WorldWideScience

Sample records for aga muhammad ali

  1. Muhammad Ali: parel voor de sport en de mensheid

    NARCIS (Netherlands)

    Jan de Leeuw

    2016-01-01

    Begin juni 2016 overleed Muhammad Ali, volgens velen de grootste sportman allertijden. De betekenis van Ali voor de sport is groot geweest. Maar zijn betekenis voor de mensheid is nog groter. Ali stond voor de idealen van gelijkheid, rechtvaardigheid, vrijheid en vrede. Hij staat op een lijn met

  2. Muhammad Ali's Fighting Words: The Paradox of Violence in Nonviolent Rhetoric

    Science.gov (United States)

    Gorsevski, Ellen W.; Butterworth, Michael L.

    2011-01-01

    While Muhammad Ali has been the subject of countless articles and books written by sports historians and journalists, rhetorical scholars have largely ignored him. This oversight is surprising given both the tradition of social movement scholarship within rhetorical studies and Ali's influential eloquence as a world renowned celebrity espousing…

  3. Muhammad Ali, um outsider na sociedade americana?

    Directory of Open Access Journals (Sweden)

    Flávio Py Mariante Neto

    2010-12-01

    Full Text Available O estudo analisa a carreira do boxeador Muhammad Ali segundo as formulações sobre as relações de poder em configurações apresentadas por Norbert Elias. O propósito foi compreender como um atleta que foi contra questões tão profundas da sociedade estabelecida obteve sucesso profissional. Tratou-se de um estudo documental, tendo como fonte livros, artigos e reportagens publicadas sobre a trajetória do lutador. Concluiu-se que apesar de Ali ter se posicionado contra padrões estabelecidos de sua época em questões como a religião, o racismo e o patriotismo, a sua habilidade técnica acima da média, o seu poder de autopromoção e a sua capacidade de participar do jogo no contexto configuracional de que fazia parte, lhe deram condições de sobrevivência no mundo do boxe e conseqüente sucesso profissional.

  4. Fighting Injustice and Intolerance: Re-Presentations of Race and Religion at the Muhammad Ali Center

    Directory of Open Access Journals (Sweden)

    Michael Brandon McCormack

    2017-11-01

    Full Text Available This article explores the significance of the Muhammad Ali Center as a site where meanings associated with “race” and “religion” are constructed, contested and potentially transformed. The Muhammad Ali Center is examined as an example of an increasing number of cultural institutions (i.e., cultural centers, museums, arts spaces etc. engaged in the strategic re-presentation of issues of cultural difference and socio-political conflict, towards the ends of promoting social justice and/or human rights. The article draws upon theories and methods in cultural studies, religious studies, and museums studies in order to explore the significance of the representational and curatorial strategies of such cultural institutions for understanding alternative approaches to influencing and/or intervening in public discourses and practices surrounding issues of racial injustice and religious intolerance.

  5. Greater self-enhancement in Western than Eastern Ukraine, but failure to replicate the Muhammad Ali effect.

    Science.gov (United States)

    Kemmelmeier, Markus; Malanchuk, Oksana

    2016-02-01

    Based on the cross-cultural research linking individualism-collectivism and self-enhancement, this research examines regional pattern of self-enhancement in Ukraine. Broadly speaking, the western part of Ukraine is mainly Ukrainian speaking and historically oriented towards Europe, whereas Eastern Ukraine is mainly Russian speaking and historically oriented towards the Russian cultural sphere. We found self-enhancement on a "better than average" task to be higher in a Western Ukrainian sample compared to an Eastern Ukrainian sample, with differences in independent self-construals supporting assumed regional variation in individualism. However, the Muhammad Ali effect, the finding that self-enhancement is greater in the domain of morality than intelligence, was not replicated. The discussion focuses on the specific sources of this regional difference in self-enhancement, and reasons for why the Muhammad Ali effect was not found. © 2015 International Union of Psychological Science.

  6. The similarity of Ali (as and Jesus (PBUH in Islamic tradition

    Directory of Open Access Journals (Sweden)

    Mahdi Hasanzadeh

    2015-12-01

    Full Text Available According to the teachings of the Shia, Imam Ali (AS has unique features by which he earned the merits of becoming the successor to the Prophet (pbuh as the Imam and Wali. One of the most important of his features is his similarity to the Jesus as one of the greatest prophets before Prophet Muhammad (pbuh. This similarity was first mentioned in some Islamic traditions, especially the ones narrated through Shiite Isnad in interpretation of the verses 57-59 of the Surta Az-Zukhruf. In these traditions, the Prophet has regarded the Position of Imam Ali (AS in his nation the same as Jesus's Position among the Israel. The Quran has cited the inimical arguments of the Arab infidels against this prophet's saying: they considered the worshiping of their own gods better than accepting Prophet's remark in equating his cousin with Jesus (pbuh. By resorting to this remark, the infidels regarded worshiping their own gods more preferable than deifying a man. Therefore, the first and most prominent similarity between Imam Ali (AS and Jesus Christ (pbuh is attributing divinity to Imam Ali (AS, at least by some of his extreme lovers. The Quranic command saying: "Do not Exaggerate about your religion… .(Quran 4:17 refers to the Christian extremism in deifying Jesus, But soon word Ghali was borrowed from this verse and used to refer to Shiite extremists. Moreover, the Quran (4: 159, talks about the advent of Jesus Christ to his followers before their death .The same concept has been mentioned in Shiite traditions about Imam Ali (AS, according to which, he is believed to be present beside every dying Muslim individual. This appearance of Imam Ali (AS would remind us the idea of Imam Ali's (AS return to this world. Thus, the return of Imam Ali (AS to this world is the third similarity between Imam Ali (AS and Jesus Christ (PBUH. Not only the return of Jesus has been mentioned in in the Christian tradition as the one manifested to the apostles after his ascension

  7. The similarity of Ali (as and Jesus (PBUH in Islamic tradition

    Directory of Open Access Journals (Sweden)

    Sorush Ghanbari

    2016-01-01

    Full Text Available According to the teachings of the Shia, Imam Ali (AS has unique features by which he earned the merits of becoming the successor to the Prophet (pbuh as the Imam and Wali. One of the most important of his features is his similarity to the Jesus as one of the greatest prophets before Prophet Muhammad (pbuh. This similarity was first mentioned in some Islamic traditions, especially the ones narrated through Shiite Isnad in interpretation of the verses 57-59 of the Surta Az-Zukhruf. In these traditions, the Prophet has regarded the Position of Imam Ali (AS in his nation the same as Jesus's Position among the Israel. The Quran has cited the inimical arguments of the Arab infidels against this prophet's saying: they considered the worshiping of their own gods better than accepting Prophet's remark in equating his cousin with Jesus (pbuh. By resorting to this remark, the infidels regarded worshiping their own gods more preferable than deifying a man. Therefore, the first and most prominent similarity between Imam Ali (AS and Jesus Christ (pbuh is attributing divinity to Imam Ali (AS, at least by some of his extreme lovers. The Quranic command saying: "Do not Exaggerate about your religion… .(Quran 4:17 refers to the Christian extremism in deifying Jesus, But soon word Ghali was borrowed from this verse and used to refer to Shiite extremists. Moreover, the Quran (4: 159, talks about the advent of Jesus Christ to his followers before their death .The same concept has been mentioned in Shiite traditions about Imam Ali (AS, according to which, he is believed to be present beside every dying Muslim individual. This appearance of Imam Ali (AS would remind us the idea of Imam Ali's (AS return to this world. Thus, the return of Imam Ali (AS to this world is the third similarity between Imam Ali (AS and Jesus Christ (PBUH. Not only the return of Jesus has been mentioned in in the Christian tradition as the one manifested to the apostles after his ascension

  8. Muhammad y el monacato palestino

    Directory of Open Access Journals (Sweden)

    José María Blázquez Martínez

    2011-01-01

    Full Text Available Los grandes genios religiosos son Jesús, Buda y Muhammad. Ni Jesús ni Muhammad quisieron crear una religión, sino corregir la primitiva revelación, que se había desviado. Muhammad ha creado una religiosidad que ha dado alimento espiritual durante muchos siglos a millones de fieles, y una mística fabulosa que ha durado más de 1.000 años. Tor Andrae señala influjos de la iglesia y del monacato sirio. D.J. Sahas indica influjo fuerte del monacato sirio en el Corán. Se comparan en este trabajo puntos fundamentales de la religiosidad del Corán con el del monacato palestino: infierno, Juicio Final, Demonología, Angeología, el Paraíso, Oración, Ayunos, Limosna, prohibición de alimento, Eucaristía, etc. Muhammad es un hereje cristiano para S. Juan Damasceno, que vivió muchos años en la corte de los Omeyas y desempeñó altos cargos. Muhammad admite que Cristo es el Mesías, un grandísimo profeta, la palabra de Dios y el enviado de Dios. Niega que sea Dios, ni la redención, ni la crucifixión, que es sólo aparente; acepta la resurrección y la subida a los cielos. No admite la Trinidad. Los grandes investigadores protestantes, Harnack, Schlatter, Wellhausen, en el siglo XX, afirman que era un ebionita, o sea, un judeo-cristiano heterodoxo, que vivían en Palestina y Siria, tesis que aceptó el gran teólogo católico H. Küng, partidario de un diálogo con el Islam. Muhammad llevó, al principio, una vida en la montaña, muy parecida a la de los monjes cristianos. En el arte musulmán hay pinturas que representan a Muhammad con monjes que él conocía de sus viajes a Siria. No se puede dudar de un fuerte influjo del monacato palestino y sirio en la religiosidad de Muhammad, como indica D.J. Sahas, excelente conocedor de S. Juan Damasceno. La religiosidad de Muhammad, del monacato palestino y de Jesús, tienen un fuerte carácter social, al igual que la de los grandes profetas de Israel. El presente estudio confirma la frase de

  9. The Danish Muhammad Cartoon Conflict

    DEFF Research Database (Denmark)

    Hervik, Peter

    The “Muhammad crisis,” the “Muhammad Cartoon Crisis,” or “The Jyllands-Posten Crisis” are three different headings used for the global, violent reactions that broke out in early 2006. The cartoon crisis was triggered by the publication of 12 cartoons in the largest Danish daily newspaper...... theme in IMER studies, which has consequences for most immigrants of non-Western countries to the Nordic countries....

  10. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  11. Muhammad Rif`at dan Turath Bacaannya

    Directory of Open Access Journals (Sweden)

    WAN HILMI WAN ABDULLAH

    2013-12-01

    Full Text Available Shaykh Muhammad Rif`at is one of the famous reciters in Egypt in the era of the 90's. His stature continues evident after officially been invited as a qari to the opening ceremony of Qari al-Misriyyah Idha`at in 1934. During his involvement in the world of Quranic recitation, Shaykh Muhammad Rif`at had recited the Quran in the mosque of Fadil Basha for 25 years. His determinations to deliver and spread Holy Quran with an intermediate reading in mosques, haflah-haflah and ma’tam also have strongly influenced the next generations of qurra’. Many of the reciters like Shaykh Mustafa Isma`il, Shaykh Abu al-`Aynin Sha`isha', Shaykh `Abdul Fattah and others recognize that he has the greatness and uniqueness of its own in the art of reading the Quran. This is evidenced by some of the titles given to him as Amir al-Qurra’, Qitharah al-Sama’ and Sawt al-Malaikah by his contemporary reciters. After Shaykh Muhammad Rif`at died in 1950, then relics of his recited turath were uncovered which compiled by his friend, Zakaria Basha and compatriot Muhammad Khamis, as they managed to gather a total of 278 cds contains 19 chapters with the duration of 21 hours.

  12. RELEVANSI STRATEGI DAKWAH HIZBUT TAHRIR INDONESIA DENGAN STRATEGI DAKWAH NABI MUHAMMAD SAW

    Directory of Open Access Journals (Sweden)

    Eunis Khoerunnisa

    2017-01-01

    Full Text Available Hizbut Tahrir Indonesia is a unique and phenomenal propaganda institution. For one decade (1998-2008 it has exercised a very intensive preaching, conception of Islam, enforcement of Syari’ah and the Khilafah ruling system. The purpose of this study is to determine the Hizbut Tahrir Indonesia thinking about: (1 the arguments used by Hizbut Tahrir Indonesia in preaching; (2 the purpose of the preaching of Hizbut Tahrir Indonesia; (3 the method used in the propaganda activities of Hizbut Tahrir Indonesia; (4 the program of propaganda in the view of Hizbut Tahrir Indonesia; and (5 the relevance of Hizbut Tahrir Indonesia propagation strategy with the strategy of propaganda of the Prophet Muhammad. The results showed that (1 Hizbut Tahrir Indonesia propagation argument is Surah (Chapter Ali-Imran verse 104; (2 the purpose of Hizbut Tahrir Indonesia propaganda is to hold Islamic life and to carry the Islamic propagation to the entire world and to revive Islam in the right way; (3 the method adopted by Hizbut Tahrir Indonesia in carrying out the mission is the laws of Personality which is taken from Prophet Sayings; (4 HizbutTahrir Indonesia propagation program is basically the same as Hizbut Tahrir anywhere, for espousing ideas, ideals and the same activity which reflects on propagation strategy of the Prophet; and (5 selection of Hizbut Tahrir Indonesia toward the Prophet Traditions about the propagation method applied by the Prophet Muhammad SAW tend to choose a more nuanced firm. In fact, the propagation method applied by the Prophet varies depending on the existing situation and conditions.   Hizbut Tahrir Indonesia adalah sebuah lembaga dakwah yang unik dan fenomenal. Selama kurang lebih satu dasawarsa (1998-2008 sangat intensif melakukan dakwahnya, konsepsinya tentang penegakan Syari’at Islam dan sistem pemerintahan Khilafah. Tujuan penelitian ini adalah untuk mengetahui pemikiran Hizbut Tahrir Indonesia tentang: (1 landasan yang digunakan

  13. Social innovation og Muhammad Yunus i en dansk kontekst

    DEFF Research Database (Denmark)

    2008-01-01

    Hvorfor er social innovation og Muhammad Yunus' arbejde relevant i en dansk kontekst? Kan social innovation være med til at skabe fremtidens danske velfærdssamfund?......Hvorfor er social innovation og Muhammad Yunus' arbejde relevant i en dansk kontekst? Kan social innovation være med til at skabe fremtidens danske velfærdssamfund?...

  14. 77 FR 70548 - Designation of one (1) individual Pursuant to Executive Order 13224 of September 23, 2001...

    Science.gov (United States)

    2012-11-26

    ... follows: Individual 1. AL-MUSAWI, Ali Mussa Daqduq (a.k.a. 'ABD AL-YUNIS, Hamid Majid; a.k.a. AL-LAMI.... AL-MUSAWI, Hamid Muhammad Jabur; a.k.a. AL-MUSUI, Hamid Muhammad Jabur; a.k.a. DAQDUQ, Ali Mussa; a.k...

  15. WAHYU DAN KEBERHASILAN DAKWAH MUHAMMAD (Sebuah Kajian Sosiologis

    Directory of Open Access Journals (Sweden)

    Khadziq Khadziq

    2016-11-01

    Full Text Available Islam is embraced by many people through a relatively fast spread. This fact cannot be separated firom the role of its preacher, Muhammad. His success in da’wa activities was contributed by his social roles as well as the revelation that he brought. This article tries to explain that both the revelation and the social factors greatly supported his da’wa. Beside his positives, the existence of Quran as a revelation contributed the social legitimacy that Muhammad was considered as a figure to be followed in spite of his contrary values to the cultures of his time.

  16. Browse Title Index

    African Journals Online (AJOL)

    Items 4851 - 4900 of 11090 ... Salman Mushtaq, Ishfaq Ahmad Hafiz, Syed Zia Ul Hasan, Muhammad Arif, Muhammad Asif Shehzad, Rizwan Rafique, Misbah Rasheed, Muhammad Ali, Muhammad Shahid Iqbal. Vol 7, No 24 (2008), Evaluation of seed production of scots pine (Pinus sylvestris L.) clonal seed orchard with cone ...

  17. KONTRIBUSI PEMIKIRAN MUHAMMAD SAW PRA DAN PASCA KENABIAN ERA MAKKIAH

    Directory of Open Access Journals (Sweden)

    Agus Jaya

    2011-11-01

    Full Text Available Abstract:Muhammad is the greatest phenomenon in human history. Signs He enshrined in the presence of the holy scriptures is  as a justification former glory. His presence was expected by every group and interest, although later become a boomerang for them because the treatise was carrying remodel beliefs and traditions handed down from their ancestors. The suffering experiences completed His life’s history  as a candidate of  a prophet. Born with orphan status, grew by profession and lived as a shepherd, had suffering experiences has  formed  the identity of Muhammad to become an intelligent and wise leader. Muhammad's intelligence and wisdom in deciding the issue and genius as well as the accuracy of missionary strategy embedded in the period of Mecca is the contribution of thinking which is priceless. Keywords: the contribution of ideas, leadership training, intelligence, wisdom, leadership characteristics

  18. KONSEP TASAWUF SYEKH MUHAMMAD ARSYAD AL-BANJARI

    Directory of Open Access Journals (Sweden)

    Nuraida Nuraida

    2016-02-01

    Full Text Available Shaykh Muhammad al - Banjari Arsyad , derived from Banjar South Kalimantan . He was a well-known figure in the 18th century. His role was not only in education , but he was known as a great scholar of fiqh and also an expert in field of Sufism . This had been the result obtained for about thirty years studying in Mecca . Therefore , he was recognized as one of the transmission of the Middle East teaching, particularly in Banjar Indonesia South Kalimantan . His study of Sufism was written in “Kanz al Ma'rifah” . In this book,  Ma'rifah is not separated from the concept of knowing God and ourselves . If someone recognizes him, he should recognize his god. Knowing God means knowing the origin of human, aacording to Arsyad, it is called Nur Muhammad ; mortal before death.

  19. RELASI-KONFLIK SUKU QURAISH DAN BANI MUSTALIQ DI ERA NABI MUHAMMAD

    Directory of Open Access Journals (Sweden)

    Muhammad Sulthon

    2017-08-01

    Full Text Available This paper examines the role of the prophet Muhammad's preaching in resolving internal conflicts of Quraysh tribe and conflicts between the Quraysh tribe with a descendant of Mustaliq. The goal is to reconstruct their conflicts and Muhammad's position in the middle of the conflict. For that purpose, the data collected from the books of Sirah Nabawiyah as the main source and analyzed so that it can be drawn the conflict relationship between the two tribes and the resolution. The results of the study found the conflict between the Quraysh tribe of the descendant of Mustaliq can be tracked since their ancestors, respectively, before the advent of Muhammad. Fundamental issues regarding with conflicts dealing with political power, self-esteem and group identity. The triggers of conflict that almost rising the violent conflicts between the other were a misunderstanding. In resolving the conflict, the prophet prefers peaceful means despite ever using violence in the form of war. Tulisan ini mengkaji peran dakwah nabi Muhammad dalam menyelesaikan konflik intern suku Quraish maupun konflik antara suku Quraish dengan bani Mustaliq. Tujuannya, merekonstruksi relasi konflik antara mereka dan posisi Muhammad di tengah tengah konflik tersebut. Untuk tujuan itu, data dihimpun dari kitab-kitab Sirah Nabawiyah sebagai sumber utama dan dianalisis sehingga tergambar relasi-konflik tokoh-tokoh dari kedua suku tersebut dan penyelesaiannya. Hasil kajian menemukan, konflik antara suku Quraish dengan bani Mustaliq dapat dilacak sejak nenek moyang mereka masing-masing, sebelum kenabian Muhammad. Issu pokok terjadinya konflik berkenaan dengan persoalan politik kekuasaan, harga diri dan identitas kelompok. Pemicu konflik yang nyaris menimbulkan kekerasan antara lain adalah kesalahpahaman. Dalam menyelesaikan konflik, nabi lebih mengutamakan jalan damai meski pernah menggunakan kekerasan dalam bentuk

  20. PENDIDIKAN MUHAMMAD ABDUH VERSUS PENDIDIKAN KARAKTER BANGSA

    Directory of Open Access Journals (Sweden)

    Cucum Novianti

    2015-01-01

    Full Text Available Education in Islam can not be separated from the history as a foothold guideline in an effort to improve the quality of education. The earlier leaders in the education field has provided a scientific concept for reconstructing the less well structure established in his time, so due to their brilliant thinking in education field we can use as a guide to dissect the our education phenomenon today. Muhammad Abduh is a Muslim philosophers and the education thinkers in world caliber. Many things that have been done in reconstructing of education through the thoughts and concrete step in order to be consistent with the purpose of human life for raise the dignity of human life. The reformation carried out by Muhammad Abduh in the field of education are able to be applied in the present by giving more attention to the character building of students. Hopefully, Indonesian people become intelligent in mind and having moral character.

  1. PERSONALITY EDUCATION ACCORDING TO ALLAMA MUHAMMAD IQBAL

    Directory of Open Access Journals (Sweden)

    Imam Bahroni

    2015-12-01

    Full Text Available         This paper is aimed at discussing the concept of Personality Education according to Allama Muhammad Iqbal. In relation with the concept, Muhammad Iqbal (1873-1938, emphasized the proper development of the individuality of man. He maintained that an individual should be exposed to all kinds of formative and challenging experiences; otherwise his individuality will shrink and wither[1]. Iqbal underscored the importance of freedom, which allowed for experimentation with the environment, for the exercise of choice and discrimination in the use of methods and substance, and for learning by direct, firsthand experience. Despite his emphasis on the individual, Iqbal did not ignore the role of the community and its culture in the give-and-take dynamics with the individual. Iqbal also subscribed to the view that there must be harmony between the material and spiritual elements in man, which educational theory should consider. He valued intellect, but he criticized contemporary thought for overstressing it at the expense of intuition or love. From Iqbal's writings, the characteristics of the good man could be inferred. First, the good man is creative and original, for creativity is the most precious and distinctive gift of man. He must be able to use his intelligence to harness the forces of nature for his own good and also to increase his knowledge and power. Secondly, the good man lives his life in the name of the Lord, dedicating his powers and knowledge to working out His purpose and thereby deserving himself for the position of God's vicegerent on earth.[1] K.G. Saiyidain, (1977, Iqbal's educational philosophy, 8th ed.,Lahore: SH Muhammad Ashraf, p. 14.

  2. Evaluation of Three Commercial Backpack Sprayers with Aqualuer (registered trademark) 20-20 Against Caged Adult Aedes aegypti

    Science.gov (United States)

    2016-03-11

    Sprayers with Aqualuer® 20–20 Against Caged Adult Aedes Aegypti Author(s): Derrick Conover, Ali Fulcher, Michael L. Smith, Muhammad Farooq, Marcia K... AEDES AEGYPTI DERRICK CONOVER,1 ALI FULCHER,1 MICHAEL L. SMITH,1 MUHAMMAD FAROOQ,2 MARCIA K. GAINES1 AND RUI-DE XUE1,3 ABSTRACT. Three commercially...adult Aedes aegypti in semifield trials in northeastern Florida. Two battery-powered sprayers, Birchmeier and Hudson, were compared with the standard

  3. New ALI and its relevant factors

    International Nuclear Information System (INIS)

    Zhou Yongzeng; Wang Jiadong

    1993-01-01

    ALI is secondary limit. The method of calculating ALI, changes of some parameters used in calculation of ALI and their influences on ALI were discussed. A comparison between old and new ALI was made. The most part of the ratios of old ALI/new ALI (about 75%) ranges from 2 to 4. Reduction of annual dose limit from 50 mSv to 20 mSv seems to be the main reason causing reduction of values of new ALI

  4. (AGA) Pre Term Babies

    African Journals Online (AJOL)

    Haematological Indices in Healthy Appropriate For-Gestational-Age (AGA) Pre Term Babies. ... International Journal of Medicine and Health Development. Journal Home ... Patient and Methods: All consecutive healthy pre-term new born babies delivered at UNTH and admitted into the hospital NBSCU were included.

  5. The Muhammad cartoon controversy and the globalization of humor

    NARCIS (Netherlands)

    Kuipers, G.

    2008-01-01

    At the 2006 conference of the International Society for Humor Studies (Danish University of Education, Copenhagen), several panels addressed issues raised by the Muhammad cartoon story. Among these, a colloquium organized by Paul Lewis and decorously titled "Transnational Ridicule and Response"

  6. AGA predicts winter jump in residential gas price

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The American Gas Association predicts the average heating bill for residential gas consumers could increase by as much as 18% this winter. AGA Pres. Mike Baly said, Last year's winter was warmer than normal. If the 1992-93 winter is similar, AGA projects that residential natural gas heating bills will go up about 6%. If we see a return to normal winter weather, our projection show the average bill could rise by almost 18%

  7. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Mohammad Sadiq1 Muhammad Ali1 Rashid Iqbal1 Khalid Saeed1 Aimal Khan1 Muhammad Naveed Umar1 Haroon Ur Rashid2. Department of Chemistry, University of Malakand, Chakdara, Dir (L), Khyber Pakhtunkhwa, Pakistan; Department of Chemistry, Sarhad University of Science and Information Technology, ...

  8. African Journal of Biotechnology - Vol 11, No 46 (2012)

    African Journals Online (AJOL)

    Punjabi population data for seven X-chromosome short tandem repeat (X-STR) loci using a new miniplex system · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Muhammad Israr, Ahamad Ali Shahid, Ziaur Rahman, Muhammad Saqib Shahzad, Obaid Ullah, ...

  9. AliEn - EDG Interoperability in ALICE

    CERN Document Server

    Bagnasco, S; Buncic, P; Carminati, F; Cerello, P G; Saiz, P

    2003-01-01

    AliEn (ALICE Environment) is a GRID-like system for large scale job submission and distributed data management developed and used in the context of ALICE, the CERN LHC heavy-ion experiment. With the aim of exploiting upcoming Grid resources to run AliEn-managed jobs and store the produced data, the problem of AliEn-EDG interoperability was addressed and an in-terface was designed. One or more EDG (European Data Grid) User Interface machines run the AliEn software suite (Cluster Monitor, Storage Element and Computing Element), and act as interface nodes between the systems. An EDG Resource Broker is seen by the AliEn server as a single Computing Element, while the EDG storage is seen by AliEn as a single, large Storage Element; files produced in EDG sites are registered in both the EDG Replica Catalogue and in the AliEn Data Catalogue, thus ensuring accessibility from both worlds. In fact, both registrations are required: the AliEn one is used for the data management, the EDG one to guarantee the integrity and...

  10. Perspektif Gender dalam Tafsir Muhammad ‘Abduh

    OpenAIRE

    Muchamad Samsukadi

    2014-01-01

    This article explains what Muhammad ‘Abduh’s interpretation on gender verses. According to ‘Abduh, Quran has broadly given same roles, duties and rights between men and women. However, sometimes the equal understanding has been forgotten by some mufasirs about verses dealing with leadership in household, polygamy, and inheritance. To ‘Abduh, in household, the relationship between husband and wife is mutualism-symbiosis. Functionally and structurally, it is lead by husband. Meanwhile, polygamy...

  11. Perspektif Gender Dalam Tafsir Muhammad ‘Abduh

    OpenAIRE

    Samsukadi, Muchamad

    2014-01-01

    This article explains what Muhammad ‘Abduh's interpretation on gender verses. According to ‘Abduh, Quran has broadly given same roles, duties and rights between men and women. However, sometimes the equal understanding has been forgotten by some mufasirs about verses dealing with leadership in household, polygamy, and inheritance. To ‘Abduh, in household, the relationship between husband and wife is mutualism-symbiosis. Functionally and structurally, it is lead by husband. Meanwhile, polygamy...

  12. AliEnFS - a Linux File System for the AliEn Grid Services

    OpenAIRE

    Peters, Andreas J.; Saiz, P.; Buncic, P.

    2003-01-01

    Among the services offered by the AliEn (ALICE Environment http://alien.cern.ch) Grid framework there is a virtual file catalogue to allow transparent access to distributed data-sets using various file transfer protocols. $alienfs$ (AliEn File System) integrates the AliEn file catalogue as a new file system type into the Linux kernel using LUFS, a hybrid user space file system framework (Open Source http://lufs.sourceforge.net). LUFS uses a special kernel interface level called VFS (Virtual F...

  13. Prognostic Significance of Modified Advanced Lung Cancer Inflammation Index (ALI) in Patients with Small Cell Lung Cancer_ Comparison with Original ALI.

    Science.gov (United States)

    Kim, Eun Young; Kim, Nambeom; Kim, Young Saing; Seo, Ja-Young; Park, Inkeun; Ahn, Hee Kyung; Jeong, Yu Mi; Kim, Jeong Ho

    2016-01-01

    Advanced lung cancer inflammation index (ALI, body mass index [BMI] x serum albumin/neutrophil-lymphocyte ratio [NLR]) has been shown to predict overall survival (OS) in small cell lung cancer (SCLC). CT enables skeletal muscle to be quantified, whereas BMI cannot accurately reflect body composition. The purpose was to evaluate prognostic value of modified ALI (mALI) using CT-determined L3 muscle index (L3MI, muscle area at L3/height2) beyond original ALI. L3MIs were calculated using the CT images of 186 consecutive patients with SCLC taken at diagnosis, and mALI was defined as L3MI x serum albumin/NLR. Using chi-squared test determined maximum cut-offs for low ALI and low mALI, the prognostic values of low ALI and low mALI were tested using Kaplan-Meier method and Cox proportional hazards analysis. Finally, deviance statistics was used to test whether the goodness of fit of the prognostic model is improved by adding mALI as an extra variable. Patients with low ALI (cut-off, 31.1, n = 94) had shorter OS than patients with high ALI (median, 6.8 months vs. 15.8 months; p ALI and low mALI (z = 0.000, p = 1.000) and between high ALI and high mALI (z = 0.330, p = 0.740). Multivariable analysis showed that low ALI was an independent prognostic factor for shorter OS (HR, 1.67, p = 0.004), along with advanced age (HR, 1.49, p = 0.045), extensive disease (HR, 2.27, p ALI using BMI. ALI is a simple and useful prognostic indicator in SCLC.

  14. Prognostic Significance of Modified Advanced Lung Cancer Inflammation Index (ALI in Patients with Small Cell Lung Cancer_ Comparison with Original ALI.

    Directory of Open Access Journals (Sweden)

    Eun Young Kim

    Full Text Available Advanced lung cancer inflammation index (ALI, body mass index [BMI] x serum albumin/neutrophil-lymphocyte ratio [NLR] has been shown to predict overall survival (OS in small cell lung cancer (SCLC. CT enables skeletal muscle to be quantified, whereas BMI cannot accurately reflect body composition. The purpose was to evaluate prognostic value of modified ALI (mALI using CT-determined L3 muscle index (L3MI, muscle area at L3/height2 beyond original ALI.L3MIs were calculated using the CT images of 186 consecutive patients with SCLC taken at diagnosis, and mALI was defined as L3MI x serum albumin/NLR. Using chi-squared test determined maximum cut-offs for low ALI and low mALI, the prognostic values of low ALI and low mALI were tested using Kaplan-Meier method and Cox proportional hazards analysis. Finally, deviance statistics was used to test whether the goodness of fit of the prognostic model is improved by adding mALI as an extra variable.Patients with low ALI (cut-off, 31.1, n = 94 had shorter OS than patients with high ALI (median, 6.8 months vs. 15.8 months; p < 0.001, and patients with low mALI (cut-off 67.7, n = 94 had shorter OS than patients with high mALI (median, 6.8 months vs. 16.5 months; p < 0.001. There was no significant difference in estimates of median survival time between low ALI and low mALI (z = 0.000, p = 1.000 and between high ALI and high mALI (z = 0.330, p = 0.740. Multivariable analysis showed that low ALI was an independent prognostic factor for shorter OS (HR, 1.67, p = 0.004, along with advanced age (HR, 1.49, p = 0.045, extensive disease (HR, 2.27, p < 0.001, supportive care only (HR, 7.86, p < 0.001, and elevated LDH (HR, 1.45, p = 0.037. Furthermore, goodness of fit of this prognostic model was not significantly increased by adding mALI as an extra variable (LR difference = 2.220, p = 0.136.The present study confirms mALI using CT-determined L3MI has no additional prognostic value beyond original ALI using BMI. ALI

  15. Syria and Iraq: Relations and Prospects

    Science.gov (United States)

    1984-05-01

    Asad TABLE 1 HAFIZ AL-ASAD’S KINSHIP GROUP Position Kinship Adnan Makhluf Muhammad al-Khuli Ali Dubah Ali Arslan Ali Salih Ali Haydar Shafiq...predecessor, General Ahmad Hasan al-Bakr, to neutralize the military’s tendency to overthrow the Party, as it did in 1963 under General Abd al-Salam Arif...SADDAM HUSAYN’S KINSHIP GROUP POSITION KINSHIP General Adnan Khay- rallah (Talfah) Ali Hasan al-Majid Fadhil al-Barrak Izzat Ibrahim al-Duri Kamil

  16. Muhammad Akbar Arzani (-1772): Mughal physician and translator.

    Science.gov (United States)

    Aggarwal, Neil Krishan

    2012-05-01

    Muhammad Akbar Arzānī was an influential Mughal physician famous throughout Iran and South Asia. His reputation is considered from contemporary accounts of his importance within the broader scholarship in South Asian culture and history. A brief synopsis of his life is provided, followed by a bibliography of his writings. Arzānī made Greco-Arabic knowledge accessible for Indo-Persian audiences in the 18th century.

  17. Experimental investigation of the Al-Y phase diagram

    International Nuclear Information System (INIS)

    Liu Shuhong; Du Yong; Xu Honghui; He Cuiyun; Schuster, Julius C.

    2006-01-01

    The Al-Y phase diagram has been reinvestigated with 16 key alloys over its whole composition range by means of differential thermal analysis, X-ray diffraction, optical microscopy, and scanning electron microscopy with energy dispersive X-ray techniques. The existence of five intermetallic phases, Al 3 Y, Al 2 Y, AlY, Al 2 Y 3 , and AlY 2 , has been confirmed. Al 2 Y and Al 2 Y 3 melt congruently at 1490 ± 2 and 1105 ± 2 deg. C, respectively. Al 3 Y, AlY, and AlY 2 are formed via the peritectic reactions L + Al 2 Y ↔ Al 3 Y at 980 ± 2 deg. C, L + Al 2 Y ↔ AlY at 1138 ± 2 deg. C, and L + Al 2 Y 3 ↔ AlY 2 at 977 ± 2 deg. C, respectively. Three eutectic reactions L ↔ (Al) + Al 3 Y at 637 ± 2 deg. C, L ↔ AlY + Al 2 Y 3 at 1081 ± 2 deg. C, and L ↔ AlY 2 + (αY) at 955 ± 2 deg. C , are observed. The previously reported Al 3 Y 5 , AlY 3 compounds were not found. A revised Al-Y phase diagram is presented mainly based on the present experimental results

  18. The Legacy of Muhammad Hamidullah in Islamic Economics

    OpenAIRE

    Islahi, Abdul Azim

    2017-01-01

    Dr. Muhammad Hamidullah is famous for his French translation of the Qur'an, and well-known for discovery, editing and bringing in light a number of rare and invaluable hadith manuscripts. He is also rightly acknowledged for his ground-breaking research works on international Islamic law, biography of the Prophet (peace be upon him), Islamic politics and archival heritage of Islam. A less known but significant aspect of his contribution is his pioneering works on Islamic Economics. Spread over...

  19. Analysis list: aly-2 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available aly-2 Larvae + ce10 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/target/aly-2.1....tsv http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/target/aly-2.5.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/target/al...y-2.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/colo/aly-2.Larvae.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/colo/Larvae.gml ...

  20. ITIJAHAT KAUN AL-NABI WA AL-RASUL FI SYAKHSIYAH MUHAMMAD FI NATSR MAULID AL-BARZANJI

    Directory of Open Access Journals (Sweden)

    Himmah Istomah

    2017-08-01

    Full Text Available One of human personalities is humanist. Based on the understanding of Maslow’s theory of motivation, researcher seeks to uncover kinds of motivational needs of Muhammad Saw contained in Maulid Al-Barzanjiy (the work of Ja 'far bin Hasan al-Barzanji (d. 1763 M. The goal is realized through a descriptive qualitative approach with  text analysis  about Psycholiterature of Endraswara. The results of this study indicate that in Maulid Al-Barzanji there are Muhammad Saw’s five needs and how their satisfying perfectly,  namely: physiological needs, safety, social, esteem, and self-actualization. Thus, it can be interpreted that Muhammad SAW as an ordinary human having motivational needs. His prophetic and apostleship honor is not a direct blessing from Allah, but he had been through some complicated processes in life. This can be applied by his followers, so they can complete their motivational needs to reach the satiation as a caliph and to be useful person in this world.

  1. AliEn: ALICE environment on the GRID

    International Nuclear Information System (INIS)

    Bagnasco, S; Betev, L; Buncic, P; Carminati, F; Cirstoiu, C; Grigoras, C; Hayrapetyan, A; Harutyunyan, A; Peters, A J; Saiz, P

    2008-01-01

    Starting from mid-2008, the ALICE detector at CERN LHC will collect data at a rate of 4PB per year. ALICE will use exclusively distributed Grid resources to store, process and analyse this data. The top-level management of the Grid resources is done through the AliEn (ALICE Environment) system, which is in continuous development since year 2000. AliEn presents several original solutions, which have shown their viability in a number of large exercises of increasing complexity called Data Challenges. This paper describes the AliEn architecture: Job Management, Data Management and UI. The current status of AliEn will be illustrated, as well as the performance of the system during the data challenges. The paper also describes the future AliEn development roadmap

  2. AliEn: ALICE Environment on the GRID

    CERN Multimedia

    Bagnasco, S; Buncic, P; Carminati, F; Cirstoiu, C; Grigoras, C; Hayrapetyan, A; Harutyunyan, A; Peters, A J; Saiz, P

    2007-01-01

    Starting from mid-2008, the ALICE detector at CERN LHC will collect data at a rate of 4PB per year. ALICE will use exclusively distributed Grid resources to store, process and analyse this data. The top-level management of the Grid resources is done through the AliEn (ALICE Environment) system, which is in continuous development since year 2000. AliEn presents several original solutions, which have shown their viability in a number of large exercises of increasing complexity called Data Challenges. This paper describes the AliEn architecture: Job Management, Data Management and UI. The current status of AliEn will be illustrated, as well as the performance of the system during the data challenges. The paper also describes the future AliEn development roadmap.

  3. AliPDU Package Upgrade

    CERN Document Server

    "Martin, Michael

    2015-01-01

    "AliPDU Package" is a set of script, panels, and datapoints designed in WinCC to manage and monitor PDU's. PDU is an essential component in the data center, in order to make data center working properly through the monitoring of power distribution and environmental condition of the data center. In this project "AliPDU Package" is upgraded so it can be used to monitor environmental condition of data center using PDU's and external environmental sensor connected to PDU.

  4. AliPDU Package Upgrade

    CERN Document Server

    Martin, Michael

    2015-01-01

    AliPDU Package is a set of script, panels, and datapoints designed in WinCC to manage and monitor PDU's. PDU is an essential component in the data center, in order to make data center working properly through the monitoring of power distribution and environmental condition of the data center. In this project "AliPDU Package" is upgraded so it can be used to monitor environmental condition of data center using PDU's and external environmental sensor connected to PDU.

  5. The role of anthropometric, growth and maturity index (AGaMI) influencing youth soccer relative performance

    Science.gov (United States)

    Bisyri Husin Musawi Maliki, Ahmad; Razali Abdullah, Mohamad; Juahir, Hafizan; Muhamad, Wan Siti Amalina Wan; Afiqah Mohamad Nasir, Nur; Muazu Musa, Rabiu; Musliha Mat-Rasid, Siti; Adnan, Aleesha; Azura Kosni, Norlaila; Abdullah, Farhana; Ain Shahirah Abdullah, Nurul

    2018-04-01

    The main purpose of this study was to develop Anthropometric, Growth and Maturity Index (AGaMI) in soccer and explore its differences to soccer player physical attributes, fitness, motivation and skills. A total 223 adolescent soccer athletes aged 12 to 18 years old were selected as respondent. AGaMI was develop based on anthropometric components (bicep, tricep, subscapular, suprailiac, calf circumference and muac) with growth and maturity component using tanner scale. Meanwhile, relative performance namely physical, fitness, motivation and skills attributes of soccer were measured as dependent variables. The Principal Component Analysis (PCA) and Analysis of Variance (ANOVA) are used to achieve the objective in this study. AGaMI had categorized players into three different groups namely; high (5 players), moderate (88 players) and low (91 players). PCA revealed a moderate to very strong dominant range of 0.69 to 0.90 of factor loading on AGaMI. Further analysis assigned AGaMI groups as treated as independent variables (IV) and physical, fitness, motivation and skills attributes were treated as dependent variables (DV). Finally, ANOVA showed that flexibility, leg power, age, weight, height, sitting height, short and long pass are the most significant parameters statistically differentiate by the groups of AGaMI (p<0.05). As a summary, body fat mass, growth and maturity are an essential component differentiating the output of the soccer players relative performance. In future, information of the AGaMI model are useful to the coach and players for identifying the suitable biological and physiological demand reflects more comprehensive means of youth soccer relative performance. This study further highlights the importance of assessing AGaMI when identifying soccer relative performance.

  6. Perspektif Gender dalam Tafsir Muhammad ‘Abduh

    Directory of Open Access Journals (Sweden)

    Muchamad Samsukadi

    2014-10-01

    Full Text Available This article explains what Muhammad ‘Abduh’s interpretation on gender verses. According to ‘Abduh, Quran has broadly given same roles, duties and rights between men and women. However, sometimes the equal understanding has been forgotten by some mufasirs about verses dealing with leadership in household, polygamy, and inheritance. To ‘Abduh, in household, the relationship between husband and wife is mutualism-symbiosis. Functionally and structurally, it is lead by husband. Meanwhile, polygamy and inheritance are kinds of protection toward women’s rights. Polygamy is forbidden to whom that has no ability to be fair, while inheritance has to be given equally and reasonably.

  7. AliEn: ALICE Environment on the GRID

    CERN Multimedia

    CERN. Geneva

    2012-01-01

    AliEn is the GRID middleware used by the ALICE collaboration. It provides all the components that are needed to manage the distributed resources. AliEn is used for all the computing workflows of the experiment: Montecarlo production, data replication and reconstruction and organixed or chaotic user analysis. Moreover, AliEn is also being used by other experiments like PANDA and CBM. The main components of AliEn are a centralized file and metadata catalogue, a job execution model and file replication model. These three components have been evolving over the last 10 years to make sure that the satisfy the computing requirements of the experiment, which keep increasing every year.

  8. AliEn - GRID application for ALICE Collaboration

    International Nuclear Information System (INIS)

    Zgura, Ion-Sorin

    2003-01-01

    AliEn (ALICE Environment) is a GRID framework built on top of the latest Internet standards for information exchange and authentication (SOAP, PKI) and common Open Source components. AliEn provides a virtual file catalogue that allows transparent access to distributed data-sets and a number of collaborating Web services which implement the authentication, job execution, file transport, performance monitor and event logging.The ALICE experiment has developed AliEn as an implementation of distributed computing infrastructure needed to simulate, reconstruct and analyze data from the experiment. The sites that belong to the ALICE Virtual Organisation can be seen and used as a single entity - any available node executes jobs and access to logical and datasets is transparent to the user. In developing AliEn common standards and solutions in the form of Open Source components were used. Only 1% (25k physical lines of code in Perl) is native AliEn code while 99% of the code has been imported in form of Open Sources packages and Perl modules. Currently ALICE is using the system for distributed production of Monte Carlo data at over 30 sites on four continents. During the last twelve months more than 30,000 jobs have been successfully run under AliEn control worldwide, totalling 25 CPU years and producing 20 TB of data. The user interface is compatible to EU DataGrid at the level of authentication and job description language. In perspective AliEn will be interfaced to the mainstream Grid infrastructure in HEP and it will remain to serve as interface between ALICE Offline framework and external Grid infrastructure. (authors)

  9. Pengaruh Muhammad Haqqi al-Nazilli (m. 1884 terhadap Amalan Keagamaan Masyarakat Melayu

    Directory of Open Access Journals (Sweden)

    Wahyu Hidayat Abdullah

    2014-12-01

    Full Text Available Muhammad Haqqi al-Nazilli (m. 1884 merupakan salah seorang tokoh ulama Islam yang penting pada abad kesembilan belas. Walaupun berasal dari Turki, beliau telah menghabiskan kebanyakan usia dan kerjayanya sebagai seorang ilmuwan yang berdomisil di Mekah dan terkenal sebagai pakar dalam bidang ilmu hadis dan tasawuf. Selain aktif mengajar, beliau turut menghasilkan sejumlah karya keagamaan yang penting dalam bahasa Arab. Secara khasnya, adikarya beliau bertajuk Khazinah al-Asrar Jalilah al-Adhkar memainkan peranan yang penting terutama sekali dalam kalangan pelajarnya yang berasal dari Alam Melayu. Ia merupakan karya berasaskan hadis Nabi SAW mengenai kelebihan dan fadilat ayatayat al-Quran dan ibadat-ibadat lain. Walau bagaimanapun, tidak banyak yang diketahui mengenai tokoh ini dan karyanya. Justeru, makalah ini bertujuan untuk membincangkan mengenainya dengan lebih mendalam. Selain membincangkan aspek biografi dan hasil karya Muhammad Haqqi dari perspektif sejarah, kertas ini terfokus untuk menganalisis metodenya dalam penilaian dan penerimaan hadis berdasarkan karyanya Khazinah al- Asrar dan pengaruhnya terhadap sesetengah amalan keagamaan masyarakat Melayu. Dapatan kajian mengetengahkan sikapnya yang mengharmonikan pandangan ulama hadis dan tasawuf dalam aspek penerimaan hadis yang memberikan kesannya terhadap amalan keagamaan masyarakat Islam, terutamanya di Alam Melayu.

  10. KOMPARASI PENDIDIKAN ISLAM K.H. AHMAD DAHLAN DAN MUHAMMAD FETHULLAH GÜLEN

    Directory of Open Access Journals (Sweden)

    Mohamad Ali

    2016-05-01

    Full Text Available Islamic education is considered only oriented to the hereafter alone, teach rituals and develop a defensive posture and formisme paradigm. On the other hand, Islamic education is faced with the phenomenon of discontinuity which marked the waning value of respect for the basic values and ethics, such as honesty, discipline, tolerance. This Problem is what ignited K.H. Ahmad Dahlan (1868-1923 and Muhammad Fethullah Gülen (1838 - ... strengthening Islamic education. This study aims to understand the concepts, practices, and comparative Islamic education K.H. Ahmad Dahlan and Muhammad Fethullah Gülen. This type of research is the study of literature  with historical and philosophical approach. The results show: first, the concept of Islamic education K.H. Ahmad Dahlan stressed intregration of religious sciences and the modern sciences, tolerance, open to modernity and perfection of mind (intellect; for Fethullah Gülen education is a manifestation of Allah, which emphasizes ethics, science, and theology. Secondly, the common the sharing concept between the two are at: ideas, foundation, educational goals and teaching methods. Third, while the point of difference lies in the educational materials, dormitory educational models (boarding school and implementing a system of moving class.

  11. Comparison of Patent Claim Construction between Netherlands and Germany on Basis of AGA v. Occlutech

    NARCIS (Netherlands)

    Tsoutsanis, A.; Kau, C.

    2013-01-01

    This article provides a brief overview on how the Dutch and German courts interpret the claims of a patent. It briefly compares each national approach on the basis of the recent AGA v Occlutech litigation in both countries. The dispute between AGA and Occlutech involved socalled ‘‘occluders’’, a

  12. Screening strategies for gestational diabetes mellitus at the Aga ...

    African Journals Online (AJOL)

    Background: Universal screening strategy for gestational diabetes mellitus offers biochemical screening to all women irrespective of risk factor status while selective strategy screens only those with risk factors. The Aga Khan University Hospital adopted a selective screening protocol by consensus. This study compares both ...

  13. Characterization of ALD grown TixAlyN and TixAlyC thin films

    Science.gov (United States)

    Kinnunen, S. A.; Malm, J.; Arstila, K.; Lahtinen, M.; Sajavaara, T.

    2017-09-01

    Atomic layer deposition (ALD) was used to grow TixAlyN and TixAlyC thin films using trimethylaluminum (TMA), titanium tetrachloride and ammonia as precursors. Deposition temperature was varied between 325 °C and 500 °C. Films were also annealed in vacuum and N2-atmosphere at 600-1000 °C. Wide range of characterization methods was used including time-of-flight elastic recoil detection analysis (ToF-ERDA), X-ray diffractometry (XRD), X-ray reflectometry (XRR), Raman spectroscopy, ellipsometry, helium ion microscopy (HIM), atomic force microscopy (AFM) and 4-point probe measurement for resistivity. Deposited films were roughly 100 nm thick and contained mainly desired elements. Carbon, chlorine and hydrogen were found to be the main impurities.

  14. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    Energy Technology Data Exchange (ETDEWEB)

    Ermolayev, Vladimir [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Cohrs, Christian M. [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Mohajerani, Pouyan; Ale, Angelique [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Hrabé de Angelis, Martin [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Ntziachristos, Vasilis, E-mail: v.ntziachristos@tum.de [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany)

    2013-03-08

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1{sup Aga2/+}, animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing.

  15. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    International Nuclear Information System (INIS)

    Ermolayev, Vladimir; Cohrs, Christian M.; Mohajerani, Pouyan; Ale, Angelique; Hrabé de Angelis, Martin; Ntziachristos, Vasilis

    2013-01-01

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1 Aga2/+ , animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing

  16. Enhancing the AliEn Web Service Authentication

    International Nuclear Information System (INIS)

    Zhu Jianlin; Zhou Daicui; Zhang Guoping; Saiz, Pablo; Carminati, Federico; Betev, Latchezar; Lorenzo, Patricia Mendez; Grigoras, Alina Gabriela; Grigoras, Costin; Furano, Fabrizio; Schreiner, Steffen; Datskova, Olga Vladimirovna; Banerjee, Subho Sankar

    2011-01-01

    Web Services are an XML based technology that allow applications to communicate with each other across disparate systems. Web Services are becoming the de facto standard that enable inter operability between heterogeneous processes and systems. AliEn2 is a grid environment based on web services. The AliEn2 services can be divided in three categories: Central services, deployed once per organization; Site services, deployed on each of the participating centers; Job Agents running on the worker nodes automatically. A security model to protect these services is essential for the whole system. Current implementations of web server, such as Apache, are not suitable to be used within the grid environment. Apache with the mod s sl and OpenSSL only supports the X.509 certificates. But in the grid environment, the common credential is the proxy certificate for the purpose of providing restricted proxy and delegation. An Authentication framework was taken for AliEn2 web services to add the ability to accept X.509 certificates and proxy certificates from client-side to Apache Web Server. The authentication framework could also allow the generation of access control policies to limit access to the AliEn2 web services.

  17. Nobel Peace Laureate Muhammad Yunus: A Banker Who Believes Credit is a Human Right

    Science.gov (United States)

    Szpara, Michelle Yvonne; Ahmad, Iftikhar; Pederson, Patricia Velde

    2007-01-01

    The article profiles Nobel Peace Laureate Muhammad Yunus, founder of Grameen Bank (an independent financial institution in Bangladesh), as well as an economics professor at the University of Chittagong. In his birthplace of Bangladesh, 49.8 percent of people exist below the poverty line, and 73.2 percent of the women are categorized as…

  18. BIMBINGAN KONSELING HOLISTIK UNTUK MEMBANTU PENYESUAIN DIRI MUALAF TIONGHOA MESJID MUHAMMAD CHENGHO PALEMBANG

    Directory of Open Access Journals (Sweden)

    Neni Noviza

    2015-12-01

    Full Text Available This study aims to determine how the adjustment itself on converts . Subjects were converts tionghoa mosque Muhammad Chengho Palembang. This study is a qualitative study with a phenomenological approach . Data were obtained and collected through semi-structured interviews and observations by using the interview guide and checklist list . Then , the data were analyzed using analysis of data reduction , display / presentation of data and making conclusions / verification of interactive models of Miles & Huberman ( 1992 . The results showed that the problems experienced by the Muslim convert Muhammad Cheng Ho Mosque is a matter of family , career and employment issues , and marginalized by other communities. The Individuals who have a religious conversion " more tasks " that adjust from changes in themselves and habits to obtain satisfactory relationships with other people and our environment . The problems associated with the present most fundamental change in the lives of converts after deciding to perform religious conversion requires the adjustment mainly in the habit of worship and in the family who did not convert to the faith of the subject . Holistic counseling through religious counseling and bibliotherapy approach is one way to help the adjustment to convert

  19. Algunas propuestas innovadoras de Muhammad Yunus para combatir la pobreza y otras carencias socioeconomicas

    OpenAIRE

    Rodr??guez S??nchez de Alva, Alfonso; Rodr??guez L??pez del R??o, Patricia; Rodr??guez L??pez del R??o, Pablo

    2013-01-01

    Aunque son numerosas las iniciativas innovadoras para financiar los programas de desarrollo de los pa??ses menos desarrollados (recargos sobre los billetes a??reos, tasa sobre las transacciones financieras, loter??a solidaria..), la gesti??n de los microcr??ditos por el Banco Grameen fundado por Muhammad Yunus, es probablemente la que ha tenido mayor difusi??n y aceptaci??n.

  20. Urinary tract infections at aga Khan University hospital nairobi - a ...

    African Journals Online (AJOL)

    2013-06-11

    Jun 11, 2013 ... (Uti) are normally treated empirically and urine culture is usual ordered for as a last ... symptomatic Uti in patients at aga Khan University hospital by looking at the trends of Uti ... in the context of pyelonephritis in pregnancy(9).

  1. An interview with Ali M. Ahad

    DEFF Research Database (Denmark)

    Zoppi, Marco

    2017-01-01

    , and on questions of migration and integration. He is the author of the book “Somali Oral Poetry and the Failed She-Camel Nation State: A Critical Discourse Analysis of the Deelley Poetry Debate (1979-1980)”, published in 2015. Ali is also an eminent voice of Italian post-colonial studies: his “I peccati storici...... del colonialismo” is a must-read for those interested in understanding the legacy of Italian colonialism in Somalia. Marco Zoppi has conducted this interview for WardheerNews.com, and wishes to thank Ali M. Ahad for his kind availability....

  2. Aga sellepärast, et on po... / Aleksandr Astrov

    Index Scriptorium Estoniae

    Astrov, Aleksandr

    2005-01-01

    Arutledes venekeelse valija hääletuskäitumise ümber juhib autor tähelepanu, et Eestis sätestab üks konkreetne seadus venelastele valimisõiguse, andes neile reaalse poliitilise jõu, teine aga piirab nende juurdepääsu ainult keele kaudu ligipääsetavatele eetikaressurssidele, mis võimaldaksid teha teadlikku valikut

  3. Physio-chemical evaluation and biological activity of Ajuga ...

    African Journals Online (AJOL)

    Physio-chemical evaluation and biological activity of Ajuga bracteosa wall and Viola odoroto Linn. Anwar Ali Shad, M. Zeeshan, Hina Fazal, Hamid Ullah Shah, Shabir Ahmed, Hasem Abeer, E. F. Abd_Allah, Riaz Ullah, Hamid Afridi, Akash tariq, Muhammad Adnan Asma ...

  4. AliEn - ALICE environment on the GRID

    International Nuclear Information System (INIS)

    Saiz, P.; Aphecetche, L.; Buncic, P.; Piskac, R.; Revsbech, J.-E.; Sego, V.

    2003-01-01

    AliEn (http://alien.cern.ch) (ALICE Environment) is a Grid framework built on top of the latest Internet standards for information exchange and authentication (SOAP, PKI) and common Open Source components. AliEn provides a virtual file catalogue that allows transparent access to distributed datasets and a number of collaborating Web services which implement the authentication, job execution, file transport, performance monitor and event logging. In the paper we will present the architecture and components of the system

  5. AliEn - ALICE environment on the GRID

    CERN Document Server

    Saiz, P; Buncic, P; Piskac, R; Revsbech, J E; Sego, V

    2003-01-01

    AliEn (http://alien.cern.ch) (ALICE Environment) is a Grid framework built on top of the latest Internet standards for information exchange and authentication (SOAP, PKI) and common Open Source components. AliEn provides a virtual file catalogue that allows transparent access to distributed datasets and a number of collaborating Web services which implement the authentication, job execution, file transport, performance monitor and event logging. In the paper we will present the architecture and components of the system.

  6. The Efforts of Arab Christians Modernist in Defending the Prophet Muhammad (pbuh

    Directory of Open Access Journals (Sweden)

    Ahmed H. Mekhelef

    2012-12-01

    Full Text Available This paper seeks to monitor the efforts of Arab Christians modernists, in respond to suspicious appellants in the biography of Prophet Muhammad (pbuh. Through researches in books and articles, it had been identified by studying books of writers who emerged in the 20th Century which had been known as the time of writings and researches development in the Arab world. Therefore, the Arab intellectuals began to review and respond what Orientalists have written about Islamic history.

  7. Association of Heme Oxygenase 1 with Lung Protection in Malaria-Associated ALI/ARDS.

    Science.gov (United States)

    Pereira, Marcelo L M; Ortolan, Luana S; Sercundes, Michelle K; Debone, Daniela; Murillo, Oscar; Lima, Flávia A; Marinho, Claudio R F; Epiphanio, Sabrina

    2016-01-01

    Malaria is a serious disease, caused by the parasite of the genus Plasmodium , which was responsible for 440,000 deaths in 2015. Acute lung injury/acute respiratory distress syndrome (ALI/ARDS) is one of the main clinical complications in severe malaria. The murine model DBA/2 reproduces the clinical signs of ALI/ARDS in humans, when infected with Plasmodium berghei ANKA. High levels of HO-1 were reported in cases of severe malaria. Our data indicated that the HO-1 mRNA and protein expression are increased in mice that develop malaria-associated ALI/ARDS (MA-ALI/ARDS). Additionally, the hemin, a HO-1 inducing drug, prevented mice from developing MA-ALI/ARDS when administered prior to the development of MA-ALI/ARDS in this model. Also, hemin treatment showed an amelioration of respiratory parameters in mice, high VEGF levels in the sera, and a decrease in vascular permeability in the lung, which are signs of ALI/ARDS. Therefore, the induction of HO-1 before the development of MA-ALI/ARDS could be protective. However, the increased expression of HO-1 on the onset of MA-ALI/ARDS development may represent an effort to revert the phenotype of this syndrome by the host. We therefore confirm that HO-1 inducing drugs could be used for prevention of MA-ALI/ARDS in humans.

