observed in the aggregate structures and in the thermodynamics of aggregation for systems of different HP sequences and different numbers of peptides. Fibril-like ordered aggregates are found for several sequences that contain the common HPH pattern, while other sequences may form helix bundles or disordered aggregates. A wide variation of the aggregation transition temperatures among sequences, even among those of the same hydrophobic fraction, indicates that not all sequences undergo aggregation at a presumable physiological temperature. The transition is found to be the most cooperative for sequences forming fibril-like structures. For a fibril-prone sequence, it is shown that fibril formation follows the nucleation and growth mechanism. Interestingly, a binary mixture of peptides of an aggregation-prone and a non-aggregation-prone sequence shows the association and conversion of the latter to the fibrillar structure. Our study highlights the role of a sequence in selecting fibril-like aggregates and also the impact of a structural template on fibril formation by peptides of unrelated sequences.

  10. Table-like magnetocaloric effect in Gd–Ni–Al amorphous/nanocrystalline composites

    International Nuclear Information System (INIS)

    Zheng, Qiang; Zhang, Linlin; Du, Juan

    2017-01-01

    In this work, Gd–Ni–Al amorphous/nanocrystalline composites produced by melt-spinning method with double magnetocaloric effect (MCE) plateaus have been developed. Two MCE plateaus, ∼4.7 J kg −1 K −1 (90–120 K) and ∼3.60 J kg −1 K −1 (250–275 K), were discovered in Gd 80 Ni 11.6 Al 8.4 for a magnetic field change of 0 to 5 T. For Gd 90 Ni 5.8 Al 4.2 , the plateau values are ∼3.90 J kg −1 K −1 (85–120 K) and ∼6.70 J kg −1 K −1 (265–280 K) for a magnetic field change of 0–5 T. The reason why MCE plateau formation was investigated and discussed. These composites having two MCE plateaus are competitive candidates for the ideal Ericsson cycle. (paper)

  11. Soft x-ray amplification in lithium-like Al XI (154 /angstrom/) and Si XII (129 /angstrom/)

    International Nuclear Information System (INIS)

    Kim, D.; Skinner, C.H.; Wouters, A.; Valeo, E.; Voorhees, D.; Suckewer, S.

    1988-03-01

    Recent experiments on soft x-ray amplification in lithium-like ions in a CO 2 laser-produced recombining plasma confined in a magnetic field are presented. The maximum gain-length products observed are GL ≅ 3 to 4 for the 154 /angstrom/, 4f-3d transition in Al XI and GL (approxreverse arrowequal/ 1 to 2 for the 129 /angstrom/, 4f-3d transition in Si XII, respectively. A one-dimensional hydrodynamic code with a collisional-radiative atomic model was used to model the plasma and the theoretical predictions of gain agree well with the observations. Descriptions of both hydrodynamic and atomic physics code are given. 36 refs., 10 figs

  12. Digoxigenylated wheat germ agglutinin visualized with alkaline phosphatase-labeled anti-digoxigenin antibodies--a new, sensitive technique with the potential for single and double tracing of neuronal connections.

    Science.gov (United States)

    Veh, R W

    1991-01-02

    For double tracing experiments, wheat germ agglutinin (WGA) molecules labeled with two different haptens are desirable. In the present report the suitability of digoxigenylated WGA (DIG-WGA) for retrograde tracing was investigated. For this purpose the new tracer was pressure injected into rat brains and the transported DIG-WGA visualized via its digoxigenyl group with an alkaline phosphatase linked anti DIG antibody in permanently stained sections of high quality. With fixatives containing 2.5% glutaraldehyde only few positive cells were found. However, at milder fixation conditions (4% paraformaldehyde, 0.05% glutaraldehyde 0.2% picric acid, 30 min) retrogradely labeled cells were detected with a sensitivity comparable to tetramethylbenzidine protocols for conventional WGA-HRP (horseradish peroxidase) tracing. Preliminary experiments suggest excellent suitability for double labeling.

  13. Combustion Synthesis Reaction Behavior of Cold-Rolled Ni/Al and Ti/Al Multilayers

    Science.gov (United States)

    2011-04-01

    reaction modes of the films. Anselmi-Tamburini and Munir (21) studied the 2 SHS reaction in laminated Ni/Al foils and established a sequence of... convolution of three peaks. The very large broad peak, centered on position C, contains a superimposed peak appearing as a shoulder (position A) and a

  14. Table-like magnetocaloric effect in Gd{sub 56}Ni{sub 15}Al{sub 27}Zr{sub 2} alloy and its field independence feature

    Energy Technology Data Exchange (ETDEWEB)

    Agurgo Balfour, E.; Ma, Z.; Fu, H., E-mail: fuhao@uestc.edu.cn, E-mail: rockingsandstorm@163.com; Wang, L.; Luo, Y. [School of Physical Electronics, University of Electronic Science and Technology of China, Chengdu 610054 (China); Hadimani, R. L.; Jiles, D. C. [Department of Electrical and Computer Engineering, Iowa State University, Ames, Iowa 50011 (United States); Ames Laboratory, U.S. Department of Energy, Ames, Iowa 50011 (United States); Wang, S. F., E-mail: fuhao@uestc.edu.cn, E-mail: rockingsandstorm@163.com [North Electronic Device Research Institute, Beijing 100141 (China)

    2015-09-28

    In order to obtain “table-like” magnetocaloric effect (MCE), multiple-phase Gd{sub 56}Ni{sub 15}Al{sub 27}Zr{sub 2} alloy was prepared by arc-melting followed by suck-casting method. Powder x-ray diffraction and calorimetric measurements reveal that the sample contains both glassy and crystalline phases. The fraction of the glassy phase is about 62%, estimated from the heat enthalpy of the crystallization. The crystalline phases, Gd{sub 2}Al and GdNiAl further broadened the relatively wider magnetic entropy change (−ΔS{sub M}) peak of the amorphous phase, which resulted in the table-like MCE over a maximum temperature range of 52.5 K to 77.5 K. The plateau feature of the MCE was found to be nearly independent of the applied magnetic field from 3 T to 5 T. The maximum −ΔS{sub M} value of the MCE platforms is 6.0 J/kg K under applied magnetic field change of 5 T. Below 3 T, the field independence of the table-like feature disappears. The relatively large constant values of −ΔS{sub M} for the respective applied magnetic fields have promising applications in magnetic refrigeration using regenerative Ericsson cycle.

  15. General LTE Sequence

    OpenAIRE

    Billal, Masum

    2015-01-01

    In this paper,we have characterized sequences which maintain the same property described in Lifting the Exponent Lemma. Lifting the Exponent Lemma is a very powerful tool in olympiad number theory and recently it has become very popular. We generalize it to all sequences that maintain a property like it i.e. if p^{\\alpha}||a_k and p^\\b{eta}||n, then p^{{\\alpha}+\\b{eta}}||a_{nk}.

  16. Efficient Destruction of Pollutants in Water by a Dual-Reaction-Center Fenton-like Process over Carbon Nitride Compounds-Complexed Cu(II)-CuAlO2.

    Science.gov (United States)

    Lyu, Lai; Yan, Dengbiao; Yu, Guangfei; Cao, Wenrui; Hu, Chun

    2018-04-03

    Carbon nitride compounds (CN) complexed with the in-situ-produced Cu(II) on the surface of CuAlO 2 substrate (CN-Cu(II)-CuAlO 2 ) is prepared via a surface growth process for the first time and exhibits exceptionally high activity and efficiency for the degradation of the refractory pollutants in water through a Fenton-like process in a wide pH range. The reaction rate for bisphenol A removal is ∼25 times higher than that of the CuAlO 2 . According to the characterization, Cu(II) generation on the surface of CuAlO 2 during the surface growth process results in the marked decrease of the surface oxygen vacancies and the formation of the C-O-Cu bridges between CN and Cu(II)-CuAlO 2 in the catalyst. The electron paramagnetic resonance (EPR) analysis and density functional theory (DFT) calculations demonstrate that the dual reaction centers are produced around the Cu and C sites due to the cation-π interactions through the C-O-Cu bridges in CN-Cu(II)-CuAlO 2 . During the Fenton-like reactions, the electron-rich center around Cu is responsible for the efficient reduction of H 2 O 2 to • OH, and the electron-poor center around C captures electrons from H 2 O 2 or pollutants and diverts them to the electron-rich area via the C-O-Cu bridge. Thus, the catalyst exhibits excellent catalytic performance for the refractory pollutant degradation. This study can deepen our understanding on the enhanced Fenton reactivity for water purification through functionalizing with organic solid-phase ligands on the catalyst surface.

  17. Lysosomal processing of sialoglycoconjugates in a wheat germ agglutinin resistant variant of EL4 murine leukemia cells

    International Nuclear Information System (INIS)

    Devino, N.L.

    1989-01-01

    Metabolic studies were undertaken in EL4 murine leukemia in WB6, a wheat germ agglutinin-resistant variant of EL4, in order to identify any differences in lysosomal processing of sialoglyco-conjugates. Five lysosomal acid hydrolases, acetylesterase, acid phosphatase, β-galactosidase, α-mannosidase, and neuraminidase, were studied using fluorescent 4-methylumbelliferyl substrates. No significant differences were found in the total activity of any of these enzymes in EL4 and WB6. Cells were incubated in the presence of N-acetylmannosamine, the metabolic precursor of sialic acid (N-acetylneuraminic acid). Free sialic acid accumulated in the lysosomes of WB6 but not of EL4. The accumulation of lysosomal free sialic acid in WB6 showed a dependence on the concentration of N-acetylmannosamine in the growth medium. Metabolic labelling with [6- 3 H]-N-acetylmannosamine showed that WB6 accumulated lysosomal free sialic acid even at very low concentrations of N-acetylmannosamine. The two cell lines differed in their distribution of radiolabelled neutral sugars, free sialic acid, and sialoglycoproteins. The velocity of 3 H-sialic acid release was 3.7-fold lower in WB6 than in EL4, suggesting that WB6 has a defect in lysosomal sialic acid transport. The metabolic consequences of this defect are examined, in light of other biochemical and immunological data on these cells

  18. Clinical and serological characterization of cold agglutinin syndrome in a Tertiary Care Hospital in Eastern India

    Directory of Open Access Journals (Sweden)

    Sudipta Sekhar Das

    2015-01-01

    Full Text Available Background and Aim: Cold agglutinin syndrome (CAS primary or secondary represents approximately 16-32% of autoimmune hemolytic anemia cases. Most patients present with mild, chronic hemolytic anemia with exacerbation of the condition in the cold environment. Red cell transfusions are only indicated when there is a life-threatening anemia causing crisis. We studied the clinical and serological characterization of CAS with the aim that the information gained from this study would help in proper diagnosis and management of these patients. Materials and Methods: The prospective study included nine patients who were admitted with severe anemia. Detailed work-up were conducted to establish the diagnosis, severity of in vivo hemolysis and transfusion management. Results: All patients presented with pallor, weakness, fatigue and painful fingers and toes with exacerbation of symptoms in winter months. Secondary CAS was observed in three patients suffering from malignant lymphoma. Red cells of all patients were coated with complements (C3 more specifically C3d. In one patient suffering from malignant lymphoma, the cold autoagglutinin titer was as high as 4096. Autoantibody in seven patients was specific to "I" antigen and one to "i" antigen. Conclusions: We conclude that detailed clinical and serological characterization is needed to diagnose and manage CAS. Whereas avoidance of cold exposure is the primary therapy, but no critical patient should be denied blood transfusion due to serological complications. All transfusion services should follow the correct protocol to maximize blood safety in CAS.

  19. Localization of Ulex europaeus agglutinin-I (UEA-I) in the developing gustatory epithelium of the rat.

    Science.gov (United States)

    Taniguchi, Ryo; Shi, Lei; Honma, Shiho; Fujii, Masae; Ueda, Katsura; El-Sharaby, Ashraf; Wakisaka, Satoshi

    2004-09-01

    To understand the development of the gustatory structures necessitates a reliable marker for both immature and mature taste buds. It has been reported that the intragemmal cells within the taste buds of adult rats were bound to Ulex europaeus agglutinin-I (UEA-I), a specific lectin for alpha-linked fucose, but it has not been determined whether immature taste buds, i.e. taste buds without an apparent taste pore, are labeled with UEA-I. The present study was conducted to examine the UEA-I binding pattern during the development of the rat gustatory epithelium. In adult animals, UEA-I bound to the membrane of taste buds in all examined regions of the gustatory epithelium. Within the individual taste buds, UEA-I labeled almost all intragemmal cells. The binding of UEA-I was occasionally detected below the keratinized layer of the trench wall epithelium but could not be found in the lingual epithelium of the adult animal. During the development of circumvallate papilla, some cells within the immature taste buds were also labeled with UEA-I. The developmental changes in the UEA-I binding pattern in fungiform papillae were almost identical to those in the circumvallate papilla: both immature and mature taste buds were labeled with UEA-I. The present results indicate that UEA-I is a specific lectin for the intragemmal cells of both immature and mature taste buds and, thus, UEA-I can be used as a reliable marker for all taste buds in the rat.

  20. Clinical characterization and diagnosis of cystic fibrosis through exome sequencing in Chinese infants with Bartter-syndrome-like hypokalemia alkalosis.

    Science.gov (United States)

    Qiu, Liru; Yang, Fengjie; He, Yonghua; Yuan, Huiqing; Zhou, Jianhua

    2018-03-09

    Cystic fibrosis (CF) is a fatal autosomal-recessive disease caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. CF is characterized by recurrent pulmonary infection with obstructive pulmonary disease. CF is common in the Caucasian population but is rare in the Chinese population. The symptoms of early-stage CF are often untypical and may sometimes manifest as Bartter syndrome (BS)-like hypokalemic alkalosis. Therefore, the ability of doctors to differentiate CF from BS-like hypokalemic alkalosis in Chinese infants is a great challenge in the timely and accurate diagnosis of CF. In China, sporadic CF has not been diagnosed in children younger than three years of age to date. Three infants, who were initially admitted to our hospital over the period of June 2013 to September 2014 with BS-like hypokalemic alkalosis, were diagnosed with CF through exome sequencing and sweat chloride measurement. The compound heterozygous mutations of the CFTR gene were detected in two infants, and a homozygous missense mutation was found in one infant. Among the six identified mutations, two are novel point mutations (c.1526G > C and c.3062C > T) that are possibly pathogenic. The three infants are the youngest Chinese patients to have been diagnosed with sporadic CF at a very early stage. Follow-up examination showed that all of the cases remained symptom-free after early intervention, indicating the potential benefit of very early diagnosis and timely intervention in children with CF. Our results demonstrate the necessity of distinguishing CF from BS in Chinese infants with hypokalemic alkalosis and the significant diagnostic value of powerful exome sequencing for rare genetic diseases. Furthermore, our findings expand the CFTR mutation spectrum associated with CF.

  1. A comparison of step-and-shoot leaf sequencing algorithms that eliminate tongue-and-groove effects

    Energy Technology Data Exchange (ETDEWEB)

    Kamath, Srijit [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Sahni, Sartaj [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Ranka, Sanjay [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Li, Jonathan [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Palta, Jatinder [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States)

    2004-07-21

    The performances of three recently published leaf sequencing algorithms for step-and-shoot intensity-modulated radiation therapy delivery that eliminates tongue-and-groove underdosage are evaluated. Proofs are given to show that the algorithm of Que et al (2004 Phys. Med. Biol. 49 399-405) generates leaf sequences free of tongue-and-groove underdosage and interdigitation. However, the total beam-on times could be up to n times those of the sequences generated by the algorithms of Kamath et al (2004 Phys. Med. Biol. 49 N7-N19), which are optimal in beam-on time for unidirectional leaf movement under the same constraints, where n is the total number of involved leaf pairs. Using 19 clinical fluence matrices and 100 000 randomly generated 15 x 15 matrices, the average monitor units and number of segments of the leaf sequences generated using the algorithm of Que et al are about two to four times those generated by the algorithm of Kamath et al.

  2. A comparison of step-and-shoot leaf sequencing algorithms that eliminate tongue-and-groove effects

    International Nuclear Information System (INIS)

    Kamath, Srijit; Sahni, Sartaj; Ranka, Sanjay; Li, Jonathan; Palta, Jatinder

    2004-01-01

    The performances of three recently published leaf sequencing algorithms for step-and-shoot intensity-modulated radiation therapy delivery that eliminates tongue-and-groove underdosage are evaluated. Proofs are given to show that the algorithm of Que et al (2004 Phys. Med. Biol. 49 399-405) generates leaf sequences free of tongue-and-groove underdosage and interdigitation. However, the total beam-on times could be up to n times those of the sequences generated by the algorithms of Kamath et al (2004 Phys. Med. Biol. 49 N7-N19), which are optimal in beam-on time for unidirectional leaf movement under the same constraints, where n is the total number of involved leaf pairs. Using 19 clinical fluence matrices and 100 000 randomly generated 15 x 15 matrices, the average monitor units and number of segments of the leaf sequences generated using the algorithm of Que et al are about two to four times those generated by the algorithm of Kamath et al

  3. The evolving genetic risk for sporadic ALS.

    Science.gov (United States)

    Gibson, Summer B; Downie, Jonathan M; Tsetsou, Spyridoula; Feusier, Julie E; Figueroa, Karla P; Bromberg, Mark B; Jorde, Lynn B; Pulst, Stefan M

    2017-07-18

    To estimate the genetic risk conferred by known amyotrophic lateral sclerosis (ALS)-associated genes to the pathogenesis of sporadic ALS (SALS) using variant allele frequencies combined with predicted variant pathogenicity. Whole exome sequencing and repeat expansion PCR of C9orf72 and ATXN2 were performed on 87 patients of European ancestry with SALS seen at the University of Utah. DNA variants that change the protein coding sequence of 31 ALS-associated genes were annotated to determine which were rare and deleterious as predicted by MetaSVM. The percentage of patients with SALS with a rare and deleterious variant or repeat expansion in an ALS-associated gene was calculated. An odds ratio analysis was performed comparing the burden of ALS-associated genes in patients with SALS vs 324 normal controls. Nineteen rare nonsynonymous variants in an ALS-associated gene, 2 of which were found in 2 different individuals, were identified in 21 patients with SALS. Further, 5 deleterious C9orf72 and 2 ATXN2 repeat expansions were identified. A total of 17.2% of patients with SALS had a rare and deleterious variant or repeat expansion in an ALS-associated gene. The genetic burden of ALS-associated genes in patients with SALS as predicted by MetaSVM was significantly higher than in normal controls. Previous analyses have identified SALS-predisposing variants only in terms of their rarity in normal control populations. By incorporating variant pathogenicity as well as variant frequency, we demonstrated that the genetic risk contributed by these genes for SALS is substantially lower than previous estimates. © 2017 American Academy of Neurology.

  4. The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

    Science.gov (United States)

    Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

    1992-12-01

    The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

  5. Influence of high temperature annealing on the structure, hardness and tribological properties of diamond-like carbon and TiAlSiCN nanocomposite coatings

    International Nuclear Information System (INIS)

    Xie, Z.W.; Wang, L.P.; Wang, X.F.; Huang, L.; Lu, Y.; Yan, J.C.

    2011-01-01

    Diamond-like carbon (DLC) and TiAlSiCN nanocomposite coatings were synthesized and annealed at different temperatures in a vacuum environment. The microstructure, hardness and tribological properties of as-deposited and annealed DLC-TiAlSiCN nanocomposite coatings were characterized by X-ray diffraction, X-ray photoelectron spectroscopy (XPS), transmission electron microscopy (TEM), Raman spectroscopy, nano-indentation and friction tests. The TEM results reveal that the as-deposited DLC-TiAlSiCN coating has a unique nanocomposite structure consisting of TiCN nanocrystals embedded in an amorphous matrix consisting of a-Si 3 N 4 , a-SiC, a-CN and DLC, and the structure changed little after annealing at 800 °C. However, XPS and Raman results show that an obvious graphitization of the DLC phase occurred during the annealing process and it worsened with annealing temperature. Because of the graphitization, the hardness of the DLC-TiAlSiCN coating after annealing at 800 °C decreased from 45 to 36 GPa. In addition, the DLC-TiAlSiCN coating after annealing at 800 °C has a similar friction coefficient to the as-deposited coating.

  6. Midbody Accumulation in Breast Cancer Stem Cells

    Science.gov (United States)

    2011-08-01

    MBds (arrows). (d) Wheat germ agglutinin, plasma membrane (red); MKLP1- GFP, MBds (green); DAPI, DNA (blue). Bar, 5 μm. (e) Electron micrograph of a... transgene sequences. Science 324, 797-801 (2009). 70. Sachdev, S., Bu, Y., and Gelman, I.H. Paxillin-Y118 phosphorylation contributes to the control

  7. Lectin conjugates as biospecific contrast agents for MRI. Coupling of Lycopersicon esculentum agglutinin to linear water-soluble DTPA-loaded oligomers.

    Science.gov (United States)

    Pashkunova-Martic, Irena; Kremser, Christian; Galanski, Markus; Schluga, Petra; Arion, Vladimir; Debbage, Paul; Jaschke, Werner; Keppler, Bernhard

    2011-06-01

    Magnetic resonance imaging (MRI) requires synthesis of contrast media bearing targeting groups and numerous gadolinium chelating groups generating high relaxivity. This paper explores the results of linking the gadolinium chelates to the targeting group, a protein molecule, via various types of linkers. Polycondensates of diethylenetriaminepentaacetic acid (DTPA) with either diols or diamines were synthesised and coupled to the targeting group, a lectin (Lycopersicon esculentum agglutinin, tomato lectin) which binds with high affinity to specific oligosaccharide configurations in the endothelial glycocalyx. The polycondensates bear up to four carboxylic groups per constitutive unit. Gd-chelate bonds are created through dative interactions with the unshared pair of electrons on each oxygen and nitrogen atom on DTPA. This is mandatory for complexation of Gd(III) and avoidance of the severe toxicity of free gadolinium ions. The polymer-DTPA compounds were characterised by (1)H NMR and mass spectrometry. The final lectin-DTPA-polycondensate conjugates were purified by fast protein liquid chromatography (FPLC). The capacity for specific binding was assessed, and the MRI properties were examined in order to evaluate the use of these oligomers as components of selective perfusional contrast agents.

  8. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  9. Molecular characterization of Als1, an acetohydroxyacid synthase mutation conferring resistance to sulfonylurea herbicides in soybean.

    Science.gov (United States)

    Ghio, Cecilia; Ramos, María Laura; Altieri, Emiliano; Bulos, Mariano; Sala, Carlos A

    2013-12-01

    The AHAS gene family in soybean was characterized. The locus Als1 for sulfonylurea resistance was mapped and the resistant allele was characterized at the molecular level. Sulfonylurea (SU) resistance in soybean is controlled by Als1, a semi-dominant allele obtained by EMS mutagenesis over the cultivar Williams 82. The overall objective of this research was to map Als1 in the soybean genome and to determine the nucleotidic changes conferring resistance to SU. Four nucleotide sequences (GmAhas1-4) showing high homology with the Arabidopsis thaliana acetohydroxyacid synthase (AHAS, EC 4.1.3.18) gene sequence were identified by in silico analysis, PCR-amplified from the SU-resistant line BTK323STS and sequenced. Expression analysis showed that GmAhas1, located on chromosome 4 by in silico analysis, is the most expressed sequence in true leaves. F2:3 families derived from the cross between susceptible and resistant lines were evaluated for SU resistance. Mapping results indicate that the locus als1 is located on chromosome 4. Sequence comparison of GmAhas1 between BTK323STS and Williams 82 showed a single nucleotide change from cytosine to thymine at position 532. This transversion generates an amino acid change from proline to serine at position 197 (A. thaliana nomenclature) of the AHAS catalytic subunit. An allele-specific marker developed for the GmAhas1 mutant sequence cosegregated with SU resistance in the F2 population. Taking together, the mapping, expression and sequencing results indicate that the GmAhas1 sequence corresponds to the Als1 gene sequence controlling SU resistance in soybean. The molecular breeding tools described herein create the basis to speed up the identification of new mutations in soybean AHAS leading to enhanced levels of resistance to SU or to other families of AHAS inhibitor herbicides.

  10. Transcriptome sequencing in prostate cancer identifies inter-tumor heterogeneity

    Directory of Open Access Journals (Sweden)

    Janet Mendonca

    2015-06-01

    Full Text Available Given the dearth of gene mutations in prostate cancer, [1] ,[2] it is likely that genomic rearrangements play a significant role in the evolution of prostate cancer. However, in the search for recurrent genomic alterations, "private alterations" have received less attention. Such alterations may provide insights into the evolution, behavior, and clinical outcome of an individual tumor. In a recent report in "Genome Biology" Wyatt et al. [3] defines unique alterations in a cohort of high-risk prostate cancer patient with a lethal phenotype. Utilizing a transcriptome sequencing approach they observe high inter-tumor heterogeneity; however, the genes altered distill into three distinct cancer-relevant pathways. Their analysis reveals the presence of several non-ETS fusions, which may contribute to the phenotype of individual tumors, and have significance for disease progression.

  11. Direct selection of expressed sequences on a YAC clone revealed proline-rich-like genes and BARE-1 sequences physically linked to the complex ¤Mla¤ powdery mildew resistance locus of barley (¤Hordeum vulgare¤ L.)

    DEFF Research Database (Denmark)

    Schwarz, G.; Michalek, W.; Jahoor, A.

    2002-01-01

    homology to the copia-like retroelement BA REI of barley, putatively involved in evolution of disease resistance loci. The high degree of clones representing barley rRNA sequences or false positives is a major disadvantage of direct selection of cDNAs in barley. (C) 2002 Elsevier Science Ireland Ltd. All...... gene. Of 22 selected cDNA clones, six were re-located on the YAC by southern analysis. Two of these clones are predicted to encode members of the hydroxyproline-rich glycoprotein and proline-rich protein gene families which have been implicated in plant defense response. Four sequences showed high...

  12. Effect of electron correlations and Breit interactions on ground-state fine-structures along the nitrogen-like isoelectronic sequence

    International Nuclear Information System (INIS)

    Wang Xiaolu; Lu Wenlai; Gao Xiang; Li Jiaming

    2009-01-01

    The accurate atomic data of nitrogen and nitrogen-like ions have an importance role in fusion plasma studies and astrophysics studies. The precise calculation of fine-structures is required to obtain such atomic data. Along the whole nitrogen isoelectronic sequence, the contributions of the electron correlations, the Breit interactions and the quantum electrodynamics corrections on the ground-state fine-structures are elucidated. When Z is low, the electron correlations are important, and the Breit interactions, which cannot be neglected cause interesting anomalous fine-structure splittings. When Z is high, the electron correlations are less important, and the Breit interactions are important in addition to spin-orbit interactions for precise calculations. (authors)

  13. Morphology and SSU rDNA sequence analysis of two hypotrichous ciliates (Protozoa, Ciliophora, Hypotrichia) including the new species Metaurostylopsis parastruederkypkeae n. sp.

    Science.gov (United States)

    Lu, Borong; Wang, Chundi; Huang, Jie; Shi, Yuhong; Chen, Xiangrui

    2016-10-01

    The morphology and phylogeny of two hypotrichous ciliates, Metaurostylopsis parastruederkypkeae n. sp. and Neourostylopsis flavicana (Wang et al., 2011) Chen et al., 2013 were investigated based on morphology, infraciliature and the small subunit (SSU) ribosomal RNA gene (rRNA) sequence. The new species, M. parastruederkypkeae n. sp. was identified according to its characteristics: body shape ellipsoidal, size about (165-200) × (45-60) μm in vivo, cell color reddish; two types of cortical granules including wheat grain-like and yellow-greenish larger ones along the marginal cirri rows and dorsal kineties and dot-like and reddish smaller ones, grouped around marginal cirri on ventral side and arranged in short lines on dorsal side; 26-41 adoral membranelles; three frontal and one parabuccal, five to seven frontoterminal, one buccal, and three to six transverse cirri; seven to thirteen midventral pairs; five to nine unpaired ventral cirri, five to seven left and three to five right marginal rows; and three complete dorsal kineties. Phylogenetic analysis based on SSU rDNA sequences showed that both Metaurostylopsis and Neourostylopsis are monophyletic. As the internal relationship between and within both genera are not clear, further studies on the species in these two genera are necessary. The key characteristics of all known twelve Metaurostylopsis-Apourostylopsis-Neourostylopsis species complex were updated.

  14. Characterization of a Novel Orthomyxo-like Virus Causing Mass Die-Offs of Tilapia.

    Science.gov (United States)

    Bacharach, Eran; Mishra, Nischay; Briese, Thomas; Zody, Michael C; Kembou Tsofack, Japhette Esther; Zamostiano, Rachel; Berkowitz, Asaf; Ng, James; Nitido, Adam; Corvelo, André; Toussaint, Nora C; Abel Nielsen, Sandra Cathrine; Hornig, Mady; Del Pozo, Jorge; Bloom, Toby; Ferguson, Hugh; Eldar, Avi; Lipkin, W Ian

    2016-04-05

    Tilapia are an important global food source due to their omnivorous diet, tolerance for high-density aquaculture, and relative disease resistance. Since 2009, tilapia aquaculture has been threatened by mass die-offs in farmed fish in Israel and Ecuador. Here we report evidence implicating a novel orthomyxo-like virus in these outbreaks. The tilapia lake virus (TiLV) has a 10-segment, negative-sense RNA genome. The largest segment, segment 1, contains an open reading frame with weak sequence homology to the influenza C virus PB1 subunit. The other nine segments showed no homology to other viruses but have conserved, complementary sequences at their 5' and 3' termini, consistent with the genome organization found in other orthomyxoviruses. In situ hybridization indicates TiLV replication and transcription at sites of pathology in the liver and central nervous system of tilapia with disease. The economic impact of worldwide trade in tilapia is estimated at $7.5 billion U.S. dollars (USD) annually. The infectious agent implicated in mass tilapia die-offs in two continents poses a threat to the global tilapia industry, which not only provides inexpensive dietary protein but also is a major employer in the developing world. Here we report characterization of the causative agent as a novel orthomyxo-like virus, tilapia lake virus (TiLV). We also describe complete genomic and protein sequences that will facilitate TiLV detection and containment and enable vaccine development. Copyright © 2016 Bacharach et al.

  15. Application of Ulex europaeus agglutinin I-modified liposomes for oral vaccine: Ex Vivo bioadhesion and in Vivo immunity.

    Science.gov (United States)

    Li, KeXin; Zhao, Xiuli; Xu, Shiyi; Pang, DaHai; Yang, ChunRong; Chen, DaWei

    2011-01-01

    The conjugation of Ulex europaeus agglutinin I (UEAI) onto surface of liposomes has been demonstrated to effectively improve the intestinal absorption of antigen, subsequently induced strong mucosal and systemic immune responses. In this context, we prepared bovine serum albumin (BSA)-encapsulating UEAI-modified liposomes (UEAI-LIP) and unmodified ones (LIP). The specific bioadhesion on mice gastro-intestinal mucosa was studied ex vivo. An important increase of interaction between UEAI-conjugated liposomes and the intestinal segments with Peyer's Patches (PPs) was observed compared with the unconjugated one (p<0.01). However, under the presence of α-L-fucose, which is the reported specific sugar for UEAI, specifically inhibited the activity of these conjugates. The immune-stimulating activity in vivo was studied by measuring immunoglobulin G (IgG) levels in serum and immunoglobulin A (IgA) levels in intestinal mucosal secretions following oral administration of BSA solution, LIP and UEAI-LIP in mice. Results indicate that antigen encapsulated in liposomes, especially the UEAI-modified ones, was favorable for inducing immune response. At 42 d after the first immunization, the highest IgG and IgA antibody levels produced by UEAI-LIP occurred, respectively showing 4.4-fold and 5-fold higher levels compared to those of the groups receiving BSA alone. This data demonstrated high potential of UEAI-modified liposomes for their use as carrier for oral vaccines.

  16. Expression of the Galanthus nivalis agglutinin (GNA) gene in transgenic potato plants confers resistance to aphids.

    Science.gov (United States)

    Mi, Xiaoxiao; Liu, Xue; Yan, Haolu; Liang, Lina; Zhou, Xiangyan; Yang, Jiangwei; Si, Huaijun; Zhang, Ning

    2017-01-01

    Aphids, the largest group of sap-sucking pests, cause significant yield losses in agricultural crops worldwide every year. The massive use of pesticides to combat this pest causes severe damage to the environment, putting in risk the human health. In this study, transgenic potato plants expressing Galanthus nivalis agglutinin (GNA) gene were developed using CaMV 35S and ST-LS1 promoters generating six transgenic lines (35S1-35S3 and ST1-ST3 corresponding to the first and second promoter, respectively). Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the GNA gene was expressed in leaves, stems and roots of transgenic plants under the control of the CaMV 35S promoter, while it was only expressed in leaves and stems under the control of the ST-LS1 promoter. The levels of aphid mortality after 5 days of the inoculation in the assessed transgenic lines ranged from 20 to 53.3%. The range of the aphid population in transgenic plants 15 days after inoculation was between 17.0±1.43 (ST2) and 36.6±0.99 (35S3) aphids per plant, which corresponds to 24.9-53.5% of the aphid population in non-transformed plants. The results of our study suggest that GNA expressed in transgenic potato plants confers a potential tolerance to aphid attack, which appears to be an alternative against the use of pesticides in the future. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  17. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  18. Precocious development of lectin (Ulex europaeus agglutinin I) receptors in dome epithelium of gut-associated lymphoid tissues.

    Science.gov (United States)

    Roy, M J

    1987-06-01

    Dome epithelium (DE), the tissue covering lymphoid domes of gut-associated lymphoid tissues, was examined in both adult and neonatal rabbit appendix or sacculus rotundus to determine if dome epithelial cells matured earlier than epithelial cells covering adjacent villi. The localization of well-differentiated epithelial cells in rabbit gut-associated lymphoid tissues (GALT) was accomplished histochemically by use of molecular probes: fluorescein isothiocyanate or horseradish peroxidase conjugates of Ulex europaeus agglutinin I (UEA), a lectin specific for terminal L-fucose molecules on certain glycoconjugates. The villus epithelial cells of newborn and 2-, 5-, or 10-day-old rabbits did not bind UEA, but between the twelfth and fifteenth days of postnatal life, UEA receptors were expressed by well-differentiated villus epithelial cells. In contrast to villus epithelium, DE in appendix and sacculus rotundus of neonatal rabbits expressed UEA receptors two days after birth, a feature that distinguished the DE of neonatal GALT for the next two weeks. In adult rabbits, UEA receptors were associated with dome epithelial cells extending from the mouths of glandular crypts to the upper domes; in contrast to the domes, UEA receptors were only present on well-differentiated epithelial cells at the villus tips. Results suggested that in neonatal rabbits most dome epithelial cells developed UEA receptors shortly after birth, reflecting precocious development of DE as compared to villus epithelium. In adult rabbit dome epithelium UEA receptors appeared on dome epithelial cells as they left the glandular crypts, representing accelerated epithelial maturation.