  8. Muhammad Abduh Dan Ijtihadnya Dalam Bidang Pendidikan

    Directory of Open Access Journals (Sweden)

    Suhaimi Suhaimi

    2017-05-01

    Full Text Available Since the arrival of Napoleon Bonaparte to Egypt in the late 19th century AD, the Islamic world can be said to have been aware of the lag in many areas including in the field of education. Therefore, among the scholars at the same time Muslim intellectuals in the Islamic world when it started thinking to bounce back and catch up with the Islamic world experienced such a variety of ways that may be carried out according to the conditions at that time. Among them was Sheikh Muhammad Abduh. In the course of his life, Abduh has done ijtihad and renewal through the various ideas put forward ideas or even gets serious challenges from various parties, including the scholars of al-Azhar itself. But all of that does not make him despair and retreat, so that his ideas had a great influence for the next generation. Abduh brilliant ideas include the fields of education, legal, social, administrative, political and others. This article only focuses his discussion on his thoughts about education which would still be relevant to observe in order to be an afterthought for students of education in this country. Abduh's ideas include the following educational objectives, curriculum, methods and the importance of education for women. ABSTRAK Sejak kedatangan Napoleon Bonaparte ke Mesir pada akhir abad ke 19 Masehi, dunia Islam dapat dikatakan telah menyadari akan ketertinggalan di berbagai bidang termasuk di bidang pendidikan. Karena itu, di antara ulama sekaligus intelektual muslim di dunia Islam saat itu mulai berfikir untuk bangkit kembali serta mengejar ketertinggalan yang dialami dunia Islam tersebut dengan berbagai cara yang mungkin dilakukan sesuai kondisi saat itu. Di antara mereka adalah Syeikh Muhammad Abduh. Dalam perjalanan hidupnya, Abduh telah melakukan ijtihad dan pem-baharuannya melalui berbagai ide atau gagasan yang dikemukakannya sekalipun mendapat tantangan yang berat dari berbagai pihak termasuk pihak ulama al-Azhar sendiri. Akan tetapi semua

  9. Qalandar-name. Chapter 2. “Praise and blessing upon Muhammad Mustafa”

    Directory of Open Access Journals (Sweden)

    Milyausha Ismagilova

    2014-09-01

    Full Text Available The present fragment contains the translated continuation of a medieval poetic text “Qalandar-name” written by the Crimean Sufi author Abu Bakr Qalandar. This fragment contains the second chapter devoted to praising (Salawat the Prophet Muhammad, after which the poet will glorify his righteous caliphs (al-Khulafa al-rashidun. As it appears from the author’s praises, he was a follower of Sunni Islam and, at the same time, a representative of the Sufi order (tariqa. Titles and names that Abu Bakr Kalandar uses in his chanting of Muhammad, are very familiar both to researchers of the Islamic religion and ordinary Muslims. He calls the Prophet the Lord (Sayyid of both worlds, Elect, Light, Leader of all the prophets and saints. The author mentions some famous miracles of the Messenger of Allah, such as the night journey (Isra and ascension to the seventh heaven (Mi’raj, the moon’s splitting and inanimate objects’ speaking. He also makes an allusion to the mystical interpretation of the Qur’an in relation to the hair of the Prophet. The Persian text is translated by Milyausha Ismagilova, a postgraduate student. Translation edition and comments are supplied by Damir Shagaviyev, Head of the Department of History of Public Thought and Islamic Studies of the Sh.Marjani Institute of History, Academy of Sciences of the Republic of Tatarstan (Kazan. * Continuation of the article. See beginning of the article in: Golden Horde Review, 2014, no. 2(4, pp.243–252.

  10. Tropical Journal of Pharmaceutical Research - Vol 15, No 7 (2016)

    African Journals Online (AJOL)

    Antibacterial and cytotoxic properties of isoprenoids from the red sea soft coral, Lobophytum sp · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Khalid O Al-Footy, Walied M Alarif, Muhammad S Zubair, Mohamed A Ghandourah, Magda M Aly, 1431-1438.

  11. Hassan Aga and his Government in Algiers. The Consolidation of a Mediterranean Myth

    Directory of Open Access Journals (Sweden)

    Fernando FERNÁNDEZ LANZA

    2014-12-01

    Full Text Available This work tries to describe graphically the consolidation of a social myth in the unsettled Mediterranean of the 16th century, through a personage: the Spanish convert to Islam Hassan Aga (Azan Aga, the Sardinian renegade who succeeded Hayreddin Barbarrosa at the helms of Algiers from 1533 till his death ten years later. This was a period of intense activity, with the climax that came with the expedition of Charles to Algiers in 1541, whose spectacular defeat can be considered as the principal nucleus of the myth of this popular personage who as a Sardinian slave came to defeat the Emperor. A myth of social ascension with maquiavelical profiles of a new prince of the frontiers.

  12. Site Protection Program and Progress Report of Ali Observatory, Tibet

    Science.gov (United States)

    Yao, Yongqiang; Zhou, Yunhe; Wang, Xiaohua; He, Jun; Zhou, Shu

    2015-08-01

    The Ali observatory, Tibet, is a promising new site identified through ten year site survey over west China, and it is of significance to establish rules of site protection during site development. The site protection program is described with five aspects: site monitoring, technical support, local government support, specific organization, and public education. The long-term sky brightness monitoring is ready with site testing instruments and basic for light pollution measurement; the monitoring also includes directions of main light sources, providing periodical reports and suggestions for coordinating meetings. The technical supports with institutes and manufacturers help to publish lighting standards and replace light fixtures; the research pays special attention to the blue-rich sources, which impact the important application of high altitude sites. An official leading group towards development and protection of astronomical resources has been established by Ali government; one of its tasks is to issue regulations against light pollution, including special restrictions of airport, mine, and winter heating, and to supervise lighting inspection and rectification. A site protection office under the official group and local astronomical society are organized by Ali observatory; the office can coordinate in government levels and promote related activities. A specific website operated by the protection office releases activity propaganda, evaluation results, and technical comparison with other observatories. Both the site protection office and Ali observatory take responsibility for public education, including popular science lectures, light pollution and energy conservation education. Ali Night Sky Park has been constructed and opens in 2014, and provides a popular place and observational experience. The establishment of Ali Observatory and Night Sky Park brings unexpected social influence, and the starry sky trip to Ali becomes a new format of culture

  13. MPC and ALI: their basis and their comparison

    International Nuclear Information System (INIS)

    Kennedy, W.E. Jr.; Watson, E.C.

    1981-03-01

    Radiation protection regulations in the United States have evolved from the recommendations of the International Commission on Radiological Protection (ICRP) and the National Council on Radiation Protection and Measurements (NCRP). In 1959, the ICRP issued Publication 2 which contained specific recommendations on dose rate limits, permissible body burdens, metabolic data for radionuclides, and maximum permissible concentrations (MPC) in air or water. Over the next 20 years, new information became available concerning the effects of radiation, the uptake and retention of radionuclides, and the radioactive decay schemes of parent radionuclides. To include this newer information, the ICRP issued Publication 30 in 1978 to supersede Publication 2. One of the secondary limits defined in Publication 30 is the annual limit of intake (ALI). Radionuclide specific ALI values are intended to replace MPC values in determining whether or not ambient air and water concentrations are sufficiently low to maintain the dose to workers within accepted dose rate limits. In this paper, we discuss the derivation of MPC and ALI values, compare inhalation committed dose equivalent factors derived from ICRP Publications 2 and 30, and discuss the practical implications of using either MPC or ALI in determining compliance with occupational exposure limits. 6 references

  14. AGA: Interactive pipeline for reproducible gene expression and DNA methylation data analyses [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Michael Considine

    2015-10-01

    Full Text Available Automated Genomics Analysis (AGA is an interactive program to analyze high-throughput genomic data sets on a variety of platforms. An easy to use, point and click, guided pipeline is implemented to combine, define, and compare datasets, and customize their outputs. In contrast to other automated programs, AGA enables flexible selection of sample groups for comparison from complex sample annotations. Batch correction techniques are also included to further enable the combination of datasets from diverse studies in this comparison. AGA also allows users to save plots, tables and data, and log files containing key portions of the R script run for reproducible analyses. The link between the interface and R supports collaborative research, enabling advanced R users to extend preliminary analyses generated from bioinformatics novices.

  15. FOLLOWING THE PROPHET MUHAMMAD CHARACTER THROUGH NGABULEH TRADITION IN PONDOK PESANTREN DARUL ULUM BANYUANYAR PAMEKASAN

    Directory of Open Access Journals (Sweden)

    Moh. Wardi

    2018-06-01

    Full Text Available This research is part of the relevance of personality character of the Prophet Muhammad with the ngabuleh tradition in the theory of FAST (fathanah, amanah, siddiq, and tabligh. The purpose of this study is to find out and explain the ngabuleh tradition in religious, cultural, and economic reviews. The study is categorized in phenomenological research using qualitative approach. The data were obtained from observation, in-depth interview, and documentary study. It was then analyzed by data reduction, data presentation, and conclusion phase. Informant in this study is kabuleh in Pondok Pesantren Darul Ulum at Banyuanyar District, Pamekasan Regency. The results show that,in the view of religion ngabuleh is the implementation of Islamic values about following the character of the Prophet Muhammad and sincerity. Culturally, as a form of adherence of high respect to the pillars of culture in Madura, namely bhuppa’-bhabhu’-ghuru-rato (father, mother, teacher/kiai and queen/government. Economical-wise, ngabuleh is a kind of paying respect to the kiai by working in the corporate run by kiai/Pesantren and at once, contributing santri’s skill and competence in the field of entrepreneur. Penelitian ini merupakan bagian dari relevansi karakter kepribadian Nabi Muhammad dengan tradisi kabuleh dalam teori FAST (fathanah, amanah, siddiq, and tabligh. Tujuan penelitian ini adalah untuk mengetahui dan menjelaskan tradisi ngabuleh dalam tinjauan agama, budaya, dan ekonomi. Metode yang digunakan dalam penelitian ini adalah kualitatif dengan jenis penelitian fenomenologis. Data diperoleh dari hasil observasi berperan serta, wawancara mendalam, dan studi dokumentasi. Analisis data dilakukan dengan reduksi data, penyajian data, dan tahap kesimpulan. Informan dalam penelitian ini kabuleh di Pesantren Darul Ulum Banyuanyar Pamekasan. Hasil penelitian menunjukan bahwa, secara agama, ngabuleh merupakan implementasi nila-nilai ajaran Islam tentang keteladanan sifat

  16. 15-00115_SI_NP.doc

    Indian Academy of Sciences (India)

    SAID TIGHADOUINI1, SMAAIL RADI*,1, LOIC TOUPET2, MUHAMMAD SIRAJUDDIN*,3, TAIBI BEN HADDA*,4, MEHMET AKKURT5, ISMAIL WARAD6, YAHIA MABKHOT7 and SAQIB ALI8. 1LCAE, Département de Chimie, Faculté des Sciences, Université Mohammed Premier, Oujda 60000, Morocco. 2Institut de Physique ...

  17. Browse Title Index

    African Journals Online (AJOL)

    Items 901 - 950 of 1250 ... ... No 2 (2016), Physio-chemical evaluation and biological activity of Ajuga bracteosa wall and Viola odoroto Linn, Abstract PDF. Anwar Ali Shad, M. Zeeshan, Hina Fazal, Hamid Ullah Shah, Shabir Ahmed, Hasem Abeer, E. F. Abd_Allah, Riaz Ullah, Hamid Afridi, Akash tariq, Muhammad Adnan Asma.

  18. High-frequency oscillatory ventilation in ALI/ARDS.

    Science.gov (United States)

    Ali, Sammy; Ferguson, Niall D

    2011-07-01

    In the last 2 decades, our goals for mechanical ventilatory support in patients with acute respiratory distress syndrome (ARDS) or acute lung injury (ALI) have changed dramatically. Several randomized controlled trials have built on a substantial body of preclinical work to demonstrate that the way in which we employ mechanical ventilation has an impact on important patient outcomes. Avoiding ventilator-induced lung injury (VILI) is now a major focus when clinicians are considering which ventilatory strategy to employ in patients with ALI/ARDS. Physicians are searching for methods that may further limit VILI, while still achieving adequate gas exchange. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Infrared dim small target segmentation method based on ALI-PCNN model

    Science.gov (United States)

    Zhao, Shangnan; Song, Yong; Zhao, Yufei; Li, Yun; Li, Xu; Jiang, Yurong; Li, Lin

    2017-10-01

    Pulse Coupled Neural Network (PCNN) is improved by Adaptive Lateral Inhibition (ALI), while a method of infrared (IR) dim small target segmentation based on ALI-PCNN model is proposed in this paper. Firstly, the feeding input signal is modulated by lateral inhibition network to suppress background. Then, the linking input is modulated by ALI, and linking weight matrix is generated adaptively by calculating ALI coefficient of each pixel. Finally, the binary image is generated through the nonlinear modulation and the pulse generator in PCNN. The experimental results show that the segmentation effect as well as the values of contrast across region and uniformity across region of the proposed method are better than the OTSU method, maximum entropy method, the methods based on conventional PCNN and visual attention, and the proposed method has excellent performance in extracting IR dim small target from complex background.

  20. Dynamic virtual AliEn Grid sites on Nimbus with CernVM

    International Nuclear Information System (INIS)

    Harutyunyan, A; Buncic, P; Freeman, T; Keahey, K

    2010-01-01

    We describe the work on enabling one click deployment of Grid sites of AliEn Grid framework on the Nimbus 'science cloud' at the University of Chicago. The integration of computing resources of the cloud with the resource pool of AliEn Grid is achieved by leveraging two mechanisms: the Nimbus Context Broker developed at Argonne National Laboratory and the University of Chicago, and CernVM - a baseline virtual software appliance for LHC experiments developed at CERN. Two approaches of dynamic virtual AliEn Grid site deployment are presented.

  1. Ali, Dr Moizuddin Abdul Salim

    Indian Academy of Sciences (India)

    ... Section: Animal Sciences. Ali, Dr Moizuddin Abdul Salim D.Sc. (Andhra), D.Sc. (h.c.), FNA. Date of birth: 12 November 1896. Date of death: 20 June 1987. Specialization: Ecology, Zoogeography, Nature Conservation, Ornithology Last known address: No. 46, Pali Hill, Bombay 400 050. YouTube; Twitter; Facebook; Blog ...

  2. KONFLIK LINGKUNGAN DI KAMPUNG AGAS, TANJUNG UMA, BATAM (Environmental Conflict in Kampung Agas, Tanjung Uma, Batam

    Directory of Open Access Journals (Sweden)

    Saprial Saprial

    2004-11-01

    Full Text Available ABSTRAK Perkembangan kota Batam sebagai kawasan industri, perdagangan, pelabuhan, dan pariwisata, membawa tidak saja dampak positip, melainkan juga dampak negatif. Salah satu dampak negatif yang muncul adalah konffik lingkungan dalam bentuk pencemaran air di sungai Jodoh yang menganggu pemukiman liar di Kampung Agas, Tanjung Uma. Penelitian ini bertujuan untuk mengkaji akar masalah konflik dan resolusinya. Penelitian ini merupakan studi deskriptif-kualitatip, dengan data yang dikumpulkan melalui wawancara mendalam dengan pihak-pihak yang terlibat dalam konflik. Penelitian ini menemukan bahwa akar masalah konffik adalah konflik spasial antara permukiman liar dan pembangunan ruko yang menimbulkan limbah di sekitar permukiman liar. Tidak dibangunnya IPAL memicu protes warga di permukiman liar dan terjadilah konflik. Penelitian ini melihat bahwa penyelesaian konflik dalam bentuk kompensasi atau “sagu hati" tidak menyelesaikan akar masalah konflik. Walaupun begitu, penyelesaian ini dipandang oleh pihak-pihak yang berkonflik sebagai hasil mufakat yang dimungkinkan untuk menghindari konflik sosial yang lebih besar. Penelitian ini juga menemukan bahwa bentuk penyelesaian konflik melalui musyawarah dan mufakat dapat dilakukan secara efektif sejauh ada mediator yang dipercaya oleh pihak-pihak yang bersengketa.   ABSTRACT The development of Batam City as an area for industry, trade, ship transit, and tourism activities brings not only positive impacts, but negative impact as well. One of the negative impacts is environmental conflict in the form of water pollution in Sei Jodoh downstream which affected informal settlement in Kampung Agas, Tanjung Uma. This research aimed to study the roots of the conflict and evaluated the resolution. It adopted a descriptive, qualitative research method. Data were collected through in-depth interviews with parties involved in the conflict. The research founded that the root causes of the environmental conflict was the

  3. The final story on the ALA3/ALIS1 complex

    DEFF Research Database (Denmark)

    Lopez Marques, Rosa Laura

    The final story on the ALA3/ALIS1 complex. Lisbeth R. Poulsena, Rosa L. López-Marquésa, Alexander Schultza, Stephen C. McDowellb, Juha Okkeric, Dirk Lichtc, Thomas Pomorskic,  Jeffrey F. Harperb, and Michael G. Palmgrena,1 aCentre for Membrane Pumps in Cells and Disease - PUMPKIN, Danish National......).              Through a database search we have previously identified five Cdc50p/Lem3p homologues in Arabidopsis (ALIS1-5 for ALA Interacting Subunit)..We investigated the capacity of ALA3, alone and in combination with expressed ALIS proteins, to functionally complement a battery of yeast mutants carrying deletions...... in endogenous P4-ATPases. Our results indicated that ALIS1 functions as a true ß-subunit for the Arabidopsis putative flippase ALA3, being required for ATP-dependent phospholipid transport and for genetic complementation of the yeast P4-ATPase gene Drs2, which is involved in vesicle budding from the late Golgi...

  4. Pemikiran Suksesi Dalam Politik Islam Masa Pra Modern

    Directory of Open Access Journals (Sweden)

    Mazro'atus Sa'adah

    2016-12-01

    Abstrak: Pemikiran politik Islam muncul setelah Islam melalui Nabi Muhammad SAW berhasil membentuk sebuah ummat baru, dari peralihan kekuasaan kerajaan/kesukuan kepada Nabi yang kemudian kepada umat. Nabi Muhammad dinilai berhasil dalam mengatur komunitas barunya yang dikendalikan oleh ajarannya dalam seluruh lini kehidupan. Persoalan muncul kemudian setelah beliau wafat, yang akhirnya memunculkan pemikiran tentang suksesi. Artikel ini akan membahas tentang mengapa terjadi suksesi setelah Nabi Muhammad SAW wafat, bagaimana pemikiran para tokoh politik Islam masa pra modern terkait dengan suksesi, dan apa kontribusi pemikiran suksesi ini terhadap politik Islam di Indonesia. Dengan menggunakan pendekatan sejarah, ditemukan bahwa Nabi Muhammad tidak menetapkan siapa yang akan menggantikannya, dan ketika beliau wafat (632 M, para sahabat memilih seorang pemimpin (imam/khalifah. Masa pemerintahan Abu Bakar, Umar dan Usman banyak terjadi perselisihan yang awalnya terkait kepentingan agama namun berkembang menjadi kepentingan politik. Ketika Ali bin Abi Talib diangkat sebagai khalifah, konflik politik berkepanjangan berkaitan dengan pembunuhan Usman, menjadikan timbulnya perang jamal antara Aisyah dan Ali. Pada masa ini perbedaan kepentingan aqidah dipolitisir lebih jauh menjadi sebuah kepentingan politik. Dinamika politik ini kemudian melahirkan mazhab politik Islam klasik yang terbagi dalam tiga mazhab besar yaitu Sunni, Syi'ah dan Khawarij, yang darinya muncul istilah-istilah khilafah, imamah, ahlul halli wal aqdi, bay’ah, walayah dan lain-lain. Dari ketiga mazhab politik ini, kemudian muncul ide pemikiran politik Islam yang sangat kompleks dan berkepanjangan dari para tokoh politik Islam pra modern yang banyak dipengaruhi oleh filosof Yunani. Di Indonesia, pemikiran suksesi dalam politik Islam masa pra modern ini pernah diwacanakan. Namun untuk pemilihan kepala Negara belum terealisasi mengingat Indonesia bukan Negara Islam.

  5. AGA answers complaints on burner tip prices

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This paper reports that the American Gas Association has rebutted complaints that natural gas prices have dropped at the wellhead but not at the burner tip. AGA Pres. Mike Baly the an association study of the issue found that all classes of customers paid less for gas in 1991 than they did in 1984, when gas prices were at their peak. He the, the study also shows that 100% of the wellhead price decline has been passed through to natural gas consumers in the form of lower retail prices. Baly the the average cost of gas delivered to all customers classes fell by $1.12/Mcf from 1984 to 1991, which exceeds the $1.10/Mcf decline in average wellhead prices during the same period

  6. [Research on blood distribution of Tibetan population in Ali area].

    Science.gov (United States)

    Liu, X X; Li, D D; Li, H L; Hou, L A; Liu, Z J; Yang, H Y; Qiu, L

    2017-12-12

    Objective: To explore the distribution of ABO blood group in the healthy population in the Ali area of Tibet, and to analyze the difference of blood group distribution between the Tibetan population in Ali and the Tibet Tibetan population. Methods: The blood distribution of 509 apparent healthy volunteers of Tueti County and Gal County, Tibet, which were randomly selected from September to November in 2016; 137 Tibetan blood donors, from 2016 September to2017 July and 84 Tibetan blood donors from 2015 August to 2017 July was analyzed retrospectively. The blood type was tested by the slide method. By reviewing the Chinese and foreign language database, seven articles on Tibetan blood group distribution were obtained. And the data of the blood distribution of the Ali area population and the Tibet Tibetan population were compared. Results: The ABO phenotype frequencies of 507 apparent healthy people, 137 blood donors and 84 recipients were B>O>A>AB. The composition ratio were 36.1%, 34.5%, 21.5 %, 7.9%; 40.1%, 35.0%, 17.5%, 7.3%; 39.3%, 34.5%, 20.2%, 6.0%.There was no statistically significant difference in blood group distribution between the donors and the recipients ( P >0.05). And there was no significant difference in the blood group distribution between Ali and Shigatse, Nagqu, Lhasa, Shannan. However, the differences between Ali and Qamdo, Nyingchi areas were statistically significant. Conclusion: The geographical position of the blood from the west to east, B type shows a downward trend, O type blood composition ratio shows an upward trend.

  7. Ground-based multi-station spectroscopic imaging with ALIS. - Scientific highlights, project status and future prospects

    Science.gov (United States)

    Brändström; Gustavsson, Björn; Pellinen-Wannberg, Asta; Sandahl, Ingrid; Sergienko, Tima; Steen, Ake

    2005-08-01

    The Auroral Large Imaging System (ALIS) was first proposed at the ESA-PAC meeting in Lahnstein 1989. The first spectroscopic imaging station was operational in 1994, and since then up to six stations have been in simultaneous operation. Each station has a scientific-grade CCD-detector and a filter-wheel for narrow-band interference-filters with six positions. The field-of-view is around 70°. Each imager is mounted in a positioning system, enabling imaging of a common volume from several sites. This enables triangulation and tomography. Raw data from ALIS is freely available at ("http://alis.irf.se") and ALIS is open for scientific colaboration. ALIS made the first unambiguous observations of Radio-induced optical emissions at high latitudes, and the detection of water in a Leonid meteor-trail. Both rockets and satellite coordination are considered for future observations with ALIS.

  8. QADIYAH AL-ISTI'BAD FI SYI'R MUHAMMAD AL-FAYTURI

    Directory of Open Access Journals (Sweden)

    Zamri Arifin

    2017-08-01

    Full Text Available The issue of slavery is one of the most important issues that have plagued mankind, both ancient and modern. The contemporary Arab poet Muhammad Miftah al-Fittouri was the first Arab poet to address this issue and to discuss the issues of African and Zenism in a qualitative and quantitative manner. Therefore, this study is aimed at presenting the efforts of the scholars of this issue in the poetry of this poet. The study revealed the intersections of the poetry with the components and manifestations of the issue of (slavery and the different poetic stages, as demonstrated by the poet's poetic. The research concluded that the literary and monetary field lacked a systematic study of this issue, revealing its motives and artistic manifestations, and the various aspects of it emerge according to a modern scientific method.

  9. Implications of the ICRP draft recommendations for ALIs

    International Nuclear Information System (INIS)

    Stather, J.W.; Kendall, G.M.; Phipps, A.W.

    1990-01-01

    The results of the calculations summarised here suggest that under the new scheme for calculating annual limits on intake proposed by ICRP there may still be a need for an organ dose limit. This would lose one of the main advantages of the new scheme, namely that ALIs could be strictly additive. Adjusting the weighting factors and allocating the 'remainder' to possibly two tissues with the highest doses would result in effectances from different radionuclides which were not strictly additive. If, however, for practical purposes effectance could be taken to be additive, then the resulting ALIs could be apportioned between different radionuclides as desired. (author)

  10. AliBaba: PubMed as a graph.

    Science.gov (United States)

    Plake, Conrad; Schiemann, Torsten; Pankalla, Marcus; Hakenberg, Jörg; Leser, Ulf

    2006-10-01

    The biomedical literature contains a wealth of information on associations between many different types of objects, such as protein-protein interactions, gene-disease associations and subcellular locations of proteins. When searching such information using conventional search engines, e.g. PubMed, users see the data only one-abstract at a time and 'hidden' in natural language text. AliBaba is an interactive tool for graphical summarization of search results. It parses the set of abstracts that fit a PubMed query and presents extracted information on biomedical objects and their relationships as a graphical network. AliBaba extracts associations between cells, diseases, drugs, proteins, species and tissues. Several filter options allow for a more focused search. Thus, researchers can grasp complex networks described in various articles at a glance. http://alibaba.informatik.hu-berlin.de/

  11. [Advance on human umbilical cord mesenchymal stem cells for treatment of ALI in severe burns].

    Science.gov (United States)

    Wang, Yu; Hu, Xiaohong

    2017-01-01

    Severe burn is often accompanied by multiple organ damage. Acute lung injury (ALI) is one of the most common complications, and often occurs in the early stage of severe burns. If it is not treated in time, it will progress to acute respiratory distress syndrome (ARDS), which will be a serious threat to the lives of patients. At present, the treatment of ALI in patients with severe burn is still remained in some common ways, such as the liquid resuscitation, the primary wound treatment, ventilation support, and anti-infection. In recently, human umbilical cord mesenchymal stem cells (hUCMSCs) have been found having some good effects on ALI caused by various causes, but few reports on the efficacy of ALI caused by severe burns were reported. By reviewing the mechanism of stem cell therapy for ALI, therapeutic potential of hUCMSCs in the treatment of severe burns with ALI and a new approach for clinical treatment was provided.

  12. Neutrophil extracellular traps contribute to the pathogenesis of acid-aspiration-induced ALI/ARDS.

    Science.gov (United States)

    Li, Haitao; Zhou, Xiaoting; Tan, Hongyi; Hu, Yongbin; Zhang, Lemeng; Liu, Shuai; Dai, Minhui; Li, Yi; Li, Qian; Mao, Zhi; Pan, Pinhua; Su, Xiaoli; Hu, Chengpin

    2018-01-05

    Acute lung injury/acute respiratory distress syndrome (ALI/ARDS) is a manifestation of systemic inflammation in the lungs, but the factors that trigger inflammation in ALI/ARDS are unclear. We hypothesized that neutrophil extracellular traps (NETs) contribute to the pathogenesis of acid aspiration-induced ALI/ARDS. Analysis of bronchial aspirates from ARDS patients showed that NETs were significantly correlated with the degree of ARDS (r = -0.5846, p = 0.0359). NETs in bronchoalveolar lavage fluid of acid-aspiration mice were significantly higher (141.6 ± 23.08) at 3 h after injury than those in the sham group (1234 ± 101.9; p = 0.003, n = 5 per group). Exogenous NETs aggravated lung injury, while alvelestat and DNase markedly attenuated the intensity of ARDS. We investigated whether NETs are involved in the severity of gastric aspiration-induced ARDS. Then, a hydrochloric acid aspiration-induced ALI murine model was used to assess whether NETs are pathogenic and whether targeting NETs is protective. Exogenous NETs were administered to mice. Alvelestat can inhibit neutrophil elastase (NE), which serves an important role in NET formation, so we investigated whether alvelestat could protect against ALI in cell and mouse models. NETs may contribute to ALI/ARDS by promoting tissue damage and systemic inflammation. Targeting NETs by alvelestat may be a potential therapeutic strategy.

  13. Cross calibration of the Landsat-7 ETM+ and EO-1 ALI sensor

    Science.gov (United States)

    Chander, G.; Meyer, D.J.; Helder, D.L.

    2004-01-01

    As part of the Earth Observer 1 (EO-1) Mission, the Advanced Land Imager (ALI) demonstrates a potential technological direction for Landsat Data Continuity Missions. To evaluate ALI's capabilities in this role, a cross-calibration methodology has been developed using image pairs from the Landsat-7 (L7) Enhanced Thematic Mapper Plus (ETM+) and EO-1 (ALI) to verify the radiometric calibration of ALI with respect to the well-calibrated L7 ETM+ sensor. Results have been obtained using two different approaches. The first approach involves calibration of nearly simultaneous surface observations based on image statistics from areas observed simultaneously by the two sensors. The second approach uses vicarious calibration techniques to compare the predicted top-of-atmosphere radiance derived from ground reference data collected during the overpass to the measured radiance obtained from the sensor. The results indicate that the relative sensor chip assemblies gains agree with the ETM+ visible and near-infrared bands to within 2% and the shortwave infrared bands to within 4%.

  14. MASJID JAMI PITI LAKSAMANA MUHAMMAD CHENG HO PURBALINGGA: SIMBOL KEINDAHAN TOLERANSI DALAM AKULTURASI

    Directory of Open Access Journals (Sweden)

    Dinda Wulan Afriani

    2015-10-01

    terletak di Kabupaten Purbalingga, Jawa Tengah. Masjid Laksamana Muhammad Cheng Ho Purbalingga merupakan salah satu dari tiga masjid Cheng Ho di Indonesia. Kehadiran masjid ini merupakan wujud simbol keindahan toleransi antar etnis dan budaya dalam sebuah akulturasi. Bentuk arsitektur masjid ini merupakan perpaduan dari budaya Islam- Tiongkok-Arab-Jawa. Keistimewaan masjid ini bukan hanya terletak pada bentuk arsitektur bangunan dan ragam hias arsitekturnya saja. Namun juga pada keindahan makna dan nilai falsafah kehidupan yang terkandung di dalamnya, yang tentu saja selaras dengan peran sertanya dalam masyarakat. Dalam membaca tanda dan makna, artikel ini juga menyajikan penalaran melalui metode semiotika visual secara singkat namun cukup padat.

  15. Pemikiran Ali Syari’ati dalam Sosiologi (Dari Teologi Menuju Revolusi

    Directory of Open Access Journals (Sweden)

    Faiq Tobroni

    2016-09-01

    Full Text Available Ali Syari’ati is muslim brilliant philosopher, graduated from doctoral of Sorbonne France. He created social teology perspective, based from his experience in west sociology perspective about Capitalism or Marxism. He succeed seek the Capitalism and Marxism weaknes if this perspective is used in Muslim Society. He mapping structure of society, insist of: Habil and Qobail. Habil is common people in society, Qabil is high class, likes: prince, aristocrats or capital owner. Qabil was repressedHabil trough social, politic, economy and religious system. This tragedy happen in Iran whenSyah Reza rezim. The consequences, Ali Syari’ati propagandist rebellion Habil to Qabil. Because of his activities, he to be prisoner one more time, then he is going abroad, until he pass away in England (with suspicious that he killed by Syah Reza people. The Iran Revolution happen, after 2 years Ali Syaria’ti pass away

  16. Ali Emirî'nin Osmanlı Tarih ve Edebiyat Mecmuası Ali Emiri's Ottoman History And Literature Periodicals

    Directory of Open Access Journals (Sweden)

    Seher ERDOĞAN ÇELTİK

    2013-03-01

    Full Text Available Periodicals are the documents which constitute resources for ourhistory. A kind of literary atmosphere forms around the magazines;feuilleton novel, story, poetry, critics and similar literary works cometogether with the reader via these magazines. Founder of the PublicLibrary, Ali Emirî published two literary periodicals named OttomanHistory and Literature and History and Literature which are thesuccessor to each other. Totally comprising of 36 issues, the first ispublished as 31 and the latter is published as 5 issues. During theirpublication years, the periodical constituted highly literary atmosphereand this atmosphere undertook an encoring mission in youth’s literaryworks.In this study, these periodicals are introduced and theircontributions to our literary and cultural life are mentioned.First of all Ali Emirî published Ottoman History and Literatureand History and Literature with the aim of being useful for his countryand nation. Later he aimed to illuminate the information/sources ofabout Ottoman history and literature and correct document mistakes.He also wanted to replay to the works that were published as anopposition for him through the magazine and, including Mehmet FuatKöprülü he criticized many other people and institutions.Ali Emiri introduces Divanu Lügati't-Türk to Turkish world. Hewho travelled a lot because of his occupation and thus he continuouslycollected new information and documents. As he enlarged Emirisometimes introduced this information to the readers. Ettik şeref-i hizmet-i ecdâdı ferâmûşÂsârına eslâfımızın rağbet olunmazBir gün bilinir kıymeti mecmûamın ammâPek çok aranır ortada mecmûa bulunmazSüreli yayınlar, edebiyat tarihimize kaynaklık eden dokümanlardandır. Dergiler çevresinde genelde edebî bir muhit oluşur; tefrika roman, hikâye, şiir, tenkit ve benzeri gibi edebî ürünler onlar vasıtasıyla okuyucusuyla buluşur. Millet Kütüphanesinin kurucusu olan Ali Emir

  17. "Parim" on subjektiivne, aga kõhutundest ka ei piisa / Inga Kuusik

    Index Scriptorium Estoniae

    Kuusik, Inga, 1961-

    2007-01-01

    Ilmunud ka: Finansovõi Menedzhment : infovõpusk nr. 13 apr. lk. 6-7. Saku Õlletehase uus finantsjuht oma tööst tubakatootja Imperial Tobacco Grupi Kesk-Aasia regiooni finantsdirektorina Kõrgõzstanis, Saku Õlletehase kapitali struktuurist, finantsdirektori rollist ettevõttes ja tööjõu värbamisest Saku Õlletehases. Lisad: Saku Õlletehas 2006: mõõdukas käibe-, aga suur kasumikasv; Tabel: Saku Õlletehase dividendimaksed 1997-2007

  18. ANALISIS KINERJA KEUANGAN PERUSAHAAN PT. ASURANSI JIWASRAYA (PERSERO) CABANG SULAWESI SELATAN

    OpenAIRE

    ARIANTY, ASTRI

    2012-01-01

    ANALISIS KINERJA KEUANGAN PERUSAHAAN PT. ASURANSI JIWASRAYA (PERSERO) CABANG SULAWESI SELATAN COMPANY FINANCIAL PERFORMANCE ANALYSIS PT. INSURANCE JIWASRAYA (LIMITED) SOUTH BRANCH SULAWESI Astri Arianty Prof. Dr. H. Muhammad Ali, SE., M.S Drs. Armayah Sida, M.Si Analisis terhadap kinerja keuangan perusahaan sangat penting dilakukan untuk mengetahui sejauh mana tingkat pencapaian yang telah diperoleh perusahaan sebagaimana tujuan perusahaan dalam menjalankan proses produk...

  19. Winning the Strategic Narrative in the Israeli-Palestinian Protracted Conflict

    Science.gov (United States)

    2012-12-01

    Introduction to Islamic Theology and Law (Princeton, NJ: Princeton University Press, 1981), Translated from the German, Vorlesungen uber den Islam...University Press, 1981), Translated from the German, Vorlesungen uber den Islam (Heidelberg, 1910), 3–30; Maulana Muhammad Ali, The Holy Qur’an (Dublin...Nabi, “Exporing the Framing Effects of Emotion: Do Discrete Emotions Differentially Influence Information Accessibility, Information Seeking, and Policy

  20. Browse Title Index

    African Journals Online (AJOL)

    Items 101 - 117 of 117 ... FO Olatunji, UF Ibrahim, N Muhammad, AA Msheliza, BB Akku, UY Ibrahim, BT Rano, M Maigoro, MU Ali. Vol 25, No 2 (2011), The use of Anti-Retroviral drugs in the Prevention of Mother to Child Transmission (PMTCT) of HIV, Abstract. KP Manji, MP Manji, FG Sheriff. Vol 25, No 1 (2011), The vital role ...

  1. 76 FR 62494 - Designation of Ibrahim `Awwad Ibrahim `Ali al-Badri, Also Known as Dr. Ibrahim `Awwad Ibrahim...

    Science.gov (United States)

    2011-10-07

    ... DEPARTMENT OF STATE [Public Notice 7638] Designation of Ibrahim `Awwad Ibrahim `Ali al-Badri, Also Known as Dr. Ibrahim `Awwad Ibrahim `Ali al-Badri, Also Known as Ibrahim `Awad Ibrahim al-Badri al... individual known as Ibrahim `Awwad Ibrahim `Ali al-Badri, also known as Dr. Ibrahim `Awwad Ibrahim `Ali al...

  2. Cardiopulmonary dysfunction in the Osteogenesis imperfecta mouse model Aga2 and human patients are caused by bone-independent mechanisms.

    Science.gov (United States)

    Thiele, Frank; Cohrs, Christian M; Flor, Armando; Lisse, Thomas S; Przemeck, Gerhard K H; Horsch, Marion; Schrewe, Anja; Gailus-Durner, Valerie; Ivandic, Boris; Katus, Hugo A; Wurst, Wolfgang; Reisenberg, Catherine; Chaney, Hollis; Fuchs, Helmut; Hans, Wolfgang; Beckers, Johannes; Marini, Joan C; Hrabé de Angelis, Martin

    2012-08-15

    Osteogenesis imperfecta (OI) is an inherited connective tissue disorder with skeletal dysplasia of varying severity, predominantly caused by mutations in the collagen I genes (COL1A1/COL1A2). Extraskeletal findings such as cardiac and pulmonary complications are generally considered to be significant secondary features. Aga2, a murine model for human OI, was systemically analyzed in the German Mouse Clinic by means of in vivo and in vitro examinations of the cardiopulmonary system, to identify novel mechanisms accounting for perinatal lethality. Pulmonary and, especially, cardiac fibroblast of perinatal lethal Aga2/+ animals display a strong down-regulation of Col1a1 transcripts in vivo and in vitro, resulting in a loss of extracellular matrix integrity. In addition, dysregulated gene expression of Nppa, different types of collagen and Agt in heart and lung tissue support a bone-independent vicious cycle of heart dysfunction, including hypertrophy, loss of myocardial matrix integrity, pulmonary hypertension, pneumonia and hypoxia leading to death in Aga2. These murine findings are corroborated by a pediatric OI cohort study, displaying significant progressive decline in pulmonary function and restrictive pulmonary disease independent of scoliosis. Most participants show mild cardiac valvular regurgitation, independent of pulmonary and skeletal findings. Data obtained from human OI patients and the mouse model Aga2 provide novel evidence for primary effects of type I collagen mutations on the heart and lung. The findings will have potential benefits of anticipatory clinical exams and early intervention in OI patients.

  3. 76 FR 11756 - Action Affecting Export Privileges; Ali Amirnazmi; Order Denying Export Privileges

    Science.gov (United States)

    2011-03-03

    ... DEPARTMENT OF COMMERCE Bureau of Industry and Security Action Affecting Export Privileges; Ali Amirnazmi; Order Denying Export Privileges In the Matter of: Ali Amirnazmi, Register 63302-066, FCI... release and forfeit $81,277.37. Section 766.25 of the Export Administration Regulations (``EAR'' or...

  4. Studying the potential role of ALIS proteins on the functionality of ALA2

    DEFF Research Database (Denmark)

    Lopez Marques, Rosa Laura; Poulsen, Lisbeth Rosager; Meffert, Katharina

    ). Recently we have identified five Cdc50p homologues in Arabidopsis [ALA Interacting Subunit (ALIS) 1 to 5] (1), and demonstrated that these ß-subunits are essential for the functioning of ALA3. We are currently working on a third Arabidopsis P4-ATPase isoform, ALA2. We have shown that this isoform...... is involved in specific translocation of phosphatidylserine analogues. Furthermore, we have found evidence that the substrate specificity is independent of the ß-subunit interacting with this P4-ATPase. ALA2 in combination with ALIS genes complement both the cold and the metal sensitive phenotype caused...... by lack of DRS2 in yeast. Tissue specific expression patterns of ALA2 and ALIS genes indicate that different ALIS isoforms may interact with ALA2 in diverse parts of the plant. At present we are studying the subcellular localization of ALA2 in planta in order to understand better its possible...

  5. La Ode Muhammad Idrus Qaimuddin Sastrawan Sufi Ternama di Buton Abad XIX

    Directory of Open Access Journals (Sweden)

    La Niampe

    2012-11-01

    Full Text Available This article talk about the characterization of La Ode Muhammad Idrus Qaimuddin as a popular mystical in Buton in XIX century. Among the mystical characters at his period, he known as a productive writer. His works in mysticism side was written in some languages (Wolio language, Malay, and Arabic. On of his popular poem entitled "Bula Malino" its content is about seeing which directed to him self. According to him, loving and teaching him self is a main need in the human life, so he clarified through his poem motuyaapa kaasina miya yitu, yinda molawana kaasimu yikaromu, moo sarowu guru Bemo yadariko yinda molawana yoda-yadari karomu. However people love us, it is still better loving ourselves, even though a thousand teachers who teach us, it is better we teach ourselves.

  6. Syed Mahmood Naqvi (27 August 1941 - 04 September 2009)

    Digital Repository Service at National Institute of Oceanography (India)

    Naqvi, S.W.A.; Rao, Y.J.B.

    -1 SYED MAHMOOD NAQVI (1941-2009) Elected Fellow 1986 LIFE, EDUCATION AND FAMILY Being a descendent of Prophet Muhammad's daughter Syeda (hence the title 'Syed') through the 10 lh Shia Imam Ali Naqi (hence the surname 'Naqvi'). Mahmood's roots into science... living, something that he was not used to. He was only moderately educated. However, both he and his father wanted Bhni to obtain ...

  7. ALI--A Digital Archive of DAISY Books

    Science.gov (United States)

    Forsberg, Asa

    2007-01-01

    ALI is a project to develop an archive for talking books produced by the Swedish universities. The universities produce talking books from the mandatory literature for students with reading disabilities, including mostly journal articles, book chapters and texts written by teachers. The project group consists of librarians and co-ordinators for…

  8. Ab-initio study of phase stability, elastic and thermodynamic properties of AlY alloy under pressure

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Dawei [College of Physics and Electronic Engineering, Nanyang Normal University, Nanyang 473061 (China); Su, Taichao [Institute of Materials Science and Engineering, Henan Polytechnic University, Jiaozuo 454000 (China); Song, Haizhen; Lu, Cheng; Zhong, Zhiguo; Lu, Zhiwen [College of Physics and Electronic Engineering, Nanyang Normal University, Nanyang 473061 (China); Pu, Chunying, E-mail: puchunying@126.com [College of Physics and Electronic Engineering, Nanyang Normal University, Nanyang 473061 (China)

    2015-11-05

    Using the particle swarm optimization algorithm combined with first-principles methods, we explore the diagram of AlY alloy up to 250 GPa. It is found that AlDy phase, rather than the experimentally observed B2 phase, is the most stable structure at 0 K and 0–20 GPa. However, our results show that B2 phase can exist as a stable phase at 20–27.6 GPa. At higher pressure, four new high-pressure phases with Cmcm-I, Cmcm-II, I4/mmm and P4/nmm structure are identified for the first time. The hardness, elastic and thermodynamic properties of the newly found phases are investigated and compared with B2 phase. The calculated hardness of AlDy, Cmcm-I, Cmcm-II, I4/mmm and P4/nmm phases is in the range of 7–9 GPa, higher than that of B2 phase. In addition, it is found that AlDy phase is a brittle material at 0 GPa, which changes to a ductile material above 12 GPa. Except for AlDy phase, all the other AlY compounds exhibit completely ductile behavior under pressure. Compared with the other phases, B2 phase is found to have the best ductility and the largest elastic anisotropy over the whole pressure investigated. Moreover, all AlY intermetallics exhibit a nearly elastic isotropy in compressibility but a comparatively large elastic anisotropy in shear. The structural stability, electronic structure, bulk and shear modulus, Debye temperature as well as sound velocities of AlY alloy under pressure are also deeply discussed. - Graphical abstract: Pressure-induced phase transition of AlY alloy up to 250 GPa. - Highlights: • The diagram of AlY alloy was explored and four new stable phases were predicted. • B2 phase shows the largest ductility and elastic anisotropy among AlY alloys. • All AlY alloys exhibit ductile behavior except for AlDy phase under pressure. • All AlY alloys show strong isotropy in compressibility and anisotropy in shear.

  9. PENGGUNAAN BIOGRAFI TUAN GURU KIYAI HAJI MUHAMMAD ZAINUDDIN ABDUL MAJID DALAM PEMBELAJARAN SEJARAH LOKAL DI MADRASAH ALIYAH NAHDLATUL WATHAN SENYIUR KABUPATEN LOMBOK TIMUR

    Directory of Open Access Journals (Sweden)

    Ahmad Afandi

    2016-04-01

    Full Text Available Penelitian ini berjudul Penggunaan Biografi Tuan Guru Kiyai Haji Muhammad Zainuddin Abdul Majid dalam Pembelajaran Sejarah Lokal di Madrasah Aliyah Nahdlatul Wathan Senyiur Kabupaten Lombok Timur. Salah satu tujuan dari penelitian ini adalah untuk melihat sejauh mana proses pembelajaran berangsung dan bagaimana dampaknya bagi siswa dalam rangka meningkatkan kreatifitas dan sikap nasionalisme siswa yang berlandaskan beberapa indikator yang peneliti sodorkan, misalnya 1 memiliki rasa bangga terhadap bangsa, 2 peduli terhadap nasib bangsa, 3 mempertahankan identitas atau jati diri sebagai bangsa timur, 4 menerima kemajemukan, 5 memiliki rasa keterpautan dan rasa memiliki (Sense of Belonging. Dari hasil penelitian yang dilakukan menunjukkan bahwa aktifitas siswa di dalam kelas selama proses pembelajaran mengalami peningkatan secara signifikan. Hal tersebut terlihat dari proses tanya jawab selama proses pembelajaran berlangsung. Salah satu kendala dalam pembelajaran ini adalah terkait minimnya sumber-sumber pendukung pembelajran, misalnya buku maupun literatur-literatur yang membahas tentang tokoh Tuan Guru Haji Muhammad Zainuddin Abdul Majid. Kata kunci: biografi, pembelajaran Sejarah.

  10. A novel base change leading to Hb Vanderbilt [β89(F5)Ser→Arg, AGT>AGA].

    Science.gov (United States)

    Goodyer, Matthew J; Elhassadi, Ezzat I; Percy, Melanie J; McMullin, Mary F

    2011-01-01

    We describe a high oxygen affinity hemoglobin (Hb) variant (Hb Vanderbilt) as a result of a heterozygous novel base change from T to A at codon 89 (AGT>AGA) leading to an amino acid change from serine to arginine.

  11. TAFSIR ALQUR’AN PARADIGMA INTEGRATIF: STUDI ATAS QIRA’AH ALTHANIYAH MUHAMMAD SYAHRUR

    Directory of Open Access Journals (Sweden)

    Abdul Malik

    2017-06-01

    Full Text Available This article describes on the alternative reading (qira'ah altaniyah of Alqur’an proposed by Muhammad Shahrur, in his work “Alkitab wa Alqur’an: Qira'ah Almu'ashirah”. Through this work, Syahrur proposed an integrative-interpretation method which is built through combining analysis of natural science, social science, and tafsir. Based on the descriptive analysis approach to this works, this study found out two important things: (1 Syahrur using mathematical analysis to interpret the muhkamat’s verses and science analysis for mutasyabihat’s verses. (2 Hudud is a result of the integrative analysis interpretation based on the linguistic and mathematic analysis in understanding the Quranic verses about the law, while ta’wil ilmi is an understanding toward mutasyabihat verses, like the revelation, which is based on the analysis of natural science cognitive.

  12. Suurajatolla Ali al-Sistani saabus Najaffi / Kalev Vilgats

    Index Scriptorium Estoniae

    Vilgats, Kalev

    2004-01-01

    Mässulise shiiidivaimuliku Moqtada al-Sadri Mahdi armee võitlejad on pidanud Najafis USA vägedega lahinguid juba kolm nädalat. Iraagi kõrgeim shiiiavaimulik suurajatolla Ali al-Sistani kutsub kõiki iraaklasi endaga Najaffi marssima, et lahingutele lõpp teha

  13. MAKNA AMAR MA’RUF NAHI MUNKAR MENURUT MUHAMMAD ASAD DALAM KITAB THE MESSAGE OF THE QUR’AN

    Directory of Open Access Journals (Sweden)

    Kusnadi Kusnadi

    2018-02-01

    Full Text Available This study purpose to understand Amar Ma'ruf Nahi Munkar according to Muhammad Asad in the book The Message of The Quran. In many Islamic literature, the study of amar ma'ruf nahi munkar has been widely practiced, both among theology, civic organizations, religious politics and literary books of commentary. One of the books that also discusses this study is The Message of The Quran, a book of translations and tafsir, written by Muhammad Asad. It is. This work is in the form of translation and interpretation. The explanations in it are in the form of footnotes and comments on translated verses as well as certain attachments related to particular themes. The compilation of this book is based on the orderliness of the letter as adopted by the majority of scholars and based on the reading of Hafs bin Sulaiman al-Asadi. At each beginning of the letter discussed, the letter periodization is first explained, the general explanation of the contents of the letter content. That Asad always interpret the word amar ma'ruf with something right. While nahi munkar with the opposite meaning something is wrong. Asad revealed to do something must be in accordance with the syariah that contained the Qur'an and sunnah. Because, to reach the best community or people is always to do something in accordance with the law or syariah that prevail in Islam.

  14. Taking Jihad Out of the Hands of Infidels

    Science.gov (United States)

    2007-06-01

    both Mecca and Medina from the Turks. In taking Mecca, the Wahhabis demonstrated their religious ferocity by destroying the tomb of Muhammad...did not sit well with the Turkish sultan. He tasked Mehmed Ali, the Egyptian Sultan, “to recover the holy cities.”73 On their third attempt, the...notable contributor to this transformation was an Egyptian named Sayyed Qutb, whose book, Milestones, was published in 1964. Qutb developed and

  15. Differential expression of THOC1 and ALY mRNP biogenesis/export factors in human cancers

    International Nuclear Information System (INIS)

    Domínguez-Sánchez, María S; Sáez, Carmen; Japón, Miguel A; Aguilera, Andrés; Luna, Rosa

    2011-01-01

    One key step in gene expression is the biogenesis of mRNA ribonucleoparticle complexes (mRNPs). Formation of the mRNP requires the participation of a number of conserved factors such as the THO complex. THO interacts physically and functionally with the Sub2/UAP56 RNA-dependent ATPase, and the Yra1/REF1/ALY RNA-binding protein linking transcription, mRNA export and genome integrity. Given the link between genome instability and cancer, we have performed a comparative analysis of the expression patterns of THOC1, a THO complex subunit, and ALY in tumor samples. The mRNA levels were measured by quantitative real-time PCR and hybridization of a tumor tissue cDNA array; and the protein levels and distribution by immunostaining of a custom tissue array containing a set of paraffin-embedded samples of different tumor and normal tissues followed by statistical analysis. We show that the expression of two mRNP factors, THOC1 and ALY are altered in several tumor tissues. THOC1 mRNA and protein levels are up-regulated in ovarian and lung tumors and down-regulated in those of testis and skin, whereas ALY is altered in a wide variety of tumors. In contrast to THOC1, ALY protein is highly detected in normal proliferative cells, but poorly in high-grade cancers. These results suggest a differential connection between tumorogenesis and the expression levels of human THO and ALY. This study opens the possibility of defining mRNP biogenesis factors as putative players in cell proliferation that could contribute to tumor development

  16. STUDI KOMPARASI PEMIKIRAN ABUL A’LA MAUDUDI DENGAN MUHAMMAD NATSIR TENTANG KONSEP NEGARA ISLAM

    Directory of Open Access Journals (Sweden)

    Ainur Ropik

    2015-12-01

    Full Text Available This paper discusses Abul A'la Maududi comparative thoughts with Muhammad Natsir about the concept of the Islamic State, both in terms of state ideology and form of government. Despite his two live in different social settings, but his political thinking, especially about the Nation of Islam have a lot in common, yet on the other hand there is also the difference, while the striking similarities in the concept of Maududi and M. Natsir are equally wanted the establishment of an Islamic state as a whole. While the difference is the legal basis of each character is like taking Ayat al-Quran and al-Hadith different interpretation. If Maududi considers democracy as shirk, but Natsir considered legitimate democratic origin remains contrary to Islamic law.

  17. Does advanced lung inflammation index (ALI) have prognostic significance in metastatic non-small cell lung cancer?

    Science.gov (United States)

    Ozyurek, Berna Akinci; Ozdemirel, Tugce Sahin; Ozden, Sertac Buyukyaylaci; Erdoğan, Yurdanur; Ozmen, Ozlem; Kaplan, Bekir; Kaplan, Tugba

    2018-01-22

    Lung cancer is the most commonly diagnosed and death-related cancer type and is more frequent in males. Non-small-cell lung cancer (NSCLC) accounts for about 85% of all case. In this study, it was aimed to research the relationship between advanced lung inflammation index (ALI) and the primary mass maximum standardized uptake value (SUVmax) and C-reactive protein (CRP) at initial diagnosis and the prognostic value of ALI in determining the survival in metastatic NSCLC. A total of 112 patients diagnosed as stage 4 non-small-lung cancer in our hospital between January 2006 and December 2013 were included in this study. ALI was calculated as body mass index (BMI) × serum albumin/neutrophil-to-lymphocyte ratio (NLR). The patients were divided into two groups as ALI ALI ≥ 18 (low inflammation). The log-rank test and Cox proportional hazard model were used to identify predictors of mortality. Evaluation was made of 94 male and 18 female patients with a mean age of 59.7 ± 9.9 years. A statistically significant negative relationship was determined between ALI and CRP values (P ALI and SUVmax values (P = .436). The median survival time in patients with ALI ALI ≥ 18, it was 16 months (P = .095). ALI is an easily calculated indicator of inflammation in lung cancer patients. Values <18 can be considered to predict a poor prognosis. © 2018 John Wiley & Sons Ltd.

  18. ALI and DAC for transuranic elements based on the metabolic data presented in ICRP Publication 48

    International Nuclear Information System (INIS)

    Togawa, Orihiko; Yamaguchi, Yukichi; Homma, Toshimitsu

    1987-07-01

    The recently published ICRP report, ICRP Publication 48, presents the new metabolic data of some transuranic elements, compared with those employed in the calculation of ALI and DAC in ICRP Publication 30. Values of ALI and DAC for 72 radionuclides were calculated using the metabolic data presented in the Publication 48. The calculation was performed by a computer code system DOSDAC, which can systematically calculate ALI and DAC by the same method as that described in the Publication 30. The calculated values of ALI and DAC were tabulated in the same format as that of the supplements to the Publication 30. For the convenience of using in the dose assessment, also given are values of committed effective dose equivalent per intake of unit activity. It is expected that these values will be applied to the radiation protection purposes. (author)

  19. Aerosolized prostacyclin for acute lung injury (ALI) and acute respiratory distress syndrome (ARDS)

    DEFF Research Database (Denmark)

    Afshari, Arash; Brok, Jesper; Møller, Ann

    2010-01-01

    Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) are critical conditions that are associated with high mortality and morbidity. Aerosolized prostacyclin has been used to improve oxygenation despite the limited evidence available so far.......Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) are critical conditions that are associated with high mortality and morbidity. Aerosolized prostacyclin has been used to improve oxygenation despite the limited evidence available so far....

  20. The German Working Group of Obesity in Childhood and Adolescence (AGA): improving the quality of care for overweight and obese children in Germany.

    Science.gov (United States)

    Reinehr, Thomas; Holl, Reinhard W; Wabitsch, Martin

    2008-01-01

    The Working Group of Obesity in Childhood and Adolescence (AGA) comprises scientists, clinicians, and therapists dealing with obesity in children and adolescents. More than 250 pediatricians, psychiatrics, dieticians, psychologists and sports therapists are integrated. On an international level, the AGA cooperates with the European Childhood Obesity Group and the International Obesity Taskforce (IOTF) for Childhood Obesity. The aims of the AGA are to initiate clinical and scientific studies, to join diagnostic, therapeutic and scientific centers, to improve the education, to support self-help groups, and to standardize diagnostic and therapeutic procedures in the field of obesity in childhood and adolescence. The milestones in the history of the AGA are the consensus process to define overweight and obesity in Germany, the development of guidelines for diagnostic procedures and treatment of obesity in childhood and adolescence, the determination of all therapy centers for obese children and adolescents in Germany, the development of a PC software (APV) to document longitudinally diagnostic and therapeutic procedures as well as outcomes by a quality management program, the certification of therapeutic institutions, and the implementation of prevention and treatment studies. As effect of these initiatives, the quality of care in overweight children has been improved in the last years. For example, the APV quality program demonstrated an increase of diagnostic procedures such as blood pressure measurement in the last 4 years. Copyright 2008 S. Karger AG, Basel.

  1. Simultaneous quantitation of six major quassinoids in Tongkat Ali dietary supplements by liquid chromatography with tandem mass spectrometry.

    Science.gov (United States)

    Han, Young Min; Jang, Moonhee; Kim, In Sook; Kim, Seung Hyun; Yoo, Hye Hyun

    2015-07-01

    Tongkat Ali (Eurycoma longifolia) is one of the most popular traditional herbs in Southeast Asia and generally consumed as forms of dietary supplements, tea, or drink additives for coffee or energy beverages. In this study, the liquid chromatography with tandem mass spectrometry method for the simultaneous quantitation of six major quassinoids of Tongkat Ali (eurycomanone, 13,21-dihydroeurycomanone, 13α(21)-epoxyeurycomanone, 14,15β-dihydroxyklaineanone, eurycomalactone, and longilactone) was developed and validated. Using the developed method, the content of the six quassinoids was measured in Tongkat Ali containing dietary supplement tablets or capsules, and the resulting data were used to confirm the presence of Tongkat Ali in those products. Among the six quassinoids, eurycomanone was the most abundant quassinoid in all samples tested. The developed method would be useful for the quality assessment of Tongkat Ali containing dietary supplements. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. A discussion about the version of the Bible available to Muhammad

    Directory of Open Access Journals (Sweden)

    Hendrik G. Stoker

    2017-10-01

    This article offers both a response to the Muslim apologist arguments regarding biblical integrity and trustworthiness as well as explains that what Muhammad knew as the Bible through the Syriac Peshitta is essentially the same in biblical content as what most reputable Bible versions contain today. Through the efforts of labour intensive manuscript discovery and exhaustive textual criticism, both Christians and Muslims can know with precision what the early writers of both the Old and New Testament wrote as ‘inspired’ Scripture. In order for the Muslim to be consistent in following the mandate to believe all the books previously given by God as well as the Qur’an, he must believe the Syriac Peshitta, or a Bible version that is a comparable translation, in order for the Muslim mandate to make sense. Such a concession, however, places the Muslim in an extremely difficult position that needs to be discussed between Christians and Muslims if they both wish and desire to be thought of as worshiping the one true God.

  3. INSAN KAMIL DALAM PEMIKIRAN MUHAMMAD NAFIS AL-BANJARI DAN ABDUSH-SHAMAD AL-FALIMBÂNÎ DALAM KITAB AD-DURR AN-NAFIS DAN SIYAR AS-SÂLIKÎN (SEBUAH STUDI PERBANDINGAN

    Directory of Open Access Journals (Sweden)

    Rodiah Rodiah

    2015-10-01

    Full Text Available This paper tries to explore the concept of Insan Kamil through two books of Sufism, ad-Durr an-Nafis by Muhammad Nafis al-Banjari and Siyar as-Salikin by Abdush-Shamad al-Falimbânî. The method used in this paper comparative descriptive approach, because the studies referred to in this study aims to look at the similarities and differences of the concept of Insan Kamil contained in both books. These results indicate that the thought of Muhammad Nafis al-Banjari in the book ad-Durr an-Nafis and Abdush-Samad al-Falimbânî in the book Siyar al-Salikin against the concept of Insan Kamil has the same basic concept, in addition to the typical thinking its own distinct between the two.

  4. Prognostic Value of the Pretreatment Advanced Lung Cancer Inflammation Index (ALI) in Diffuse Large B Cell Lymphoma Patients Treated with R-CHOP Chemotherapy.

    Science.gov (United States)

    Park, Young Hoon; Yi, Hyeon Gyu; Lee, Moon Hee; Kim, Chul Soo; Lim, Joo Han

    2017-01-01

    The Advanced Lung Cancer Inflammation Index (ALI, body mass index × albumin/neutrophil-to-lymphocyte ratio) has been demonstrated to be a prognostic factor of survival in some solid cancers. We retrospectively investigated the usefulness of the ALI to predict chemotherapy response and survival in 212 patients with diffuse large B cell lymphoma (DLBCL) treated with R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone) chemotherapy. Patients were allocated to a low ALI group (n = 82, 38.7%) or a high ALI group (n = 130, 61.3%) according to an optimal pretreatment ALI cut-off value of 15.5 as determined by receiver operating curve analysis. The low ALI group displayed more adverse clinical characteristics, lower rates of complete remission (54.9 vs. 75.4%, p = 0.008), and poorer 5-year progression-free (PFS, 58.1 vs. 77.3%, p = 0.006) and overall (OS, 64.2 vs. 80.2%, p = 0.008) survival. Multivariate analysis showed that low ALI was found to independently predict shorter PFS and OS. Interestingly, a low ALI reverted to a high ALI during treatment in 58 patients (27.4%), and the 5-year OS of these patients was better than that of patients whose ALI remained low (n = 24, 72.5 vs. 24%, p ALI might be an easily available marker for predicting clinical outcomes in DLBCL patients treated with R-CHOP chemotherapy. © 2017 S. Karger AG, Basel.

  5. Gene expression of bovine embryos developing at the air-liquid interface on oviductal epithelial cells (ALI-BOEC).

    Science.gov (United States)

    van der Weijden, Vera A; Chen, Shuai; Bauersachs, Stefan; Ulbrich, Susanne E; Schoen, Jennifer

    2017-11-25

    We recently developed an air-liquid interface long-term culture of differentiated bovine oviductal epithelial cells (ALI-BOEC). This ex vivo oviduct epithelium is capable of supporting embryo development in co-culture up to the blastocyst stage without addition of embryo culture medium. However, blastocyst rates in co-culture were markedly lower than in conventional in vitro embryo production procedures. In the present study, we assessed target gene expression of ALI-BOEC derived embryos to test their similarity to embryos from conventional in vitro embryo culture. We screened previously published data from developing bovine embryos and selected 41 genes which are either differentially expressed during embryo development, or reflect differences between various in vitro culture conditions or in vitro and in vivo embryos. Target gene expression was measured in 8-cell embryos and blastocysts using a 48.48 Dynamic Array™ on a Biomark HD instrument. For comparison with the ALI-BOEC system, we generated embryos by two different standard IVP protocols. The culture conditions lead to differential gene expression in both 8-cell embryos and blastocysts. Across the expression of all target genes the embryos developing on ALI-BOEC did not depart from conventional IVP embryos. These first results prove that gene expression in ALI-BOEC embryos is not largely aberrant. However, there was no clear indication for a more in vivo-like target gene expression of these embryos. This calls for further optimization of the ALI-BOEC system to increase its efficiency both quantitatively and qualitatively.

  6. Improving performance of AliRoot using C++11

    CERN Document Server

    Agarwal, Abhineet

    2014-01-01

    The aim of the project was to increase the performance and better the memory management which is currently used in AliRoot. For this, we want to look up to certain ROOT libraries and containers which could be replaced using C++ containers and standard libraries. Also, to better the memory management, we wanted to use the smart pointers used in C++11.

  7. Metode Darb al-Amthâl dalam Penafsiran Muhammad ‘Abduh

    Directory of Open Access Journals (Sweden)

    Agus Salim

    2015-09-01

    Full Text Available Muh}ammad ‘Abduh had ground the orientation of the Koran in the line of Muslim life. In other words, interpretations are always aiming to make the Koran as well as applying the guidance in public life as a solution to the problem of street life. Therefore, associated with verses mubham and mutashâbih, ‘Abduh closer to the bow of the salaf scholars who prefer silence and surrender fully to God’s intention (tafwîd. However, on several occasions, he sometimes shifts from the bow, for example, when in contact with mutashâbih verses, verses related to the supernatural, and the stories in the Koran as may be necessary to explain in detail. In this position, he sometimes refers to methods tamthîl as tafwîd form or otherwise as a form of ta’wîl. This article will explore the darb al-amthâl in view of ‘Abduh as one method of interpreting the Koran from his works that contain related ideas and his interpretation of the Koran and the consideration of the methods of darb al-amthâl

  8. Enzymatic liquefaction of agarose above the sol-gel transition temperature using a thermostable endo-type β-agarase, Aga16B.

    Science.gov (United States)

    Kim, Jung Hyun; Yun, Eun Ju; Seo, Nari; Yu, Sora; Kim, Dong Hyun; Cho, Kyung Mun; An, Hyun Joo; Kim, Jae-Han; Choi, In-Geol; Kim, Kyoung Heon

    2017-02-01

    The main carbohydrate of red macroalgae is agarose, a heterogeneous polysaccharide composed of D-galactose and 3,6-anhydro-L-galactose. When saccharifying agarose by enzymes, the unique physical properties of agarose, namely the sol-gel transition and the near-insolubility of agarose in water, limit the accessibility of agarose to the enzymes. Due to the lower accessibility of agarose to enzymes in the gel state than to the sol state, it is important to prevent the sol-gel transition by performing the enzymatic liquefaction of agarose at a temperature higher than the sol-gel transition temperature of agarose. In this study, a thermostable endo-type β-agarase, Aga16B, originating from Saccharophagus degradans 2-40 T , was characterized and introduced in the liquefaction process. Aga16B was thermostable up to 50 °C and depolymerized agarose mainly into neoagarooligosaccharides with degrees of polymerization 4 and 6. Aga16B was applied to enzymatic liquefaction of agarose at 45 °C, which was above the sol-gel transition temperature of 1 % (w/v) agarose (∼35 °C) when cooling agarose. This is the first systematic demonstration of enzymatic liquefaction of agarose, enabled by determining the sol-gel temperature of agarose under specific conditions and by characterizing the thermostability of an endo-type β-agarase.

  9. Evaluation of lipid and glucose metabolism and cortisol and thyroid hormone levels in obese appropriate for gestational age (AGA) born and non-obese small for gestational age (SGA) born prepubertal Slovak children.

    Science.gov (United States)

    Blusková, Zuzana; Koštálová, Ludmila; Celec, Peter; Vitáriušová, Eva; Pribilincová, Zuzana; Maršálková, Marianna; Šemberová, Jana; Kyselová, Tatiana; Hlavatá, Anna; Kovács, László

    2014-07-01

    Obesity is the major determinant of metabolic syndrome. Being born small for gestational age (SGA) may be co-responsible. We aimed at evaluating the association between 1. obesity and 2. being born SGA and the presence of endocrine-metabolic abnormalities in prepubertal Slovak children. The study included 98 children, aged 3-10.9 years: 36 AGA-born obese children (OB), 31 SGA-born children (SGA) and 31 appropriate for gestational age born non-obese children (AGA). Fasting serum levels of glucose, total cholesterol, LDL, HDL, triglycerides, fT4, TSH, cortisol and insulin were determined. HOMA-IR was calculated. Personal data about birth weight and length and family history were collected. Actual anthropometric measurement was done. In every group, high prevalence of positive family history of metabolic disorder was found. In comparison with AGA children, OB children were taller (plevels and homeostasis model assessment for insulin resistance (HOMA-IR) (pcortisol levels (p=0.069) was noted. SGA-born children were shorter (plevels (plevels (p=0.085) and increased fT4 levels (pobese children and twice more metabolic abnormalities were present in SGA-born children in comparison with AGA-born children. SGA-born children are more prone to developing endocrine-metabolic abnormalities than non-obese children born AGA, but they are at less risk than obese AGA-born children. We should provide specialized care for obese children already in prepubertal age and pay attention to SGA-born children.

  10. Individuality In the Educational Philosophy of Allama Muhammad Iqbal

    Directory of Open Access Journals (Sweden)

    Imam Bahroni

    2011-06-01

    Full Text Available Nowadays, Muslim Ummah all over the world likely at the cross road,at the position where they watch clearly a phenomenon of life that directsthem into surprising modern civilization with full creativities and innovations,but far away from the true values of Islamic education. On the other hand,they observe vividly numerous dimensions of life that direct every individualinto strong morality, norms and right way of life to discover the Ultimate Reality.This social fact at the end compelled every one of modern people to selectwhich one among these two is the correct ideal for the truth of life.This article tries to elaborate the concept of individuality in the educationalphilosophy of Allama Muhammad Iqbal 2 . In his Lectures, Iqbal elaborated thatindividuality is not a datum but an achievement. It is the fruit of a constant,strenuous effort in and against the forces of the external environment as well asthe disruptive tendencies within man himself. The life of individuality (the Ego,he further explained is a kind of tension caused by the Ego invading theenvironment and the environment invading the Ego.An individual is the basis of all aspects of educations, which then mustbe educated and concerned together with the development of its relationshipto the community. Like the philosopher, the educator must necessarily inquireinto the nature of these two terms of his active individual and the environment,which ultimately determine the solution of all his problems.

  11. Exhaled breath analysis discriminates phenotypes of acute lung injury (ALI)

    NARCIS (Netherlands)

    Bos, L.D.J.; Hemmes, S.N.T.; Nijsen, T.M.E.; Sterk, P.J; Schultz, M.J.

    2012-01-01

    Introduction It has been postulated that the pathophysiology and clinical presentation of ALI based on pulmonary and non-pulmonary etiology represent different phenotypes1. Until now, little biological evidence on the molecular level has been presented to support this hypothesis. Exhaled air

  12. Ten Years after the Danish Muhammad Cartoon News Stories: Terror and Radicalization as Predictable Media Events

    DEFF Research Database (Denmark)

    Hervik, Peter

    2018-01-01

    , radicalization as a “pre-terrorist” phase has become the lens through which the category “Muslims” has been represented in much media coverage. In this article, I argue that the dominant hegemonic understanding in Denmark that is based on a certain spatial–racial logic is not a passive production of knowledge......In the tenth year after Danish daily Jyllands-Posten published twelve cartoons, the Muhammad Cartoons, this media event—and the hegemonic understanding behind it—continues to be a discursive reference point for new controversies around national borders and racial boundaries. Then, since late 2010....... It keeps informing news coverage of media events as terror and thereby risking describing the hegemony more than adequately understanding the events at hand....

  13. Neoplasia yield and colonoscopic workload of surveillance regimes for colorectal cancer in colitis patients: a retrospective study comparing the performance of the updated AGA and BSG guidelines.

    Science.gov (United States)

    Mooiweer, Erik; van der Meulen, Andrea E; van Bodegraven, Adriaan A; Jansen, Jeroen M; Mahmmod, Nofel; Nijsten, Joyce; van Oijen, Martijn G H; Siersema, Peter D; Oldenburg, Bas

    2013-11-01

    Due to the increased risk of colorectal cancer, colonoscopic surveillance is recommended for patients with ulcerative and Crohn's colitis. Because surveillance intervals differ considerably between the recently updated American Gastroenterological Association (AGA) and British Society of Gastroenterology (BSG) guidelines, we compared the neoplasia yield and colonoscopic workload of these guidelines. Patients with inflammatory bowel disease undergoing surveillance were identified using medical records. Patients were stratified according to the BSG and AGA guidelines, and corresponding colonoscopic workload was calculated based on the risk factors present during follow-up. The incidence of colitis-associated neoplasia (CAN), defined as a low-grade dysplasia in flat mucosa or a non-adenoma-like mass, high-grade dysplasia, or colorectal cancer was compared between the risk groups of either guidelines. In total, 1018 patients with inflammatory bowel disease who underwent surveillance were identified. Using the AGA surveillance intervals, 64 patients (6%) were assigned to annual and 954 patients (94%) to biannual surveillance, resulting in 541 colonoscopies per year. The yield of CAN was 5.3% and 20.3% in the low- and high-risk groups, respectively (P = 0.02). Using the BSG surveillance intervals, 204 patients received surveillance annually (20%), 393 patients every 3 years (39%), and 421 patients every 5 years (41%), resulting in 420 colonoscopies per year, which is 22% lower than the AGA guidelines. The yield of CAN was 3.6%, 6.9%, and 10.8%, for the low-, intermediate-, and high-risk groups, respectively (P = 0.26). Although the BSG surveillance intervals offer the advantage of a lower colonoscopic workload, the risk stratification of the AGA seems superior in distinguishing patients at higher risk of CAN.

  14. Toplumcu gerçekçilik ve Sabahattin Ali'nin hikâye kişileri

    OpenAIRE

    Hasdedeoğlu, Mehmet Onur

    2008-01-01

    Bu çalısmanın konusu, günümüzde devrini tamamlamıs olan toplumcu gerçekçilik akımının ilkeleri dorultusunda, Sabahattin Ali'nin hikâye kisilerini tanımaktır. Ulasılması hedeflenen amaç, edebiyatın çesitli türlerinde eserler vermis olmasına karsın daha çok hikâyeci kimligiyle öne çıkan Sabahattin Ali'nin, hikâyelerinde yarattıgı kahramanları inceleme yoluyla, temsilcisi oldugu toplumcu gerçekçilik akımı içerisindeki yerini belirlemektir. Çalısmanın çekirdegini olusturan ?Sabahattin Ali'nin Hik...

  15. Securing the AliEn File Catalogue - Enforcing authorization with accountable file operations

    International Nuclear Information System (INIS)

    Schreiner, Steffen; Banerjee, Subho Sankar; Betev, Latchezar; Carminati, Federico; Vladimirovna Datskova, Olga; Furano, Fabrizio; Grigoras, Alina; Grigoras, Costin; Mendez Lorenzo, Patricia; Peters, Andreas Joachim; Saiz, Pablo; Bagnasco, Stefano; Zhu Jianlin

    2011-01-01

    The AliEn Grid Services, as operated by the ALICE Collaboration in its global physics analysis grid framework, is based on a central File Catalogue together with a distributed set of storage systems and the possibility to register links to external data resources. This paper describes several identified vulnerabilities in the AliEn File Catalogue access protocol regarding fraud and unauthorized file alteration and presents a more secure and revised design: a new mechanism, called LFN Booking Table, is introduced in order to keep track of access authorization in the transient state of files entering or leaving the File Catalogue. Due to a simplification of the original Access Envelope mechanism for xrootd-protocol-based storage systems, fundamental computational improvements of the mechanism were achieved as well as an up to 50% reduction of the credential's size. By extending the access protocol with signed status messages from the underlying storage system, the File Catalogue receives trusted information about a file's size and checksum and the protocol is no longer dependent on client trust. Altogether, the revised design complies with atomic and consistent transactions and allows for accountable, authentic, and traceable file operations. This paper describes these changes as part and beyond the development of AliEn version 2.19.

  16. Sidi Ali Ou Azza (L4): A New Moroccan Fall

    Science.gov (United States)

    Chennaoui Aoudjehane, H.; Agee, C. B.; Aaranson, A.; Bouragaa, A.

    2016-08-01

    Sidi Ali Ou Azza is the latest meteorite fall in Morocco, it occurred on 28 July 2015 very close (about 40 km) to Tissint martian shergottite fall that occurred on 18 July 2011. It's one of the small group of 23 L4 ordinary chondrite falls.

  17. The ALI-ARMS Code for Modeling Atmospheric non-LTE Molecular Band Emissions: Current Status and Applications

    Science.gov (United States)

    Kutepov, A. A.; Feofilov, A. G.; Manuilova, R. O.; Yankovsky, V. A.; Rezac, L.; Pesnell, W. D.; Goldberg, R. A.

    2008-01-01

    The Accelerated Lambda Iteration (ALI) technique was developed in stellar astrophysics at the beginning of 1990s for solving the non-LTE radiative transfer problem in atomic lines and multiplets in stellar atmospheres. It was later successfully applied to modeling the non-LTE emissions and radiative cooling/heating in the vibrational-rotational bands of molecules in planetary atmospheres. Similar to the standard lambda iterations ALI operates with the matrices of minimal dimension. However, it provides higher convergence rate and stability due to removing from the iterating process the photons trapped in the optically thick line cores. In the current ALI-ARMS (ALI for Atmospheric Radiation and Molecular Spectra) code version additional acceleration of calculations is provided by utilizing the opacity distribution function (ODF) approach and "decoupling". The former allows replacing the band branches by single lines of special shape, whereas the latter treats non-linearity caused by strong near-resonant vibration-vibrational level coupling without additional linearizing the statistical equilibrium equations. Latest code application for the non-LTE diagnostics of the molecular band emissions of Earth's and Martian atmospheres as well as for the non-LTE IR cooling/heating calculations are discussed.

  18. An Assessment of the AGA and CCFA Quality Indicators in a Sample of Patients Diagnosed with Inflammatory Bowel Disease.

    Science.gov (United States)

    Tkacz, Joseph; Brady, Brenna L; Meyer, Roxanne; Lofland, Jennifer H; Ruetsch, Charles; Coelho-Prabhu, Nayantara

    2015-11-01

    Inflammatory bowel disease (IBD) is a chronic relapsing disease characterized by activation of the mucosal immune system and inflammation of the gastrointestinal tract. Management of IBD places a significant burden on the health care system because of the complexity of treatment, variability in patient outcomes, and chronic nature of the disease.  To investigate the American Gastroenterological Association (AGA) and Crohn's and Colitis Foundation of America's (CCFA) quality measurement sets in a sample of IBD patients. Fourteen quality measures were restated for application to a claims database and calculated using Optum Clinformatics DataMart database. Selected measures were calculated over calendar year 2011. Performance measures ranged from 0.4% for AGA measure 9, prophylaxis for venous thromboembolism, to 66.9% for AGA measure 8, testing for Clostridium difficile. CCFA outcome measures ranged from 0.6% qualifying for CCFA O10, report of fecal incontinence, to 32.9% for CCFA O1, prednisone usage. In addition to Clostridium difficile testing, the use of appropriate corticosteroid-sparing therapy (51.1%) and testing for latent tuberculosis before initiating anti-tumor necrosis factor therapy (45.0%) were the highest achieved measures. This is the first examination of IBD quality measures using administrative claims. Rates of achievement across measures were variable and likely affected by the ability to calculate certain measures with claims data. Future studies should further examine measurement of IBD quality indicators in claims data to assess the validity of claims-based analyses and to ascertain whether measure attainment translates into better overall health or IBD-related outcomes.

  19. Stapled hemorrhoidopexy: The Aga Khan University Hospital Experience

    International Nuclear Information System (INIS)

    Athar, Ali; Chawla, Tabish; Turab, Pishori

    2009-01-01

    Stapled hemorrhoidopexy for prolapsing hemorrhoids is conceptually different from excision hemorrhoidectomy. It does not accompany the pain that usually occurs after resection of the sensitive anoderm. This study was carried out to evaluate the clinical outcome of stapled hemorrhoidopexy at The Aga Khan University Hospital. A sample of 140 patients with symptomatic second-, third-, and fourth-degree hemorrhoids and circumferential mucosal prolapse underwent stapled hemorrhoidopexy from July 2002 to July 2007. They were evaluated for postoperative morbidity, analgesic requirement, and recurrence. Seventy-eight percent were males and the mean age was 45 (range 16-90) years. The mean operative time was 35 (15-78) min. The mean parenteral analgesic doses during the first 24 h were 2.1. All patients received oral analgesics alone after 24 h. No significant postoperative morbidity was observed. The mean in-patient hospital stay was 1.3 (0-5) days. Patients were followed-up for 24 (range, 2-48) months. Minor local recurrence of hemorrhoids was seen in four patients and was managed by band ligation. Stapled hemorrhoidopexy procedure was found safe, well tolerated by patients with minimal parenteral analgesic use and early discharge from the hospital. (author)

  20. Land cover mapping with emphasis to burnt area delineation using co-orbital ALI and Landsat TM imagery

    Science.gov (United States)

    Petropoulos, George P.; Kontoes, Charalambos C.; Keramitsoglou, Iphigenia

    2012-08-01

    In this study, the potential of EO-1 Advanced Land Imager (ALI) radiometer for land cover and especially burnt area mapping from a single image analysis is investigated. Co-orbital imagery from the Landsat Thematic Mapper (TM) was also utilised for comparison purposes. Both images were acquired shortly after the suppression of a fire occurred during the summer of 2009 North-East of Athens, the capital of Greece. The Maximum Likelihood (ML), Artificial Neural Networks (ANNs) and Support Vector Machines (SVMs) classifiers were parameterised and subsequently applied to the acquired satellite datasets. Evaluation of the land use/cover mapping accuracy was based on the error matrix statistics. Also, the McNemar test was used to evaluate the statistical significance of the differences between the approaches tested. Derived burnt area estimates were validated against the operationally deployed Services and Applications For Emergency Response (SAFER) Burnt Scar Mapping service. All classifiers applied to either ALI or TM imagery proved flexible enough to map land cover and also to extract the burnt area from other land surface types. The highest total classification accuracy and burnt area detection capability was returned from the application of SVMs to ALI data. This was due to the SVMs ability to identify an optimal separating hyperplane for best classes' separation that was able to better utilise ALI's advanced technological characteristics in comparison to those of TM sensor. This study is to our knowledge the first of its kind, effectively demonstrating the benefits of the combined application of SVMs to ALI data further implying that ALI technology may prove highly valuable in mapping burnt areas and land use/cover if it is incorporated into the development of Landsat 8 mission, planned to be launched in the coming years.

  1. The Stereotyping of Muslims : An Analysis of The New York Times’ and The Washington Times’ Coverage of Veiling and the Muhammad Cartoon Controversy

    OpenAIRE

    Schønemann, Julie

    2013-01-01

    This thesis investigates the stereotypical portrayal of Muslims in the American media. More specifically, it explores the relative importance of stereotype theory, prejudice theory and the stereotype content model in the media’s remaking and reinforcing of common stereotypes of Muslims. This study argues that that Muslims were stereotypically portrayed in The New York Times’ and The Washington Times’ coverage of the Muhammad cartoons controversy and the tradition of veiling among Muslim women...

  2. 75 FR 2921 - In the Matter of the Designation of Said Ali al-Shihri, Also Known as Abu-Sayyaf, Also Known as...

    Science.gov (United States)

    2010-01-19

    ... DEPARTMENT OF STATE [Public Notice 6872] In the Matter of the Designation of Said Ali al-Shihri... Known as Abu Sufian Kadhdhaab Matrook, Also Known as Sa'id Ali Jabir al-Khathim al-Shihri, Also Known as... January 23, 2003, I hereby determine that the individual known as Said Ali al- Shihri, and also known as...

  3. JAliEn - A new interface between the AliEn jobs and the central services

    CERN Document Server

    Grigoras, A G; Pedreira, M M; Saiz, P; Schreiner, S

    2014-01-01

    Since the ALICE experiment began data taking in early 2010, the amount of end user jobs on the AliEn Grid has increased signif icantly. Presently 1/3 of the 40K CPU cores available to ALICE are occupied by jobs submitted by about 400 distinct users, individually or in organized analysis trains. The overall stability of the AliEn middleware has been excellent throughout the 3 years of running, but the massive amount of end-user analysis and its specific requirements and load has revealed few components which can be improved. One of them is the interface between users and central AliEn services (catalogue, job submission system) which we are currently re-implementing in Java . The interface provides persistent connection with enhanced data and job submission authenticity. In this paper we will describe the architecture of the new interface, the ROOT binding which enables the use of a single interface in addition to the standard UN IX-like access shell and the new security-related features.

  4. JAliEn – A new interface between the AliEn jobs and the central services

    International Nuclear Information System (INIS)

    Grigoras, A G; Grigoras, C; Pedreira, M M; Saiz, P; Schreiner, S

    2014-01-01

    Since the ALICE experiment began data taking in early 2010, the amount of end user jobs on the AliEn Grid has increased significantly. Presently 1/3 of the 40K CPU cores available to ALICE are occupied by jobs submitted by about 400 distinct users, individually or in organized analysis trains. The overall stability of the AliEn middleware has been excellent throughout the 3 years of running, but the massive amount of end-user analysis and its specific requirements and load has revealed few components which can be improved. One of them is the interface between users and central AliEn services (catalogue, job submission system) which we are currently re-implementing in Java. The interface provides persistent connection with enhanced data and job submission authenticity. In this paper we will describe the architecture of the new interface, the ROOT binding which enables the use of a single interface in addition to the standard UNIX-like access shell and the new security-related features

  5. Examining Reliability and Validity of an Online Score (ALiEM AIR) for Rating Free Open Access Medical Education Resources.

    Science.gov (United States)

    Chan, Teresa Man-Yee; Grock, Andrew; Paddock, Michael; Kulasegaram, Kulamakan; Yarris, Lalena M; Lin, Michelle

    2016-12-01

    Since 2014, Academic Life in Emergency Medicine (ALiEM) has used the Approved Instructional Resources (AIR) score to critically appraise online content. The primary goals of this study are to determine the interrater reliability (IRR) of the ALiEM AIR rating score and determine its correlation with expert educator gestalt. We also determine the minimum number of educator-raters needed to achieve acceptable reliability. Eight educators each rated 83 online educational posts with the ALiEM AIR scale. Items include accuracy, usage of evidence-based medicine, referencing, utility, and the Best Evidence in Emergency Medicine rating score. A generalizability study was conducted to determine IRR and rating variance contributions of facets such as rater, blogs, posts, and topic. A randomized selection of 40 blog posts previously rated through ALiEM AIR was then rated again by a blinded group of expert medical educators according to their gestalt. Their gestalt impression was subsequently correlated with the ALiEM AIR score. The IRR for the ALiEM AIR rating scale was 0.81 during the 6-month pilot period. Decision studies showed that at least 9 raters were required to achieve this reliability. Spearman correlations between mean AIR score and the mean expert gestalt ratings were 0.40 for recommendation for learners and 0.35 for their colleagues. The ALiEM AIR scale is a moderately to highly reliable, 5-question tool when used by medical educators for rating online resources. The score displays a fair correlation with expert educator gestalt in regard to the quality of the resources. The score displays a fair correlation with educator gestalt. Copyright © 2016 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  6. Catalytically important amino-acid residues of abalone alginate lyase HdAly assessed by site-directed mutagenesis

    OpenAIRE

    Yamamoto, Sayo; Sahara, Takehiko; Sato, Daisuke; Kawasaki, Kosei; Ohgiya, Satoru; Inoue, Akira; Ojima, Takao

    2008-01-01

    Alginate lyase is an enzyme that degrades alginate chains via β-elimination and has been used for the production of alginate oligosaccharides and protoplasts from brown algae. Previously, we deduced the amino-acid sequence of an abalone alginate lyase, HdAly, from its cDNA sequence and, through multiple amino-acid sequence alignment, found that several basic amino-acid residues were highly conserved among the polysaccharide-lyase family 14 (PL-14) enzymes including HdAly. In the present study...

  7. Book featuring Grand Egyptian Museum design proposals by Ahmed Ali published

    OpenAIRE

    Chadwick, Heather Riley

    2009-01-01

    "Silence, Darkness and Light," a new book by Ahmed K. Ali, adjunct professor of architecture in the School of Architecture + Design and program leader for study abroad in Egypt for Virginia Tech's College of Architecture and Urban Studies, has been published by VDM Verlag in Saarbrucken, Germany.

  8. Assessments of Ali, Dome A, and Summit Camp for mm-wave Observations Using MERRA-2 Reanalysis

    Science.gov (United States)

    Kuo, Chao-Lin

    2017-10-01

    NASA’s latest MERRA-2 reanalysis of the modern satellite measurements has made atmospheric data easily accessible with unprecedented uniformity, fidelity, and completeness. In this paper, these data are used to evaluate five sites for millimeter-wave (mm-wave) observations. These include two established sites (South Pole and Chajnantor, Atacama), and three new sites (Ali in Tibet, Dome A in Antarctica, and Summit Camp in Greenland). Atmospheric properties including precipitable water vapor (PWV), sky brightness temperature fluctuations, and ice and liquid water paths are derived and compared. Dome A emerges to be the best among those evaluated, with PWV and fluctuations smaller than the second-best site, South Pole, by more than a factor of 2. It is found that the higher site in Ali (6100 m) is on par with Cerro Chajnantor (5612 m) in terms of transmission and stability. The lower site in Ali (5250 m) planned for the first stage of observations at 90/150 GHz provides conditions comparable to those on the Chajnantor Plateau. These analyses confirm Ali to be an excellent mm-wave site in the Northern Hemisphere that will complement well-established Southern sites. According to MERRA-2 data, the observing conditions at Summit Camp are also comparable to Cerro Chajnantor. However, it is more affected by the presence of liquid water clouds.

  9. Assessments of Ali, Dome A, and Summit Camp for mm-wave Observations Using MERRA-2 Reanalysis

    International Nuclear Information System (INIS)

    Kuo, Chao-Lin

    2017-01-01

    NASA's latest MERRA-2 reanalysis of the modern satellite measurements has made atmospheric data easily accessible with unprecedented uniformity, fidelity, and completeness. In this paper, these data are used to evaluate five sites for millimeter-wave (mm-wave) observations. These include two established sites (South Pole and Chajnantor, Atacama), and three new sites (Ali in Tibet, Dome A in Antarctica, and Summit Camp in Greenland). Atmospheric properties including precipitable water vapor (PWV), sky brightness temperature fluctuations, and ice and liquid water paths are derived and compared. Dome A emerges to be the best among those evaluated, with PWV and fluctuations smaller than the second-best site, South Pole, by more than a factor of 2. It is found that the higher site in Ali (6100 m) is on par with Cerro Chajnantor (5612 m) in terms of transmission and stability. The lower site in Ali (5250 m) planned for the first stage of observations at 90/150 GHz provides conditions comparable to those on the Chajnantor Plateau. These analyses confirm Ali to be an excellent mm-wave site in the Northern Hemisphere that will complement well-established Southern sites. According to MERRA-2 data, the observing conditions at Summit Camp are also comparable to Cerro Chajnantor. Furthermore, it is more affected by the presence of liquid water clouds.

  10. Pretreatment advanced lung cancer inflammation index (ALI) for predicting early progression in nivolumab-treated patients with advanced non-small cell lung cancer.

    Science.gov (United States)

    Shiroyama, Takayuki; Suzuki, Hidekazu; Tamiya, Motohiro; Tamiya, Akihiro; Tanaka, Ayako; Okamoto, Norio; Nakahama, Kenji; Taniguchi, Yoshihiko; Isa, Shun-Ichi; Inoue, Takako; Imamura, Fumio; Atagi, Shinji; Hirashima, Tomonori

    2018-01-01

    Programmed death-ligand 1 (PD-L1) expression status is inadequate for indicating nivolumab in patients with non-small cell lung cancer (NSCLC). Because the baseline advanced lung cancer inflammation index (ALI) is reportedly associated with patient outcomes, we investigated whether the pretreatment ALI is prognostic in NSCLC patients treated with nivolumab. We retrospectively reviewed the medical records of all patients treated with nivolumab for advanced NSCLC between December 2015 and May 2016 at three Japanese institutes. Multivariate logistic regression and Cox proportional hazards models were used to assess the impact of the pretreatment ALI (and other inflammation-related parameters) on progression-free survival (PFS) and early progression (i.e., within 8 weeks after starting nivolumab). A total of 201 patients were analyzed; their median age was 68 years (range, 27-87 years), 67% were men, and 24% had an Eastern Cooperative Oncology Group (ECOG) performance status of 2 or higher. An ECOG performance status ≥2, serum albumin ALI ALI ALI was found to be a significant independent predictor of early progression in patients with advanced NSCLC receiving nivolumab, and may help identify patients likely to benefit from continued nivolumab treatment in routine clinical practice. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  11. A Mathematician Hussein Ryfky Tamani ibn Muhammad ibn Kyrym Ghazi »

    Directory of Open Access Journals (Sweden)

    M.A. Useinov

    2015-09-01

    Full Text Available In this article an attempt is made to open up and make the analysis of the creative work of one of the outstanding scholar-mathematician in the Ottoman Empire at the end of the 18th – beginning of the 19th centuries whose origin was from the Crimean Khanate – Hussein Ryfky Tamani ibn Muhammad ibn Kyrym Ghazi. At the beginning of the 19th century, during 11 years, the scholar was a leader (bashkhoja of the Ground forces military-engineering school (Muhendishane-i berry-i Humayun in Istanbul. The article provides a review of translations made by Hussein Ryfky into the Ottoman language of European scientists’ works, as well as of his own research works on Geometry, Engineering and Military science, Astronomy, Geography, and other disciplines. The author also presents the textbooks having for centuries become the basic textbooks in the Ottoman Empire for learning exact sciences in the military educational institutions. The author provides the analysis of the pedagogical and public activity of the scientist during the period of reforms Nizam-i-Jedid, as well as the short description of his activities during the student years. Hussein Ryfky Tamani made a synthesis of Western and Ottoman approaches to the science. His works became the corner-stone in the foundation of Ottoman Mathematical science at the beginning of the 19th century.

  12. Mir Masoom Ali: A Distinguished and Dedicated Statistician Who Never Gets Old – Even at Seventy-Five

    Directory of Open Access Journals (Sweden)

    Aylin Alin

    2012-07-01

    Full Text Available I first met Distinguished Professor Dr. Mir Masoom Ali at the International Conference on Mathematics and Statistics held in Athens, Greece in 2007. He was there as an invited speaker and he also chaired my session. After my session we had a chance to chat on our way to the restaurant where the banquet was held.  Even though it was the first time we hadmet, he was very kind to me.  He was there with his wife Firoza (Leena Ali. They looked great together.  Family is the most important part of our lives.  It was immediately apparent to me that Professor Ali, apart from being an outstanding statistician and a great teacher, is also a dedicated husband, father and grandfather. We have always kept in touch since our first meeting. I am very lucky to have had a chance to recently collaborate with him in a research paper. It is also a great honor for me to have been asked to serve as a guest editor for this special issue and to be able to be part of this undertaking to celebrate Dr. Ali’s 75th birthday anniversary. To some people, age is only an indicator of the year they were born but inside they feel much younger. Professor Ali is onesuch person who not only looks very young both physically and emotionally for his age but who also has the personality and mentality of a very active younger person. That is why I have chosen the title "Mir Masoom Ali: A Distinguished and Dedicated Statistician Who Never Gets Old - Even at Seventy-Five."  

  13. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

  14. New Approach in Religious Studies with Special Reference to Muhammad Abid al-Jabiri

    Directory of Open Access Journals (Sweden)

    Nirwan Syafrin

    2014-11-01

    Full Text Available Beginning from the nineteenth century, Arab-Muslim intelligentsias marched to reform their societies. Many things since then have been carried out. They put forward various proposals, advanced numerous ideas and concepts and established several institutions. Nevertheless, their condition has yet improved. In some context, it even deteriorates. Triggered by this situation, a number of Arab and Muslim scholars then embark on a new reform project. But at this time, their reform attempt is materialized in the form of intellectual and cultural project. For they believe that the basic problem and crisis beset their society lies in their understanding of turâts. Thus, unless this understanding is corrected, no genuine reform would be able to be materialized. Muhammad ‘Abid al-Jabiri, a Moroccan scholar, is one of the many Arab scholars who have taken this course. For this purpose, he constructed his own project which he names Naqd al-‘Aql al-‘Arabi. This article specifically attempts to shed light on conceptual apparatus and methods that he uses which this study finds to have originated from different schools of thought of western philosophy and social sciences, important of which is Marxism and postmodernism.

  15. Interoperating AliEn and ARC for a Distributed Tier1 in the Nordic Countries

    CERN Document Server

    Gros, Philippe; Lindemann, Jonas; Saiz, Pablo; Zarochentsev, Andrey

    2011-01-01

    To reach its large computing needs, the ALICE experiment at CERN has developed its own middleware called AliEn, centralised and relying on pilot jobs. One of its strength is the automatic installation of the required packages. The Nordic countries have offered a distributed Tier-1 centre for the CERN experiments, where the job management should be done with the NorduGrid middleware ARC. We have developed an interoperation module to allow to unify several computing sites using ARC, and make them look like a single site from the point of view of AliEn. A prototype has been completed and tested out of production. This talk will present implementation details of the system and its performance in tests.

  16. Alteration zone Mapping in the Meiduk and Sar Cheshmeh Porphyry Copper Mining Districts of Iran using Advanced Land Imager (ALI Satellite Data

    Directory of Open Access Journals (Sweden)

    A. Beiranvand Pour

    2015-10-01

    Full Text Available This study evaluates the capability of Earth Observing-1 (EO1 Advanced Land Imager (ALI data for hydrothermal alteration mapping in the Meiduk and Sar Cheshmeh porphyry copper mining districts, SE Iran. Feature-oriented principal components selection, 4/2, 8/9, 5/4 band ratioing were applied to ALI data for enhancing the hydrothermally altered rocks associated with porphyry copper mineralization, lithological units and vegetation. Mixture-tuned matched-filtering (MTMF was tested to discriminate the hydrothermal alteration areas of porphyry copper mineralization from surrounding environment using the shortwave infrared bands of ALI. Results indicate that the tested methods are able to yield spectral information for identifying vegetation, iron oxide/hydroxide and clay minerals, lithological units and the discrimination of hydrothermally altered rocks from unaltered rocks using ALI data.

  17. El cuerpo extendido : indumentaria mutante en la obra de Ali Schachtschneider

    OpenAIRE

    Nóvoa Vicente, Elena Fernández

    2017-01-01

    The issue of this paper is to explore the concept of the extended body reflecting on clothing and biotechnology activated through Ali Schachtschneider´s work. Going through the different scopes articulated by the Vivorium project, we will look over the taxonomy review that these pieces of work arouse info:eu-repo/semantics/publishedVersion

  18. Incorporation of Tongkat Ali and Ginseng extracts from mass propagated roots derived from bioreactor technology as supplements in energy chocolate confectionery

    International Nuclear Information System (INIS)

    Seri Cempaka Mohd Yusof; Sobri Hussein; Salmah Moosa; Salahbiah Badul Majid; Azhar Mohammad; Foziah Ali; Shafii Khamis; Rusli Ibrahim

    2012-01-01

    Tongkat Ali (Eurycoma longifolia) and Ginseng (Panax ginseng) are well known herbs among Asians and have been sought after by Europeans and others for the benefits to health, especially as aphrodisiac and nourishing stimulants. They have high antioxidant level and were reported to be used in the treatment of type II diabetes, as well as for sexual dysfunction in men. Since Tongkat Ali and Ginseng are difficult to cultivate and have a long cultivation period, the bioreactor technology is the alternative method to produce huge amount of raw materials for the herbal industry and continuous supply of standardized raw materials that is not affected by geographical and environmental factors, soil less and free from pesticides and other contaminants. Tongkat Ali and Ginseng extracts from mass propagated roots derived from bioreactor technology have similar profiles as extracts derived from normal cultivation. Liquid Chromatography-Mass Spectrometer (LC-MS) profiles showed presence of active compounds in the Tongkat Ali and Ginseng extracts from the mass propagated roots. Cytotoxicity test using the brine shrimp (Artemia salina Leach) lethality assay, revealed that higher concentration of Tongkat Ali and Ginseng extracts from mass propagated roots did not kill or affect the brine shrimps, implying that the extracts were safe for consumption. Incorporation of combination of Tongkat Ali and Ginseng total extracts from mass propagated roots derived from bioreactor technology energy chocolate confectionery was accepted by the panelists in sensory evaluation and showed that the chocolate product has good potential as a carrier besides beverages and capsules. (author)

  19. ALiEM Blog and Podcast Watch: Toxicology.

    Science.gov (United States)

    Zaver, Fareen; Craddick, Michael; Sanford, Audrey; Sefa, Nana; Hughes, George; Lin, Michelle

    2017-10-01

    The WestJEM Blog and Podcast Watch presents high-quality open-access educational blogs and podcasts in emergency medicine based on the ongoing Academic Life in Emergency Medicine (ALiEM) Approved Instructional Resources (AIR) and AIR-Professional (Pro) series. Both series critically appraise open-access educational blogs and podcasts in EM using an objective scoring instrument. This installment of the blog and podcast watch series curated and scored relevant posts in the specific topic of toxicology emergencies from the AIR-Pro Series. The AIR-Pro Series is a continuously building curriculum covering a new subject area every two months. For each area, eight EM chief residents identify 3-5 advanced clinical questions. Using FOAMsearch.net and FOAMSearcher to search blogs and podcasts, relevant posts are scored by eight reviewers from the AIR-Pro editorial board, which is comprised of EM faculty and chief residents at various institutions across North America. The scoring instrument contains five measurement outcomes based on seven-point Likert scales: recency, accuracy, educational utility, evidence based, and references. The AIR-Pro label is awarded to posts with a score of ≥28 (out of 35) points. An "honorable mention" label is awarded if board members collectively felt that the blogs were valuable and the scores were > 25. A total of 31 blog posts and podcasts were included. Key educational pearls from the six high-quality AIR-Pro posts and four honorable mentions are summarized. The WestJEM ALiEM Blog and Podcast Watch series is based on the AIR and AIR-Pro Series, which attempts to identify high-quality educational content on open-access blogs and podcasts. This series provides an expert-based, crowdsourced approach towards critically appraising educational social media content for EM clinicians. This installment focuses on toxicology emergencies.

  20. Does gender affect career satisfaction and advancement in gastroenterology? Results of an AGA institute-sponsored survey.

    Science.gov (United States)

    Gerson, Lauren B; Twomey, Kay; Hecht, Gail; Lee, Linda; McQuaid, Ken; Pizarro, Theresa T; Street, Sarah; Yoshida, Cynthia; Early, Dayna

    2007-04-01

    Women comprise 19% of the American Gastroenterological Association (AGA) membership. We performed a prospective study to determine whether female gastroenterologists were less likely to achieve career advancement and satisfaction. We administered an online survey to AGA members from 2004-2006. The survey contained questions regarding effects of gender on career advancement, satisfaction with career, promotional policies, and integration of family and career. A total of 457 individuals (response rate 9% after 2 major invitations) completed the survey, including 262 (57%) women (20% in private practice, 53% in academic careers, and 27% trainees) and 195 men (23% in private practice, 58% in academic careers, and 19% trainees). The male gastroenterologists were significantly older (P careers for significantly more years (P = .002). There were no significant differences with respect to marital status, number of children, or number of hours worked between the genders. Men were more likely to achieve the rank of full professor (P = .035), and significantly more women reported that gender affected their career advancement (47% vs 9%; P careers reported less satisfaction with their careers (P = .01) and perceived more difficulty in achieving promotion and tenure. Women were more likely to choose private practice careers because of part-time options (P = .025). Equal numbers of men and women in practice reported difficulty balancing work and family life. Significantly more female than male gastroenterologists perceive that gender has affected their career advancement. Female academic gastroenterologists reported less overall career satisfaction and promotion than male academic gastroenterologists.

  1. Tongkat Ali (Eurycoma longifolia Jack): a review on its ethnobotany and pharmacological importance.

    Science.gov (United States)

    Bhat, Rajeev; Karim, A A

    2010-10-01

    Eurycoma longifolia Jack is an herbal medicinal plant of South-East Asian origin, popularly recognized as 'Tongkat Ali.' The plant parts have been traditionally used for its antimalarial, aphrodisiac, anti-diabetic, antimicrobial and anti-pyretic activities, which have also been proved scientifically. The plant parts are rich in various bioactive compounds (like eurycomaoside, eurycolactone, eurycomalactone, eurycomanone, and pasakbumin-B) among which the alkaloids and quassinoids form a major portion. Even though toxicity and safety evaluation studies have been pursued, still a major gap exists in providing scientific base for commercial utilization and clearance of the Tongkat Ali products with regard to consumer's safety. The present review aims at reviewing the research works undertaken till date, on this plant in order to provide sufficient baseline information for future works and for commercial exploitation. Copyright © 2010 Elsevier B.V. All rights reserved.

  2. Stress field during early magmatism in the Ali Sabieh Dome, Djibouti, SE Afar rift

    Science.gov (United States)

    Sue, Christian; Le Gall, Bernard; Daoud, Ahmed Mohamed

    2014-09-01

    The so-called Ali Sabieh range, SE Afar rift, exhibits an atypical antiform structure occurring in the overall extensional tectonic context of the Afar triple junction. We dynamically analyzed the brittle deformation of this specific structural high using four different methods in order to better constrain the tectonic evolution of this key-area in the Afar depression. Paleostress inversions appear highly consistent using the four methods, which a posteriori validates this approach. Computed paleostress fields document two major signals: an early E-W extensional field, and a later transcurrent field, kinematically consistent with the previous one. The Ali Sabieh range may have evolved continuously during Oligo-Miocene times from large-scale extensional to transcurrent tectonism, as the result of probable local stress permutation between σ1 and σ2 stress axes.

  3. Tasawuf Transformatif sebagai Solusi Problematika Manusia Modern dalam Perspektif Pemikiran Tasawuf Muhammad Zuhri

    Directory of Open Access Journals (Sweden)

    Rahmad Yulianto

    2015-09-01

    Full Text Available This article discusses the relevance between Sufism and modernity in the perspective Muhammad Zuhri. This study concludes that transformative Sufism which has been initiated by Zuhri is a sort of Sufism which is grounded to the spirit and values of the fundamental teachings of Sufism, shown in accordance with the context of its time, and discussed with the problems of human beings in dealing with the dynamics of life. Modern life has led to the problem of alienation. Of course, the alienation does not merely occur within individual dimensions (self-consciousness of human (alienation of consciousness, but it also occurs in their relationship to the nature (ecological alienation, and the relationship among human beings (social alienation. The point of relevance is how the human are subsequently able to build their self-consciousness toward the universe and their human brothers. Such awareness is then contextualized into the dimensions of the problems of modern man. The contextualization of this Sufi teaching makes the transformative Sufism not only actual, but also relevant in order to “liberate” the modern man from entanglement of various problems they deal with. The spirit of Sufism brought by Zuhri seems to be laden with social actions and communal aspects.

  4. “Speeches” of Sigismund II’s Courier, Mikhail Garaburda, Addressed to the Crimean Qalga Muhammad Giray (1559

    Directory of Open Access Journals (Sweden)

    A.A. Gorsky

    2017-03-01

    Full Text Available The author of the article for the first time publishes completely the “speeches” of Mikhail Garaburda – the courier of the Polish king and the Great Lithuanian prince Sigismund II – addressed to Qalga of the Crimean Khanate Muhammad Giray, which were intercepted in 1559 by the voivode D.Adashev and presented by Ivan the Terrible to the Lithuanian side in 1562. Both the embassy of Mikhail Garaburda in the Crimea and the Dnieper-Crimean campaign of D.Adashev took place in 1559. The Ambassadorial book of the Grand Duchy of Lithuania speaks about Sigismund’s charter and the “speeches” of his courier. It is noteworthy that Sigismund’s charter and M.Garaburda’s “speeches” were used by the Russian side only in the course of the negotiations in 1562, that is, three years after they had been delivered to Moscow.

  5. An analysis of Canada-US natural gas trade using the AGAS energy model

    International Nuclear Information System (INIS)

    Quon, D.; Wong, S.

    1989-01-01

    The strength of AGAS is that it was structurally designed to address the primary issue of EMF9, namely the medium and long-term prospects for Canada-US natural gas trade. Consequently, it is one of the very few models with the following necessary features: (1) it treats all the regions of Canada and the United States as one continental entity, both with respect to demand and supply; (2) All regional supplies and demands are integrated. Hence, regional gas prices are endogenous; inter-regional gas flows, including Canadian-US gas exchanges, are endogenous. Models that do not have both of these features require that the answers that are being sought have to be specified exogenously. An iterative procedure can be used to reconcile unrealistic results but only with difficulty

  6. Lubâb At-Ta’wîl ‘Inda Al-Imâm Al-Khâzîn Baina Al-Ma’tsûr wa Ar-Ra’yi (Dirâsah Maudhu’iyyah fi Ayah al-Qashash

    Directory of Open Access Journals (Sweden)

    Muhammad Shulhi Alhadi siregar

    2018-03-01

    Full Text Available This paper concern to study about one of Tafseer book, namely Lubâb al-Ta'wîl fi Ma'âny at-Tanzîl by Imam al-Khazin. Some scholars differ in the setting of sources of tafseer. Such as, the well-known scholars, Muhammad Ali Iyazi and Muhammad Husain ad-Dzahabi. Ulama Iyazi assumes that Tafseer Khazin belongs to the category of commentary bi al-Ma'tsûr, since this commentary is an ikhtishar of Tafseer al-Baghawi. While some scholars such as adz-Dzahabi, categorized this tafseer into the bi al-Ra'yi. By using the tahlily documentation method and the thematic method associated with Qashash verses in the Qur'an, the researchers found the correct method, namely the tafseer of al-Atsary an-Nazhary or known by tafseer bi al-Ma'tsûr who use Ra'yi as an extension of explanation and the determination of the most powerful law, seen from writing theme related at the end of its tafseer.

  7. Pemikiran Ali Syari’ati dalam Sosiologi (Dari Teologi Menuju Revolusi)

    OpenAIRE

    Faiq Tobroni

    2016-01-01

    Ali Syari’ati is muslim brilliant philosopher, graduated from doctoral of Sorbonne France. He created social teology perspective, based from his experience in west sociology perspective about Capitalism or Marxism. He succeed seek the Capitalism and Marxism weaknes if this perspective is used in Muslim Society. He mapping structure of society, insist of: Habil and Qobail. Habil is common people in society, Qabil is high class, likes: prince, aristocrats or capital owner. Qabil was repressedHa...

  8. Pemikiran Ali Syari'ati Dalam Sosiologi (Dari Teologi Menuju Revolusi)

    OpenAIRE

    Tobroni, Faiq

    2015-01-01

    Ali Syari'ati is muslim brilliant philosopher, graduated from doctoral of Sorbonne France. He created social teology perspective, based from his experience in west sociology perspective about Capitalism or Marxism. He succeed seek the Capitalism and Marxism weaknes if this perspective is used in Muslim Society. He mapping structure of society, insist of: Habil and Qobail. Habil is common people in society, Qabil is high class, likes: prince, aristocrats or capital owner. Qabil was repressedHa...

  9. Peranan Agama dalam Restorasi Peradaban Umat Islam Menurut Muhammad Fethullah Gulen

    Directory of Open Access Journals (Sweden)

    Usman Syihab

    2014-11-01

    Full Text Available This article examines Muhammad Fethullah Gulen’s thought on the roles of religion in reconstruction of a civilization. The article analyzes the problem anatomy of the Ummah, concepts of civilization, relationship between identity and civilization, religion and its roles in formation of civilization identity, the “essential” conditions for Muslim’s renaissance, and the role of Islamic scholars in the renaissance process. The article reveals Gulen’s idea, that the Muslim’ crises is internal in nature, and not because of others, it is a “liability to be colonize” attitude. Religion has a vital role in construction of a civilization identity. A religion can be pillar of a civilization is a religion that has lofty goals, able to apply moral values, upgrade spiritual quality, and fulfill human’s soul needs. According to Gulen, every civilization has its links with the past and its cultural haritage, and that any attempt to reconstruct a future civilization has to consider its own cultural roots. Thus, a civilization is neither a life adopted from colonials nor values that has been deprived from its own noble values. The article, using philosophical, historical and sociological approaches, tries to analyze the “essential” conditions that able to restore Islamic civilization and spawn Muslim’s renaissance, mainly; a moral-spiritual, b knowledge, c aesthetic, and d love. The article also explains critically the roles and missions of ulamâ in making “resurrection from the grave”, renaissance and total reform of the ummah.

  10. Remembering for tomorrow: Professor Mansour Ali Haseeb.

    Science.gov (United States)

    Salih, Mustafa Abdalla M

    2013-01-01

    This is a highlight of the obituary ceremony in tribute to Professor Mansour Ali Haseeb (1910 - 1973), organized by the Medical Students Association of the Faculty of Medicine, the University of Khartoum (U of K). Professor Haseeb has been the first Sudanese Professor and first Dean of the Faculty of Medicine. He was an outstanding humane teacher, mentor and researcher, and was awarded the international Dr. Shousha Foundation Prize and Medal by the WHO. He was also an active citizen in public life and became Mayor of Omdurman City. The obituary ceremony reflected the feelings of the medical community and included speeches by Professor Abdalla El Tayeb, President of U of K; the Dean, Faculty of Medicine; the Late Professor Haseeb's colleagues and students, His family representative, and an elegy poem.

  11. 40 CFR 721.9527 - Bis(1,2,2,6,6-pentamethyl-4-piperidin-4-ol) ester of cy-clo-ali-phatic spiroketal.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Bis(1,2,2,6,6-pentamethyl-4-piperidin-4-ol) ester of cy-clo-ali-phatic spiroketal. 721.9527 Section 721.9527 Protection of Environment...-piperidin-4-ol) ester of cy-clo-ali-phatic spiroketal. (a) Chemical substance and significant new uses...

  12. THE ROLE OF HABITUS IN DEVELOPING INTELLECTUAL CAPITAL STUDENT AT MA'HAD ALY AL FURQON, PONOROGO

    Directory of Open Access Journals (Sweden)

    Katni dan Anip Dwi Saputro

    2017-12-01

    Full Text Available The institution always expects the output quality and personality, but if the surroundings of education never give appropriate habitus, then the result will not be achieved. On the basis of this research, trying to peel about the role of habitus in developing intellectual capital which is a student at Ma'had synergy between the structure with an agency, how an intellectual capital created and run in a Ma'had university. The question of the Islamic College during this time, when students are extremely variable input, its ability to be tough in the formation and determination of the standard of their abilities.  The results of this study found that the role of habitus intellectual capital improvement done in Mahad Aly Al Furqon Ponorogo there are seven models of the structure that supports the students ' intellectual capital development in Ma'had Aly Al Furqon Ponorogo. As for overcoming the Burnout, the students do a variety of activities that make students fresh so avoid burnout. The results of the intellectual capital developed in the Mahad Aly Al Furqon students achieved the target of memorizing a set amount and the more intellectual growth of students marked with a creative, independent inquiries, in drawing up the scientific agenda, active removing the arguments in different ways.

  13. [VEGF165 transfected endothelial progenitor cells mediated by lentivirus alleviated ALI in rats].