  19. The soybean-Phytophthora resistance locus Rps1-k encompasses coiled coil-nucleotide binding-leucine rich repeat-like genes and repetitive sequences

    Directory of Open Access Journals (Sweden)

    Bhattacharyya Madan K

    2008-03-01

    Full Text Available Abstract Background A series of Rps (resistance to Pytophthora sojae genes have been protecting soybean from the root and stem rot disease caused by the Oomycete pathogen, Phytophthora sojae. Five Rps genes were mapped to the Rps1 locus located near the 28 cM map position on molecular linkage group N of the composite genetic soybean map. Among these five genes, Rps1-k was introgressed from the cultivar, Kingwa. Rps1-k has been providing stable and broad-spectrum Phytophthora resistance in the major soybean-producing regions of the United States. Rps1-k has been mapped and isolated. More than one functional Rps1-k gene was identified from the Rps1-k locus. The clustering feature at the Rps1-k locus might have facilitated the expansion of Rps1-k gene numbers and the generation of new recognition specificities. The Rps1-k region was sequenced to understand the possible evolutionary steps that shaped the generation of Phytophthora resistance genes in soybean. Results Here the analyses of sequences of three overlapping BAC clones containing the 184,111 bp Rps1-k region are reported. A shotgun sequencing strategy was applied in sequencing the BAC contig. Sequence analysis predicted a few full-length genes including two Rps1-k genes, Rps1-k-1 and Rps1-k-2. Previously reported Rps1-k-3 from this genomic region 1 was evolved through intramolecular recombination between Rps1-k-1 and Rps1-k-2 in Escherichia coli. The majority of the predicted genes are truncated and therefore most likely they are nonfunctional. A member of a highly abundant retroelement, SIRE1, was identified from the Rps1-k region. The Rps1-k region is primarily composed of repetitive sequences. Sixteen simple repeat and 63 tandem repeat sequences were identified from the locus. Conclusion These data indicate that the Rps1 locus is located in a gene-poor region. The abundance of repetitive sequences in the Rps1-k region suggested that the location of this locus is in or near a

  20. Sequence-to-Sequence Prediction of Vehicle Trajectory via LSTM Encoder-Decoder Architecture

    OpenAIRE

    Park, Seong Hyeon; Kim, ByeongDo; Kang, Chang Mook; Chung, Chung Choo; Choi, Jun Won

    2018-01-01

    In this paper, we propose a deep learning based vehicle trajectory prediction technique which can generate the future trajectory sequence of surrounding vehicles in real time. We employ the encoder-decoder architecture which analyzes the pattern underlying in the past trajectory using the long short-term memory (LSTM) based encoder and generates the future trajectory sequence using the LSTM based decoder. This structure produces the $K$ most likely trajectory candidates over occupancy grid ma...

  1. Influence of divalent metal on the decomposition products of hydrotalcite-like ternary systems M{sup II}-Al-Cr (M{sup II} = Zn, Cd)

    Energy Technology Data Exchange (ETDEWEB)

    Perez, M.R.; Crespo, I.; Ulibarri, M.A.; Barriga, C. [Departamento de Quimica Inorganica e Ingenieria Quimica, Campus de Rabanales, Universidad de Cordoba, Cordoba (Spain); Rives, V. [GIR-QUESCAT, Departamento de Quimica Inorganica, Universidad de Salamanca, Salamanca (Spain); Fernandez, J.M., E-mail: um1feroj@uco.es [Departamento de Quimica Inorganica e Ingenieria Quimica, Campus de Rabanales, Universidad de Cordoba, Cordoba (Spain)

    2012-02-15

    Highlights: Black-Right-Pointing-Pointer LDHs M{sup II}-Al-Cr (M = Zn, Cd) with Cr in the layer or interlayer have been prepared. Black-Right-Pointing-Pointer LDHs Zn-Al or Zn-Cr decompose by heating forming ZnO and ZnAl{sub 2}O{sub 4} or ZnO and ZnCr{sub 2}O{sub 4}. Black-Right-Pointing-Pointer LDHs Zn-Al-Cr give rise to the formation of ZnO and the mixed spinel ZnAl{sub 2-x}Cr{sub x}O{sub 4}. Black-Right-Pointing-Pointer LDH Cd-Al-Cr shows the formation of CdO, CdCr{sub 2-x}Al{sub x}O{sub 4}, and (Al, Cr){sub 2}O{sub 3} mixed oxide. Black-Right-Pointing-Pointer Calcination of the CdAl-CrO{sub 4} give rise to (Al, Cr){sub 2}O{sub 3} as the majority phase. - Abstract: Layered double hydroxides (LDHs) containing M{sup II}, Al{sup III}, and Cr{sup III} in the brucite-like layers (M = Cd, Zn) with different starting Al/Cr molar ratios and nitrate/carbonate as the interlayer anion have been prepared following the coprecipitation method at a constant pH: Zn{sup II}-Al{sup III}-Cr{sup III}-CO{sub 3}{sup 2-} at pH = 10, and Cd{sup II}-Al{sup III}-Cr{sup III}-NO{sub 3}{sup -} at pH = 8. Two additional M{sup II},Al{sup III}-LDH samples (M = Cd, Zn) with chromate ions (CrO{sub 4}{sup 2-}) in the interlayer have been prepared by ionic exchange at pH = 9 and 8, respectively, starting from M{sup II}-Al{sup III}-NO{sub 3}{sup -}. The samples have been characterised by absorption atomic spectrometry, powder X-ray diffraction (PXRD), FT-IR spectroscopy and transmission electron microscopy (TEM). Their thermal stability has been assessed by DTA-TG and mass spectrometric analysis of the evolved gases. The PXRD patterns of the solids calcined at 800 Degree-Sign C show diffraction lines corresponding to ZnO and ZnAl{sub 2-x}Cr{sub x}O{sub 4} for the Zn-containing samples, and diffraction lines attributed to CdO and CdCr{sub 2}O{sub 4} and (Al,Cr){sub 2}O{sub 3} for the Cd-containing ones. Additionally a minority oxide, Cd{sub 2}CrO{sub 5}, is observed to Cd{sup II}-Al{sup III

  2. Preparation and activity of Cu-Al mixed oxides via hydrotalcite-like precursors for the oxidation of phenol aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Alejandre, A.; Medina, F.; Rodriguez, X.; Salagre, P.; Sueiras, J.E.

    1999-12-10

    The authors performed thermogravimetric analysis (TGA), X-ray diffraction (XRD), BET areas, and FT-IR spectroscopy to characterize copper-aluminium mixed-oxide samples with Cu/Al ratios between 0.5 and 3.0. The thermal stability, crystallinity, and purity of the materials depended on the Cu/Al atomic ratio. The FT-IR and TG detected carbonate (mainly) and nitrate as counteranions which interact in the interlayer region. The authors found loosely bound carbonate and nitrate anions and one strongly bound type of carbonate. They used dynamic XRD experiments to study the evolution of phases during calcination. All the samples after calcination showed well-dispersed CuO and/or CuAl{sub 2}O{sub 4} phases. They also tested their catalytic behavior for the oxidation of 5 g/l phenol aqueous solutions using a triphasic tubular reactor working in a trickle-bed regime and air with an oxygen partial pressure of 0.9 MPa at a temperature reaction of 413 K. Phenol conversion decreased continuously over time for the samples calcined at lower temperatures (673 K). This is because of continuous loss of the CuO phase by elution and the formation of a new phase like copper oxalate on the surface of the copper catalysts which also elutes with time XRD shows that samples calcined at higher temperatures (1,073 K) and after HCl treatment (0.1 M) to avoid the CuO phase, have a pure copper aluminate phase. This CuAl{sub 2}O{sub 4} phase reaches steady activity plateaus in the 55--65% range of phenol conversion. The triphasic tubular reactor using trickle-bed regime largely avoids polymer formation as a catalyst-deactivation process.

  3. Distribution of binding sites for the plant lectin Ulex europaeus agglutinin I on primary sensory neurones in seven different mammalian species.

    Science.gov (United States)

    Gerke, Michelle B; Plenderleith, Mark B

    2002-01-01

    There is an increasing body of evidence to suggest that different functional classes of neurones express characteristic cell-surface carbohydrates. Previous studies have shown that the plant lectin Ulex europaeus agglutinin-I (UEA) binds to a population of small to medium diameter primary sensory neurones in rabbits and humans. This suggests that a fucose-containing glycoconjugate may be expressed by nociceptive primary sensory neurones. In order to determine the extent to which this glycoconjugate is expressed by other species, in the current study, we have examined the distribution of UEA-binding sites on primary sensory neurones in seven different mammals. Binding sites for UEA were associated with the plasma membrane and cytoplasmic granules of small to medium dorsal root ganglion cells and their axon terminals in laminae I-III of the grey matter of the spinal cord, in the rabbit, cat and marmoset monkey. However, no binding was observed in either the dorsal root ganglia or spinal cord in the mouse, rat, guinea pig or flying fox. These results indicate an inter-species variation in the expression of cell-surface glycoconjugates on mammalian primary sensory neurones.

  4. Fine mapping of powdery mildew resistance genes PmTb7A.1 and PmTb7A.2 in Triticum boeoticum (Boiss.) using the shotgun sequence assembly of chromosome 7AL.

    Science.gov (United States)

    Chhuneja, Parveen; Yadav, Bharat; Stirnweis, Daniel; Hurni, Severine; Kaur, Satinder; Elkot, Ahmed Fawzy; Keller, Beat; Wicker, Thomas; Sehgal, Sunish; Gill, Bikram S; Singh, Kuldeep

    2015-10-01

    A novel powdery mildew resistance gene and a new allele of Pm1 were identified and fine mapped. DNA markers suitable for marker-assisted selection have been identified. Powdery mildew caused by Blumeria graminis is one of the most important foliar diseases of wheat and causes significant yield losses worldwide. Diploid A genome species are an important genetic resource for disease resistance genes. Two powdery mildew resistance genes, identified in Triticum boeoticum (A(b)A(b)) accession pau5088, PmTb7A.1 and PmTb7A.2 were mapped on chromosome 7AL. In the present study, shotgun sequence assembly data for chromosome 7AL were utilised for fine mapping of these Pm resistance genes. Forty SSR, 73 resistance gene analogue-based sequence-tagged sites (RGA-STS) and 36 single nucleotide polymorphism markers were designed for fine mapping of PmTb7A.1 and PmTb7A.2. Twenty-one RGA-STS, 8 SSR and 13 SNP markers were mapped to 7AL. RGA-STS markers Ta7AL-4556232 and 7AL-4426363 were linked to the PmTb7A.1 and PmTb7A.2, at a genetic distance of 0.6 and 6.0 cM, respectively. The present investigation established that PmTb7A.1 is a new powdery mildew resistance gene that confers resistance to a broad range of Bgt isolates, whereas PmTb7A.2 most probably is a new allele of Pm1 based on chromosomal location and screening with Bgt isolates showing differential reaction on lines with different Pm1 alleles. The markers identified to be linked to the two Pm resistance genes are robust and can be used for marker-assisted introgression of these genes to hexaploid wheat.

  5. Non-invasive glucagon-like peptide-1 receptor imaging in pancreas with {sup 18}F-Al labeled Cys{sup 39}-exendin-4

    Energy Technology Data Exchange (ETDEWEB)

    Mi, Baoming [Department of Nuclear Medicine, The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu, 215006 (China); Department of Nuclear Medicine, Affiliated Hospital of Jiangnan University (Wuxi 4th People' s Hospital), Wuxi, Jiangsu, 214062 (China); Xu, Yuping [Key Laboratory of Nuclear Medicine, Ministry of Health, Jiangsu Key Laboratory of Molecular Nuclear Medicine, Jiangsu Institute of Nuclear Medicine, Wuxi, Jiangsu, 214063 (China); Nanjing Medical University, Nanjing, Jiangsu, 210029 (China); Pan, Donghui; Wang, Lizhen; Yang, Runlin [Key Laboratory of Nuclear Medicine, Ministry of Health, Jiangsu Key Laboratory of Molecular Nuclear Medicine, Jiangsu Institute of Nuclear Medicine, Wuxi, Jiangsu, 214063 (China); Yu, Chunjing; Wan, Weixing [Department of Nuclear Medicine, Affiliated Hospital of Jiangnan University (Wuxi 4th People' s Hospital), Wuxi, Jiangsu, 214062 (China); Wu, Yiwei, E-mail: wuyiwei3988@gmail.com [Department of Nuclear Medicine, The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu, 215006 (China); Yang, Min, E-mail: ymzfk@yahoo.com.hk [Key Laboratory of Nuclear Medicine, Ministry of Health, Jiangsu Key Laboratory of Molecular Nuclear Medicine, Jiangsu Institute of Nuclear Medicine, Wuxi, Jiangsu, 214063 (China); Nanjing Medical University, Nanjing, Jiangsu, 210029 (China)

    2016-02-26

    Purpose: Glucagon-like peptide-1 receptor (GLP-1R) is abundantly expressed on beta cells and may be an ideal target for the pancreas imaging. Monitoring the GLP-1R of pancreas could be benefit for understanding the pathophysiology of diabetes. In the present study, {sup 18}F-Al labeled exendin-4 analog, {sup 18}F-Al-NOTA-MAL-Cys{sup 39}-exendin-4, was evaluated for PET imaging GLP-1R in the pancreas. Methods: The targeting of {sup 18}F-Al labeled exendin-4 analog was examined in healthy and streptozotocin induced diabetic rats. Rats were injected with {sup 18}F-Al-NOTA-MAL-Cys{sup 39}-exendin-4 and microPET imaging was performed at 1 h postinjection, followed by ex vivo biodistribution. GLP-1R expression in pancreas was determined through post mortern examinations. Results: The pancreas of healthy rats was readily visualized after administration of {sup 18}F-Al-NOTA-MAL-Cys{sup 39}-exendin-4, whereas the pancreas of diabetic rats, as well as those from rats co-injected with excess of unlabeled peptides, was barely visible by microPET. At 60 min postinjection, the pancreatic uptakes were 1.02 ± 0.15%ID/g and 0.23 ± 0.05%ID/g in healthy and diabetic rats respectively. Under block, the pancreatic uptakes of non-diabetic rats reduced to 0.21 ± 0.07%ID/g at the same time point. Biodistribution data and IHC staining confirmed the findings of the microPET imaging. Conclusion: The favorable preclinical data indicated that {sup 18}F-Al-NOTA-MAL-Cys{sup 39}-exendin-4may be suitable for non-invasive monitoring functional pancreatic beta cells.

  6. SMRT sequencing data for Garcinia mangostana L. variety Mesta

    Directory of Open Access Journals (Sweden)

    Mohd Razik Midin

    2017-06-01

    Full Text Available The “Queen of Fruits” mangosteen (Garcinia mangostana L. produces commercially important fruits with desirable taste of flesh and pericarp rich in xanthones with medicinal properties. To date, only limited knowledge is available on the cytogenetics and genome sequences of a common variety of mangosteen (Abu Bakar et al., 2016 [1]. Here, we report the first single-molecule real-time (SMRT sequencing data from whole genome sequencing of mangosteen of Mesta variety. Raw reads of the SMRT sequencing project can be obtained from SRA database with the accession numbers SRX2718652 until SRX2718659.

  7. Complete Genome Sequence of EtG, the First Phage Sequenced from Erwinia tracheiphila.

    Science.gov (United States)

    Andrade-Domínguez, Andrés; Kolter, Roberto; Shapiro, Lori R

    2018-02-22

    Erwinia tracheiphila is the causal agent of bacterial wilt of cucurbits. Here, we report the genome sequence of the temperate phage EtG, which was isolated from an E. tracheiphila -infected cucumber plant. Phage EtG has a linear 30,413-bp double-stranded DNA genome with cohesive ends and 45 predicted open reading frames. Copyright © 2018 Andrade-Domínguez et al.

  8. Evaluation of microstructural development in electron beam melted Ti-6Al-4V

    International Nuclear Information System (INIS)

    Safdar, A.; Wei, L.-Y.; Snis, A.; Lai, Z.

    2012-01-01

    In the current work an investigation of the microstructures of EBM built Ti-6Al-4V test bars has been performed using OM, SEM, TEM and XRD. It has been found that the prior β phase, that formed during the initial solidification, possesses a column shaped morphology with growing direction parallel to built direction. Typical (α + β) structures namely Widmanstätten α platelets with rod-like β phase formed on the interfaces of the fine α grains, have been observed in the columnar prior β grains. Grain boundary α phase was found to be formed around the boundaries of the columnar prior β grains. Different phases present in the parts, especially the BCC β phases have been characterized. The TEM/EDX results indicate very high V composition in the β phase. Results of TEM/SAED and XRD also revealed that a superlattice structure could be present in the β phase. Phase transformation sequence is discussed according to the processing history and the microstructures observed. - Highlights: ► α + β and individual β phase is observed and characterized by SEM, TEM and XRD. ► β-phase is identified as rod-like structure embedded in α matrix and platelets. ► Phase transformation sequence is discussed as per thermal history and microstructures.

  9. Al-Si/Al2O3 in situ composite prepared by displacement reaction of CuO/Al system

    Directory of Open Access Journals (Sweden)

    Zhang Jing

    2010-02-01

    Full Text Available Al2O3 particle-reinforced ZL109 composite was prepared by in situ reaction between CuO and Al. The microstructure was observed by means of OM, SEM and TEM. The Al2O3 particles in sub-micron sizes distribute uniformly in the matrix, and the Cu displaced from the in situ reaction forms net-like alloy phases with other alloy elements. The hardness and the tensile strength of the composites at room temperature have a slight increase as compared to that of the matrix. However, the tensile strength at 350 ℃ has reached 90.23 MPa, or 16.92 MPa higher than that of the matrix. The mechanism of the reaction in the CuO/Al system was studied by using of differential scanning calorimetry(DSC and thermodynamic calculation. The reaction between CuO and Al involves two steps. First, CuO reacts with Al to form Cu2O and Al2O3 at the melting temperature of the matrix alloy, and second, Cu2O reacts with Al to form Cu and Al2O3 at a higher temperature. At ZL109 casting temperature of 750–780 ℃, the second step can also take place because of the effect of exothermic reaction of the first step.

  10. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Science.gov (United States)

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  11. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  12. Draft Genome Sequences of Four Hospital-Associated Pseudomonas putida Isolates.

    Science.gov (United States)

    Mustapha, Mustapha M; Marsh, Jane W; Ezeonwuka, Chinelo D; Pasculle, Anthony W; Pacey, Marissa P; Querry, Ashley M; Muto, Carlene A; Harrison, Lee H

    2016-09-29

    We present here the draft genome sequences of four Pseudomonas putida isolates belonging to a single clone suspected for nosocomial transmission between patients and a bronchoscope in a tertiary hospital. The four genome sequences belong to a single lineage but contain differences in their mobile genetic elements. Copyright © 2016 Mustapha et al.

  13. Identification of a nuclear matrix attachment region like sequence in the last intron of PI3Kγ

    International Nuclear Information System (INIS)

    Dai Bingbing; Ying Lei; Cai Rong; Li Ying; Zhang Xingqian; Lu Jian; Qian Guanxiang

    2006-01-01

    MARs are not only the structure bases of chromatin higher order structure but also have much biological significance. In this study, the whole sequence of about 100 kb in length from BAC clone of GS1-223D4 (GI: 5931478), in which human PI3Kγ gene is localized, was analyzed by two online-based computer programs, MARFinder and SMARTest. A strong potential MAR was predicted in the last and largest intron of PI3Kγ. The predicted 2 kb MAR, we refer to PIMAR, was further analyzed through biochemical methods in vitro and in vivo. The results showed that the PIMAR could be associated with nuclear matrices from HeLa cells both in vitro and in vivo. Further reporter gene analysis showed that in the transient transfection the expression of reporter gene linked with reversed PIMAR was repressed slightly, while in stably integrated state, the luciferase reporter both linked with reversed and orientated PIMAR was enhanced greatly in NIH-3T3 and K-562. These results suggest that the PIMAR maybe has the capacity of shielding integrated heterogeneous gene from chromatin position effect. Through combination of computer program analysis with confirmation by biochemical methods, we identified, for First time, a 2 kb matrix attachment region like sequence in the last intron of human PI3Kγ

  14. Use of Ulex europaeus agglutinin I (UEAI) to distinguish vascular and "pseudovascular" invasion in transitional cell carcinoma of bladder with lamina propria invasion.

    Science.gov (United States)

    Larsen, M P; Steinberg, G D; Brendler, C B; Epstein, J I

    1990-01-01

    We used Ulex europaeus agglutinin I (UEAI)-immunoperoxidase staining of endothelium to study the accuracy of hematoxylin and eosin (H&E) diagnosis, occurrence, and significance of lymphvascular invasion in transitional cell carcinoma (TCC) of the bladder invading the lamina propria (Stage T1). Original histologic slides from cases (1967 to 1985) with and without vascular invasion were destained and restained with UEAI-immunoperoxidase. Only 5 of 36 biopsies originally diagnosed with lymphvascular invasion had tumor nests within endothelium-lined spaces. The 31 negative biopsies had extensive retraction artifacts lined by connective tissue and fibroblasts around tumor nests. Thirty-five control biopsies remained negative for lymphvascular invasion. Clinical follow-up of the five patients with proven lymphvascular invasion found three without progression of disease 3 to 10 yr postbiopsy, one dead of a local recurrence of TCC 1.67 yr postbiopsy, and one lost to follow-up. Based on this study, we feel that lymphvascular invasion by TCC in Stage T1 tumors is unusual, is frequently misdiagnosed on H&E stain, and does not necessarily portend a poor prognosis.

  15. Citrus and Prunuscopia-like retrotransposons.

    Science.gov (United States)

    Asíns, M J; Monforte, A J; Mestre, P F; Carbonell, E A

    1999-08-01

    Many of the world's most important citrus cultivars ("Washington Navel", satsumas, clementines) have arisen through somatic mutation. This phenomenon occurs fairly often in the various species and varieties of the genus.The presence of copia-like retrotransposons has been investigated in fruit trees, especially citrus, by using a PCR assay designed to detect copia-like reverse transcriptase (RT) sequences. Amplification products from a genotype of each the following species Citrus sinensis, Citrus grandis, Citrus clementina, Prunus armeniaca and Prunus amygdalus, were cloned and some of them sequenced. Southern-blot hybridization using RT clones as probes showed that multiple copies are integrated throughout the citrus genome, while only 1-3 copies are detected in the P. armeniaca genome, which is in accordance with the Citrus and Prunus genome sizes. Sequence analysis of RT clones allowed a search for homologous sequences within three gene banks. The most similar ones correspond to RT domains of copia-like retrotransposons from unrelated plant species. Cluster analysis of these sequences has shown a great heterogeneity among RT domains cloned from the same genotype. This finding supports the hypothesis that horizontal transmission of retrotransposons has occurred in the past. The species presenting a RT sequence most similar to citrus RT clones is Gnetum montanum, a gymnosperm whose distribution area coincides with two of the main centers of origin of Citrus spp. A new C-methylated restriction DNA fragment containing a RT sequence is present in navel sweet oranges, but not in Valencia oranges from which the former originated suggesting, that retrotransposon activity might be, at least in part, involved in the genetic variability among sweet orange cultivars. Given that retrotransposons are quite abundant throughout the citrus genome, their activity should be investigated thoroughly before commercializing any transgenic citrus plant where the transgene(s) is part

  16. Next-Generation Sequencing in Neuropathologic Diagnosis of Infections of the Nervous System (Open Access)

    Science.gov (United States)

    2016-06-13

    nervous system ABSTRACT Objective: To determine the feasibility of next-generation sequencing (NGS) microbiome ap- proaches in the diagnosis of infectious...V, van Doorn HR, Nghia HD, et al. Identification of a new cyclovirus in cerebrospinal fluid of patients with acute central nervous system infections...Kumar, et al. system Next-generation sequencing in neuropathologic diagnosis of infections of the nervous This information is current as of June 13

  17. ORF Alignment: NC_006351 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available racterization Of The Native Fetuin-Binding ... Protein Scilla Campanulata Agglutinin (Scafet): A Nove...in-Binding Protein ... Scilla Campanulata Agglutinin (Scafet): A Novel Two...nding Protein ... Scilla Campanulata Agglutinin (Scafet): A Novel Two ... Domain Lectin pdb|1D... Protein ... Scilla Campanulata Agglutinin (Scafet): A Novel Two ... Domain Lectin pdb|1DLP|B ...Chain B, Structural ... Characterization Of The Native Fetuin-Binding Protein ... Scilla Campanulata Agglutinin (Scafe

  18. Repeated DNA sequences in fungi

    Energy Technology Data Exchange (ETDEWEB)

    Dutta, S K

    1974-11-01

    Several fungal species, representatives of all broad groups like basidiomycetes, ascomycetes and phycomycetes, were examined for the nature of repeated DNA sequences by DNA:DNA reassociation studies using hydroxyapatite chromatography. All of the fungal species tested contained 10 to 20 percent repeated DNA sequences. There are approximately 100 to 110 copies of repeated DNA sequences of approximately 4 x 10/sup 7/ daltons piece size of each. Repeated DNA sequence homoduplexes showed on average 5/sup 0/C difference of T/sub e/50 (temperature at which 50 percent duplexes dissociate) values from the corresponding homoduplexes of unfractionated whole DNA. It is suggested that a part of repetitive sequences in fungi constitutes mitochondrial DNA and a part of it constitutes nuclear DNA. (auth)

  19. Molecular characterization of Vulmar1, a complete mariner transposon of sugar beet and diversity of mariner- and En/Spm-like sequences in the genus Beta.

    Science.gov (United States)

    Jacobs, Gunnar; Dechyeva, Daryna; Menzel, Gerhard; Dombrowski, Cora; Schmidt, Thomas

    2004-12-01

    Transposons of the Tc1-mariner superfamily are widespread in eukaryotic genomes. We have isolated the mariner element Vulmar1 from Beta vulgaris L., which is 3909 bp long and bordered by perfect terminal inverted repeats of 32 bp with homology to terminal inverted repeats of transposons from soybean and rice. According to a characteristic amino acid signature, Vulmar1 can be assigned to the DD39D group of mariner transposons. Vulmar1 is flanked by a 5'-TA-3' target site duplication that is typical for mariner transposons. Southern hybridization revealed that mariner-like copies are highly abundant in Beta species, and sequence analysis of 10 transposase fragments from representative species of the four Beta sections revealed an identity between 34% and 100% after conceptual translation. By fluorescent in situ hybridization, Vulmar1 was detected in distal euchromatin as well as in some intercalary and pericentromeric regions of all B. vulgaris chromosomes. In addition, using PCR, we were able to amplify fragments of the transposase gene of En/Spm-like transposons in the genus Beta. En/Spm-like transposase sequences are highly amplified in four Beta sections and showed a considerable degree of conservation (88.5-100%) at the protein level, while the homology to corresponding regions of En/Spm transposons of other plant species ranges from 49.5% to 62.5%. By fluorescent in situ hybridization, En/Spm-like transposon signals of strong intensity were detected on all chromosomes of B. vulgaris.

  20. Complete genome sequence of Nakamurella multipartita type strain (Y-104).

    Science.gov (United States)

    Tice, Hope; Mayilraj, Shanmugam; Sims, David; Lapidus, Alla; Nolan, Matt; Lucas, Susan; Glavina Del Rio, Tijana; Copeland, Alex; Cheng, Jan-Fang; Meincke, Linda; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavromatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Detter, John C; Brettin, Thomas; Rohde, Manfred; Göker, Markus; Bristow, Jim; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Chen, Feng

    2010-03-30

    Nakamurella multipartita (Yoshimi et al. 1996) Tao et al. 2004 is the type species of the monospecific genus Nakamurella in the actinobacterial suborder Frankineae. The nonmotile, coccus-shaped strain was isolated from activated sludge acclimated with sugar-containing synthetic wastewater, and is capable of accumulating large amounts of polysaccharides in its cells. Here we describe the features of the organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of a member of the family Nakamurellaceae. The 6,060,298 bp long single replicon genome with its 5415 protein-coding and 56 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  1. Influence of copper content on microstructure development of AlSi9Cu3 alloy

    Directory of Open Access Journals (Sweden)

    Brodarac Zovko Z.

    2014-01-01

    Full Text Available Microstructure development and possible interaction of present elements have been determined in charge material of EN AlSi9Cu3 quality. Literature review enables prediction of solidification sequence. Modelling of equilibrium phase diagram for examined chemical composition has been performed, which enables determination of equilibrium solidification sequence. Microstructural investigation indicated distribution and morphology of particular phase. Metallographic analysis tools enable exact determination of microstructural constituents: matrix αAl, eutectic αAl+βSi, iron base intermetallic phase - Al5FeSi, Alx(Fe,MnyCuuSiw and/or Alx(Fe,MnyMgzCuuSiw and copper base phases in ternary eutectic morphology Al-Al2Cu-Si and in complex intermetallic ramified morphology Alx(Fe,MnyMgzSiuCuw. Microstructure development examination reveals potential differences due to copper content which is prerequisite for high values of final mechanical, physical and technological properties of cast products.

  2. Production of recombinant AAV vectors encoding insulin-like growth factor I is enhanced by interaction among AAV rep regulatory sequences

    Directory of Open Access Journals (Sweden)

    Dilley Robert

    2009-01-01

    Full Text Available Abstract Background Adeno-associated virus (AAV vectors are promising tools for gene therapy. Currently, their potential is limited by difficulties in producing high vector yields with which to generate transgene protein product. AAV vector production depends in part upon the replication (Rep proteins required for viral replication. We tested the hypothesis that mutations in the start codon and upstream regulatory elements of Rep78/68 in AAV helper plasmids can regulate recombinant AAV (rAAV vector production. We further tested whether the resulting rAAV vector preparation augments the production of the potentially therapeutic transgene, insulin-like growth factor I (IGF-I. Results We constructed a series of AAV helper plasmids containing different Rep78/68 start codon in combination with different gene regulatory sequences. rAAV vectors carrying the human IGF-I gene were prepared with these vectors and the vector preparations used to transduce HT1080 target cells. We found that the substitution of ATG by ACG in the Rep78/68 start codon in an AAV helper plasmid (pAAV-RC eliminated Rep78/68 translation, rAAV and IGF-I production. Replacement of the heterologous sequence upstream of Rep78/68 in pAAV-RC with the AAV2 endogenous p5 promoter restored translational activity to the ACG mutant, and restored rAAV and IGF-I production. Insertion of the AAV2 p19 promoter sequence into pAAV-RC in front of the heterologous sequence also enabled ACG to function as a start codon for Rep78/68 translation. The data further indicate that the function of the AAV helper construct (pAAV-RC, that is in current widespread use for rAAV production, may be improved by replacement of its AAV2 unrelated heterologous sequence with the native AAV2 p5 promoter. Conclusion Taken together, the data demonstrate an interplay between the start codon and upstream regulatory sequences in the regulation of Rep78/68 and indicate that selective mutations in Rep78/68 regulatory elements

  3. Chlamydia trachomatis Mip-like protein

    DEFF Research Database (Denmark)

    Lundemose, AG; Rousch, DA; Birkelund, Svend

    1992-01-01

    venereum (LGV) biovar) is presented. The sequence shows high similarity to the legionella Mip protein and its C-terminal region, like that of the legionella Mip, has high amino acid similarity to eukaryotic and prokaryotic FK506-binding proteins. The chlamydial mip-like gene was detected by polymerase...

  4. Tumor affinity of radiolabeled peanut agglutinin compared with that of Ga-67 citrate in animal models

    International Nuclear Information System (INIS)

    Yokoyama, K.; Aburano, T.; Watanabe, N.; Kawabata, S.; Ishida, H.; Mukai, K.; Tonami, N.; Hisada, K.

    1985-01-01

    Peanut agglutinin (PNA) binds avidly to the immunodominant group of the tumor associated T antigen. The purpose of this study was to evaluate oncodiagnostic potential of radiolabeled PNA in animal models. PNA was labeled with I-125 or I-131 by Iodogen and also with In-111 by cyclic DTPA anhydride. The biological activity of PNA was examined by a hemaglutination titer with a photometer before and after labeling. Animal tumor models used were Lewis Lung Cancer(LLC), B-16 Melanotic Melanoma(MM), Yoshida Sarcoma(YS), Ehrlich Ascites Tumor(EAT and Hepatoma AH109A(HAH). Inflammatory tissue induced by turpentine oil was used as an abscess model. Serial scintigraphic images were obtained following IV injections of 100 μCi of I-131 or In-111-DTPA-PNA. The tumor affinity of Ga-67 citrate was studied to compare that of radiolabeled PNA. Tissue biodistribution was studied in EAT bearing mice. All of these tumor models except HAH were clearly visible by radiolabeled PNA without subtraction techniques. In the models of LLC and EAT, PNA showed the better accumulation into the tumor tissue than Ga-67 citrate. In YS and MM, PNA represented almost the same accumulation as Ga-67 citrate. The localization of PNA into abscess tissue wasn't found although Ga-67 citrate markedly accumulated into abscess tissue as well as tumor tissue. The clearance of PNA from tumor was slower than those from any other organs. Tumor to muscle ratio was 5.1 at 48hrs. and tumor to blood ratio increased with time to 2.3 at 96hrs. These results suggested that radiolabeled PNA may have a potential in the detection of tumor

  5. Immunochemical studies on the N-acetyllactosamine beta-(1----6)-linked trisaccharide specificity of Ricinus communis agglutinin.

    Science.gov (United States)

    Wu, A M; Sugii, S; Gruezo, F G; Kabat, E A

    1988-07-15

    The combining site of Ricinus communis agglutinin (RCA1) was studied by quantitative precipitin and precipitin inhibition assays. Of 31 complex carbohydrates tested, all except active and inactive antifreeze glycoproteins, Streptococcus group C polysaccharide, and native rat salivary glycoprotein, reacted strongly, and 22 completely precipitated the lectin, indicating that RCA1 has both a broad range of affinity and a low solubility of its carbohydrate-bound complex. Of the monosaccharides and glycosides tested for inhibition of precipitation, p-nitrophenyl beta-D-galactopyranoside was the best. It was about 6.4 times better than methyl beta-D-galactopyranoside. The beta anomer of glycosides of D-galactose was much more potent than the corresponding alpha anomer. Among the oligosaccharides tested, beta-D-Galp-(1----4)-beta-D-GlcpNAc-(1----6)-D-Gal was the best inhibitor, which was approximately 2/3 as active as p-nitrophenyl beta-D-galactopyranoside. It was approximately 1.4 times as active as beta-D-Gal-(1----4)-D-GlcNAc (N-acetyllactosamine), twice as active as beta-D-Gal-(1----3)-D-GlcNAc, and 4.5 times more active than lacto-N-tetraose. From the results, it can be concluded that; (a) hydrophobic interaction is important for binding; (b) the combining site of this lectin is at least as large as a trisaccharide; and (c) of the compounds studied, the trisaccharide beta-D-Galp-(1----4)-beta-D-GlcpNAc-(1----6)-D-Gal was the most complementary to the human blood group I Ma determinant beta-D-Galp-(1----4)-beta-D-GlcpNAc-(1----6)-D-Gal.

  6. Identity of the immunomodulatory proteins from garlic (Allium sativum) with the major garlic lectins or agglutinins.

    Science.gov (United States)

    Clement, Fatima; Pramod, Siddanakoppalu N; Venkatesh, Yeldur P

    2010-03-01

    Garlic (Allium sativum), an important medicinal spice, displays a plethora of biological effects including immunomodulation. Although some immunomodulatory proteins from garlic have been described, their identities are still unknown. The present study was envisaged to isolate immunomodulatory proteins from raw garlic, and examine their effects on certain cells of the immune system (lymphocytes, mast cells, and basophils) in relation to mitogenicity and hypersensitivity. Three protein components of approximately 13 kD (QR-1, QR-2, and QR-3 in the ratio 7:28:1) were separated by Q-Sepharose chromatography of 30 kD ultrafiltrate of raw garlic extract. All the 3 proteins exhibited mitogenic activity towards human peripheral blood lymphocytes, murine splenocytes and thymocytes. The mitogenicity of QR-2 was the highest among the three immunomodulatory proteins. QR-1 and QR-2 displayed hemagglutination and mannose-binding activities; QR-3 showed only mannose-binding activity. Immunoreactivity of rabbit anti-QR-1 and anti-QR-2 polyclonal antisera showed specificity for their respective antigens as well as mutual cross-reactivity; QR-3 was better recognized by anti-QR-2 (82%) than by anti-QR-1 (55%). QR-2 induced a 2-fold higher histamine release in vitro from leukocytes of atopic subjects compared to that of non-atopic subjects. In all functional studies, QR-2 was more potent compared to QR-1. Taken together, all these results indicate that the two major proteins QR-2 and QR-1 present in a ratio of 4:1 in raw garlic contribute to garlic's immunomodulatory activity, and their characteristics are markedly similar to the abundant Allium sativum agglutinins (ASA) I and II, respectively. Copyright 2010 Elsevier B.V. All rights reserved.