    Science.gov (United States)

    He, Zhaohui; He, Huiwei; Lu, Yuanhua; Chen, Zhi; Xu, Fanghua; Wang, Rongsheng; Yang, Chunli

    2017-11-01

    To investigate the protective effects of vascular endothelial growth factor-165 (VEGF165) transfected the endothelial progenitor cells (EPCs) mediated by lentivirus on acute lung injury (ALI) in rats. The mononuclear cells from the male Sprague-Dawley (SD) rats were isolated and cultured to get the EPCs for study. The lentivirus vector carrying the human VEGF165 gene was constructed. According to the random number table method, 90 male SD rats were divided into ALI model group, phosphate buffer solution (PBS) group, EPCs treatment group, none transfected EPCs treatment group and VEGF165 transfected EPCs treatment group, and the rats in each group were subdivided into 4, 12 and 48 hours subgroups, with 6 rats in each subgroup. The rat model of ALI was reproduced by intravenous injection of oleic acid (0.15 μL/g). Then each treatment group was given PBS, EPCs, none transfected EPCs and VEGF165 transfected EPCs respectively with the same volume of 0.2 mL. For the groups with cells, about 1×10 6 cells were contained. Abdominal aortic blood and lung tissue were harvested at 4, 12 and 48 hours. Arterial blood gas analysis was performed. The lung wet/dry weight ratio (W/D) was calculated. The expressions of induced nitric oxide synthase (iNOS), endothelin-1 (ET-1) and VEGF165 were determined by enzyme-linked immunosorbent assay (ELISA). After dyed with hematoxylin-eosin (HE), the lung tissue pathology was observed and the lung injury score was performed. Compared with the ALI model group, the arterial partial pressure of oxygen (PaO 2 ) in EPCs, none transfected EPCs and VEGF165 transfected EPCs treatment groups was significantly increased from 4 hours, and lung W/D, expressions of iNOS and ET-1 were significantly decreased, and VEGF165 expression was significantly increased. Compared with the EPCs treatment group, the increase in PaO 2 , the decrease in lung W/D and expressions of iNOS and ET-1, and the increase in VEGF165 expression in VEGF165 transfected EPCs

  14. An Approach to the Stories of Sabahattin Ali within the Context of Marxist Literary Aesthetics: The Conflict between Peasants and the Intelligentsia

    Science.gov (United States)

    Yigit, Murat

    2016-01-01

    This study will try to read the stories of Sabahattin Ali, who has written various books in Turkish, within the context of Marxist literary aesthetics, assess the types and characters in the stories of Sabahattin Ali within that framework, and observe the social levels and the gaps between them based on the relationships between the two extreme…

  15. Epistemology And The Problem Of Cultural Hybridity In Muhammad Iqbal’s Thought

    Directory of Open Access Journals (Sweden)

    Hawasi Hawasi

    2015-12-01

    Full Text Available Abstract : The hegemony of rational-positivistic paradigm of modern Western epistemology contributes greatly to  the  development  of  modern  thought.  The  paradigm,  so  far,  brings  knowledge  and  science  into mere instrumental goals. Scientism is the result of the paradigm which lost of its sacred as science. Therefore,  it  gets  philosophical  attack  from  both  Western  postmodern  thinkers  and  indigenous scholars who already experienced Western colonialism and imperialism. One of the Moslem scholars who criticized the hegemony of Western thought to Islamic culture and civilization is Muhammad Iqbal. For Iqbal, for centuries, Muslim thinkers were unable to see Islam from Quran point of view because they perceive it from the eye of rational-speculative Greek philosophy. Islamic thinking had been under its hegemony for so long that need to be deconstructed. In the postcolonial perspective, Iqbal’s  attempt  to  decolonize  Western  rational-speculative  epistemology  from  Plato  to  Descartes found  him  in  ambivalence.  British  colonialism  experienced  by  Iqbal  in  India  formed  the  hybrid culture in his project of reconstructing Islamic thought in relation to Western thought. Therefore, Iqbal’s  attempt  to  bridge  the  gap  between  rational-speculative  of  Western  thought  and  mystic- religious tendencies of Islamic thought is a process of seeking “the Third Space” through mimicry as consequence of cultural interaction between the colonizer and the colonized. Kata-kata Kunci: decolonization of epistemology, hybrid culture, Islamic epistemology, the Third Space.   Abstrak : Hegemoni  paradigma  epistemologi  Barat  modern  yang  rasional  positivistik  berkontribusi  besar terhadap perkembangan pemikiran modern. Paradigma tersebut sejauh ini, menggiring pengetahuan dan sains pada tujuan-tujuan yang bersifat instrumental. Saintisisme merupakan

  16. Divider plate leak inspections using an acoustic tool 'ALIS'

    International Nuclear Information System (INIS)

    Kowalewski, J.; Colbert, M.

    1998-01-01

    Divider plate leakage in the primary head of steam generators may be a contributor to high Reactor Inlet Header Temperature (RIHT) which can have a negative effect on the operation of a plant. A method to provide quick information of divider plate leakage can be very useful in helping operators to make timely and cost effective repair and maintenance decisions. As part of a CANDU Owners Group (COG) funded program, a novel acoustic tool for performing inspections in empty steam generators during a shutdown has been developed and successfully demonstrated by Ontario Hydro Technologies (OHT). The basic principle of this technique utilizes sound transmission through the leakage paths of a divider plate assembly for creating a graphic image which reveals the locations and relative sizes of leaks. This is accomplished by injecting one side of the primary head with a series of airborne, ultrasonic sound bursts while scanning the divider plates from the opposite side and collecting transmitted sound pressure levels. Once a scan is completed the results are processed and displayed graphically as a color mapping of the entire divider plate assembly showing an image of the leakage locations and relative severity. The special transducers of the acoustic leak inspection system (ALIS) are installed through the manways of the steam generator at both sides of the primary head. These are clamped to the tube sheet and operated from a convenient remote location within the containment building. This process minimizes radiation exposure of the workers, as well, it reduces risk of contamination of the ALIS equipment. The current version of this tool performs the scans by remote manual control. (author)

  17. DYNAMICS OF LOCAL ISLAM: FATWA OF MUHAMMAD BASIUNI IMRAN, THE GRAND IMAM OF SAMBAS, ON THE FRIDAY PRAYER ATTENDED BY FEWER THAN FORTY PEOPLE

    Directory of Open Access Journals (Sweden)

    Hamka Siregar

    2013-12-01

    Full Text Available This article is an analitical work based on local Islam dynamic of Sambas society in the era of Sambas Sultanate. The work attempts to promote intellectual heritages such as the book of Cahaya Suluh, which could at least give us an idea that in a process of setting certain rules or istinbat, there is a need for flexibility. As can be observed from the whole argument built in this book, the process is completely flexible, not merely following one school of thought. As indicated in this paper, especially in the discussion of his thought, Muhammad Basiuni Imran used various references for his propositions. Although he was an advocate of the school of Syafi’i, he was still open to the other schools of thought. As a matter of fact, in the case of Friday prayer, his position was different from the school of thought he supported. He took that position because he considered the socio cultural conditions of Sambas at the time. Intellectual spirit shown by the Grand Imam of Sambas should continue to be emulated and expanded. It is a way to avoid the ‘blind’ taqlid against a certain school of thought, as such attitude can narrow human intelligence and reasoning which will eventually lead to collision with local reality that sometimes contains values that do not contradict with religion. In addition, the approach to the interpretation of law should look at its socio-cultural and historical background as this will keep the law strong and sustainable. In this way, Islam will be easily accepted without having to impose foreign culture on local people. Keywords: Dynamic, Islam, Sambas, Grand Imam, Muhammad Basuni Imran

  18. Comparative alteration mineral mapping using visible to shortwave infrared (0.4-2.4 μm) Hyperion, ALI, and ASTER imagery

    Science.gov (United States)

    Hubbard, B.E.; Crowley, J.K.; Zimbelman, D.R.

    2003-01-01

    Advanced Land Imager (ALI), Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER), and Hyperion imaging spectrometer data covering an area in the Central Andes between Volcan Socompa and Salar de Llullaillaco were used to map hydrothermally altered rocks associated with several young volcanic systems. Six ALI channels in the visible and near-infrared wavelength range (0.4-1.0 ??m) were useful for discriminating between ferric-iron alteration minerals based on the spectral shapes of electronic absorption features seen in continuum-removed spectra. Six ASTER channels in the short wavelength infrared (1.0-2.5 ??m) enabled distinctions between clay and sulfate mineral types based on the positions of band minima related to Al-OH vibrational absorption features. Hyperion imagery embedded in the broader image coverage of ALI and ASTER provided essential leverage for calibrating and improving the mapping accuracy of the multispectral data. This capability is especially valuable in remote areas of the earth where available geologic and other ground truth information is limited.

  19. Molecular detection of the carriers of Staphylococcus aureus golden in referred to the Imam Ali Clinic in Shahrekord, Iran

    Directory of Open Access Journals (Sweden)

    Maryam Reisi

    2014-12-01

    Full Text Available Objective: To conduct for the molecular detection of Staphylococcus aureus (S. aureus (Golden staph carriers among patients referred to the Imam Ali Clinic, Shahrekord, Iran. Methods: This sectional-descriptive study was conducted with 200 persons with suspected upper respiratory tract infections, who were referred to the Imam Ali Clinic in Shahrekord, Iran, in 2012. After culturing the nasal swab samples in mannitol salt agar and blood agar, S. aureus colonies were confirmed by biochemical methods. To determine the susceptibility of S. aureus strains isolated, molecular methods were used. Results: Among the 200 investigated samples, 60 cases (30%, comprising 25 men (41.66% and 35 women (58.33%, were found to be S. aureus carriers. Conclusions: The results of the present study showed that the frequency of the S. aureus strain isolated from the nasal swabs of patients with respiratory tract infections admitted to the Imam Ali Clinic in Shahrekord, Iran, was remarkable. Thus, knowing detection of S. aureus carriers, who are at a risk of spreading nosocomial infection among the staff, is vital to control and prevent nosocomial infections.

  20. La Roma della diaspora somala: i grovigli spaziali ed identitari della narrativa di Cristina Ali Farah - The Somali Diaspora within Rome: Entanglements of Space and Identity in Cristina Ali Farah's novels

    Directory of Open Access Journals (Sweden)

    Nora Moll

    2017-12-01

    Full Text Available Scenario urbano principale dei due romanzi Madre piccola (2007 e Il comandante del fiume (2014, la città di Roma viene ricostruita narrativamente dalla scrittrice italo-somala Cristina Ali Farah secondo prospettive e tensioni nuove e significative. Le geografie degli spazi esterni ed interni della città rispondono in entrambi i testi a delle dinamiche identitarie le quali sono attraversate da temi comuni agli scrittori contemporanei della diaspora africana: la dialettica tra presenza ed assenza (di persone, di luoghi, la precarietà e l’instabilità della dimora d’arrivo, il conflitto tra la memoria traumatica e la necessità di radicarsi nell’hic et nunc spaziale ed esistenziale, la rilettura degli spazi urbani in chiave postcoloniale. A partire da tale matrice tematica, la narrativa di Ali Farah si carica di simbologie e di metafore nuove, che rimandano alla sua poetica e al suo immaginario ben personali. Subentra, nella lettura critica dei testi in questione, anche la considerazione dell’aspetto generazionale, che contrassegna i personaggi, e del diverso vivere la città d’approdo nel caso di biografie finzionali segnate dalla fuga e dalla diaspora, o viceversa dai legami con essa degli esponenti delle “seconde generazioni”.   The city of Rome is the main urban scenario of Cristina Ali Farah's two novels Madre piccola (2007 and Il comandante del fiume (2014, being constructed narratively from new perspectives and using significant narrative strategies. In both fictional texts, the Italian author of Somali and Italian origin depicts external and internal geographies of the Italian Capital, which are connected with identitary dynamics expressed by themes frequently used by contemporary diasporic writers: the dialectics between the presence and the absence (of people and places, the precariousness and instability of the new abode, the conflict between a traumatic memory and the necessity of establishing roots in the spacial

  1. Põhja-Küprose liider soovib isolatsiooni lõppemist / Mehmet Ali Talat ; interv. Erkki Bahovski

    Index Scriptorium Estoniae

    Talat, Mehmet Ali

    2004-01-01

    Põhja-Küprose liidri väitel soovib türklaste kogukond diplomaatilise tunnustuse asemel isolatsiooni lõppemist. Intervjuus käsitletavad teemad: Küprose saare tulevik, liitumine Euroopa Liiduga, Türgi liitumine euroliiduga. Lisad: Kahe kogukonna - kreeklaste ja türklaste - vahel lõhestatud Küpros; Mehmet Ali Talat

  2. WAKTU PUASA ARAFAH PERSPEKTIF MUHAMMAD BIN SHALIH AL ‘UTSAYMIN: Telaah Kajian Hukum Islam dan Astronomi Islam

    Directory of Open Access Journals (Sweden)

    Benny Afwadzi

    2017-12-01

    Full Text Available All this time there was a different opinion about the time for Arafah fasting. Whether to comply with the provisions of Saudi Arabia or adjust the territory of each person. In Saudi Arabia, there appears a mufti named Muhammad bin Shalih al ‘Utsaymin who holds that fasting of Arafah must follow the country where a person lives. This opinion is interesting because it is different from other Salafis, such as ‘Abd al ‘Aziz bin Baz, Abdul Hakim bin Amir Abdat and HTI. Using the analytical tools of Islamic law and Islamic astronomy, the authors conclude that the fatwa issued by al ‘Utsaymin is considered quite representative, because considering the locality of a country, realizing the time of worship should adjust the kamariyah time of the country, and also in accordance with the mathla‘ in the form of mathla‘ wilayah al hukmi. Opinions as expressed by al ‘Utsaymin is conformable with the implementation of the time of the fasting of Arafat by the majority of Muslims in Indonesia.

  3. Confronting a Divided Past for a Shared Future: The Lieux de Mémoire of the Altab Ali Park in London

    OpenAIRE

    Vékony, Dániel

    2017-01-01

    This paper deals with the Altab Ali Park and its significance in regards to the Muslim community in the London borough of Tower Hamlets. Using Pierre Nora’s concept of lieux de Mémoire, I would like to demonstrate how the Bangladeshi Muslim minority and the rest of the community of Tower Hamlets construct their collective memory through the transformation of the park. The article argues that the Altab Ali Park is in Pierre Nora's term a lieu de Mémoire with a multiple layers, which has been d...

  4. STS-45 Earth observation of the Persian Gulf and the island of Abu Ali

    Science.gov (United States)

    1992-01-01

    STS-45 Earth observation taken aboard Atlantis, Orbiter Vehicle (OV) 104, is of the northern reaches of the Persian Gulf with the sunglint pattern centered on the Saudi Arabian island of Abu Ali. Bright features along the coast are thought to be deposits of oil, released from a terminal offshore of Kuwait during the recent Persian Gulf War. Further up the coast, in Kuwait, the black, oil-soaked desert surrounding the site of the oil well fires is clearly visible. View was taken from an altitude of 160 nautical miles with OV-104 located at 28 degrees north and 52.8 degrees east. During the STS-45 mission, an international survey team focused on oil contamination of the shallow-water habitants in the area north of Abu Ali Island. Crewmembers contacted the NOAA survey vessel, the R/V Mt. Mitchell, several times and photographed water color and sunglint within the study area and throughout the entire Persian Gulf. These photographic data are expected to aid the Persian Gulf researchers in

  5. Ali Canip Yöntem’in Sanata ve Edebiyata Bakışı Ali Canip Yöntem’s Perspective to Art and Literature

    Directory of Open Access Journals (Sweden)

    Abdullah HARMANCI

    2012-09-01

    Full Text Available Ali Canip Yöntem (1887-1967 who is one of the prominent names of the national literary movement gave many works relating to literary theory and criticism as well as poem. Before being connected to national literary, author who has largely been seeking on the line extending from Muallim Naci to Cedideci (New Literature movement and Fecr-i Aticis (Dawn of the Future has deep thoughts in his many articles that will light the way for today’s artists and researchers either due to hiscommand of our classical literature or of Western Literature. From hiswritings in question, in our article, opinions of Yöntem about somematters such as what is the art and literature, why it is existing, whatcould be its power and effect, how to take advantage of art andliterature, the place and importance of the imitation in art, pleasure,beauty, perception and genius concepts, purpose of art, relationshipbetween artist and school of art, art and dialectic, poem and knowledge,poem and sensation etc were scanned and these opinions were whollyattempted to be assessed. Apart from these, problems collected undersome titles such as what, in fact, is the concept of national literature adhow it should be understood, our mistakes when assessing the concept“national”, dimensions of artist and public when assessing within thecontext of national literature have been the topic of the Ali CanipYöntem’s articles and opinions of author about these issues wereattempted to be examined by us. Yöntem also referred to the problemsabout limits of literary criticism and features which a reviewer musthave, and attached importance to the relationship of literary criticismwith literary text. Milli edebiyat akımının önde gelen isimlerinden olan Ali Canip Yöntem (1887 – 1967, şiirin yanı sıra edebiyat teorisine ve eleştirisine ilişkin eserler de vermiştir. Milli edebiyata mensup olmadan önce, Muallim Naci’den Edebiyatı Cedidecilere, Fecr-i Âticilere uzanan

  6. A.G.A. program gives utilities a leg up on benchmarking

    International Nuclear Information System (INIS)

    Share, J.

    1997-01-01

    In this era of downsizing, distribution companies are banding together under the aegis of the American Gas Association to improve their performance, ultimately saving money and jobs. The Best Practice Benchmarking program began in 1990 when New Orleans Public Service coordinated an effort by several utilities wanting to compare practices and data. It is not benchmarking in the traditional sense. Best Practices stresses functional rather than competitive or numerical benchmarking by focusing on what utilities have done to improve their operations. In a report on Best Practices, John Bayko, Director of System Operations for Consumers Gas in Toronto, noted these success stories: Building odorant storage and transport facilities were found to save one company $17,500 annually because it could buy odorant in bulk as opposed to 55-gallon drums. Upgrading its cathodic protection system helped a company realize a 40 percent reduction in corrosion leaks over a two-year period, saving $200,000 a year. Another company began studying partnering with contractors which would eliminate the need of a pipeline inspector in each crew. Those potential savings are over $2 million. This paper describes three other Best Practices related to worker safety, system mapping, and activity-based accounting. A.G.A.'s role is briefly discussed

  7. Audito pasiūlos Baltijos šalių kapitalo rinkoms tyrimas

    OpenAIRE

    Černelis, Vidmantas

    2011-01-01

    Šiame darbe yra atskleidžiama ir analizuojama audito pasiūla tenkanti kapitalo rinkoms, nagrinėjama jos nepakankamumo problema. Darbo tikslas yra, įvertinus globalius audito pasiūlos pokyčius ir jų įtaką kapitalo rinkoms, atlikti audito pasiūlos ir auditoriaus pasirinkimo veiksnių Baltijos šalių kapitalo rinkoms tyrimą. Darbas skirstomas į tris pagrindines dalis. Pirmojoje dalyje apibūdinamas auditoriaus vaidmuo bei jo reikšmė ekonomikai, atskleidžiamas sisteminės rizikos, kylančios iš audito...

  8. Landslide detection using LiDAR data and data mining technology: Ali Mountain Highway case study (Taiwan)

    Science.gov (United States)

    Cheng, Youg-Sin; Yu, Teng-To; Tarolli, Paolo

    2017-04-01

    Taiwan mountains are severely affected each year by landslides, rock falls, and debris flows where the roads system suffer the most critical consequences. Among all mountain highways, Ali Highway, located into the main entrance of Alishan Mountain region, is one of the most landslide-prone areas in southern Taiwan. During the typhoon season, between May and August, the probability of occurrence of mass movements is at higher level than usual seeing great erosion rates. In fact, during Typhoon Morakot, in 2009, the intense rainfall caused abrupt interruption of the circulation for three months triggering several landslides (Liu et al. 2012). The topographic features such as slope, roughness and curvature among others have been extracted from 1 m DTM derived by a LiDAR dataset (collected in 2015) to investigate the slope failures along the Ali Mountain Highway. The high-resolution DTM highlighted that the hydrogeomorphological (e.g. density of stream, the distance from the ridge and terrain) features are one of the most influencing factors affecting the change and the instability of the slopes. To detect the landslide area, the decision tree classifier and the random forest algorithm (RF) have been adopted. The results provided a suitable analysis of the area involved in the failure. This will be a useful step in the understanding (and management) landslide processes of study area. References Liu CN, Dong JJ, Chen CJ, Lee WF (2012) Typical landslides and related mechanisms in Ali Mountain highway induced by typhoon Morakot: Perspectives from engineering geology. Landslides 9:239-254.

  9. Magma-driven antiform structures in the Afar rift: The Ali Sabieh range, Djibouti

    Science.gov (United States)

    Le Gall, Bernard; Daoud, Mohamed Ahmed; Maury, René C.; Rolet, Joël; Guillou, Hervé; Sue, Christian

    2010-06-01

    The Ali Sabieh Range, SE Afar, is an antiform involving Mesozoic sedimentary rocks and synrift volcanics. Previous studies have postulated a tectonic origin for this structure, in either a contractional or extensional regime. New stratigraphic, mapping and structural data demonstrate that large-scale doming took place at an early stage of rifting, in response to a mafic laccolithic intrusion dated between 28 and 20 Ma from new K-Ar age determinations. Our 'laccolith' model is chiefly supported by: (i) the geometry of the intrusion roof, (ii) the recognition of roof pendants in its axial part, and (iii) the mapping relationships between the intrusion, the associated dyke-sill network, and the upper volcanic/volcaniclastic sequences. The laccolith is assumed to have inflated with time, and to have upwardly bent its sedimentary roof rocks. From the architecture of the ˜1 km-thick Mesozoic overburden sequences, ca. 2 km of roof lifting are assumed to have occurred, probably in association with reactivated transverse discontinuities. Computed paleostress tensors indicate that the minimum principal stress axis is consistently horizontal and oriented E-W, with a dominance of extensional versus strike-slip regimes. The Ali Sabieh laccolith is the first regional-scale magma-driven antiform structure reported so far in the Afro-Arabian rift system.

  10. Peran Mukti Ali dalam Pengembangan Toleransi Antar Agama di Indonesia

    Directory of Open Access Journals (Sweden)

    Khairah Husin

    2014-06-01

    Full Text Available Agama sebagai sasaran kajian penelitian sudah banyak dilakukan oleh para sarjana disiplin ilmu. Mereka melakukan penelitian terhadap berbagai aspek dari agama, baik aspek ide maupun aspek perwujudan dalam kenyataan. Dimulai dari keyakinan dan ajaran yang dimiliki oleh suatu agama hingga pengaruh agama pada kehidupan masyarakat pemeluk agama tersebut. Kalau yang dimaksud metode dalam ilmu perbandingan agama adalah cara untuk memperoleh dan mamahami kebenaran agama dari realitas empiris, atau lebih tepatnya “kebenaran ilmiah agamis”, maka pendekatan tiada lain adalah suatu sikap ilmiah (persepsi dari seorang yang harus ditunjukkan untuk menemukan kebenaran ilmiah yang hendak diperoleh. Dengan demikian pendekatan sifatnya umum. Dalan suatu pendekatan tertentu dapat digunakan bermacammacam metode, umpamanya seorang Sosiolog akan mengkaji agama pasti akan menerapkan pendekatan metode-metode sosiologis. Begitu pula Sejarawan, Antropolog, Fenomenolog, dan lain-lain akan menerapkan pendekatan dan metode sesuai dengan latar belakang keahliannya. Maka sasaran ideal dari beberapa pendekatan adalah memperoleh interelasi yang sistematis dari fakta-fakta agama, dan bertujuan untuk mencari jawaban tentang fakta-fakta tersebut dengan menggunakan kesangsian sistematis. Pendekatan keilmuan dalam meneliti agama mencoba mendeskripsikan dunia pemeluk agama secara apa adanya (das sein, bukan didasarkan semestinya secara normatif (das sollen. Dengan demikian, pendekatan keilmuan yang empiris ini menggunakan dan mengadaptasi pendekatanpendekatan ilmu-ilmu sosial dan budaya. Dari sekian tokoh ilmu Perbandingan Agama, kebanyakan dari mereka merupakan ilmuwan Barat. Namun demikian ada juga beberapa tokoh perbandingan agama dari duni Islam, antara lain adalah Prof. Dr. H.A. Mukti Ali, Ibnu Hazm dan As-Syahrastani. Sementara Ibnu Hazm Al Andalusy dan As-Syahrastani merupakan tokoh-tokoh Perbaga Muslim dari zaman klasik – zaman ketika Perbaga belum terbentuk sebagai

  11. Patandžali jogas un Kundalīni jogas sintēze Tantra jogas doktrīnā

    OpenAIRE

    Hvoraks, Antons

    2007-01-01

    Antons Hvoraks, Patandžali Jogas un Kundalīni Jogas sintēze Tantra Jogas doktrīnā, Rīga, 2007. Darba tēze: „Tantra-joga” skolas filozofija ir Patandžali jogas un Kundalīni jogas sintēze. Darbs sastāv no ievada, trim nodaļām, kuras ir sadalītas 20 apakšnodaļās, un no noslēguma daļas ar secinājumiem. Pirmajā nodaļā tiek aplūkoti klasiskās jogas uzskati par Visumu un cilvēku, par iespējām sasniegt atbrīvošanu un jogas kustības lielo izplatību. Otrajā nodaļā aprakstīti tantrisma uzs...

  12. Pioneers of paediatrics: Professor Salah Abdelrahman Ali Taha

    Science.gov (United States)

    2013-01-01

    This article highlights the contributions of Professor Salah Abdelrahman Ali Taha (1927–1988), one of the pioneers in paediatrics in Sudan and Saudi Arabia. He graduated from Kitchener School of Medicine (renamed, Faculty of Medicine, University of Khartoum[U of K]) in 1952 and was awarded an MD from the U of K in 1973, having accomplished a survey on the prevalence and underlying causes of childhood malnutrition in 14 villages. His impact was remarkable in establishing child health services in Sudan and Saudi Arabia, and in laying the foundation of the Department of Pediatrics, College of Medicine, King Saud University. He was also an active researcher in various fields in child health, and was pioneering in those related to nutrition. Following his return to Sudan, Dr Salah A Taha was elected Member of Parliament from his rural district in Gezira State and was the Speaker of the House of Parliament in 1986. PMID:27493360

  13. Les « faux » mariages homosexuels de Sidi Ali au Maroc : enjeux d’un scandale médiatique

    Directory of Open Access Journals (Sweden)

    Florence Bergeaud-Blackler

    2012-01-01

    Full Text Available Les affaires de « mariages homosexuels » à Ksar el Kebir puis à Sidi Ali ont fait grand bruit dans la presse marocaine. Au-delà de l’émotion soulevée par le scandaleux amalgame entre l’institution respectée du mariage et une forme illégale de sexualité, elle a mis en évidence une transformation du traitement public de la question homosexuelle. Le changement de ton de la presse reflète-t-il celui de l’attitude de la société marocaine vis-à-vis de l’homosexualité ? Assiste-t-on à l’émergence d’une communauté homosexuelle militant pour la défense de ses droits ? Les « mariages » de Ksar el Kebir et de Sidi Ali constituent-ils des démonstrations visant à briser le tabou de l’homosexualité par l’émergence d’une « fierté » homosexuelle ? D’enquêtes menées à Sidi Ali, Fez et Casablanca, nous concluons que la médiatisation autour des affaires de mariages d’homosexuels a été un instrument d’une stratégie d’un « retour de la morale » aux relents nationalistes consécutive à la période d’establishement du roi Mohamed VI. L’article s’attache à montrer les enjeux locaux et nationaux d’une fausse chasse aux sorcières dans un pays où les conditions d’un débat sur la dépénalisation de l’homosexualité ne semblent pas encore réalisées.

  14. AL ITTIJAHAT AL MUNHARIFAH FI AT TAFSIR LI BADLI ASHAB AL MADZAHIB AL NAHWIYYAH WA BADL MAN YAJHALUNA QAWAID AL LUGHAH AL ARABIYYAH FI NADHAR MUHAMMAD HUSAIN AL DZAHABIY

    Directory of Open Access Journals (Sweden)

    Misbakhudin Misbakhudin

    2017-06-01

    Full Text Available One of the most precious achievement in qur’anic studies was the book of Al-Ittijâhât al-Munharifah fî al-Tafsîr: Dawâfi’uha wa Daf’uha written by A great Islamic scholar, Muhammad Husein al-Dzahabî. He was succeeded in discussing several issues of corruptions of the exegesis of the holy Qur’an. This article is aimed to explain and to describe his analysis toward several corrupted linguist interpretations in their originations and such corrupted linguistic interpretations of the holy Qur’an which are ignoring Arabic structures and grammers

  15. IJITIHAD SULTAN MUHAMMAD IDRUS KAIMUDDIN IBNU BADARUDDIN AL BUTHUNI (1824-1851: Akulturasi Islam dengan Budaya di Kesultanan Buton

    Directory of Open Access Journals (Sweden)

    Basrin Melamba

    2014-06-01

    Full Text Available The coming of Islam in the Buton Sultanate has brought a change in the social, political, even in the intellectual aspects. It produced scholars with the thought or ijitihad as a blend of Islamic and local cultures. One of the scholars as well as Buton Sultan was Muhammad Idrus Kaimuddin Ibnu Badaruddin Al Buthuni (1824-1851. His thought or ijitihad found the essence of the concept of manners according to the teachings of the ancestors in kabanti Bula Malino. His several works became the guidance of the public and court authorities in the Sultanate of Buton which were basically rooted from the teachings of Islam. Kaimuddin’s thought in terms of ethics, morals, manners, or advice showed his horizons of knowledge and the depth of leadership thought. The magnitude of Islamic influence in some of his works proves the enduring process of Islamic acculturation done continuously and deeply since the era of Buton Islamic empire. Kaimuddin’s thought is essentially a formation process of Buton’s civilization centered on the palace and passed to Buton society in general through the process of cultural dialogue between Buton culture (Wolio and Islam.

  16. Investigation of thermodynamic and mechanical properties of AlyIn1-yP alloys by statistical moment method

    Science.gov (United States)

    Ha, Vu Thi Thanh; Hung, Vu Van; Hanh, Pham Thi Minh; Tuyen, Nguyen Viet; Hai, Tran Thi; Hieu, Ho Khac

    2018-03-01

    The thermodynamic and mechanical properties of III-V zinc-blende AlP, InP semiconductors and their alloys have been studied in detail from statistical moment method taking into account the anharmonicity effects of the lattice vibrations. The nearest neighbor distance, thermal expansion coefficient, bulk moduli, specific heats at the constant volume and constant pressure of the zincblende AlP, InP and AlyIn1-yP alloys are calculated as functions of the temperature. The statistical moment method calculations are performed by using the many-body Stillinger-Weber potential. The concentration dependences of the thermodynamic quantities of zinc-blende AlyIn1-yP crystals have also been discussed and compared with those of the experimental results. Our results are reasonable agreement with earlier density functional theory calculations and can provide useful qualitative information for future experiments. The moment method then can be developed extensively for studying the atomistic structure and thermodynamic properties of nanoscale materials as well.

  17. AN ANALYSIS OF TRANSLATION TECHNIQUES IN THE ENGLISH VERSION OF ARRAHMAN SURAH

    Directory of Open Access Journals (Sweden)

    Farida Repelita Wati Kembaren

    2018-02-01

    Full Text Available The Holy Qur’an has been translated into many languages including English. However, different translator of the Holy Qur’an produces different English version of Al-Qur’an because every translator uses different translation techniques to translate Al-Qur’an. This study aims to compare the three English versions of Arrahman surah, and describe the most dominant translation techniques used by the three translators to translate the Holy Qur’an. Translation techniques proposed by Molina and Albir (2002, p.509-511 are used to analyze the data. The data for this study are words, phrases, and clauses in the 78 verses of Arrahman surah in Arabic and its three English versions translated by Maulawi Sher ‘Ali, Dr. Muhammad Taqi­ud­Din Al­Hilali and Dr. Muhammad Muhsin Khan, and Talal Itani. The result shows that there are four most dominant techniques used by the three translators in translating the Holy Qur’an; Adaptation, Amplification, Established Equivalent, and Literal Translation technique. The first and the second translator prefer to use Amplification to introduce details in brackets or footnotes, but the third translator prefers to use Established Equivalent to find a term or expression recognized (by dictionaries or language in use as an equivalent.

  18. Expounding a Few Key Strategies of Imam Ali (AS on Prevention of Diseases by Means of Improving Nutrition Style

    Directory of Open Access Journals (Sweden)

    Hossein Moradi

    2016-06-01

    Conclusion: Using the guidelines of Imam Ali (AS, new dimensions of prevention practices and treatment of chronic diseases can be achieved. Furthermore, many other hypotheses can be raised making available a wide range of scientific researches

  19. Thinking Muhammad Legenhausen's Non-Reductive Pluralism Through: Some Reflections about its Implications

    Directory of Open Access Journals (Sweden)

    STEFANO BIGLIARDI

    2014-12-01

    Full Text Available One of the most vibrant contemporary philosophical debates concerns the definition, and defence, of religious pluralism. The philosophers who address such a topic usually hold widely divergent views regarding its exact definition and the arguments through which it can be upheld. The absence of a general consensus notwithstanding, the debate on religious pluralism has ‘de facto’ become an important area of dialogue between different religions in general, and between Christianity and Islam in particular. At stake in the present paper is the discussion of pluralism developed by the US-American-Persian philosopher Muhammad (Gary Carl Legenhausen (b. 1953, that he presents as a criticism of the views of the late British theologian John Harwood Hick (1922-2012. Hick developed his views mainly influenced by Christianity, yet he also took into account some ideas advanced by Muslim authors. Legenhausen, a convert to Islam, puts forth his own version of pluralism in the framework of a discussion of the concept as it has emerged within Christianity, and advances a refutation of Hick's view complementary to his own theory of pluralism. The aim of the present pages is to offer an overview of Legenhausen’s contribution and discuss some of its possible implications and premises. In other words, rather than producing a defence of Legenhausen’s theory, this study is to analyse the logic behind and beyond his specific ‘Muslim proposal’ and explain what some of its unstated premises might be, as well as the consequences of fully embracing such stance, for philosophers, – not only Muslims ones –, interested in understanding religion from a religious point of view and in advocating that religious differences should not turn into a reason of animosity. The paper is divided into two main sections. The first one reconstructs Legenhausen's version of religious pluralism, while especially recalling the points with which it is presented as clashing with

  20. PETA GERAKAN SYI’AH DI KALIMANTAN SELATAN

    Directory of Open Access Journals (Sweden)

    Humaidy humaidy

    2014-05-01

    Full Text Available This article traces back the entry of the Shi’a in South Kalimantan through the inclusion of Islamic Wujudiyah (panentheism Sufismwhich was firstspreadin the kingdom of Banjar.  This isdue to the similaritybetween Wujudiyah Sufism with the concept of Irfan in Shi'a. However, the influence of Shia in  South Kalimantan  suffered a setback atthe era  of Syekh Muhammad al-Banjari Arsyad (1710-1812 AD.  According to Habib Ali,Shia began to revive in South Kalimantan after the Iranian revolution in 1979.  Ja’fari school of thought (madhabs  is the growing Shiah in South Kalimantan. The Developmentof Shi’a in South kalimantan faces manychallenges since Muslims in South Kalimantan have a strong belief in Sunni

  1. Diagnosis of hepatoma using grayscale and Doppler ultrasound in patients with chronic liver disease

    Directory of Open Access Journals (Sweden)

    Idris S

    2011-10-01

    Full Text Available Wasim A Memon, Zishan Haider, Mirza Amanullah Beg, Muhammad Idris, Tanveer-ul-Haq, Waseem Akhtar, Sidra IdrisRadiology Department, Aga Khan University Hospital, Karachi, Pakistan Every author contributed equally to the workObjective: To determine the diagnostic accuracy of liver ultrasound for the detection of hepatoma in chronic liver disease (CLD patients by either taking histopathology or serum α-fetoprotein levels or a biphasic computed tomography (CT scan (whichever is available as the gold standard.Study design: Cross-sectional.Place and duration of study: Radiology Department, The Aga Khan University Hospital, Karachi, Pakistan, from January 2007 to January 2010.Methods: A total of 239 patients (156 males and 83 females with clinical suspicion or surveillance of hepatoma in CLD referred to the radiology department for ultrasound evaluation followed by either liver biopsy and histopathology or serum α-fetoprotein level or biphasic CT scan.Results: The sensitivity of ultrasound for hepatoma detection in CLD was 65%, specificity was 85%, and accuracy was 70%, and positive predictive value and negative predictive value were 92% and 45%, respectively.Conclusion: Ultrasound is a relatively quick, safe, reasonably accurate, and noninvasive imaging modality for the detection of hepatoma in CLD and can be complemented with clinical assessment of screening high-risk patients.Keywords: hepatoma, ultrasound, radiology, chronic liver disease

  2. Contamination of mercury in tongkat Ali hitam herbal preparations.

    Science.gov (United States)

    Ang, H H; Lee, K L

    2006-08-01

    The DCA (Drug Control Authority), Malaysia has implemented the phase three registration of traditional medicines on 1 January 1992. As such, a total of 100 products in various pharmaceutical dosage forms of a herbal preparation found in Malaysia, containing tongkat Ali hitam, either single or combined preparations, were analyzed for the presence of a heavy toxic metal, mercury, using atomic absorption spectrophotometer, after performing a simple random sampling to enable each sample an equal chance of being selected in an unbiased manner. Results showed that 26% of these products possessed 0.53-2.35 ppm of mercury, and therefore, do not comply with the quality requirement for traditional medicines in Malaysia. The quality requirement for traditional medicines in Malaysia is not exceeding 0.5 ppm for mercury. Out of these 26 products, four products have already registered with the DCA, Malaysia whilst the rest, however, have not registered with the DCA, Malaysia.

  3. Şiî Kaynaklarda Ali B. Ebî Tâlib ve Fatıma Mushafı

    Directory of Open Access Journals (Sweden)

    Mehmet Atalan

    2015-11-01

    Full Text Available It isimportant to note that the issue of the mushaf of Ali b. Ebi Talib is neither based on inference nor is it a matter of belief but it is rather a historical and well-researched fact, and if there exists any dispute over this issue, it is regarding certain details and the eventual fate of this mushaf Most of the narrations indicate that Imam Ali mushaf was compiled on the basis of the order of the revelation of the surahs. However, there are differing views as regards the contents of the mushaf had whether it contained only the revealed text or the al-nuzul and the nasikh and mansukh. In one tradition it is said that Fatimah, after the Prophet passed away, used to write what she was told that would happen to her descendants and stories about other rulers to come. Fatimah recorded those information, which was kept in her family of Imams, and was called The Mushaf of Fatimah. But, The Mushaf of Fatimah is not a part of Quran. It does not have anything to do with Shari’ah and the religious practices

  4. Comparison of hyperspectral transformation accuracies of multispectral Landsat TM, ETM+, OLI and EO-1 ALI images for detecting minerals in a geothermal prospect area

    Science.gov (United States)

    Hoang, Nguyen Tien; Koike, Katsuaki

    2018-03-01

    Hyperspectral remote sensing generally provides more detailed spectral information and greater accuracy than multispectral remote sensing for identification of surface materials. However, there have been no hyperspectral imagers that cover the entire Earth surface. This lack points to a need for producing pseudo-hyperspectral imagery by hyperspectral transformation from multispectral images. We have recently developed such a method, a Pseudo-Hyperspectral Image Transformation Algorithm (PHITA), which transforms Landsat 7 ETM+ images into pseudo-EO-1 Hyperion images using multiple linear regression models of ETM+ and Hyperion band reflectance data. This study extends the PHITA to transform TM, OLI, and EO-1 ALI sensor images into pseudo-Hyperion images. By choosing a part of the Fish Lake Valley geothermal prospect area in the western United States for study, the pseudo-Hyperion images produced from the TM, ETM+, OLI, and ALI images by PHITA were confirmed to be applicable to mineral mapping. Using a reference map as the truth, three main minerals (muscovite and chlorite mixture, opal, and calcite) were identified with high overall accuracies from the pseudo-images (> 95% and > 42% for excluding and including unclassified pixels, respectively). The highest accuracy was obtained from the ALI image, followed by ETM+, TM, and OLI images in descending order. The TM, OLI, and ALI images can be alternatives to ETM+ imagery for the hyperspectral transformation that aids the production of pseudo-Hyperion images for areas without high-quality ETM+ images because of scan line corrector failure, and for long-term global monitoring of land surfaces.

  5. Synthesis and optical properties of turquoise- and green-colored brownmillerite- type Ba2In2-x-yMnxAlyO5+x codoped with manganese and aluminum

    Institute of Scientific and Technical Information of China (English)

    Peng Jiang; Wen-hui Yang; Yun-cheng Zhou; Jian-lei Kuang; Yong Li; Ting Xiao

    2016-01-01

    Brownmillerite-type oxides Ba2In2−x−yMnxAlyO5+x (0≤x≤ 0.6, 0≤y≤ 0.5) were prepared at 1300°C through solid-state reaction. X-ray diffraction (XRD) analysis showed that the structure symmetry evolved from orthorhombic to cubic with increasing Mn and Al con-tents. Wheny was greater than 0.3, peaks associated with small amounts of BaAl2O4 and Ba2InAlO5 impurities were observed in the XRD patterns. When substituted with a small amount of Mn (x≤ 0.3), the Ba2In2−x−yMnxAlyO5+x samples exhibited an intense turquoise color. The color changed to green and dark-green with increasing Mn concentration. UV–vis absorbance spectra revealed that the color changed only slightly upon Al doping. The valence state of Mn ions in Ba2In2−x−yMnxAlyO5+x was confirmed to be +5 on the basis of X-ray photoelectron spectroscopic analysis. According to this analysis, the intense turquoise color of the Ba2In2−x−yMnxAlyO5+x samples is rooted in the existence of Mn5+; thus, the introduction of Al does not affect the optical properties of the compounds.

  6. Shaft line systems draw the line systems (Kawam Din Muhammad ibn Mohammed Hussein al-Husseini (رمح الخط في نظم رسم الخط نظم (قوام الدين محمد بن محمد حسين الحسيني

    Directory of Open Access Journals (Sweden)

    Qassim Raheem Hassan المدرس. قاسم رحيم حسن

    2011-06-01

    Full Text Available We pray For Allah For Aid and Praise be to Allah, and peace be upon Muhammad and The God of the good and virtuous, and companions Almentajabin. After A. Scientists in this science a lot of acronyms and shaft line one important condensed systems in line and spelling rules which was written by Mirza strength Din Muhammad ibn Muhammad Mahdi al-Husseini Saifi Qazwini Alhily. The flag line systems of healing morphological eyebrow. Finished their Isfahan years (1123 AH and explained disciple famous with Mawla Mohsen and Alnhoi Qazwini. He called his explanation (font calendar not only governing the organized aware the systems in all branches of knowledge Fenrah regulated in the account (Account Summary and (systems message astrolabe In fiqh (systems Includes index In praise (Ithnaa Ashraat in Madaih In ethics him Orjosp has Orjosp in jurisprudence has Orjosp in the statement has Orjosp in intonation has Orjosp modulated with Orjosp in equalizer and Altrajih name of justice and charity has Orjosp in census Quran and some rules of Quran has Orjosp in exchange has Orjosp has Orjosp in as he has a cabinet Saifi Qazwini has Alchukaat almonzomma and Nozim Zobdat Alssol with the statement in the science system.

  7. Radiometric cross-calibration of EO-1 ALI with L7 ETM+ and Terra MODIS sensors using near-simultaneous desert observations

    Science.gov (United States)

    Chander, Gyanesh; Angal, Amit; Choi, Taeyoung; Xiong, Xiaoxiong

    2013-01-01

    The Earth Observing-1 (EO-1) satellite was launched on November 21, 2000, as part of a one-year technology demonstration mission. The mission was extended because of the value it continued to add to the scientific community. EO-1 has now been operational for more than a decade, providing both multispectral and hyperspectral measurements. As part of the EO-1 mission, the Advanced Land Imager (ALI) sensor demonstrates a potential technological direction for the next generation of Landsat sensors. To evaluate the ALI sensor capabilities as a precursor to the Operational Land Imager (OLI) onboard the Landsat Data Continuity Mission (LDCM, or Landsat 8 after launch), its measured top-of-atmosphere (TOA) reflectances were compared to the well-calibrated Landsat 7 (L7) Enhanced Thematic Mapper Plus (ETM+) and the Terra Moderate Resolution Imaging Spectroradiometer (MODIS) sensors in the reflective solar bands (RSB). These three satellites operate in a near-polar, sun-synchronous orbit 705 km above the Earth's surface. EO-1 was designed to fly one minute behind L7 and approximately 30 minutes in front of Terra. In this configuration, all the three sensors can view near-identical ground targets with similar atmospheric, solar, and viewing conditions. However, because of the differences in the relative spectral response (RSR), the measured physical quantities can be significantly different while observing the same target. The cross-calibration of ALI with ETM+ and MODIS was performed using near-simultaneous surface observations based on image statistics from areas observed by these sensors over four desert sites (Libya 4, Mauritania 2, Arabia 1, and Sudan 1). The differences in the measured TOA reflectances due to RSR mismatches were compensated by using a spectral band adjustment factor (SBAF), which takes into account the spectral profile of the target and the RSR of each sensor. For this study, the spectral profile of the target comes from the near-simultaneous EO-1

  8. Mass propagation of in vitro plantlets and extraction of bioactive compounds from Eurycoma Longifolia Jack (Tongkat Ali) using cell and organ cultures

    International Nuclear Information System (INIS)

    Sobri Hussein; Rusli Ibrahim

    2006-01-01

    Eurycoma longifolia Jack or better known in Malaysia as Tongkat Ali is an important herbal plant that owes its popularity locally and worldwide to its aphrodisiac claim and has been sought after as an essential component for the treatment of anti-malarial, anti-ulcer, anti-tumour promoting and anti-parasitic agent and also as health supplements. Quassinoids and canthin-6-one alkaloids contained in Tongkat Ali roots are the main substances having active functions for human body. Propagation is commonly done through seeds or some vegetative means such as cuttings of stems and root, grafting or layering. However, propagation by conventional method is inadequate to meet the demand due to low viability, low germination rate, delayed rooting and long life cycle. Tissue culture has been successfully applied for mass production of plantlets and extraction of many useful secondary metabolites, including pharmaceuticals, pigments and other fine chemicals. Tongkat Ali active substances have also been derived through cell culture technology but its processes need to be optimized before the product can be commercialized. Cell and organ cultures have been proven to be an efficient alternative method for biomass production due to its fast growth and stable metabolite production. In view of its potential commercial value as a plantation crop as well as to conserve its germplasm, micropropagation technique using cell culture system is an attractive method for regeneration and mass propagation. (Author)

  9. Selon une étude réalisée en Amérique latine, l'investissement dans l ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Selon une étude réalisée en Amérique latine, l'accès à Internet haute vitesse ... contribuer au développement social et économique, mais uniquement s'il est ... Le réseau a aussi découvert que l'impact des services à large bande sur la ...

  10. ALICE distributed analysis of the K*(892)0 signal in pp events with the AliEn package

    International Nuclear Information System (INIS)

    Badala, A.; Barbera, R.; Lo Re, G.; Palmeri, A.; Pappalardo, G.S.; Pulvirenti, A.; Riggi, F.

    2004-01-01

    A simulation study concerning the K*(892)0 resonance was carried out within the ALICE Collaboration, in order to evaluate the capability of the detector in the reconstruction of this signal in pp collisions at the Large Hadron Collider (LHC) energy. A description of the analysis procedure which makes use of AliEn, the ALICE package for distributed computing, is given together with the obtained results

  11. ALICE distributed analysis of the $K^{*}(892)^{0}$ signal in pp events with the AliEn package

    CERN Document Server

    Badalà, A; Palmeri, A; Pappalardo, G S; Pulvirenti, A; Lo Re, G; Riggi, F

    2004-01-01

    A simulation study concerning the K*(892)**0 resonance was carried out within the ALICE Collaboration, in order to evaluate the capability of the detector in the reconstruction of this signal in pp collisions at the Large Hadron Collider (LHC) energy. A description of the analysis procedure which makes use of AliEn, the ALICE package for distributed computing, is given together with the obtained results.

  12. Outcome prediction in pneumonia induced ALI/ARDS by clinical features and peptide patterns of BALF determined by mass spectrometry.

    Science.gov (United States)

    Frenzel, Jochen; Gessner, Christian; Sandvoss, Torsten; Hammerschmidt, Stefan; Schellenberger, Wolfgang; Sack, Ulrich; Eschrich, Klaus; Wirtz, Hubert

    2011-01-01

    Peptide patterns of bronchoalveolar lavage fluid (BALF) were assumed to reflect the complex pathology of acute lung injury (ALI)/acute respiratory distress syndrome (ARDS) better than clinical and inflammatory parameters and may be superior for outcome prediction. A training group of patients suffering from ALI/ARDS was compiled from equal numbers of survivors and nonsurvivors. Clinical history, ventilation parameters, Murray's lung injury severity score (Murray's LISS) and interleukins in BALF were gathered. In addition, samples of bronchoalveolar lavage fluid were analyzed by means of hydrophobic chromatography and MALDI-ToF mass spectrometry (MALDI-ToF MS). Receiver operating characteristic (ROC) analysis for each clinical and cytokine parameter revealed interleukin-6>interleukin-8>diabetes mellitus>Murray's LISS as the best outcome predictors. Outcome predicted on the basis of BALF levels of interleukin-6 resulted in 79.4% accuracy, 82.7% sensitivity and 76.1% specificity (area under the ROC curve, AUC, 0.853). Both clinical parameters and cytokines as well as peptide patterns determined by MALDI-ToF MS were analyzed by classification and regression tree (CART) analysis and support vector machine (SVM) algorithms. CART analysis including Murray's LISS, interleukin-6 and interleukin-8 in combination was correct in 78.0%. MALDI-ToF MS of BALF peptides did not reveal a single identifiable biomarker for ARDS. However, classification of patients was successfully achieved based on the entire peptide pattern analyzed using SVM. This method resulted in 90% accuracy, 93.3% sensitivity and 86.7% specificity following a 10-fold cross validation (AUC = 0.953). Subsequent validation of the optimized SVM algorithm with a test group of patients with unknown prognosis yielded 87.5% accuracy, 83.3% sensitivity and 90.0% specificity. MALDI-ToF MS peptide patterns of BALF, evaluated by appropriate mathematical methods can be of value in predicting outcome in pneumonia induced

  13. Factors influencing development of management strategies for the Abou Ali River in Lebanon I: spatial variation and land use.

    Science.gov (United States)

    Massoud, May A; El-Fadel, Mutasem; Scrimshaw, Mark D; Lester, John N

    2006-06-01

    Surface water bodies are progressively subject to increasing stress as a result of environmentally degrading processes primarily related to anthropogenic activities. This study assesses and examines the impact of land use and land-based activities on the spatial variation in water quality of the Abou Ali River in North Lebanon. It is the first detailed study of its kind in Lebanon and adds to the existing knowledge by shedding light on a relatively small Mediterranean river in a developing country where there is a paucity of such studies. The assessment was conducted at the end of the dry season in 2002 and 2003 and the end of the wet season in 2003 and 2004. The study has demonstrated the importance of anthropogenic influences on the water quality of the Abou Ali River Basin, as concentrations of most contaminants were higher at locations with greatest human activity. The most adversely affected area was the section of the river that flows through an entirely urbanized and highly populated region, the Tripoli conurbation. Upstream rural sites were enriched by contaminants primarily from non-point sources such as agricultural runoff and poultry litter whereas contaminant concentrations at the urban sites were enriched by a combination of sewage discharge and flow of contaminants from upstream. If the Abou Ali River is to be utilized as a managed water resource and its water quality sustained, point source discharges will require treatment and land use management must be planned to minimize the impact of diffuse source pollution on the river. A high priority should be given to the implementation and enforcement of the precautionary and polluter pays principles. Moreover, an effective legal, economic and institutional framework is required to encourage investment in waste reduction and control and to introduce environmentally sound practices.

  14. Use of EO-1 Advanced Land Imager (ALI) multispectral image data and real-time field sampling for water quality mapping in the Hirfanlı Dam Lake, Turkey.

    Science.gov (United States)

    Kavurmacı, Murat; Ekercin, Semih; Altaş, Levent; Kurmaç, Yakup

    2013-08-01

    This paper focuses on the evaluation of water quality variations in Hirfanlı Water Reservoir, which is one of the most important water resources in Turkey, through EO-1 (Earth Observing-1) Advanced Land Imager (ALI) multispectral data and real-time field sampling. The study was materialized in 20 different sampling points during the overpass of the EO-1 ALI sensor over the study area. A multi-linear regression technique was used to explore the relationships between radiometrically corrected EO-1 ALI image data and water quality parameters: chlorophyll a, turbidity, and suspended solids. The retrieved and verified results show that the measured and estimated values of water quality parameters are in good agreement (R (2) >0.93). The resulting thematic maps derived from EO-1 multispectral data for chlorophyll a, turbidity, and suspended solids show the spatial distribution of the water quality parameters. The results indicate that the reservoir has average nutrient values. Furthermore, chlorophyll a, turbidity, and suspended solids values increased at the upstream reservoir and shallow coast of the Hirfanlı Water Reservoir.

  15. Porphyry Cu-Au mineralization in the Mirkuh Ali Mirza magmatic complex, NW Iran

    Science.gov (United States)

    Maghsoudi, A.; Yazdi, M.; Mehrpartou, M.; Vosoughi, M.; Younesi, S.

    2014-01-01

    The Mirkuh Ali Mirza Cu-Au porphyry system in East Azerbaijan Province is located on the western part of the Cenozoic Alborz-Azerbaijan volcanic belt. The belt is also an important Cu-Mo-Au metallogenic province in northwestern Iran. The exposed rocks in the study area consist of a volcaniclastic sequence, subvolcanic rocks and intermediate to mafic lava flows of Neogene age. The volcanic rocks show a typical subduction-related magmatic arc geological and geochemical signature, with low concentration of Nb, Ta, and Ti. Mineralization is hosted by Neogene dacitic tuff and porphyritic dacite situated at the intersections of northeast and northwest faults. Field observations, alteration zonation, geochemical haloes and isotopic data of the Mirkuh Ali Mirza magmatic complex show similarities with typical convergent margin Cu-Au porphyry type deposits. The following features confirm the classic model for Cu-Au porphyry systems: (a) close spatial association with high-K calcalkaline to shoshonitic rock related to post-collision extensional setting (b) low grade Cu (0.57%) (c) stockworks as well as disseminated sulfides (c) zonality of the alteration patterns from intense phyllic at the center to outward weak-phyllic, argillic, and propylitic (d) the presence of a pyritic halo (e) accompanied by sheeted veins and low-sulfidation epithermal gold (f) mineralization spatially associated with intersection of structures, (g) genetically related to diorite porphyry stocks at depth (h) geochemical zonation of (Cu ± Au ± Ag ± Bi) → (Cu + Mo ± Bi ± Au ± Pb ± Zn ± As) → (Au + Mo ± Pb ± Zn) → (As + Ag + Sb + Mn + Ba + Pb + Zn + Hg) → Hg from center to outwards (i) The range of sulfur isotopic values is approximately zero (interpreted to have magmatic source) and similar to other subduction-related porphyry Cu deposits.

  16. Synthesis of Multispectral Bands from Hyperspectral Data: Validation Based on Images Acquired by AVIRIS, Hyperion, ALI, and ETM+

    Science.gov (United States)

    Blonski, Slawomir; Glasser, Gerald; Russell, Jeffrey; Ryan, Robert; Terrie, Greg; Zanoni, Vicki

    2003-01-01

    Spectral band synthesis is a key step in the process of creating a simulated multispectral image from hyperspectral data. In this step, narrow hyperspectral bands are combined into broader multispectral bands. Such an approach has been used quite often, but to the best of our knowledge accuracy of the band synthesis simulations has not been evaluated thus far. Therefore, the main goal of this paper is to provide validation of the spectral band synthesis algorithm used in the ART software. The next section contains a description of the algorithm and an example of its application. Using spectral responses of AVIRIS, Hyperion, ALI, and ETM+, the following section shows how the synthesized spectral bands compare with actual bands, and it presents an evaluation of the simulation accuracy based on results of MODTRAN modeling. In the final sections of the paper, simulated images are compared with data acquired by actual satellite sensors. First, a Landsat 7 ETM+ image is simulated using an AVIRIS hyperspectral data cube. Then, two datasets collected with the Hyperion instrument from the EO-1 satellite are used to simulate multispectral images from the ALI and ETM+ sensors.

  17. Analysis and Study of Muhammad Husayn Tabataba'i's Theory about the origin of secondary philosophical intelligibles using Morteza Motahhari's Commenting

    Directory of Open Access Journals (Sweden)

    Alireza Dorri Nogoorani

    2018-02-01

    Full Text Available Secondary philosophical intelligibles are general philosophical concepts such as existence, non-existence, cause, effect and accident on which the life of Islamic philosophy depends. Muhammad Husayn Tabataba'I has tried to propose a comprehensive theory about the way through which secondary philosophical intelligibles are originated. He believes that these intelligibles are first understood through relational concepts and then non-relational concepts are abstracted from those relational ones and generalized. This article tries to give a clear formulation of the theory with four phases (in addition to its foundations using Tabataba'i's works and Motahhari's comments. The resuts of this research study shows that these concepts are not delusion. It also depicts that these concepts are not extracted from internal or external experiences or primordial human nature (fitrah but are created from perceptive faculty. In addition, some other key issues to which Allameh has not paid enough attention, such as how to generalize the concept of secondary intelligible which has been abstracted from a special mental state to the whole world and the relationship between secondary intelligible obtained in the mind and the object to which the secondary intelligible refers, have been stated and the researcher has tried to find answers for these questions.

  18. Conformational preferences of DNA following damage by aristolochic acids: Structural and energetic insights into the different mutagenic potential of the ALI and ALII-N(6)-dA adducts.