  7. Coherent light from E-field induced quantum coupling of exciton states in superlattice-like quantum wells

    DEFF Research Database (Denmark)

    Lyssenko, V. G.; Østergaard, John Erland; Hvam, Jørn Märcher

    1999-01-01

    Summary form only given. We focus on the ability to control the electronic coupling in coupled quantum wells with external E-fields leading to a strong modification of the coherent light emission, in particular at a bias where a superlattice-like miniband is formed. More specifically, we investig......Summary form only given. We focus on the ability to control the electronic coupling in coupled quantum wells with external E-fields leading to a strong modification of the coherent light emission, in particular at a bias where a superlattice-like miniband is formed. More specifically, we...... investigate a MBE-grown GaAs sample with a sequence of 15 single quantum wells having a successive increase of 1 monolayer in width ranging from 62 A to 102 A and with AlGaAs barriers of 17 Å....

  8. Tokay gecko photoreceptors achieve rod-like physiology with cone-like proteins.

    Science.gov (United States)

    Zhang, Xue; Wensel, Theodore G; Yuan, Ching

    2006-01-01

    The retinal photoreceptors of the nocturnal Tokay gecko (Gekko gekko) consist exclusively of rods by the criteria of morphology and key features of their light responses. Unlike cones, they display robust photoresponses and have relatively slow recovery times. Nonetheless, the major and minor visual pigments identified in gecko rods are of the cone type by sequence and spectroscopic behavior. In the ongoing search for the molecular bases for the physiological differences between cones and rods, we have characterized the molecular biology and biochemistry of the gecko rod phototransduction cascade. We have cloned cDNAs encoding all or part of major protein components of the phototransduction cascade by RT-PCR with degenerate oligonucleotides designed to amplify cone- or rod-like sequences. For all proteins examined we obtained only cone-like and never rod-like sequences. The proteins identified include transducin alpha (Galphat), phosphodiesterase (PDE6) catalytic and inhibitory subunits, cyclic nucleotide-gated channel (CNGalpha) and arrestin. We also cloned cDNA encoding gecko RGS9-1 (Regulator of G Protein Signaling 9, splice variant 1), which is expressed in both rods and cones of all species studied but is typically found at 10-fold higher concentrations in cones, and found that gecko rods contain slightly lower RGS9-1 levels than mammalian rods. Furthermore, we found that the levels of GTPase accelerating protein (GAP) activity and cyclic GMP (cGMP) phosphodiesterase activity were similar in gecko and mammalian rods. These results place substantial constraints on the critical changes needed to convert a cone into a rod in the course of evolution: The many features of phototransduction molecules conserved between those expressed in gecko rods and those expressed in cones cannot explain the physiological differences, whereas the higher levels of RGS9-1 and GAP activity in cones are likely among the essential requirements for the rapid photoresponses of cones.

  9. Changes in cell surface structure by viral transformation studied by binding of lectins differing in sugar specificity.

    Science.gov (United States)

    Tsuda, M; Kurokawa, T; Takeuchi, M; Sugino, Y

    1975-10-01

    Changes in cell surface structure by viral transformation were studied by examining changes in the binding of various lectins differing in carbohydrate specificities. Binding of lectins was assayed directly using cells grown in coverslips. The following 125I-lectins were used: Concanavalin-A (specific for glucose and mannose), wheat germ agglutinin (specific for N-acetylglucosamine), castor bean agglutinin (specific for galactose), Wistaria floribunda agglutinin (specific for N-acetylgalactosamine), and soybean agglutinin (specific for N-acetyl-galactosamine). Cells for a clone, SS7, transformed by bovine adenovirus type-3, were found to bind 5 to 6 times more Wistaria floribunda agglutinin than the normal counterpart cells (clone C31, from C3H mouse kidney). In contrast, the binding of soybean agglutinin, which has a sugar specificity similar to Wistaria floribunda agglutinin, to normal and transformed cells was similar. The binding of wheat germ agglutinin and castor bean agglutinin, respectively, to normal and transformed cells was also similar. However, normal cells bound twice as much concanavalin-A as transformed cells. Only half as much Wistaria floribunda agglutinin was bound to transformed cells when they had been dispersed with EDTA. These changes in the number of lectin binding sites on transformation are thought to reflect alteration of the cell surface structure. The amount of lectins bound per cell decreased with increase in cell density, especially in the case of binding of Wistaria floribunda agglutinin to normal cells.

  10. Aftershock Sequences and Seismic-Like Organization of Acoustic Events Produced by a Single Propagating Crack

    Science.gov (United States)

    Alizee, D.; Bonamy, D.

    2017-12-01

    In inhomogeneous brittle solids like rocks, concrete or ceramics, one usually distinguish nominally brittle fracture, driven by the propagation of a single crack from quasibrittle one, resulting from the accumulation of many microcracks. The latter goes along with intermittent sharp noise, as e.g. revealed by the acoustic emission observed in lab scale compressive fracture experiments or at geophysical scale in the seismic activity. In both cases, statistical analyses have revealed a complex time-energy organization into aftershock sequences obeying a range of robust empirical scaling laws (the Omori-Utsu, productivity and Bath's law) that help carry out seismic hazard analysis and damage mitigation. These laws are usually conjectured to emerge from the collective dynamics of microcrack nucleation. In the experiments presented at AGU, we will show that such a statistical organization is not specific to the quasi-brittle multicracking situations, but also rules the acoustic events produced by a single crack slowly driven in an artificial rock made of sintered polymer beads. This simpler situation has advantageous properties (statistical stationarity in particular) permitting us to uncover the origins of these seismic laws: Both productivity law and Bath's law result from the scale free statistics for event energy and Omori-Utsu law results from the scale-free statistics of inter-event time. This yields predictions on how the associated parameters are related, which were analytically derived. Surprisingly, the so-obtained relations are also compatible with observations on lab scale compressive fracture experiments, suggesting that, in these complex multicracking situations also, the organization into aftershock sequences and associated seismic laws are also ruled by the propagation of individual microcrack fronts, and not by the collective, stress-mediated, microcrack nucleation. Conversely, the relations are not fulfilled in seismology signals, suggesting that

  11. Oxidation Kinetics of Cast TiAl3

    Science.gov (United States)

    Smialek, J. L.; Humphrey, D. L.

    1992-01-01

    The isothermal oxidation kinetics of the TiAl3 compound over a wide temperature range is documented, and these rates are related to exclusive alpha-Al2O3 scale growth. The specific weight change vs time curves are shown. Two abnormalities are immediately apparent. One is that a rapid initial uptake of oxygen occurs at times less than 5 h, followed by a lower oxidation rate at longer times, for tests at 900 C and below. The other is that the final weight changes for the 700, 800, and 900 C tests are not in the sequence expected with respect to temperature. Isothermal oxidation of drop cast TiAl above 1000 C was found to exhibit parabolic oxidation controlled by protective alpha-Al2O3 scale formation. TiAl is the only phase in the binary Ti-Al system that forms exclusive scales of alpha-Al2O3 in isothermal oxidation. High anomalous rates at short times and at temperatures below 1000 C resulted from the internal oxidation of a second phase of aluminum.

  12. Coincidence measurement between α-particles and projectile-like fragments in the reaction of 82.7 MeV 16O on 27Al

    International Nuclear Information System (INIS)

    Shen Wenqing; Zhan Wenlong; Zhu Yongtai

    1988-01-01

    In a coincidence measurement between α-particles and projectile-like fragments in the reaction of 82.7 MeV 16 O on 27 Al, the contour plot of Galilean-invariant cross section of the coincidence between C-fragments and α-particles in the velocity plane, and the coincident angular correlation have been obtained. The correlated α-particles measured at positive angles (on the same side of the beam as the projectile-like fragments) were emitted mainly from the projectile-like fragments;the α-particles at large negative angles were emitted from the target-like fragments;the α-particles at small negative angles came from the fragmentation of the 16 O projectile. A possible reaction mechanism in which the residue produced in the fragmentation of the projectile continues the dissipation process during the interaction with the target has been discussed. It is also pointed out that in the large yield of C-fragments observed in the inclusive experiment, the contribution of C-fragments produced by the excited 16 O of DIC product via α-emission is quite small

  13. Optical, structural, and nuclear scientific studies of AlGaN with high Al composition

    Science.gov (United States)

    Lin, Tse Yang; Chung, Yee Ling; Li, Lin; Yao, Shude; Lee, Y. C.; Feng, Zhe Chuan; Ferguson, Ian T.; Lu, Weijie

    2010-08-01

    AlGaN epilayers with higher Al-compositions were grown by Metalorganic Chemical Vapor Deposition (MOCVD) on (0001) sapphire. Trimethylgallium (TMGa), trimethylaluminium (TMAl) and NH3 were used as the source precursors for Ga, Al, and N, respectively. A 25 nm AlN nucleation layer was first grown at low-temperature of 590 °C at 300 Torr. Followed, AlxGa1-xN layers were grown at 1080 °C on low-temperature AlN nucleation layers. The heterostructures were characterized by a series of techniques, including x-ray diffraction (XRD), Rutherford backscattering (RBS), photoluminescence (PL), scanning electron microscopy (SEM) and Raman scattering. Precise Al compositions were determined through XRD, RBS, and SEM combined measurements. Room Temperature Raman Scattering spectra shows three major bands from AlGaN alloys, which are AlN-like, A1 longitudinal optical (LO) phonon modes, and E2 transverse optical (TO) band, respectively, plus several peak comes from the substrate. Raman spectral line shape analysis lead to an optical determination of the electrical property free carrier concentration of AlGaN. The optical properties of AlGaN with high Al composition were presented here.

  14. Electronic Structures and Bonding Properties of Ti2AlC and Ti3AlC2

    Institute of Scientific and Technical Information of China (English)

    MIN Xinmin; REN Yi

    2007-01-01

    The relation among electronic structure, chemical bond and property of Ti2AlC, Ti3AlC2 and doping Si into Ti2AlC was studied by density function and the discrete variation (DFT-DVM) method. After adding Si into Ti2AlC, the interaction between Si and Ti is weaker than that between Al and Ti, and the strengths of ionic and covalent bonds decrease both. The ionic and covalent bonds in Ti3AlC2, especially in Ti-Al, are stronger than those in Ti2AlC. Therefore, in synthesis of Ti2AlC, the addition of Si enhances the Ti3AlC2 content instead of Ti2AlC. The density of state (DOS) shows that there is mixed conductor characteristic in Ti2AlC and Ti3AlC2. The DOS of Ti3AlC2 is much like that of Ti2AlC. Ti2SixAl1-x C has more obvious tendency to form a semiconductor than Ti2AlC, which is seen from the obvious difference of partial DOS between Si and Al3p.

  15. Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks

    Science.gov (United States)

    Belotserkovskii, Boris P.; Neil, Alexander J.; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M.; Hanawalt, Philip C.

    2013-01-01

    The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation. PMID:23275544

  16. Characterization of Bovine Brain ATPase

    Science.gov (United States)

    1988-07-01

    1 51 40 91 SBA 45 72 117 LPA 32 50 82 Con-A 68 38 106 Abbreviation Sugar Specificity WGA= Wheat Germ Agglutinin N-Acetylglucosamine IJEA= Ulex ... Europaeus Agglutinin L-Fucose SBA= Soy Bean Agglutinin D-Galactose LPA= Limulus Polyphemus Agglutinin N-Acetylgalactosamine Con-A= Concanavalin-A, D-Glucose

  17. Expression of Ulex europaeus agglutinin I lectin-binding sites in squamous cell carcinomas and their absence in basal cell carcinomas. Indicator of tumor type and differentiation.

    Science.gov (United States)

    Heng, M C; Fallon-Friedlander, S; Bennett, R

    1992-06-01

    Lectins bind tightly to carbohydrate moieties on cell surfaces. Alterations in lectin binding have been reported to accompany epidermal cell differentiation, marking alterations in membrane sugars during this process. The presence of UEA I (Ulex europaeus agglutinin I) L-fucose-specific lectin-binding sites has been used as a marker for terminally differentiated (committed) keratinocytes. In this article, we report the presence of UEA-I-binding sites on squamous keratinocytes of well-differentiated squamous cell carcinomas, with patchy loss of UEA I positivity on poorly differentiated cells of squamous cell carcinomas, suggesting a possible use for this technique in the rapid assessment of less differentiated areas within the squamous cell tumor. The absence of UEA-I-binding sites on basal cell carcinomas may be related to an inability of cells comprising this tumor to convert the L-D-pyranosyl moiety on basal cells to the L-fucose moiety, resulting in an inability of basal cell carcinoma cell to undergo terminal differentiation into a committed keratinocyte.

  18. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  19. Prognostic role of ‘prion-like propagation’ in SOD1-linked familial ALS: an alternative view

    Directory of Open Access Journals (Sweden)

    Keizo eSugaya

    2014-10-01

    Full Text Available ‘Prion-like propagation’ has recently been proposed for disease spread in Cu/Zn superoxide dismutase 1 (SOD1-linked familial amyotrophic lateral sclerosis (ALS. Pathological SOD1 conformers are presumed to propagate via cell-to-cell transmission. In this model, the risk-based kinetics of neuronal cell loss over time appears to be represented by a sigmoidal function that reflects the kinetics of intercellular transmission. Here, we describe an alternative view of prion-like propagation in SOD1-linked ALS−its relation to disease prognosis under the protective-aggregation hypothesis. Nucleation-dependent polymerization has been widely accepted as the molecular mechanism of prion propagation. If toxic species of misfolded SOD1, as soluble oligomers, are formed as on-pathway intermediates of nucleation-dependent polymerization, further fibril extension via sequential addition of monomeric mutant SOD1 would be protective against neurodegeneration. This is because the concentration of unfolded mutant SOD1 monomers, which serve as precursor of nucleation and toxic species of mutant SOD1, would decline in proportion to the extent of aggregation. The nucleation process requires that native conformers exist in an unfolded state that may result from escaping the cellular protein quality control machinery. However, prion-like propagation−SOD1 aggregated form self-propagates by imposing its altered conformation on normal SOD1−appears to antagonize the protective role of aggregate growth. The cross-seeding reaction with normal SOD1 would lead to a failure to reduce the concentration of unfolded mutant SOD1 monomers, resulting in continuous nucleation and subsequent generation of toxic species, and influence disease prognosis. In this alternative view, the kinetics of neuronal loss appears to be represented by an exponential function, with decreasing risk reflecting the protective role of aggregate and the potential for cross-seeding reactions between

  20. Oscillator strengths and lifetimes for low-lying terms in the Al isoelectronic sequence

    International Nuclear Information System (INIS)

    Hjort-Jensen, M.; Aashamar, K.

    1988-11-01

    Using the Multiconfiguration Optimized Potential Model, calculations of oscillator strengths in the length, and velocity formulation for a large number of transitions in the Aluminium isoelectronic sequence from Si II through K VII, have been performed. The results have been used to determine the lifetimes of 14 low-lying excited terms along the sequence. Comparison is made with experiment and with other theory where results are available. The agreement between the obtained values and other theoretical results is generally good, although deviations do occur near level crossings. Some significant discrepancies between theory and experiment persist concerning lifetimes for S IV

  1. The scorpion toxin Bot IX is a potent member of the α-like family and has a unique N-terminal sequence extension.

    Science.gov (United States)

    Martin-Eauclaire, Marie-France; Salvatierra, Juan; Bosmans, Frank; Bougis, Pierre E

    2016-09-01

    We report the detailed chemical, immunological and pharmacological characterization of the α-toxin Bot IX from the Moroccan scorpion Buthus occitanus tunetanus venom. Bot IX, which consists of 70 amino acids, is a highly atypical toxin. It carries a unique N-terminal sequence extension and is highly lethal in mice. Voltage clamp recordings on oocytes expressing rat Nav1.2 or insect BgNav1 reveal that, similar to other α-like toxins, Bot IX inhibits fast inactivation of both variants. Moreover, Bot IX belongs to the same structural/immunological group as the α-like toxin Bot I. Remarkably, radioiodinated Bot IX competes efficiently with the classical α-toxin AaH II from Androctonus australis, and displays one of the highest affinities for Nav channels. © 2016 Federation of European Biochemical Societies.

  2. Genomic instability in rat: Breakpoints induced by ionising radiation and interstitial telomeric-like sequences

    International Nuclear Information System (INIS)

    Camats, Nuria; Ruiz-Herrera, Aurora; Parrilla, Juan Jose; Acien, Maribel; Paya, Pilar; Giulotto, Elena; Egozcue, Josep; Garcia, Francisca; Garcia, Montserrat

    2006-01-01

    The Norwegian rat (Rattus norvegicus) is the most widely studied experimental species in biomedical research although little is known about its chromosomal structure. The characterisation of possible unstable regions of the karyotype of this species would contribute to the better understanding of its genomic architecture. The cytogenetic effects of ionising radiation have been widely used for the study of genomic instability, and the importance of interstitial telomeric-like sequences (ITSs) in instability of the genome has also been reported in previous studies in vertebrates. In order to describe the unstable chromosomal regions of R. norvegicus, the distribution of breakpoints induced by X-irradiation and ITSs in its karyotype were analysed in this work. For the X-irradiation analysis, 52 foetuses (from 14 irradiated rats) were studied, 4803 metaphases were analysed, and a total of 456 breakpoints induced by X-rays were detected, located in 114 chromosomal bands, with 25 of them significantly affected by X-irradiation (hot spots). For the analysis of ITSs, three foetuses (from three rats) were studied, 305 metaphases were analysed and 121 ITSs were detected, widely distributed in the karyotype of this species. Seventy-six percent of all hot spots analysed in this study were co-localised with ITSs

  3. Genomic instability in rat: Breakpoints induced by ionising radiation and interstitial telomeric-like sequences

    Energy Technology Data Exchange (ETDEWEB)

    Camats, Nuria [Institut de Biotecnologia i Biomedicina (IBB), Universitat Autonoma de Barcelona, 08193 Barcelona (Spain); Departament de Biologia Cel.lular, Fisiologia i Immunologia Universitat Autonoma de Barcelona, 08193 Barcelona (Spain); Ruiz-Herrera, Aurora [Departament de Biologia Cel.lular, Fisiologia i Immunologia Universitat Autonoma de Barcelona, 08193 Barcelona (Spain); Parrilla, Juan Jose [Servicio de Ginecologia y Obstetricia, Hospital Universitario Virgen de la Arrixaca, Ctra, Madrid-Cartagena, s/n, El Palmar, 30120 Murcia (Spain); Acien, Maribel [Servicio de Ginecologia y Obstetricia, Hospital Universitario Virgen de la Arrixaca, Ctra, Madrid-Cartagena, s/n, El Palmar, 30120 Murcia (Spain); Paya, Pilar [Servicio de Ginecologia y Obstetricia, Hospital Universitario Virgen de la Arrixaca, Ctra, Madrid-Cartagena, s/n, El Palmar, 30120 Murcia (Spain); Giulotto, Elena [Dipartimento di Genetica e Microbiologia Adriano Buzzati Traverso, Universita degli Studi di Pavia, 27100 Pavia (Italy); Egozcue, Josep [Departament de Biologia Cel.lular, Fisiologia i Immunologia Universitat Autonoma de Barcelona, 08193 Barcelona (Spain); Garcia, Francisca [Institut de Biotecnologia i Biomedicina (IBB), Universitat Autonoma de Barcelona, 08193 Barcelona (Spain); Garcia, Montserrat [Institut de Biotecnologia i Biomedicina (IBB), Universitat Autonoma de Barcelona, 08193 Barcelona (Spain) and Departament de Biologia Cellular, Fisiologia i Immunologia Universitat Autonoma de Barcelona, 08193 Barcelona (Spain)]. E-mail: Montserrat.Garcia.Caldes@uab.es

    2006-03-20

    The Norwegian rat (Rattus norvegicus) is the most widely studied experimental species in biomedical research although little is known about its chromosomal structure. The characterisation of possible unstable regions of the karyotype of this species would contribute to the better understanding of its genomic architecture. The cytogenetic effects of ionising radiation have been widely used for the study of genomic instability, and the importance of interstitial telomeric-like sequences (ITSs) in instability of the genome has also been reported in previous studies in vertebrates. In order to describe the unstable chromosomal regions of R. norvegicus, the distribution of breakpoints induced by X-irradiation and ITSs in its karyotype were analysed in this work. For the X-irradiation analysis, 52 foetuses (from 14 irradiated rats) were studied, 4803 metaphases were analysed, and a total of 456 breakpoints induced by X-rays were detected, located in 114 chromosomal bands, with 25 of them significantly affected by X-irradiation (hot spots). For the analysis of ITSs, three foetuses (from three rats) were studied, 305 metaphases were analysed and 121 ITSs were detected, widely distributed in the karyotype of this species. Seventy-six percent of all hot spots analysed in this study were co-localised with ITSs.

  4. Complete sequence of Tvv1, a family of Ty 1 copia-like retrotransposons of Vitis vinifera L., reconstituted by chromosome walking.

    Science.gov (United States)

    Pelsy, F.; Merdinoglu, D.

    2002-09-01

    A chromosome-walking strategy was used to sequence and characterize retrotransposons in the grapevine genome. The reconstitution of a family of retroelements, named Tvv1, was achieved by six successive steps. These elements share a single, highly conserved open reading frame 4,153 nucleotides-long, putatively encoding the gag, pro, int, rt and rh proteins. Comparison of the Tvv1 open reading frame coding potential with those of drosophila copia and tobacco Tnt1, revealed that Tvv1 is closely related to Ty 1 copia-like retrotransposons. A highly variable untranslated leader region, upstream of the open reading frame, allowed us to differentiate Tvv1 variants, which represent a family of at least 28 copies, in varying sizes. This internal region is flanked by two long terminal repeats in direct orientation, sized between 149 and 157 bp. Among elements theoretically sized from 4,970 to 5,550 bp, we describe the full-length sequence of a reference element Tvv1-1, 5,343 nucleotides-long. The full-length sequence of Tvv1-1 compared to pea PDR1 shows a 53.3% identity. In addition, both elements contain long terminal repeats of nearly the same size in which the U5 region could be entirely absent. Therefore, we assume that Tvv1 and PDR1 could constitute a particular class of short LTRs retroelements.

  5. Complete Genome Sequence of the Probiotic Strain Lactobacillus salivarius LPM01.

    Science.gov (United States)

    Chenoll, Empar; Codoñer, Francisco M; Martinez-Blanch, Juan F; Acevedo-Piérart, Marcelo; Ormeño, M Loreto; Ramón, Daniel; Genovés, Salvador

    2016-11-23

    Lactobacillus salivarius LPM01 (DSM 22150) is a probiotic strain able to improve health status in immunocompromised people. Here, we report its complete genome sequence deciphered by PacBio single-molecule real-time (SMRT) technology. Analysis of the sequence may provide insights into its functional activity and safety assessment. Copyright © 2016 Chenoll et al.

  6. Hot Corrosion Behavior of Stainless Steel with Al-Si/Al-Si-Cr Coating

    Science.gov (United States)

    Fu, Guangyan; Wu, Yongzhao; Liu, Qun; Li, Rongguang; Su, Yong

    2017-03-01

    The 1Cr18Ni9Ti stainless steel with Al-Si/Al-Si-Cr coatings is prepared by slurry process and vacuum diffusion, and the hot corrosion behavior of the stainless steel with/without the coatings is studied under the condition of Na2SO4 film at 950 °C in air. Results show that the corrosion kinetics of stainless steel, the stainless steel with Al-Si coating and the stainless steel with Al-Si-Cr coating follow parabolic laws in several segments. After 24 h corrosion, the sequence of the mass gain for the three alloys is the stainless steel with Al-Si-Cr coating coating coating. The corrosion products of the three alloys are layered. Thereinto, the corrosion products of stainless steel without coating are divided into two layers, where the outside layer contains a composite of Fe2O3 and FeO, and the inner layer is Cr2O3. The corrosion products of the stainless steel with Al-Si coating are also divided into two layers, of which the outside layer mainly consists of Cr2O3, and the inner layer is mainly SiO2. The corrosion film of the stainless steel with Al-Si-Cr coating is thin and dense, which combines well with substrate. Thereinto, the outside layer is mainly Cr2O3, and the inside layer is Al2O3. In the matrix of all of the three alloys, there exist small amount of sulfides. Continuous and protective films of Cr2O3, SiO2 and Al2O3 form on the surface of the stainless steel with Al-Si and Al-Si-Cr coatings, which prevent further oxidation or sulfide corrosion of matrix metals, and this is the main reason for the much smaller mass gain of the two alloys than that of the stainless steel without any coatings in the 24 h hot corrosion process.

  7. Identification of snake bradykinin-potentiating peptides (BPPs)-simile sequences in rat brain--Potential BPP-like precursor protein?

    Science.gov (United States)

    Campeiro, Joana D'Arc; Neshich, Izabella P; Sant'Anna, Osvaldo A; Lopes, Robson; Ianzer, Danielle; Assakura, Marina T; Neshich, Goran; Hayashi, Mirian A F

    2015-08-01

    Bradykinin-potentiating peptides (BPPs) from the South American pit viper snake venom were the first natural inhibitors of the human angiotensin I-converting enzyme (ACE) described. The pioneer characterization of the BPPs precursor from the snake venom glands by our group showed for the first time the presence of the C-type natriuretic peptide (CNP) in this same viper precursor protein. The confirmation of the BPP/CNP expression in snake brain regions correlated with neuroendocrine functions stimulated us to pursue the physiological correlates of these vasoactive peptides in mammals. Notably, several snake toxins were shown to have endogenous physiological correlates in mammals. In the present work, we expressed in bacteria the BPPs domain of the snake venom gland precursor protein, and this purified recombinant protein was used to raise specific polyclonal anti-BPPs antibodies. The correspondent single protein band immune-recognized in adult rat brain cytosol was isolated by 2D-SDS/PAGE and/or HPLC, before characterization by MS fingerprint analysis, which identified this protein as superoxide dismutase (SOD, EC 1.15.1.1), a classically known enzyme with antioxidant activity and important roles in the blood pressure modulation. In silico analysis showed the exposition of the BPP-like peptide sequences on the surface of the 3D structure of rat SOD. These peptides were chemically synthesized to show the BPP-like biological activities in ex vivo and in vivo pharmacological bioassays. Taken together, our data suggest that SOD protein have the potential to be a source for putative BPP-like bioactive peptides, which once released may contribute to the blood pressure control in mammals. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Development of Sn-Ag-Cu-X Solders for Electronic Assembly by Micro-Alloying with Al

    Science.gov (United States)

    Boesenberg, Adam J.; Anderson, Iver E.; Harringa, Joel L.

    2012-07-01

    Of Pb-free solder choices, an array of solder alloys based on the Sn-Ag-Cu (SAC) ternary eutectic ( T eut = 217°C) composition have emerged with potential for broad use, including ball grid array (BGA) joints that cool slowly. This work investigated minor substitutional additions of Al (0.05Al), but the suppression effect faded for >0.20Al. Undercooling suppression did not correlate specifically with blade suppression since it became significant at 0.10Al and increased continuously with greater Al to 0.25Al. Surprisingly, an intermediate range of Al content (0.10 wt.% to 0.20 wt.% Al) promoted formation of significant populations of 2- μm to 5- μm faceted Cu-Al particles, identified as Cu33Al17, that clustered at the top of the solder joint matrix and exhibited extraordinary hardness. Clustering of Cu33Al17 was attributed to its buoyancy, from a lower density than Sn liquid, and its early position in the nucleation sequence within the solder matrix, permitting unrestricted migration to the top interface. Joint microstructures and implications for the full nucleation sequence for these SAC + Al solder joints are discussed, along with possible benefits from the clustered particles for improved thermal cycling resistance.

  9. Site preference of Zr in Ti 3 Al and phase stability of Ti 2 ZrAl

    Indian Academy of Sciences (India)

    Calculated values of equilibrium lattice parameters, heat of formation and bulk modulus of Ti2ZrAl are presented. The basis for the structural stability and bonding are analysed in terms of the density of states. Between the two possible 2-like structures, Ti2ZrAl shows enhanced stability for the one where Zr is substituted in ...

  10. Synthesis, characterization and magnetic properties of Fe-Al nanopins

    International Nuclear Information System (INIS)

    Zhang, W.S.; Brueck, E.; Li, W.F.; Si, P.Z.; Geng, D.Y.; Zhang, Z.D.

    2005-01-01

    We report the synthesis of Fe-Al nanopins using arc discharge. The morphology and chemical composition of the Fe-Al nanopins were studied by means of X-ray diffraction, X-ray photoelectron spectroscopy (XPS), energy dispersive X-ray spectroscopy (EDX), and high-resolution transmission electron microscopy (HRTEM). The nanopins are composed of a spherical base of about 20-100 nm and a needle-like tip of about several hundred nanometers. EDX and HRTEM studies indicate that the spherical base is mainly composed of α-Fe and FeAl core coated with a thin Al 2 O 3 layer, while the needle-like part contains only Al and O and corresponds to Al 2 O 3 . The formation mechanism of the nanopins is suggestive of a vapor-liquid-solid (VLS) growth process. The as-prepared Fe-Al nanopins show ferromagnetic properties. The temperature dependence of the magnetization at high temperatures indicates the existence of some phase transformations

  11. Constant region of a kappa III immunoglobulin light chain as a major AL-amyloid protein

    DEFF Research Database (Denmark)

    Engvig, J P; Olsen, K E; Gislefoss, R E

    1998-01-01

    AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein and the correspond......AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein...... and the corresponding AL protein as a kappa III immunoglobulin light chain from material of a patient with systemic AL-amyloidosis presenting as a local inguinal tumour. The two proteins showed some unique features. The major part of the AL amyloid fibril protein consisted of C-terminal fragments of the Bence......-Jones protein. Furthermore, both the Bence-Jones protein and the AL protein were glycosylated, with possibly a glycosylation in the constant part of the light chain....

  12. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Science.gov (United States)

    Seo, Heewon; Park, Yoomi; Min, Byung Joo; Seo, Myung Eui; Kim, Ju Han

    2017-01-01

    The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7%) of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit) exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  13. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Directory of Open Access Journals (Sweden)

    Heewon Seo

    Full Text Available The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7% of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  14. CRISPR/Cas9 Technology as an Emerging Tool for Targeting Amyotrophic Lateral Sclerosis (ALS).

    Science.gov (United States)

    Kruminis-Kaszkiel, Ewa; Juranek, Judyta; Maksymowicz, Wojciech; Wojtkiewicz, Joanna

    2018-03-19

    The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein-9 nuclease (Cas9) is a genome editing tool that has recently caught enormous attention due to its novelty, feasibility, and affordability. This system naturally functions as a defense mechanism in bacteria and has been repurposed as an RNA-guided DNA editing tool. Unlike zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), CRISPR/Cas9 takes advantage of an RNA-guided DNA endonuclease enzyme, Cas9, which is able to generate double-strand breaks (DSBs) at specific genomic locations. It triggers cellular endogenous DNA repair pathways, contributing to the generation of desired modifications in the genome. The ability of the system to precisely disrupt DNA sequences has opened up new avenues in our understanding of amyotrophic lateral sclerosis (ALS) pathogenesis and the development of new therapeutic approaches. In this review, we discuss the current knowledge of the principles and limitations of the CRISPR/Cas9 system, as well as strategies to improve these limitations. Furthermore, we summarize novel approaches of engaging the CRISPR/Cas9 system in establishing an adequate model of neurodegenerative disease and in the treatment of SOD1-linked forms of ALS. We also highlight possible applications of this system in the therapy of ALS, both the inherited type as well as ALS of sporadic origin.

  15. Coincidence measurement between. cap alpha. -particles and projectile-like fragments in reaction of 82. 7 MeV /sup 16/O on /sup 27/Al

    Energy Technology Data Exchange (ETDEWEB)

    Wen-Qing, Shen; Wen-long, Zhan; Yong-tai, Zhu; Shu-zhi, Yin; Zhong-yan, Guo; Wei-min, Qiao; Guo-ying, Fan; Gen-ming, Jin; Song-ling, Li; Zhen, Zhang; others, and

    1987-01-01

    In the coincidence measurement between ..cap alpha..-particles and projectile-like fragments in the reaction of 82.7 MeV /sup 16/O on /sup 27/Al, the contour plot of the C-..cap alpha.. coincidence in the velocity plane and the coincident angular correlation are obtained. Different mechanisms of ..cap alpha..-particle emission are analysed. A possible reaction mechanism of incomplete DIC is discussed.

  16. Genetic diversity among five T4-like bacteriophages

    Directory of Open Access Journals (Sweden)

    Bertrand Claire

    2006-05-01

    Full Text Available Abstract Background Bacteriophages are an important repository of genetic diversity. As one of the major constituents of terrestrial biomass, they exert profound effects on the earth's ecology and microbial evolution by mediating horizontal gene transfer between bacteria and controlling their growth. Only limited genomic sequence data are currently available for phages but even this reveals an overwhelming diversity in their gene sequences and genomes. The contribution of the T4-like phages to this overall phage diversity is difficult to assess, since only a few examples of complete genome sequence exist for these phages. Our analysis of five T4-like genomes represents half of the known T4-like genomes in GenBank. Results Here, we have examined in detail the genetic diversity of the genomes of five relatives of bacteriophage T4: the Escherichia coli phages RB43, RB49 and RB69, the Aeromonas salmonicida phage 44RR2.8t (or 44RR and the Aeromonas hydrophila phage Aeh1. Our data define a core set of conserved genes common to these genomes as well as hundreds of additional open reading frames (ORFs that are nonconserved. Although some of these ORFs resemble known genes from bacterial hosts or other phages, most show no significant similarity to any known sequence in the databases. The five genomes analyzed here all have similarities in gene regulation to T4. Sequence motifs resembling T4 early and late consensus promoters were observed in all five genomes. In contrast, only two of these genomes, RB69 and 44RR, showed similarities to T4 middle-mode promoter sequences and to the T4 motA gene product required for their recognition. In addition, we observed that each phage differed in the number and assortment of putative genes encoding host-like metabolic enzymes, tRNA species, and homing endonucleases. Conclusion Our observations suggest that evolution of the T4-like phages has drawn on a highly diverged pool of genes in the microbial world. The T4

  17. Wear protection in cutting tool applications by PACVD (Ti,Al)N and Al2O3 coatings

    International Nuclear Information System (INIS)

    Kathrein, M.; Heiss, M.; Rofner, R.; Schleinkofer, U.; Schintlmeister, W.; Schatte, J.; Mitterer, C.

    2001-01-01

    Various (Ti,Al)N-, Al 2 O 3 -, and (Ti,Al)N/Al 2 O 3 multilayer coatings were deposited onto cemented carbide cutting tool inserts by a plasma assisted chemical vapor deposition (PACVD) technique. Al 2 O 3 coatings were deposited using the gaseous mixture AlCl 3 , Ar, H 2 , and O 2 . (Ti,Al)N intermediate layers were deposited in the same device using the process mentioned and the gases AICl 3 , Ar, H 2 , TiCl 4 and N 2 . The unique properties of (Ti,Al)N/Al 2 O 3 multilayer coatings result in superior wear protection for cutting inserts applied in severe multifunction cutting processes. The influence of different deposition temperatures an structure and properties of the coatings like crystallographic phases, chemical composition, mechanical and technological properties is shown. PACVD (Ti,Al)N/Al 2 O 3 coated cutting inserts with fine grained crystalline α/κ-Al 2 O 3 offer performance advantages which are superior with respect to coatings deposited by chemical vapor deposition (CVD) due to the low deposition temperature applied. (author)

  18. Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

    Science.gov (United States)

    Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

  19. Growth and Device Performance of AlGaN/GaN Heterostructure with AlSiC Precoverage on Silicon Substrate

    Directory of Open Access Journals (Sweden)

    Jae-Hoon Lee

    2014-01-01

    Full Text Available A crack-free AlGaN/GaN heterostructure was grown on 4-inch Si (111 substrate with initial dot-like AlSiC precoverage layer. It is believed that introducing the AlSiC layer between AlN wetting layer and Si substrate is more effective in obtaining a compressively stressed film growth than conventional Al precoverage on Si surface. The metal semiconductor field effect transistor (MESFET, fabricated on the AlGaN/GaN heterostructure grown with the AlSiC layer, exhibited normally on characteristics, such as threshold voltage of −2.3 V, maximum drain current of 370 mA/mm, and transconductance of 124 mS/mm.