    Science.gov (United States)

    Kathuria, Preetleen; Sharma, Purshotam; Abendong, Minette N; Wetmore, Stacey D

    2015-04-21

    Aristolochic acids (AAI and AAII), produced by the Aristolochiaceae family of plants, are classified as group I (human) carcinogens by the International Agency for Research on Cancer. These acids are metabolized in cells to yield aristolactams (ALI and ALII, respectively), which further form bulky adducts with the purine nucleobases. Specifically, the adenine lesions are more persistent in cells and have been associated with chronic renal diseases and related carcinogenesis. To understand the structural basis of the nephrotoxicity induced by AAs, the ALI-N(6)-dA and ALII-N(6)-dA lesions are systematically studied using computational methods. Density functional theory calculations indicate that the aristolactam moiety intrinsically prefers a planar conformation with respect to adenine. Nucleoside and nucleotide models suggest that the anti and syn orientations about the glycosidic bond are isoenergetic for both adducts. Molecular dynamics simulations and free energy calculations reveal that the anti base-displaced intercalated conformation is the most stable conformer for both types of AL-N(6)-dA adducted DNA, which agrees with previous experimental work on the ALII-N(6)-dA adduct and thereby validates our approach. Interestingly, this conformer differs from the dominant conformations adopted by other N6-linked adenine lesions, including those derived from polycyclic aromatic hydrocarbons. Furthermore, the second most stable syn base-displaced intercalated conformation lies closer in energy to the anti base-displaced intercalated conformation for ALI-N(6)-dA compared to ALII-N(6)-dA. This indicates that a mixture of conformations may be detectable for ALI-N(6)-dA in DNA. If this enhanced conformational flexibility of double-stranded DNA persists when bound to a lesion-bypass polymerase, this provides a possible structural explanation for the previously observed greater nephrotoxic potential for the ALI versus ALII-N(6)-dA adduct. In addition, the structural

  19. Effet des conditions climatiques sur le niveau du lac Sidi Ali (Moyen Atlas, Maroc)

    OpenAIRE

    Sayad, Ahmed; Chakiri, Saïd; Martin, Claude; Bejjaji, Zohra; Echarfaoui, Hassan

    2012-01-01

    Le lac Sidi Ali est un lac naturel d'altitude (2070-2080 m), sans exutoire superficiel, déterminé par le barrage d'une coulée basaltique. Doté d'un bassin versant apparent de 15,6 km2, il est alimenté par des eaux de ruissellement et par des sources karstiques. Son niveau subit des variations très fortes, annuelles et interannuelles, sous le contrôle des conditions climatiques, et en particulier des pluies et de l'évapotranspiration. Les périodes de sécheresse qui ont marqué les trois dernièr...

  20. Morbility, clinical data and proteomic analysis of IUGR and AGA newborns at different gestational ages

    Directory of Open Access Journals (Sweden)

    M.D. Ruiz-González

    2016-12-01

    Full Text Available The data are related to the proteomic analysis of 43 newborns with intrauterine growth retardation (IUGR and 45 newborns with appropriate weight for gestational age (AGA carried out by separation via 2DE and analyzed by MS–TOF/TOF. All newborns were separated into three gestational age groups, "Very Preterm" 29–32 weeks, "Moderate Preterm" 33–36 weeks, and, "Term" ≥37weeks. From each newborn, blood was drawn three times from birth to 1 month life. High-abundant serum proteins were depleted, and the minority ones were separated by 2DE and analyzed for significant expression differences. The data reflect analytic and clinic variables analyzed globally and categorized by gestational age in relation to IUGR and the optimization of conditions for 2-DE separation. The data from this study are related to the research article entitled "Alterations of Protein Expression in Serum of Infants with Intrauterine Growth Restriction and Different Gestational Ages" (M.D. Ruis-González, M.D. Cañete, J.L. Gómez-Chaparro, N. Abril, R. Cañete, J. López-Barea, 2015 [1]. The present dataset of serum IUGR newborn proteome can be used as a reference for any study involving intrauterine growth restriction during the first month of life.

  1. ALI and DAC for transuranic elements based on the metabolic data presented in ICRP publication 48

    OpenAIRE

    外川 織彦; 山口 勇吉; 本間 俊充

    1987-01-01

    最近刊行されたICRPの報告書、ICRP Publication 48にはICRP Publication 30の年摂取限度(ALI)と誘導空気中濃度(DAC)の計算に採用されたデータと比較して、いくつかの超ウラン元素について新しい代謝データが示されている。

  2. Study of the raw materials used in the manufacture of ceramics in Fran Ali (Oued Laou, Marruecos); Estudio de materiales usados en la fabricacion de las ceramicas de Fran Ali (Oued Laou, Marruecos)

    Energy Technology Data Exchange (ETDEWEB)

    Barrios Neira, J.; Martin de la Cruz, J. C.; Montealegre Contreras, L.

    2012-11-01

    The thermal behaviour, mineralogy, texture and micro-structure of the original rocks used as raw materials in the manufacture of ceramics of the potter community in Fran Ali (Oued Laou, Tetouan, Morocco) were studied. The original rocks of the alteration deposit are metapelites and altered philites from the Units Malaguide-Gomaride in the Baetic-Rifian mountain system. The techniques used by local potters and the water used to prepare the ceramic bodies were also studied. Original rocks are metapelites or filadios and raw materials belong to levels caused by exogenous or supergene alteration (quartz-illite and chlorite type clays). The ceramics studied by microscopy exhibit anisotropy. (Author) 15 refs.

  3. Pharmacognostic and phytochemical analyses of leaves and seed storage of abutilon pakistanicum jafri and ali an endemic plant of pakistan

    International Nuclear Information System (INIS)

    Fatima, H.; Munir, U.

    2014-01-01

    There are vast varieties of medicinal plant in the world having therapeutical importance. With increasing popularity of herbal medicine as a curative measure, the need for correct identification and standardization of the plant is also increased. Present work was performed to study the pharmacognostic and phytochemical characters of leaves and exsitu seed conservation by seed storage of Abutilon pakistanicum Jafri and Ali. It is an endemic plant, found in the sub tropical regions of Pakistan and is used in traditional medicine for treating rheumatism. The leaves of Abutilon pakistanicum Jafri andAli were investigated for pharmacognostic parameters. Phytochemical screening, macroscopic characters, physiochemical attributes and fluorescence analysis. The results revealed the presence of pharmacologically active compounds like alkaloids, flavonoids, terpinoids, saponins and phenolic compounds, leaf constant values and the extractive values obtained were found close to the values reported for other Abutilon species, while high ash value indicated presence of impurities in the crude drug. The investigation provides information for correct identification and authentication of plant species for further studies and medicinal evaluation of the species. (author)

  4. Analytical Characterization of Rococo Paintings in Egypt: Preliminary Results from El-Gawhara Palace at Cairo

    Directory of Open Access Journals (Sweden)

    Fatma REFAAT

    2012-12-01

    Full Text Available El-Gawhara palace (1813–1814 AD is situated south of the Mosque of Muhammad Ali in the Cairo Citadel. This palace is an important example of the best early 19th century rococo decorations in Egypt. The present study reports some of the results obtained from the application of different analytical techniques to characterize some rococo paintings at El-Gawhara palace at Cairo, Egypt. The characterization of the studied paintings was carried out by means of optical microscopy (OM, scanning electron microscopy equipped with an energy dispersive X-ray detector (EDS and Fourier transform infrared spectroscopy (FT−IR. The obtained results allowed the identification of the chemical composition, structure and the painting technique employed in these paintings. This methodology reveals some useful information on some rococo paintings dating back to the 19th century in Egypt.

  5. Odonata (Insecta diversity of Salim Ali Bird Sanctuary and its adjacent areas in Thattekkad, Kerala, India

    Directory of Open Access Journals (Sweden)

    A.P. Varghese

    2014-06-01

    Full Text Available Odonata diversity of Salim Ali Bird Sanctuary and its adjacent areas in Thattekkad, Kerala, India were documented from 2010 to 2012. Opportunistic observations were carried out to record species diversity. Eighty-two species of Odonata, which included 51 species of Anisoptera (dragonflies and 31 species of Zygoptera (damselflies, were recorded during the study. Of this 21 species are endemic to the Western Ghats. The presence of the IUCN categorized nearly threatened species like Megalogomphus hannyngtoni and vulnerable species like Platysticta deccanensis and Protosticta sanguinostigma is remarkable.

  6. Interview with Muhammad Affan Othman on Small Changes

    Directory of Open Access Journals (Sweden)

    Vahid Nimehchisalem

    2017-04-01

    Full Text Available Small Changes, a community organization in Malaysia (www.smallchangesmy.org, was founded in 2011 to raise funds and provide support for underprivileged individuals in the community. With an interesting tagline of Cultivating Volunteerism, Empowering Generations this community organizations has raised hundreds of thousands and has attracted tens of Malaysian students from local and overseas universities. The team consists of an enthusiastic group of young Malaysians who believe that it is possible to create big differences in the community with small changes. I had the pleasure of meeting the team in one of their social event in Kuala Lumpur. What you are going to read is the responses provided by the Vice President of Strategic Planning Unit, Mr. Muhammad Affan Othman, who kindly consented to an E-mail interview. The interview VN[1]: Perhaps we could start with a short introduction of Small Changes. Could you please tell our readers about your organization and its objective? MAO[2]: Small Changes started from an idea coined by our founders in which they aspire to create social awareness by making one small change at a time. For example, they started helping flood victims in flood prone locations in Malaysia such as in Kelantan and reaching out orphanage by offering them some help in terms of financial aid. As the organization grows, they started diving into more projects that have diverse aims such as tackling education inequality, which is translated into our Seeds of Deeds initiative, which has been done annually since 2014. However, since 2016, Small Changes has decided to shift gears and start to focus on becoming an organization that offers a platform for volunteering for youths and at the same time empowering both its volunteers and its beneficiaries. These will be made possible through our projects that allow Malaysian youths to participate and become empowered as they are actively participating in a nation building effort. Through these

  7. Outcome prediction in pneumonia induced ALI/ARDS by clinical features and peptide patterns of BALF determined by mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Jochen Frenzel

    Full Text Available BACKGROUND: Peptide patterns of bronchoalveolar lavage fluid (BALF were assumed to reflect the complex pathology of acute lung injury (ALI/acute respiratory distress syndrome (ARDS better than clinical and inflammatory parameters and may be superior for outcome prediction. METHODOLOGY/PRINCIPAL FINDINGS: A training group of patients suffering from ALI/ARDS was compiled from equal numbers of survivors and nonsurvivors. Clinical history, ventilation parameters, Murray's lung injury severity score (Murray's LISS and interleukins in BALF were gathered. In addition, samples of bronchoalveolar lavage fluid were analyzed by means of hydrophobic chromatography and MALDI-ToF mass spectrometry (MALDI-ToF MS. Receiver operating characteristic (ROC analysis for each clinical and cytokine parameter revealed interleukin-6>interleukin-8>diabetes mellitus>Murray's LISS as the best outcome predictors. Outcome predicted on the basis of BALF levels of interleukin-6 resulted in 79.4% accuracy, 82.7% sensitivity and 76.1% specificity (area under the ROC curve, AUC, 0.853. Both clinical parameters and cytokines as well as peptide patterns determined by MALDI-ToF MS were analyzed by classification and regression tree (CART analysis and support vector machine (SVM algorithms. CART analysis including Murray's LISS, interleukin-6 and interleukin-8 in combination was correct in 78.0%. MALDI-ToF MS of BALF peptides did not reveal a single identifiable biomarker for ARDS. However, classification of patients was successfully achieved based on the entire peptide pattern analyzed using SVM. This method resulted in 90% accuracy, 93.3% sensitivity and 86.7% specificity following a 10-fold cross validation (AUC = 0.953. Subsequent validation of the optimized SVM algorithm with a test group of patients with unknown prognosis yielded 87.5% accuracy, 83.3% sensitivity and 90.0% specificity. CONCLUSIONS/SIGNIFICANCE: MALDI-ToF MS peptide patterns of BALF, evaluated by appropriate

  8. VizieR Online Data Catalog: AKARI IRC asteroid sample diameters & albedos (Ali-Lagoa+, 2018)

    Science.gov (United States)

    Ali-Lagoa, V.; Mueller, T. G.; Usui, F.; Hasegawa, S.

    2017-11-01

    Table 1 contains the best-fitting values of size and beaming parameter and corresponding visible geometric albedos for the full AKARI IRC sample. We fitted the near-Earth asteroid thermal model (NEATM) of Harris (1998Icar..131..291H) to the AKARI IRC thermal infrared data (Murakami et al., 2007PASJ...59S.369M, Onaka et al., 2007PASJ...59S.401O, Ishihara et al., 2010A&A...514A...1I, Cat. II/297, Usui et al., 2011PASJ...63.1117U, Cat. J/PASJ/63/1117, Takita et al., 2012PASJ...64..126T, Hasegawa et al., 2013PASJ...65...34H, Cat. J/PASJ/65/34). The NEATM implementation is described in Ali-Lagoa and Delbo' (2017A&A...603A..55A, cat. J/A+A/603/A55). Minimum relative errors of 10, 15, and 20 percent are given for size, beaming parameter and albedo in those cases where the beaming parameter could be fitted. Otherwise, a default value of the beaming parameter is assumed based on Eq. 1 in the article, and the minimum relative errors in size and albedo increase to 20 and 40 percent (see the discussions in Mainzer et al., 2011ApJ...736..100M, Ali-Lagoa et al., 2016A&A...591A..14A, Cat. J/A+A/591/A14). We also provide the asteroid absolute magnitudes and G12 slope parameters retrieved from Oszkiewicz et al. (2012), the number of observations used in each IRC band (S9W and L18W), plus the heliocentric and geocentric distances and phase angle (r, Delta, alpha) based on the ephemerides taken from the MIRIADE service (http://vo.imcce.fr/webservices/miriade/?ephemph). (1 data file).

  9. Links between the Prophet Muhammad (PBUH) recommended foods and disease management: A review in the light of modern superfoods.

    Science.gov (United States)

    Ali, Sharique A; Parveen, Naima; Ali, Ayesha S

    2018-01-01

    Nutrition and other bioactive natural products present in specific foods within a balanced diet play an indispensable role in maintaining and promoting human health. Plants are rich sources of a balanced nutrition because of high content of bioactive products; hence, most of them recently have acquired the status of superfoods. It has been used since ancient times for the treatment of various ailments, and these traditional medicines still remain as one of the most affordable and easily accessible sources of treatment in the primary health-care system. The scientifically based use of these superfoods date back to the era of Prophet Muhammad along with other historical uses of plant products. Prescription of a large number of herbal foods such as dates, pomegranate, olives, figs, grapes, and black seeds was successfully proposed by him. These recently have become superfoods with their powerful healing properties and act as favorable dietary interventions for disease prevention as well as for the good maintenance of health. The use of these foods as ingredients of natural origin with fewer side effects seems to be more favorable than the chemical treatment, which is often complicated. The present review is an attempt to provide a brief survey of the literature on scientifically based significance of these superfoods carried out by various researchers and exploration of a wide spectrum of their pharmacological actions which include antidiabetic, anticancer, immune modulator, analgesic, anti-inflammatory, and hepatoprotective properties.

  10. His Excellency Mr Ali Naci Koru Ambassador extraordinary and plenipotentiary Permanent Representative of Turkey to the United Nations Office at Geneva and other international organisations in Switzerland

    CERN Multimedia

    Bennett, Sophia Elizabeth

    2017-01-01

    His Excellency Mr Ali Naci Koru Ambassador extraordinary and plenipotentiary Permanent Representative of Turkey to the United Nations Office at Geneva and other international organisations in Switzerland

  11. Parallelization of the AliRoot event reconstruction by performing a semi- automatic source-code transformation

    CERN Multimedia

    CERN. Geneva

    2012-01-01

    side bus or processor interconnections. Parallelism can only result in performance gain, if the memory usage is optimized, memory locality improved and the communication between threads is minimized. But the domain of concurrent programming has become a field for highly skilled experts, as the implementation of multithreading is difficult, error prone and labor intensive. A full re-implementation for parallel execution of existing offline frameworks, like AliRoot in ALICE, is thus unaffordable. An alternative method, is to use a semi-automatic source-to-source transformation for getting a simple parallel design, with almost no interference between threads. This reduces the need of rewriting the develop...

  12. The effect of a knowledge-based ergonomic intervention amongst administrators at Aga Khan University Hospital, Nairobi.

    Science.gov (United States)

    Wanyonyi, Nancy; Frantz, Jose; Saidi, Hassan

    2015-01-01

    Low back pain (LBP) and neck pain are part of the common work-related musculoskeletal disorders with a large impact on the affected person. Despite having a multifactorial aetiology, ergonomic factors play a major role thus necessitating workers' education. To determine the prevalence of ergonomic-related LBP and neck pain, and describe the effect of a knowledge-based ergonomic intervention amongst administrators in Aga Khan University Hospital, Nairobi. This study applied a mixed method design utilizing a survey and two focus group discussions (FGD). A self-administered questionnaire was distributed to 208 participants through systematic sampling. A one hour knowledge-based ergonomic session founded on the survey results was thereafter administered to interested participants, followed by two FGDs a month later with purposive selection of eight participants to explore their experience of the ergonomic intervention. Quantitative data was captured and analyzed using SPSS by means of descriptive and inferential statistics, whereas thematic content analysis was used for qualitative data. Most participants were knowledgeable about ergonomic-related LBP and neck pain with a twelve month prevalence of 75.5% and 67.8% respectively. Continual ergonomic education is necessary for adherence to health-related behaviours that will preventwork-related LBP and neck pain.

  13. Examination of the "Theory of Guidance" in the View of 'Ali Ibn Abi Talib (A): An Exploration into the Nahj Al-Balaghah

    Science.gov (United States)

    Rostami-Nasab, Abas Ali; Tajedini, Oranus; Sadatmoosavi, Ali

    2016-01-01

    This study examines the "Theory of Guidance" according to 'Ali ibn Abi Talib (a). This theory is based on three divine covenants or fundamentals in guidance including the divine Prophet, the divine Book, and the divine human nature ("fitrat"). Research in this regard seems essential because this theory has not been previously…

  14. Investigation on the neutral and anionic BxAlyH2 (x + y = 7, 8, 9) clusters using density functional theory combined with photoelectron spectroscopy.

    Science.gov (United States)

    Ding, Li-Ping; Shao, Peng; Lu, Cheng; Zhang, Fang-Hui; Ding, Lei; Yuan, Tao Li

    2016-08-17

    The structure and bonding nature of neutral and negatively charged BxAlyH2 (x + y = 7, 8, 9) clusters are investigated with the aid of previously published experimental photoelectron spectra combined with the present density functional theory calculations. The comparison between the experimental photoelectron spectra and theoretical simulated spectra helps to identify the ground state structures. The accuracy of the obtained ground state structures is further verified by calculating their adiabatic electron affinities and vertical detachment energies and comparing them against available experimental data. The results show that the structures of BxAlyH2 transform from three-dimensional to planar structures as the number of boron atoms increases. Moreover, boron atoms tend to bind together forming Bn units. The hydrogen atoms prefer to bind with boron atoms rather than aluminum atoms. The analyses of the molecular orbital on the ground state structures further support the abovementioned results.

  15. Occurrence and genesis of Quaternary microbialitic tufa at Hammam Al Ali, Oman

    Science.gov (United States)

    Khalaf, Fikry I.

    2017-05-01

    Remnants of late Quaternary microbialitic tufa occurs within a shallow depression in the Hammam Al Ali hot spring area, which is located approximately 14.5 km to the southwest of Muscat, Oman. The tufa precipitated from hot spring water supersaturated with respect to calcium carbonate and is mostly of a porous phytogenic type, with occasional detrital and stromatolitic types. Microscopic and nanoscopic examination revealed that the tufa deposits developed through two successive processes of calcite precipitation, biotic and abiotic, preceded by limited precipitation of unstable aragonite. It is suggested that biologically mediated precipitation results in the construction of incomplete skeletal calcite crystals. The latter provide a base for classical physiochemical precipitation and, eventually, the development of complete sparry calcite crystals. The initiation of dendritic calcite crystals in the stromatolitic tufa as incomplete biogenic skeletal crystals and their characteristic growth pattern indicates that the tufa represents a clear example of hot spring calcitic microbialite.

  16. Worlds Apart: Nam Le’s The Boat and Ali Alizadeh’s Transactions

    Directory of Open Access Journals (Sweden)

    Lachlan Brown

    2015-05-01

    Full Text Available This paper reads Ali Alizadeh’s transnational book of short stories (Transactions, 2013 as a curious and pointed response to the kind of literary internationalism seen in Nam Le’s The Boat (2008. Le’s work was first published in the same year as Alizadeh’s The New Angel (which was set during the Iranian revolution. There is a sense in which the spectacular success of Le’s book ‘overshadowed’ the publicity for Alizadeh’s novel in the year of its arrival. But Le’s also work contains a story about an American woman visiting Tehran, and his mimicry perhaps signifies a more problematic representational point of comparison. With this in mind, this paper examines Alizadeh’s Transactions exploring the ways in which Alizadeh’s brutally connected global vision is coded through certain aesthetic choices (including structural, tonal and descriptive that offer something very different to the artisanal and paratactic sensibility of The Boat.

  17. Morality and Intimate Partner Violence: Do Men in Court-Mandated Psychological Treatment Hold a Sacred Moral Vision of the World and Themselves?

    Science.gov (United States)

    Vecina, María L; Chacón, José C

    2016-01-01

    This article examines the characterization of men in a court-mandated treatment for violence against their partners as holding a sacred vision of the 5 moral foundations and of their own morality. This characterization is compatible with the assumption that a sacred moral world is easily threatened by reality and that may be associated to violent defensive actions. The results from latent class analyses reveal (a) a 4-class distribution depending exclusively on the intensity with which all participants (violent and nonviolent) tend to sacralize the actions proposed in the Moral Foundations Sacredness Scale and (b) a greater prevalence of the violent participants among the classes that are more prone to sacralize. They also show that they hold an inflated moral vision of themselves: They think they are much more moral than intelligent than others who have never been charged with criminal behavior (Muhammad Ali effect).

  18. METAPHOR AS A STYLISTIC DEVICE OF ISLAMIC TEACHING

    Directory of Open Access Journals (Sweden)

    Jumino Suhadi

    2011-06-01

    Full Text Available Metafor Sebagai Sarana Stilistika Pembelajaran Islam. Artikel ini membahas tentang berbagai tipe metafora yang terdapat dalam ayat-ayat suci al-Qur’an dan Hadis berdasarkan kerangka teori sastra dan linguistik modern. Sumber data utama dalam studi ini terdiri dari ayat-ayat suci al-Qur’an yang diterjemahkan dalam Bahasa Inggris oleh Abdullah Yusuf Ali dan beberapa matan Hadis dari buku kumpulan Hadis karangan Habib Muhammad al-Haddar. Tujuan analisis ini adalah untuk memaparkan bukti kuat bahwa metafora merupakan alat stilistika ‘stylistic device’ yang dipergunakan secara luas dalam al-Qur’an dan al-Hadis dalam menyampaikan ajaran Islam. Hasil dari studi ini menunjukkan bahwa semua tipe metafora dalam arti luas terdapat dalam berbagai ayat suci al-Qur’an dan al-Hadis. Argumen tersebut menurut penulis merupakan bukti yang sangat meyakinkan bahwa metafora merupakan salah satu alat stilistika dalam menyampaikan ajaran Islam.

  19. Factors influencing development of management strategies for the Abou Ali River in Lebanon. I: Spatial variation and land use

    OpenAIRE

    Massoud, MA; El-Fadel, M; Scrimshaw, MDirector; Lester, JN

    2006-01-01

    Surface water bodies are progressively subject to increasing stress as a result of environmentally degrading processes primarily related to anthropogenic activities. This study assesses and examines the impact of land use and anthropogenic activities on the spatial variation in water quality of the Abou Ali River in North Lebanon. It is the first detailed study of its kind in Lebanon and adds to the existing Knowledge by shedding light on a relatively small Mediterranean river in a developing...

  20. Effet des conditions climatiques sur le niveau du lac Sidi Ali (Moyen Atlas, Maroc

    Directory of Open Access Journals (Sweden)

    Claude Martin

    2011-11-01

    Full Text Available Le lac Sidi Ali est un lac naturel d'altitude (2070-2080 m, sans exutoire superficiel, déterminé par le barrage d'une coulée basaltique. Doté d'un bassin versant apparent de 15,6 km2, il est alimenté par des eaux de ruissellement et par des sources karstiques. Son niveau subit des variations très fortes, annuelles et interannuelles, sous le contrôle des conditions climatiques, et en particulier des pluies et de l'évapotranspiration. Les périodes de sécheresse qui ont marqué les trois dernières décennies, se sont traduites par un abaissement du niveau de près de 7 m. Mais les précipitations abondantes des années 2008-09 et 2009-10 ont provoqué une nette remontée. Une régression multiple d'assez bonne qualité (r = 0,87 lie la variation annuelle du niveau (d'août à août à différents paramètres (conditions climatiques et niveau initial du lac.Lake Sidi Ali is a natural lake at high altitude (2070-2080 m, without surface outlet, determined by the dam of a basalt flow. With an apparent catchment of 15.6 km2, it is fed by runoff and karst springs. Its level shows strong annual and interannual variations, depending on weather conditions, particularly rainfall and evapotranspiration. Droughts that have marked the last three decades have resulted in a lowering of about 7 m of the water level. But heavy rainfall that occurred in 2008-09 and 2009-10 caused a marked rise. A multiple regression of sufficient quality (r = 0.87 binds the annual change (from august to august at differents parameters (weather conditions and initial level of the lake.

  1. Summary of Current Radiometric Calibration Coefficients for Landsat MSS, TM, ETM+, and EO-1 ALI Sensors

    Science.gov (United States)

    Chander, Gyanesh; Markham, Brian L.; Helder, Dennis L.

    2009-01-01

    This paper provides a summary of the current equations and rescaling factors for converting calibrated Digital Numbers (DNs) to absolute units of at-sensor spectral radiance, Top-Of- Atmosphere (TOA) reflectance, and at-sensor brightness temperature. It tabulates the necessary constants for the Multispectral Scanner (MSS), Thematic Mapper (TM), Enhanced Thematic Mapper Plus (ETM+), and Advanced Land Imager (ALI) sensors. These conversions provide a basis for standardized comparison of data in a single scene or between images acquired on different dates or by different sensors. This paper forms a needed guide for Landsat data users who now have access to the entire Landsat archive at no cost.

  2. The Impact of Vocational Schools on the Regional Development Akören Ali Rıza Ercan Vocational School Example

    Directory of Open Access Journals (Sweden)

    Refika Atalay

    2017-07-01

    Full Text Available The regional development difference which has globally become a major problem even for developing countries is one of important problems of Turkey's economy. The regional dualism in the country's economy brings with many economic and social problems such as the immigration, the income inequality, the unplanned urbanization etc. The vocational schools established generally in localities less than ten thousand people contribute to remove the development difference of these localities by providing social and economic benefits as well as by training skilled staff to the locality where they are located. In this study we investigated the impact of vocational schools in the removal of the regional development difference and we made use of primary and secondary sources. Firstly, we scanned the literatures concerning this study, then we made survey with the students which study in Akören Ali Riza Ercan Vocational School. By taking the 5% significance level and the 5% margin of error into consideration in this study we used the SPSS for Windows statistics program in the evaluation of data taken as 317 students sample among the main body of 1,240 students. We tried to present solution proposals by studying the expectations and problems of the students as well as the contribution of the Akören Ali Riza Ercan Vocational School to the development of Akören district.

  3. The Political Structure at Basra Gulf in the Period of Ali b. Ebu Talib and Yezid b. Muaviye

    OpenAIRE

    Taner YILDIRIM

    2011-01-01

    At this work about the political structure of the Basra Gulf, we dwelled upon the general geography of the district and its political history. The political situation of the district in this period is assessed in a way that comprises especially the period of Hz. Ali the fourth caliph of early islamic period Muaviya, the first Emevi caliph, and his son Yazid in the light of political developments in that period. When we took up Gulf of Basra we saw that the region of the Gulf is a very importa...

  4. Expounding a Few Key Strategies of Imam Ali (AS) on Prevention of Diseases by Means of Improving Nutrition Style

    OpenAIRE

    Hossein Moradi

    2016-01-01

    diseases are due to lifestyle changes, especially in the field of nutrition. The Iranian Islamic teachings have extensive guidelines on the issue of healthy lifestyle and nutrition in particular. On that account, there are many sayings and traditions related to nutrition and its practices. The sayings of Imam Ali (AS) like avoiding eating when you are full, not eating your fill when mealtime, and masticating food well are among those traditions. In the light of Imam’s view, the role of ...

  5. Impact of different moisture regimes and nitrogen rates on yield and ...

    African Journals Online (AJOL)

    Impact of different moisture regimes and nitrogen rates on yield and yield attributes of maize (Zea mays L.) Muhammad Maqsood, Muhammad Asif Shehzad, Muhammad Aqeel Sarwar, Hafiz Tassawar Abbas, Salman Mushtaq ...

  6. Assessment of a volume-dependent dynamic respiratory system compliance in ALI/ARDS by pooling breathing cycles

    International Nuclear Information System (INIS)

    Zhao, Zhanqi; Möller, Knut; Guttmann, Josef

    2012-01-01

    New methods were developed to calculate the volume-dependent dynamic respiratory system compliance (C rs ) in mechanically ventilated patients. Due to noise in respiratory signals and different characteristics of the methods, their results can considerably differ. The aim of the study was to establish a practical procedure to validate the estimation of intratidal dynamic C rs . A total of 28 patients from intensive care units of eight German university hospitals with acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) were studied retrospectively. Dynamic volume-dependent C rs was determined during ongoing mechanical ventilation with the SLICE method, dynostatic algorithm and adaptive slice method. Conventional two-point compliance C 2P was calculated for comparison. A number of consecutive breathing cycles were pooled to reduce noise in the respiratory signals. C rs -volume curves produced with different methods converged when the number of pooling cycles increased (n ≥ 7). The mean volume-dependent C rs of 20 breaths was highly correlated with mean C 2P (C 2P,mean = 0.945 × C rs,mean − 0.053, r 2 = 0.968, p < 0.0001). The Bland–Altman analysis indicated that C 2P,mean was lower than C rs,mean (−2.4 ± 6.4 ml cm −1 H 2 O, mean bias ± 2 SD), but not significant according to the paired t-test (p > 0.05). Methods for analyzing dynamic respiratory mechanics are sensitive to noise and will converge to a unique solution when the number of pooled cycles increases. Under steady-state conditions, assessment of the volume-dependent C rs in ALI/ARDS patients can be validated by pooling respiratory data of consecutive breaths regardless of which method is applied. Confidence in dynamic C rs determination may be increased with the proposed pooling. (note)

  7. Isolation and identification of flavonoids from anticancer and ...

    African Journals Online (AJOL)

    Isolation and identification of flavonoids from anticancer and neuroprotective extracts of Trigonella foenum graecum. Shabina Ishtiaq Ahmed, Muhammad Qasim Hayat, Saadia Zahid, Muhammad Tahir, Qaisar Mansoor, Muhammad Ismail, Kristen Keck, Robert Bates ...

  8. Muusikamaailm : Ozawa festival Matsumotos. Pidustused Utrechtis ülehomseni. Philip Glassi uusteos Salzburgis. Alexandre Lagoya surnud. Frangiz Ali-Zade asutamine Luzernis. Wolfgang Wagner 80 / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    1999-01-01

    H.Saito mälestusfestivalist "Saito Kinen" 29.08-12.09 Jaapanis. Utrechti varajase muusika pidustustest 27.08-5.09. P.Glassi teose "Requiem, Bardo and Nimanakaya" maailmaesiettekandest Salzburgi suvefestivalil 28.08. A. Lagoya elust ja tegevusest. Luzerni festivali resideerivaks heliloojaks oli F.Ali-Zade. W. Wagneri tegevusest impressaariona

  9. Geochemistry of rare earth elements in the Baba Ali magnetite skarn deposit, western Iran – a key to determine conditions of mineralisation

    Directory of Open Access Journals (Sweden)

    Zamanian Hassan

    2016-03-01

    Full Text Available The Baba Ali skarn deposit, situated 39 km to the northwest of Hamadan (Iran, is the result of a syenitic pluton that intruded and metamorphosed the diorite host rock. Rare earth element (REE values in the quartz syenite and diorite range between 35.4 and 560 ppm. Although the distribution pattern of REEs is more and less flat and smooth, light REEs (LREEs in general show higher concentrations than heavy REEs (HREEs in different lithounits. The skarn zone reveals the highest REE-enriched pattern, while the ore zone shows the maximum depletion pattern. A comparison of the concentration variations of LREEs (La–Nd, middle REEs (MREEs; Sm–Ho and HREEs (Er–Lu of the ore zone samples to the other zones elucidates two important points for the distribution of REEs: 1 the distribution patterns of LREEs and MREEs show a distinct depletion in the ore zone while representing a great enrichment in the skarn facies neighbouring the ore body border and decreasing towards the altered diorite host rock; 2 HREEs show the same pattern, but in the exoskarn do not reveal any distinct increase as observed for LREEs and MREEs. The ratio of La/Y in the Baba Ali skarn ranges from 0.37 to 2.89. The ore zone has the highest La/Y ratio. In this regard the skarn zones exhibit two distinctive portions: 1 one that has La/Y >1 beingadjacent to the ore body and; 2 another one with La/Y < 1 neighbouring altered diorite. Accordingly, the Baba Ali profile, from the quartz syenite to the middle part of the exoskarn, demonstrates chiefly alkaline conditions of formation, with a gradual change to acidic towards the altered diorite host rocks. Utilising three parameters, Ce/Ce*, Eu/Eu* and (Pr/Ybn, in different minerals implies that the hydrothermal fluids responsible for epidote and garnet were mostly of magmatic origin and for magnetite, actinolite and phlogopite these were of magmatic origin with low REE concentration or meteoric water involved.

  10. Quaternary selenostannates Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs) through rapid cooling of melts. Kinetics versus thermodynamics in the polymorphism of AGaSnSe{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, S -J; Iyer, R G; Kanatzidis, M G

    2004-10-01

    The quaternary alkali-metal gallium selenostannates, Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs), were synthesized by reacting alkali-metal selenide, Ga, Sn, and Se with a flame melting-rapid cooling method. Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} crystallizes in the non-centrosymmetric space group C2 with cell constants a=13.308(3) A, b=7.594(2) A, c=13.842(3) A, {beta}=118.730(4) deg., V=1226.7(5) A{sup 3}. {alpha}-KGaSnSe{sub 4} crystallizes in the tetragonal space group I4/mcm with a=8.186(5) A and c=6.403(5) A, V=429.1(5) A{sup 3}. {beta}-KGaSnSe{sub 4} crystallizes in the space group P2{sub 1}/c with cell constants a=7.490(2) A, b=12.578(3) A, c=18.306(5) A, {beta}=98.653(5) deg., V=1705.0(8) A{sup 3}. The unit cell of isostructural RbGaSnSe{sub 4} is a=7.567(2) A, b=12.656(3) A, c=18.277(4) A, {beta}=95.924(4) deg., V=1741.1(7) A{sup 3}. CsGaSnSe{sub 4} crystallizes in the orthorhombic space group Pmcn with a=7.679(2) A, b=12.655(3) A, c=18.278(5) A, V=1776.1(8) A{sup 3}. The structure of Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} consists of a polar three-dimensional network of trimeric (Sn,Ga){sub 3}Se{sub 9} units with Na atoms located in tunnels. The AGaSnSe{sub 4} possess layered structures. The compounds show nearly the same Raman spectral features, except for Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6}. Optical band gaps, determined from UV-Vis spectroscopy, range from 1.50 eV in Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} to 1.97 eV in CsGaSnSe{sub 4}. Cooling of the melts of KGaSnSe{sub 4} and RbGaSnSe{sub 4} produces only kinetically stable products. The thermodynamically stable product is accessible under extended annealing, which leads to the so-called {gamma}-form (BaGa{sub 2}S{sub 4}-type) of these compounds.

  11. Lithospheric mantle evolution in the Afro-Arabian domain: Insights from Bir Ali mantle xenoliths (Yemen)

    Science.gov (United States)

    Sgualdo, P.; Aviado, K.; Beccaluva, L.; Bianchini, G.; Blichert-Toft, J.; Bryce, J. G.; Graham, D. W.; Natali, C.; Siena, F.

    2015-05-01

    Detailed petrological and geochemical investigations of an extensive sampling of mantle xenoliths from the Neogene-Quaternary Bir Ali diatreme (southern Yemen) indicate that the underlying lithospheric mantle consists predominantly of medium- to fine-grained (often foliated) spinel-peridotites (85-90%) and spinel-pyroxenites (10-15%) showing thermobarometric estimates in the P-T range of 0.9-2.0 GPa and 900-1150 °C. Peridotites, including lherzolites, harzburgites and dunites delineate continuous chemical, modal and mineralogical variations compatible with large extractions of basic melts occurring since the late Proterozoic (~ 2 Ga, according to Lu-Hf model ages). Pyroxenites may represent intrusions of subalkaline basic melts interacting and equilibrated with the host peridotite. Subsequent metasomatism has led to modal changes, with evidence of reaction patches and clinopyroxene and spinel destabilization, as well as formation of new phases (glass, amphibole and feldspar). These changes are accompanied by enrichment of the most incompatible elements and isotopic compositions. 143Nd/144Nd ranges from 0.51419 to 0.51209 (εNd from + 30.3 to - 10.5), 176Hf/177Hf from 0.28459 to 0.28239 (εHf from + 64.4 to - 13.6), and 208Pb/204Pb from 36.85 to 41.56, thus extending from the depleted mantle (DM) towards the enriched OIB mantle (EM and HIMU) components. 3He/4He (R/RA) ratios vary from 7.2 to 7.9 with He concentrations co-varying with the most incompatible element enrichment, in parallel with metasomatic effects. These metasomatic events, particularly effective in harzburgites and dunites, are attributable to the variable interaction with alkaline basic melts related to the general extensional and rifting regime affecting the East Africa-Arabian domain during the Cenozoic. In this respect, Bir Ali mantle xenoliths resemble those occurring along the Arabian margins and the East Africa Rift system, similarly affected by alkaline metasomatism, whereas they are

  12. Pb-Zn mineralization of Ali ou Daoud area (Central High Atlas, Morocco: characterisation of deposit and relationship with the clay assemblages

    Directory of Open Access Journals (Sweden)

    Daoudi, L.

    2008-12-01

    Full Text Available Zn-Pb-Fe ores in the Ali ou Daoud deposit (Central High Atlas are found as stratiform levels and as karst fillings in carbonate platforms facies of Bajocian age. Tectonic structures (e.g., synsedimentary faults played a relevant role in the ore emplacement. The dolomitic ore-related host-rock levels are characterized by the presence of kaolinite enrichment in clay levels in amounts directly related to the proportion of the clay minerals. The latter is evidenced by correlation between kaolinite and sulphide contents, suggesting that the installation of kaolinite and mineralisations would result from the same hydrothermal fluid.[Français] Dans les séries sédimentaires carbonatées d’Ali ou Daoud (Haut Atlas Central, les minéralisations à Zn, Pb et Fe en amas stratiformes forment les faciès de remplissage des karsts d’une plateforme carbonatée bajocienne. Le contrôle structural joue un rôle capital dans la localisation du gîte en bordure de plateforme sur des failles synsédimentaires. Dans les niveaux dolomitiques encaissants des minéralisations, les assemblages argileux sont caractérisés par la présence de kaolinite dont la teneur varie parallèlement avec celle du minerai. Ceci suggère que la mise en place de la kaolinite et des minéralisations résulterait du même fluide hydrothermal. [Español] En las series sedimentarias carbonatadas de Ali ou Daoud (Alto Atlas Central, las mineralizaciones de Zn, Pb y Fe aparecen en niveles estratiformes como facies de reemplazamiento de los karsts de una plataforma carbonatada Bajociense. El control estructural desempeña un papel crucial en la localización del yacimiento a lo largo de la plataforma sobre fallas sinsedimentarias. En los niveles dolomíticos que incluyen las mineralizaciones, las asociaciones arcillosas se caracterizan por la presencia de caolinita, cuyo contenido varía paralelamente al de la mineralización. Esto sugiere que la creación de caolinita y de la

  13. Ibn Tufail : tema aeg, elu ja koht islami-araabia filosoofia ajaloos / Haljand Udam

    Index Scriptorium Estoniae

    Udam, Haljand, 1936-2005

    2001-01-01

    Varem ilmunud järelsõnana raamatus: Elav Ärganu poeg. Tallinn : Olion, 1992. 12. sajandil Araabia Hispaanias elanud filosoof Abu Bakr Muhammad ibn Abd al-Malik ibn Muhammad ibn Muhammad ibn Tufail. Tema põhiteosest, filosoofilisest jutustusest "Elav Ärganu poeg"

  14. Molecular characterization of capsid protein gene of potato virus X ...

    African Journals Online (AJOL)

    Molecular characterization of capsid protein gene of potato virus X from Pakistan. Arshad Jamal, Idrees Ahmad Nasir, Bushra Tabassum, Muhammad Tariq, Abdul Munim Farooq, Zahida Qamar, Mohsin Ahmad Khan, Nadeem Ahmad, Muhammad Shafiq, Muhammad Saleem Haider, M. Arshad Javed, Tayyab Husnain ...

  15. Regions of Different Confinement in Low-Dimensional AlyInxGa1−x−yN Quantum Structures

    Directory of Open Access Journals (Sweden)

    A. Gröning

    2007-01-01

    Full Text Available The optical properties of metal-organic vapor phase epitaxy grown AlyInxGa1−x−yN quantum dot structures have been studied by time-resolved photoluminescence experiments. We investigated the recombination dynamics of the photo-exited carriers in dependence of the growth parameters such as aluminium flow and the duration of the growth interruption after the dot deposition. Our results confirm the presence of localized states, where the degree of localization is strongly dependent on the growth conditions. To describe this behavior, we propose a band structure with coupled potentials for these nanostructures. Finally, we demonstrate state filling to prove the zero-dimensional character of the strongly localized states in our quaternary quantum dots.

  16. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Genetic analysis of a consanguineous Pakistani family with Leber congenital amaurosis identifies a novel mutation in GUCY2D gene. Muzammil Ahmad Khan Verena Rupp Muhammad Ayaz Khan Muhammad Pervaiz Khan Muhammad Ansar Christian Windpassinger. Research Note Volume 93 Issue 2 August 2014 pp ...

  17. Ventilation distribution measured with EIT at varying levels of pressure support and Neurally Adjusted Ventilatory Assist in patients with ALI.

    Science.gov (United States)

    Blankman, Paul; Hasan, Djo; van Mourik, Martijn S; Gommers, Diederik

    2013-06-01

    The purpose of this study was to compare the effect of varying levels of assist during pressure support (PSV) and Neurally Adjusted Ventilatory Assist (NAVA) on the aeration of the dependent and non-dependent lung regions by means of Electrical Impedance Tomography (EIT). We studied ten mechanically ventilated patients with Acute Lung Injury (ALI). Positive-End Expiratory Pressure (PEEP) and PSV levels were both 10 cm H₂O during the initial PSV step. Thereafter, we changed the inspiratory pressure to 15 and 5 cm H₂O during PSV. The electrical activity of the diaphragm (EAdi) during pressure support ten was used to define the initial NAVA gain (100 %). Thereafter, we changed NAVA gain to 150 and 50 %, respectively. After each step the assist level was switched back to PSV 10 cm H₂O or NAVA 100 % to get a new baseline. The EIT registration was performed continuously. Tidal impedance variation significantly decreased during descending PSV levels within patients, whereas not during NAVA. The dorsal-to-ventral impedance distribution, expressed according to the center of gravity index, was lower during PSV compared to NAVA. Ventilation contribution of the dependent lung region was equally in balance with the non-dependent lung region during PSV 5 cm H₂O, NAVA 50 and 100 %. Neurally Adjusted Ventilatory Assist ventilation had a beneficial effect on the ventilation of the dependent lung region and showed less over-assistance compared to PSV in patients with ALI.

  18. ASPM

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... microcephaly associated (ASPM) gene mutation is a major cause of primary microcephaly in Pashtoon ethnic group of Pakistan. Shamim Saleha1, Muhammad Ajmal2, Muhammad Jamil1, Muhammad Nasir2 and Abdul. Hameed2*. 1Department of Biotechnology and Genetic Engineering, Kohat University ...

  19. ETIKA BISNIS ISLAMI DALAM PRAKTEK BISNIS RASULULLAH

    Directory of Open Access Journals (Sweden)

    Muhammad Saifullah

    2011-06-01

    Kajian sejarah mengenai perilaku dan etika bisnis Muhammad sebelum ditunjuk sebagai nabi merupakan kajian yang menarik, karena peri laku dan etika bisnis yang diterapkan oleh Muhammad didasarkan pada kajian ayat-ayat al-Qur’an. Setelah ditunjuk sebagai nabi (usia 40 tahun, kehidupan Nabi Muhammad lebih dibimbing oleh wahyu-wahyu al-Qur’an. Beberapa prinsip yang diterapkan oleh Muhammad adalah jujur, amanah, timbangan yang tepat, menghindari gharar, tidak menimbun barang, tidak melakukan al-ghalb dan tadlis di antara penjual dengan pembeli.

  20. Ideal-gas thermodynamic properties for natural-gas applications

    International Nuclear Information System (INIS)

    Jaeschke, M.; Schley, P.

    1995-01-01

    Calculating caloric properties from a thermal equation of state requires information such as isobaric heat capacities in the ideal-gas state as a function of temperature. In this work, values for the parameters of the c p o correlation proposed by Aly and Lee were newly determined for 21 pure gases which are compounds of natural gas mixtures. The values of the parameters were adjusted to selected c p o data calculated form spectroscopic data for temperatures ranging from 10 to 1000 K. The data sources used are discussed and compared with literature data deduced from theoretic models and caloric measurements. The parameters presented will be applied in a current GERG project for evaluating equations of state (e.g., the AGA 8 equation) for their suitability for calculating caloric properties

  1. Actividades económicas primarias predominantes en la Reserva Paisajística Nor Yauyos Cochas, Perú. Caso: distritos de Huancaya, Alis y Vitis

    Directory of Open Access Journals (Sweden)

    Wilfredo Bulege Gutiérrez

    2011-12-01

    Full Text Available Objetivos: Determinar las actividades económicas primarias predominantes en los distritos de Huancaya, Alis y Vitis de la provincia de Yauyos, región Lima, ubicados en la zona de aprovechamiento directo de la Reserva Paisajística Nor Yauyos Cochas. Métodos: Es una investigación de tipo básica, alcance descriptiva, diseño transversal, en el proceso de recolección de datos se aplicó un cuestionario estructurado a una muestra no probabilística de 79 personas con edades mayores a 18 años entre varones y mujeres de los distritos de Huancaya, Alis y Vitis, quienes participaron en un evento académico sobre “Econegocios para el desarrollo” organizado por Grupo de Proyección Social “Eco-negocios” de la Universidad Continental, este mismo instrumento se aplicó a personas ubicadas circunstancialmente en la vía pública de los mencionados distritos hasta completar el tamaño muestral de 79. Resultados: El 42% manifiesta que se dedica principalmente a la agricultura; 37%, a la ganadería; 5%, a la acuicultura; 5%, a la artesanía y un 11% a otras actividades entre las cuales se puede identificar el comercio, servicios turísticos, minería, etc. Las personas cuya actividad principal es la agricultura manifestaron que el 44% de su producción es maíz; 28%, papa; 23%, trigo y 5% otros productos. Las personas dedicadas a la ganadería manifestaron que el 41%, cría camélidos; 28%, vacunos; 14%, ovinos y un 17%, otros. Conclusiones: La población de los distritos de Huancaya, Alis y Vitis dedican como una de sus actividades económicas de mayor predominancia a la agricultura, luego la ganadería, siendo este un indicador importanteque caracteriza a estos distritos como zonas con una economía basada en actividades primarias, es decir extractiva de recursos naturales y aprovechada prioritariamente para autoconsumo y su comercialización.

  2. Near-critical density filling of the SF6 fluid cell for the ALI-R-DECLIC experiment in weightlessness

    Science.gov (United States)

    Lecoutre, C.; Marre, S.; Garrabos, Y.; Beysens, D.; Hahn, I.

    2018-05-01

    Analyses of ground-based experiments on near-critical fluids to precisely determine their density can be hampered by several effects, especially the density stratification of the sample, the liquid wetting behavior at the cell walls, and a possible singular curvature of the "rectilinear" diameter of the density coexisting curve. For the latter effect, theoretical efforts have been made to understand the amplitude and shape of the critical hook of the density diameter, which depart from predictions from the so-called ideal lattice-gas model of the uniaxial 3D-Ising universality class. In order to optimize the observation of these subtle effects on the position and shape of the liquid-vapor meniscus in the particular case of SF6, we have designed and filled a cell that is highly symmetrized with respect to any median plane of the total fluid volume. In such a viewed quasi-perfect symmetrical fluid volume, the precise detection of the meniscus position and shape for different orientations of the cell with respect to the Earth's gravity acceleration field becomes a sensitive probe to estimate the cell mean density filling and to test the singular diameter effects. After integration of this cell in the ALI-R insert, we take benefit of the high optical and thermal performances of the DECLIC Engineering Model. Here we present the sensitive imaging method providing the precise ground-based SF6 benchmark data. From these data analysis it is found that the temperature dependence of the meniscus position does not reflect the expected critical hook in the rectilinear density diameter. Therefore the off-density criticality of the cell is accurately estimated, before near future experiments using the same ALI-R insert in the DECLIC facility already on-board the International Space Station.

  3. Plasticité du droit constitutionnel et dynamique de l’autoritarisme dans la Tunisie de Ben Ali

    Directory of Open Access Journals (Sweden)

    Éric Gobe

    2012-02-01

    Full Text Available Le droit des institutions politiques dans la Tunisie de Ben Ali apparaît particulièrement plastique et instable car ce sont les échéances politiques liées à la pérennisation du régime autoritaire qui dictent le rythme et la nature des changements institutionnels. Ce droit est conçu de façon à rendre impensable l’éventualité d’une alternance au sommet de l’État tout en permettant aux pouvoirs publics tunisiens de tenir un discours sur la résolution de la Tunisie à approfondir son engagement démocratique. Les récents textes constitutionnels et législatifs organisant la vie politique concourent, dans le même temps à limiter formellement les pratiques autoritaires tout en les autorisant si nécessaire.

  4. Reasons for not receiving thrombolytic therapy in patients with acute myocardial infarction admitted to Bu-Ali Sina Hospital in Qazvin (2013-14)

    OpenAIRE

    MM. Daei; M. Karimi Rad; M. Khalaja

    2017-01-01

    This hospital-based cross-sectional study was conducted in 2013-14 in Qazvin Bu-Ali Sina Hospital. 170 patients with acute myocardial infarction who not receiving thrombolytic therapy entered the study and were analyzed. Medical history, physical examination, twelve lead ECG and cardiac biomarkers were obtained. The mean age of the patients was 63.4±14.4 years (from 19 to 90 years). 110 (64.7%) of the patients were male and 48 (28.2%) were diabetic. 86 (50%) of patients due to late present...

  5. Mobile Sensor System AGaMon for Breath Control: Numerical Signal Analysis of Ternary Gas Mixtures and First Field Tests

    Directory of Open Access Journals (Sweden)

    Rolf Seifert

    2018-01-01

    Full Text Available An innovative mobile sensor system for breath control in the exhaled air is introduced. In this paper, the application of alcohol control in the exhaled air is considered. This sensor system operates semiconducting gas sensor elements with respect to the application in a thermo-cyclic operation mode. This operation mode leads to so-called conductance-over-time-profiles (CTPs, which are fingerprints of the gas mixture under consideration and can be used for substance identification and concentration determination. Especially for the alcohol control in the exhaled air, ethanol is the leading gas component to be investigated. But, there are also other interfering gas components in the exhaled air, like H2 and acetone, which may influence the measurement results. Therefore, a ternary ethanol-H2-acetone gas mixture was investigated. The establishing of the mathematical calibration model and the data analysis was performed with a newly developed innovative calibration and evaluation procedure called ProSens 3.0. The analysis of ternary ethanol-H2-acetone gas samples with ProSens 3.0 shows a very good substance identification performance and a very good concentration determination of the leading ethanol component. The relative analysis errors for the leading component ethanol were in all considered samples less than 9 %. First field test performed with the sensor system AGaMon shows very promising results.

  6. Browse Author Index

    African Journals Online (AJOL)

    Items 1 - 47 of 47 ... Ikhuoria, E.U. · Ikiz, Serkan · Ikram, Muhammad · Ikram, Muhammad · Ilomo, O. O. · Ilomo, O.O. · Ilukhor, P.E.P. · Imanieh, Hossein · Imeokparia, F.E. · Imran, M. Inayat, M. Ipinmoroti, K.O. · Iqbal, M. Iqbal Choudhary, M. Iqbal Choudhary, Muhammad · Iranmanesh, P. Irfan, A. Irfan, A. Irina, Justin · Isabirye, D.A.

  7. Book Reviews

    Directory of Open Access Journals (Sweden)

    A. Teeuw

    1961-04-01

    Full Text Available - R.J. Mohr, Carl A. Schmitz, Historische probleme in Nordost-Neuguinea. Huon-Halbinsel. Franz Steiner Verlag GMBH. Wiesbaden. 1960. 425 Pp., 43 Abbildungen, 9 karten und 1 Faltkarte. Studien zur Kulturkunde 16. Band. - P.E. de Josselin de Jong, H.G. Quaritch Wales, Prehistory and religion in South-East Asia. Bernard Quaritch Ltd., London 1957. 175 pp. text, 24 figs., 2 plates. - H.J. de Graaf, K.G. Tregonning, Under chartered company rule (North Borneo 1881-1946. University of Malaya Press, Singapore, 1958. 222 pp. tekst, 3 ills., 2 krtn. - S. Kooyman, Karl Erik Larsson, Fijian Studies. Etnologiska Studier, 25. Göteborg, 1960. 147 pag., 65 ills. - A. Teeuw, Hans Kähler, Ethnographische und linguistische studien über die Orang darat, Orang akit, Orang laut und Orang utan im Riau-Archipel und auf den Inseln an der Ostküste von Sumatra. Veröffentlichungen des Seminars für Indonesische und Südseesprachen der Universität Hamburg. Band 2. Berlin 1960. VI + 294 pp. - A. Teeuw, Ali Haji Ahmad, Puisi Baharu Melayu (Zaman Permulaan. Disusun oleh: Ali Haji Ahmad. Siri Sastera DBP. Bil. 4. Dewan Bahasa dan Pustaka....Kuala Lumpur 1959. XV + 60 pp. - A. Teeuw, William Shakespeare, Romeo dan Julia, di-terjemahkan oleh Trisno Sumardjo. Oxford University Press, Kuala Lumpur 1960. X + 150 pp. - A. Teeuw, Chepu Kenchana. Antoloji cherita2 pendek dunia. Pengenalan dan anotasi oleh Derwent May. Kata pengantar oleh Asraf. Oxford University Press, Kuala Lumpur 1960. 196 pp. - A. Teeuw, Hasan bin Muhammad Ali, Musafir. Siri Sastera DBP Bil. 3....Kuala Lumpur 1959. 142 pp. - A. Teeuw, Asraf, Mekar dan Segar. Bunga rampai cherita-cherita pendek angkatan baru. Di-pileh dan di-bicharakan oleh Asraf. Oxford University Press, Kuala Lumpur 1959. XV + 157 pp. - A. Teeuw, Cherita pendek DBP. Siri Sastera DBP Bil. 2. Dewan Bahasa dan Pustaka...Kula Lumpur 1958. 180 pp. - B.A.L. Cranstone, S. Kooyman, The art of Lake Sentani. Museum of Primitive Art, New York

  8. The Shah-Ali-Beiglou Zn-Pb-Cu (-Ag Deposit, Iran: An Example of Intermediate Sulfidation Epithermal Type Mineralization

    Directory of Open Access Journals (Sweden)

    Khadijeh Mikaeili

    2018-04-01

    Full Text Available The Shah-Ali-Beiglou epithermal base metal-silver deposit is located in the Tarom-Hashjin metallogenic province (THMP in northwestern Iran. This deposit is hosted by quartz monzonite dikes of Oligocene age and surrounded by andesite to trachyandesite volcanic and volcaniclastic rocks of Eocene age. The subvolcanic rocks in the study area vary in composition from quartz-monzonite to monzonite and have metaluminous, calc-alkaline to shoshonitic affinity. These rocks have I-type geochemical characteristic and are related to post-collisional tectonic setting. The mineralization occurs as NE-SW and E-W-trending brecciated veins controlled by strike-slip and normal faults, which are associated to the Late Oligocene compressional regime. The mineral paragenesis of the vein mineralization is subdivided into pre-ore stage, ore stage, post-ore stage, and supergene stage. Pre-ore stage is dominated by quartz, sericite, and subhedral to anhedral pyrite as disseminated form. Ore-stage is represented by quartz, sphalerite (from 0.1 mol % to 4 mol % FeS, galena, chalcopyrite, tetrahedrite-tennantite, minor seligmannite and enargite, as vein-veinlet, cement and clast breccias. Post-ore stage is defined by deposition of quartz and carbonate along with minor barite, and supergene stage is characterized by bornite, chalcocite, covellite, hematite, goethite, and jarosite. The ore mineralization is associated with the silicic alteration. The styles of alteration are silicic, carbonate, sericitic, chloritic, and propylitic. Fluid inclusions in sphalerite have a wide range of salinities between 0.35 wt % and 21.4 wt % NaCl equivalent and homogenization temperatures range from 123 to 320 °C. The isotopic values of sulfides vary from 2.8‰ to 6.7‰ suggesting a magmatic source for the sulfur. In the present study, based on geological setting, alteration style of the host and wall rocks, main textures, mineral assemblages, composition of ore minerals, and structural

  9. AKTOR PEMBENTUK JARINGAN PESANTREN DI SULAWESI SELATAN 1928-1952

    Directory of Open Access Journals (Sweden)

    Syamsuddin Arief

    2007-12-01

    Full Text Available Anre Gurutta Haji (A.G.H Muhammad As’ad is one of the actors of forming Islamic Boarding Schools in South Sulawesi. He went back from Makkah and went to Sengkang-Wajo in 1928. He graduated from al-Falah Makkah Mukarramah. He studied to the great Ulamas in the Mesjidil Haram (Haram Mosque. Among of his teachers were Syekh Abdul Rasyid al-Bugis, Syekh Ambo Wellang al-Bugis, Syekh Abbas Abdul Jabbar al-Bugis, Syekh Mallawa al-Bugis, Syekh Umar Hamdani (the traditional expert, Syekh Ahmad Azdirin, Syekh Jamal Makki, Syekh al-Abrar, Syekh Muhammad Said al-Yamani, and Syekh Hasan al-Yamani. Another students of A.G.H Muhammad As’ad who helped as teachers such as A.G.H Abdurrah-man Ambo Dalle, A.G.H Daud Ismail, A.G.H Yunus Maratn, Hamzah Badawi, Abdul Malik Muhammad, A.G.H Muhammad Abduh Pabbaja, Abdul Muin Yusuf, and Abdul Azis (North Luwu.