  20. Complete genome sequence of the gliding, heparinolytic Pedobacter saltans type strain (113).

    Science.gov (United States)

    Liolios, Konstantinos; Sikorski, Johannes; Lu, Meagan; Nolan, Matt; Lapidus, Alla; Lucas, Susan; Hammon, Nancy; Deshpande, Shweta; Cheng, Jan-Fang; Tapia, Roxanne; Han, Cliff; Goodwin, Lynne; Pitluck, Sam; Huntemann, Marcel; Ivanova, Natalia; Pagani, Ioanna; Mavromatis, Konstantinos; Ovchinikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Brambilla, Evelyne-Marie; Kotsyurbenko, Oleg; Rohde, Manfred; Tindall, Brian J; Abt, Birte; Göker, Markus; Detter, John C; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C

    2011-10-15

    Pedobacter saltans Steyn et al. 1998 is one of currently 32 species in the genus Pedobacter within the family Sphingobacteriaceae. The species is of interest for its isolated location in the tree of life. Like other members of the genus P. saltans is heparinolytic. Cells of P. saltans show a peculiar gliding, dancing motility and can be distinguished from other Pedobacter strains by their ability to utilize glycerol and the inability to assimilate D-cellobiose. The genome presented here is only the second completed genome sequence of a type strain from a member of the family Sphingobacteriaceae to be published. The 4,635,236 bp long genome with its 3,854 protein-coding and 67 RNA genes consists of one chromosome, and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  1. The establishment of Saccharomyces boulardii surface display system using a single expression vector.

    Science.gov (United States)

    Wang, Tiantian; Sun, Hui; Zhang, Jie; Liu, Qing; Wang, Longjiang; Chen, Peipei; Wang, Fangkun; Li, Hongmei; Xiao, Yihong; Zhao, Xiaomin

    2014-03-01

    In the present study, an a-agglutinin-based Saccharomyces boulardii surface display system was successfully established using a single expression vector. Based on the two protein co-expression vector pSP-G1 built by Partow et al., a S. boulardii surface display vector-pSDSb containing all the display elements was constructed. The display results of heterologous proteins were confirmed by successfully displaying enhanced green fluorescent protein (EGFP) and chicken Eimeria tenella Microneme-2 proteins (EtMic2) on the S. boulardii cell surface. The DNA sequence of AGA1 gene from S. boulardii (SbAGA1) was determined and used as the cell wall anchor partner. This is the first time heterologous proteins have been displayed on the cell surface of S. boulardii. Because S. boulardii is probiotic and eukaryotic, its surface display system would be very valuable, particularly in the development of a live vaccine against various pathogenic organisms especially eukaryotic pathogens such as protistan parasites. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. The Alleret Maar lacustrine sequence (French Massif Central): a 150 ka long early-middle Pleistocene continental paleoenvironmental record.

    Science.gov (United States)

    Nomade, S.; Pastre, J.; Guillou, H.; Gauthier, A.; Scaillet, S.

    2008-12-01

    Lacustrine maar sequences of the French Massif Central are of great interest for paleoclimatic and paleoenvironmental reconstructions of mid-latitudes Quaternary continental environments. In particular, the western Velay region yields exceptional sequences spanning the last 450 ka (Reille et al., J. Quat. Sci. 2000). However, older sequences remain largely unknown despite the presence of interbedded alkaline tephras allowing precise absolute radiochronological control of many lacustrine squences. The Alleret maar is a 1500 m wide phreatomagmatic crater that provides a long lacustrine sequence (41 m). The upper part of this sequence (AL2 core, 14.6 m) was studied between 2005 and 2006 (Pastre et al., C. R. Acad Sci, 2007). A 39Ar/40Ar date (557 ± 5ka) obtained from an interbedded tephra layer located at 7m as well as the associated pollen data attribute the beginning of this sequence to the MIS 15. Thanks to the AL3 core recovered in 2005 (40.6 m, CNRS Meudon) several new tephra layers were discovered in the bottom part of this lacustrine sequence. Three new 39Ar/40Ar ages (single crystal analyses) from trachytic tephra layers were obtained at the LSCE Argon Laboratory (France). These layers are located at -30.2, -36.2 and -39.2m. Ages obtained relative to the ACR-2 flux standard (1,201Ma, Kuiper et al., Science, 2008) range from 692 ± 6 ka (MSWD: 2.3, n=18) for the youngest (-30.2m) to 726 ± 9Ka Ka (MSWD: 2.2, n=12) for the lowest tephra located at -39.2m. These new dates indicate a relatively homogeneous deposition rate of 3.5cm/ka and that the last 10 meters cover the MIS 17-MIS18 period. According to these current radiochronological data the complete lacustrine sequence last more than 150ka. Ongoing sedimentary and pollen studies will allow to extend the paleoenvironmental and paleoclimatic records of the French Massif Central towards the beginning of the early middle Pleistocene.

  3. The fecal microbiome of ALS patients.

    Science.gov (United States)

    Brenner, David; Hiergeist, Andreas; Adis, Carolin; Mayer, Benjamin; Gessner, André; Ludolph, Albert C; Weishaupt, Jochen H

    2018-01-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative motor neuron disease accompanied by both systemic and central nervous system-specific inflammation as well as deregulated energy metabolism. These potential pathogenetic factors have recently been found to mutually interact with the gut microbiota, raising the hypothesis of a link between microbiome alterations and ALS pathogenesis. The aim of our study was to assess whether ALS is associated with an altered composition of the fecal microbiota. We compared the fecal microbiota of 25 ALS patients with 32 age- and gender-matched healthy persons using 16S rRNA gene sequencing analysis. Confounding factors and secondary disease effects on the microbiome were minimized by selection of patients without dysphagia, gastrostomy, noninvasive ventilation, or reduced body mass index. Comparing the 2 carefully matched groups, the diversity and the abundance of the bacterial taxa on the different taxonomic levels as well as PICRUSt-predicted metagenomes were almost indistinguishable. Significant differences between ALS patients and healthy controls were only observed with regard to the overall number of microbial species (operational taxonomic units) and in the abundance of uncultured Ruminococcaceae. Conclusively, ALS patients do not exhibit a substantial alteration of the gut microbiota composition. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Radio-immunoassays for glucagon-like peptides 1 and 2 (GLP-1 and GLP-2)

    DEFF Research Database (Denmark)

    Orskov, C; Holst, J J

    1987-01-01

    Gene-sequencing studies have shown that the glucagon precursor contains two additional glucagon-like sequences, the so-called glucagon-like peptides 1 and 2 (GLP-1 and GLP-2). We developed radio-immunoassays against synthetic peptides corresponding to these sequences. Antisera were raised in rabb...

  5. SU-E-T-605: Performance Evaluation of MLC Leaf-Sequencing Algorithms in Head-And-Neck IMRT

    Energy Technology Data Exchange (ETDEWEB)

    Jing, J; Lin, H [Hefei University of Technology, Hefei, Anhui (China); Chow, J [Princess Margaret Hospital, Toronto, ON (Canada)

    2015-06-15

    Purpose: To investigate the efficiency of three multileaf collimator (MLC) leaf-sequencing algorithms proposed by Galvin et al, Chen et al and Siochi et al using external beam treatment plans for head-and-neck intensity modulated radiation therapy (IMRT). Methods: IMRT plans for head-and-neck were created using the CORVUS treatment planning system. The plans were optimized and the fluence maps for all photon beams determined. Three different MLC leaf-sequencing algorithms based on Galvin et al, Chen et al and Siochi et al were used to calculate the final photon segmental fields and their monitor units in delivery. For comparison purpose, the maximum intensity of fluence map was kept constant in different plans. The number of beam segments and total number of monitor units were calculated for the three algorithms. Results: From results of number of beam segments and total number of monitor units, we found that algorithm of Galvin et al had the largest number of monitor unit which was about 70% larger than the other two algorithms. Moreover, both algorithms of Galvin et al and Siochi et al have relatively lower number of beam segment compared to Chen et al. Although values of number of beam segment and total number of monitor unit calculated by different algorithms varied with the head-and-neck plans, it can be seen that algorithms of Galvin et al and Siochi et al performed well with a lower number of beam segment, though algorithm of Galvin et al had a larger total number of monitor units than Siochi et al. Conclusion: Although performance of the leaf-sequencing algorithm varied with different IMRT plans having different fluence maps, an evaluation is possible based on the calculated number of beam segment and monitor unit. In this study, algorithm by Siochi et al was found to be more efficient in the head-and-neck IMRT. The Project Sponsored by the Fundamental Research Funds for the Central Universities (J2014HGXJ0094) and the Scientific Research Foundation for the

  6. SU-E-T-605: Performance Evaluation of MLC Leaf-Sequencing Algorithms in Head-And-Neck IMRT

    International Nuclear Information System (INIS)

    Jing, J; Lin, H; Chow, J

    2015-01-01

    Purpose: To investigate the efficiency of three multileaf collimator (MLC) leaf-sequencing algorithms proposed by Galvin et al, Chen et al and Siochi et al using external beam treatment plans for head-and-neck intensity modulated radiation therapy (IMRT). Methods: IMRT plans for head-and-neck were created using the CORVUS treatment planning system. The plans were optimized and the fluence maps for all photon beams determined. Three different MLC leaf-sequencing algorithms based on Galvin et al, Chen et al and Siochi et al were used to calculate the final photon segmental fields and their monitor units in delivery. For comparison purpose, the maximum intensity of fluence map was kept constant in different plans. The number of beam segments and total number of monitor units were calculated for the three algorithms. Results: From results of number of beam segments and total number of monitor units, we found that algorithm of Galvin et al had the largest number of monitor unit which was about 70% larger than the other two algorithms. Moreover, both algorithms of Galvin et al and Siochi et al have relatively lower number of beam segment compared to Chen et al. Although values of number of beam segment and total number of monitor unit calculated by different algorithms varied with the head-and-neck plans, it can be seen that algorithms of Galvin et al and Siochi et al performed well with a lower number of beam segment, though algorithm of Galvin et al had a larger total number of monitor units than Siochi et al. Conclusion: Although performance of the leaf-sequencing algorithm varied with different IMRT plans having different fluence maps, an evaluation is possible based on the calculated number of beam segment and monitor unit. In this study, algorithm by Siochi et al was found to be more efficient in the head-and-neck IMRT. The Project Sponsored by the Fundamental Research Funds for the Central Universities (J2014HGXJ0094) and the Scientific Research Foundation for the

  7. A novel amino acid substitution Trp574Arg in acetolactate synthase (ALS) confers broad resistance to ALS-inhibiting herbicides in crabgrass (Digitaria sanguinalis).

    Science.gov (United States)

    Li, Jian; Li, Mei; Gao, Xingxiang; Fang, Feng

    2017-12-01

    Crabgrass (Digitaria sanguinalis) is an annual monocotyledonous weed. In recent years, field applications of nicosulfuron have been ineffective in controlling crabgrass populations in Shandong Province, China. To investigate the mechanisms of resistance to nicosulfuron in crabgrass populations, the acetolactate synthase (ALS) gene fragment covering known resistance-confering mutation sites was amplified and sequenced. Dose-response experiments suggested that the resistant population SD13 (R) was highly resistant to nicosulfuron (resistance index R/S = 43.7) compared with the sensitive population SD22 (S). ALS gene sequencing revealed a Trp574Arg substitution in the SD13 population, and no other known resistance-conferring mutations were found. In vitro ALS enzyme assays further confirmed that the SD13 population was resistant to all tested ALS-inhibiting herbicides. The resistance pattern experiments revealed that, compared with SD22, the SD13 population exhibited broad-spectrum resistance to nicosulfuron (43.7-fold), imazethapyr (11.4-fold) and flumetsulam (16.1-fold); however, it did not develop resistance to atrazine, mesotrione and topramezone. This study demonstrated that Trp574Arg substitution was the main reason for crabgrass resistance to ALS-inhibiting herbicides. To our knowledge, this is the first report of Trp574Arg substitution in a weed species, and is the first report of target-site mechanisms of herbicide resistance for crabgrass. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  8. Filovirus Glycoprotein Sequence, Structure and Virulence

    OpenAIRE

    Phillips, J. C.

    2014-01-01

    Leading Ebola subtypes exhibit a wide mortality range, here explained at the molecular level by using fractal hydropathic scaling of amino acid sequences based on protein self-organized criticality. Specific hydrophobic features in the hydrophilic mucin-like domain suffice to account for the wide mortality range. Significance statement: Ebola virus is spreading rapidly in Africa. The connection between protein amino acid sequence and mortality is identified here.

  9. Targeted Gene Sequencing and Whole-Exome Sequencing in Autopsied Fetuses with Prenatally Diagnosed Kidney Anomalies

    DEFF Research Database (Denmark)

    Rasmussen, M; Sunde, L; Nielsen, M L

    2018-01-01

    Identification of fetal kidney anomalies invites questions about underlying causes and recurrence risk in future pregnancies. We therefore investigated the diagnostic yield of next-generation sequencing in fetuses with bilateral kidney anomalies and the correlation between disrupted genes and fetal...... phenotypes. Fetuses with bilateral kidney anomalies were screened using an in-house-designed kidney-gene panel. In families where candidate variants were not identified, whole-exome sequencing was performed. Genes uncovered by this analysis were added to our kidney-panel. We identified likely deleterious...... of nephronophthisis. Exome sequencing identified ROBO1 variants in one family and a GREB1L variant in another family. GREB1L and ROBO1 were added to our kidney-gene panel and additional variants were identified. Next-generation sequencing substantially contributes to identifying causes of fetal kidney anomalies...

  10. First-principle study of the AlP/Si interfacial adhesion

    Energy Technology Data Exchange (ETDEWEB)

    Dai Hongshang [Key Laboratory of Liquid Structure and Heredity of Materials, Ministry of Education, Shandong University, 73 Jingshi Road, Jinan 250061 (China); Du Jing [School of Science, Shandong Jianzhu University, Jinan 250101 (China); Wang Li; Peng Chuanxiao [Key Laboratory of Liquid Structure and Heredity of Materials, Ministry of Education, Shandong University, 73 Jingshi Road, Jinan 250061 (China); Liu Xiangfa, E-mail: xfliu@sdu.edu.c [Key Laboratory of Liquid Structure and Heredity of Materials, Ministry of Education, Shandong University, 73 Jingshi Road, Jinan 250061 (China); Shandong Binzhou Bohai Piston Co. Ltd., Binzhou 256602, Shandong (China)

    2010-01-15

    AlP is heterogeneous nucleation substrate of primary Si in hypereutectic Al-Si alloys, while studies on the nucleation mechanism at atomic level are absent. The pseudopotential-based DFT calculations have been carried out to investigate the atomic and electronic structure, bonding and adhesion of the AlP/Si interface. In total, eight geometries have been investigated, in which the interfacial stacking sequence is different. The favorable interfaces can be deduced for the reason that adhesive interface energies (W{sub ad}) are different, which cannot be obtained from the traditional mismatch theory. The interfacial density of states and Mulliken population are also investigated. It is found that the main bond between AlP and Si is covalent Al-Si or P-Si bond, accompanying some ionic characteristic.

  11. Complete genome sequence of 'Thermobaculum terrenum' type strain (YNP1).

    Science.gov (United States)

    Kiss, Hajnalka; Cleland, David; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Nolan, Matt; Tice, Hope; Han, Cliff; Goodwin, Lynne; Pitluck, Sam; Liolios, Konstantinos; Ivanova, Natalia; Mavromatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Lu, Megan; Brettin, Thomas; Detter, John C; Göker, Markus; Tindall, Brian J; Beck, Brian; McDermott, Timothy R; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Cheng, Jan-Fang

    2010-10-27

    'Thermobaculum terrenum' Botero et al. 2004 is the sole species within the proposed genus 'Thermobaculum'. Strain YNP1(T) is the only cultivated member of an acid tolerant, extremely thermophilic species belonging to a phylogenetically isolated environmental clone group within the phylum Chloroflexi. At present, the name 'Thermobaculum terrenum' is not yet validly published as it contravenes Rule 30 (3a) of the Bacteriological Code. The bacterium was isolated from a slightly acidic extreme thermal soil in Yellowstone National Park, Wyoming (USA). Depending on its final taxonomic allocation, this is likely to be the third completed genome sequence of a member of the class Thermomicrobia and the seventh type strain genome from the phylum Chloroflexi. The 3,101,581 bp long genome with its 2,872 protein-coding and 58 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  12. Tectonic and metamorphic discontinuities in the Greater Himalayan Sequence in Central Himalaya: in-sequence shearing by accretion from the Indian plate

    Science.gov (United States)

    Carosi, Rodolfo

    2016-04-01

    The Greater Himalayan Sequence (GHS) is the main metamorphic unit of the Himalayas, stretching for over 2400 km, bounded to the South by the Main Central Thrust (MCT) and to the North by the South Tibetan Detachment (STD) whose contemporanous activity controlled its exhumation between 23 and 17 Ma (Godin et al., 2006). Several shear zones and/or faults have been recognized within the GHS, usually regarded as out of sequence thrusts. Recent investigations, using a multitechnique approach, allowed to recognize a tectonic and metamorphic discontinuity, localized in the mid GHS, with a top-to-the SW sense of shear (Higher Himalayan Discontinuity: HHD) (Carosi et al., 2010; Montomoli et al., 2013). U-(Th)-Pb in situ monazite ages provide temporal constraint of the acitivity of the HHD from ~ 27-25 Ma to 18-17 Ma. Data on the P and T evolution testify that this shear zone affected the tectono-metamorphic evolution of the belt and different P and T conditions have been recorded in the hanging-wall and footwall of the HHD. The HHD is a regional tectonic feature running for more than 700 km, dividing the GHS in two different portions (Iaccarino et al., 2015; Montomoli et al., 2015). The occurrence of even more structurally higher contractional shear zone in the GHS (above the HHD): the Kalopani shear zone (Kali Gandaki valley, Central Nepal), active from ~ 41 to 30 Ma (U-Th-Pb on monazite) points out to a more complex deformation pattern in the GHS characterized by in sequence shearing. The actual proposed models of exhumation of the GHS, based exclusively on the MCT and STD activities, are not able to explain the occurrence of the HHD and other in-sequence shear zones. Any model of the tectonic and metamorphic evolution of the GHS should account for the occurrence of the tectonic and metamorphic discontinuities within the GHS and its consequences on the metamorphic paths and on the assembly of Himalayan belt. References Godin L., Grujic D., Law, R. D. & Searle, M. P. 2006

  13. Influence of Ni content on physico-chemical characteristics of Ni, Mg, Al-Hydrotalcite like compounds

    Directory of Open Access Journals (Sweden)

    Alexandre Carlos Camacho Rodrigues

    2003-12-01

    Full Text Available The physico-chemical properties of a series of Ni,Mg,Al-HTLC with Al/(Al+Mg+Ni = 0.25 and low Ni/Mg ratios were studied by means of X-ray diffraction (XRD, thermogravimetric (TGA and thermodifferential (DTA analysis, N2 physissorption and temperature programmed reduction (TPR. The as-synthesized materials were well-crystallized, with XRD patterns typical of the HTLCs in carbonate form. Upon calcination and dehydration the dehydroxilation of the layers with concurrent decomposition of carbonate anions produced mixed oxides with high surface area. XRD analysis indicated that the different nickel and aluminum oxides species are well-dispersed in a poor-crystallized MgO periclase-type phase. As observed by TPR, the different Ni species showed distinct interactions with Mg(AlO phase, which were influenced by both nickel content and calcination temperature. Regardless of the the nickel content, the reduction of nickel species was not complete as indicated by the presence of metallic dispersions.

  14. Chimaeric Virus-Like Particles Derived from Consensus Genome Sequences of Human Rotavirus Strains Co-Circulating in Africa

    Science.gov (United States)

    Jere, Khuzwayo C.; O'Neill, Hester G.; Potgieter, A. Christiaan; van Dijk, Alberdina A.

    2014-01-01

    Rotavirus virus-like particles (RV-VLPs) are potential alternative non-live vaccine candidates due to their high immunogenicity. They mimic the natural conformation of native viral proteins but cannot replicate because they do not contain genomic material which makes them safe. To date, most RV-VLPs have been derived from cell culture adapted strains or common G1 and G3 rotaviruses that have been circulating in communities for some time. In this study, chimaeric RV-VLPs were generated from the consensus sequences of African rotaviruses (G2, G8, G9 or G12 strains associated with either P[4], P[6] or P[8] genotypes) characterised directly from human stool samples without prior adaptation of the wild type strains to cell culture. Codon-optimised sequences for insect cell expression of genome segments 2 (VP2), 4 (VP4), 6 (VP6) and 9 (VP7) were cloned into a modified pFASTBAC vector, which allowed simultaneous expression of up to four genes using the Bac-to-Bac Baculovirus Expression System (BEVS; Invitrogen). Several combinations of the genome segments originating from different field strains were cloned to produce double-layered RV-VLPs (dRV-VLP; VP2/6), triple-layered RV-VLPs (tRV-VLP; VP2/6/7 or VP2/6/7/4) and chimaeric tRV-VLPs. The RV-VLPs were produced by infecting Spodoptera frugiperda 9 and Trichoplusia ni cells with recombinant baculoviruses using multi-cistronic, dual co-infection and stepwise-infection expression strategies. The size and morphology of the RV-VLPs, as determined by transmission electron microscopy, revealed successful production of RV-VLPs. The novel approach of producing tRV-VLPs, by using the consensus insect cell codon-optimised nucleotide sequence derived from dsRNA extracted directly from clinical specimens, should speed-up vaccine research and development by by-passing the need to adapt rotaviruses to cell culture. Other problems associated with cell culture adaptation, such as possible changes in epitopes, can also be circumvented

  15. Synthesis and Characterization of Allophane-Like as Chromium (Cr) Ion Adsorbent

    Science.gov (United States)

    Pranoto; Purnawan, C.; Husnina, A. N.

    2018-03-01

    The synthesis and characterization of allophane-like as chrom (Cr) ion adsorbent has been studied. The objectives of this study is to determine the characteristics of allophane-like and determine ratio of Al/Si, chromium solution pH, and contact time to get the best decreasing metal ion chrom (Cr) adsorption condition. The study was conducted with the ratio of Al/Si ratios 0.5; 0.75; 1.0; 1.25 and 1.5 from Tetraetyl Orthosilicate (TEOS) solution and Aluminium Nitrate Nonahydrate [Al(NO3)3.9H2O] in pH 3-4. The result of synthetic was characterized on functional groups and cristallinity. Experiment of adsorption ability using variation of Cr solution pH 3-7, contact time 30, 60, 90 and 120 minutes with batch method. The results by FTIR shows that functional groups-OH, the asymmetry groups O-Si-O or O-Al-O, relatively weak absorption which stronger then the presence of OH and bending vibration Si-O or Al-O on allophane-like. The best conditions of chromium metal adsorption with adsorbent allophane-like was obtained at pH 5, contact time 90 minutes, and the ratio Al/Si 1.5. Types of adsorption in this study follows Freundlich and Langmuir isotherm.

  16. Modeling of Precipitation Sequence and Ageing Kinetics in Al-Mg-Si Alloys

    NARCIS (Netherlands)

    Bahrami, A.

    2010-01-01

    Al-Mg-Si alloys are heat treatable alloys in which strength is obtained by precipitation hardening. Precipitates, formed from a supersaturated solid solution during ageing heat treatment, are GP-zones, B", B´ and B-Mg2Si. Precipitation kinetics and strength vary with alloy composition and process

  17. Probabilistic Motor Sequence Yields Greater Offline and Less Online Learning than Fixed Sequence.

    Science.gov (United States)

    Du, Yue; Prashad, Shikha; Schoenbrun, Ilana; Clark, Jane E

    2016-01-01

    by concurrent online and offline learning. In addition, as the acquisition of a probabilistic sequence requires greater procedural memory compared to the acquisition of a fixed sequence, our results suggest that offline learning is more likely to take place in a procedural sequence learning task.

  18. Multi-proxy approach for palaeoclimate reconstruction using a loess-palaeosol sequence from Süttő , Hungary

    Science.gov (United States)

    Thiel, Christine; Königer, Paul; Ostertag-Henning, Christian; Scheeder, Georg; Novothny, Ágnes; Horváth, Erzsébet; Wacha, Lara; Techmer, Astrid; Frechen, Manfred

    2010-05-01

    The loess-palaeosol sequence at Süttő , Hungary contains a high-resolution terrestrial archive of palaeoenvironmental changes. The sequence is about 20 m thick and overlies travertine which was dated using Uranium-series to 235-314 ka (Sierralta et al., in press). Imbedded with the loess are two greyish stratified horizons, three brownish steppe-like soils and a pedocomplex composed of a reddish-brown palaeosol covered by a chernozem. Detailed dating studies were carried out (Novothny et al, 2009, Novothny et al., in press) revealing more or less continuous sedimentation from marine isotope stage (MIS) 6 to MIS 2. High-resolution grain size and magnetic susceptibility data exist (Novothny et al., in prep.) which allow for palaeoenvironmental reconstructions. In addition to those data sets we analysed the carbon and oxygen isotopic composition of bulk carbonate, carbonate nodules, and organic material in order to get further insight into palaeoprecipitation and palaeoclimatic conditions. To strengthen the interpretation based on isotopic data, we examined biomarkers derived from land plants (long-chain n-alkanes) for both loess and palaeosols to add information on the vegetation changes. We will discuss the new results in comparison with the published data sets and highlight inherent problems of the individual approaches. Novothny, A., Frechen, M., Horváth, E., Wacha, L., Rolf, C., in prep. High resolution grain size and magnetic susceptibility record of the last glacial cycles in the Süttő loess section, Hungary. Quaternary International. Novothny, A., Frechen, M., Horváth, E., Krbetschek, M., Tsukamoto, S., in press. Infrared stimulated luminescence and radiofluorescence dating of aeolian sediments from Hungary. Quaternary Geochronology, doi:10.1016/j.quageo.2009.05.002. Novothny, A., Frechen, M., Horváth, E., Bradák, B., Oches, E. A., McCoy, W. D., Stevens, T., 2009a. Luminescence and amino acid racemisation chronology of the loess-paleosol sequence

  19. First insight into CD59-like molecules of adult Fasciola hepatica.

    Science.gov (United States)

    Shi, Yunliang; Toet, Hayley; Rathinasamy, Vignesh; Young, Neil D; Gasser, Robin B; Beddoe, Travis; Huang, Weiyi; Spithill, Terry W

    2014-09-01

    The present study focussed on investigating CD59-like molecules of Fasciola hepatica. A cDNA encoding a CD59-like protein (termed FhCD59-1) identified previously in the membrane fraction of the F. hepatica tegument was isolated. This homologue was shown to encode a predicted open reading frame (ORF) of 122 amino acids (aa) orthologous to human CD59 with a 25 aa signal peptide, a mature protein containing 10 cysteines and a conserved CD59/Ly-6 family motif "CCXXXXCN". An analysis of cDNAs from two different adult specimens of F. hepatica revealed seven variable types of FhCD59-1 sequences, designated FhCD59-1.1 to FhCD59-1.7, which had 94.3-99.7% amino acid sequence identity upon pairwise comparison. Molecular modeling of FhCD59-1.1 with human CD59 confirmed the presence of the three-finger protein domain found in the CD59 family and predicted three disulphide bonds in the F. hepatica sequence. The interrogation of F. hepatica databases identified two additional sequences, designated FhCD59-2 and FhCD59-3, which had only 23.4-29.5% amino acid identity to FhCD59-1.1. Orthologues of the inferred CD59 protein sequences of F. hepatica were also identified in other flatworms, including Fasciola gigantica, Fascioloides magna, Schistosoma haematobium, Schistosoma japonicum, Schistosoma mansoni, Clonorchis sinensis, Opisthorchis viverrini, Taenia solium, Echinococcus granulosus and the free living Schmidtea mediterannea. The results revealed a considerable degree of sequence complexity in the CD59-like sequence families in F. hepatica and flatworms. Phylogenetic analysis of CD59-like aa sequences from F. hepatica and flatworms showed that FhCD59-2 clustered with the known surface-associated protein SmCD59-2 of S. mansoni. Relatively well-supported clades specific to schistosomes, fasciolids and opisthorchiids were identified. The qPCR analysis of gene transcription showed that the relative expression of these 3 FhCD59-like sequences varied by 11-47-fold during fluke

  20. Stratigraphy and stable isotope geochemistry of the carbonate sequence from the Paraguay belt

    International Nuclear Information System (INIS)

    Santos, Roberto Ventura.; Alvarenga, Carlos Jose Souza de; Dantas, Elton Luiz

    2001-01-01

    Two main Neoproterozoic carbonate sequences occur central Brazil both of which are stratiphicaly above glacial derived sediments. An older carbonate sequence occurs over the Sao Francisco Craton and in the surrounding folded belts (Rio Preto, Aracuai Ribeira and Brasilia). These carbonates overlie glacial diamictites that were related to the 'Sturtian' event dated between 0.7 and 0.9 Ga (Toulkeridis et al. 1999, Santos et al., 2000). A second carbonate sequence is described in the Paraguay Belt and postdated Vendian/Varegian glaciation sediments from the end of the Neoproterozoic. This glacial event has been reported in many studies concerning the Gondwana and the Laurentia supercontinent (Trompette, 1996; Condon and Prave, 2000; Myrow and Kaufman, 1999). In the Paraguay Belt the Vendian- Varangian glaciation rocks are characterized by a glaciomarine sequence, that occur at the border of the basin, and by glacial derived turbidites deposits, that occur in the deeper parts of the basin (Alvarenga and Trompette, 1992). Near the city of Corumba this glaciomarine sequence is overlaid by carbonate rocks containing Ediacaran-like fauna in which has been described Corumbella werneri and Cloudina Lucianoi (Hahn et al., 1982; Walde et al., 1982; Zaine and Fairchild, 1985; 1987). These carbonates have been interpreted as cap carbonates and the age of their fossils have been attributed to the Vendian Superior (590-545 MA) (Alvarenga and Trompette, 1992, Trompette 1996). Isotope stratigraphy studies have been widely used to study cap carbonate rocks that overlie Sturtian and Vendian- Varagian glaciogenic rocks. Stratigraphic correlation of these units is usually difficult because their lack fossils and there is no precise dating method that could be applied to these rocks. Hence, most studies concerning Neoproterozoic carbonates have concentrated on their stromatilites and microfossils content as well as on carbon isotope variations. In the present study, we present new carbon

  1. PENDEKATAN FILSAFAT HERMENEUTIKA DALAM PENAFSIRAN AL-QURAN: Transformasi Global Tafsir al-Quran

    Directory of Open Access Journals (Sweden)

    Fathul Mufid

    2013-09-01

    Full Text Available This essay will describe the transformation process of the interpretation of al Quran from the literal perspectives towards hermeneutics interpretations method, in a line with the recent globalization changes. Globalization is an era after modern where the world like a small village (global village, which makes interaction among countries, civilizations, religions, and cultures become more intens, fast and easy. This golbal changes is a medium which influencing cultures, countries, civilizations, and even religions aspects. Al Quran intepretation method which has been used by classical scholars stress more on the literal approach (tahlili was considered to be irrelevant to answer and respon the current human problems in this globalization era. The advanced of the global information technology has brought positive impact for human life to fullfil their live needs. However, on the other side, golbalization brings negatives effect as well. For instance, since the information centers are controlled by advanced secular  countries, the understanding of the Al Quran from various dimensions has shift and lose its function. These negatives effects are unavoidable for moslems which getting more influence on their religius life, including their understanding on the Holly Quran. Therefore, whether like or not, scholars in the intepretaion fields should adjust and inovate according to the current needs and trends using heurmenutics approach. Heurmenutics is a classical text critics method  which is used to understand al Quran that contains God’s messages that should be understood, and used in our life practically and empirically.

  2. RNA-DNA sequence differences spell genetic code ambiguities

    DEFF Research Database (Denmark)

    Bentin, Thomas; Nielsen, Michael L

    2013-01-01

    A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

  3. Inhibition of severe acute respiratory syndrome coronavirus replication in a lethal SARS-CoV BALB/c mouse model by stinging nettle lectin, Urtica dioica agglutinin

    Science.gov (United States)

    Kumaki, Yohichi; Wandersee, Miles K.; Smith, Aaron J.; Zhou, Yanchen; Simmons, Graham; Nelson, Nathan M.; Bailey, Kevin W.; Vest, Zachary G.; Li, Joseph K.-K.; Chan, Paul Kay-Sheung; Smee, Donald F.; Barnard, Dale L.

    2011-01-01

    Urtica dioica agglutinin (UDA) is a small plant monomeric lectin, 8.7 kDa in size, with an N-acetylglucosamine specificity that inhibits viruses from Nidovirales in vitro. In the current study, we first examined the efficacy of UDA on the replication of different SARS-CoV strains in Vero 76 cells. UDA inhibited virus replication in a dose-dependent manner and reduced virus yields of the Urbani strain by 90% at 1.1 ± 0.4 µg/ml in Vero 76 cells. Then, UDA was tested for efficacy in a lethal SARS-CoV-infected BALB/c mouse model. BALB/c mice were infected with two LD50 (575 PFU) of virus for 4 hours before the mice were treated intraperitoneally with UDA at 20, 10, 5 or 0 mg/kg/day for 4 days. Treatment with UDA at 5 mg/kg significantly protected the mice against a lethal infection with mouse-adapted SARS-CoV (p<0.001), but did not significantly reduce virus lung titers. All virus-infected mice receiving UDA treatments were also significantly protected against weight loss (p<0.001). UDA also effectively reduced lung pathology scores. At day 6 after virus exposure, all groups of mice receiving UDA had much lower lung weights than did the placebo-treated mice. Thus, our data suggest that UDA treatment of SARS infection in mice leads to a substantial therapeutic effect that protects mice against death and weight loss. Furthermore, the mode of action of UDA in vitro was further investigated using live SARS-CoV Urbani strain virus and retroviral particles pseudotyped with SARS-CoV spike (S). UDA specifically inhibited the replication of live SARS-CoV or SARS-CoV pseudotyped virus when added just before, but not after, adsorption. These data suggested that UDA likely inhibits SARS-CoV infection by targeting early stages of the replication cycle, namely, adsorption or penetration. In addition, we demonstrated that UDA neutralizes the virus infectivity, presumably by binding to the SARS-CoV spike (S) glycoprotein. Finally, the target molecule for inhibition of virus

  4. Wisteria floribunda Agglutinin and Its Reactive-Glycan-Carrying Prostate-Specific Antigen as a Novel Diagnostic and Prognostic Marker of Prostate Cancer.