  10. New insights into the structure of Om Ali-Thelepte basin, central Tunisia, inferred from gravity data: Hydrogeological implications

    Science.gov (United States)

    Harchi, Mongi; Gabtni, Hakim; El Mejri, Hatem; Dassi, Lassaad; Mammou, Abdallah Ben

    2016-08-01

    This work presents new results from gravity data analyses and interpretation within the Om Ali-Thelepte (OAT) basin, central Tunisia. It focuses on the hydrogeological implication, using several qualitative and quantitative techniques such as horizontal gradient, upward continuation and Euler deconvolution on boreholes log data, seismic reflection data and electrical conductivity measurements. The structures highlighted using the filtering techniques suggest that the Miocene aquifer of OAT basin is cut by four major fault systems that trend E-W, NE-SW, NW-SE and NNE-SSW. In addition, a NW-SE gravity model established shows the geometry of the Miocene sandstone reservoir and the Upper Cretaceous limestone rocks. Moreover, the superimposition of the electrical conductivity and the structural maps indicates that the low conductivity values of sampled water from boreholes are located around main faults.

  11. Turkish Postmodernism through the “Second Wave” Paradigm: The Example of Creative Work by Hasan Ali Toptaş and Perihan Mağden

    Directory of Open Access Journals (Sweden)

    Kseniya V. Grebenshcikova

    2017-11-01

    Full Text Available This paper describes the aspects of Turkish postmodernism of the "second wave", which is justified by an insignificant number of theoretical works and inadequate elaboration of studies concerning the representatives of Turkish postmodernism "second wave". The exception is represented by the works of Russian turkologists M.M. Repenkova and O.V. Kareva, who consider the features of the postmodern paradigm in their studies within the novelistics of the leading representatives of the Turkish postmodernism "second wave". The representatives of the "second wave" (Hasan Ali Toptaş, İhsan Oktay Anar, Perihan Mağden, Kürşat Başar, etc. were not the object of close research before, and therefore the consideration of their creativity as the next stage in the development of Turkish postmodernism is relevant. The "second wave" of postmodernism is characterized by the appeal to the literature of symbolic modeling in 1990s. During this period, the literature of postmodernism develops into a powerful trend, which becomes the predominant trend of the cultural life of Turkey in 2000s. It is worth noting that, if in the postmodern prose of 1980s was marked by the dominance of "lyrical stream", then in 1990s and 2000s the dominant trend was represented by narrative modification. Hasan Ali Toptaş, known for his mastery of language use, is regarded as one of the main representatives of the second wave of postmodern literature.

  12. Digital Workflow for the Conservation of Bahrain Built Heritage: the Sheik Isa Bin ALI House

    Science.gov (United States)

    Barazzetti, L.; Mezzino, D.; Santana Quintero, M.

    2017-08-01

    Currently, the commercial market offers several tools for digital documentation of historic sites and buildings. Photogrammetry and laser scanning play a fundamental role in the acquisition of metric information, which is then processed to generate reliable records particularly useful also in the built heritage conservation field. Although potentially very fast and accurate, such techniques require expert operators to produce reliable results, especially in the case of complex and large sites. The aim of this paper is to present the digital workflow developed for data acquisition and processing of the Shaikh Isa Bin Ali house in Muharraq, Bahrain. This historic structure is an outstanding example of Bahrain architecture as well as tangible memory of the country history, with strong connotations in the Bahrain cultural identity. The building has been documented employing several digital techniques, including: aerial (drone) and terrestrial photogrammetry, rectifying photography, total station and laser scanning. The documentation project has been developed for the Bahrain Authority for Culture and Antiquities (BACA) by a multidisciplinary team of experts from Carleton Immersive Media Studio (CIMS, Carleton University, Canada) and Gicarus Lab (Politecnico di Milano, Italy).

  13. Summer students and professor from the United Arab Emirates - from left to right : Alya Ali Binghurair, Shaikha Al Kalbani, Professor Chafia Hejase de Trad, Mariam Al Hassani, Aminah Al Abdouli.

    CERN Multimedia

    Maximilien Brice

    2004-01-01

    Summer students and professor from the United Arab Emirates - from left to right : Alya Ali Binghurair, Shaikha Al Kalbani, Professor Chafia Hejase de Trad, Mariam Al Hassani, Aminah Al Abdouli.

  14. The Effect of Dramatized Instruction on Speaking Ability of Imam Ali University EFL Learners

    Directory of Open Access Journals (Sweden)

    Sadegh Khosronejad

    2013-09-01

    Full Text Available Teaching language as a second or foreign language, undoubtedly, is so demanding and seeking to find methods for facilitating this prominent practice whets the appetite of any practitioner who works in this field. Research shows that using drama in the classroom as a means of teaching helps students learn socially, academically, and developmentally. This study was an attempt to determine the effect of dramatized instruction on the speaking ability of EFL learners of Imam Ali University. Sixty EFL male students at the intermediate level participated in the study. Their age range was 19-22. Two instruments were utilized in this study; pretest, and posttest.  The data were analyzed through t-test. The data analysis indicated that the mean scores of the experimental group students (M = 72.80 were significantly different (3.29>2; df = 58 from the control group students (M = 65.39. In other words, the experimental group outperformed the control group in the posttest significantly. Moreover, the findings indicated that dramatized instruction does have a great effect on the speaking skills. This study supported the idea of effectiveness of dramatized instruction on developing speaking skill and the teachers can help the learners at lower levels promote their speaking skill through dramatized instruction in EFL classes.

  15. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    org/10.21010/ajtcam.v13i6.9 .... Muhammad Abuzar Ghaffari, Bashir Ahmed Chaudhary, Muhammad Uzair, Khuram Ashfaq, 194-198 ... Abdelkader Benhelima, Zohra Kaid-Omar, Houari Hemida, Tarek Benmahdi, Ahmed Addou, 204-214.

  16. موقف مجلس الشورى الوطني الإيراني من السلطة التنفيذية "الوزارة " 1909 – 1911 The position of the National Iranian Shura Council of the executive branch, "the ministry" 1909 - 1911

    Directory of Open Access Journals (Sweden)

    Uday Mohammed Kazem Sabti عدي محمد كاظم السبتي

    2014-06-01

    Full Text Available The relationship between the Shura Council and the National Iranian, Mohammad Ali shah Experienced a major irritant to the extent of hostility between the two parties settled the outcome in favor of the council after that erupted Iranian people and declared his revolution to Muhammad Ali Shah and being able to eliminate his rule, and the impact of this success has been the reinstatement of parliamentary life and the opening of the Council again. the Council Elevated at its second session (1909 - 1911 and the agents of walks of different political, was among the most prominent of those stripes are party social workers Moderations and the Democratic Party and the Party of the agreement and Progress Party advocates liberal south, has entered the bipartisan social workers Moderations and the Democratic Party in the struggle frantically prolonged effects of various aspects of the state 'is the most important detail was the executive branch, "the ministry" to the degree that has become a process of forming a ministry or fall depends on the nature of the relationship between the agents of these parties in the council, and from this standpoint deliberately researchers to choose the theme of "the position of the Shura Council national Iranian power Executive "ministry" 1909 - 1911 "to be the title of their research, as well as a bowl in Zhenehma of questions about the number of ministries problem in this period first, and is the personalities that took over its presidency secondly what are the political conditions which formed the third and what is the nature of the relationship between the Council and the Ministry of A fourth point and other questions

  17. Pb-Zn mineralization of the Ali ou Daoud area (Central High Atlas, Morocco): characterisation of the deposit and relationships with the clay assemblages; Mineralisation Pb-Zn du type MVT de la region d'Ali ou Daoud (Haut Atlas Central, Maroc): caracterisations du gite et relations avec les corteges de mineraux argileux

    Energy Technology Data Exchange (ETDEWEB)

    Mouguina, E. M.; Daoudi, L.

    2008-07-01

    Zn-Pb-Fe ores in the Ali ou Daoud deposit (Central High Atlas) are found as stratiform levels and as karst fillings in carbonate platforms facies of Bajocian age. Tectonic structures (e.g., syn sedimentary faults) played a relevant role in the ore emplacement. The dolomitic ore-related host-rock levels are characterized by the presence of kaolinite enrichment in clay levels in amounts directly related to the proportion of the clay minerals. The latter is evidenced by correlation between kaolinite and sulphide contents, suggesting that the installation of kaolinite and mineralizations would result from the same hydrothermal fluid. (Author) 55 refs.

  18. The hidden costs of installing xpert machines in a tuberculosis high ...

    African Journals Online (AJOL)

    The hidden costs of installing xpert machines in a tuberculosis high-burden country: experiences from Nigeria. Saddiq Tsimiri Abdurrahman, Nnamdi Emenyonu, Olusegun Joshua Obasanya, Lovett Lawson, Russell Dacombe, Muhammad Muhammad, Olanrewaju Oladimeji, Luis Eduardo Cuevas ...

  19. Mikrolaenude ristiisa hoiatab liiga kiire kasvu eest / Kaire Talviste

    Index Scriptorium Estoniae

    Talviste, Kaire, 1979-

    2008-01-01

    2006. aastal vaesusega võitlemise eest Nobeli rahupreemia saanud Bangladeshi majandusteadlasest Muhammad Yunusest, kelle asutatud Grameeni väikepank annab jõukohaseid mikrolaene vaestele. Lisa: Muhammad Yunus; Laenude teine nägu; Üks näide

  20. Clinical Practice Update: The Use of Per-Oral Endoscopic Myotomy in Achalasia: Expert Review and Best Practice Advice From the AGA Institute.

    Science.gov (United States)

    Kahrilas, Peter J; Katzka, David; Richter, Joel E

    2017-11-01

    The purpose of this review is to describe a place for per-oral endoscopic myotomy (POEM) among the currently available robust treatments for achalasia. The recommendations outlined in this review are based on expert opinion and on relevant publications from PubMed and EMbase. The Clinical Practice Updates Committee of the American Gastroenterological Association proposes the following recommendations: 1) in determining the need for achalasia therapy, patient-specific parameters (Chicago Classification subtype, comorbidities, early vs late disease, primary or secondary causes) should be considered along with published efficacy data; 2) given the complexity of this procedure, POEM should be performed by experienced physicians in high-volume centers because an estimated 20-40 procedures are needed to achieve competence; 3) if the expertise is available, POEM should be considered as primary therapy for type III achalasia; 4) if the expertise is available, POEM should be considered as treatment option comparable with laparoscopic Heller myotomy for any of the achalasia syndromes; and 5) post-POEM patients should be considered high risk to develop reflux esophagitis and advised of the management considerations (potential indefinite proton pump inhibitor therapy and/or surveillance endoscopy) of this before undergoing the procedure. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  1. Hz. Ali’nin Menkıbevî Hayatına Dair Bir Destan: Dâstân-ı Ejderhâ A Legend about the life of Ali: The Legend of Dragon

    Directory of Open Access Journals (Sweden)

    Ali KOZAN

    2013-07-01

    Full Text Available Following the conversion of Turks to Islam a new structure ofbelief and culture has appeared for them. They recall the individualsthey consubstantiated with Islam by heroic stories in verbal custom. Inthis praxis especially the son in law of Prophet Muhammed, first fourCaliphs and the friends of Prophet have become indispensable part ofthese legendary stories. In the legendary stories which our workincludes, the heroic, warrior and courageous side of Ali have shown asbeing a son in law of Prophet and father of Hasan and Hussein.Thistradition has written down by the works of Islamic Era of TurkishHistory. One of the “Cenknâmes” which Ali's braveness and courageoushas mention is “Destan-ı Ejderha”, The Legend Of Dragon. The legendhas written in the manner of "masnavi" and also it has some features oftale and legend genre.In this work namely “Destan-ı Ejderha” a dragon which Muslimscame to place of Prophet Muhammed in order to complain of it and awar which was fought between dragon and a group of “sahabe” underthe leadership of Ali by the assignment of Prophet Muhammed and thedefeat of dragon were mentioned. At the work Ali combines fantasticpowers in his heroic personality therefore withstands against dragonwhich was symbolized as an enemy of the religion and Ali has apersonality that is not avoid to struggle. In the legend Muslims wereaimed to encourage to “gaza” by underlining Ali’s face up of the death.Also it is aimed to obtain an idea that the true religion is Islam and alsoto make the ideal of gaza and jihad by the pointing the rebellious oneswill be eradicated in a pathetic way.In our work primarily we have compared the copies by collectedthe exemplars of “The Legend of Dragon” then tried to expose theoriginal text. Epic’s implications are discussed in Anatolia and theBalkans, later on an assessment is made about the value and place ofthe mentioned pamphlet in the history of Turkish Culture in Islamicperiod

  2. Early Freezing of Gait: Atypical versus Typical Parkinson Disorders

    Directory of Open Access Journals (Sweden)

    Abraham Lieberman

    2015-01-01

    Full Text Available In 18 months, 850 patients were referred to Muhammad Ali Parkinson Center (MAPC. Among them, 810 patients had typical Parkinson disease (PD and 212 had PD for ≤5 years. Among the 212 patients with early PD, 27 (12.7% had freezing of gait (FOG. Forty of the 850 had atypical parkinsonism. Among these 40 patients, all of whom had symptoms for ≤5 years, 12 (30.0% had FOG. FOG improved with levodopa in 21/27 patients with typical PD but did not improve in the 12 patients with atypical parkinsonism. FOG was associated with falls in both groups of patients. We believe that FOG unresponsive to levodopa in typical PD resembles FOG in atypical parkinsonism. We thus compared the 6 typical PD patients with FOG unresponsive to levodopa plus the 12 patients with atypical parkinsonism with the 21 patients with typical PD responsive to levodopa. We compared them by tests of locomotion and postural stability. Among the patients with FOG unresponsive to levodopa, postural stability was more impaired than locomotion. This finding leads us to believe that, in these patients, postural stability, not locomotion, is the principal problem underlying FOG.

  3. Measurement of Radon (222Rn) in the High School of Medicine 'Dr.Ali Sokoli' in Prishtina

    International Nuclear Information System (INIS)

    Kadiri, S.; Hodolli, G.; Pllana, X.; Dumani, S.; Hasani, F.

    2011-01-01

    Measurements of radon concentration (222Rn) were performed in the largest High School of Medicine ''Dr. Ali Sokoli'' in Prishtina. We choose four locations (classrooms) at ground level, three at first and three on the second floor. In the same premises, the measurements were performed with two methods: using a scintillation cell and a continuous method. The maximum value of radon concentration, measurements with scintillation cells, were obtained by the ground level moving to (573 ± 26) Bq m -3 , while the minimum value of (176 ± 11) Bq m -3 was obtained in the second floor. The maximum value of radon concentration measurements with the continuous method was 116 Bq m -3 in ground level, and the minimum value was 70 Bq m -3 . Based on these results, we calculated annual effective dose, which ranges between (0.76 ± 0.06) mSv and (2.48 ± 0.11) mSv, by scintillation cells. Whereas, the annual effective dose measuring by continuous method was between 0.30 mSv and 0.50 mSv. Based on those results, we conclude that radon concentration and annual effective doses were within accepted international standards. (author)

  4. African Journal of Biotechnology - Vol 11, No 62 (2012)

    African Journals Online (AJOL)

    Production of pectinase by Bacillus subtilis EFRL 01 in a date syrup medium · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Abdul Sattar Qureshi, Muhammad Aqeel Bhutto, Yusuf Chisti, Imrana Khushk, Muhammad Umar Dahot, Safia Bano, 12563-12570 ...

  5. Androgenetic alopecia in men aged 40-69 years: prevalence and risk factors.

    Science.gov (United States)

    Severi, G; Sinclair, R; Hopper, J L; English, D R; McCredie, M R E; Boyle, P; Giles, G G

    2003-12-01

    The epidemiology of androgenetic alopecia (AGA) is not fully understood. Although a strong genetic basis has long been identified, little is known of its non-genetic causes. To estimate the prevalence of and to determine risk factors for AGA in men aged 40-69 years in Australia. Men (n = 1390) were recruited at random from the electoral rolls to serve as controls in a population-based case-control study of prostate cancer. All were interviewed in person and direct observations of AGA were made. Men were grouped into the following categories; no AGA, frontal AGA, vertex AGA and full AGA (frontal and vertex AGA). Epidemiological data collected from these men were used for an analysis of risk factors for each AGA category using unconditional logistic regression with AGA category as the response variable adjusting for age, education and country of birth. The prevalence of vertex and full AGA increased with age from 31% (age 40-55 years) to 53% (age 65-69 years). Conversely, the proportion of men with only frontal AGA was very similar across all age groups (31-33%). No associations were found between pubertal growth spurt or acne, reports of adult body size at time of interview, urinary symptom score, marital status, or current smoking status or duration of smoking and the risk of any form of AGA. The consumption of alcohol was associated with a significant increase in risk of frontal and vertex AGA but not full AGA. Men with vertex AGA had fewer female sexual partners but average ejaculatory frequency did not differ between men in different AGA categories. Reported weight and lean body mass at reaching maturity at about 21 years of age were negatively associated with vertex balding (P for trend body mass at age 21 years would be worthy of further research if they were able to be replicated in other studies.

  6. Geology, Alteration, Mineralization, Geochemistry and Petrology of intrusive units in the Shah Soltan Ali prospect area (Southwest of Birjand, South Khorasan province

    Directory of Open Access Journals (Sweden)

    Samaneh Nadermezerji

    2017-07-01

    Full Text Available Introduction The Shah Soltan Ali area is located 85 km southwest of Birjand in the South Khorasan province. This area is part of the Tertiary volcanic-plutonic rocks in the east of the Lut block. The Lut block is bounded to the east by the Nehbandan and associated faults, to the north by the Doruneh and related faults (Sabzevar zone, to the south by the Makran arc and Bazman volcanic complex and to the west by the Nayband Fault. The Lut block is the main metallogenic province in the east of Iran (Karimpour et al., 2012, that comprises of numerous porphyry Cu and Cu–Au deposits, low and high sulfidation epithermal Au deposits, iron oxide deposits, base-metal deposits and Cu–Pb–Zn vein-type deposits. The geology of Shah Soltan Ali area is dominated by volcanic rocks, comprised of andesite and basalt, which are intruded by subvolanic units such as monzonite porphyry, monzodiorite porphyry and diorite porphyry. Materials and methods 1. 170 thin sections of the rock samples as well as 25 polished and thin polished sections were prepared for petrography, alteration and mineralization. 2. Twenty five samples were analyzed for Cu, Pb, Zn, Sb, Mo and As elements by the Aqua regia method in the Zarazama laboratory in Tehran, Iran. 3. Nine samples were analyzed for trace elements [including rare earth elements (REEs]. As a result of these analyses, trace elements and REE were determined by inductively coupled plasma mass spectrometry (ICP-MS in the ACME Analytical Laboratories (Vancouver Ltd., Canada. 4. Ten samples were analyzed for major elements by wavelength dispersive X-ray fluorescence spectrometry in the East Amethyst laboratory in Mashhad, Iran. 5. Five samples were analyzed for Firre Assay analysis in the Zarazma Laboratory in Tehran, Iran. 6. The results of XRD analysis were used for 4 samples. Discussion and results Petrographic studies indicate that subvolcanic rocks consist of diorite porphyry, monzonite porphyry and monzodiorite

  7. Browse Title Index

    African Journals Online (AJOL)

    Samina Shahid, Shafiq ur Rehman, Ahmad Adnan. Vol 7, No 25 (2008), Sucrose assimilation and ... Abdul Mateen, Shaukat Hussain, Shams Ur Rehman, Basharat Mahmood, Muhammad Aslam Khan, Abdul Rashid, Majid Sohail, Muhammad Farooq, S Jawad Ahmed Shah. Vol 8, No 22 (2009), Sulfuric acid and hot water ...

  8. Hypertension in Adults: Part 2. Assessment and management

    African Journals Online (AJOL)

    Angel_D

    Dr Muhammad Ilyas, Specialist Registrar Acute Medicine, St Mary's Hospital Isle of Wight, UK muhammad_ilyas73@yahoo.com. (Part 1. Prevalence, types, causes and effects was published in volume 2 issue 3 ... peripheral oedema ... Electrocardiogram for cardiac rhythm and ... and oils come from plant foods and fish.

  9. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. MUHAMMAD UMAIR. Articles written in Journal of Genetics. Volume 96 Issue 6 December 2017 pp 1005-1014 Research article. Ellis–van Creveld syndrome and profound deafness resulted by sequence variants in the EVC/EVC2 and TMC1 genes · MUHAMMAD UMAIR HEIDE ...

  10. Study of the International Epidemiology of Androgenetic Alopecia in Young Caucasian Men Using Photographs From the Internet.

    Science.gov (United States)

    Avital, Yaniv Shalom; Morvay, Marta; Gaaland, Magdolna; Kemény, Lajos

    2015-01-01

    The epidemiological evaluation of androgenetic alopecia (AGA) is based mainly on direct observation and questionnaires. The international epidemiology and environmental risk factors of AGA in young Caucasian men remain unknown. To use photographs and data from the Internet to evaluate severe AGA and generate greater understanding of the international epidemiology of the disorder in young Caucasian men. A population-based cross-sectional study design was used. The sample included 26,340 Caucasian men aged 30 to 40 years who had uploaded profiles to two dating websites. Their photographs were evaluated for AGA and graded as follows: severe AGA (Norwood type VI-VII), non-severe AGA, and unknown. Epidemiological data were collected from the sites. Logistic regression was used to analyze the effect of risk factors on the prevalence of severe AGA. The overall success rate for identifying severe AGA by indirect evaluation of Internet photographs was 94%. The prevalence of severe AGA was 15.33% overall and varied significantly by geographical region. The risk of having severe AGA was increased by 1.092 for every year of age between 30 and 40 years. Severe AGA was more prevalent in subjects with higher body mass index. Photographs from the Internet can be used to evaluate severe AGA in epidemiological studies. The prevalence of severe AGA in young Caucasian men increases with age and varies by geographical region. Body mass index is an environmental risk factor for severe AGA.

  11. Study of the international epidemiology of androgenetic alopecia in young caucasian men using photographs from the internet

    Directory of Open Access Journals (Sweden)

    Yaniv Shalom Avital

    2015-01-01

    Full Text Available Background: The epidemiological evaluation of androgenetic alopecia (AGA is based mainly on direct observation and questionnaires. The international epidemiology and environmental risk factors of AGA in young Caucasian men remain unknown. Aim: To use photographs and data from the Internet to evaluate severe AGA and generate greater understanding of the international epidemiology of the disorder in young Caucasian men. Materials and Methods: A population-based cross-sectional study design was used. The sample included 26,340 Caucasian men aged 30 to 40 years who had uploaded profiles to two dating websites. Their photographs were evaluated for AGA and graded as follows: severe AGA (Norwood type VI-VII, non-severe AGA, and unknown. Epidemiological data were collected from the sites. Logistic regression was used to analyze the effect of risk factors on the prevalence of severe AGA. Results : The overall success rate for identifying severe AGA by indirect evaluation of Internet photographs was 94%. The prevalence of severe AGA was 15.33% overall and varied significantly by geographical region. The risk of having severe AGA was increased by 1.092 for every year of age between 30 and 40 years. Severe AGA was more prevalent in subjects with higher body mass index. Conclusions: Photographs from the Internet can be used to evaluate severe AGA in epidemiological studies. The prevalence of severe AGA in young Caucasian men increases with age and varies by geographical region. Body mass index is an environmental risk factor for severe AGA.

  12. Committee for International Conference on Mechanical Engineering Research (ICMER 2011)

    Science.gov (United States)

    Yusoff, Ahmad Razlan Bin

    2012-09-01

    Scientific Advisory Committee: 1) Prof. Dr. Ahmad Kamal Ariffin (UKM) 2) Prof. Dr. Hj. Rosli Abu Bakar (UMP) 3) Prof. Dr. Hanafi Ismail (USM) 4) Prof. Ir. Dr. Mohd Jailani Mohd Nor (MoHE) 5) Prof. Dr. Zahari Taha (UMP) 6) Prof. Dr. Masjuki Haji Hassan 7) Prof. Ir. Dr. Ramesh Singh (UNITEN) 8) Prof. Dr. Razali Ayob (UTEM) 9) Prof. Dr. Wan Khairuddin (UTM) 10) Prof. Dr. Sulaiman Hj. Hasan (UTHM) 11) Prof. Dr. Zuraidah Mohd. Zain (UniMAP) 12) Prof. Dr. Horizon Gitano (USM) 13) Prof. Dr. K.V Sharma (UMP) 14) Prof. Dr. Shahrani Anuar (UMP) 15) Assoc. Prof. Dr. Abd Rashid Abd. Aziz (UTP) 16) Assoc. Prof. Dr. Aidy Ali (UPM) 17) Assoc. Prof. Dr. Saidur Rahman (UM) 18) Assoc. Prof. Dr. Md Abdul Maleque (UIA) Organizing Committee Chairman: Prof. Dr. Hj. Rosli Abu Bakar Co-Chair: Prof. Dr. Zahari Taha Co-Chair: Prof. Ir. Dr. Jailani Salihon Secretary: Dr. Rizalman Mamat Committee on Keynote Speaker 1) Kumaran Kadirgama (Chair) 2) Prof. Dr. K.V. Sharma 3) Haji Amirruddin Abdul Kadir 4) Miminorazeansuhaila Loman 5) Mohd Akramin Mohd Romlay Technical Committee (Peer Review & Proceedings) 1) Dr. Abdul Adam Abdullah (Chair) 2) Dr. Ahmad Razlan Yusoff 3) Mohd Yusof Taib 4) Dr. Md. Mustafizur Rahman 5) Dr. Hjh. Yusnita Rahayu 6) Dr. Gigih Priyandoko 7) Dr. Agung Sudrajad 8) Muhammad Hatifi Mansor 9) Mohd Fadzil Abdul Rahim Technical Committee (Panels & Session Chairs) 1) Dr. Mahadzir Ishak (Chair) 2) Prof. Dr. Shahrani Anuar 3) Dr. Maisara Mohyeldin Gasim Mohamed 4) Muhammad Ammar Nik Mu'tasim 5) Ahmad Basirul Subha bin Alias Technical Committee (Journal Publication) 1) Dr. Ahmad Razlan bin Yusoff (Chair) 2) Mohd Yusof Taib 3) Dr. Mahadzir Ishak 4) Dr. Abdul Adam Abdullah 5) Hj. Amirruddin Abdul Kadir 6) Hadi Abdul Salaam Bureau of Publicity & Website 1) Dr. Muhamad Arifpin Mansor (Chair) 2) Amir Abdul Razak 3) Idris Mat Sahat 4) Prof. Dr. Hj. Rosli Abu Bakar 5) Muhamad Zuhairi Sulaiman 6) Dr. Sugeng Ariyono 7) Asnul Hadi Ahmad 8) Mohd Tarmizy Che Kar 9) Mohd Padzly Radzi Bureau of

  13. Structural Study and Evaluation of Previous Restoration Work of Mohammad 'Ali Pasha Mosque at the Citadel in Cairo

    Directory of Open Access Journals (Sweden)

    dr.Yaser Yehya Amin Abdel-Aty

    2011-01-01

    Full Text Available Mohammad 'Ali Pasha Mosque at the Citadel in Cairo is considered one of the main landmarks in Egypt. It majestically stands at a northwestern bend of the Citadel and it is visible from numerous locations in Cairo. It has become the symbol of the Citadel, to the point that its name is given to the whole complex in the colloquial Egyptian parlance. This paper studies analytically the static and dynamic structural behavior of this great mosque using computer numerical modeling techniques, to reach the main reasons for past cracking and failures in its domed-roof and other structural elements, which occurred by the end of 19th Century. A number of 3D-models are analyzed to study the mosque, in both original and after restoration conditions, under static (i.e. dead and live loads and dynamic (i.e. Eigenvector modal analysis, response-spectrum and time-history cases of loading. Besides, structural evaluation of major restoration project, in 1930s, is conducted to determine the current structural safety status of the mosque

  14. Biochemical characterization and comparison of aspartylglucosaminidases secreted in venom of the parasitoid wasps Asobara tabida and Leptopilina heterotoma.

    Directory of Open Access Journals (Sweden)

    Quentin Coulette

    Full Text Available Aspartylglucosaminidase (AGA is a low-abundance intracellular enzyme that plays a key role in the last stage of glycoproteins degradation, and whose deficiency leads to human aspartylglucosaminuria, a lysosomal storage disease. Surprisingly, high amounts of AGA-like proteins are secreted in the venom of two phylogenetically distant hymenopteran parasitoid wasp species, Asobara tabida (Braconidae and Leptopilina heterotoma (Cynipidae. These venom AGAs have a similar domain organization as mammalian AGAs. They share with them key residues for autocatalysis and activity, and the mature α- and β-subunits also form an (αβ2 structure in solution. Interestingly, only one of these AGAs subunits (α for AtAGA and β for LhAGA is glycosylated instead of the two subunits for lysosomal human AGA (hAGA, and these glycosylations are partially resistant to PGNase F treatment. The two venom AGAs are secreted as fully activated enzymes, they have a similar aspartylglucosaminidase activity and are both also efficient asparaginases. Once AGAs are injected into the larvae of the Drosophila melanogaster host, the asparaginase activity may play a role in modulating their physiology. Altogether, our data provide new elements for a better understanding of the secretion and the role of venom AGAs as virulence factors in the parasitoid wasps' success.

  15. Erken Cumhuriyet Yılları Milli Kimlik Tartışmaları: Hasan Ali Yücel ve Türkiye’de Hümanizma Arayışları Discussions on National Identity in the Early Republican Years: Hasan Ali Yucel and Searching for Turkish Humanism

    Directory of Open Access Journals (Sweden)

    Emre YILDIRIM

    2013-09-01

    Full Text Available This article aims to demonstrate a small group of intellectuals’ thoughts on nationalism and Turkish national identity who had tried to give an answer by searching for a new and unique Turkish humanism in general and particularly former Minister of Education, Hasan Ali Yücel’s period (1939-1946 and his humanist reformist approach to politics during the nation/identity-building process in the early decades of Republican Era. After the historical and social transition, French Revolution spreading the ideas of equality, liberty and fraternity giving rise to nationalist movements throughout Europe ended up with the decline of the multi-national empires and gave birth to the nation-states. Like the others, a new nation-state, Turkish Republic was established after the Ottoman Empire had collapsed. Turkish modernization initially took a form of westernization. Three ideologies; Pan-Ottomanism, Pan-Islamism and Pan-Turkism were seen as an appropriate direction for the society’s search for a new identity. At the same time, Turkish national identity was seen as an appropriate direction for the society’s search for a new identity and The republican elite embarked a radical stand and defined Turkish identiy as western modern secular nation which later became a dominant ideology for the new republic. At the time of early years of Republic, there were seen different acceptions for the content national identity. Hasan Ali Yücel and intellectuals searching for Turkish humanism defined modern Turkish identity by deriving it from Anatolian humanism, which could be realized through a Turkish Renaissance and claimed that it would be possible to create a unique Anatolian identity by this definition. Bu çalışma, Modern Türkiye tarihinin erken Cumhuriyet yıllarının ulus-devletleşme sürecinde milliyetçilik ve milli kimlik üzerine yaşanan tartışmalara katkıları açısından milli kimliğin içeriğini belirlemede Türkiye’ye özgü yeni bir

  16. BIBLIOMETRICS ON ONE OF THE LARGEST TERMITE INVENTORIES IN THE CERRADO: "STUDIES ON TERMITES FROM THE MATO GROSSO STATE, BRAZIL BY AGA MATHEWS 1977"

    Directory of Open Access Journals (Sweden)

    HÉLIDA FERREIRA DA CUNHA

    2015-01-01

    Full Text Available ABSTRACT This paper consists on a bibliometric analysis of the international influences of the book "Studies on termites from the Mato Grosso State, Brazil", by AGA Mathews (1977. The number of citations has increased over the years after the first citation. Mathews book was cited in articles, reviews, theses, dissertations, books, book chapters, abstracts in conference proceedings, comments and scientific notes. Most these studies are empirical and descriptive. The studies were conducted in 35 countries of the Neotropical, Palearctic, Afrotropical, Nearctic, Australasia and Indomalaya regions. 55% of the studies were carried out in Brazil. The journals Sociobiology and Insectes Sociaux, have social insect studies within its scope, and the highest number of articles citing Mathews. Most of the 71 authors that cited Mathews more than twice are Brazilian. Constrictotermes cyphergaster was the most studied in over 80% of the studies addressing Isoptera. The most frequent keywords were termite, Isoptera and taxonomy, generalist terms indexed in most publications carried out in different countries. Most of the research studies were carried out in laboratories and native vegetation areas. Studies in agroecosystems were implemented predominantly in Brazil. This study shows the diversity of application (citations of Mathews' book, and that the number of citations will continue to increase due to the large amount of information presented by the author.

  17. Browse Title Index

    African Journals Online (AJOL)

    Items 8751 - 8800 of 11090 ... Vol 11, No 62 (2012), Production of pectinase by Bacillus subtilis EFRL 01 in a date syrup medium, Abstract PDF. Abdul Sattar Qureshi, Muhammad Aqeel Bhutto, Yusuf Chisti, Imrana Khushk, Muhammad Umar Dahot, Safia Bano. Vol 5, No 18 (2006), Production of peptone from soya beans ...

  18. Makna menjadi keluarga ‘teroris’ bagi keluarga tersangka terorisme Amrozi dan Ali Ghufron di Desa Tenggulun, Kecamatan Solokuro, Kabupaten Lamongan

    Directory of Open Access Journals (Sweden)

    Anis Ulfiyatun

    2015-04-01

    Full Text Available In understanding terrorism, comprehensive perspective is strongly needed in order to explain terrorism activity in a boarder structure. The main purpose of this article is to understand the circumstances that were redefined by terrorism suspect's family about their existence in the society. Another objective of this research was also to prove the presumption of being a terrorist's family and their response of massive terrorism related reportage from media. This research uses qualitative method to comprehend value and socio-cultural context in many terrorism cases, considering terrorits's family position and situation after the bombing. Primary data were collected by in-depth interview with Amrozy and Ali Ghufron's family. The research shows that terrorist's family has redefined their identity as terrorist's family by saying "us" are different with common family around them. The difference meant in this context was about life principal that was based on Islamic value and behaviour which had to be preserved by the terrorist's family

  19. Paparan Debu Kayu Dan Gangguan Fungsi Paru Pada Pekerja Mebel (Studi di PT Alis Jaya Ciptatama

    Directory of Open Access Journals (Sweden)

    Wenang Triatmo

    2015-12-01

    Full Text Available ABSTRACT Background : Wood dust generated from processes of sawing, planning and sanding can disperse in the workplace air and harm to the workers. Exposed to low concentration of wood dust for a long time can cause respiratory tract disorders  such as restriction, obstruction or mixed. Generally, organic dust exposure will effect on obstruction of respiratory tract which is indicated by decreasing of % FEV – 1 / FVC. Workers of wood industries have a high risk from wood dust deposition on their respiratory tract. Absorption of wood dust particles in the lung occurred by respiration mechanism. Methods : This research purpose was to analyze the exposure of wood dust and lung function disorder on furniture workers (Study  at  PT Alis Jaya Ciptatama in Jepara Regency. This research was an observational study with a cross Sectional approach with 55 samples. Sampling was carried out by using a Probability Systematic Sampling. Data of respirable wood dust concentration  was measured by a using Personal Dust Sampler. Whereas data of lung function was resulted from Sprirometry test  using a spirometer. Other data was collected from interview with the workers with age limitation is up to 40 years old. Data analyze by Chi Square Test was used to   identity the wood dust exposure, age, gender, time of exposure, working years, smoking habit, excercise habit, nutrient status and awareness in using of Personal Protective Equipment, in the correlation of occuring the lung function disorder.Multivariat analysis was carried out by regression test with the method of backward stepwise. Results: The result of this research was wood dust exposure significantly influence and correlate to the occuring of the lung function disorder on furniture workers ( Study at PT Alis Jaya Ciptatama , using appliance Personal Dust Sampler, highest result wood dust exposure 1,848 mg/m³ and the low result wood dust exposure 0,833 mg/m³, with the result : for wood dust

  20. Permanentnost primitivne akumulacije, ali o privatni lastnini, komodifikaciji in povratku rente

    Directory of Open Access Journals (Sweden)

    Jernej Prodnik

    2011-06-01

    Full Text Available Namen teksta je prispevati k razumevanju ideje o skupnem v obstoječih zgodovinskih okvirih. Avtor opozarja na množico pomenov, ki jih je potrebno vzeti v ozir, ko poizkušamo konceptualizirati skupno, vsaj če ga hočemo razumeti kar se le da celovito. Tega koncepta namreč nikakor ne smemo dojemati le v povezavi s skupnimi viri, področji ali dobrinami, torej v pomenu tega, kar se najpogosteje dojema za skupno posest ali skupno »lastnino«. Skupno je namreč v prvi vrsti koncept, ki ga je nemogoče misliti brez družbenih odnosov, ki so njegov neizogiben del. Omenjen ožji oziroma zamejen pristop, ki je značilen predvsem za politično-ekonomski pogled na skupno, sicer lahko nudi enega izmed ključev za razumevanje raznolikosti skupnega in s kakšnimi tehnikami se ga v epohi bio-lingvističnega kapitalizma eksploatira, vendar bi ekskluzivno osredotočanje le na ta pomen reduciralo kompleksnost tako samega koncepta, kot tudi družbe, v kateri nastaja, s čimer bi lahko tvegali naturalizacijo nekaterih delov družbenega. Prvi del teksta je zato namenjen razjasnitvi mnoštva obrazov in pristopov, iz katerih je mogoče opazovati skupno, čemur šele v drugem delu in s pridržki sledi poizkus politično-ekonomske tipologizacije skupnega. V tem delu sta izpostavljeni predvsem dve »neotipljivi« obliki skupnega, ki postajata žrtvi novih procesov ograjevanja in privatizacije. V obeh primerih se lastnini same informacije, za katere je značilna nerivalska logika ter nizka subtraktivnost, s tem pa se ustvarja nove monopole nad znanjem, ki posredno vplivajo na delovanje celotne družbe. Ti procesi so omogočeni z zunaj-ekonomskimi posegi, predvsem prek uveljavljanja t.i. intelektualne lastnine, ki se na globalni ravni širi prek novih in rigidnih lastniških sistemov (npr. TRIPS, lastnikom pa omogoča omejevanje dostopa ter jim s tem potencialno prinaša ‘profit, ki postaja renta’. Avtor k skupnemu pristopa iz radikalne pozicije alternativne

  1. Olaitan and Muhammad (12)

    African Journals Online (AJOL)

    DELL

    various selective media such as MacConkey agar, mannitol salt agar .... Yemen. Journal of Pharmacy and. Pharmacognosy Research.3(1), 6 – 12. Amira, E. E., Abdel, M. E. S. ... of Natural and Social Sciences.2: 54 – 59. Ferreria, A. C., Morais ...

  2. Professor Mansour Ali Haseeb: Highlights from a pioneer of biomedical research, physician and scientist.

    Science.gov (United States)

    Salih, Mustafa Abdalla M

    2013-01-01

    The article highlights the career of Professor Mansour Ali Haseeb (1910 - 1973; DKSM, Dip Bact, FRCPath, FRCP [Lond]), a pioneer worker in health, medical services, biomedical research and medical education in the Sudan. After his graduation from the Kitchener School of Medicine (renamed, Faculty of Medicine, University of Khartoum [U of K]) in 1934, he devoted his life for the development of laboratory medicine. He became the first Sudanese Director of Stack Medical Research Laboratories (1952 - 1962). He made valuable contributions by his services in the vaccine production and implementation programs, most notably in combating small pox, rabies and epidemic meningitis. In 1963 he became the first Sudanese Professor of Microbiology and Parasitology and served as the first Sudanese Dean of the Faculty of Medicine, U of K (1963-1969). He was an active loyal citizen in public life and served in various fields outside the medical profession. As Mayor of Omdurman, he was invited to visit Berlin in 1963 by Willy Brandt, Mayor of West Berlin (1957-1966) and Chancellor of the Federal Republic of Germany (1969 to 1974). Also as Mayor of Omdurman, he represented the City in welcoming Queen Elizabeth II during her visit to Sudan in February 1965. He also received State Medals from Egypt and Ethiopia. In 1973 he was appointed Chairman of the Sudan Medical Research Council, and was awarded the international Dr. Shousha Foundation Prize and Medal by the WHO for his contribution in the advancement of health, research and medical services.

  3. Management of Clostridium difficile Infection in Inflammatory Bowel Disease: Expert Review from the Clinical Practice Updates Committee of the AGA Institute.

    Science.gov (United States)

    Khanna, Sahil; Shin, Andrea; Kelly, Ciarán P

    2017-02-01

    The purpose of this expert review is to synthesize the existing evidence on the management of Clostridium difficile infection in patients with underlying inflammatory bowel disease. The evidence reviewed in this article is a summation of relevant scientific publications, expert opinion statements, and current practice guidelines. This review is a summary of expert opinion in the field without a formal systematic review of evidence. Best Practice Advice 1: Clinicians should test patients who present with a flare of underlying inflammatory bowel disease for Clostridium difficile infection. Best Practice Advice 2: Clinicians should screen for recurrent C difficile infection if diarrhea or other symptoms of colitis persist or return after antibiotic treatment for C difficile infection. Best Practice Advice 3: Clinicians should consider treating C difficile infection in inflammatory bowel disease patients with vancomycin instead of metronidazole. Best Practice Advice 4: Clinicians strongly should consider hospitalization for close monitoring and aggressive management for inflammatory bowel disease patients with C difficile infection who have profuse diarrhea, severe abdominal pain, a markedly increased peripheral blood leukocyte count, or other evidence of sepsis. Best Practice Advice 5: Clinicians may postpone escalation of steroids and other immunosuppression agents during acute C difficile infection until therapy for C difficile infection has been initiated. However, the decision to withhold or continue immunosuppression in inflammatory bowel disease patients with C difficile infection should be individualized because there is insufficient existing robust literature on which to develop firm recommendations. Best Practice Advice 6: Clinicians should offer a referral for fecal microbiota transplantation to inflammatory bowel disease patients with recurrent C difficile infection. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  4. Shalawatan: Pembelajaran Akhlak Kalangan Tradisionalis

    OpenAIRE

    Mawardi, Kholid

    2015-01-01

    Shalawat is welfare pray and honor greeting to Nabi Muhammad SAW. For traditionalist Muslim, shalawatan or activity to recite shalawat can’t be separated with their paradigm about iman. Shalawatan tradition amongst this community also has purpose to transform noble akhlak (character) of Nabi Muhammad SAW to their daily activity, both in ibadah (ritual) or muamalah (worldly activity).

  5. ORF Alignment: NC_002678 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002678 gi|13475930 >1el5A 6 379 7 420 7e-42 ... ref|NP_107500.1| AgaE protein, conversion of agropini...c acid to mannopinic acid ... [Mesorhizobium loti MAFF303099] dbj|BAB53286.1| AgaE

  6. IMPACT DE L’ORIENTATION SUR LE CONFORT THERMIQUE INTERIEUR DANS L’HABITATION COLLECTIVE : Cas de la nouvelle ville Ali Mendjeli, Constantine

    Directory of Open Access Journals (Sweden)

    S BELLARA LOUAFI

    2009-06-01

    Une étude est effectuée sur le site de la nouvelle ville ALI MENDJELI de Constantine afin de comparer et de chercher la relation entre les éléments du climat et l’orientation. Une investigation sur terrain (relevé des températures, humidité relatives, températures de surfaces est entreprise pour évaluer la réponse quantitative globale pour ce type de climat (semi aride. Parallèlement à cela une simulation à l’aide d’un logiciel TRNSYS (version 14.1 a été effectuée pour tester plusieurs possibilités d’orientations et d’améliorations afin de déterminer les éléments qui peuvent servir à des conditions meilleures. Les résultats montrent que la prise en compte du critère orientation fait participer le bâtiment à une conception plus performante thermiquement et plus économe énergétiquement.

  7. »Nočem biti odvisna«: Ali javne prevajalske in tolmaške storitve res negativno vplivajo na aktivno vključenost migrantov v državo gostiteljico?

    Directory of Open Access Journals (Sweden)

    Nike Kocijančič Pokorn

    2016-12-01

    Full Text Available Prispevek se sprašuje o upravičenosti določenih političnih ukrepov, ki odrekajo zagotavljanje prevajanja in tolmačenja migrantom, ter zagovarja nove pristope k jezikovni in prevodni politiki, in sicer prek raziskave, ki je bila zasnovana kot odziv na trditve, da prevajalske in tolmaške storitve ovirajo integracijo nedavnih priseljencev. Raziskava je bila izvedena na skupini prosilcev za mednarodno zaščito v azilnem domu v Ljubljani. Najprej smo zbrali podatke o jezikovnem ozadju vseh stanovalcev azilnega doma v avgustu 2014 (56 stanovalcev iz 19 različnih držav, nato pa sestavili reprezentativno skupino 18 prosilcev za mednarodno zaščito na podlagi njihovega maternega jezika in jih razdelili na dve skupini glede na čas bivanja v Sloveniji v času intervjuja (krajše ali daljše obdobje. Kvantitativne podatke o jezikovnih profilih smo zbrali z vprašalnikom, kvalitativne pa s pomočjo polstrukturiranih intervjujev, izvedenih v letu 2014, in dveh ponovitvenih intervjujev v letu 2015. Nato smo kvalitativno analizirali transkripcije vseh posnetih intervjujev, pri čemer smo se osredotočali na jezikovne in komunikacijske rešitve na različnih stopnjah migrantovega življenja v državi gostiteljici. Rezultati kažejo, da je osnovne kompromise mogoče doseči, saj so prevajalske in tolmaške storitve komplementarni koraki do neodvisnosti in kot take ne ovirajo učenja dominantnega oz. nacionalnega jezika države gostiteljice, temveč ga podpirajo.

  8. Long-range ferromagnetism and magnetocaloric effects in rapidly quenched Ni50−xCoxMn50−yAly ribbons

    Directory of Open Access Journals (Sweden)

    Nguyen Thi Mai

    2017-03-01

    Full Text Available Ni50−xCoxMn50−yAly (x = 7 and 9; y = 17, 18 and 19 alloy ribbons were prepared by melt-spinning with a tangential velocity of copper wheel of 40 m s−1. X-ray diffraction patterns reveal multi-crystalline phase behavior in the fabricated ribbons. The shape of thermomagnetization curves clearly depends on Co and Al concentrations. The Curie temperatures (TC of the alloy ribbons strongly increase with increasing the Co concentration and slightly decrease with increasing the Al concentration. The martensitic-austenitic phase transition in the alloy ribbons can be manipulated by tuning Co and Al concentrations. The maximum magnetic entropy change |ΔSm|max of about 0.75 J kg−1 K−1 for a field change of 12 kOe at TC ≈ 364 K was achieved for the Ni43Co7Mn32Al18 ribbon. Critical analysis using the Arrott-Noaks and Kouvel–Fisher methods demonstrates the existence of a long-range ferromagnetic order in this ribbon.

  9. 27 August 2013 - Signature of an Agreement between KTO Karatay University in Turkey represented by the Dean of Engineering Professor Ali Okatan, CERN represented by Director for Research and Computing Dr Sergio Bertolucci and ALICE Collaboration represented by ALICE Collaboration Spokesperson Dr Paolo Giubellino.

    CERN Multimedia

    Maximilien Brice

    2013-01-01

    27 August 2013 - Signature of an Agreement between KTO Karatay University in Turkey represented by the Dean of Engineering Professor Ali Okatan, CERN represented by Director for Research and Computing Dr Sergio Bertolucci and ALICE Collaboration represented by ALICE Collaboration Spokesperson Dr Paolo Giubellino.

  10. Characterization of Streptomyces spp. isolated from the rhizosphere of oil palm and evaluation of their ability to suppress basal stem rot disease in oil palm seedlings when applied as powder formulations in a glasshouse trial.

    Science.gov (United States)

    Shariffah-Muzaimah, S A; Idris, A S; Madihah, A Z; Dzolkhifli, O; Kamaruzzaman, S; Maizatul-Suriza, M

    2017-12-18

    Ganoderma boninense, the main causal agent of oil palm (Elaeis guineensis) basal stem rot (BSR), severely reduces oil palm yields around the world. To reduce reliance on fungicide applications to control BSR, we are investigating the efficacy of alternative control methods, such as the application of biological control agents. In this study, we used four Streptomyces-like actinomycetes (isolates AGA43, AGA48, AGA347 and AGA506) that had been isolated from the oil palm rhizosphere and screened for antagonism towards G. boninense in a previous study. The aim of this study was to characterize these four isolates and then to assess their ability to suppress BSR in oil palm seedlings when applied individually to the soil in a vermiculite powder formulation. Analysis of partial 16S rRNA gene sequences (512 bp) revealed that the isolates exhibited a very high level of sequence similarity (> 98%) with GenBank reference sequences. Isolates AGA347 and AGA506 showed 99% similarity with Streptomyces hygroscopicus subsp. hygroscopicus and Streptomyces ahygroscopicus, respectively. Isolates AGA43 and AGA48 also belonged to the Streptomyces genus. The most effective formulation, AGA347, reduced BSR in seedlings by 73.1%. Formulations using the known antifungal producer Streptomyces noursei, AGA043, AGA048 or AGA506 reduced BSR by 47.4, 30.1, 54.8 and 44.1%, respectively. This glasshouse trial indicates that these Streptomyces spp. show promise as potential biological control agents against Ganoderma in oil palm. Further investigations are needed to determine the mechanism of antagonism and to increase the shelf life of Streptomyces formulations.

  11. العلامة السيد أبو القاسم رضي الدين علي بن موسى بن جعفر الحسني المعروف بابن طاووس(589هـ 664هـ ومنهجه في كتاب (سعد السعود للنفوس Alalmaa ALSayyed Abu al-Qasim Radhi al-Din Ali ibn Musa ibn Jaafar al-Hassani known as Ibn Tawoos (589 Ah 664 Ah And His method in the book (Saad Al Saud of souls

    Directory of Open Access Journals (Sweden)

    Dr. Mohmed Abbass Noemman Aljobry أ.م.د. محمد عباس نعمان الجبوري

    2012-06-01

    Full Text Available Praise be to Allah who created man, aware man of the statement, and peace and blessings on the pillow creatures Muhammad and his Generous family, and after: Jurists and scholars alive in the hearts and thoughts of the faithful and if they departed this world, their careers and their works live what remains forever, they are sponsored by it for the hearts and neighborhoods of hearts, that Mr. Radhi al-Din Ali bin Tawoos (God's mercy Beauty walk and role models who know her place above the level of the mind, knowledge is infinite factor the satisfaction of God Almighty Mahtata so most reservists, pride of Hilla city, his efforts to raise the nation and Asaaffha, and access to the height of greatness and integrity through Asudaih of tips and guidance gained from his grandfather and Ram and his father and his life. know religion his main concern and suggesting that arguments and evidence relied upon, teaches others how to derive rulings of the conversations of the Prophet (them blessings and peace. wrote books have scientific value and features Balothaqh text transfer in a topping books written in his time. His books (Saad Al Saud of souls have ways a new kind of authorship in this book, the first mention of suspicions and discussed and the response based on evidence and arguments. Vmnahjah Mr. Saad Saud book include the following: the oath on two fronts: Part One: Transfer of Qurans binoculars and Rabat Mecca. Part II: What transfer of interpretations of the Koran and the specialty, has explained in detail the methodology on which the book was keeping conclusion to reach the most important included in the search results.

  12. Crystal structures of hydrates of simple inorganic salts. III. Water-rich aluminium halide hydrates: AlCl3 · 15H2O, AlBr3 · 15H2O, AlI3 · 15H2O, AlI3 · 17H2O and AlBr3 · 9H2O.

    Science.gov (United States)

    Schmidt, Horst; Hennings, Erik; Voigt, Wolfgang

    2014-09-01

    Water-rich aluminium halide hydrate structures are not known in the literature. The highest known water content per Al atom is nine for the perchlorate and fluoride. The nonahydrate of aluminium bromide, stable pentadecahydrates of aluminium chloride, bromide and iodide, and a metastable heptadecahydrate of the iodide have now been crystallized from low-temperature solutions. The structures of these hydrates were determined and are discussed in terms of the development of cation hydration spheres. The pentadecahydrate of the chloride and bromide are isostructural. In AlI(3) · 15H2O, half of the Al(3+) cations are surrounded by two complete hydration spheres, with six H2O in the primary and 12 in the secondary. For the heptadecahydrate of aluminium iodide, this hydration was found for every Al(3+).

  13. Aesthetics of the Classical Period of the Islamic Mughal Empire in India through a Portrait of Abū al-Fath Jalāl al-Dīn Muhammad Akbar

    Directory of Open Access Journals (Sweden)

    Nina PETEK

    2018-01-01

    Full Text Available The reign of Abū al-Fath Jalāl al-Dīn Muhammad Akbar (1556–1605 was a fruitful period of the political, cultural and spiritual synthesis of Persian, Indian, and European tradition, as well as an artistic and aesthetic renaissance. This cosmopolitan, universal and charismatic ruler strived for the external, political, material and spiritual well-being of his colourful empire. In search of a balance between the external and internal, and in his endeavours for the unification and uniformity of India he gradually created a completely new style of Mughal arts, which is a stunning reflection of his personality’s transformations, principles, insights, interests, and spiritual growth. The paper focuses on a psychological portrait of the ruler, who dictated aesthetics and the style of the classical period of Mughal arts which consists of the three basic developmental phases of Akbar’s enigmatic character. The thesis on the parallel development of Akbar’s personality and Mughal arts is supported by research on the influence of certain European and Persian aesthetic elements, and mainly on the influence of Indian philosophical-religious tradition (the doctrines on rasa, bhakti, yoga, and tantra. The early period of Mughal arts, with predominantly realistic elements, coincides with the ruler’s dynamic, youthful enthusiasm and immense curiosity to acquaint himself the most varied aspects of external events and appearances. The second, the mature period, which enriches this earlier realism by means of mystical elements and the symbolism of Indian pre-Mughal painting, is marked by the shift into the interior and by searching for the harmony between the material and spiritual. In the late period of Mughal painting, however, reflexive and lyrical works prevail, which are a reflection of completion of Akbar’s spiritual quests, and the unique project of multifaceted synthesis that he undertook and promoted.

  14. Ionic ASi{sub 2}N{sub 3} (A=Li, Na, K and Rb) stabilized by the covalent Si–N bonding: First-principles calculations

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Huijun [College of Information Science and Engineering, Yanshan University, Qinhuangdao 066004 (China); Ren, Jiadong, E-mail: jdren@ysu.edu.cn [College of Information Science and Engineering, Yanshan University, Qinhuangdao 066004 (China); Wu, Lailei [Key Laboratory of Metastable Materials Science and Technology, College of Material Science and Engineering, Yanshan University, Qinhuangdao 066004 (China); Zhang, Jingwu, E-mail: zjw@ysu.edu.cn [Key Laboratory of Metastable Materials Science and Technology, College of Material Science and Engineering, Yanshan University, Qinhuangdao 066004 (China)

    2017-01-15

    The structural, elastic and electronic properties of LiSi{sub 2}N{sub 3} and its substitutions by Na, K and Rb were investigated through first-principles computations. The expansion of lattice parameters of ASi{sub 2}N{sub 3} from Li, Na, K to Rb is found to be determined by the bond angle of Si–N1–Si, which suggests a possible way to improve the lithium ionic conductivity by substitutions. ASi{sub 2}N{sub 3} (A=Li, Na, K and Rb) shows the similar elastic behaviors, while the electronic band gap gradually decreases from 5.1 to 3.4 eV from LiSi{sub 2}N{sub 3} to RbSi{sub 2}N{sub 3}. Interestingly, the analysis of electronic structure, crystal orbital Hamiltonian populations and Bader charges shows that the covalence of Si–N bonding is critical for the stability of ASi{sub 2}N{sub 3} phase. Among ASi{sub 2}N{sub 3} phases, there is a relatively high ionicity in NaSi{sub 2}N{sub 3}; the Si–N bond strength in [Si{sub 2}N{sub 3}]{sup −} net for KSi{sub 2}N{sub 3} and RbSi{sub 2}N{sub 3} is comparable to LiSi{sub 2}N{sub 3}, but stronger than NaSi{sub 2}N{sub 3}. - Graphic abstract: Universal trend of structural and electronic properties in alkaline metal silicon nitrides, ASi{sub 2}N{sub 3}, A=Li, Na, K and Rb. - Highlights: • Trend in structure, electronic and mechanical properties of ASi{sub 2}N{sub 3} (A=Li-Rb) were predicted. • Lattice expansion of ASi{sub 2}N{sub 3} induced by the bond angle of Si–N1–Si was found. • Calculated band gap decreases from 5.1 to 3.4 eV from LiSi{sub 2}N{sub 3} to RbSi{sub 2}N{sub 3}. • Covalent Si–N bonding is critical for the stability of ASi{sub 2}N{sub 3}.