    Science.gov (United States)

    Hagiwara, Kazuhisa; Tobisawa, Yuki; Kaya, Takatoshi; Kaneko, Tomonori; Hatakeyama, Shingo; Mori, Kazuyuki; Hashimoto, Yasuhiro; Koie, Takuya; Suda, Yoshihiko; Ohyama, Chikara; Yoneyama, Tohru

    2017-01-26

    Wisteria floribunda agglutinin (WFA) preferably binds to LacdiNAc glycans, and its reactivity is associated with tumor progression. The aim of this study to examine whether the serum LacdiNAc carrying prostate-specific antigen-glycosylation isomer (PSA-Gi) and WFA-reactivity of tumor tissue can be applied as a diagnostic and prognostic marker of prostate cancer (PCa). Between 2007 and 2016, serum PSA-Gi levels before prostate biopsy (Pbx) were measured in 184 biopsy-proven benign prostatic hyperplasia patients and 244 PCa patients using an automated lectin-antibody immunoassay. WFA-reactivity on tumor was analyzed in 260 radical prostatectomy (RP) patients. Diagnostic and prognostic performance of serum PSA-Gi was evaluated using area under the receiver-operator characteristic curve (AUC). Prognostic performance of WFA-reactivity on tumor was evaluated via Cox proportional hazards regression analysis and nomogram. The AUC of serum PSA-Gi detecting PCa and predicting Pbx Grade Group (GG) 3 and GG ≥ 3 after RP was much higher than those of conventional PSA. Multivariate analysis showed that WFA-reactivity on prostate tumor was an independent risk factor of PSA recurrence. The nomogram was a strong model for predicting PSA-free survival provability with a c -index ≥0.7. Serum PSA-Gi levels and WFA-reactivity on prostate tumor may be a novel diagnostic and pre- and post-operative prognostic biomarkers of PCa, respectively.

  5. Complete Genome Sequence of Staphylococcus epidermidis 1457.

    Science.gov (United States)

    Galac, Madeline R; Stam, Jason; Maybank, Rosslyn; Hinkle, Mary; Mack, Dietrich; Rohde, Holger; Roth, Amanda L; Fey, Paul D

    2017-06-01

    Staphylococcus epidermidis 1457 is a frequently utilized strain that is amenable to genetic manipulation and has been widely used for biofilm-related research. We report here the whole-genome sequence of this strain, which encodes 2,277 protein-coding genes and 81 RNAs within its 2.4-Mb genome and plasmid. Copyright © 2017 Galac et al.

  6. The complete genome sequence of Yersinia pseudotuberculosis IP31758, the causative agent of Far East scarlet-like fever.

    Directory of Open Access Journals (Sweden)

    Mark Eppinger

    2007-08-01

    Full Text Available The first reported Far East scarlet-like fever (FESLF epidemic swept the Pacific coastal region of Russia in the late 1950s. Symptoms of the severe infection included erythematous skin rash and desquamation, exanthema, hyperhemic tongue, and a toxic shock syndrome. The term FESLF was coined for the infection because it shares clinical presentations with scarlet fever caused by group A streptococci. The causative agent was later identified as Yersinia pseudotuberculosis, although the range of morbidities was vastly different from classical pseudotuberculosis symptoms. To understand the origin and emergence of the peculiar clinical features of FESLF, we have sequenced the genome of the FESLF-causing strain Y. pseudotuberculosis IP31758 and compared it with that of another Y. pseudotuberculosis strain, IP32953, which causes classical gastrointestinal symptoms. The unique gene pool of Y pseudotuberculosis IP31758 accounts for more than 260 strain-specific genes and introduces individual physiological capabilities and virulence determinants, with a significant proportion horizontally acquired that likely originated from Enterobacteriaceae and other soil-dwelling bacteria that persist in the same ecological niche. The mobile genome pool includes two novel plasmids phylogenetically unrelated to all currently reported Yersinia plasmids. An icm/dot type IVB secretion system, shared only with the intracellular persisting pathogens of the order Legionellales, was found on the larger plasmid and could contribute to scarlatinoid fever symptoms in patients due to the introduction of immunomodulatory and immunosuppressive capabilities. We determined the common and unique traits resulting from genome evolution and speciation within the genus Yersinia and drew a more accurate species border between Y. pseudotuberculosis and Y. pestis. In contrast to the lack of genetic diversity observed in the evolutionary young descending Y. pestis lineage, the population

  7. Non-target-site resistance to ALS-inhibiting herbicides in a Sagittaria trifolia L. population.

    Science.gov (United States)

    Zhao, Bochui; Fu, Danni; Yu, Yang; Huang, Chengtian; Yan, Kecheng; Li, Pingsheng; Shafi, Jamil; Zhu, He; Wei, Songhong; Ji, Mingshan

    2017-08-01

    Sagittaria trifolia L. is one of the most competitive weeds in rice fields in northeastern China. The continuous use of acetolactate synthase (ALS)-inhibitors has led to the evolution of herbicide resistant S. trifolia. A subpopulation BC1, which was derived from the L1 population, was analyzed using DNA sequencing and ALS enzyme activity assays and levels of resistance to five ALS-inhibiting herbicides was determined. DNA sequencing and ALS enzyme assays revealed no amino acid substitutions and no significant differences in enzyme sensitivity between susceptible and resistant populations. Whole-plant dose-response experiments showed that the BC1 population exhibited different levels of resistance (resistance ratios ranging from 2.14 to 51.53) to five ALS herbicides, and the addition of malathion (P450 inhibitor) to bensulfuron-methyl, penoxsulam and bispyribac-sodium strongly reduced the dry weight accumulation of the BC1 population compared with the effects of the three herbicides alone. The results of the present study demonstrated that the BC1 population has evolved non-target-site resistance to ALS-inhibiting herbicides. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Cytochemical localization of small intestinal glycoconjugates by lectin histochemistry in controls and subjects with cystic fibrosis.

    Science.gov (United States)

    Jacobs, L R; De Fontes, D; Cox, K L

    1983-05-01

    Human mucosal glycoconjugates were examined in normal small intestinal biopsies from five control subjects using six different fluorescein-conjugated lectins: Triticum vulgare agglutinin (WGA), Ulex europaeus agglutinin I (UEA1), Ricinus communis agglutinin I (RCA1), glycin max-soy bean agglutinin (SBA), Dolichus biflorus agglutinin (DBA), and Arachis hypogaea peanut agglutinin (PNA). These plant agglutinins bind to specific nonreducing end-terminal carbohydrate residues. Only the lectins derived from WGA, which produced the strongest staining, and UEA1 consistently bound to both intestinal goblet cell mucin and epithelial cell microvillar membranes. The intensity of lectin binding was greatest in the upper villus and diminished down towards the crypt, being weakest in the crypt base. Similar histochemical studies carried out on small bowel biopsies from five patients with cystic fibrosis revealed no major qualitative differences between the intestinal glycoconjugates in normal subjects and those with cystic fibrosis. These results suggest that glycoconjugate biosynthesis of human intestinal goblet cell mucin and epithelial cell membranes may be complete and hence full differentiation achieved only when these cells have migrated out of the crypt and onto the villus.

  9. Comparison of pause predictions of two sequence-dependent transcription models

    International Nuclear Information System (INIS)

    Bai, Lu; Wang, Michelle D

    2010-01-01

    Two recent theoretical models, Bai et al (2004, 2007) and Tadigotla et al (2006), formulated thermodynamic explanations of sequence-dependent transcription pausing by RNA polymerase (RNAP). The two models differ in some basic assumptions and therefore make different yet overlapping predictions for pause locations, and different predictions on pause kinetics and mechanisms. Here we present a comprehensive comparison of the two models. We show that while they have comparable predictive power of pause locations at low NTP concentrations, the Bai et al model is more accurate than Tadigotla et al at higher NTP concentrations. The pausing kinetics predicted by Bai et al is also consistent with time-course transcription reactions, while Tadigotla et al is unsuited for this type of kinetic prediction. More importantly, the two models in general predict different pausing mechanisms even for the same pausing sites, and the Bai et al model provides an explanation more consistent with recent single molecule observations

  10. When does ALS start? ADAR2-GluA2 hypothesis for the etiology of sporadic ALS

    Directory of Open Access Journals (Sweden)

    Takuto eHideyama

    2011-11-01

    Full Text Available Amyotrophic lateral sclerosis (ALS is the most common adult-onset motor neuron disease. More than 90% of ALS cases are sporadic, and the majority of sporadic ALS patients do not carry mutations in genes causative of familial ALS; therefore, investigation specifically targeting sporadic ALS is needed to discover the pathogenesis. The motor neurons of sporadic ALS patients express unedited GluA2 mRNA at the Q/R site in a disease-specific and motor neuron-selective manner. GluA2 is a subunit of the AMPA receptor, and it has a regulatory role in the Ca2+-permeability of the AMPA receptor after the genomic Q codon is replaced with the R codon in mRNA by adenosine-inosine conversion, which is mediated by adenosine deaminase acting on RNA 2 (ADAR2. Therefore, ADAR2 activity may not be sufficient to edit all GluA2 mRNA expressed in the motor neurons of ALS patients. To investigate whether deficient ADAR2 activity plays pathogenic roles in sporadic ALS, we generated genetically modified mice (AR2 in which the ADAR2 gene was conditionally knocked out in the motor neurons. AR2 mice showed an ALS-like phenotype with the death of ADAR2-lacking motor neurons. Notably, the motor neurons deficient in ADAR2 survived when they expressed only edited GluA2 in AR2/GluR-BR/R (AR2res mice, in which the endogenous GluA2 alleles were replaced by the GluR-BR allele that encoded edited GluA2. In heterozygous AR2 mice with only one ADAR2 allele, approximately 20% of the spinal motor neurons expressed unedited GluA2 and underwent degeneration, indicating that half-normal ADAR2 activity is not sufficient to edit all GluA2 expressed in motor neurons. It is likely therefore that the expression of unedited GluA2 causes the death of motor neurons in sporadic ALS. We hypothesize that a progressive downregulation of ADAR2 activity plays a critical role in the pathogenesis of sporadic ALS and that the pathological process commences when motor neurons express unedited GluA2.

  11. Al-‘Alāqah baina Ushūl al-Fiqh wa Maqāshidi al-Sharīah wa al-Da’wah ilā Ta’sīsi ‘Ilmi al-Maqāshid

    Directory of Open Access Journals (Sweden)

    Anggraini Binti Ramli

    2016-12-01

    Full Text Available The study of Maqāshid sharīa is an important point in the discussion of Islamic legal theory (ushūl al-fiqh. Serious debates began to emerge in the 19th century among Islamic jurists concerning the position of maqāshid sharīa. At least, there are three important debates in the history; first, whether maqāshid is part of the discussion ushūl al-fiqh; second, is maqāshid sharīa built upon a foundation of classical Islamic jurisprudence (fiqh; and third, whether the maqāshid sharīa study is able to become an independent science that is separated from the study of classical Islamic jurisprudence. This article tries to present a discussion of the three paradigms by employing a descriptive-analytic method. The results of this study uncover that the study of maqāshid sharīa is like two sides of one coin; theoretically it is a distinctive study from ushūl al-fiqh, but it cannot be separated from one another. Ushūl al-fiqh has become the foundation to find out more details about the study of maqashid sharia. The separation between classical Islamic jurisprudence (fiqh and maqāshid sharīa study conducted by Islamic jurists is a relative separation.

  12. Snake Genome Sequencing: Results and Future Prospects.

    Science.gov (United States)

    Kerkkamp, Harald M I; Kini, R Manjunatha; Pospelov, Alexey S; Vonk, Freek J; Henkel, Christiaan V; Richardson, Michael K

    2016-12-01

    Snake genome sequencing is in its infancy-very much behind the progress made in sequencing the genomes of humans, model organisms and pathogens relevant to biomedical research, and agricultural species. We provide here an overview of some of the snake genome projects in progress, and discuss the biological findings, with special emphasis on toxinology, from the small number of draft snake genomes already published. We discuss the future of snake genomics, pointing out that new sequencing technologies will help overcome the problem of repetitive sequences in assembling snake genomes. Genome sequences are also likely to be valuable in examining the clustering of toxin genes on the chromosomes, in designing recombinant antivenoms and in studying the epigenetic regulation of toxin gene expression.

  13. Snake Genome Sequencing: Results and Future Prospects

    Directory of Open Access Journals (Sweden)

    Harald M. I. Kerkkamp

    2016-12-01

    Full Text Available Snake genome sequencing is in its infancy—very much behind the progress made in sequencing the genomes of humans, model organisms and pathogens relevant to biomedical research, and agricultural species. We provide here an overview of some of the snake genome projects in progress, and discuss the biological findings, with special emphasis on toxinology, from the small number of draft snake genomes already published. We discuss the future of snake genomics, pointing out that new sequencing technologies will help overcome the problem of repetitive sequences in assembling snake genomes. Genome sequences are also likely to be valuable in examining the clustering of toxin genes on the chromosomes, in designing recombinant antivenoms and in studying the epigenetic regulation of toxin gene expression.

  14. Effects of wheat germ agglutinin on human gastrointestinal epithelium: Insights from an experimental model of immune/epithelial cell interaction

    International Nuclear Information System (INIS)

    Pellegrina, Chiara Dalla; Perbellini, Omar; Scupoli, Maria Teresa; Tomelleri, Carlo; Zanetti, Chiara; Zoccatelli, Gianni; Fusi, Marina; Peruffo, Angelo; Rizzi, Corrado; Chignola, Roberto

    2009-01-01

    Wheat germ agglutinin (WGA) is a plant protein that binds specifically to sugars expressed, among many others, by human gastrointestinal epithelial and immune cells. WGA is a toxic compound and an anti-nutritional factor, but recent works have shown that it may have potential as an anti-tumor drug and as a carrier for oral drugs. To quantitate the toxicity threshold for WGA on normal epithelial cells we previously investigated the effects of the lectin on differentiated Caco2 cells, and showed that in the micromolar range of concentrations WGA could alter the integrity of the epithelium layer and increase its permeability to both mannitol and dextran. WGA was shown to be uptaken by Caco2 cells and only ∼ 0.1% molecules were observed to cross the epithelium layer by transcytosis. Here we show that at nanomolar concentrations WGA is unexpectedly bioactive on immune cells. The supernatants of WGA-stimulated peripheral blood mononuclear cells (PBMC) can alter the integrity of the epithelium layer when administered to the basolateral side of differentiated Caco2 cells and the effects can be partially inhibited by monoclonal antibodies against IL1, IL6 and IL8. At nanomolar concentrations WGA stimulates the synthesis of pro-inflammatory cytokines and thus the biological activity of WGA should be reconsidered by taking into account the effects of WGA on the immune system at the gastrointestinal interface. These results shed new light onto the molecular mechanisms underlying the onset of gastrointestinal disorders observed in vivo upon dietary intake of wheat-based foods.

  15. Statistical convergence of double sequences in intuitionistic fuzzy normed spaces

    International Nuclear Information System (INIS)

    Mursaleen, M.; Mohiuddine, S.A.

    2009-01-01

    Recently, the concept of intuitionistic fuzzy normed spaces was introduced by Saadati and Park [Saadati R, Park JH. Chaos, Solitons and Fractals 2006;27:331-44]. Karakus et al. [Karakus S, Demirci K, Duman O. Chaos, Solitons and Fractals 2008;35:763-69] have quite recently studied the notion of statistical convergence for single sequences in intuitionistic fuzzy normed spaces. In this paper, we study the concept of statistically convergent and statistically Cauchy double sequences in intuitionistic fuzzy normed spaces. Furthermore, we construct an example of a double sequence to show that in IFNS statistical convergence does not imply convergence and our method of convergence even for double sequences is stronger than the usual convergence in intuitionistic fuzzy normed space.

  16. Kerja Perspektif Al-Qur'an

    Directory of Open Access Journals (Sweden)

    Ahmad Munir

    2011-05-01

    Full Text Available The moslem ethics of life is based on movement as ex­pressed in certain terms like al-sharī’ah, al-tarīqah, al-sirāt, al-sabīl and al-manhaj, that make sense of way and teachings to achieve good life. Islam obliges and gives appreciation of the achievements of Mus­lims. The Qur’an uses several terms to refer to such work; ‘charity, kasb, juhd, ibtighâ’, sa ’yu and su ’âl. From this concept, the Qur’an considers work as nob­le, while begging is despicable. Work means thankful to God for the potential He bestows. The Qur’an promotes work not only because it is the way to achieve the wealth, but also because it possesses the its sacred value for the benefit of fulfilling livelihood. Therefore the work should also be done based on ethical values .

  17. Sequence comparison of the rDNA introns from six different species of Tetrahymena

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engberg, J

    1985-01-01

    model for the intron RNA of Cech et al. (Proc. Natl. Acad. Sci. U.S.A. 80, 3903 (83)). Most of the sequence variation in the four new sequences reported here is found in single stranded loops in the model. However, in four cases we found nucleotide substitutions in duplex stem regions, two of them...

  18. In vitro induction of Entamoeba histolytica cyst-like structures from trophozoites.

    Directory of Open Access Journals (Sweden)

    Hugo Aguilar-Díaz

    Full Text Available Inhibition of encystment can be conceived as a potentially useful mechanism to block the transmission of Entamoeba histolytica under natural conditions. Unfortunately, amoeba encystment has not been achieved in vitro and drugs inhibiting the formation of cysts are not available. Luminal conditions inducing encystment in vivo are also unknown, but cellular stress such as exposure to reactive oxygen species from immune cells or intestinal microbiota could be involved. A role for certain divalent cations as cofactors of enzymes involved in excystment has also been described. In this study, we show that trophozoite cultures, treated with hydrogen peroxide in the presence of trace amounts of several cations, transform into small-sized spherical and refringent structures that exhibit resistance to different detergents. Ultrastructural analysis under scanning and transmission electron microscopy revealed multinucleated structures (some with four nuclei with smooth, thick membranes and multiple vacuoles. Staining with calcofluor white, as well as an ELISA binding assay using wheat germ agglutinin, demonstrated the presence of polymers of N-acetylglucosamine (chitin, which is the primary component of the natural cyst walls. Over-expression of glucosamine 6-phosphate isomerase, likely to be the rate-limiting enzyme in the chitin synthesis pathway, was also confirmed by RT-PCR. These results suggest that E. histolytica trophozoites activated encystment pathways when exposed to our treatment.

  19. Complete genome sequence of Arcanobacterium haemolyticum type strain (11018T)

    Energy Technology Data Exchange (ETDEWEB)

    Yasawong, Montri [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Teshima, Hazuki [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Pukall, Rudiger [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany

    2010-01-01

    Vulcanisaeta distributa Itoh et al. 2002 belongs to the family Thermoproteaceae in the phylum Crenarchaeota. The genus Vulcanisaeta is characterized by a global distribution in hot and acidic springs. This is the first genome sequence from a member of the genus Vulcanisaeta and seventh genome sequence in the family Thermoproteaceae. The 2,374,137 bp long genome with its 2,544 protein-coding and 49 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  20. Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%

    DEFF Research Database (Denmark)

    Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.

    2005-01-01

    detect two genes with low sequence similarity, where the genes are part of a larger genomic region. Results: Here we present such an approach for pairwise local alignment which is based on FILDALIGN and the Sankoff algorithm for simultaneous structural alignment of multiple sequences. We include...... the ability to conduct mutual scans of two sequences of arbitrary length while searching for common local structural motifs of some maximum length. This drastically reduces the complexity of the algorithm. The scoring scheme includes structural parameters corresponding to those available for free energy....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...

  1. Envelope-like retrotransposons in the plant kingdom: evidence of their presence in gymnosperms (Pinus pinaster).

    Science.gov (United States)

    Miguel, Célia; Simões, Marta; Oliveira, Maria Margarida; Rocheta, Margarida

    2008-11-01

    Retroviruses differ from retrotransposons due to their infective capacity, which depends critically on the encoded envelope. Some plant retroelements contain domains reminiscent of the env of animal retroviruses but the number of such elements described to date is restricted to angiosperms. We show here the first evidence of the presence of putative env-like gene sequences in a gymnosperm species, Pinus pinaster (maritime pine). Using a degenerate primer approach for conserved domains of RNaseH gene, three clones from putative envelope-like retrotransposons (PpRT2, PpRT3, and PpRT4) were identified. The env-like sequences of P. pinaster clones are predicted to encode proteins with transmembrane domains. These sequences showed identity scores of up to 30% with env-like sequences belonging to different organisms. A phylogenetic analysis based on protein alignment of deduced aminoacid sequences revealed that these clones clustered with env-containing plant retrotransposons, as well as with retrotransposons from invertebrate organisms. The differences found among the sequences of maritime pine clones isolated here suggest the existence of different putative classes of env-like retroelements. The identification for the first time of env-like genes in a gymnosperm species may support the ancestrality of retroviruses among plants shedding light on their role in plant evolution.

  2. Structural properties of MBE AlInN and AlGaInN barrier layers for GaN-HEMT structures

    International Nuclear Information System (INIS)

    Kirste, Lutz; Lim, Taek; Aidam, Rolf; Mueller, Stefan; Waltereit, Patrick; Ambacher, Oliver

    2010-01-01

    A high-resolution X-ray diffraction and X-ray reflectivity study of the structural properties of AlInN/GaN and AlGaInN/GaN high electron mobility transistor structures deposited by molecular beam epitaxy on metal organic chemical vapor deposition GaN/Al 2 O 3 and GaN/SiC templates is presented. A new AlN/GaN/AlN triple-interlayer is implemented to improve the interface properties between barrier layer and GaN buffer for a higher mobility of the polarization induced two-dimensional electron gas. Layer properties and structural parameters like concentration, interface quality, layer thickness, strain and crystalline perfection are analyzed. Best structural properties are achieved for an AlGaInN layer with AlN/GaN/AlN interlayer deposited on a GaN/4H-SiC (00.1) template. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  3. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  4. Microstructural characteristics and aging response of Zn-containing Al-Mg-Si-Cu alloy

    Science.gov (United States)

    Cai, Yuan-hua; Wang, Cong; Zhang, Ji-shan

    2013-07-01

    Al-Mg-Si-Cu alloys with and without Zn addition were fabricated by conventional ingot metallurgy method. The microstructures and properties were investigated using optical microscopy (OM), field emission scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM), tensile test, hardness test, and electrical conductivity measurement. It is found that the as-cast Al-Mg-Si-Cu-Zn alloy is composed of coarse dendritic grains, long needle-like β/δ-AlFeSi white intermetallics, and Chinese script-like α-AlFeSi compounds. During high temperature homogenization treatment, only harmful needle-like β-AlFeSi phase undergoes fragmentation and spheroidizing at its tips, and the destructive needle-like δ-phase does not show any morphological and size changes. Phase transitions from β-AlFeSi to α-AlFeSi and from δ-AlFeSi to β-AlFeSi are also not found. Zn addition improves the aging hardening response during the former aging stage and postpones the peak-aged hardness to a long aging time. In T4 condition, Zn addition does not obviously increase the yield strength and decrease the elongation, but it markedly improves paint-bake hardening response during paint-bake cycle. The addition of 0.5wt% Zn can lead to an increment of 99 MPa in yield strength compared with the value of 69 MPa for the alloy without Zn after paint-bake cycle.

  5. Lectin immunohistochemical evaluation of human bladder carcinomas. A comparison of Carnoy's and formalin fixation.

    Science.gov (United States)

    Okamura, T; Ueda, K; Ohtaguro, K; Inoue, K; Washida, H; Mori, M; Tatemoto, Y; Fukushima, S

    1993-10-01

    A lectin immunohistochemical analysis of 51 human bladder carcinomas, including 44 cases of transitional cell carcinoma (TCC) (G1, 15 cases; G2, 17 cases; G3, 12 cases) and 7 cases of squamous cell carcinoma (SCC), was performed. Tissues were obtained by cold punch biopsies, fixed in Carnoy's or 10% formalin solution, stained for binding of 10 different lectins, and evaluated under the light microscope. The lectins used were concanavalin agglutinin (Con A), soybean agglutinin (SBA), Lotus tetragonolobus agglutinin (LTA), Dolichos biflorusa agglutinin (DBA), peanut agglutinin (PNA), Ricinus communis agglutinin I (RCA1), Ulex europaeus agglutinin I, II (UEA-I, II), wheat germ agglutinin (WGA), and Pisum sativum agglutinin (PEA). TCC prepared with Carnoy's fixation tended to show moderately positive Con A, UEA-I, and WGA reactions for G1, and strongly positive reactions for G2 and G3 lesions. UEA-II was mainly negative in G1, but tended to increase to become moderate in G3. DBA tended to show a moderately positive reaction in G1 and G2, but was mainly negative in G3. With formalin fixation, only RCA1 demonstrated grade specific variation, tendency to react moderately in the G1 and G2 cases, and strongly in G3. There were no further differences among the histopathological grades of TCC for other lectins. Thus, Carnoy's fixation appears superior for distinguishing between grades of lesions. SCC tended to react more strongly than TCC with all the various lectins except PEA, independent of fixation.

  6. Array-based FMR1 sequencing and deletion analysis in patients with a fragile X syndrome-like phenotype.

    Directory of Open Access Journals (Sweden)

    Stephen C Collins

    2010-03-01

    Full Text Available Fragile X syndrome (FXS is caused by loss of function mutations in the FMR1 gene. Trinucleotide CGG-repeat expansions, resulting in FMR1 gene silencing, are the most common mutations observed at this locus. Even though the repeat expansion mutation is a functional null mutation, few conventional mutations have been identified at this locus, largely due to the clinical laboratory focus on the repeat tract.To more thoroughly evaluate the frequency of conventional mutations in FXS-like patients, we used an array-based method to sequence FMR1 in 51 unrelated males exhibiting several features characteristic of FXS but with normal CGG-repeat tracts of FMR1. One patient was identified with a deletion in FMR1, but none of the patients were found to have other conventional mutations.These data suggest that missense mutations in FMR1 are not a common cause of the FXS phenotype in patients who have normal-length CGG-repeat tracts. However, screening for small deletions of FMR1 may be of clinically utility.

  7. The Genyornis Egg: Response to Miller et al.'s commentary on Grellet-Tinner et al., 2016

    Science.gov (United States)

    Grellet-Tinner, Gerald; Spooner, Nigel A.; Handley, Warren D.; Worthy, Trevor H.

    2017-04-01

    Williams (1981) and Williams and Rich (1991) attributed Australian Quaternary fossil eggshell that differed from that of emu Dromaius novaehollandiae to the extinct bird Genyornis newtoni without any osteological or embryonic support. Such association by proximity or abundance mirrors the case of the mistaken association of oviraptor eggs to Protoceratops in the 1920's by Andrews (Grellet-Tinner and Makovicky, 2006). No other candidate species was considered, and this attribution has been unchallenged and followed by everyone thereafter. Much research has been done on this Australian eggshell, with one result being that the extinction of the parent of this eggshell is the most well documented for a taxon in Australia (e.g., Miller et al., 1999, 2005). Grellet-Tinner et al. (2016) raised several problems with the identity of the eggshell Williams (1981) attributed to Genyornis newtoni and suggested that extinct megapodes of the genus Progura were the more likely layer of this eggshell type, therein referred to as ;putative Genyornis oological material; (PGOM). Miller et al. (2017) challenged our hypothesis stating that ;Based on the dimensions of the reconstructed Spooner Egg,Grellet-Tinner et al. (2016)argue that PGOM is too small for a bird with the body mass estimated for Genyornis (168-275 kg) … …[and] …. None of the additional PGOM observations reported byGrellet-Tinner et al. (2016)are inconsistent with a Genyornis parent;. Here we take the opportunity to respond to their critique, the basis of which resolves into a few points, which we address in turn.

  8. Insulin-like growth factor-II (IGF II) receptor from rat brain is of lower apparent molecular weight than the IGF II receptor from rat liver

    International Nuclear Information System (INIS)

    McElduff, A.; Poronnik, P.; Baxter, R.C.

    1987-01-01

    The binding subunits of the insulin and insulin-like growth factor-I (IGF I) receptors from rat brain are of lower molecular weight than the corresponding receptor in rat liver, possibly due to variations in sialic acid content. We have compared the IGF II receptor from rat brain and rat liver. The brain receptor is of smaller apparent mol wt (about 10 K) on sodium dodecyl sulfate polyacrylamide gel electrophoresis. This size difference is independent of ligand binding as it persists in iodinated and specifically immunoprecipitated receptors. From studies of wheat germ agglutinin binding and the effect of neuraminidase on receptor mobility, we conclude that this difference is not simply due to variations in sialic acid content. Treatment with endoglycosidase F results in reduction in the molecular size of both liver and brain receptors and after this treatment the aglycoreceptors are of similar size. We conclude that in rat brain tissue the IGF II receptor like the binding subunits of the insulin and IGF I receptors is of lower molecular size than the corresponding receptors in rat liver. This difference is due to differences in N-linked glycosylation

  9. In silico sequence analysis and homology modeling of predicted beta-amylase 7-like protein in Brachypodium distachyon L.

    Directory of Open Access Journals (Sweden)

    ERTUĞRUL FILIZ

    2014-04-01

    Full Text Available Beta-amylase (β-amylase, EC 3.2.1.2 is an enzyme that catalyses hydrolysis of glucosidic bonds in polysaccharides. In this study, we analyzed protein sequence of predicted beta-amylase 7-like protein in Brachypodium distachyon. pI (isoelectric point value was found as 5.23 in acidic character, while the instability index (II was found as 50.28 with accepted unstable protein. The prediction of subcellular localization was revealed that the protein may reside in chloroplast by using CELLO v.2.5. The 3D structure of protein was performed using comparative homology modeling with SWISS-MODEL. The accuracy of the predicted 3D structure was checked using Ramachandran plot analysis showed that 95.4% in favored region. The results of our study contribute to understanding of β-amylase protein structure in grass species and will be scientific base for 3D modeling of beta-amylase proteins in further studies.

  10. Interfacial reaction in SiC_f/Ti-6Al-4V composite by using transmission electron microscopy

    International Nuclear Information System (INIS)

    Huang, Bin; Li, Maohua; Chen, Yanxia; Luo, Xian; Yang, Yanqing

    2015-01-01

    The interfacial reactions of continuous SiC fiber reinforced Ti-6Al-4V matrix composite (SiC_f/Ti-6Al-4V composite) and continuous SiC fiber coated by C reinforced Ti-6Al-4V matrix composite (SiC_f/C/Ti-6Al-4V composite) were investigated by using micro-beam electron diffraction (MBED) and energy disperse spectroscopy (EDS) on transmission electron microscopy (TEM). The sequence of the interfacial reactions in the as-processed and exposed at 900°C for 50h SiC_f/Ti-6Al-4V composites can be described as SiC||TiC||Ti_5Si_3 + TiC||Ti-6Al-4V and SiC||TiC||Ti_5Si_3||TiC||Ti_5Si_3||TiC||Ti_5Si_3||Ti-6Al-4V, respectively. Additionally, both in as-processed and exposed composites, Ti_3SiC_2 and Ti_3Si are absent at the interfaces. For the SiC_f/C/Ti-6Al-4V composite exposed at 900 °C for 50 h, the sequence of the interfacial reaction can be described as SiC||C||TiC_F||TiC_C||Ti-6Al-4V before C coating is completely consumed by interfacial reaction. When interfacial reaction consumes C coating completely, the sequence of the interfacial reaction can be described as SiC||TiC||Ti_5Si_3||TiC||Ti-6Al-4V. Furthermore, in SiC_f/C/Ti-6Al-4V composite, C coating can absolutely prevent Si diffusion from SiC fiber to matrix. Basing on these results, the model of formation process of the interfacial reaction products in the composites was proposed. - Highlights: • We obtained the sequence of the interfacial reactions in the as-processed and exposed at 900 °C for 50 h SiC_f/Ti-6Al-4 V composites as well as in the SiC_f/C/Ti-6Al-4 V composite exposed at 900 °C for 50 h. • We verified that both in as-processed and exposed SiC_f/Ti-6Al-4 V composites, Ti_3SiC_2 and Ti_3Si are absent at the interfaces. • Carbon coating can absolutely prevent silicon diffusion from SiC fiber to matrix. • Basing on these results, the model of formation process of the interfacial reaction products in the composites was proposed.

  11. Effect of Ni on eutectic structural evolution in hypereutectic Al-Mg2Si cast alloys

    International Nuclear Information System (INIS)

    Li Chong; Wu Yaping; Li Hui; Wu Yuying; Liu Xiangfa

    2010-01-01

    Research highlights: → By the injection of rod-like NiAl 3 phase in Al-Mg 2 Si alloys, Al-Mg 2 Si binary eutectic structure gradually evolves into Al-Mg 2 Si-NiAl 3 ternary eutectic. → The ternary eutectic presents a unique double rod structure that rod-like NiAl 3 and Mg 2 Si uniformly distribute in Al matrix. → The mechanism of structural evolution was analyzed in terms of the detailed microstructural observations. → The high temperature (350 deg. C) tensile strength of the alloy increases by 23% due to the eutectic structural evolution. - Abstract: The aim of this work is to investigate the eutectic structural evolution of hypereutectic Al-20% Mg 2 Si with Ni addition under a gravity casting process. Three-dimensional morphologies of eutectic phases were observed in detail using field emission scanning electron microscopy, after Al matrix was removed by deep etching or extraction. The results show that Al-Mg 2 Si binary eutectic gradually evolves into Al-Mg 2 Si-NiAl 3 ternary eutectic with the increase of Ni content, and flake-like eutectic Mg 2 Si transforms into rods. The ternary eutectic presents a unique double rod structure that rod-like NiAl 3 and Mg 2 Si uniformly distribute in Al matrix. Further, the high temperature (350 deg. C) tensile strength of the alloy increases by 23% due to the eutectic structure evolution, and the mechanism of structural evolution was discussed and analyzed in terms of the detailed microstructural observations.

  12. Isolation of Exosome-Like Nanoparticles and Analysis of MicroRNAs Derived from Coconut Water Based on Small RNA High-Throughput Sequencing.

    Science.gov (United States)

    Zhao, Zhehao; Yu, Siran; Li, Min; Gui, Xin; Li, Ping

    2018-03-21

    In this study, the presence of microRNAs in coconut water was identified by real-time polymerase chain reaction (PCR) based on the results of high-throughput small RNA sequencing. In addition, the differences in microRNA content between immature and mature coconut water were compared. A total of 47 known microRNAs belonging to 25 families and 14 new microRNAs were identified in coconut endosperm. Through analysis using a target gene prediction software, potential microRNA target genes were identified in the human genome. Real-time PCR showed that the level of most microRNAs was higher in mature coconut water than in immature coconut water. Then, exosome-like nanoparticles were isolated from coconut water. After ultracentrifugation, some particle structures were seen in coconut water samples using 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate fluorescence staining. Subsequent scanning electron microscopy observation and dynamic light scattering analysis also revealed some exosome-like nanoparticles in coconut water, and the mean diameters of the particles detected by the two methods were 13.16 and 59.72 nm, respectively. In conclusion, there are extracellular microRNAs in coconut water, and their levels are higher in mature coconut water than in immature coconut water. Some exosome-like nanoparticles were isolated from coconut water, and the diameter of these particles was smaller than that of animal-derived exosomes.

  13. Nanocrystallization in Cu-Zr-Al-Sm Bulk Metallic Glasses

    Science.gov (United States)

    Sikan, Fatih; Yasar, Bengisu; Kalay, Ilkay

    2018-04-01

    The effect of rare-earth element (Sm) microalloying on the thermal stability and crystallization kinetics of melt-spun ribbons and suction-cast rods of Zr48Cu38.4Al9.6Sm4 alloy were investigated using differential scanning calorimetry (DSC), X-ray diffraction (XRD), transmission electron microscopy (TEM), and atom probe tomography (APT). The XRD results of constant heating rate annealing indicated that amorphous Zr48Cu38.4Al9.6Sm4 melt-spun ribbons devitrifies into Cu2Sm at 673 K (400 °C). The sequence continues with the precipitation of Cu10Zr7 and then these two phases coexist. XRD and TEM studies on 1 mm diameter as suction-cast rods indicated the precipitation of 30-nm-mean size Cu2Sm crystals during solidification. TEM investigation of the isothermal crystallization sequence of melt-spun ribbons and 1-mm-diameter suction-cast rods revealed the precipitation of Cu2Sm nanocrystals at the onset of crystallization and the restriction of the growth of these nanocrystals up to 10 nm diameter with further annealing. APT analysis of 1-mm-diameter suction-cast rods showed that the limited growth of Cu2Sm nanocrystals is due to sluggish diffusion of Sm and Al-Zr pile up at the interface.