  15. The Political Structure at Basra Gulf in the Period of Ali b. Ebu Talib and Yezid b. Muaviye

    Directory of Open Access Journals (Sweden)

    Taner YILDIRIM

    2011-06-01

    Full Text Available At this work about the political structure of the Basra Gulf, we dwelled upon the general geography of the district and its political history. The political situation of the district in this period is assessed in a way that comprises especially the period of Hz. Ali the fourth caliph of early islamic period Muaviya, the first Emevi caliph, and his son Yazid in the light of political developments in that period. When we took up Gulf of Basra we saw that the region of the Gulf is a very important strategic lacation. So since the most prohestoric period this area have got a lot of civilizations, big wars, social events and contentions. We saw that in the time of the region that we take up, the pozition of the Gulf area have gotten similar events in the past. Consequently, the area of the Gulf have owned most active pozition in that term that we take up. Especially because of the land trade roads, sea trade roads and riwer trade roads, Gulf of Basra have owned a very active junction at all time in the past and we easily guess that it will be protect its status in the future, too

  16. Reasons for not receiving thrombolytic therapy in patients with acute myocardial infarction admitted to Bu-Ali Sina Hospital in Qazvin (2013-14

    Directory of Open Access Journals (Sweden)

    MM. Daei

    2017-04-01

    Full Text Available This hospital-based cross-sectional study was conducted in 2013-14 in Qazvin Bu-Ali Sina Hospital. 170 patients with acute myocardial infarction who not receiving thrombolytic therapy entered the study and were analyzed. Medical history, physical examination, twelve lead ECG and cardiac biomarkers were obtained. The mean age of the patients was 63.4±14.4 years (from 19 to 90 years. 110 (64.7% of the patients were male and 48 (28.2% were diabetic. 86 (50% of patients due to late presentation and 47 (28% due to lack of diagnosis and 29 (17% due to contraindication and 8 (5% due to autolysis or coronary spam were not received thrombolytic therapy. We could reduce failure of receiving thrombolytic therapy more than seventy five percent with increasing people's awareness about the symptoms of myocardial infarction and skills of health staff in relation to the proper and timely diagnosis of myocardial infarction.

  17. Application of multivariate statistical analysis and hydrochemical and isotopic investigations for evaluation of groundwater quality and its suitability for drinking and agriculture purposes: case of Oum Ali-Thelepte aquifer, central Tunisia.

    Science.gov (United States)

    Hassen, Imen; Hamzaoui-Azaza, Fadoua; Bouhlila, Rachida

    2016-03-01

    Groundwater plays a dominant role in arid regions; it is among the most available water resources in Tunisia. Located in northwestern Tunisia, Oum Ali-Thelepte is a deep Miocene sedimentary aquifer, where groundwater is the most important source of water supply. The aim of the study is to investigate the hydrochemical processes leading to mineralization and to assess water quality with respect to agriculture and drinking for a better management of groundwater resources. To achieve such objectives, water analysis was carried out on 16 groundwater samples collected during January-February 2014. Stable isotopes and 26 hydrochemical parameters were examined. The interpretation of these analytical data showed that the concentrations of major and trace elements were within the permissible level for human use. The distribution of mineral processes in this aquifer was identified using conventional classification techniques, suggesting that the water facies gradually changes from Ca-HCO3 to Mg-SO4 type and are controlled by water-rock interaction. These results were endorsed using multivariate statistical methods such as principal component analysis and cluster analysis. The sustainability of groundwater for drinking and irrigation was assessed based on the water quality index (WQI) and on Wilcox and Richards's diagrams. This aquifer has been classified as "excellent water" serving good irrigation in the area. As for the stable isotope, the measurements showed that groundwater samples lay between global meteoric water line (GMWL) and LMWL; hence, this arrangement signifies that the recharge of the Oum Ali-Thelepte aquifer is ensured by rainwater infiltration through mountains in the border of the aquifer without evaporation effects.

  18. Higher body mass index is associated with greater severity of alopecia in men with male-pattern androgenetic alopecia in Taiwan: a cross-sectional study.

    Science.gov (United States)

    Yang, Chao-Chun; Hsieh, Fu-Nien; Lin, Li-Yu; Hsu, Chao-Kai; Sheu, Hamm-Ming; Chen, WenChieh

    2014-02-01

    Obesity is a risk factor for multiple health problems, but its association with androgenetic alopecia (AGA) remains controversial. We sought to determine the association between body mass index (BMI) and alopecia severity in men with AGA and early-onset AGA. A cross-sectional study was conducted. The medical charts and photographs of men with a clinical diagnosis of AGA were reviewed. In all, 189 men were enrolled with a mean age of 30.8 years. In male-pattern AGA (n = 142), men with severe alopecia (grade V-VII) had higher BMI than those with mild to moderate alopecia (grade I-IV) (25.1 vs 22.8 kg/m(2), P = .01). After multivariate adjustments, the risk for severe alopecia was higher in the overweight or obese (BMI ≥24 kg/m(2)) subjects with male-pattern AGA (odds ratio 3.52, P < .01). In early-onset male-pattern AGA (n = 46), the risk for having severe alopecia was also higher in the overweight or obese subjects (odds ratio 4.97, P = .03). Parameters used to evaluate obesity were limited because of the retrospective nature of the study. Higher BMI was significantly associated with greater severity of hair loss in men with male-pattern AGA, especially in those with early-onset AGA. Copyright © 2013 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  19. أواصر العناصر الكونية من منظور الأستاذ النورسي - Dr. ‘Uthman Muhammad Gharib: The Bonds of the Universal Elements from the Viewpoint of Bedi‘uzzaman al-Nursi

    OpenAIRE

    غريب, د. عثمان محمد

    2015-01-01

    أواصر العناصر الكونية من منظور ا أواصر العناصر الكونيةمن منظور الأستاذ بديع الزمان النورسي -ABSTRACT- The Bonds of the Universal Elements from the Viewpoint of Bedi'uzzaman al-Nursi Dr. 'Uthman Muhammad Gharib The researcher indicates the bonds of the elements of the universe as reflected in the "Nur Letters", which is a vision that elucidates the comprehensive identity of man. That identity is connected to the manifestations of existence and elements in the universe and i...

  20. Discharge Against Medical Advice in the Pediatric Wards in Boo-ali Sina Hospital, Sari, Iran 2010.

    Science.gov (United States)

    Mohseni Saravi, Benyamin; Reza Zadeh, Esmaeil; Siamian, Hasan; Yahghoobian, Mahboobeh

    2013-12-01

    Since children neither comprehended nor contribute to the decision, discharge against medical advice is a challenge of health care systems in the world. Therefore, the current study was designed to determine the rate and causes of discharge against medical advice. This descriptive cross-sectional study was done by reviewing the medical records by census method. Data was analyzed using SPSS software and x(2) statistics was used to determine the relationship between variables. The value of P<0.05 was considered significant. Rate of discharged against medical advice was 108 (2.2%). Mean of age and length of stay were 2.8±4 (SD).3 years old and 3.7±5.4 (SD) days, respectively. Totally, 95 patients (88.7%) had health insurance and 65 (60.2%) patients lived in urban areas. History of psychiatric disease and addiction in 22 (20.6%) of the parents were negative. In addition, 100 (92.3%) patients admitted for medical treatment and the others for surgery. The relationship of the signatory with patients (72.3%) was father. Of 108 patients discharged against medical advice, 20 (12%) were readmitted. The relationship between the day of discharge and discharge against medical advice was significant (ρ =0/03). Rate of discharge against medical advice in Boo-ali hospital is the same as the other studies in the same range. The form which is used for this purpose did not have suitable data elements about description of consequence of such discharge, and it has not shown the real causes of discharge against medical advice.

  1. Deamidated gliadin peptide antibodies as a routine test for celiac disease: a prospective analysis.

    Science.gov (United States)

    Volta, Umberto; Granito, Alessandro; Parisi, Claudia; Fabbri, Angela; Fiorini, Erica; Piscaglia, Maria; Tovoli, Francesco; Grasso, Valentina; Muratori, Paolo; Pappas, Georgios; De Giorgio, Roberto

    2010-03-01

    This study was designed to establish whether deamidated gliadin peptide antibodies (DGP-AGA) could improve the serologic workup for celiac disease (CD). The best serologic approach for CD screening is currently based on the combined detection of tissue transglutaminase (tTGA), endomysial (EmA), and gliadin antibodies (AGA). One hundred forty-four consecutive patients with gastrointestinal and extraintestinal signs suggestive for CD were investigated using serologic tests, that is, IgG and IgA DGP-AGA, IgA tTGA, IgA EmA, and duodenal biopsy. Forty-eight out of 144 patients (33%) had CD with different severity of villous atrophy. IgA tTGA showed 93.7% sensitivity compared with 91.6% for IgA EmA, 84.3% for IgA DGP-AGA, and 82.3% for IgG DGP-AGA. Of the 3 cases negative for IgA tTGA, IgA EmA, and IgA DGP-AGA, 2 had total IgA deficiency, although both were positive for IgG DGP-AGA. IgG DGP-AGA showed a very high specificity for CD (98.9%), not only superior to IgA DGP-AGA (79.8%), but also to IgA tTGA (96.6%) and very close to IgA EmA (100%). Our prospective study shows that the combined search for IgA tTGA and IgG DGP-AGA provides the best diagnostic accuracy for CD, allowing the identification of all CD cases---except one---with a very high specificity. The serologic workup for CD screening could be significantly improved by the routine introduction of IgG DGP-AGA together with IgA tTGA, thus reducing the number of tests and with an obvious advantage in terms of cost-efficacy.

  2. The Emphasizing Metonymy and Its Relation Whit Ambiguity of Text

    Directory of Open Access Journals (Sweden)

    Amir Saleh Masoomi

    2016-05-01

    holy scripture like the Quran? What is the position of this combined tool in Arabic language?   Such questions prompted us to study the validity of this linguistic phenomenon by using of descriptive-analytical method and explain its effect on perception of reader. On the basis of data of this article, the emphasizing metonymy in contrary to its illogical appearance could be an acceptable phenomenon in the tradition of Arabic language.   References   1. Holy Quran , Fuladvand, Mohammad Mahdi & Payande, Abul Qasem (trans..   2. Abouhayan, Mohamed ibn Youssef (1998. Irteshaf az-Zarab min Lisan al-Arab. Osman Mohammed Rajab and Ramadan Abdaltwab (Emend.. Cairo: Khanji library.   3. ------------------------------------------ (2001.Tafsir al- Bahr al-Mohit. Adel Ahmed Abdol-Mowjood and Ali Mohamed Moawad (Emend.. Beirut: House of scientific books.   4. Astrabadi, Radhi ad-Din Muhammad ibn al-Hasan (1996. Sharh ar-Razi al-Kafyah. Yusuf Hassan Omar (Emend.. Benghazi: University Publications of Garyounes.   5. Azhari, Muhammad bin Ahmad (2001. Tahzib al- loghah. Mohamed Awad terrifying (Emend.. Beirut: House of Revival of Islamic Heritage.   6. Farazdak, Bin Hammam Ghalib (1987. Diwan of Farazdaq. Ali Faour (Emend.. Beirut: House of scientific books.   7. Ibn Abi al-Esba, Abdul Azim ibn al-vahid (1963. Tahrir al-Tahbir fi sana'at al-sher va al-nathr va bayan ejaz alquran. Hafni Mohammad Sharaf (Emend.. Cairo: grope of Revival of Islamic Heritage .   8. Ibn Ashur, Muhammad Tahir (1997. Al-Tahrir va al- Tahbir. Tunisia: Dar Sahnoun for publication and distribution.   9. Ibn Jenni, Abul Fath Othman ibn Jenni (1952. Al-Khasa'es. Mohammad Ali al-Najar (Emend.. Beirut: Book World.   10. Jmaha, Muhammad ibn Salaam (n.d.. Tabaghat al-Fohul al-sho'ara. Mahmoud Mohamed Shaker (Emend.. Jiddah: Dar al-madani.   11. Khatib Qazwini, Muhammad ibn Abd or-Rahman (n.d.. Al-Talkhis fi Olum al-Balaghah. Abdulrahman Albrkoqa (explain. Egypt: Arab Thought House

  3. Impelemtasi Strategi Pemasaran Rasulullah Dalam Konteks Kontemporer (Analisis Di Swalayan Pamella YOGYAKARTA Dan La Tansa Gontor Ponorogo)

    OpenAIRE

    Sahroni, Abdullah

    2015-01-01

    Rasulullah's Marketing strategy based on Muhammad Suyanto book “Muhammad Bisuness Strategy and Ethics” are; product strategy is halalan thayyiban goods, price strategy based on the principle of concensual and market's price, place positioning is preferred in the market and strategys place and promotion strategy is more emphasis on the relationship with the costumer. This research is meant to scrutinize and understand rasulullah's marketing strategy at Pamella minimarket and La Tansa. This res...

  4. Hizb ut-Tahrir: A Threat Behind a Legal Facade?

    Science.gov (United States)

    2006-06-01

    private, public, and state. Produced wealth out of ownership belongs to God alone and the state ensures appropriate taxation , to include kharaj and...is the word of God, revealed to and recited by Muhammad, later written down and distributed in a canonical form by his successors. However, the...the collection of loose papyrus-leaves from Hafsa (a widow of Muhammad) in order to have them bound into a single volume. Uthman canoned and

  5. 2029-IJBCS-Article-Muhammad abdullahi

    African Journals Online (AJOL)

    hp

    NUS have the potential to fight malnutrition and improve human health particularly ... pulp for yoghurt production using different mixtures of milk and A. digitata fruit pulp powder in ratios of 4:1,. 3:2, 2:3, ..... characteristic flavor of yoghurt. Ibrahim ...

  6. 50 - 55_Muhammad and Massawe

    African Journals Online (AJOL)

    USER

    2015-06-01

    Jun 1, 2015 ... PHOTOSYNTHETIC GAS EXCHANGE AND CHLOROPHYLL IN BAMBARA ... The study evaluated the response of two Bambara groundnut (Vigna subterranea L. ..... processes due to the decreased tissue water content.

  7. Role of magnetic resonance planimetry and magnetic resonance parkinsonism index in discriminating Parkinson’s disease and progressive supranuclear palsy: a retrospective study based on 1.5 and 3 T MRI

    Directory of Open Access Journals (Sweden)

    Nizamani WM

    2017-10-01

    Full Text Available Waseem Mehmood Nizamani,1 Fatima Mubarak,1 Muhammad Danish Barakzai,1 Muhammad Saad Ahmed2 1Department of Radiology, Aga Khan University Hospital, Karachi, Pakistan, 2Department of Radiology, Ziauddin University Hospital, Karachi, Pakistan Objective: The objective of the study was to assess magnetic resonance (MR planimetric measurements and MR parkinsonism index (MRPI in differentiating progressive supranuclear palsy (PSP from Parkinson’s disease (PD using 1.5 and 3 T MRI scanner. Subjects and methods: After ethical approval was obtained, analysis of 34 consecutive patients with PSP, 34 patients with PD and 34 healthy controls (HCs was performed. HCs were age-matched adults without any history of neurodegenerative disease or movement disorders. Retrospective data from the past 10 years (from January 2006 to December 2015 were obtained from the Hospital Information Management System, and informed consent was obtained from all participants. The measurements of pons area–midbrain area ratio (P/M and MCP width–superior cerebellar peduncle (SCP width ratio (MCP/SCP were used, and MRPI was calculated by the formula ([P/M]×[MCP/SCP]. Results: Midbrain area and SCP width in patients with PSP (19 males, 15 females; mean age =66.7 years were significantly (P<0.001 smaller than in patients with PD (20 males, 14 females; mean age =66.7 years and control participants (17 males, 17 females; mean age =66.1 years. P/M and MCP/SCP were significantly higher in patients with PSP than in patients with PD and control participants. All measurements showed some overlap of values between patients with PSP and patients from PD group and control participants. MRPI value was significantly higher in patients with PSP (mean 21.00 than in patients with PD (mean 9.50; P<0.001 and control participants (mean 9.6; P<0.001, without any overlap of values among groups. No correlation was found between the duration of disease, PSP rating scale, PSP staging system and MRPI in

  8. Androgenetic alopecia as an indicator of metabolic syndrome and cardiovascular risk.

    Science.gov (United States)

    Ertas, Ragip; Orscelik, Ozcan; Kartal, Demet; Dogan, Ali; Ertas, Sule Ketenci; Aydogdu, Ebru Guler; Ascioglu, Ozcan; Borlu, Murat

    2016-06-01

    Numerous studies have investigated a probable association between androgenetic alopecia (AGA) and cardiovascular disease (CVD) by researching limited and dispersed parameters. We aimed to evaluate both traditional and non-traditional cardiovascular risk factors in male patients with early-onset AGA. This case-control study included 68 participants: 51 male patients with early-onset AGA and 17 healthy male controls. Patients with AGA were classified into three groups according to the Hamilton-Norwood scale and the presence of vertex hair loss. Traditional and non-traditional cardiovascular risk factors were examined in all study subjects. Metabolic syndrome was diagnosed in 25 patients with AGA and in two control subjects (p baldness and controls (p < 0.05). The pulse-wave velocity values were also found to be significantly higher in patients (p < 0.001). A limitation of this study was the small study population. In conclusion, vertex pattern AGA appears to be a marker for early atherosclerosis. This finding supports the hypothesis that early-onset AGA alone could be an independent risk factor for CVD and metabolic syndrome.

  9. Quality and storage characteristics of yogurt containing Lacobacillus sakei ALI033 and cinnamon ethanol extract

    Directory of Open Access Journals (Sweden)

    Yu Jin Choi

    2016-04-01

    Full Text Available Abstract Background This study was conducted to examine the quality and storage characteristics of yogurt containing antifungal-active lactic acid bacteria (ALH, Lacobacillus sakei ALI033 isolated from kimchi and cinnamon ethanol extract. The starter was used for culture inoculation (1.0 % commercial starter culture YF-L812 and ALH. Results The antifungal activity of cinnamon extracts was observed in treatments with either cinnamon ethanol extracts or cinnamon methanol extracts. Changes in fermented milk made with ALH and cinnamon extract during fermentation at 40 °C were as follows. The pH was 4.6 after only 6 h of fermentation. Titratable acidity values were maintained at 0.8 % in all treatment groups. Viable cell counts were maintained at 4 × 109 CFU/mL in all groups except for 1.00 % cinnamon treatment. Sensory evaluations of fermented milk sample made with ALH and 0.05 % cinnamon ethanol extract were the highest. Changes in fermented milk made with ALH and cinnamon ethanol extract during storage at 4 °C for 28 days were as follows. In fermented milk containing ALH and cinnamon ethanol extracts, the changes in pH and titratable acidity were moderate and smaller compared with those of the control. Viable cell counts were maintained within a proper range of 108 CFU/mL. Conclusions The results of this study suggest that the overgrowth of fermentation strains or post acidification during storage can be effectively delayed, thereby maintaining the storage quality of yogurt products in a stable way, using cinnamon ethanol extract, which exhibits excellent antifungal and antibacterial activity, in combination with lactic acid bacteria isolated from kimchi.

  10. IMPELENTASI STRATEGI PEMASARAN RASULULLAH DALAM KONTEKS KONTEMPORER (Analisis di Swalayan Pamella Yogyakarta dan La Tansa Gontor Ponorogo)

    OpenAIRE

    Sahroni, Abdullah

    2016-01-01

    Rasulullah’s Marketing strategy based on Muhammad Suyanto book “Muhammad Bisuness Strategy and Ethics” are; product strategy is halalan thayyiban goods, price strategy based on the principle of concensual and market’s price, place positioning is preferred in the market and strategys place and promotion strategy is more emphasis on the relationship with the costumer. This research is meant to scrutinize and understand rasulullah’s marketing strategy at Pamella minimarket and La Tansa. This res...

  11. Ibn Rushd, Abu'l Waleed Muhammad Ibn Ahmad Ibn Muhammad [known as Averroes] (1128-98)

    Science.gov (United States)

    Murdin, P.

    2000-11-01

    Islamic philosopher, lawyer, physician and astronomer, born in Cordoba, Spain, became physician to the Caliph of Morocco. Ibn Rushd's controversial views on philosophy—he was the greatest Islamic proponent of ARISTOTLE—led to the burning of his books and banishment by the Caliph. He wrote numerous books (87 survive) dealing with philosophy, logic, medicine, jurisprudence and astronomy, which ...

  12. حسن وثوق الدولة ودوره السياسي في إيران (1905-1920

    Directory of Open Access Journals (Sweden)

    احمد يونس زويد الجشعمي

    2017-09-01

    Full Text Available Wothoq Al – Dawla is the most important political personalities which appeared in the end of Gajarian era (1796 – 1925 which brought up and taught in the rulers castles of Gajarian , especially that his uncle (Ameen Al – Dawla was one of these , when he became a young man his father has oppointed (Mutamad Al – Dawla as his assistant in Collecting Azerbaijan's tax with the agreement of Nassir Al – Deen Shah . As a result of standing rebels of the constitutioned movement against the treaty between Russia and Britain in 1907 which divided Iran into Russian influence areas in the north and a British in the south and an entral area in the Middle , Muhammad Ali Shah is obliged to leave the Country and appoint the Crown prince Ahmed Shah instead of him . He has been chosen as a justice minister and finance minister after his winning the election of Shoura Council in 1909 . Ahmed Shah once again has chosen Wothoq Al – Dawla in 7 Aug. 1918 to form government , he has been considered a betrayal by the opponents of holding the government between Iran and Britain in 1919 , he was hated and neglected by Iranian people accusing him of selling Iran to Britain to resign who was obliged to do that in 23 June 1920 .

  13. Comparison of the X-ray features between child Hirschsprung alied disease and Hirschsprung disease

    International Nuclear Information System (INIS)

    Wu Shuochun; Yuan Xinyu; Bai Fengsen; Ma Lishuang; Li Long

    2010-01-01

    Objective: To compare the X-ray features between Hirschsprung alied disease (HAD) and Hirschsprung disease (HD), and analyze the differentiations. Methods: From December 2004 to December 2009, nineteen cases of HAD, aged from 30 days to 10 years (median, 14 months), received barium enema examinations in our institution. Other 19 cases with HD, also received barium enema examinations, were chosen randomly. They were aged from 42 days to 8 years (median, 8 months). The imaging features of HAD and HD were analyzed retrospectively. The incidence rate of colon stenosis, 'truncation sign' and spasm notch and R/C ratio (the longest diameter of rectum/colon) were calculated and compared between these two groups. In all these cases, diagnosis was confirmed by postoperative histopathology. The position of barium retained was also evaluated. These parameters of both groups were compared by χ 2 and Fisher test. Results: There was statistical significance in the incidence rate of' colon stenosis between HAD (9/19) and HD (18/19) (χ 2 =10.364, P 0.05 for both). R/C ratio was 0.42±0.15 in HAD group and 0.29±0.12 in HD group, and there was statistical significance between them (t=2.892, P<0.01). In HAD group, barium retained in distal sigmoid colon in 1 case (1/19), in distal descending colon in 7 cases (7/19), in distal transverse colon in 1 case (1/19), in total colon in 6 cases (6/19); However, in HD group, barium retained in distal rectum in 3 cases (3/19), in distal sigmoid colon in 13 cases (13/19), in distal descending colon in 3 cases (3/19). Conclusions: There were some differences in the imaging features between HAD and HD though they presented similar clinic experience. HAD cases presented a lower incidence rate of colon stenosis and a higher R/C ratio than HD cases. In HAD cases, the most common site of barium retained is distal descending colon, while in HD cases, it is distal sigmoid colon. (authors)

  14. White Paper AGA: An Episode-of-Care Framework for the Management of Obesity-Moving Toward High Value, High Quality Care: A Report From the American Gastroenterological Association Institute Obesity Episode of Care and Bundle Initiative Work Group.

    Science.gov (United States)

    Brill, Joel V; Ashmore, Jamile A; Brengman, Matthew L; Buffington, Daniel E; Feldshon, S David; Friedman, Kelli E; Margolis, Peter S; Markus, Danielle; Narramore, Leslie; Rastogi, Amita; Starpoli, Anthony A; Strople, Kenneth; White, Jane V; Streett, Sarah E

    2017-05-01

    The American Gastroenterological Association acknowledges the need for gastroenterologists to participate in and provide value-based care for both cognitive and procedural conditions. Episodes of care are designed to engage specialists in the movement toward fee for value, while facilitating improved outcomes and patient experience and a reduction in unnecessary services and overall costs. The episode of care model puts the patient at the center of all activity related to their particular diagnosis, procedure, or health care event, rather than on a physician's specific services. It encourages and incents communication, collaboration, and coordination across the full continuum of care and creates accountability for the patient's entire experience and outcome. This paper outlines a collaborative approach involving multiple stakeholders for gastrointestinal practices to assess their ability to participate in and implement an episode of care for obesity and understand the essentials of coding and billing for these services. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  15. Study of the hydrodynamic of groundwater karst system of Laraos and Alis, upper basin of the Canete river using environmental isotopes

    International Nuclear Information System (INIS)

    Valencia, Jacinto; Mamani, Enoc; Magina, Jose

    2014-01-01

    In this study, seven water samples have been characterized, collected from the upper Canete river micro-basins Laraos and Alis. They were analyzed by Oxygen-18 (δ18O), deuterium (δ2H) and radioactive tritium (3H) using the technique of laser spectrometry and characterized in order to establish the recharge-discharge relationship karst system under study, formed by the dissolution of limestone from the Cretaceous age formation Jumasha, and forming watertight groundwater that by connection and hydraulic gradient of fractures discharge into springs. The interpretation of the isotopic analysis performed according to the diagram δ18O/δ2H indicates that the springs are originated from infiltrating rainwater into the karst system due to the structural design and make the connection between micro-basins. Groundwater has a different dynamic, and to a lesser extent, receives contributions from waters lagoons, this fact makes them vulnerable to contamination. In the karst hydrogeological system, groundwater from micro-basins has a dynamic part of water with a long residence time with 1.8 units of tritium (RC-7) and another water dynamic of short residence time of 3 and 3.2 tritium units (RC-4, RC-5, RC-6). (authors).

  16. ORF Alignment: NC_002678 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002678 gi|13475854 >1el5A 4 378 18 430 4e-33 ... ref|NP_107424.1| agaE protein, conversion of agropini...c acid to mannopinic acid ... [Mesorhizobium loti MAFF303099] dbj|BAB53210.1| Aga

  17. ORF Alignment: NC_002679 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002679 gi|13488188 >1el5A 4 377 26 437 3e-36 ... ref|NP_085608.1| agaE(conversion of agropini...c acid to mannopinic acid) ... [Mesorhizobium loti MAFF303099] dbj|BAB54449.1| AgaE ...

  18. Understanding patient and physician perceptions of male androgenetic alopecia treatments in Asia-Pacific and Latin America.

    Science.gov (United States)

    Lulic, Zrinka; Inui, Shigeki; Sim, Woo-Young; Kang, Hoon; Choi, Gwang Seong; Hong, Woosung; Hatanaka, Toshiki; Wilson, Timothy; Manyak, Michael

    2017-08-01

    This survey aimed to explore patient and physician attitudes towards male androgenetic alopecia (AGA), satisfaction with currently available male AGA treatments and investigate the factors affecting treatment choice. The survey was carried out in five countries (Japan, South Korea, Taiwan, Mexico and Brazil) between November and December 2015 using a standard market research methodology. Questionnaires were completed by patients with male AGA or hair loss/thinning and practicing physicians who were responsible for prescribing AGA treatment. In total, 835 patients and 338 physicians completed the questionnaire. Overall, 37.6% of patients reported satisfaction with the treatments they had used. The highest patient satisfaction was reported for 5-alpha-reductase inhibitors (53.9% of patients satisfied). In all countries, physicians were more likely than patients to think that male AGA has a major impact on patient confidence (89.3% vs 70.4%, respectively). There was agreement by physicians and patients that male AGA patients who are involved in their treatment decisions have better outcomes. Patients who were satisfied with AGA treatments were more likely to have the level of involvement they desired in treatment decisions (69.1% of satisfied patients) than dissatisfied patients (56.4% of dissatisfied patients). This survey provides valuable insights into the attitudes of patients and physicians in Asia and Latin America about male AGA and its treatments. The survey identified areas of disconnect between physicians and patients regarding the impact of male AGA, treatment consultations and the importance of treatment attributes. It also highlights the need for physicians to spend sufficient time with patients discussing AGA treatment approaches. © 2017 GlaxoSmithKline. The Journal of Dermatology published by John Wiley & Sons Australia, Ltd on behalf of Japanese Dermatological Association.

  19. Le diagnostic anténatal de la trisomie 21 par l'hybridation in situ en fluorescence (FISH): à propos des premiers tests réalisés au Maroc

    Science.gov (United States)

    Lamzouri, Afaf; Natiq, Abdelhafid; Tajir, Mariam; Sendid, Mohamed; Sefiani, Abdelaziz

    2012-01-01

    Introduction Le but de cette étude était de présenter les premiers résultats de diagnostic anténatal de la trisomie 21 par la technique d'hybridation in situ en fluorescence (FISH) au Maroc et discuter son intérêt dans le diagnostic rapide de cette aneuploïdie. Méthodes Ce travail a été réalisé chez 23 femmes avec des grossesses à haut risque de trisomie 21. La moyenne d’âge des gestantes étaient de 37,43 ans avec des extrêmes de 21 et 43 ans. Toutes étaient musulmanes mariées, mariage légitimé par la Charia, dont trois mariages consanguins, sauf une originaire de la République Démocratique du Congo qui était chrétienne et concubine. La majorité des femmes étaient fonctionnaires et avaient un niveau de scolarisation moyen à élevé. Toutes les patientes ont bénéficié d'une consultation de génétique médicale au cours de laquelle il leur a été donné des informations sur la technique, son intérêt et ses limites. Il s'agit de femmes enceintes qui avaient soit un âge maternel élevé ou des signes d'appel échographiques et/ ou biochimiques. Une des patientes était porteuse d'une translocation robertsonienne t(14;21) équilibrée. Une amniocentèse a été réalisée chez toutes les gestantes et aucun avortement n'a était induit par ce geste invasif. L’âge gestationnel moyen à la première consultation était de 14 semaines d'aménorrhée (SA) et à l'amniocentèse était de 16 SA et 5 jours. L'analyse FISH a été réalisée, après consentement des couples, sur des cellules non cultivées à partir des échantillons de liquides amniotiques, en utilisant des sondes spécifiques du chromosome 21. Résultats Parmi les 23 patientes qui ont bénéficiées d'un diagnostic anténatal de la trisomie 21 par la technique FISH, nous avons pu rassurer 21 d'entre elles, et nous avons détecté deux cas de trisomie 21 fœtal. Conclusion La technique FISH permet un diagnostic anténatal rapide, en moins de 48h, de la trisomie 21 sur

  20. Masa Depan Partai Politik Islam dalam Pertarungan Pemilu 2009

    OpenAIRE

    Purwanto, Yedi

    2009-01-01

    As the majority in this country, the Moslems have an important role in determining who and what party will win the upcoming general election this year and then lead this country for the next five years. Dealing with leadership, Moslems believe that Prophet Muhammad is the best leader ever in the world. However, some Moslem intellectuals argued that Prophet Muhammad was only a religious leader, instead of a political leader. This article discusses any issues on the leadership of Prophet Muhamm...

  1. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

    2016-01-01

    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  2. CHEMICAL COMPOSITION AND NUTRITIONAL EVALUATION OF Paracalyx scariosus (ROXB. ALI A WILD RELATIVE OF CAJANUS FROM SOUTHERN PENINSULAR INDIA

    Directory of Open Access Journals (Sweden)

    Kondragunta Sri Rama Murthy

    2008-12-01

    Full Text Available Seeds of Paracalyx scariosus (Roxb. Ali locally known as ";;adavi tellakandulu";; in Telugu, used as food by local tribes people in the Rollapenta forest, Kurnool district, Nallamalais of Andhra Pradesh of southern Peninsular India. The mature seed samples were analysed for proximate composition, total (true seed protein fractions, amino acid composition, fatty acids profile, mineral and antinutritional factors. They contained higher amount of crude protein, crude fat, ash and nitrogen free extractives constitute 20.56, 5.19, 5.12 and 56.25 % respectively of the seed weight. The calorific value of 100g dry matter of seed material was 1680.92 kJ DM. The essential amino acids, isoleucine, tyrosine and phenylalanine, were present in relatively large quantities.  The fatty acid profiles revealed that the seed lipids contained higher concentrations of palmitic and linoleic acids. The seeds are rich in sodium, phosphorus, calcium, zinc, manganese and iron. Anti-nutritional factors such as total free phenols, (5.56% tannins (2.78%, L -DOPA (0.63%, hydrogen cyanide (0.065% and phytic acid (0.85% are present in variable quantities. From the results these plant have a good potential as food crops in Andhra Pradesh.  This paper presents the chemical composition and nutritional potential of Paracalyx scariosus seeds with regard to its suitability as a regular component in human diet.

  3. Androgenetic alopecia: An update

    Directory of Open Access Journals (Sweden)

    Feroze Kaliyadan

    2013-01-01

    Full Text Available Androgenetic alopecia (AGA is one of the commonest reasons for dermatological consultation. Over the last few years our understanding of the pathophysiology of AGA has improved and this has paved way for better diagnostic and therapeutic options. Recent research has dwelled on the role of stem cells in the pathophysiology of AGA and has also identified newer genetic basis for the condition. Dermoscopy/trichoscopy has emerged as a useful diagnostic tool for AGA. While the major treatment options continue to be topical minoxidil, systemic Finasteride and hair transplantations, newer modalities are under investigation. Specific diagnostic and treatment recommendations have also been developed on evidence based principles. This article reviews the recent concepts in relation to AGA. With regards to the pathophysiology we have tried to stress on recent knowledge of the molecular and genetic basis of AGA. We have emphasized on an evidence based approach for treatment and diagnosis.

  4. Religious Pluralism and Civic Rights in a “Muslim Nation”: An Analysis of Prophet Muhammad’s Covenants with Christians

    Directory of Open Access Journals (Sweden)

    Craig Considine

    2016-02-01

    Full Text Available This article examines the roles that religious pluralism and civic rights played in Prophet Muhammad’s vision of a “Muslim nation”. I demonstrate how Muhammad desired a pluralistic society in which citizenship and equal rights were granted to all people regardless of religious beliefs and practices. The Covenants of the Prophet Muhammad with the Christians of his time are used as a framework for analysis. These documents have received little attention in our time, but their messages are crucial in light of current debates about Muslim-Christian relations. The article campaigns for reviving the egalitarian spirit of the Covenants by refocusing our understanding of the ummah as a site for religious freedom and civil rights. Ultimately, I argue that the Covenants of Prophet Muhammad with the Christians of his time can be used to develop a stronger narrative of democratic partnership between Muslims and Christians in the “Islamic world” and beyond.

  5. The Islamic Education Methods in Al-Quran

    Directory of Open Access Journals (Sweden)

    Kemas Abdul Hai

    2017-06-01

    Full Text Available When the Prophet Muhammad was appointed as an apostle, the first commandment from Allah to him was to read, because reading is a symbol towards the mastery of science. As an educator of the Messenger of Allah, whatever he does is guided directly from Allah SWT through the verses revealed to him (al-Qur'an. His success in educating humanity is the background of this essay. That is by looking from the Qur'an as information and references used in the Prophet Muhammad SA in educating people. In this article, I described the three global principles in defending (educating through the Qur'an Surah an-Nahl verse 125 consisting of the al-Hikmah, al-mau'izah al-hasanah, and al-mujadalah. I also discussed the method of these three principles that the Prophet Muhammad has made as the best example in educating humanity. Its success is not only recognized by Muslims but also non-Muslims.

  6. TELAAH KRITIS TERHADAP HADIS MISOGINIS

    Directory of Open Access Journals (Sweden)

    Syamsul Hadi Untung

    2012-03-01

    Full Text Available One aspect that was criticized by liberal feminists in Islam is the hadith of Prophet Muhammad PBUH. This group accused some hadith of Prophet Muhammad PBUH anti to women. They call it misogynistic hadith. Surprisingly, the first pioneer of this discourse is a Muslim woman named Fatima Mernissi. In her book Women and Islam: An Historical and Theological Enquiry, Mernissi has written two sub-chapters examinedthe hadith assumed as misogynistic. This discourse became a serious debate among Muslim scholars. In Islam, fighting for justice and equality for women should be based on the al-Quran and al-Sunnah, so that when one of the sources questioned will rise the restlessness among Muslims. This article tries to study and examine Mernissi’s statement and study about hadiths of the Prophet Muhammad PBUH which described as  misogynistic hadith. This needs to be done, so get the correct meaning and wisdom related to the Prophetic traditions.

  7. Prime Minister of Pakistan visits CERN

    CERN Multimedia

    Anaïs Schaeffer

    2016-01-01

    On Saturday, 23 January 2016, CERN welcomed Mr Muhammad Nawaz Sharif, Prime Minister of Pakistan.   From left to right: Minister of Finance Mr Mohammad Ishaq Dar, Prime Minister of the Islamic Republic of Pakistan, Muhammad Nawaz Sharif, CERN Director-General Fabiola Gianotti and CMS national contact physicist Hafeez Hoorani. Mr Muhammad Nawaz Sharif arrived at Point 5 in Cessy, where he was welcomed onto French soil by the sous-préfet of Cessy, Stéphane Donnot, and, representing CERN, Director-General Fabiola Gianotti, Directors Eckhard Elsen and Charlotte Warakaulle, and Rüdiger Voss, the adviser for relations with Pakistan. It was the first visit by a head of government of Pakistan since the country became CERN's latest Associate Member State in July 2015. The Prime Minister then had the opportunity to visit the CMS underground experimental area accompanied by the CMS Spokesperson, Tiziano Camporesi, and the CMS collaboration’...

  8. Identification of risk factors for hepatitis B and C in Peshawar, Pakistan

    Directory of Open Access Journals (Sweden)

    Shafiq M

    2015-08-01

    Full Text Available Muhammad Shafiq,1 Muhammad Nadeem,2 Zeeshan Sattar,3 Sohaib Mohammad Khan,2 Sheikh Muhammad Faheem,4 Irfan Ahsan,5 Rabia Naheed,6 Tahir Mehmood Khattak,2 Shahzad Akbar,7 Muhammad Talha Khan,3 Muhammad Ilyas Khan,1 Muhammad Zubair Khan8 1Department of Internal Medicine, Khyber Teaching Hospital, University Town, Peshawar, 2Department of General Surgery, Nishtar Medical College and Hospital, Dera Ghazi Khan, Punjab, 3Department of Internal Medicine, Khyber Medical College, University Campus, Peshawar, 4Department of Neurology, King Edward Medical University, Anarkali, Lahore, Pakistan; 5Department of Internal Medicine, Mayo Hospital, Phoenix, AZ, USA; 6Department of Internal Medicine, Fatima Memorial Hospital, Lahore, 7Department of Internal Medicine, Lady Reading Hospital, Andar Shehr, Peshawar, 8Department of Internal Medicine, Hayatabad Medical Complex, Hayat Abad, Pakistan Background: Hepatitis B and C need immediate worldwide attention as the infection rates are too high. More than 240 million people have chronic (long-term liver infections. Every year, about 600,000 people die globally due to the acute or chronic consequences of hepatitis B and more than 350,000 people die from hepatitis C-related liver diseases. Methods: Our study was designed as a case-control, descriptive study. It was conducted through formal interviews by using structured questionnaires. A total of 100 cases were included, with four controls for each case. Results: This study confirms household contact, history of dental work, history of surgery, sexual contact, and history of transfusion (blood and its components as the main risk factors which are responsible for the increased prevalence of hepatitis. Conclusion: The important risk factors, responsible for the high prevalence of hepatitis B and C in our society are household contact, history of dental work, history of surgery, sexual contact, and history of transfusion (blood and its components. The odds ratio of

  9. Human embryology and the holy quran: an overview.

    Science.gov (United States)

    Saadat, Sabiha

    2009-01-01

    Man's quest to know about his origin has led him to search his roots and the best source for him has been religious scriptures. The greatest miracle is the Holy Quraan. There is an elegant description of origin, development and step by step developmental stages of intra-uterine life in Quraan. Muslims had this knowledge in 7th century and the Prophet Muhammad's Ahadeeth (sayings, deeds, approvals narrated by authentic narrators) had explained almost everything about natal and even postnatal events. These findings once presented to experts in the field of Anatomy and Embryology surprised them and they believed that the knowledge given to the Prophet Muhammad was indeed divine. Who else would provide this knowledge to the Prophet Muhammad (PBUH) except the Creator Himself.Modern embryology is a fairly recent development which has its beginning with the invention of microscope in the 17th century. However the concept of the human being developing in stages was not recognised until much later. But the scientists then and most Muslim and non-Muslim scholars do not even know that the holy Quran and Sunnah [words, deeds, approvals of Prophet Muhammad (PBUH) collected by authentic narrators] had provided a detailed description of the significant events in human development from the stages of gametes and conception until the full term pregnancy and delivery or even post partum. Actually information in the Quran and Hadith corrected many superstitious and vague ideas about human development that were prevalent before.

  10. Kritik Makna Islam Perspektif Orientalis dan Liberal

    Directory of Open Access Journals (Sweden)

    Syamsi Wal Qamar

    2015-03-01

    Full Text Available Islam is a name religion with clear explanation based on the arguments that are normative and historically, the Qur’an, Hadith and history of preaching Prophet Muhammad when spread this religion. Of course this naming is permanent so it will not be changed until the end of time later. But for Wilfreid Cantwell Smith and Muhammad Shahrur which are the thinkers of the West and the Muslim Orientalist Liberals are trying to recontruction naming them. For Smith, Islam is only submission to God to be obedient and submissive to the shari’ah religion are shared by humans, as judging that the word Islam is derived from the word aslama means surrender or submission. Meanwhile, according Shahrur, Islam is taught by the shari’ah of the Prophet Muhammad who was also taught by the previous Prophets such as Abraham, Moses, Jesus and others. So according Shahrur Muslim person can be said without having to follow and believe in the Shari’ah as taught by the Prophet Muhammad. From this a second thought leaders cause various problems, such as Islamic religious truth is relative or inclusive or decontructed concept and the Shari’ah of Islam. So in this paper the authors will describe how Smith and Shahrur view of the meaning of Islam, the background of their thinking and their implications for the Islamic religion, and a refutation of their thinking.

  11. FINASTERIDE AS A TREATMENT FOR MALE ANDROGENETIC ALOPECIA

    Directory of Open Access Journals (Sweden)

    Ni Komang Tristiana Dewi

    2013-04-01

    Full Text Available Androgenetic alopecia (AGA is a type of alopecia non sikatrik that most often occur, especially in men. AGA is hereditary baldness and form distinctive patterns. Causes related to AGA estimated serum androgen levels, especially 5-?-dehydrotestosterone (DHT, which can lead to miniaturization of the hair follicle. Finasteride is one of drugs that proven effective in treating hair loss caused by AGA. Finasteride is a 4-azasteroid components that are competitive and specific inhibitor of the enzyme 5-?-reductase type II, an enzyme that converts testosteron into intracellular DHT. By inhibiting the enzyme 5-?-reductase type II, conversion of testosteron to DHT inhibited, thereby causing a significant decrease in serum and tissue DHT concentrations. The use of finasteride 1 mg per day proven to effectively treat AGA in men.  

  12. Aliénor, une infante entre la Castille, l’Aragon et le Portugal

    Directory of Open Access Journals (Sweden)

    Ana Maria S. A. RODRIGUES

    2008-07-01

    Full Text Available Aliénor (?-1445, fille de l’infant Ferdinand de Castille, est devenue infante d’Aragon par l’accession de son père à la couronne d’Aragon et princesse puis reine du Portugal par son mariage avec Édouard (1391-1438. Dans cette étude, nous essayons de démontrer qu’elle ne se contenta pas d’être un simple pion dans les jeux de pouvoir des hommes de ses deux familles – la famille d’origine et la famille d’alliance –, mais qu’elle y prit part activement sans pourtant manquer à ses obligations spécifiquement féminines. Elle mit au monde neuf enfants, garantissant ainsi la continuité dynastique et de fructueuses alliances avec d’autres monarchies, prodigua à son mari affection et conseils et assura la régence du royaume au nom de son fils, tout en gardant un contact étroit avec ses frères et les aidant le cas échéant. Elle fut pourtant déchue du pouvoir par ses beaux-frères. Abandonnée par les infants d’Aragon, elle mourut en exil dans un dénuement presque complet.Leonor (?-1445, hija del infante Fernando de Castilla, fue infanta de Aragón por la elevación de su padre a ese trono, princesa y luego reina de Portugal por su matrimonio con Eduardo (1391-1438. En este estudio, intentamos demostrar que ella no se contentó con ser un simple peón en los juegos de poder de los hombres de sus dos familias – la familia de origen y la familia de alianza – sino que participó en ellos activamente sin por eso faltar a sus deberes específicamente femeninos. Tuvo nueve hijos, garantizando así la continuidad dinástica y fructuosas alianzas con otras monarquías, prodigó a su marido afecto y consejos, y aseguró la regencia del reino en nombre de su hijo, guardando al mismo tiempo un contacto estrecho con sus hermanos y ayudándoles en caso de necesidad. Sin embargo fue descartada del poder por sus cuñados. Abandonada por los infantes de Aragón, murió en exilio en la más extrema necesidad.

  13. Blood Plasma-Derived Anti-Glycan Antibodies to Sialylated and Sulfated Glycans Identify Ovarian Cancer Patients.

    Science.gov (United States)

    Pochechueva, Tatiana; Chinarev, Alexander; Schoetzau, Andreas; Fedier, André; Bovin, Nicolai V; Hacker, Neville F; Jacob, Francis; Heinzelmann-Schwarz, Viola

    2016-01-01

    Altered levels of naturally occurring anti-glycan antibodies (AGA) circulating in human blood plasma are found in different pathologies including cancer. Here the levels of AGA directed against 22 negatively charged (sialylated and sulfated) glycans were assessed in high-grade serous ovarian cancer (HGSOC, n = 22) patients and benign controls (n = 31) using our previously developed suspension glycan array (SGA). Specifically, the ability of AGA to differentiate between controls and HGSOC, the most common and aggressive type of ovarian cancer with a poor outcome was determined. Results were compared to CA125, the commonly used ovarian cancer biomarker. AGA to seven glycans that significantly (P<0.05) differentiated between HGSOC and control were identified: AGA to top candidates SiaTn and 6-OSulfo-TF (both IgM) differentiated comparably to CA125. The area under the curve (AUC) of a panel of AGA to 5 glycans (SiaTn, 6-OSulfo-TF, 6-OSulfo-LN, SiaLea, and GM2) (0.878) was comparable to CA125 (0.864), but it markedly increased (0.985) when combined with CA125. AGA to SiaTn and 6-OSulfo-TF were also valuable predictors for HGSOC when CA125 values appeared inconclusive, i.e. were below a certain threshold. AGA-glycan binding was in some cases isotype-dependent and sensitive to glycosidic linkage switch (α2-6 vs. α2-3), to sialylation, and to sulfation of the glycans. In conclusion, plasma-derived AGA to sialylated and sulfated glycans including SiaTn and 6-OSulfo-TF detected by SGA present a valuable alternative to CA125 for differentiating controls from HGSOC patients and for predicting the likelihood of HGSOC, and may be potential HGSOC tumor markers.

  14. Iraqi Perspectives Project. Primary Source Materials for Saddam and Terrorism: Emerging Insights from Captured Iraqi Documents. Volume 2 (Redacted)

    Science.gov (United States)

    2007-11-01

    File 12 CMPC-2004-004572 3 Volunteers for "Nusrat al-’Iraq" and "Ashbal Saddam" Courses 13 IISP -2003-00026588 3 Details on ’Far’ay Saddam and Muhammad...al- Mahdi’ Sector and Letters to the lIS 14 IISP -2003-00027 I92 3 Agreement between Iran and Hamas designating $15 million dollars a month to form a...new group called "Palestine Hizbullah" 15 IISP -2003-00027194 3 Information about the Palestinian internal situation. 16 IISP -2003-00029003 3 liS

  15. Rõve kuubis, aga... / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2006-01-01

    Dokumentaalfilm "Aristokraadid", kus ühte roppu habemega anekdooti jutustavad meelelahutustööstusest tuntud tegijad : režissöör Paul Provenza : Ameerika Ühendriigid 2006. Filmi näitab Tallinna Kinomaja

  16. Usalda, aga kontrolli / Manuela Pihlap

    Index Scriptorium Estoniae

    Pihlap, Manuela

    2008-01-01

    Uuest isikuandmete kaitse seadusest. Ilmunud ka Harju Ekspress 22. veeb. 2008, lk. 6 ; Meie Maa 26. veeb. 2008, lk. 2 ; Pärnu Postimees 28. veeb. 2008, lk. 15 ; LõunaLeht 28. veeb. 2008, lk. 4 ; Valgamaalane 28. veeb. 2008, lk. 2

  17. JGME-ALiEM Hot Topics in Medical Education: An Analysis of a Virtual Discussion on Resident Well-Being.

    Science.gov (United States)

    Chung, Arlene; Battaglioli, Nicole; Lin, Michelle; Sherbino, Jonathan

    2018-02-01

    Physician well-being is garnering increasing attention. In 2016, the Journal of Graduate Medical Education ( JGME ) published a review by Kristin Raj, MD, entitled "Well-Being in Residency: A Systematic Review." There is benefit in contextualizing the literature on resident well-being through an academic journal club. We summarized an asynchronous, online journal club discussion about this systematic review and highlighted themes that were identified in the review. In January 2017, JGME and the Academic Life in Emergency Medicine (ALiEM) blog facilitated an open-access, online, weeklong journal club on the featured JGME article. Online discussions and interactions were facilitated via blog posts and comments, a video discussion on Google Hangouts on Air, and Twitter. We performed a thematic analysis of the discussion and captured web analytics. Over the first 14 days, the blog post was viewed 1070 unique times across 52 different countries. A total of 130 unique participants on Twitter posted 480 tweets using the hashtag #JGMEscholar. Thematic analysis revealed 5 major domains: the multidimensional nature of well-being, measurement of well-being, description of wellness programs and interventions, creation of a culture of wellness, and critique of the methodology of the review. Our online journal club highlighted several gaps in the current understanding of resident well-being, including the need for consensus on the operational definition, the need for effective instruments to evaluate wellness programs and identify residents in distress, and a national research collaboration to assess wellness programs and their impact on resident well-being.

  18. Synthesis and optimization of novel allylated mono-carbonyl analogs of curcumin (MACs) act as potent anti-inflammatory agents against LPS-induced acute lung injury (ALI) in rats.

    Science.gov (United States)

    Zhu, Heping; Xu, Tingting; Qiu, Chenyu; Wu, Beibei; Zhang, Yali; Chen, Lingfeng; Xia, Qinqin; Li, Chenglong; Zhou, Bin; Liu, Zhiguo; Liang, Guang

    2016-10-04

    A series of novel symmetric and asymmetric allylated mono-carbonyl analogs of curcumin (MACs) were synthesized using an appropriate synthetic route and evaluated experimentally thru the LPS-induced expression of TNF-α and IL-6. Most of the obtained compounds exhibited improved water solubility as a hydrochloride salt compared to lead molecule 8f. The most active compound 7a was effective in reducing the Wet/Dry ratio in the lungs and protein concentration in bronchoalveolar lavage fluid. Meanwhile, 7a also inhibited mRNA expression of several inflammatory cytokines, including TNF-α, IL-6, IL-1β, and VCAM-1, in Beas-2B cells after Lipopolysaccharide (LPS) challenge. These results suggest that 7a could be therapeutically beneficial for use as an anti-inflammatory agent in the clinical treatment of acute lung injury (ALI). Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  19. Changes in the sebaceous gland in patients with male pattern hair loss (androgenic alopecia).

    Science.gov (United States)

    Kure, Katsuhiro; Isago, Tsukasa; Hirayama, Takeshi

    2015-09-01

    The sebaceous gland and the follicular bulge region have important role in biology of the hair. They initiate destruction of the hair follicle both in human and animal models in certain conditions. The morphometric feature of the sebaceous gland is not well understood so as the distribution of the bulge stem cells in pathological conditions of male pattern hair loss or androgenic alopecia (AGA). The authors perform morphometric analysis of the sebaceous gland in AGA patients and also study distribution of the follicular stem cells in the bulge region in these populations. Two hundred and fifty cases of glass slide specimen from Japanese patients with male pattern hair loss were reviewed. Among these, 23 cases of the longitudinal (vertical) sections of the scalp skin with diagnosis of AGA were found and analyzed for the morphometric characteristics. Each sebaceous gland area was measured using NIH imagej system and statistically analyzed. For the identification of the follicular bulge region, an immunohistochemistry using anticytokeratin 15 (C8/144B clone) was carried out in the cases of AGA. The sebaceous gland area of the AGA group was noticeably increased, while the size of each sebaceous gland remains unchanged. It has more lobules in the hair follicular unit in the AGA population. In the immunohistochemistry, the follicular stem cells are present in the bulge regions in cases of AGA. The overgrowth (multilobulation) of the sebaceous gland and relative preservation of the follicular stem cells suggest that the changes in the sebaceous gland could be an important factor in the pathology of AGA. © 2015 Wiley Periodicals, Inc.

  20. Тіе Modern treatment of androgenetic alopecia

    Directory of Open Access Journals (Sweden)

    V. K. Karnaukhov

    2017-01-01

    Full Text Available Androgenetic alopecia (AGA is the most common reason for hair loss. Its frequency in Caucasian population is up to 80% in men and 42% in women. Current gold standard for AGA treatment includes minoxidil and/or finasteride. Both drugs have moderate treatment efficacy and can cause significant side effects. Minoxidil is the only option for treatment of AGA in women since finasteride has no efficacy. This review considers actual concepts of molecular mechanisms of pathogenesis and current treatment options of AGA with their limitations and shortcomings. Current state and perspectives of novel approaches to AGA treatment, potentially more effective and safe than minoxidil and finasteride, are described. The review discusses growth factors and cytokines, topical 5-alpha-reductase inhibitors, androgen receptor antagonists, prostaglandin analogs and antagonists, Wnt signaling activators and platelet-rich plasma injections.

  1. Genetic variants at 20p11 confer risk to androgenetic alopecia in the Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Bo Liang

    Full Text Available BACKGROUND: Androgenetic alopecia (AGA is a well-characterized type of progressive hair loss commonly seen in men, with different prevalences in different ethnic populations. It is generally considered to be a polygenic heritable trait. Several susceptibility genes/loci, such as AR/EDA2R, HDAC9 and 20p11, have been identified as being involved in its development in European populations. In this study, we aim to validate whether these loci are also associated with AGA in the Chinese Han population. METHODS: We genotyped 16 previously reported single nucleotide polymorphisms (SNPs with 445 AGA cases and 546 healthy controls using the Sequenom iPlex platform. The trend test was used to evaluate the association between these loci and AGA in the Chinese Han population. Conservatively accounting for multiple testing by the Bonferroni correction, the threshold for statistical significance was P ≤ 3.13 × 10(-3. RESULTS: We identified that 5 SNPs at 20p11 were significantly associated with AGA in the Chinese Han population (1.84 × 10(-11 ≤ P ≤ 2.10 × 10(-6. CONCLUSIONS: This study validated, for the first time, that 20p11 also confers risk for AGA in the Chinese Han population and implicated the potential common genetic factors for AGA shared by both Chinese and European populations.

  2. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  3. Kultur Arab dalam Hadis Pemimpin Negara dari Suku Quraysh

    Directory of Open Access Journals (Sweden)

    Moh. Misbakhul Khoir

    2015-09-01

    Full Text Available This article wants to present a comprehensive discussion of related interventions arabic culture elements which to some extent has influenced the style of thinking and normal life of the Prophet in the hadith leaders expressed in the State of Quraysh. This is given in addition to as an Apostle, Muhammad also serves as head of state, warlords, judges, community leaders, husband and personal. As an Arab man who lives in the community and the arabic culture, the environment and the interaction with the surrounding culture has its own influence on the habits and behavior. Consequently, what comes from the Prophet Muhammad must exist in between which is the culture of Arab societies at the time. Hadith state leaders of Quraysh, for example, is a statement of the Prophet Muhammad based on considerations of arabic culture at that time. Socio-historical, Quraysh is a decent clan inherited the throne of leadership, due to the advantages that are not found in other ethnic groups at the time. Thus, the actual terms of the Quraysh merely symbolic terms.

  4. A Review on the Concepts of Traditional Architecture by Mulla Sadra’s Al-Hikmat Al-Mota'alie

    Directory of Open Access Journals (Sweden)

    Zeinab Soleimani Sheijani

    2017-12-01

    Full Text Available Paying little attention to the roots of today's architecture has departed the contemporary architecture from its conceptual origins. However, the single application of traditional architecture principles does not fulfill the demands of today's life. Although by peering into the traditional Iranian architecture, principles and specific ideas implicit in the Islamic wisdom of Iran are revealed. In addition to maintaining the values of traditional architecture, a new approach to architectural design can also be achieved by recognizing and integrating these principles with the necessities of today's life. The article aims to answer whether it is possible to create a link between the traditional Iranian architecture concepts and the principles of contemporary rational architecture, similar to what Mulla Sadra, the great Persian philosopher, created between the Iranian ancient wisdom and al-Hikmat al-Masha which was solely a rational philosophy. To achieve the mentioned aim, first Mulla Sadra's intellectual structure has been studied, after modeling al-Hikmat al-Mota'alie. Then the traditional architecture has been analyzed in order to recognize its being (al-Wojud and essence (al-Mahiyat. The priority of being has been introduced in the next step, followed by levels of being. The next pace was to discuss the structure of Mulla Sadra's thinking method in architecture. The results of study indicate that the process of communication between ancient wisdom and al-Hikmat al-Mashaexplained by Sadra can be classified in two phases, cognizing and integrating. In the stage of integration Sadra used rational reasoning to prove the issues that have been obtained through intuition and the same trend can be applied in architecture. The intuitive aspects of traditional architecture can also be presented within the framework of today's rationalist architecture in two steps, including cognizing and integrating.