  14. Performance improvement of AlGaN-based deep-ultraviolet light-emitting diodes via Al-composition graded quantum wells

    Science.gov (United States)

    Lu, Lin; Zhang, Yu; Xu, Fujun; Ding, Gege; Liu, Yuhang

    2018-06-01

    Characteristics of AlGaN-based deep-ultraviolet light-emitting diodes (DUV-LEDs) with step-like and Al-composition graded quantum wells have been investigated. The simulation results show that compared to DUV-LEDs with the conventional AlGaN multiple quantum wells (MQWs) structure, the light output power (LOP) and efficiency droop of DUV-LEDs with the Al-composition graded wells were remarkably improved. The key factor accounting for the improved performance is ascribed to the better modulation of carrier distribution in the quantum wells to increase the overlap between electron and hole wavefunctions, which contributes to more efficient recombination of electrons and holes, and thereby a significant enhancement in the LOP.

  15. Single-Genome Sequencing of Hepatitis C Virus in Donor-Recipient Pairs Distinguishes Modes and Models of Virus Transmission and Early Diversification.

    Science.gov (United States)

    Li, Hui; Stoddard, Mark B; Wang, Shuyi; Giorgi, Elena E; Blair, Lily M; Learn, Gerald H; Hahn, Beatrice H; Alter, Harvey J; Busch, Michael P; Fierer, Daniel S; Ribeiro, Ruy M; Perelson, Alan S; Bhattacharya, Tanmoy; Shaw, George M

    2016-01-01

    Despite the recent development of highly effective anti-hepatitis C virus (HCV) drugs, the global burden of this pathogen remains immense. Control or eradication of HCV will likely require the broad application of antiviral drugs and development of an effective vaccine. A precise molecular identification of transmitted/founder (T/F) HCV genomes that lead to productive clinical infection could play a critical role in vaccine research, as it has for HIV-1. However, the replication schema of these two RNA viruses differ substantially, as do viral responses to innate and adaptive host defenses. These differences raise questions as to the certainty of T/F HCV genome inferences, particularly in cases where multiple closely related sequence lineages have been observed. To clarify these issues and distinguish between competing models of early HCV diversification, we examined seven cases of acute HCV infection in humans and chimpanzees, including three examples of virus transmission between linked donors and recipients. Using single-genome sequencing (SGS) of plasma vRNA, we found that inferred T/F sequences in recipients were identical to viral sequences in their respective donors. Early in infection, HCV genomes generally evolved according to a simple model of random evolution where the coalescent corresponded to the T/F sequence. Closely related sequence lineages could be explained by high multiplicity infection from a donor whose viral sequences had undergone a pretransmission bottleneck due to treatment, immune selection, or recent infection. These findings validate SGS, together with mathematical modeling and phylogenetic analysis, as a novel strategy to infer T/F HCV genome sequences. Despite the recent development of highly effective, interferon-sparing anti-hepatitis C virus (HCV) drugs, the global burden of this pathogen remains immense. Control or eradication of HCV will likely require the broad application of antiviral drugs and the development of an effective

  16. Comparison of ELISA and dual stage real time RT-PCR to differentiate Sabin like and non-Sabin like poliovirus isolates.

    Science.gov (United States)

    Kaundal, Nirmal; Sarkate, Purva; Prakash, Charu; Rishi, Narayan

    2017-06-01

    Environmental surveillance of polioviruses has been used as an important tool in monitoring circulation of wild polioviruses and/or Vaccine derived polioviruses in sewage samples. It is important to distinguish Sabin like isolates from non-Sabin like; ELISA & dual stage real time RT-PCR have been used for the same. Current study was carried out on sewage isolates to compare ELISA & RT-PCR with sequencing to distinguish Sabin like from non-Sabin like. Out of 468 sewage specimens, 91 (19.44%) were non-polio enteroviruses positive and 377 (80.56%) were polio positive by virus isolation method. A total of 488 polio virus isolates were detected by L20B and RD route which were further subjected to ELISA and RT-PCR. The results were compared with sequencing. On comparison, the specificity of ELISA was only 66.67% in spite of very low sensitivity (3.43%). The sensitivity of RT-PCR was 97.71% which makes it a good primary screening test for detection of non-Sabin like viruses. However, the specificity was only 33.33%. RT-PCR appears to be a sensitive tool for detecting non-Sabin like viruses however; the isolates which are non-Sabin like by RT-PCR may not necessarily be mutated viruses. ELISA cannot be used for differentiation of Sabin likes from non-Sabin likes due to low sensitivity.

  17. Complete Genome Sequences of 44 Arthrobacter Phages.

    Science.gov (United States)

    Klyczek, Karen K; Jacobs-Sera, Deborah; Adair, Tamarah L; Adams, Sandra D; Ball, Sarah L; Benjamin, Robert C; Bonilla, J Alfred; Breitenberger, Caroline A; Daniels, Charles J; Gaffney, Bobby L; Harrison, Melinda; Hughes, Lee E; King, Rodney A; Krukonis, Gregory P; Lopez, A Javier; Monsen-Collar, Kirsten; Pizzorno, Marie C; Rinehart, Claire A; Staples, Amanda K; Stowe, Emily L; Garlena, Rebecca A; Russell, Daniel A; Cresawn, Steven G; Pope, Welkin H; Hatfull, Graham F

    2018-02-01

    We report here the complete genome sequences of 44 phages infecting Arthrobacter sp. strain ATCC 21022. These phages have double-stranded DNA genomes with sizes ranging from 15,680 to 70,707 bp and G+C contents from 45.1% to 68.5%. All three tail types (belonging to the families Siphoviridae , Myoviridae , and Podoviridae ) are represented. Copyright © 2018 Klyczek et al.

  18. Genome Sequences of 19 Novel Erwinia amylovora Bacteriophages.

    Science.gov (United States)

    Esplin, Ian N D; Berg, Jordan A; Sharma, Ruchira; Allen, Robert C; Arens, Daniel K; Ashcroft, Cody R; Bairett, Shannon R; Beatty, Nolan J; Bickmore, Madeline; Bloomfield, Travis J; Brady, T Scott; Bybee, Rachel N; Carter, John L; Choi, Minsey C; Duncan, Steven; Fajardo, Christopher P; Foy, Brayden B; Fuhriman, David A; Gibby, Paul D; Grossarth, Savannah E; Harbaugh, Kala; Harris, Natalie; Hilton, Jared A; Hurst, Emily; Hyde, Jonathan R; Ingersoll, Kayleigh; Jacobson, Caitlin M; James, Brady D; Jarvis, Todd M; Jaen-Anieves, Daniella; Jensen, Garrett L; Knabe, Bradley K; Kruger, Jared L; Merrill, Bryan D; Pape, Jenny A; Payne Anderson, Ashley M; Payne, David E; Peck, Malia D; Pollock, Samuel V; Putnam, Micah J; Ransom, Ethan K; Ririe, Devin B; Robinson, David M; Rogers, Spencer L; Russell, Kerri A; Schoenhals, Jonathan E; Shurtleff, Christopher A; Simister, Austin R; Smith, Hunter G; Stephenson, Michael B; Staley, Lyndsay A; Stettler, Jason M; Stratton, Mallorie L; Tateoka, Olivia B; Tatlow, P J; Taylor, Alexander S; Thompson, Suzanne E; Townsend, Michelle H; Thurgood, Trever L; Usher, Brittian K; Whitley, Kiara V; Ward, Andrew T; Ward, Megan E H; Webb, Charles J; Wienclaw, Trevor M; Williamson, Taryn L; Wells, Michael J; Wright, Cole K; Breakwell, Donald P; Hope, Sandra; Grose, Julianne H

    2017-11-16

    Erwinia amylovora is the causal agent of fire blight, a devastating disease affecting some plants of the Rosaceae family. We isolated bacteriophages from samples collected from infected apple and pear trees along the Wasatch Front in Utah. We announce 19 high-quality complete genome sequences of E. amylovora bacteriophages. Copyright © 2017 Esplin et al.

  19. Our Preferences: Why We Like What We Like

    Science.gov (United States)

    Grammer, Karl; Oberzaucher, Elisabeth

    Humans tend to judge and sort their social and non-social environment permanently into a few basic categories: 'likes' and 'don't likes'. Indeed we have developed general preferences for our social and non-social environment. These preferences can be subsumed under the term 'evolutionary aesthetics' (Voland & Grammer 2003). Indeed humans and animals have evolved preferences for mates, food, habitats, odors, and objects. Those stimuli that promoted reproductive success are bound to evoke positive emotional responses, and humans develop an obsession-like attitude towards aesthetics and beauty. Although we are 'all legally equal', people are often treated differently according to their physical appearance. This differential treatment by others starts early in life. Three-month-old children gaze longer at attractive faces than at unattractive faces. From these results, Langlois et al. (1990) conclude that beauty standards are not learned, but that there is an innate beauty detector. Attractive children receive less punishment than unattractive children for the same types of misbehavior. Differential treatment goes on at school, college, and even university (Baugh & Parry 1991). In this part of our lives attractiveness is coupled to academic achievements - attractive students receive better grades. Even when we apply for jobs, appearance may dominate qualification (Collins & Zebrowitz 1995). This differential treatment reaches its peak perhaps in jurisdiction, where attractiveness can lead to better treatment and lighter sentences. However, this is only the case if attractiveness did not play a role in the crime (Hateld & Sprecher 1986). We even believe that attractive people are better - 'what is beautiful is good' is a common standard in our thinking, according to Dion et al. (1972). The question then arises: Where does this obsessive preoccupation with beauty and attractiveness come from?We will outline here the thesis that human mate selection criteria, which have

  20. A sequence of events across the Cretaceous-Tertiary boundary

    NARCIS (Netherlands)

    Smit, J.; Romein, A.J.T.

    1985-01-01

    The lithological and biological sequence of events across the Cretaceous-Tertiary (K/T), as developed in thick and complete landbased sections and termed the standard K/T event sequence, is also found in many DSDP cores from all over the globe. Microtektite-like spherules have been found in

  1. Complete genome sequence of the gliding, heparinolytic Pedobacter saltans type strain (113T)

    Science.gov (United States)

    Liolios, Konstantinos; Sikorski, Johannes; Lu, Meagan; Nolan, Matt; Lapidus, Alla; Lucas, Susan; Hammon, Nancy; Deshpande, Shweta; Cheng, Jan-Fang; Tapia, Roxanne; Han, Cliff; Goodwin, Lynne; Pitluck, Sam; Huntemann, Marcel; Ivanova, Natalia; Pagani, Ioanna; Mavromatis, Konstantinos; Ovchinikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Brambilla, Evelyne-Marie; Kotsyurbenko, Oleg; Rohde, Manfred; Tindall, Brian J.; Abt, Birte; Göker, Markus; Detter, John C.; Woyke, Tanja; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C.

    2011-01-01

    Pedobacter saltans Steyn et al. 1998 is one of currently 32 species in the genus Pedobacter within the family Sphingobacteriaceae. The species is of interest for its isolated location in the tree of life. Like other members of the genus P. saltans is heparinolytic. Cells of P. saltans show a peculiar gliding, dancing motility and can be distinguished from other Pedobacter strains by their ability to utilize glycerol and the inability to assimilate D-cellobiose. The genome presented here is only the second completed genome sequence of a type strain from a member of the family Sphingobacteriaceae to be published. The 4,635,236 bp long genome with its 3,854 protein-coding and 67 RNA genes consists of one chromosome, and is a part of the Genomic Encyclopedia of Bacteria and Archaea project. PMID:22180808

  2. Sr-Al-Si co-segregated regions in eutectic Si phase of Sr-modified Al-10Si alloy.

    Science.gov (United States)

    Timpel, M; Wanderka, N; Schlesiger, R; Yamamoto, T; Isheim, D; Schmitz, G; Matsumura, S; Banhart, J

    2013-09-01

    The addition of 200 ppm strontium to an Al-10 wt% Si casting alloy changes the morphology of the eutectic silicon phase from coarse plate-like to fine fibrous networks. In order to clarify this modification mechanism the location of Sr within the eutectic Si phase has been investigated by a combination of high-resolution methods. Whereas three-dimensional atom probe tomography allows us to visualise the distribution of Sr on the atomic scale and to analyse its local enrichment, transmission electron microscopy yields information about the crystallographic nature of segregated regions. Segregations with two kinds of morphologies were found at the intersections of Si twin lamellae: Sr-Al-Si co-segregations of rod-like morphology and Al-rich regions of spherical morphology. Both are responsible for the formation of a high density of multiple twins and promote the anisotropic growth of the eutectic Si phase in specific crystallographic directions during solidification. The experimental findings are related to the previously postulated mechanism of "impurity induced twinning". Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Dynamic evolution of toll-like receptor multigene families in echinoderms

    Directory of Open Access Journals (Sweden)

    Katherine M Buckley

    2012-06-01

    Full Text Available The genome of the purple sea urchin, Strongylocentrotus purpuratus, was the first to be sequenced from a long-lived large invertebrate. Analysis of this genome uncovered a surprisingly complex immune system in which the moderately sized sets of pattern recognition receptors that form the core of vertebrate innate immunity are encoded in large multigene families. The sea urchin genome contains 253 Toll-like receptor (TLR genes, more than 200 Nod-like receptors and 1095 scavenger receptor cysteine-rich domains, a ten-fold expansion relative to vertebrates. Given their stereotypic structure and simple intron-exon architecture, the TLRs are the most tractable of these families for more detailed analysis. An immune defense role for these receptors is suggested by their sequence diversity and expression in immunologically active tissues, including phagocytes. This complexity of the sea urchin TLR multigene families largely derives from expansions that are independent of those in vertebrates and protostomes, although a small family of TLRs with structure similar to that of Drosophila Toll likely originated in an ancient eumetazoan ancestor. Several other invertebrate deuterostome genomes have been sequenced, including the cephalochordate, Branchiostoma floridae and the sea urchin Lytechinus variegatus, as well as partial sequences from two other sea urchin species. Here, we present an analysis of the invertebrate deuterostome TLRs with emphasis on the echinoderms. Representatives of most of the S. purpuratus TLR subfamilies and homologs of the protostome-like sequences are found in L. variegatus. The phylogeny of these genes within sea urchins highlights lineage-specific expansions at higher resolution than is evident at the phylum level. These analyses identify quickly evolving TLR subfamilies that are likely to have novel functions and other, more stable, subfamilies that may function similarly to those of vertebrates.

  4. Sedimentology, sequence-stratigraphy, and geochemical variations in the Mesoproterozoic Nonesuch Formation, northern Wisconsin, USA

    Science.gov (United States)

    Kingsbury Stewart, Esther; Mauk, Jeffrey L.

    2017-01-01

    We use core descriptions and portable X-ray fluorescence analyses to identify lithofacies and stratigraphic surfaces for the Mesoproterozoic Nonesuch Formation within the Ashland syncline, Wisconsin. We group lithofacies into facies associations and construct a sequence stratigraphic framework based on lithofacies stacking and stratigraphic surfaces. The fluvial-alluvial facies association (upper Copper Harbor Conglomerate) is overlain across a transgressive surface by the fluctuating-profundal facies association (lower Nonesuch Formation). The fluctuating-profundal facies association comprises a retrogradational sequence set overlain across a maximum flooding surface by an aggradational-progradational sequence set comprising fluctuating-profundal, fluvial-lacustrine, and fluvial-alluvial facies associations (middle Nonesuch through lower Freda Formations). Lithogeochemistry supports sedimentologic and stratigraphic interpretations. Fe/S molar ratios reflect the oxidation state of the lithofacies; values are most depleted above the maximum flooding surface where lithofacies are chemically reduced and are greatest in the chemically oxidized lithofacies. Si/Al and Zr/Al molar ratios reflect the relative abundance of detrital heavy minerals vs. clay minerals; greater values correlate with larger grain size. Vertical facies association stacking records depositional environments that evolved from fluvial and alluvial, to balanced-fill lake, to overfilled lake, and returning to fluvial and alluvial. Elsewhere in the basin, where accommodation was greatest, some volume of fluvial-lacustrine facies is likely present below the transgressive stratigraphic surface. This succession of continental and lake-basin types indicates a predominant tectonic driver of basin evolution. Lithofacies distribution and geochemistry indicate deposition within an asymmetric half-graben bounded on the east by a west-dipping growth fault. While facies assemblages are lacustrine and continental

  5. Whole-Genome Sequencing of Lactobacillus salivarius Strains BCRC 14759 and BCRC 12574.

    Science.gov (United States)

    Chiu, Shih-Hau; Chen, Chien-Chi; Wang, Li-Ting; Huang, Lina

    2017-11-22

    Lactobacillus salivarius BCRC 14759 has been identified as a high-exopolysaccharide-producing strain with potential as a probiotic or fermented dairy product. Here, we report the genome sequences of L. salivarius BCRC 14759 and the comparable strain BCRC 12574, isolated from human saliva. The PacBio RSII sequencing platform was used to obtain high-quality assemblies for characterization of this probiotic candidate. Copyright © 2017 Chiu et al.

  6. The evolution of function in strictosidine synthase-like proteins.

    Science.gov (United States)

    Hicks, Michael A; Barber, Alan E; Giddings, Lesley-Ann; Caldwell, Jenna; O'Connor, Sarah E; Babbitt, Patricia C

    2011-11-01

    The exponential growth of sequence data provides abundant information for the discovery of new enzyme reactions. Correctly annotating the functions of highly diverse proteins can be difficult, however, hindering use of this information. Global analysis of large superfamilies of related proteins is a powerful strategy for understanding the evolution of reactions by identifying catalytic commonalities and differences in reaction and substrate specificity, even when only a few members have been biochemically or structurally characterized. A comparison of >2500 sequences sharing the six-bladed β-propeller fold establishes sequence, structural, and functional links among the three subgroups of the functionally diverse N6P superfamily: the arylesterase-like and senescence marker protein-30/gluconolactonase/luciferin-regenerating enzyme-like (SGL) subgroups, representing enzymes that catalyze lactonase and related hydrolytic reactions, and the so-called strictosidine synthase-like (SSL) subgroup. Metal-coordinating residues were identified as broadly conserved in the active sites of all three subgroups except for a few proteins from the SSL subgroup, which have been experimentally determined to catalyze the quite different strictosidine synthase (SS) reaction, a metal-independent condensation reaction. Despite these differences, comparison of conserved catalytic features of the arylesterase-like and SGL enzymes with the SSs identified similar structural and mechanistic attributes between the hydrolytic reactions catalyzed by the former and the condensation reaction catalyzed by SS. The results also suggest that despite their annotations, the great majority of these >500 SSL sequences do not catalyze the SS reaction; rather, they likely catalyze hydrolytic reactions typical of the other two subgroups instead. This prediction was confirmed experimentally for one of these proteins. Copyright © 2011 Wiley-Liss, Inc.

  7. The microstructure and mechanical properties of Al-containing 9Cr ODS ferritic alloy

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Guangming [School of Materials Science and Engineering, University of Science and Technology, Beijing, Beijing 100083 (China); Department of Nuclear, Plasma and Radiological Engineering, University of Illinois at Urbana-Champaign, IL 61801 (United States); Zhou, Zhangjian, E-mail: zhouzhj@mater.ustb.edu.cn [School of Materials Science and Engineering, University of Science and Technology, Beijing, Beijing 100083 (China); Mo, Kun [Nuclear Engineering Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Wang, Pinghuai [Fusion Reactor & Materials Division, Southwestern Institute of Physics, Chengdu, Sichuan 610041 (China); Miao, Yinbin [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois at Urbana-Champaign, IL 61801 (United States); Li, Shaofu; Wang, Man [School of Materials Science and Engineering, University of Science and Technology, Beijing, Beijing 100083 (China); Liu, Xiang [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois at Urbana-Champaign, IL 61801 (United States); Gong, Mengqiang [School of Materials Science and Engineering, University of Science and Technology, Beijing, Beijing 100083 (China); Almer, Jonathan [X-ray Science Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Stubbins, James F. [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois at Urbana-Champaign, IL 61801 (United States)

    2015-11-05

    In this study, a 9Cr oxide-dispersion strengthened (ODS) alloy with additional corrosion resistant element Al was fabricated by mechanical alloying (MA) and hot pressing (HP) to explore the impact of Al on the microstructure and mechanical property of a 9Cr ODS alloy. It is found that the Al completely dissolved into the Fe–Cr matrix after milling for 30 h. The minor phases in the Al-containing 9Cr ODS ferritic alloy were investigated by a high-energy X-ray, and were identified to be orthorhombic-YAlO{sub 3} (YAP), bcc-Y{sub 3}Al{sub 5}O{sub 12} (YAG), monoclinic-Al{sub 2}Y{sub 4}O{sub 9} (YAM), and hexagonal-YAlO{sub 3} (YAH). These phases were further confirmed by selected area diffraction pattern (SADP), energy dispersive spectroscopy (EDS), and high resolution transmission electron microscopy (HRTEM). In addition, their volume fractions were also calculated from the integrated intensities. According to the analysis of the particles and their formation sequences, the larger particles (greater than 100 nm) are identified as mainly YAG and Al{sub 2}O{sub 3} particles, while the particles with small size (less than 30 nm) are likely primarily YAM, YAH, and YAP particles. The yielding strength (YS) and ultimate tensile strength (UTS) at RT are 563 MPa and 744 MPa, respectively, while the YS and UTS at 700 °C are 245 MPa and 276 MPa, respectively. Although the addition Al in ODS alloys decreases the strength at RT, the values at high temperature are similar to those obtained for 9Cr ODS alloys strengthened by fine Y–Ti–O particles. - Graphical abstract: Synchrotron X-ray diffraction line profile of the 9CrAl ODS alloy; (Ferrite matrix phases, along with minor phases, orthorhombic YAlO{sub 3} (yttrium aluminum perovskite, YAP), bcc Y{sub 3}Al{sub 5}O{sub 12} (yttrium aluminum garnet, YAG), monoclinic Al{sub 2}Y{sub 4}O{sub 9} (yttrium aluminum monoclinic, YAM), and hexagonal YAlO{sub 3} (yttium aluminum hexagonal, YAH) were recognized.). - Highlights: • The

  8. Serum Wisteria floribunda agglutinin-positive Mac-2-binding protein expression predicts disease severity in chronic hepatitis C patients

    Directory of Open Access Journals (Sweden)

    Ching-I Huang

    2017-08-01

    Full Text Available Wisteria floribunda agglutinin-positive Mac-2 binding protein (WFA+-M2BP has recently been developed as a promising liver fibrosis glyco biomarker. We assessed its efficacy in evaluating liver disease severity in chronic hepatitis C (CHC in Taiwan. The association between WFA+-M2BP and histological features was evaluated among those CHC patients underwent liver biopsy. We also aimed to clarify the factors determining the performance of WFA+-M2BP in CHC. A total of 229 CHC patients were consecutively recruited. The mean value of WFA+-M2BP in patients from F0 to F4 was 1.68, 2.23, 3.45, 3.48, 3.77 respectively (linear trend P = 0.008. Linear regression analysis revealed that alanine aminotransferase (odds ratio [OR]: 0.03, 95% confidence intervals [CI]: 0.02–0.05, P < 0.001, AST (OR: −0.1, 95% CI: −0.02 to −0.01, P < 0.001, and liver fibrosis (OR: 0.30, 95% CI: 0.01–0.59, P = 0.043 were the independent factors correlated to serum WFA+-M2BP level. The optimal cutoff values of WFA+-M2BP for fibrosis stages F1, F2, F3, and F4 were 1.42, 1.61, 1.42, and 2.67, respectively. Multivariate analysis revealed that the platelet count (OR/CI: −0.009/0.986–0.996, P = <0.001, r-glutamyl transferase (OR/CI: 0.007/1.000–1.013, P = 0.036, and WFA+-M2BP (OR/CI: 0.187/1.057–1.374, P = 0.005. We concluded that WFA+-M2BP is a competent noninvasive marker for liver fibrosis assessment in CHC patients.

  9. Situation models and memory: the effects of temporal and causal information on recall sequence.

    Science.gov (United States)

    Brownstein, Aaron L; Read, Stephen J

    2007-10-01

    Participants watched an episode of the television show Cheers on video and then reported free recall. Recall sequence followed the sequence of events in the story; if one concept was observed immediately after another, it was recalled immediately after it. We also made a causal network of the show's story and found that recall sequence followed causal links; effects were recalled immediately after their causes. Recall sequence was more likely to follow causal links than temporal sequence, and most likely to follow causal links that were temporally sequential. Results were similar at 10-minute and 1-week delayed recall. This is the most direct and detailed evidence reported on sequential effects in recall. The causal network also predicted probability of recall; concepts with more links and concepts on the main causal chain were most likely to be recalled. This extends the causal network model to more complex materials than previous research.

  10. Prediction of novel archaeal enzymes from sequence-derived features

    DEFF Research Database (Denmark)

    Jensen, Lars Juhl; Skovgaard, Marie; Brunak, Søren

    2002-01-01

    The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http://www.cbs.dtu.dk/......The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http......://www.cbs.dtu.dk/services/ArchaeaFun/). The method does not make use of sequence similarity; rather, it relies on predicted protein features like cotranslational and posttranslational modifications, secondary structure, and simple physical/chemical properties....

  11. Expression of blood group I and i active carbohydrate sequences on cultured human and animal cell lines assessed by radioimmunoassays with monoclonal cold agglutinins

    International Nuclear Information System (INIS)

    Childs, R.A.; Kapadia, A.; Feizi, T.

    1980-01-01

    Human monoclonal anti-I and anti-i, reactive with known carbohydrate sequences, have been used as reagents to quantitate (by radioimmunoassay) and visualize (by immunofluorescence) the expression of the various blood group I and i antigenic determinants in a variety of cultured cell lines commonly used in laboratory investigations. It has been shown that the antigens they recognize are widely distributed on the surface of human and animal cell lines, expressed in varying amounts in different cell lines and on individual cells within a given cell line. In two cell lines, a transformation-associated increase in the expression of I antigen was observed. Because of their precise specificity for defined carbohydrate chain domains, these autoantibodies have become valuable reagents in biological chemistry. (orig.) [de

  12. Complete Genome Sequence of a Rhodococcus Species Isolated from the Winter Skate Leucoraja ocellata.

    Science.gov (United States)

    Wiens, Julia; Ho, Ryan; Fernando, Dinesh; Kumar, Ayush; Loewen, Peter C; Brassinga, Ann Karen C; Anderson, W Gary

    2016-09-01

    We report here a genome sequence for Rhodococcus sp. isolate UM008 isolated from the renal/interrenal tissue of the winter skate Leucoraja ocellata Genome sequence analysis suggests that Rhodococcus bacteria may act in a novel mutualistic relationship with their elasmobranch host, serving as biocatalysts in the steroidogenic pathway of 1α-hydroxycorticosterone. Copyright © 2016 Wiens et al.

  13. Genome Sequence of Jumbo Phage vB_AbaM_ME3 of Acinetobacter baumanni.

    Science.gov (United States)

    Buttimer, Colin; O'Sullivan, Lisa; Elbreki, Mohamed; Neve, Horst; McAuliffe, Olivia; Ross, R Paul; Hill, Colin; O'Mahony, Jim; Coffey, Aidan

    2016-08-25

    Bacteriophage (phage) vB_AbaM_ME3 was previously isolated from wastewater effluent using the propagating host Acinetobacter baumannii DSM 30007. The full genome was sequenced, revealing it to be the largest Acinetobacter bacteriophage sequenced to date with a size of 234,900 bp and containing 326 open reading frames (ORFs). Copyright © 2016 Buttimer et al.

  14. Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri.

    Science.gov (United States)

    Nigg, Jared C; Nouri, Shahideh; Falk, Bryce W

    2016-07-28

    Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera. Copyright © 2016 Nigg et al.

  15. Characterization of human MMTV-like (HML) elements similar to a sequence that was highly expressed in a human breast cancer: further definition of the HML-6 group.

    Science.gov (United States)

    Yin, H; Medstrand, P; Kristofferson, A; Dietrich, U; Aman, P; Blomberg, J

    1999-03-30

    Previously, we found a retroviral sequence, HML-6.2BC1, to be expressed at high levels in a multifocal ductal breast cancer from a 41-year-old woman who also developed ovarian carcinoma. The sequence of a human genomic clone (HML-6.28) selected by high-stringency hybridization with HML-6.2BC1 is reported here. It was 99% identical to HML-6.2BC1 and gave the same restriction fragments as total DNA. HML-6.28 is a 4.7-kb provirus with a 5'LTR, truncated in RT. Data from two similar genomic clones and sequences found in GenBank are also reported. Overlaps between them gave a rather complete picture of the HML-6.2BC1-like human endogenous retroviral elements. Work with somatic cell hybrids and FISH localized HML-6.28 to chromosome 6, band p21, close to the MHC region. The causal role of HML-6.28 in breast cancer remains unclear. Nevertheless, the ca. 20 Myr old HML-6 sequences enabled the definition of common and unique features of type A, B, and D (ABD) retroviruses. In Gag, HML-6 has no intervening sequences between matrix and capsid proteins, unlike extant exogenous ABD viruses, possibly an ancestral feature. Alignment of the dUTPase showed it to be present in all ABD viruses, but gave a phylogenetic tree different from trees made from other ABD genes, indicating a distinct phylogeny of dUTPase. A conserved 24-mer sequence in the amino terminus of some ABD envelope genes suggested a conserved function. Copyright 1999 Academic Press.

  16. The RNA world, automatic sequences and oncogenetics

    Energy Technology Data Exchange (ETDEWEB)

    Tahir Shah, K

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. (1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. (2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or ``accept`` other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs.

  17. The RNA world, automatic sequences and oncogenetics

    International Nuclear Information System (INIS)

    Tahir Shah, K.

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. 1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. 2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or 'accept' other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs

  18. Vacuum Pressureless Sintering of Ti-6Al-4V Alloy with Full Densification and Forged-Like Mechanical Properties

    Science.gov (United States)

    Zhang, Ce; Lu, Boxin; Wang, Haiying; Guo, Zhimeng; Paley, Vladislav; Volinsky, Alex A.

    2018-01-01

    Ti-6Al-4V ingots with a nearly 100% density, fine and homogeneous basket-weave microstructure, and better comprehensive mechanical properties (UTS = 935 MPa, Y.S. = 865 MPa, El. = 15.8%), have been manufactured by vacuum pressureless sintering of blended elemental powders. Coarse TiH2 powder, Al powder (2, 20 μm), V powder, and Al-V master alloy powder were used as raw materials to produce different powder mixtures ( D 50 = 10 μm). Then, the compacts made by cold isostatic pressing were consolidated by different sintering curves. A detailed investigation of different as-sintered samples revealed that a higher density can be obtained by generating transient molten Al in the sintering process. Coarse Al powder and a rapid heating rate under the melting point of Al contribute to molten Al formation. The presence of temporary liquid phase changes the sintering mechanism, accelerating the sintering neck formation, improving sinterability of the powder mixtures. Density of 99.5% was achieved at 1150 °C, which is markedly lower than the sintering temperatures reported for conventional blended elemental powder metallurgy routes. In addition, low interstitial content, especially for oxygen (0.17 wt.%), is obtained by strict process control.

  19. Al-Shāṭibīs sufismekritik:

    DEFF Research Database (Denmark)

    Riexinger, Martin Thomas

    2016-01-01

    The faqīh (Islamic legal scholar) al-Shāṭibī (d. 1388) from Granada is primarily known for his innovative approach within the field of legal theory (uṣūl al-fiqh). However, he dedicated much attention to the criticism of sufism. But like other Islamic scholars who opposed Sufism he did...

  20. Structure, surface area and morphology of aluminas from thermal decomposition of Al(OH(CH3COO2 crystals

    Directory of Open Access Journals (Sweden)

    KIYOHARA PEDRO K.

    2000-01-01

    Full Text Available Crystalline aluminium hydroxiacetate was prepared by reaction between aluminium powder (ALCOA 123 and aqueous solution of acetic acid at 96ºC ±1ºC. The white powder of Al(OH(CH3COO2 is constituted by agglomerates of crystalline plates, having size about 10mum. The crystals were fired from 200ºC to 1550ºC, in oxidizing atmosphere and the products characterized by X-ray diffraction, scanning electron microscopy and surface area measurements by BET-nitrogen method. Transition aluminas are formed from heating at the following temperatures: gamma (300ºC; delta (750ºC; alpha (1050ºC. The aluminas maintain the original morphology of the Al(OHAc2 crystal agglomerates, up to 1050ºC, when sintering and coalescence of the alpha-alumina crystals start and proceed up to 1550ºC. High surface area aluminas are formed in the temperature range of 700ºC to 1100ºC; the maximum value of 198m²/g is obtained at 900ºC, with delta-alumina structure. The formation sequence of transition aluminas is similar to the sequence from well ordered boehmite, but with differences in the transition temperatures and in the development of high surface areas. It is suggested that the causes for these diversities between the two sequences from Al(OH Ac2 and boehmite are due to the different particle sizes, shapes and textures of the gamma-Al2O3 which acts as precursor for the sequence gamma- to alpha-Al2O3.

  1. Heterogeneous nucleation of solid Al from the melt by TiB2 and Al3Ti: An ab initio molecular dynamics study

    KAUST Repository

    Wang, Junsheng; Horsfield, Andrew; Lee, Peter D.; Schwingenschlö gl, Udo

    2010-01-01

    The nucleation of solid Al from the melt by TiB2 is well established and is believed to involve the formation of Al3Ti. Since the atomic-scale mechanisms involved are not fully understood, we look to computer simulation to provide insight. As there is an absence of suitable potentials for all of this complex system we have performed large-scale density-functional-theory molecular dynamics simulations of the nucleation of solid Al from the melt on TiB2 and Al3Ti substrates at undercoolings of around 2 K. Using periodic boundary conditions, we find limited ordering and no signs of incipient growth in the liquid Al close to the B-terminated surface of TiB2. By contrast, we see fcc-like ordering near the Ti-terminated surface, with growth being frustrated by the lattice mismatch between bulk Al and the TiB2 substrate. The Al interatomic distances at the Ti-terminated surface are similar to distances found in Al3Ti; we suggest that the layer encasing TiB2 observed experimentally may be strained Al on a Ti-terminated surface rather than Al3Ti. For the Al3Ti substrate, fcc-like structures are observed on both sides which extend rapidly into the melt. Periodic boundaries introduce unphysical stresses which we removed by introducing a vacuum region to separate the liquid from the solid at one of the interfaces. We see ordering in the Al on both the B-terminated (0001) surface of TiB2, and on Al3Ti(112), with the ordering able to be stronger on the Al3Ti substrate. However, we cannot draw strong conclusions as these simulations need more time to allow long-ranged fluctuations in the liquid Al to dampen out. The huge computational cost restricted the range and duration of simulations that was possible.

  2. Heterogeneous nucleation of solid Al from the melt by TiB2 and Al3Ti: An ab initio molecular dynamics study

    KAUST Repository

    Wang, Junsheng

    2010-11-16

    The nucleation of solid Al from the melt by TiB2 is well established and is believed to involve the formation of Al3Ti. Since the atomic-scale mechanisms involved are not fully understood, we look to computer simulation to provide insight. As there is an absence of suitable potentials for all of this complex system we have performed large-scale density-functional-theory molecular dynamics simulations of the nucleation of solid Al from the melt on TiB2 and Al3Ti substrates at undercoolings of around 2 K. Using periodic boundary conditions, we find limited ordering and no signs of incipient growth in the liquid Al close to the B-terminated surface of TiB2. By contrast, we see fcc-like ordering near the Ti-terminated surface, with growth being frustrated by the lattice mismatch between bulk Al and the TiB2 substrate. The Al interatomic distances at the Ti-terminated surface are similar to distances found in Al3Ti; we suggest that the layer encasing TiB2 observed experimentally may be strained Al on a Ti-terminated surface rather than Al3Ti. For the Al3Ti substrate, fcc-like structures are observed on both sides which extend rapidly into the melt. Periodic boundaries introduce unphysical stresses which we removed by introducing a vacuum region to separate the liquid from the solid at one of the interfaces. We see ordering in the Al on both the B-terminated (0001) surface of TiB2, and on Al3Ti(112), with the ordering able to be stronger on the Al3Ti substrate. However, we cannot draw strong conclusions as these simulations need more time to allow long-ranged fluctuations in the liquid Al to dampen out. The huge computational cost restricted the range and duration of simulations that was possible.

  3. Modeling of Eutectic Formation in Al-Si Alloy Using A Phase-Field Method

    Directory of Open Access Journals (Sweden)

    Ebrahimi Z.

    2017-12-01

    Full Text Available We have utilized a phase-field model to investigate the evolution of eutectic silicon in Al-Si alloy. The interfacial fluctuations are included into a phase-field model of two-phase solidification, as stochastic noise terms and their dominant role in eutectic silicon formation is discussed. We have observed that silicon spherical particles nucleate on the foundation of primary aluminum phase and their nucleation continues on concentric rings, through the Al matrix. The nucleation of silicon particles is attributed to the inclusion of fluctuations into the phase-field equations. The simulation results have shown needle-like, fish-bone like and flakes of silicon phase by adjusting the noise coefficients to larger values. Moreover, the role of primary Al phase on nucleation of silicon particles in Al-Si alloy is elaborated. We have found that the addition of fluctuations plays the role of modifiers in our simulations and is essential for phase-field modeling of eutectic growth in Al-Si system. The simulated finger-like Al phases and spherical Si particles are very similar to those of experimental eutectic growth in modified Al-Si alloy.

  4. Detection of Emerging Vaccine-Related Polioviruses by Deep Sequencing.

    Science.gov (United States)

    Sahoo, Malaya K; Holubar, Marisa; Huang, ChunHong; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Waggoner, Jesse J; Troy, Stephanie B; Garcia-Garcia, Lourdes; Ferreyra-Reyes, Leticia; Maldonado, Yvonne; Pinsky, Benjamin A

    2017-07-01

    Oral poliovirus vaccine can mutate to regain neurovirulence. To date, evaluation of these mutations has been performed primarily on culture-enriched isolates by using conventional Sanger sequencing. We therefore developed a culture-independent, deep-sequencing method targeting the 5' untranslated region (UTR) and P1 genomic region to characterize vaccine-related poliovirus variants. Error analysis of the deep-sequencing method demonstrated reliable detection of poliovirus mutations at levels of vaccinated, asymptomatic children and their close contacts collected during a prospective cohort study in Veracruz, Mexico, revealed no vaccine-derived polioviruses. This was expected given that the longest duration between sequenced sample collection and the end of the most recent national immunization week was 66 days. However, we identified many low-level variants (Sabin serotypes, as well as vaccine-related viruses with multiple canonical mutations associated with phenotypic reversion present at high levels (>90%). These results suggest that monitoring emerging vaccine-related poliovirus variants by deep sequencing may aid in the poliovirus endgame and efforts to ensure global polio eradication. Copyright © 2017 Sahoo et al.

  5. Ancestral sequence reconstruction with Maximum Parsimony

    OpenAIRE

    Herbst, Lina; Fischer, Mareike

    2017-01-01

    One of the main aims in phylogenetics is the estimation of ancestral sequences based on present-day data like, for instance, DNA alignments. One way to estimate the data of the last common ancestor of a given set of species is to first reconstruct a phylogenetic tree with some tree inference method and then to use some method of ancestral state inference based on that tree. One of the best-known methods both for tree inference as well as for ancestral sequence inference is Maximum Parsimony (...

  6. The utility of Next Generation Sequencing for molecular diagnostics in Rett syndrome.

    Science.gov (United States)

    Vidal, Silvia; Brandi, Núria; Pacheco, Paola; Gerotina, Edgar; Blasco, Laura; Trotta, Jean-Rémi; Derdak, Sophia; Del Mar O'Callaghan, Maria; Garcia-Cazorla, Àngels; Pineda, Mercè; Armstrong, Judith

    2017-09-25

    Rett syndrome (RTT) is an early-onset neurodevelopmental disorder that almost exclusively affects girls and is totally disabling. Three genes have been identified that cause RTT: MECP2, CDKL5 and FOXG1. However, the etiology of some of RTT patients still remains unknown. Recently, next generation sequencing (NGS) has promoted genetic diagnoses because of the quickness and affordability of the method. To evaluate the usefulness of NGS in genetic diagnosis, we present the genetic study of RTT-like patients using different techniques based on this technology. We studied 1577 patients with RTT-like clinical diagnoses and reviewed patients who were previously studied and thought to have RTT genes by Sanger sequencing. Genetically, 477 of 1577 patients with a RTT-like suspicion have been diagnosed. Positive results were found in 30% by Sanger sequencing, 23% with a custom panel, 24% with a commercial panel and 32% with whole exome sequencing. A genetic study using NGS allows the study of a larger number of genes associated with RTT-like symptoms simultaneously, providing genetic study of a wider group of patients as well as significantly reducing the response time and cost of the study.

  7. Time-dependent H-like and He-like Al lines produced by ultra-short pulse laser

    Energy Technology Data Exchange (ETDEWEB)

    Kato, Takako; Kato, Masatoshi [National Inst. for Fusion Science, Nagoya (Japan); Shepherd, R; Young, B; More, R; Osterheld, Al

    1998-03-01

    We have performed numerical modeling of time-resolved x-ray spectra from thin foil targets heated by the LLNL Ultra-short pulse (USP) laser. The targets were aluminum foils of thickness ranging from 250 A to 1250 A, heated with 120 fsec pulses of 400 nm light from the USP laser. The laser energy was approximately 0.2 Joules, focused to a 3 micron spot size for a peak intensity near 2 x 10{sup 19} W/cm{sup 2}. Ly{alpha} and He{alpha} lines were recorded using a 900 fsec x-ray streak camera. We calculate the effective ionization, recombination and emission rate coefficients including density effects for H-like and He-like aluminum ions using a collisional radiative model. We calculate time-dependent ion abundances using these effective ionization and recombination rate coefficients. The time-dependent electron temperature and density used in the calculation are based on an analytical model for the hydrodynamic expansion of the target foils. During the laser pulse the target is ionized. After the laser heating stops, the plasma begins to recombine. Using the calculated time dependent ion abundances and the effective emission rate coefficients, we calculate the time dependent Ly{alpha} and He{alpha} lines. The calculations reproduce the main qualitative features of the experimental spectra. (author)

  8. Influence of deposition conditions on the microstructure of Al-based coatings for applications as corrosion and anti-permeation barrier

    Energy Technology Data Exchange (ETDEWEB)

    Wulf, Sven-Erik, E-mail: sven-erik.wulf@kit.edu; Holstein, Nils; Krauss, Wolfgang; Konys, Jürgen

    2013-10-15

    Highlights: • Electrochemical Al deposition is industrially relevant for barrier formation. • Al coatings have to be converted into protective layers by heat treatments. • Morphology of Al coatings made by ECX process depends on deposition parameters. • Heat treatment behavior depends on the morphology of the coating produced by ECX. • ECX is proven to produce layer sequences on Eurofer similar to HDA and ECA process. -- Abstract: Previous research revealed that the application of aluminum-based barriers is suitable to minimize corrosion rates of Eurofer steel in Pb–15.7Li and tritium-permeation from the liquid breeder into the cooling system (HCLL) in an envisaged future fusion reactor. Besides the former developed hot-dip-aluminization process (HDA), electrodeposition techniques based on water-free electrolytes, such as toluene-based electrolytes (ECA) and ionic liquids (ECX), showed promising results for the production of suitable aluminum layers. These processes allow electrodeposition of Al-layers on Eurofer steel with adjustable layer thicknesses, but a heat treatment procedure is needed afterwards to form the desired Fe–Al/Alumina scale. To investigate the deposition and treatment process in more detail, a new series of aluminum electroplating was performed by using the ECX process. The variation of deposition parameters (direct and pulsed current) showed clear impact on the morphology of deposited Al-layers. Heat treatments revealed that the formation of Fe–Al barriers is significantly influenced by the morphology of deposits, beyond other parameters like layer thickness. Presented metallographic and SEM/EDX analyses underline the occurred dependencies between deposition conditions and morphology and on the other hand Al-layer morphology and heat treatment behavior.

  9. Intercalation of paracetamol into the hydrotalcite-like host

    International Nuclear Information System (INIS)

    Kovanda, František; Maryšková, Zuzana; Kovář, Petr

    2011-01-01

    Hydrotalcite-like compounds are often used as host structures for intercalation of various anionic species. The product intercalated with the nonionic, water-soluble pharmaceuticals paracetamol, N-(4-hydroxyphenyl)acetamide, was prepared by rehydration of the Mg–Al mixed oxide obtained by calcination of hydrotalcite-like precursor at 500 °C. The successful intercalation of paracetamol molecules into the interlayer space was confirmed by powder X-ray diffraction and infrared spectroscopy measurements. Molecular simulations showed that the phenolic hydroxyl groups of paracetamol interact with hydroxide sheets of the host via the hydroxyl groups of the positively charged sites of Al-containing octahedra; the interlayer water molecules are located mostly near the hydroxide sheets. The arrangement of paracetamol molecules in the interlayer is rather disordered and interactions between neighboring molecules cause their tilting towards the hydroxide sheets. Dissolution tests in various media showed slower release of paracetamol intercalated in the hydrotalcite-like host in comparison with tablets containing the powdered pharmaceuticals. - Graphical abstract: Molecular simulations showed disordered arrangement of paracetamol molecules in the interlayer; most of the interlayer water molecules are located near the hydroxide sheets.▪ Highlights: ► Paracetamol was intercalated in Mg–Al hydrotalcite-like host by rehydration/reconstruction procedure. ► Paracetamol phenolic groups interact with positively charged sites in hydroxide sheets. ► Molecular simulations showed disordered arrangement of guest molecules in the interlayer. ► Slower release of paracetamol intercalated in the hydrotalcite-like host was observed.

  10. Formation of Nb3Al in powder processed Nb-Al superconductors

    International Nuclear Information System (INIS)

    Johnson, P.E.

    1987-05-01

    In high magnetic fields, the critical current density is strongly dependent on the upper critical field, which is determined primarily by the stoichiometry of the Nb 3 Al. The critical temperature (T/sub c/), like the upper critical field, is considered to be a measure of the ''intrinsic'' quality of the superconductor, indicating the stoichiometry, order, and strain. If the A15 phase is stoichiometric and well ordered, a high T/sub c/ (and high H/sub C 2 /) is expected, regardless of the volume fraction of superconductor. On the other hand, if sigma phase is present with the A15, the resultant composition gradient across the sigma-A15 interface(s) requires that some of the A15 be off-stoichiometric, and therefore that the T/sub c/ (and H/sub C 2 /) be low. Thus the extent of the A15 (Nb 3 Al) reaction and the quality of the A15 formed are interdependent. This work focuses on the factors that control the extent of Nb 3 Al formation in Nb/Al powder wires. The morphology and content of the reacted and unreacted wires are studied in optical, SEM, and TEM micrographs. Critical current density data and its dependence on processing are explained in terms of the unreacted microstructure and its effect on the extent of Nb 3 Al formation. As a method of improving the critical current density, a new variation of the conventional powder process for wire manufacturing is developed and tested

  11. Differing lectin-binding patterns of malignant melanoma and nevocellular and Spitz nevi.

    Science.gov (United States)

    Kohchiyama, A; Oka, D; Ueki, H

    1987-01-01

    The lectin-binding patterns of primary malignant melanoma, nevocellular nevus, and Spitz nevus were studied on formalin-fixed, paraffin-embedded sections using a series of biotinylated lectins--concanavalin A (ConA), Ricinus communis agglutinin-1 (RCA1), dolichos biflorus agglutinin (DBA), soybean agglutinin (SBA), maclura pomifera agglutinin (MPA), peanut agglutinin (PNA), wheat germ agglutinin (WGA), and Ulex europeus agglutinin-1(UEA1)--and employing the avidin-biotin-peroxidase complex method. In nevocellular and Spitz nevi, all of the nevus cells were positively stained with ConA and RCA1. No positive staining was observed, however, with the other lectins and no change in binding patterns occurred following neuraminidase pretreatment. In malignant melanoma, all of the melanoma cells were positively stained with ConA and RCA1, and some were also stained with MPA, PNA, and WGA. In addition, DBA, SBA, MPA, PNA, and WGA labeled all of the melanoma cells after neuraminidase pretreatment. No positive staining was observed with UEA1 despite neuraminidase pretreatment. The present results showed that malignant melanoma and nevocellular and Spitz nevi have different lectin-binding patterns and different responses to neuraminidase pretreatment. We, therefore, believe that the lectin staining on paraffin-embedded sections can be a useful probe for the differentiation of these diseases.

  12. Interfacial structure of V2AlC thin films deposited on (112-bar 0)-sapphire

    International Nuclear Information System (INIS)

    Sigumonrong, Darwin P.; Zhang, Jie; Zhou, Yanchun; Music, Denis; Emmerlich, Jens; Mayer, Joachim; Schneider, Jochen M.

    2011-01-01

    Local epitaxy between V 2 AlC and sapphire without intentionally or spontaneously formed seed layers was observed by transmission electron microscopy. Our ab initio calculations suggest that the most stable interfacial structure is characterized by the stacking sequence ...C-V-Al-V//O-Al..., exhibiting the largest work of separation for the configurations studied and hence strong interfacial bonding. It is proposed that a small misfit accompanied by strong interfacial bonding enable the local epitaxial growth of V 2 AlC on (112-bar 0)-sapphire.

  13. Large-scale Identification of Expressed Sequence Tags (ESTs from Nicotianatabacum by Normalized cDNA Library Sequencing

    Directory of Open Access Journals (Sweden)

    Alvarez S Perez

    2014-12-01

    Full Text Available An expressed sequence tags (EST resource for tobacco plants (Nicotianatabacum was established using high-throughput sequencing of randomly selected clones from one cDNA library representing a range of plant organs (leaf, stem, root and root base. Over 5000 ESTs were generated from the 3’ ends of 8000 clones, analyzed by BLAST searches and categorized functionally. All annotated ESTs were classified into 18 functional categories, unique transcripts involved in energy were the largest group accounting for 831 (32.32% of the annotated ESTs. After excluding 2450 non-significant tentative unique transcripts (TUTs, 100 unique sequences (1.67% of total TUTs were identified from the N. tabacum database. In the array result two genes strongly related to the tobacco mosaic virus (TMV were obtained, one basic form of pathogenesis-related protein 1 precursor (TBT012G08 and ubiquitin (TBT087G01. Both of them were found in the variety Hongda, some other important genes were classified into two groups, one of these implicated in plant development like those genes related to a photosynthetic process (chlorophyll a-b binding protein, photosystem I, ferredoxin I and III, ATP synthase and a further group including genes related to plant stress response (ubiquitin, ubiquitin-like protein SMT3, glycine-rich RNA binding protein, histones and methallothionein. The interesting finding in this study is that two of these genes have never been reported before in N. tabacum (ubiquitin-like protein SMT3 and methallothionein. The array results were confirmed using quantitative PCR.

  14. Evaluation of a fluorescent lectin-based staining technique for some acidophilic mining bacteria

    International Nuclear Information System (INIS)

    Fife, D.J.; Bruhn, D.F.; Miller, K.S.; Stoner, D.L.

    2000-01-01

    A fluorescence-labeled wheat germ agglutinin staining technique was modified and found to be effective for staining gram-positive, acidophilic mining bacteria. Bacteria identified by others as being gram positive through 16S rRNA sequence analyses, yet clustering near the divergence of that group, stained weakly. Gram-negative bacteria did not stain. Background staining of environmental samples was negligible, and pyrite and soil particles in the samples did not interfere with the staining procedure

  15. Some Double Sequence Spaces of Fuzzy Real Numbers of Paranormed Type

    Directory of Open Access Journals (Sweden)

    Bipul Sarma

    2013-01-01

    Full Text Available We study different properties of convergent, null, and bounded double sequence spaces of fuzzy real numbers like completeness, solidness, sequence algebra, symmetricity, convergence-free, and so forth. We prove some inclusion results too.

  16. Effects of Galanthus nivalis agglutinin (GNA) expressed in tomato leaves on larvae of the tomato moth Lacanobia oleracea (Lepidoptera: Noctuidae) and the effect of GNA on the development of the endoparasitoid Meteorus gyrator (Hymenoptera: Braconidae).

    Science.gov (United States)

    Wakefield, M E; Bell, H A; Fitches, E C; Edwards, J P; Gatehouse, A M R

    2006-02-01

    The effect of ingestion of transgenic tomato leaves expressing the plant lectin Galanthus nivalis agglutinin (GNA) on development of larvae of Lacanobia oleracea (Linnaeus) was studied under laboratory conditions. When L. oleracea larvae were fed on tomato line 14.1H, expressing approximately 2.0% GNA, significant increases in the mean larval weight and in the amount of food consumed were found. This resulted in an overall reduction in the mean development time to the pupal stage of approximately 7 days. A significant increase in the percentage survival to the adult moth was also recorded when newly hatched larvae were reared on transgenic tomato leaves (72%) compared to larvae reared on untransformed leaves (40%). The effects of ingestion of GNA by L. oleracea larvae, via artificial diet or the leaves of transgenic tomato or potato plants, on the subsequent development of its solitary endoparasitoid Meteorus gyrator (Thunberg) was also studied. No significant effects on the life cycle parameters of M. gyrator developing in L. oleracea fed on GNA-containing diets were observed. Experiments with transgenic potato plants indicated that the stadium of the host larvae at parasitism had a greater influence on M. gyrator development than the presence of GNA. Potential GNA-binding glycoproteins were detected in the gut and body tissues of larval M. gyrator. Despite detection in host tissues, GNA could not be detected in adult M. gyrator and therefore it is likely that at the time of pupation M. gyrator are able to void the GNA in the meconial pellet.

  17. Inhibition of severe acute respiratory syndrome coronavirus replication in a lethal SARS-CoV BALB/c mouse model by stinging nettle lectin, Urtica dioica agglutinin.

    Science.gov (United States)

    Kumaki, Yohichi; Wandersee, Miles K; Smith, Aaron J; Zhou, Yanchen; Simmons, Graham; Nelson, Nathan M; Bailey, Kevin W; Vest, Zachary G; Li, Joseph K-K; Chan, Paul Kay-Sheung; Smee, Donald F; Barnard, Dale L

    2011-04-01

    Urtica dioica agglutinin (UDA) is a small plant monomeric lectin, 8.7 kDa in size, with an N-acetylglucosamine specificity that inhibits viruses from Nidovirales in vitro. In the current study, we first examined the efficacy of UDA on the replication of different SARS-CoV strains in Vero 76 cells. UDA inhibited virus replication in a dose-dependent manner and reduced virus yields of the Urbani strain by 90% at 1.1 ± 0.4 μg/ml in Vero 76 cells. Then, UDA was tested for efficacy in a lethal SARS-CoV-infected BALB/c mouse model. BALB/c mice were infected with two LD50 (575 PFU) of virus for 4 h before the mice were treated intraperitoneally with UDA at 20, 10, 5 or 0 mg/kg/day for 4 days. Treatment with UDA at 5 mg/kg significantly protected the mice against a lethal infection with mouse-adapted SARS-CoV (p < 0.001), but did not significantly reduce virus lung titers. All virus-infected mice receiving UDA treatments were also significantly protected against weight loss (p < 0.001). UDA also effectively reduced lung pathology scores. At day 6 after virus exposure, all groups of mice receiving UDA had much lower lung weights than did the placebo-treated mice. Thus, our data suggest that UDA treatment of SARS infection in mice leads to a substantial therapeutic effect that protects mice against death and weight loss. Furthermore, the mode of action of UDA in vitro was further investigated using live SARS-CoV Urbani strain virus and retroviral particles pseudotyped with SARS-CoV spike (S). UDA specifically inhibited the replication of live SARS-CoV or SARS-CoV pseudotyped virus when added just before, but not after, adsorption. These data suggested that UDA likely inhibits SARS-CoV infection by targeting early stages of the replication cycle, namely, adsorption or penetration. In addition, we demonstrated that UDA neutralizes the virus infectivity, presumably by binding to the SARS-CoV spike (S) glycoprotein. Finally, the target molecule for the inhibition of virus

  18. Design of Protein Multi-specificity Using an Independent Sequence Search Reduces the Barrier to Low Energy Sequences.

    Directory of Open Access Journals (Sweden)

    Alexander M Sevy

    2015-07-01

    Full Text Available Computational protein design has found great success in engineering proteins for thermodynamic stability, binding specificity, or enzymatic activity in a 'single state' design (SSD paradigm. Multi-specificity design (MSD, on the other hand, involves considering the stability of multiple protein states simultaneously. We have developed a novel MSD algorithm, which we refer to as REstrained CONvergence in multi-specificity design (RECON. The algorithm allows each state to adopt its own sequence throughout the design process rather than enforcing a single sequence on all states. Convergence to a single sequence is encouraged through an incrementally increasing convergence restraint for corresponding positions. Compared to MSD algorithms that enforce (constrain an identical sequence on all states the energy landscape is simplified, which accelerates the search drastically. As a result, RECON can readily be used in simulations with a flexible protein backbone. We have benchmarked RECON on two design tasks. First, we designed antibodies derived from a common germline gene against their diverse targets to assess recovery of the germline, polyspecific sequence. Second, we design "promiscuous", polyspecific proteins against all binding partners and measure recovery of the native sequence. We show that RECON is able to efficiently recover native-like, biologically relevant sequences in this diverse set of protein complexes.

  19. Swallow Event Sequencing: Comparing Healthy Older and Younger Adults.

    Science.gov (United States)

    Herzberg, Erica G; Lazarus, Cathy L; Steele, Catriona M; Molfenter, Sonja M

    2018-04-23

    Previous research has established that a great deal of variation exists in the temporal sequence of swallowing events for healthy adults. Yet, the impact of aging on swallow event sequence is not well understood. Kendall et al. (Dysphagia 18(2):85-91, 2003) suggested there are 4 obligatory paired-event sequences in swallowing. We directly compared adherence to these sequences, as well as event latencies, and quantified the percentage of unique sequences in two samples of healthy adults: young ( 65). The 8 swallowing events that contribute to the sequences were reliably identified from videofluoroscopy in a sample of 23 healthy seniors (10 male, mean age 74.7) and 20 healthy young adults (10 male, mean age 31.5) with no evidence of penetration-aspiration or post-swallow residue. Chi-square analyses compared the proportions of obligatory pairs and unique sequences by age group. Compared to the older subjects, younger subjects had significantly lower adherence to two obligatory sequences: Upper Esophageal Sphincter (UES) opening occurs before (or simultaneous with) the bolus arriving at the UES and UES maximum distention occurs before maximum pharyngeal constriction. The associated latencies were significantly different between age groups as well. Further, significantly fewer unique swallow sequences were observed in the older group (61%) compared with the young (82%) (χ 2  = 31.8; p < 0.001). Our findings suggest that paired swallow event sequences may not be robust across the age continuum and that variation in swallow sequences appears to decrease with aging. These findings provide normative references for comparisons to older individuals with dysphagia.

  20. Effects of Mn addition on microstructure and hardness of Al-12.6Si alloy

    Science.gov (United States)

    Biswas, Prosanta; Patra, Surajit; Mondal, Manas Kumar

    2018-03-01

    In this work, eutectic Al-12.6Si alloy with and without manganese (Mn) have been developed through gravity casting route. The effect of Mn concentration (0.0 wt.%, 1 wt%, 2 wt% and 3 wt%) on microstructural morphology and hardness property of the alloy has been investigated. The eutectic Al-12.6 Si alloy exhibits the presence of combine plate, needle and rod-like eutectic silicon phase with very sharp corners and coarser primary silicon particles within the α-Al phase. In addition of 1wt.% of Mn in the eutectic Al-12.6Si alloy, sharp corners of the primary Si and needle-like eutectic Si are became blunt and particles size is reduced. Further, increase in Mn concentration (2.0 wt.%) in the Al-12.6Si alloy, irregular plate shape Al6(Mn,Fe) intermetallics are formed inside the α-Al phase, but the primary and eutectic phase morphology is similar to the eutectic Al-12.6Si alloy. The volume fraction of Al6(Mn,Fe) increases and Al6(Mn,Fe) particles appear as like chain structure in the alloy with 3 wt.% Mn. An increase in Mn concentration in the Al-12.6Si alloys result in the increase in bulk hardness of the alloy as an effects of microstructure modification as well as the presence of harder Al6(Mn,Fe) phase in the developed alloy.

  1. Draft Genome Sequences of Three Novel Low-Abundance Species Strains Isolated from Kefir Grain.

    Science.gov (United States)

    Kim, Yongkyu; Blasche, Sonja; Patil, Kiran R

    2017-09-28

    We report here the genome sequences of three novel bacterial species strains- Bacillus kefirresidentii Opo, Rothia kefirresidentii KRP, and Streptococcus kefirresidentii YK-isolated from kefir grains collected in Germany. The draft genomes of these isolates were remarkably dissimilar (average nucleotide identities, 77.80%, 89.01%, and 92.10%, respectively) to those of the previously sequenced strains. Copyright © 2017 Kim et al.

  2. Drug-like density: a method of quantifying the "bindability" of a protein target based on a very large set of pockets and drug-like ligands from the Protein Data Bank.

    Science.gov (United States)

    Sheridan, Robert P; Maiorov, Vladimir N; Holloway, M Katharine; Cornell, Wendy D; Gao, Ying-Duo

    2010-11-22

    One approach to estimating the "chemical tractability" of a candidate protein target where we know the atomic resolution structure is to examine the physical properties of potential binding sites. A number of other workers have addressed this issue. We characterize ~290,000 "pockets" from ~42,000 protein crystal structures in terms of a three parameter "pocket space": volume, buriedness, and hydrophobicity. A metric DLID (drug-like density) measures how likely a pocket is to bind a drug-like molecule. This is calculated from the count of other pockets in its local neighborhood in pocket space that contain drug-like cocrystallized ligands and the count of total pockets in the neighborhood. Surprisingly, despite being defined locally, a global trend in DLID can be predicted by a simple linear regression on log(volume), buriedness, and hydrophobicity. Two levels of simplification are necessary to relate the DLID of individual pockets to "targets": taking the best DLID per Protein Data Bank (PDB) entry (because any given crystal structure can have many pockets), and taking the median DLID over all PDB entries for the same target (because different crystal structures of the same protein can vary because of artifacts and real conformational changes). We can show that median DLIDs for targets that are detectably homologous in sequence are reasonably similar and that median DLIDs correlate with the "druggability" estimate of Cheng et al. (Nature Biotechnology 2007, 25, 71-75).

  3. Applying Convergent Immunity to Innovative Vaccines Targeting Staphylococcus aureus

    Science.gov (United States)

    Yeaman, Michael R.; Filler, Scott G.; Schmidt, Clint S.; Ibrahim, Ashraf S.; Edwards, John E.; Hennessey, John P.

    2014-01-01

    Recent perspectives forecast a new paradigm for future “third generation” vaccines based on commonalities found in diverse pathogens or convergent immune defenses to such pathogens. For Staphylococcus aureus, recurring infections and a limited success of vaccines containing S. aureus antigens imply that native antigens induce immune responses insufficient for optimal efficacy. These perspectives exemplify the need to apply novel vaccine strategies to high-priority pathogens. One such approach can be termed convergent immunity, where antigens from non-target organisms that contain epitope homologs found in the target organism are applied in vaccines. This approach aims to evoke atypical immune defenses via synergistic processes that (1) afford protective efficacy; (2) target an epitope from one organism that contributes to protective immunity against another; (3) cross-protect against multiple pathogens occupying a common anatomic or immunological niche; and/or (4) overcome immune subversion or avoidance strategies of target pathogens. Thus, convergent immunity has a potential to promote protective efficacy not usually elicited by native antigens from a target pathogen. Variations of this concept have been mainstays in the history of viral and bacterial vaccine development. A more far-reaching example is the pre-clinical evidence that specific fungal antigens can induce cross-kingdom protection against bacterial pathogens. This trans-kingdom protection has been demonstrated in pre-clinical studies of the recombinant Candida albicans agglutinin-like sequence 3 protein (rAls3) where it was shown that a vaccine containing rAls3 provides homologous protection against C. albicans, heterologous protection against several other Candida species, and convergent protection against several strains of S. aureus. Convergent immunity reflects an intriguing new approach to designing and developing vaccine antigens and is considered here in the context of vaccines to target S

  4. Applying Convergent Immunity to Innovative Vaccines Targeting Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Michael R Yeaman

    2014-09-01

    Full Text Available Recent perspectives forecast a new paradigm for future 3rd generation vaccines based on commonalities found in diverse pathogens or convergent immune defenses to such pathogens. For Staphylococcus aureus, recurring infections and a limited success of vaccines containing S. aureus antigens imply that native antigens induce immune responses insufficient for optimal efficacy. These perspectives exemplify the need to apply novel vaccine strategies to high priority pathogens. One such approach can be termed convergent immunity, where antigens from non-target organisms that contain epitope homologues found in the target organism are applied in vaccines. This approach aims to evoke atypical immune defenses via synergistic processes that 1 afford protective efficacy; 2 target an epitope from one organism that contributes to protective immunity against another; 3 cross-protect against multiple pathogens occupying a common anatomic or immunologic niche; and/or 4 overcome immune subversion or avoidance strategies of target pathogens. Thus, convergent immunity has a potential to promote protective efficacy not usually elicited by native antigens from a target pathogen. Variations of this concept have been mainstays in the history of viral and bacterial vaccine development. A more far-reaching example is the pre–clinical evidence that specific fungal antigens can induce cross-kingdom protection against bacterial pathogens. This trans-kingdom protection has been demonstrated in preclinical studies of the recombinant Candida albicans agglutinin-like sequence 3 protein (rAls3 where it was shown that a vaccine containing rAls3 provides homologous protection against C. albicans, heterologous protection against several other Candida species, and convergent protection against several strains of S. aureus. Convergent immunity reflects an intriguing new approach to designing and developing vaccine antigens and is considered here in the context of vaccines to target

  5. Al2O3 Passivation Effect in HfO2·Al2O3 Laminate Structures Grown on InP Substrates.

    Science.gov (United States)

    Kang, Hang-Kyu; Kang, Yu-Seon; Kim, Dae-Kyoung; Baik, Min; Song, Jin-Dong; An, Youngseo; Kim, Hyoungsub; Cho, Mann-Ho

    2017-05-24

    The passivation effect of an Al 2 O 3 layer on the electrical properties was investigated in HfO 2 -Al 2 O 3 laminate structures grown on indium phosphide (InP) substrate by atomic-layer deposition. The chemical state obtained using high-resolution X-ray photoelectron spectroscopy showed that interfacial reactions were dependent on the presence of the Al 2 O 3 passivation layer and its sequence in the HfO 2 -Al 2 O 3 laminate structures. Because of the interfacial reaction, the Al 2 O 3 /HfO 2 /Al 2 O 3 structure showed the best electrical characteristics. The top Al 2 O 3 layer suppressed the interdiffusion of oxidizing species into the HfO 2 films, whereas the bottom Al 2 O 3 layer blocked the outdiffusion of In and P atoms. As a result, the formation of In-O bonds was more effectively suppressed in the Al 2 O 3 /HfO 2 /Al 2 O 3 /InP structure than that in the HfO 2 -on-InP system. Moreover, conductance data revealed that the Al 2 O 3 layer on InP reduces the midgap traps to 2.6 × 10 12 eV -1 cm -2 (compared to that of HfO 2 /InP, that is, 5.4 × 10 12 eV -1 cm -2 ). The suppression of gap states caused by the outdiffusion of In atoms significantly controls the degradation of capacitors caused by leakage current through the stacked oxide layers.

  6. Chunk concatenation evolves with practice and sleep-related enhancement consolidation in a complex arm movement sequence

    Directory of Open Access Journals (Sweden)

    Blischke Klaus

    2016-06-01

    Full Text Available This paper addresses the notion of chunk concatenation being associated with sleep-related enhancement consolidation of motor sequence memory, thereby essentially contributing to improvements in sequence execution speed. To this end, element movement times of a multi-joint arm movement sequence incorporated in a recent study by Malangré et al. (2014 were reanalyzed. As sequence elements differed with respect to movement distance, element movement times had to be purged from differences solely due to varying trajectory lengths. This was done by dividing each element movement time per subject and trial block by the respective “reference movement time” collected from subjects who had extensively practiced each sequence element in isolation. Any differences in these “relative element movement times” were supposed to reflect element-specific “production costs” imposed solely by the sequence context. Across all subjects non-idiosyncratic, lasting sequence segmentation was shown, and four possible concatenation points (i.e. transition points between successive chunks within the original arm movement sequence were identified. Based on theoretical suppositions derived from previous work with the discrete sequence production task and the dual processor model (Abrahamse et al., 2013, significantly larger improvements in transition speed occurring at these four concatenation points as compared to the five fastest transition positions within the sequence (associated with mere element execution were assumed to indicate increased chunk concatenation. As a result, chunk concatenation was shown to proceed during acquisition with physical practice, and, most importantly, to significantly progress some more during retention following a night of sleep, but not during a waking interval.

  7. Insulin-like growth factor system in amyotrophic lateral sclerosis

    NARCIS (Netherlands)

    Wilczak, N; de Keyser, J; Cianfarani, S; Clemmons, DR; Savage, MO

    2005-01-01

    Insulin-like growth factor-I (IGF-I) is a neurotrophic factor with insulin-like metabolic activities, and possesses potential clinical applications, particularly in neurodegenerative disorders. Amyotrophic lateral sclerosis (ALS) is a chronic progressive devastating disorder of the central nervous

  8. Atomic Structure of a Spinel-like Transition Al2O3 (100) Surface

    DEFF Research Database (Denmark)

    Jensen, Thomas Nørregaard; Meinander, Kristoffer; Helveg, Stig

    2014-01-01

    We study a crystalline epitaxial alumina thin film with the characteristics of a spinel-type transition Al2O3(100) surface by using atom-resolved noncontact atomic force microscopy and density functional theory. It is shown that the films are terminated by an Al-O layer rich in Al vacancies......, exhibiting a strong preference for surface hydroxyl group formation in two configurations. The transition alumina films are crystalline and perfectly stable in ambient atmospheres, a quality which is expected to open the door to new fundamental studies of the surfaces of transition aluminas....

  9. Referral bias in ALS epidemiological studies.

    Science.gov (United States)

    Logroscino, Giancarlo; Marin, Benoit; Piccininni, Marco; Arcuti, Simona; Chiò, Adriano; Hardiman, Orla; Rooney, James; Zoccolella, Stefano; Couratier, Philippe; Preux, Pierre-Marie; Beghi, Ettore

    2018-01-01

    Despite concerns about the representativeness of patients from ALS tertiary centers as compared to the ALS general population, the extent of referral bias in clinical studies remains largely unknown. Using data from EURALS consortium we aimed to assess nature, extent and impact of referral bias. Four European ALS population-based registries located in Ireland, Piedmont, Puglia, Italy, and Limousin, France, covering 50 million person-years, participated. Demographic and clinic characteristics of ALS patients diagnosed in tertiary referral centers were contrasted with the whole ALS populations enrolled in registries in the same geographical areas. Patients referred to ALS centers were younger (with difference ranging from 1.1 years to 2.4 years), less likely to present a bulbar onset, with a higher proportion of familial antecedents and a longer survival (ranging from 11% to 15%) when compared to the entire ALS population in the same geographic area. A trend for referral bias is present in cohorts drawn from ALS referral centers. The magnitude of the possible referral bias in a particular tertiary center can be estimated through a comparison with ALS patients drawn from registry in the same geographic area. Studies based on clinical cohorts should be cautiously interpreted. The presence of a registry in the same area may improve the complete ascertainment in the referral center.

  10. Comparative performance of the BGISEQ-500 versus Illumina HiSeq2500 sequencing platforms for palaeogenomic sequencing

    DEFF Research Database (Denmark)

    Mak, Sarah Siu Tze Mak; Gopalakrishnan, Shyam Sunder; Carøe, Christian

    2017-01-01

    on degraded DNA, then directly compared the sequencing performance and data quality of the BGISEQ-500 to the Illumina HiSeq2500 platform, on DNA extracted from eight historic and ancient dog and wolf samples. Results: The data generated was largely comparable between sequencing platforms...... difference was also observed in the mitochondrial DNA percentages recovered (p = 0.018), although we believe this is likely a stochastic effect relating to the extremely low levels of mitochondria that were sequenced from three of the samples with overall very low levels of endogenous DNA. Conclusions......: Although we acknowledge our analyses were limited to animal material, our observations suggest that the BGISEQ-500 holds the potential to represent valid and potentially valuable alternative platform for palaeogenomic data generation, that is worthy of future exploration by those interested...

  11. Suppression of phase separation in $(AlAs)_{2ML} (InAs)_{2ML}$ superlattices using $Al_{0.48}In_{0.52}$ As monolayer insertions

    CERN Document Server

    Lee, S R; Follstaedt, D M

    2001-01-01

    Al/sub 0.48/In/sub 0.52/As monolayers (ML) are inserted at the binary-compound interfaces of (AlAs)/sub 2/ /sub ML/(InAs)/sub 2/ /sub ML/ short-period superlattices (SPSs) during growth on (001) In P. The insertion of Al/sub 0.48/In/sub 0.52/As interlayers greater than 2 ML thick tends to suppress the phase separation that normally occurs during molecular beam epitaxy of the SPS. The degree of suppression is a sensitive function of both the monolayer-scale thickness, and the intraperiod growth sequence, of the interlayers in the SPS. Given this sensitivity to monolayer-scale variations in the surface-region composition, we propose that cyclical phase transition of the reconstructed surface initiates SPS decomposition. (21 refs).

  12. Chromatid interchanges at intrachromosomal telomeric DNA sequences

    International Nuclear Information System (INIS)

    Fernandez, J.L.; Vazquez-Gundin, F.; Bilbao, A.; Gosalvez, J.; Goyanes, V.

    1997-01-01

    Chinese hamster Don cells were exposed to X-rays, mitomycin C and teniposide (VM-26) to induce chromatid exchanges (quadriradials and triradials). After fluorescence in situ hybridization (FISH) of telomere sequences it was found that interstitial telomere-like DNA sequence arrays presented around five times more breakage-rearrangements than the genome overall. This high recombinogenic capacity was independent of the clastogen, suggesting that this susceptibility is not related to the initial mechanisms of DNA damage. (author)

  13. Gene Unprediction with Spurio: A tool to identify spurious protein sequences.

    Science.gov (United States)

    Höps, Wolfram; Jeffryes, Matt; Bateman, Alex

    2018-01-01

    We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation.  Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases.  We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes.  Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.

  14. Complete Genome Sequence of an Avian Metapneumovirus Subtype A Strain Isolated from Chicken (Gallus gallus) in Brazil.

    Science.gov (United States)

    Rizotto, Laís S; Scagion, Guilherme P; Cardoso, Tereza C; Simão, Raphael M; Caserta, Leonardo C; Benassi, Julia C; Keid, Lara B; Oliveira, Trícia M F de S; Soares, Rodrigo M; Arns, Clarice W; Van Borm, Steven; Ferreira, Helena L

    2017-07-20

    We report here the complete genome sequence of an avian metapneumovirus (aMPV) isolated from a tracheal tissue sample of a commercial layer flock. The complete genome sequence of aMPV-A/chicken/Brazil-SP/669/2003 was obtained using MiSeq (Illumina, Inc.) sequencing. Phylogenetic analysis of the complete genome classified the isolate as avian metapneumovirus subtype A. Copyright © 2017 Rizotto et al.

  15. Some double sequence spaces of interval numbers defined by Orlicz function

    Directory of Open Access Journals (Sweden)

    Ayhan Esi

    2014-10-01

    Full Text Available In this paper we introduce some interval valued double sequence spaces defined by Orlicz function and study different properties of these spaces like inclusion relations, solidity, etc. We establish some inclusion relations among them. Also we introduce the concept of double statistical convergence for interval number sequences and give an inclusion relation between interval valued double sequence spaces.

  16. Screening method of carbohydrate-binding proteins in biological sources by capillary affinity electrophoresis and its application to determination of Tulipa gesneriana agglutinin in tulip bulbs.

    Science.gov (United States)

    Nakajima, Kazuki; Kinoshita, Mitsuhiro; Oda, Yasuo; Masuko, Takashi; Kaku, Hanae; Shibuya, Naoto; Kakehi, Kazuaki

    2004-09-01

    We developed capillary affinity electrophoresis (CAE) to analyze the molecular interaction between carbohydrate chains and proteins in solution state. A mixture of oligosaccharides derived from a glycoprotein was labeled with 8-aminopyrene-1,3,6-trisulfonate (APTS), and used as glycan library without isolation. Interaction of a carbohydrate-binding protein with each oligosaccharide in the mixture could be simultaneously observed, and relative affinities of oligosaccharides toward the protein were accurately determined. In this study, we applied CAE to detect the presence of lectins in some plants (Japanese elderberry bark and tulip bulb). In the crude extract of the elderberry bark, binding activity toward sialo-carbohydrate chains could be easily detected. We also examined the presence of lectins in the crude extract of tulip bulbs and determined the detailed carbohydrate-binding specificity of Tulipa gesneriana agglutinin (TGA), one of the lectins from tulip bulbs. Kinetic studies demonstrated that TGA showed novel carbohydrate-binding specificity and preferentially recognized triantennary oligosaccharides with Gal residues at nonreducing termini and a Fuc residue linked through alpha(1-6) linkage at chitobiose portion of the reducing termini but not tetraantennary carbohydrates. The results described here indicate that CAE will be a valuable method for both screening of lectins in natural sources and determination of their detailed carbohydrate-binding specificities.

  17. Characterization of the Complete Nucleotide Sequences of IncA/C2 Plasmids Carrying In809-Like Integrons from Enterobacteriaceae Isolates of Wildlife Origin.

    Science.gov (United States)

    Papagiannitsis, Costas C; Kutilova, Iva; Medvecky, Matej; Hrabak, Jaroslav; Dolejska, Monika

    2017-09-01

    A total of 18 Enterobacteriaceae (17 from gulls and 1 from a clinical sample) collected from Australia, carrying IncA/C plasmids with the IMP-encoding In809-like integrons, were studied. Seven plasmids, being representatives of different origins, plasmid sizes, replicon combinations, and resistance genes, were completely sequenced. Plasmid pEc158, identified in a clinical Escherichia coli ST752 isolate, showed extensive similarity to type 2 IncA/C 2 plasmids. pEc158 carried none of the bla CMY-2 -like region or ARI-B and ARI-A regions, while it contained a hybrid transposon structure. The six remaining plasmids, which were of wildlife origin, were highly similar to each other and probably were fusion derivatives of type 1 and type 2 A/C 2 plasmids. The latter plasmids contained an ARI-B region and hybrid transposon structures. In all plasmids, hybrid transposon structures containing In809-like integrons were inserted 3,434 bp downstream of the rhs2 start codon. In all cases, the one outermost 38-bp inverted repeat (IR) of the transposon was associated with the Tn 1696 tnp module, while the other outermost 38-bp IR of the transposon was associated with either a Tn 6317 -like module or a Tn 21 mer module. However, the internal structure of the transposon and the resistance genes were different in each plasmid. These findings indicated that, for the specific periods of time and settings, different IncA/C 2 plasmid types carrying In809-like elements circulated among isolates of wildlife and clinical origins. Additionally, they provided the basis for speculations regarding the reshuffling of IncA/C 2 plasmids with In809-like integrons and confirmed the rapid evolution of IncA/C 2 plasmid lineages. Copyright © 2017 American Society for Microbiology.

  18. Comparative genomics defines the core genome of the growing N4-like phage genus and identifies N4-like Roseophage specific genes

    Directory of Open Access Journals (Sweden)

    Jacqueline Zoe-Munn Chan

    2014-10-01

    Full Text Available Two bacteriophages, RPP1 and RLP1, infecting members of the marine Roseobacter clade were isolated from seawater. Their linear genomes are 74.7 and 74.6 kb and encode 91 and 92 coding DNA sequences, respectively. Around 30% of these are homologous to genes found in Enterobacter phage N4. Comparative genomics of these two new Roseobacter phages and twenty-three other sequenced N4-like phages (three infecting members of the Roseobacter lineage and twenty infecting other Gammaproteobacteria revealed that N4-like phages share a core genome of 14 genes responsible for control of gene expression, replication and virion proteins. Phylogenetic analysis of these genes placed the five N4-like roseophages (RN4 into a distinct subclade. Analysis of the RN4 phage genomes revealed they share a further 19 genes of which nine are found exclusively in RN4 phages and four appear to have been acquired from their bacterial hosts. Proteomic analysis of the RPP1 and RLP1 virions identified a second structural module present in the RN4 phages similar to that found in the Pseudomonas N4-like phage LIT1. Searches of various metagenomic databases, included the GOS database, using CDS sequences from RPP1 suggests these phages are widely distributed in marine environments in particular in the open ocean environment.

  19. Draft Genome Sequence of Cupriavidus pauculus Strain KF709, a Biphenyl-Utilizing Bacterium Isolated from Biphenyl-Contaminated Soil.

    Science.gov (United States)

    Watanabe, Takahito; Yamazoe, Atsushi; Hosoyama, Akira; Fujihara, Hidehiko; Suenaga, Hikaru; Hirose, Jun; Futagami, Taiki; Goto, Masatoshi; Kimura, Nobutada; Furukawa, Kensuke

    2015-03-26

    We report the draft genome sequence of Cupriavidus pauculus strain KF709, which comprises 6,826,799 bp with 6,272 coding sequences. The strain KF709 utilizes biphenyl and degrades low-chlorinated biphenyls; however, it possesses fewer coding sequences involved in the degradation of aromatic compounds than other strains belonging to the Betaproteobacteria. Copyright © 2015 Watanabe et al.

  20. Sequence-specific 1H NMR assignments, secondary structure, and location of the calcium binding site in the first epidermal growth factor like domain of blood coagulation factor IX

    International Nuclear Information System (INIS)

    Huang, L.H.; Cheng, H.; Sweeney, W.V.; Pardi, A.; Tam, J.P.

    1991-01-01

    Factor IX is a blood clotting protein that contains three regions, including a γ-carboxyglutamic acid (Gla) domain, two tandemly connected epidermal growth factor like (EGF-like) domains, and a serine protease region. The protein exhibits a high-affinity calcium binding site in the first EGF0like domain, in addition to calcium binding in the Gla domain. The first EGF-like domain, factor IX (45-87), has been synthesized. Sequence-specific resonance assignment of the peptide has been made by using 2D NMR techniques, and its secondary structure has been determined. The protein is found to have two antiparallel β-sheets, and preliminary distance geometry calculations indicate that the protein has two domains, separated by Trp 28 , with the overall structure being similar to that of EGF. An NMR investigation of the calcium-bound first EGF-like domain indicates the presence and location of a calcium binding site involving residues on both strands of one of the β-sheets as well as the N-terminal region of the peptide. These results suggest that calcium binding in the first EGF-like domain could induce long-range (possibly interdomain) conformational changes in factor IX, rather than causing structural alterations in the EGF-like domain itself

  1. Sorptive stabilization of organic matter by amorphous Al hydroxide

    NARCIS (Netherlands)

    Schneider, M.P.W.; Scheel, T.; Mikutta, R.; van Hees, P.; Kaiser, K.; Kalbitz, K.

    2010-01-01

    Amorphous Al hydroxides (am-Al(OH)(3)) strongly sorb and by this means likely protect dissolved organic matter (OM) against microbial decay in soils. We carried out batch sorption experiments (pH 4.5; 40 mg organic C L-1) with OM extracted from organic horizons under a Norway spruce and a European

  2. Identification of a Flavivirus Sequence in a Marine Arthropod.

    Directory of Open Access Journals (Sweden)

    Michael J Conway

    Full Text Available Phylogenetic analysis has yet to uncover the early origins of flaviviruses. In this study, I mined a database of expressed sequence tags in order to discover novel flavivirus sequences. Flavivirus sequences were identified in a pool of mRNA extracted from the sea spider Endeis spinosa (Pycnogonida, Pantopoda. Reconstruction of the translated sequences and BLAST analysis matched the sequence to the flavivirus NS5 gene. Additional sequences corresponding to envelope and the NS5 MTase domain were also identified. Phylogenetic analysis of homologous NS5 sequences revealed that Endeis spinosa NS5 (ESNS5 is likely related to classical insect-specific flaviviruses. It is unclear if ESNS5 represents genetic material from an active viral infection or an integrated viral genome. These data raise the possibility that classical insect-specific flaviviruses and perhaps medically relevant flaviviruses, evolved from progenitors that infected marine arthropods.

  3. Combining Amplification Typing of L1 Active Subfamilies (ATLAS) with High-Throughput Sequencing.

    Science.gov (United States)

    Rahbari, Raheleh; Badge, Richard M

    2016-01-01

    With the advent of new generations of high-throughput sequencing technologies, the catalog of human genome variants created by retrotransposon activity is expanding rapidly. However, despite these advances in describing L1 diversity and the fact that L1 must retrotranspose in the germline or prior to germline partitioning to be evolutionarily successful, direct assessment of de novo L1 retrotransposition in the germline or early embryogenesis has not been achieved for endogenous L1 elements. A direct study of de novo L1 retrotransposition into susceptible loci within sperm DNA (Freeman et al., Hum Mutat 32(8):978-988, 2011) suggested that the rate of L1 retrotransposition in the germline is much lower than previously estimated (ATLAS L1 display technique (Badge et al., Am J Hum Genet 72(4):823-838, 2003) to investigate de novo L1 retrotransposition in human genomes. In this chapter, we describe how we combined a high-coverage ATLAS variant with high-throughput sequencing, achieving 11-25× sequence depth per single amplicon, to study L1 retrotransposition in whole genome amplified (WGA) DNAs.

  4. Differential evolution-simulated annealing for multiple sequence alignment

    Science.gov (United States)

    Addawe, R. C.; Addawe, J. M.; Sueño, M. R. K.; Magadia, J. C.

    2017-10-01

    Multiple sequence alignments (MSA) are used in the analysis of molecular evolution and sequence structure relationships. In this paper, a hybrid algorithm, Differential Evolution - Simulated Annealing (DESA) is applied in optimizing multiple sequence alignments (MSAs) based on structural information, non-gaps percentage and totally conserved columns. DESA is a robust algorithm characterized by self-organization, mutation, crossover, and SA-like selection scheme of the strategy parameters. Here, the MSA problem is treated as a multi-objective optimization problem of the hybrid evolutionary algorithm, DESA. Thus, we name the algorithm as DESA-MSA. Simulated sequences and alignments were generated to evaluate the accuracy and efficiency of DESA-MSA using different indel sizes, sequence lengths, deletion rates and insertion rates. The proposed hybrid algorithm obtained acceptable solutions particularly for the MSA problem evaluated based on the three objectives.

  5. A note on the almost sure central limit theorems for the maxima of strongly dependent nonstationary Gaussian vector sequences

    Directory of Open Access Journals (Sweden)

    Xiang Zeng

    2016-06-01

    Full Text Available Abstract We prove some almost sure central limit theorems for the maxima of strongly dependent nonstationary Gaussian vector sequences under some mild conditions. The results extend the ASCLT to nonstationary Gaussian vector sequences and give substantial improvements for the weight sequence obtained by Lin et al. (Comput. Math. Appl. 62(2:635-640, 2011.

  6. Highly conserved non-coding sequences are associated with vertebrate development.

    Directory of Open Access Journals (Sweden)

    Adam Woolfe

    2005-01-01

    Full Text Available In addition to protein coding sequence, the human genome contains a significant amount of regulatory DNA, the identification of which is proving somewhat recalcitrant to both in silico and functional methods. An approach that has been used with some success is comparative sequence analysis, whereby equivalent genomic regions from different organisms are compared in order to identify both similarities and differences. In general, similarities in sequence between highly divergent organisms imply functional constraint. We have used a whole-genome comparison between humans and the pufferfish, Fugu rubripes, to identify nearly 1,400 highly conserved non-coding sequences. Given the evolutionary divergence between these species, it is likely that these sequences are found in, and furthermore are essential to, all vertebrates. Most, and possibly all, of these sequences are located in and around genes that act as developmental regulators. Some of these sequences are over 90% identical across more than 500 bases, being more highly conserved than coding sequence between these two species. Despite this, we cannot find any similar sequences in invertebrate genomes. In order to begin to functionally test this set of sequences, we have used a rapid in vivo assay system using zebrafish embryos that allows tissue-specific enhancer activity to be identified. Functional data is presented for highly conserved non-coding sequences associated with four unrelated developmental regulators (SOX21, PAX6, HLXB9, and SHH, in order to demonstrate the suitability of this screen to a wide range of genes and expression patterns. Of 25 sequence elements tested around these four genes, 23 show significant enhancer activity in one or more tissues. We have identified a set of non-coding sequences that are highly conserved throughout vertebrates. They are found in clusters across the human genome, principally around genes that are implicated in the regulation of development

  7. Al-Anon newcomers: benefits of continuing attendance for six months.

    Science.gov (United States)

    Timko, Christine; Laudet, Alexandre; Moos, Rudolf H

    2016-07-01

    Al-Anon Family Groups, a 12-step mutual-help program for people concerned about another person's drinking, is the most widely used form of help by Concerned Others. This longitudinal study examined newcomers' outcomes of attending Al-Anon. Aims were to better understand early gains from Al-Anon to inform efforts in the professional community to facilitate concerned others' attendance of and engagement in Al-Anon. We compared two groups of Al-Anon newcomers who completed surveys at baseline and 6 months later: those who discontinued attendance by the 6-month follow-up (N = 133), and those who were still attending Al-Anon meetings (N = 97); baseline characteristics were controlled in these comparisons. Newcomers who sustained participation in Al-Anon over the first 6 months of attendance were more likely than those who discontinued participation during the same period to report gains in a variety of domains, such as learning how to handle problems due to the drinker, and increased well-being and functioning, including reduced verbal or physical abuse victimization. Newcomers to Al-Anon reported more personal gains than drinker-related gains. The most frequent drinker gain was a better relationship with the Concerned Other; attendees were more likely to report this, as well as daily, in-person contact with the drinker. Al-Anon participation may facilitate ongoing interaction between Concerned Others and drinkers, and help Concerned Others function and feel better. Thus, short-term participation may be beneficial. Health-care professionals should consider providing referrals to Al-Anon and monitoring early attendance.

  8. Chinese Script vs Plate-Like Precipitation of Beta-Al9Fe2Si2 Phase in an Al-6.5Si-1Fe Alloy

    Science.gov (United States)

    Ferdian, Deni; Josse, Claudie; Nguyen, Patrick; Gey, Nathalie; Ratel-Ramond, Nicolas; de Parseval, Philippe; Thebault, Yannick; Malard, Benoit; Lacaze, Jacques; Salvo, Luc

    2015-07-01

    The microstructure of a high-purity Al-6.5Si-1Fe (wt pct) alloy after solidification at various cooling rates was investigated. In most of the cases, the monoclinic beta-Al9Fe2Si2 phase was observed as long and thin lamellae. However, at a very slow cooling rate, Fe-bearing precipitates with Chinese script morphology appeared together with lamellae. Further analysis showed all these Chinese script precipitates correspond also to the monoclinic beta phase. This finding stresses that differentiating second phases according to their shape may be misleading.

  9. Chondrule-like object from the Indian Ocean cosmic spherules

    Digital Repository Service at National Institute of Oceanography (India)

    Reshma, K.; Rudraswami, N.G.; ShyamPrasad, M.

    of the chondrule-like object is 72μm. The chondrule-like object contains bars of ∼1–2μm (figure 2b) composed of Ca-poor pyrox- ene (En 89.9%, Fe 10.01 and Wo 0.05). The clasts surrounding chondrule have pyroxene nor- mative mineralogy; contain pyroxene (∼8–15μm... in micrometeorites, examples are: Kurat et al. (1996) found the fragment of radial pyroxene chondrule with a diameter of 120μm in Antarc- tic micrometeorites. Genge et al. (2004) discov- ered chondritic igneous objects and matrix which constitute 1...

  10. Control of interfacial intermetallic compounds in Fe–Al joining by Zn addition

    Energy Technology Data Exchange (ETDEWEB)

    Yang, J. [Key Laboratory of Robot and Welding Automation of Jiangxi Province, School of Mechanical and Electrical Engineering, Nanchang University, Nanchang, Jiangxi 330031 (China); Center for Advanced Materials Joining, University of Waterloo, Waterloo, Ontario, Canada N2L 3G1 (Canada); Li, Y.L., E-mail: liyulong1112ster@gmail.com [Key Laboratory of Robot and Welding Automation of Jiangxi Province, School of Mechanical and Electrical Engineering, Nanchang University, Nanchang, Jiangxi 330031 (China); Zhang, H. [Key Laboratory of Robot and Welding Automation of Jiangxi Province, School of Mechanical and Electrical Engineering, Nanchang University, Nanchang, Jiangxi 330031 (China); Guo, W. [Center for Advanced Materials Joining, University of Waterloo, Waterloo, Ontario, Canada N2L 3G1 (Canada); School of Mechanical Engineering and Automation, Beijing University of Aeronautics and Astronautics, Beijing 100191 (China); Zhou, Y. [Center for Advanced Materials Joining, University of Waterloo, Waterloo, Ontario, Canada N2L 3G1 (Canada)

    2015-10-01

    By Zn addition to the fusion zone, the interfacial intermetallic compounds (IMCs) of laser Al/steel joint changed from layered Fe{sub 2}Al{sub 5} and needle-like FeAl{sub 3} to layered Fe{sub 2}Al{sub 5−x}Zn{sub x} and dispersed FeZn{sub 10} with minor Al-rich amorphous phase. This resulted in an improvement in the joint strength and the change of failure mode.

  11. Complete genome sequence of Olsenella uli type strain (VPI D76D-27CT)

    Energy Technology Data Exchange (ETDEWEB)

    Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Held, Brittany [Los Alamos National Laboratory (LANL); Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Yasawong, Montri [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Pukall, Rudiger [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany

    2010-01-01

    Olsenella uli (Olsen et al. 1991) Dewhirst et al. 2001 is the type species of the genus Olsenella, which belongs to the actinobacterial family Coriobacteriaceae. The species is of interest because it is frequently isolated from dental plaque in periodontitis patients and can cause primary endodontic infection. The species is a Gram-positive, non-motile and non-sporulating bacterium. The strain described in this study has been isolated from human gingival crevices in 1982. This is the first completed sequence of the genus Olsenella and the fifth sequence from the family Coriobacteriaceae. The 2,051,896 bp long genome with its 1,795 protein-coding and 55 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  12. Repeat Sequence Proteins as Matrices for Nanocomposites

    Energy Technology Data Exchange (ETDEWEB)

    Drummy, L.; Koerner, H; Phillips, D; McAuliffe, J; Kumar, M; Farmer, B; Vaia, R; Naik, R

    2009-01-01

    Recombinant protein-inorganic nanocomposites comprised of exfoliated Na+ montmorillonite (MMT) in a recombinant protein matrix based on silk-like and elastin-like amino acid motifs (silk elastin-like protein (SELP)) were formed via a solution blending process. Charged residues along the protein backbone are shown to dominate long-range interactions, whereas the SELP repeat sequence leads to local protein/MMT compatibility. Up to a 50% increase in room temperature modulus and a comparable decrease in high temperature coefficient of thermal expansion occur for cast films containing 2-10 wt.% MMT.

  13. Endocytosis of wheat germ agglutinin binding sites from the cell surface into a tubular endosomal network.

    Science.gov (United States)

    Raub, T J; Koroly, M J; Roberts, R M

    1990-04-01

    By using fluorescence and electron microscopy, the endocytic pathway encountered by cell surface components after they had bound wheat germ agglutinin (WGA) was visualized. The majority of these components are thought to consist of sialylated glycoproteins (HMWAG) that represent a subpopulation of the total cell surface proteins but most of the externally disposed plasma membrane proteins of the cell. Examination of semi-thin sections by medium- and high-voltage electron microscopy revealed the three-dimensional organization of vesicular and tubular endosomes. Binding of either fluorescein isothiocyanate-, horseradish peroxidase-, or ferritin-conjugated WGA to cells at 4 degrees C showed that the HMWAG were distributed uniformly over the cell surface. Warming of surface-labeled cells to 37 degrees C resulted in the endocytosis of WGA into peripheral endosomes via invagination of regions of both coated and uncoated membrane. The peripheral endosome appeared as isolated complexes comprising a vesicular element (300-400 nm diam.) surrounded by and continuous with tubular cisternae (45-60 nm diam.), which did not interconnect the endosomes. After 30 min or more label also became localized in a network of anastomosing tubules (45-60 nm diam.) that were located in the centrosomal region of the cell. Endocytosed WGA-HMWAG complexes did not become associated with cisternae of the Golgi apparatus, although tubular and vesicular endosomes were noted in the vicinity of the trans-Golgi region. The accumulation of WGA-HMWAG in the endosomes within the centrosomal region was inhibited when cells were incubated at 18 degrees C. None of these compartments contained acid phosphatase activity, a result that is consistent with other data that the HMWAG do not pass through lysosomes initially. The kinetics of labeling were consistent with the interpretation that recycling of most of the WGA binding surface glycoproteins occurred rapidly from early peripheral endosomes followed by the

  14. Global Transcriptome Analysis Reveals Distinct Aluminum-Tolerance Pathways in the Al-Accumulating Species Hydrangea macrophylla and Marker Identification.

    Directory of Open Access Journals (Sweden)

    Haixia Chen

    Full Text Available Hydrangea (Hydrangea macrophylla is a well known Al-accumulating plant, showing a high level of aluminum (Al tolerance and accumulation. Although the physiological mechanisms for detoxification of Al and the roles of Al in blue hydrangea sepals have been reported, the molecular mechanisms of Al tolerance and accumulation are poorly understood in hydrangea. In this study, we conducted a genome-wide transcriptome analysis of Al-response genes in the roots and leaves of hydrangea by RNA sequencing (RNA-seq. The assembly of hydrangea transcriptome provides a rich source for gene identification and mining molecular markers, including single nucleotide polymorphism (SNP and simple sequence repeat (SSR. A total of 401,215 transcripts with an average length of 810.77 bp were assembled, generating 256,127 unigenes. After annotation, 4,287 genes in the roots and 730 genes in the leaves were up-regulated by Al exposure, while 236 genes in the roots and 719 genes in the leaves were down-regulated, respectively. Many transporters, including MATE and ABC families, were involved in the process of Al-citrate complex transporting from the roots in hydrangea. A plasma membrane Al uptake transporter, Nramp aluminum transporter was up-regulated in roots and leaves under Al stress, indicating it may play an important role in Al tolerance by reducing the level of toxic Al. Although the exact roles of these candidate genes remain to be examined, these results provide a platform for further functional analysis of the process of detoxification of Al in hydrangea.

  15. Complete Genome Sequence of Photobacterium sp. Strain J15, Isolated from Seawater of Southwestern Johor, Malaysia.

    Science.gov (United States)

    Roslan, Noordiyanah Nadhirah; Sabri, Suriana; Oslan, Siti Nurbaya; Baharum, Syarul Nataqain; Leow, Thean Chor

    2016-07-28

    Here, we report the genome sequences of Photobacterium sp. strain J15, isolated from seawater in Johor, Malaysia, with the ability to produce lipase and asparaginase. The PacBio genome sequence analysis of Photobacterium sp. strain J15 generated revealed its potential in producing enzymes with different catalytic functions. Copyright © 2016 Roslan et al.

  16. TBX1 mutation identified by exome sequencing in a Japanese family with 22q11.2 deletion syndrome-like craniofacial features and hypocalcemia.

    Directory of Open Access Journals (Sweden)

    Tsutomu Ogata

    Full Text Available BACKGROUND: Although TBX1 mutations have been identified in patients with 22q11.2 deletion syndrome (22q11.2DS-like phenotypes including characteristic craniofacial features, cardiovascular anomalies, hypoparathyroidism, and thymic hypoplasia, the frequency of TBX1 mutations remains rare in deletion-negative patients. Thus, it would be reasonable to perform a comprehensive genetic analysis in deletion-negative patients with 22q11.2DS-like phenotypes. METHODOLOGY/PRINCIPAL FINDINGS: We studied three subjects with craniofacial features and hypocalcemia (group 1, two subjects with craniofacial features alone (group 2, and three subjects with normal phenotype within a single Japanese family. Fluorescence in situ hybridization analysis excluded chromosome 22q11.2 deletion, and genomewide array comparative genomic hybridization analysis revealed no copy number change specific to group 1 or groups 1+2. However, exome sequencing identified a heterozygous TBX1 frameshift mutation (c.1253delA, p.Y418fsX459 specific to groups 1+2, as well as six missense variants and two in-frame microdeletions specific to groups 1+2 and two missense variants specific to group 1. The TBX1 mutation resided at exon 9C and was predicted to produce a non-functional truncated protein missing the nuclear localization signal and most of the transactivation domain. CONCLUSIONS/SIGNIFICANCE: Clinical features in groups 1+2 are well explained by the TBX1 mutation, while the clinical effects of the remaining variants are largely unknown. Thus, the results exemplify the usefulness of exome sequencing in the identification of disease-causing mutations in familial disorders. Furthermore, the results, in conjunction with the previous data, imply that TBX1 isoform C is the biologically essential variant and that TBX1 mutations are associated with a wide phenotypic spectrum, including most of 22q11.2DS phenotypes.

  17. Curtobacterium sp. Genome Sequencing Underlines Plant Growth Promotion-Related Traits.

    Science.gov (United States)

    Bulgari, Daniela; Minio, Andrea; Casati, Paola; Quaglino, Fabio; Delledonne, Massimo; Bianco, Piero A

    2014-07-17

    Endophytic bacteria are microorganisms residing in plant tissues without causing disease symptoms. Here, we provide the high-quality genome sequence of Curtobacterium sp. strain S6, isolated from grapevine plant. The genome assembly contains 2,759,404 bp in 13 contigs and 2,456 predicted genes. Copyright © 2014 Bulgari et al.

  18. Kepler-4b: A Hot Neptune-Like Planet of a G0 Star Near Main-Sequence Turnoff

    Science.gov (United States)

    2010-04-20

    events using the procedures described by Jenkins et al. (2010) and by Batalha et al. (2010). One of the transiting planet candidates identified by the...Tillinghast Reflector at the Whipple Obser- vatory showed a velocity variation of less than 150 m s−1 over 5 days. Accordingly, we obtained RV measurements with

  19. Sequence analysis of the N-acetyltransferase 2 gene (NAT2) among ...

    African Journals Online (AJOL)

    Yazun Bashir Jarrar

    2017-11-26

    Nov 26, 2017 ... Sequence analysis of the N-acetyltransferase 2 gene (NAT2) among Jordanian volunteers. Yazun Bashir Jarrar, Ayat Ahmed Balasmeh and Wassan Jarrar. Department of Pharmacy, College of Pharmacy, AlZaytoonah University of Jordan, Amman, Jordan. ABSTRACT. The present study aimed to identify ...

  20. AL Amyloidosis Complicated by Persistent Oral Bleeding

    Directory of Open Access Journals (Sweden)

    Luiz Antonio Liarte Marconcini

    2015-01-01

    Full Text Available A case of amyloid light chain (AL amyloidosis is presented here with uncontrolled bleeding after a nonsurgical dental procedure, most likely multifactorial in nature, and consequently treated with a multidisciplinary approach.

  1. Draft Genome Sequence of Lactobacillus sp. Strain TCF032-E4, Isolated from Fermented Radish.

    Science.gov (United States)

    Mao, Yuejian; Chen, Meng; Horvath, Philippe

    2015-07-30

    Here, we report the draft genome sequence of Lactobacillus sp. strain TCF032-E4 (= CCTCC AB2015090 = DSM 100358), isolated from a Chinese fermented radish. The total length of the 57 contigs is about 2.9 Mb, with a G+C content of 43.5 mol% and 2,797 predicted coding sequences (CDSs). Copyright © 2015 Mao et al.

  2. New Erwinia-Like Organism Causing Cervical Lymphadenitis▿

    Science.gov (United States)

    Shin, Sang Yop; Lee, Mi Young; Song, Jae-Hoon; Ko, Kwan Soo

    2008-01-01

    The first case of cervical lymphadenitis due to infection by a new Erwinia-like organism is reported. The organism was identified initially as Pantoea sp. by a Vitek 2-based assessment but was finally identified as a member of the genus Erwinia by 16S rRNA gene sequence analysis. The isolate displayed 98.9% 16S rRNA gene sequence similarity to that of E. tasmaniensis and showed phenotypic characteristics that were different from other Erwinia species. PMID:18614665

  3. Catalytic effect of Al and AlN interlayer on the growth and properties of containing carbon films

    International Nuclear Information System (INIS)

    Zhou, Bing; Liu, Zhubo; Tang, Bin; Rogachev, A.V.

    2015-01-01

    Highlights: • DLC and CN x bilayers with Al (AlN) interlayer were fabricated by cathode arc technique. • Complete diffusion of Al and C atoms occurs at the interface of Al/DLC (CN x ) bilayer. • Al/CN x bilayer presents a higher content of Csp 3 /Csp 2 bonds. • The hardness of Al/DLC bilayer decreases but increases for the other bilayers. • Morphology of the bilayers was explained by growth mechanism of DLC and surface state of substrate. - Abstract: Diamond-like carbon (DLC) and carbon nitride (CN x ) bilayer films with Al and AlN interlayer were fabricated by pulse cathode arc technique. The structure, composition, morphology and mechanical properties of the films were investigated by Raman, Auger electron spectroscopy (AES) and X-ray photoelectron spectroscopy (XPS), atomic force microscopy (AFM), Knoop sclerometer and surface profilometer. The results indicated that the complete diffusion between C and Al atoms occurs in the Al/DLC and Al/CN x bilayer. Al interlayer induces the increase of the size and ordering of Csp 2 clusters in the films but AlN interlayer increases the disordering degree of Csp 2 clusters. XPS results showed that a higher content of Csp 3 /Csp 2 bonds presents in the Al/CN x bilayer, and Al and AlN interlayer decreases the atomic ratio of N/C. AFM with phase contrast mode illustrated the morphologic characteristics of the bilayer films. All the bilayers show a nano-structural surface. The morphology changes of the bilayer were well explained by the surface state of the substrate and the growth mechanism of DLC films. The hardness of Al/DLC bilayer decreases but it increases for the other bilayers compared to the corresponding DLC (CN x ) monolayer. The internal stress of the bilayer is significantly lower than that of the monolayer except for the AlN/CN x bilayer. These studies could make the difference at the time of choosing a suitable functional film for certain application

  4. Rotation in moderate-mass pre-main-sequence radiative track G stars

    International Nuclear Information System (INIS)

    Mcnamara, B.

    1990-01-01

    Recent studies suggest that the observed high-mass radiative track velocity histogra