  5. Ghrelin and obestatin plasma levels and ghrelin/obestatin prepropeptide gene polymorphisms in small for gestational age infants.

    Science.gov (United States)

    Zhang, Shulian; Zhai, Guanpeng; Zhang, Jinping; Zhou, Jianguo; Chen, Chao

    2014-12-01

    To investigate plasma ghrelin and obestatin levels, and ghrelin/obestatin prepropeptide gene polymorphisms, in sequentially enrolled small for gestational age (SGA) infants. Neonates were sequentially enrolled into this study and were then subdivided into different groups, according to different study aims and availability of study materials. Consequently, plasma ghrelin and obestatin levels were measured in term SGA, term appropriate for gestational age (AGA), term large for gestational age (LGA), preterm SGA and preterm AGA neonates. Levels of both peptides were also measured in AGA infants of different gestational ages, and in term AGA neonates at different days following birth. Three ghrelin/obestatin prepropeptide gene single nucleotide polymorphisms (SNPs), Arg51Gln, Leu72Met, and Gln90Leu, were measured in neonates. The study involved a total cohort of 581 neonates. Out of 150 neonates (30 term AGA, 30 term SGA, 30 term LGA, 30 preterm AGA, and 30 preterm SGA), plasma obestatin levels were significantly higher in term SGA versus term LGA neonates (0.21 ± 0.02 ng/ml versus 0.17 ± 0.01 ng/ml, respectively). Out of a wider cohort, there were no significant differences in genotypes and allele frequencies of Arg51Gln, Leu72Met, and Gln90Leu SNPs between term SGA and AGA neonates, or between preterm SGA and AGA neonates. Ghrelin/obestatin prepropeptide polymorphisms were not found to be associated with SGA status in neonates; however, ghrelin and obestatin levels may be involved in growth and development. Further studies are required to understand the relationship between ghrelin, obestatin and prenatal development. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  6. Development of silver impregnated alumina for iodine separation from off-gas streams

    Energy Technology Data Exchange (ETDEWEB)

    Funabashi, Kiyomi; Fukasawa, Tetsuo; Kikuchi, Makoto [Energy Research Laboratory, Hitachi (Japan)] [and others

    1995-02-01

    An inorganic iodine adsorbent, silver impregnated alumina (AgA), has been developed to separate iodine effectively from off-gas streams of nuclear facilities and to decrease the volume of waste (spent adsorbent). Iodine removal efficiency was improved at relatively high humidity by using alumina carrier with two different pore diameters. Waste volume reduction was achieved by impregnating relatively large amounts of silver into the alumina pores. The developed adsorbent was tested first with simulated off-gas streams under various experimental conditions and finally with actual off-gas streams of the Karlsruhe reprocessing plant. The decontamination factor (DF) was about 100 with the AgA bed depth of 2cm at 70% relative humidity, which was a DF one order higher than that when AgA with one pore size was used. Iodine adsorption capacity was checked by passing excess iodine into the AgA bed. Values were about 0.12 and 0.35 g-I/cm`-AgA bed for 10 and 24wt% silver impregnated AgA, respectively. The results obtained in this study demonstrated the applicability of the developed AgA to the off-gas treatment system of nuclear facilities.

  7. A Comparison of Hybrid Approaches for Turbofan Engine Gas Path Fault Diagnosis

    Science.gov (United States)

    Lu, Feng; Wang, Yafan; Huang, Jinquan; Wang, Qihang

    2016-09-01

    A hybrid diagnostic method utilizing Extended Kalman Filter (EKF) and Adaptive Genetic Algorithm (AGA) is presented for performance degradation estimation and sensor anomaly detection of turbofan engine. The EKF is used to estimate engine component performance degradation for gas path fault diagnosis. The AGA is introduced in the integrated architecture and applied for sensor bias detection. The contributions of this work are the comparisons of Kalman Filters (KF)-AGA algorithms and Neural Networks (NN)-AGA algorithms with a unified framework for gas path fault diagnosis. The NN needs to be trained off-line with a large number of prior fault mode data. When new fault mode occurs, estimation accuracy by the NN evidently decreases. However, the application of the Linearized Kalman Filter (LKF) and EKF will not be restricted in such case. The crossover factor and the mutation factor are adapted to the fitness function at each generation in the AGA, and it consumes less time to search for the optimal sensor bias value compared to the Genetic Algorithm (GA). In a word, we conclude that the hybrid EKF-AGA algorithm is the best choice for gas path fault diagnosis of turbofan engine among the algorithms discussed.

  8. Serum androgens and prostate-specific antigen levels in androgenetic alopecia: is there a difference between frontal and vertex baldness?

    Science.gov (United States)

    Lis-Święty, A; Arasiewicz, H; Ranosz-Janicka, I; Brzezińska-Wcisło, L

    2017-12-13

    Androgenetic alopecia (AGA) seems to be a marker of increased risk of prostate cancer (PCa). We sought to investigate potential pathophysiological differences between frontal and vertex balding that might have the impact on the incidence of PCa. Serum concentrations of testosterone (T), dihydrotestosterone (DHT) and prostate-specific antigen (PSA) were measured in 88 subjects with AGA. We have examined sixty patients with frontal baldness and 28 patients with vertex baldness. The subgroups did not differ significantly in age, BMI and as regards age of AGA onset, duration of AGA and comorbidities. The mean value of DHT in serum of the men with vertex baldness was higher than those in the men with frontal baldness with statistical significance (P baldness may signal higher exposures to circulating DHT. Serum PSA level cannot serve as surrogate diagnostic marker of increased androgenic activity in men with AGA. © 2017 European Academy of Dermatology and Venereology.

  9. Geometry correction Algorithm for UAV Remote Sensing Image Based on Improved Neural Network

    Science.gov (United States)

    Liu, Ruian; Liu, Nan; Zeng, Beibei; Chen, Tingting; Yin, Ninghao

    2018-03-01

    Aiming at the disadvantage of current geometry correction algorithm for UAV remote sensing image, a new algorithm is proposed. Adaptive genetic algorithm (AGA) and RBF neural network are introduced into this algorithm. And combined with the geometry correction principle for UAV remote sensing image, the algorithm and solving steps of AGA-RBF are presented in order to realize geometry correction for UAV remote sensing. The correction accuracy and operational efficiency is improved through optimizing the structure and connection weight of RBF neural network separately with AGA and LMS algorithm. Finally, experiments show that AGA-RBF algorithm has the advantages of high correction accuracy, high running rate and strong generalization ability.

  10. Révolution : mode d'emploi

    Directory of Open Access Journals (Sweden)

    Marie Camberlin

    2001-09-01

    Full Text Available Pourquoi, en 1948 d'abord, en 1955 ensuite, les tentatives du mouvement des " Yéménites Libres " fondé par Muhammad al-Zubayrî et Ahmad Nu'mân de mettre un terme à l'absolutisme et à l'immobilisme de l'imamat zaydite ont-elles échoué à capitaliser un mécontentement populaire qui était pourtant manifeste ? Pourquoi l'imam Ahmad est-il parvenu à mobiliser avec tant de facilité les masses rurales (des tribus contre le programme de l'intelligentsia éclairée ? Derrière l'inventaire lucide des "erreurs des Libres" que dresse al-Zubayrî, résident certaines péripéties révélatrices des résistances à la modernisation politique au Yémen.Muhammad Mahmûd al-Zubayrî and the mistakes of the Free Yemeni MovementWhy have the attempts of the Free Yemeni movement, founded by Muhammad Mahmûd al-Zubayrî and AΩmad al-Nu'mân to put an end to the absolutism and standstill of the Zaydi Imamate, failed to capitalize on the manifest popular discontent in 1948 and 1955 ? Why did Imam Ahmad manage so easily to gather the tribal rural masses against the project of an enlightened intelligentsia ? This article assesses the mistakes of the Free Yemeni movement as seen by Muhammad al-Zubayrî and relates a number of episodes that reveal some of the resistance to political modernization in Yemen at the time.

  11. Poklicna izgorelost ali zavzetost za delo, to je zdaj vprašanje Osebni in skupinski izobraževalni moduli za preprečevanje poklicne izgorelosti (2. del

    Directory of Open Access Journals (Sweden)

    Andreja Pšeničny

    2005-12-01

    Full Text Available Raziskavo sta avtorici posvetili preucevanju potreb po varovanju zaposlenih pred poklicno izgorelostjo, hkrati pa tudi spodbujanju njihove zavzetosti za delo. Podjetje, ki se zaveda pomena svojih virov, lahko v enem in drugem primeru s podobnimi izobrazevalnimi vsebinami in postopki oplemeniti svoj najpomembnejsi vir ljudi. Avtorici ugotavljata, da v zvezi s poklicno izgorelostjo danes ni vec poudarek na preucevanju osebnostnih lastnosti za delo »preveč« vnetih ljudi, marvec predvsem na proucevanju delovnega okolja in psiholoških delovnih okolisCin v podjetju. Poklicno izgorelost lahko prepreCimo tudi z znanstveno utemeljeno organiziranostjo podjetja ali ustanove; taksno, ki spodbuja formalne in neformalne komunikacijske okoliscine, pozitivne medsebojne in kolektivne odnose ter druge ugodne psihološke delovne okoliscine. Izobrazevanje za prepoznavanje in preprečevanje poklicne izgorelosti na eni strani ter izobrazevanje za spodbujanje zavzetosti za delo na drugi strani je posvečeno posameznikom, podjetjem, strokovni in široki javnosti.

  12. 1 - 6_Abubakar and Muhammad_1

    African Journals Online (AJOL)

    User

    phosphorus availability in soil using Sokoto Rock Phosphate. The experiment ... essential macro-nutrient required by plants (Srinivasan ... microbial metabolites such as organic acids (Singh and ..... Adaptations by Plants for Securing a Non-.

  13. Muhammad Junaid Sulaiman Shairon wa Adibon

    OpenAIRE

    Safa, Najmuddin H. Abd.

    2014-01-01

    ???????????? ?????????? ?????????? ???????? ???????? ???????????? ???? ???????????????? ?????????????? ???????? ???????? ?????????? ?????????? ?????????? ???????????????????? . ???????? ???????? ???? ???????????? ?????? ???????? 1921 ??? 1996 ?? . ?????????? ?????????? ?????? ?????????? ???????????? ???? ???????? ?? ???? ?????????? ?????????? ?????????????????? ???????????????? ???????? ???????? ???????? ?????????? . ???????? ?????????? ???????? ???????? ?????? ?????????? ???? ????...

  14. 24__170 - 177_Muhammad and Mukhtar

    African Journals Online (AJOL)

    pc

    , the ... as rain crops that turn from green to golden as grain ripens ..... Mean. LSD. IT89KD-288. 3.438. 3.011. 2.888. 3.112. 0.198. Kanannado. 3.943. 3.788. 3.225. 3.652. 0.266. Mean. 3.690. 3.399. 3.056. LSD (0.05%) 0.282. 0.756. 0.807.

  15. Gold nanoparticle trapping and delivery for therapeutic applications

    Directory of Open Access Journals (Sweden)

    Aziz MS

    2011-12-01

    Full Text Available MS Aziz1, Nathaporn Suwanpayak3,4, Muhammad Arif Jalil2, R Jomtarak4, T Saktioto2, Jalil Ali1, PP Yupapin41Institute of Advanced Photonics Science, 2Ibnu Sina Institute of Fundamental Science Studies, Nanotechnology Research Alliance, Universiti Teknologi Malaysia, Johor Bahru, Malaysia; 3King Mongkut's Institute of Technology Ladkrabang, Chump on Campus, Chumphon, 4Nanoscale Science and Engineering Research Alliance (N'SERA, Faculty of Science, King Mongkut's Institute of Technology Ladkrabang, Bangkok, ThailandAbstract: A new optical trapping design to transport gold nanoparticles using a PANDA ring resonator system is proposed. Intense optical fields in the form of dark solitons controlled by Gaussian pulses are used to trap and transport nanoscopic volumes of matter to the desired destination via an optical waveguide. Theoretically, the gradient and scattering forces are responsible for this trapping phenomenon, where in practice such systems can be fabricated and a thin-film device formed on the specific artificial medical materials, for instance, an artificial bone. The dynamic behavior of the tweezers can be tuned by controlling the optical pulse input power and parameters of the ring resonator system. Different trap sizes can be generated to trap different gold nanoparticles sizes, which is useful for gold nanoparticle therapy. In this paper, we have shown the utility of gold nanoparticle trapping and delivery for therapy, which may be useful for cosmetic therapy and related applications.Keywords: gold nanoparticle trapping, particle trapping, therapy, transport

  16. Prevalence and risk factors of Parkinson's disease in retired Thai traditional boxers.

    Science.gov (United States)

    Lolekha, Praween; Phanthumchinda, Kammant; Bhidayasiri, Roongroj

    2010-09-15

    Boxing is often believed to be a frequent cause for parkinsonism caused by chronic repetitive head injury, with Muhammad Ali frequently cited as an example. The purpose of this study is to determine the prevalence of Parkinson's disease (PD) in retired Thai traditional boxers. Two standardized screening questionnaires were sent to all registered Thai traditional boxers. Subjects who screened positive for parkinsonism were invited for clinical examinations by two independent neurologists. Among 704 boxers (70%) who completed the questionnaires, 8 boxers (1.14%) had parkinsonism: 5 with PD, 1 with progressive supranuclear palsy and 2 with vascular parkinsonism. Boxers with PD were found to have an older mean age than those without PD (P = 0.003). The analysis of probable risk factors disclosed an association between the number of professional bouts (>100 times) and PD (P = 0.01). The crude prevalence of PD in Thai boxers was 0.71% (95% CI: 0.09-1.33), with a significant increase with age. The prevalence rate of PD in those aged 50 and above was 0.17% (95% CI: 0.15-0.20), age-adjusted to the USA 1970 census, which is comparable to that of the general populations. The analysis determined that the number of professional bouts is a risk factor among these boxers, supporting the notion that repetitive head trauma may pose an additional risk to certain individuals who are already susceptible to PD. © 2010 Movement Disorder Society.

  17. التعبير القرآني في قصة مريم (عليها السلام Quranic expression in the story of Mary (peace be upon her

    Directory of Open Access Journals (Sweden)

    Dr. Ahlam Fadel Abboud د. أحلام فاضل عبود

    2015-06-01

    Full Text Available There are multiple aspects of the dialogue in the story of Mary (AS are: 1-Mary mother of dialogue with God Almighty. Angels 7 dialogue with Mary (p. 2 Zakaria dialogue with God. 8 dialogue Mary (p with itself. 3 dialogue Mary (p with God says of. 9-dialogue or Ghebraúalma Mariam Isa (AS 4 speech Allah Almighty to Prophet Muhammad . 10-Mary dialogue (p with her people. 5 Zakaria dialogue with Mary (p. 11 Assa dialogue with folk 6. dialogue with the angels Zakaria. We will discuss in a detailed search last of these aspects, God willing. In the story of Mary (AS gloss inspired them a lesson and sermon in the consolidation of recurrence of these meanings, including: First: It concludes depending on God Almighty God may be in His help in all its affairs. Second: The cut off to the worship of one God Almighty and humbled heart God reassured him in degree Alosfia and close the Almighty said: oaz angels said: O Mary, God has chosen you and purified thee and chosen thee above the women Alim Imran / 42. Third: The Almighty God simplifies the provision for whom He wills without account, he says: kellma entered her Zakariamihrab found sustenance then said, O Mary, that I said to you this is from God, that God is alive and he wants without Hsab Imran / 37. Fourth: The mercy of God and the wide range and ability does not Aadzha everything in the heavens and the earth, and if he wants God something said to him, 'Be Creating Isa  without a father as creation before Adam  is or is not the father and the creation of Eve from a father without a mother he says: qal well God creates what He wills If he decrees a thing he says to it Be Vicu Imran / 47 and the words of the Almighty: qal also said RBC is Ali Hin and make him a sign for mankind and a mercy from us and was very Mqzia Mary / 21 and the Almighty said:  ... If he decrees a thing he says to it Be Vicu Mary / 35 Glory to God for what they describe There is

  18. Capacity fade of LiNi(1-x-y)CoxAlyO2 cathode for lithium-ion batteries during accelerated calendar and cycle life test. I. Comparison analysis between LiNi(1-x-y)CoxAlyO2 and LiCoO2 cathodes in cylindrical lithium-ion cells during long term storage test

    Science.gov (United States)

    Watanabe, Shoichiro; Kinoshita, Masahiro; Nakura, Kensuke

    2014-02-01

    Ni-based LiNi(1-x-y)CoxAlyO2 (NCA) and LiCoO2 (LCO) cathode materials taken out of lithium-ion cells after storage for 2 years at 45 °C were analyzed by various spectroscopic techniques. X-ray photoelectron spectroscopy exhibited that there was no difference between NCA and LCO. On the other hand, scanning transmission electron microscopy-electron energy-loss spectroscopy demonstrated there was a remarkably large difference between the two cathode materials. Ni-L2,3 energy-loss near-edge structure (ELNES) spectra of the NCA showed a peak at about 856.5 eV, which was assigned to trivalent nickel, was maintained even after storage, indicating that the NCA had no significant change in its surface structure during storage. On the other hand, in the Co-L2,3 ELNES spectra of the LCO a peak at about 782.5 eV, which was assigned to trivalent cobalt, significantly shifted to the lower energies after storage. These results suggest that crystal structure change of the active material surface is a predominant reason of deterioration during the storage test.

  19. Androgenic alopecia and dutasteride in hair mesotherapy: A short review

    Directory of Open Access Journals (Sweden)

    Estela B Busanello

    2018-02-01

    Full Text Available Androgenic alopecia (AGA is the most common cause of patterned hair loss in predisposed men and women. AGA is a multifactorial and polygenetic condition, affecting up to 80% of men and 40-50% of women during life. AGA is characterized by a gradual reduction of the anagen and increase in telagen phase, leading to a progressive follicle miniaturization. As a consequence, terminal hairs are converted into vellus hairs decreasing hair density. The pathophysiology of AGA is heterogeneous and highly complex. A diverse combination of genetical factors, endocrine abnormalities, circulating androgens, drugs, diet and microinflammation in hair follicles of each individual are related to this condition. However, it is well known that androgens are the major modulators of male AGA but their specific action on female AGA is still under debate. Circulating testosterone is converted by 5a-reductase in 5a-dihydrotestosterone (DHT in the periphery, a decrease of anagen phase occur, anticipating catagen phase in a complex process involving apoptosis as probably microinflammation. In AGA treatment, mesotherapy is being used with 5a-reductase inhibitors, especially dutasteride, injected directly on scalp. Thus, this updated review summarized the injectable use of dutasteride based on data available on PubMed until March 2017. Dutasteride, a second-generation inhibitor of 5a-reductase is more potent than finasteride due to the capability of inhibit types 1 and 2 of the enzyme. The efficacy and safety of hair mesotherapy with dutasteride were reported by distinct groups and the best results were achieved when this compound was used in combination with other substances, increasing hair growth. This result could be explained by the multifactorial pathophysiology of AGA, involving hair follicle sensitivity to DHT and microinflammation. Therefore, a multi-therapeutic approach seems to be more effective in AGA management. In conclusion, more studies are needed to

  20. Association of asthma therapy and Churg-Strauss syndrome: an analysis of postmarketing surveillance data.

    Science.gov (United States)

    DuMouchel, William; Smith, Eric T; Beasley, Richard; Nelson, Harold; Yang, Xionghu; Fram, David; Almenoff, June S

    2004-07-01

    Churg-Strauss syndrome (CSS), also known as allergic granulomatous angiitis (AGA), is a rare vasculitis that occurs in patients with bronchial asthma. The nature of the association of CSS with various asthma therapies is unclear. This study investigated the associations of different multidrug asthma therapy regimens and the reporting of AGA (the preferred code for CSS in the coding dictionary for the Adverse Event Reporting System [AERS]) by applying an iterative method of disproportionally analysis to th AERS database maintained by the US Food and Drug Administration. The public-release version of the AERS database was used to identify reports of AGA in patients receiving asthma therapy. Reporting of AGA was examined using iterative disproportionality methods in patients receiving > or =1 of the following drug classes: inhaled corticosteroid (ICS), leukotriene receptor antagonist (LTRA), short-acting beta(2)-agonist (SABA), or long-acting beta(2)-agonist (LABA). The Bayesian data-mining algorithm known as the multi-item gamma poisson shrinker was used to determine the relative reporting rates by calculation of the empirical Bayes geometric mean (EBGM) and its 90% CI (EB05 = lower limit and EB95 = upper limit) for each drug. Subset analyses were performed for each drug with different medication combinations to differentiate the relative reporting of AGA for each. A strong association was found between LTRA use and AGA (EBGM = 104.0, EB05 = 95.0, EB95 = 113.8) that persisted with all combinations of therapy studied. AGA was also associated with the ICS, SABA and LABA classes (EBGM values of 27.8, 14.6 and 40.4, respectively). However, the latter associations were mostly dependent on the presence of concurrent LTRA and, to a lesser extemt, oral corticosteroid therapy and became negligible (ie, EB05 < 2) for patients who were not receiving these concurrent treatments. Differences based on relative reporting were observed in the patterns of association of AGA with LTRA

  1. A comparison of the metabolism of the abortifacient compounds from Ponderosa pine needles in conditioned versus naive cattle.

    Science.gov (United States)

    Welch, K D; Gardner, D R; Pfister, J A; Panter, K E; Zieglar, J; Hall, J O

    2012-12-01

    Isocupressic acid (ICA) is the abortifacient compound in ponderosa pine (Pinus ponderosa L.) needles, which can cause late-term abortions in cattle (Bos taurus). However, cattle rapidly metabolize ICA to agathic acid (AGA) and subsequent metabolites. When pine needles are dosed orally to cattle, no ICA is detected in their serum, whereas AGA is readily detected. Recent research has demonstrated that AGA is also an abortifacient compound in cattle. The observation has been made that when cattle are dosed with labdane acids for an extended time, the concentration of AGA in serum increases for 1 to 2 d but then decreases to baseline after 5 to 6 d even though they are still being dosed twice daily. Therefore, in this study we investigated whether cattle conditioned to pine needles metabolize ICA, and its metabolites, faster than naïve cattle. Agathic acid was readily detected in the serum of naïve cattle fed ponderosa pine needles, whereas very little AGA was detected in the serum of cattle conditioned to pine needles. We also compared the metabolism of ICA in vitro using rumen cultures from pine-needle-conditioned and naïve cattle. In the rumen cultures from conditioned cattle, AGA concentrations were dramatically less than rumen cultures from naïve cattle. Thus, an adaptation occurs to cattle conditioned to pine needles such that the metabolism AGA by the rumen microflora is altered.

  2. Study of gene expression alteration in male androgenetic alopecia: evidence of predominant molecular signalling pathways.

    Science.gov (United States)

    Michel, L; Reygagne, P; Benech, P; Jean-Louis, F; Scalvino, S; Ly Ka So, S; Hamidou, Z; Bianovici, S; Pouch, J; Ducos, B; Bonnet, M; Bensussan, A; Patatian, A; Lati, E; Wdzieczak-Bakala, J; Choulot, J-C; Loing, E; Hocquaux, M

    2017-11-01

    Male androgenetic alopecia (AGA) is the most common form of hair loss in men. It is characterized by a distinct pattern of progressive hair loss starting from the frontal area and the vertex of the scalp. Although several genetic risk loci have been identified, relevant genes for AGA remain to be defined. To identify biomarkers associated with AGA. Molecular biomarkers associated with premature AGA were identified through gene expression analysis using cDNA generated from scalp vertex biopsies of hairless or bald men with premature AGA, and healthy volunteers. This monocentric study reveals that genes encoding mast cell granule enzymes, inflammatory mediators and immunoglobulin-associated immune mediators were significantly overexpressed in AGA. In contrast, underexpressed genes appear to be associated with the Wnt/β-catenin and bone morphogenic protein/transforming growth factor-β signalling pathways. Although involvement of these pathways in hair follicle regeneration is well described, functional interpretation of the transcriptomic data highlights different events that account for their inhibition. In particular, one of these events depends on the dysregulated expression of proopiomelanocortin, as confirmed by polymerase chain reaction and immunohistochemistry. In addition, lower expression of CYP27B1 in patients with AGA supports the notion that changes in vitamin D metabolism contributes to hair loss. This study provides compelling evidence for distinct molecular events contributing to alopecia that may pave the way for new therapeutic approaches. © 2017 British Association of Dermatologists.

  3. TINJAUAN SEJARAH TERHADAP NASKAH DAN TEKS KITAB PENGETAHUAN BAHASA, KAMUS LOGAT MELAYU JOHOR PAHANG RIAU LINGGA KARYA RAJA ALI HAJI

    Directory of Open Access Journals (Sweden)

    Ellya Roza

    2012-11-01

    Full Text Available Kingdom of Riau in the 19th century recognized by many historians as the center of culture and intellectual development. While at the same time, the kingdom of Riau no longer holds hegemony and succeeding in politics, economy and trade, but they have a tradition of excellence in the form of writing that many writers with works of quality that is not only in the field of literature and language alone but also in the fields of religion, history, socio-political, legal, and cultural. Although the tools for writing like paper and ink difficulty encountered in those days, and must be imported from European countries, but the author and the author's Riau while still concentrating on the activities making up the reef. For instance, Raja Ali Haji (1808-1873 is the third descendant of Raja Haji Fi Sabilillah most productive in writing activities. One of his works, entitled The Book of Knowledge of Language, Slang Dictionary Pahang Malay Johor Riau linga which was completed in 1858 is a Malay Dictionary Malay First Nature books can even be regarded as Malay Einsiklopedi containing approximately 2000 sentences basic and advanced script written as Bustanul Katibin which intends to foster Malay language became the language of the standard on its own. The manuscript of the book, now the mistress Foundation Indrasakti in Penyengat. In connection with that paper will review the history of the manuscript and are contained in the text.

  4. Asymptomatic bacteriuria in pregnant women attending Boo-Ali Hospital Tehran Iran: Urine analysis vs. urine culture.

    Science.gov (United States)

    Etminan-Bakhsh, Mina; Tadi, Sima; Darabi, Roksana

    2017-11-01

    Asymptomatic bacteriuria is one of the common problems in pregnancy. Asymptomatic bacteriuria is associated with pyelonephritis, preterm labor and low birth weight infants. The physiological and anatomical changes in pregnancy facilitate urinary tract infection (UTI) during pregnancy. Several tests are available for diagnosis of asymptomatic bacteriuria. The urine culture is a gold standard diagnostic test for asymptomatic bacteriuria but it is expensive and time-consuming. Screening methods may be useful in detecting high-risk pregnant women for asymptomatic bacteriuria. The aim of the present study was to compare urine analysis as a rapid screening test to urine culture in diagnosis of asymptomatic bacteriuria. A total of 123 pregnant women attending the obstetrics clinic of Boo-Ali hospital in Tehran, Iran from March 2013 to September 2014 were included in the present diagnostic cross-sectional study. One hundred twenty three mid-stream urine samples were inoculated into cultures and were processed by dipstick (nitrite test and leucocyte esterase test) and microscopic pus cell count. The sensitivity, specificity, positive predictive value and negative predictive value of nitrite test, leucocyte esterase test and microscopic pus cell count were compared with urine culture in diagnosis of asymptomatic bacteriuria by using SPSS version 19. Of 123 urine samples, significant asymptomatic bacteriuria (≥10 4 cfu/Ml) was detected in 8 (6.5%) subjects. The sensitivity and specificity of nitrite test were 37% and 100% respectively. The sensitivity of pus cell count alone and leucocyte esterase test alone were 100% but the specificity of them were 64% and 65% respectively. We found high negative predictive value by Pus cell count and the leucocyte esterase test (100%) and low positive predictive value by them (16% and 17% respectively). Urine culture is the most useful test for diagnosis of asymptomatic bacteriuria. None of our screening tests had a sensitivity and

  5. Characteristics of Androgenetic Alopecia in Asian

    OpenAIRE

    Lee, Won-Soo; Lee, Hae-Jin

    2012-01-01

    Androgenetic alopecia (AGA), or pattern hair loss, is a common disorder in Asian men and women, with a reported incidence of up to 73% among general population. There are several descriptions regarding the characteristics of AGA in patients of European descent. Asian patients with AGA have different types of hair loss and family histories from Europeans, which may affect treatment response. Therefore, in this review, prevalence, hair loss patterns, familial factors, androgen receptor gene pol...

  6. Engineering Task Plan to Expand the Environmental Operational Envelope of Core Sampling

    International Nuclear Information System (INIS)

    BOGER, R.M.

    1999-01-01

    This Engineering Task Plan authorizes the development of an Alternative Generation and Analysis (AGA). The AGA will determine how to expand the environmental operating envelope during core sampling operations

  7. Nosocomial infections and antibiotic resistance pattern in open-heart surgery patients at Imam Ali Hospital in Kermanshah, Iran.

    Science.gov (United States)

    Heydarpour, Fatemeh; Rahmani, Youssef; Heydarpour, Behzad; Asadmobini, Atefeh

    2017-01-01

    Background: Patients undergoing open heart surgery have a relatively high risk of acquiring nosocomial infections. The development of antibiotic-resistant infections is associated with prolonged hospital stays and mortalities. Objectives: The present study was conducted to investigate nosocomial infections and the antibiotic resistance pattern in bacteria causing these infections in open heart surgery patients at Imam Ali Hospital in Kermanshah in the west of Iran over a 4-year period from March 2011 to March 2014. Materials and methods: The present cross-sectional study was conducted on 135 cases of nosocomial infection among open heart surgery patients. The demographic characteristics and the risk factors of each case of infection were recorded. The antibiotic susceptibility test was carried out using the Minimum Inhibitory Concentration (MIC) method based on the Clinical and Laboratory Standards Institute (CLSI) protocol. The data collected were then analyzed in SPSS-16. Results: Out of the 6,000 patients who underwent open heart surgery during this 4-year period at the selected hospital, nosocomial infections developed in 135 patients (2.25%), 59.3% of whom were female and 40.7% male. Surgery site infection (SSI), pneumonia (PNEU), urinary tract infection (UTI) and blood stream infection (BSI) affected 52.6%, 37%, 9.6% and 0.8% of the cases, respectively. E.coli , Klebsiella spp. and S. aureus were the most common bacteria causing the nosocomial infections. E. coli was most frequently resistant to imipenem (23.3%) Klebsiella spp. to gentamicin (38.5%) S. aureus to co-trimoxazole (54.2%). Conclusion: SSI had a high prevalence in this study. Further studies should therefore be conducted to examine the risk factors associated with SSI in open heart surgery. Various studies have shown that antibiotic resistance patterns are different in different regions. Finding a definitive treatment therefore requires an antibiogram.

  8. PREFACE: The 3rd ISESCO International Workshop and Conference On Nanotechnology 2012 (IWCN2012)

    Science.gov (United States)

    Umar, Akrajas Ali; Yahaya, Muhammad; Mat Salleh, Muhamad

    2013-04-01

    unwavering support dedicated by all the referees. Their tireless work has helped guarantee the high scientific level of this series. Many thanks are also addressed to the ISESCO, COMSATS, MASS, UKM and FST for their financial support. Logistics support provided by IMEN and MNA is also much appreciated. We realized that this volume would never have materialized without the hard work of Ms Siti Khatijah Md Saad who helped the editorial secretariat in many ways communicating with the authors and reviewers and checking and typesetting the papers in the final stage. Finally, great appreciation is addressed to all who have worked hard and given support ensuring that the conference was a success. Editors Associate Professor Dr Akrajas Ali Umar Professor Dr Muhamad Mat Salleh Professor Dato' Dr Muhammad Yahaya IWCN 2012 Organizing Committee International Advisory Board Professor Dato' Dr Muhammad Yahaya (UKM, Malaysia) Dr Faiq Bilal (ISESCO, Morocco) Professor Dr Michael Graetzel (Switzerland) Professor Dr Muhamad Rasat (Malaysia) Prof Dr Masbah R T Siregar (Indonesia) Associate Professor Dr Munetaka Oyama (Japan) Professor Dr Ismat Shah (USA) Professor Dr Muhamad Mat Salleh (Malaysia) Chairman Associate Professor Dr Mohammad Kassim Co-Chairman Dr Mohammad Hafizuddin Haji Jumali Secretary Dr Lorna Jeffry Minggu Treasurer Dr Sharina Abu Hanifah Committee Members Associate Professor Dr Mohd Azmi Abd Hamid Associate Professor Dr Akrajas Ali Umar Dr Zahari Ibarahim Dr Rozidawati Awang Dr Farah Hannan Anuar Secretariat Dr Khuzaimah Mohd Firdauz Ismail Izura Izzuddin Nor Huwaida Janil Jamil Siti Khatijah Md Saad Noor Razinah Rahmat Mark Lee Wun Fui Ng Kim Hang Lee Thian Khoon Law Kung Pui Choong Yan Yi

  9. Effect of integrated pest management on controlling zoonotic cutaneous leishmaniasis in Emamzadeh Agha Ali Abbas (AS) District, Isfahan province, 2006-2009.

    Science.gov (United States)

    Nilforoushzadeh, Mohammad Ali; Shirani-Bidabadi, Leila; Saberi, Sedigheh; Hosseini, Seyed Mohsen; Jaffary, Fariba

    2014-01-01

    Cutaneous leishmaniasis (CL) is still considered as a health problem in the world. Several methods of control in different regions, together with obtaining integrated information on its natural foci, are needed to decrease its prevalence. This study was designed to evaluate the effects of simultaneous interventions on CL control. A standard questionnaire was used to identify patients among pilgrims to Emamzadeh Agha Ali Abbas (Isfahan Province, Iran). Subsequently, three methods of controlling the disease, including, spraying residential buildings with Baygon, baiting with zinc phosphide poisons, changing the vegetative cover of the region, improving the environment, and mounting a mesh on all doors and windows of buildings in residential areas were used. The control measures were then evaluated by comparing the number of pilgrims affected by CL after and before the interventions. While 23 pilgrims (1.4%) were affected with CL before the intervention (pretest), five (0.3%) persons were found to have CL after taking control measures. The Chi-square test did not indicate any significant difference in the relative frequency of CL (P = 0.731). The only scientific method for preventing and controlling zoonotic CL (ZCL) is a combination of the control methods (improving the environment and fighting off the disease districts and vectors) together with changing the vegetative cover of the region. Any measure for controlling this disease must be taken and programmed in accordance with the relevant experts' views, in coordination with the participation of other organizations and the society.

  10. The trend toward digital in medical education – playing devil's advocate

    Directory of Open Access Journals (Sweden)

    Al-Jibury O

    2015-10-01

    Full Text Available Osama Al-jibury, Maroof Ahmed, Muhammad Najim, Riham Rabee, Muhammad Ashraf, Yusuf Sherwani, Osama AnjumDepartment of Medicine, Imperial College Medical School, London, UKDigitalization of medical resources has completely revolutionized medical education. Nowadays, medical information is readily accessible online. If a doctor needs to learn about Lesch–Nyhan syndrome, he or she can just search online – thousands of digital resources, explaining everything from simple pathophysiology to the latest genetic research into the condition, can be found; even videos of patients with the condition are available and easily located by using a search engine such as Google. Could there possibly be any downsides to this?

  11. Conventional and novel stem cell based therapies for androgenic alopecia.

    Science.gov (United States)

    Talavera-Adame, Dodanim; Newman, Daniella; Newman, Nathan

    2017-01-01

    The prevalence of androgenic alopecia (AGA) increases with age and it affects both men and women. Patients diagnosed with AGA may experience decreased quality of life, depression, and feel self-conscious. There are a variety of therapeutic options ranging from prescription drugs to non-prescription medications. Currently, AGA involves an annual global market revenue of US$4 billion and a growth rate of 1.8%, indicating a growing consumer market. Although natural and synthetic ingredients can promote hair growth and, therefore, be useful to treat AGA, some of them have important adverse effects and unknown mechanisms of action that limit their use and benefits. Biologic factors that include signaling from stem cells, dermal papilla cells, and platelet-rich plasma are some of the current therapeutic agents being studied for hair restoration with milder side effects. However, most of the mechanisms exerted by these factors in hair restoration are still being researched. In this review, we analyze the therapeutic agents that have been used for AGA and emphasize the potential of new therapies based on advances in stem cell technologies and regenerative medicine.

  12. Birth weight and long-term metabolic outcomes: does the definition of smallness matter?

    Science.gov (United States)

    Verkauskiene, R; Figueras, F; Deghmoun, S; Chevenne, D; Gardosi, J; Levy-Marchal, M

    2008-01-01

    To establish the role of individual definition of smallness at birth in the association between birth weight and long-term metabolic outcomes. Lipid profile and oral glucose tolerance test were performed in young adults (22 years) born either small (SGA) or appropriate for gestational age (AGA). AGA/SGA were defined by both population-based and customized methods adjusting for individual maternal/pregnancy characteristics. 825 individuals were classified as AGA and 575 as SGA by both methods, 131 were SGA by the population-based method only (SGA(pop)) and 22 were SGA by the customized method only (SGA(cust)). SGA(cust) subjects had higher total cholesterol and triglyceride levels and lower high-density lipoprotein cholesterol concentrations than SGA(pop) and AGA subjects, however, insignificantly when adjusted for age, gender and body mass index. The homeostasis model assessment for insulin resistance (HOMA-IR) index was higher in the SGA(cust) (p = 0.05) and SGA(pop) (p = 0.02) versus the AGA group. Controlling for the HOMA-IR index, the insulinogenic index was significantly lower in the SGA(cust) versus SGA(pop) (p = 0.001) and AGA (p = 0.003) groups. In SGA(cust) individuals, the HOMA-IR index was clearly shifted to higher, while the insulinogenic index to lower tertiles of AGA distribution; SGA(pop) subjects had the HOMA-IR and insulinogenic index predominantly in the highest tertiles. Individualized birth weight standards allow to better identify subjects who failed to reach their genetic potential of intrauterine growth and are at higher risk of metabolic disturbances and impaired insulin secretion later in life. Copyright 2008 S. Karger AG, Basel.

  13. Association between anti-endomysial antibody and total intestinal villous atrophy in children with coeliac disease.

    Directory of Open Access Journals (Sweden)

    Ozgenc F

    2003-01-01

    Full Text Available BACKGROUND: There is growing evidence to suggest that detection of anti-gliadin antibody (AGA and anti-endomysial antibody (EmA can serve as sensitive markers of the degree of histological abnormalities in patients with coeliac disease. AIM: To evaluate the association between the presence of AGA and EmA and villous atrophy in intestinal biopsies of children with suspected coeliac disease. SETTINGS AND DESIGN: Intestinal samples of 46 children with failure to thrive, chronic diarrhoea, malabsorption and short stature with either AGA and/or EmA positivity were evaluated, retrospectively. The diagnosis of coeliac disease was based on ESPGHAN criteria. METHODS AND MATERIAL: Patients with total villous atrophy who fulfilled the ESPGHAN criteria for the diagnosis of coeliac disease were diagnosed to have coeliac disease. Nine patients without villous atrophy were taken as negative controls for this study. AGA-IgA was measured both by immunoflourescence (IF and ELISA and EmA-IgA by IF while patients were on normal diet. Relationship between autoantibody positivity and intestinal total villous atrophy was evaluated. RESULTS: Overall positivity for AGA IgA was 85% (39/46 by IF+ELISA and EmA positivity was 85% (39/46 by IF within the study group. Histological examination revealed total villous atrophy with lymphocyte infiltration and crypt hyperplasia in 37 (80% patients. AGA IgA was positive in 14 (38% and 31 (84% of these children by ELISA and IF, respectively. EmA positivity was detected in 35/37 (95% cases with atrophy and 4/9 (44% without atrophy (p=0.002. Thirty out of 37 (81% patients with villous atrophy had both AGA IgA (IF and EmA positivity (p=0.186. All of the sixteen patients that had both positive AGA IgA (ELISA+IF and EmA had total villous atrophy (p=0.037. CONCLUSION: A significant association between total villous atrophy and EmA positivity has been documented in this study.

  14. Hiilgav, aga... / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Earth 2" (1994), "EZ Streets" (1996), "Profit" (1996), "Strange World" (1999), "The Inside" (2005), "Drive" (2007), "Aliens in America" (2007)

  15. Edasi loodusesse! Aga kuhu? / Riina Oruaas

    Index Scriptorium Estoniae

    Oruaas, Riina

    2007-01-01

    Tantsulavastustest: Oksana Titova, Päär Pärenson ja Juhan Ulfsak "Roots", Kaja Kanni sooloetendus "There are Laika dogs living in Estonia", Tiina Mölder, Kaja Kann ja Bush Hartshor "Naine ja Hunt"

  16. Protsessijuhtimine suurendab kliendikesksust / Verner Mättas

    Index Scriptorium Estoniae

    Mättas, Verner

    2003-01-01

    Protsessijuhtimise ja funktsioonipõhise juhtimise võrdlus. Autor tutvustab protsessimudelit AGA tööstuslike gaaside ärivaldkonnas. Skeem: Erinevate huvigruppide ootuste ja rahulolu seosed (Eesti AGA näitel); Vt. samas: Protsessijuhtimine keskendub eri huvigruppide ootustele

  17. Androgenetic alopecia and risk of coronary artery disease

    Directory of Open Access Journals (Sweden)

    Lata Sharma

    2013-01-01

    Full Text Available Background: Androgenetic alopecia (AGA or male pattern baldness (MPB has been found to be associated with the risk of coronary artery disease (CAD. The well-known risk factors are family history of CAD, hypertension, increased body mass index (BMI, central obesity, hyperglycemia, and dyslipidemia. The newer risk factors are serum lipoprotein-a (SL-a, serum homocysteine (SH, and serum adiponectin (SA. Aim : Identifying individuals at risk of CAD at an early age might help in preventing CAD and save life. Hence, a comparative study of CAD risk factors was planned in 100 males of AGA between the age of 25 and 40 years with equal number of age- and sex-matched controls. Materials and Methods : Patients of AGA grade II or more of Hamilton and Norwood (HN Scale and controls were examined clinically and advised blood test. The reports were available for fasting blood sugar (FBS, serum total serum cholesterol (SC in 64 cases, 64 controls; lipoproteins (high, low, very low density, HDL, LDL, VLDL, serum triglycerides (ST in 63 cases, 63 controls; SL-a in 63 cases, 74 controls; SH in 56 cases, 74 controls; and SA in 62 cases, 74 controls. Results : In these cases family history (FH of AGA and CAD was significantly high. The blood pressure (BP was also found to be significantly high in the cases. The difference of mean serum HDL, LDL, VLDL, ST, SH, and SL-a in cases and controls were statistically significant and with increasing grade of AGA, the risk factors also increased. Conclusion : Patients with AGA appear to be at an increased risk of developing CAD, therefore, clinical evaluation of cases with AGA of grade II and above may be of help in preventing CAD in future.

  18. Role of adiponectin and leptin on body development in infants during the first year of life

    Directory of Open Access Journals (Sweden)

    Gasparoni Antonella

    2010-03-01

    Full Text Available Abstract Background The control of growth and nutritional status in the foetus and neonate is a complex mechanism, in which also hormones produced by adipose tissue, such as adiponectin and leptin are involved. The aim of this study was to evaluate levels of adiponectin, leptin and insulin in appropriate (AGA and small for gestational age (SGA children during the 1st year of life and to correlate these with auxological parameters. Methods In 33 AGA and 29 SGA infants, weight, length, head circumference, glucose, insulin, adiponectin and leptin levels were evaluated at the second day of life, and at one, six and twelve months, during which a portion of SGA could show catch-up growth (rapid growth in infants born small for their gestational age. Results Both total and isoform adiponectin levels were comparable between AGA and SGA infants at birth and until age one year. These levels significantly increased from birth to the first month of life and then decreased to lower values at 1 year of age in all subjects. Circulating leptin concentrations were higher in AGA (2.1 ± 4.1 ng/ml than in SGA neonates (0.88 ± 1.03 ng/ml, p st and the 6th month of age, but they increased in SGA from six months to one year, when they showed catch-up growth. Circulating insulin levels were not statistically different in AGA and SGA neonates at any study time point. Insulin levels in both AGA and SGA infants increased over the study period, and were significantly lower at birth compared to one, six and 12 months of age. Conclusions During the first year of life, in both AGA and SGA infants a progressive decrease in adiponectin levels was observed, while a difference in leptin values was correlated with the nutritional status.

  19. Agama Sebagai Kesadaran Ideologis: Refleksi Perubahan Sosial Ali Syari’ati

    Directory of Open Access Journals (Sweden)

    Imam Bonjol Jauhari

    2016-06-01

    Full Text Available Abstract: In the context of social change, the thought of Ali Syar'ati, if seen from the perspective of its frameworks and methods,is different from the thought of other Islamic movements.On the one hand, Shari'ati’s thought opposes the Iranian authority, Shah Pahlavi, but on the other hand, it is totally different from the traditional Iranian anti-change cleric, and it is also in contrast to the radical Islamic movements that do political rebellion against the ruler.Shari'atiput up political resistance through revolutionary ideas influencing public opinion to understand Islam as a doctrine which has an emancipatory interest, that is, the belief of Islam as a school of thought and action in the fight against social and economic injustice, despotic ruler, and the fetters of culture. Efforts to comprehend Islamic meanings in modern and contextual Islamic thought presents two patterns of social changes; first is the pattern of moderatemovement and second is extreme one. The formerleads more specifically to how to implement Islamic values in the national way of life, and   sense of nationalitywithout being trapped inreligious symbols and labels, while the latter leads totheimplementation of Islamic values and symbolismand labeling whichare both considered to be important. So the former tends to take more substantive values of Islam that is essentially concerned with the purpose of realization of the ideals of Islam, while the latter tends to the enactment of Islamic lawin all aspects of community life.  الملخص: في سياق التغيير الاجتماعي، يعتقد أن فكرة علي شريعتي لها إطار وأساليب تختلف عن أساليب رواد الفكر والحركات الإسلامية الأخرى. من ناحية ،أن شريعتي يكافح ضد سلطة مستبدة في إيران، شاه بهلوي. ومن ناحية أخرى، كان مختلفا تماما عن علماء الدين

  20. Sequence Classification: 378135 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB TMH TMB Non-TMB Non-TMB Non-TMB >gi|13475854|ref|NP_107424.1| agaE protein, conversion of agropini...c acid to mannopinic acid || http://www.ncbi.nlm.nih.gov/protein/13475854 ...

  1. Hunting the genes in male-pattern alopecia: how important are they, how close are we and what will they tell us?

    Science.gov (United States)

    Heilmann-Heimbach, Stefanie; Hochfeld, Lara M; Paus, Ralf; Nöthen, Markus M

    2016-04-01

    Androgenetic alopecia (AGA) is a highly heritable condition, and the most common form of hair loss in men. The phenotype is characterized by an androgen-dependent, progressive loss of hair from the scalp, which may commence during puberty. Up to 80% of European men experience some degree of androgen-dependent hair loss during their lifetime. Current treatment options for AGA have limited efficacy, and improved understanding of the underlying biological causes is required to facilitate novel therapeutic approaches. To date, molecular genetic studies have implicated 12 genomic regions in AGA and identified a number of candidate genes. The latter include those encoding the androgen receptor (AR), the histone deacetylases (HDAC) 4 and 9, and the WNT molecule WNT10A. However, the majority of contributing genetic risk factors still await identification. This review describes the current status of AGA genetic research. We discuss the strength of the genetic approach and anticipated developments in the field, and how these will facilitate the systematic unravelling of AGA pathobiology, a process which may lead to the identification of new therapeutic targets. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Development of antiproliferative nanohybrid compound with controlled release property using ellagic acid as the active agent

    Directory of Open Access Journals (Sweden)

    Hussein MZ

    2011-07-01

    Full Text Available Mohd Zobir Hussein1,2, Samer Hasan Al Ali2, Zulkarnain Zainal2, Muhammad Nazrul Hakim31Advanced Materials and Nanotechnology Laboratory, Institute of Advanced Technology (ITMA, 2Department of Chemistry, Faculty of Science, 3Department of Biomedical Science, Faculty of Medicine and Health Science, Universiti Putra Malaysia, Selangor, MalaysiaAbstract: An ellagic acid (EA–zinc layered hydroxide (ZLH nanohybrid (EAN was synthesized under a nonaqueous environment using EA and zinc oxide (ZnO as the precursors. Powder X-ray diffraction showed that the basal spacing of the nanohybrid was 10.4 Å, resulting in the spatial orientation of EA molecules between the interlayers of 22.5° from z-axis with two negative charges at 8,8′ position of the molecules pointed toward the ZLH interlayers. FTIR study showed that the intercalated EA spectral feature is generally similar to that of EA, but with bands slightly shifted. This indicates that some chemical bonding of EA presence between the nanohybrid interlayers was slightly changed, due to the formation of host–guest interaction. The nanohybrid is of mesopores type with 58.8% drug loading and enhanced thermal stability. The release of the drug active, EA from the nanohybrid was found to be sustained and therefore has good potential to be used as a drug controlled-release formulation. In vitro bioassay study showed that the EAN has a mild effect on the hepatocytes cells, similar to its counterpart, free EA.Keywords: ellagic acid, nonaqueous solution, ZnO, zinc-layered hydroxide, viability test

  3. Embedded nanomicro syringe on chip for molecular therapy

    Directory of Open Access Journals (Sweden)

    Jalil MA

    2011-11-01

    Full Text Available Muhammad Arif Jalil1, Nathaporn Suwanpayak2,3, Kathawut Kulsirirat3, Saisudawan Suttirak3, Jalil Ali4, Preecha P Yupapin31Ibnu Sina Institute of Fundamental Science Studies, Nanotechnology Research Alliance, Universiti Teknologi Malaysia, Johor Bahru, Malaysia; 2King Mongkut's Institute of Technology Ladkrabang, Chumphon Campus, Chumphon, Thailand; 3Nanoscale Science and Engineering Research Alliance, Advanced Research Center for Photonics, Faculty of Science, King Mongkut's Institute of Technology Ladkrabang, Bangkok, Thailand; 4Institute of Advanced Photonics Science, Nanotechnology Research Alliance, Universiti Teknologi Malaysia, Johor Bahru, MalaysiaBackground: A novel nanomicro syringe system was proposed for drug storage and delivery using a PANDA ring resonator and atomic buffer. A PANDA ring is a modified optical add/drop filter, named after the well known Chinese bear. In principle, the molecule/drug is trapped by the force generated by different combinations of gradient fields and scattering photons within the PANDA ring. A nanomicro needle system can be formed by optical vortices in the liquid core waveguide which can be embedded on a chip, and can be used for long-term treatment. By using intense optical vortices, the required genes/molecules can be trapped and transported dynamically to the intended destinations via the nanomicro syringe, which is available for drug delivery to target tissues, in particular tumors. The advantage of the proposed system is that by confining the treatment area, the effect can be decreased. The use of different optical vortices for therapeutic efficiency is also discussed.Keywords: nanomicro syringe, nanomicro needle, molecular therapy, therapeutic efficiency, cancer

  4. 77 FR 44618 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

    Science.gov (United States)

    2012-07-30

    ..., New York, New York 10045-0001: 1. Muhammad Habib, Kusnacht, Switzerland; Hamza Habib, and Khadijah... Maham Beteiligungsgessellschaft AG, Zurich, Switzerland, and thereby indirectly retain control of Habib...

  5. AFJU OFC 18(3).indd

    African Journals Online (AJOL)

    imac-3

    a Department of Radiology, Aga Khan Medical University, Karachi, Pakistan b Rhode Island Hospital, Brown University, Providence, RI 02912, USA c Department of Surgery, Aga .... In defense of IVU, Saeed et al. [12] noted that the addition of ...

  6. Sequence Classification: 378211 [

    Lifescience Database Archive (English)

    Full Text Available nic acid to mannopinic acid || http://www.ncbi.nlm.nih.gov/protein/13475930 ... ...Non-TMB TMH Non-TMB Non-TMB Non-TMB Non-TMB >gi|13475930|ref|NP_107500.1| AgaE protein, conversion of agropi

  7. Aplikasi Teori Fungsi Interpretasi Jorge J.E. Gracia Tentang Hadîth Kebiri

    Directory of Open Access Journals (Sweden)

    Bahruddin Zamawi

    2016-09-01

    Full Text Available The paper highlights the contradiction of two hadîths on castration. The context of the issue has appeared within the contemporary Indonesia right after the Government stated the “additional punishment” for those who commit sexual harassment. The spirit of the punishment is to give a sort of “daunting effect” for the committers and “possible predators”. Such additional punishment has, however, invited various different responses from the Indonesian people. Some have rejected it, while some other have intensely called for its implementation. Regardless of this debate, article will shed light on the historical narration of Islamic view on castration in Muhammad’s life. The research finds that there are two hadîths which are regarded as contradictory. The first hadîth has narrated that Muhammad banned his companions to geld themselves. This happened when Muhammad and his companions went to battle field. Another hadîth has, however, reported that Muhammad allowed one of his companions to geld himself. These two seemingly conflicting hadîths need further care-ful explanations in order to reach the best and proper under-standing. In doing so, the author employs Gracia’s theory on the Function of Interpretation.

  8. Health care system in Sudan: review and analysis of Strength ...

    African Journals Online (AJOL)

    Health care system in Sudan: review and analysis of Strength, Weakness, Opportunity, and Threats (SWOT Analysis). Ebrahim M.A. Ebrahim, Luam Ghebrehiwot, Tasneem Abdalgfar, Muhammad Hanafiah Juni ...

  9. TOURE ALI.xps

    African Journals Online (AJOL)

    HP Pro 2000

    irrigated-rice production enterprise revealed positive economic profitability for both ... marketing in which a great number of women rice traders are active. ..... Table 3 : Summary results for single-factor change scenarios: increase in yield and ...

  10. Ali, Prof. Sher

    Indian Academy of Sciences (India)

    Elected: 2005 Section: Animal Sciences ... Specialization: Molecular Genetics of Humans & Animals, Gene Expression, Cancer Genomics and Genomics of Endangered Species ... Biotechnology techniques in Biodiversity conservation

  11. Statement from the 1983 meeting of the International Commission on Radiological Protection: annual limits for intakes (ALI) and derived air concentrations (DAC) for members of the public

    International Nuclear Information System (INIS)

    1983-01-01

    The limitation of the committed effective dose equivalent for members of the public is sufficient to provide compliance over a lifetime with the limit for single organs, thus avoiding non-stochastic effects. Relative values for infants and adults of the committed dose equivalent in a number of tissues per unit intake for each of a few radionuclides have been given: the values for infants are just more than 1 up to 100 times greater than those for adult workers. In each of these cases the appropriate annual dose-equivalent limits recommended by the Commission for members of the public are 10 times less than the corresponding values for workers; the resulting ALI for infants aged six months will be smaller than the values given in ICRP Publication 30 for limiting stochastic effects in workers by factors that range from just more than 10 (for caesium-137) to 1,000 (for ingested plutonium-239). Intermediate factors would apply for older members of the public. The magnitude of the range emphasises the need to consider each situation carefully, with particular reference to children and women. (author)

  12. Hasan Ali Toptaş'ın Kayıp Hayaller Kitabı'nda Büyülü Gerçekçilik In Kayıp Hayaller Kitabı of Hasan Ali Toptaş Megical Realism

    Directory of Open Access Journals (Sweden)

    Oktay YİVLİ

    2013-09-01

    Full Text Available In narrations of magical reality, real and unreal, ordinary andextraordinary, authentic and imaginary elements exist together withoutany conflict. Magical Realism flourishes especially in the twentiethcentury Latin American Literature. This sense results from the struggleof comprehending and narrating new reality as opposed to fantasticfictions and tales. In his novel called Kayıp Hayaller Kitabı, Hasan AliToptaş included the techniques and elements used in the samples ofmagical realism, such as de-familiarization, singularity, indefiniteness,dead people and multiple narrators.As be different fantastic in magical realism fictional people havebeen to become inured to in a world which is together realty and magic,just about accepted it as a natural media. Formal notice of magicalrealism from fantastic is that it selects spaces from realty world notimaginary world.In his novel called Kayıp Hayaller Kitabı, external reality isn’talways reflected one to one. The narration differentiates from classicnarrative structure reality in terms of presentations. Event descriptionsseen, heard and dreamed are presented in an imaginary order. In thenovel, the nature of entities and objects are given as changed Thus ittries to catch to catch another dimension of reality. The people in thenovel doubt from their own realities. What is real, what is not realbecome confused.After all these features, the novel studied should be considered asa magical realistic novel and should be evaluated as use aesthetics ofmagical realism. Büyülü gerçekçi anlatılarda gerçekle gerçek dışı, olağanla olağan olmayan, düşsel ile sahici ögeler aynı dünyanın içinde herhangi bir çatışmaya girmeden yaşarlar. Büyülü gerçekçilik özellikle yirminci yüzyıl Latin Amerikan edebiyatında gelişip serpilmiştir. Bu anlayış fantastikten ve masaldan ayrı olarak yeni gerçekliği kavramanın ve anlatmanın bir çabası olarak ortaya çıkmıştır. Hasan Ali

  13. Collection d'entretiens avec des chercheurs participant à des ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Costa Rica, Guatemala, and Nicaragua). Ritesh Kumar Wetlands International - South Asia (India). Muhammad Shah Alam Khan Bangladesh University of Engineering and Technology (India, Bangladesh, Nepal, and Pakistan). Osvaldo Girardin

  14. Comparison of serum 25-hydroxy vitamin D levels between mothers with small for gestational age and appropriate for gestational age newborns in Kerman.

    Science.gov (United States)

    Mirzaei, Fatemeh; Amiri Moghadam, Tayebeh; Arasteh, Peyman

    2015-04-01

    Vitamin D deficiency during pregnancy is associated with some adverse pregnancy outcomes but its relationship with fetal growth is unknown. We compared the 25-hydroxy vitamin D levels between mothers and their small for gestational age (SGA) newborns with mothers and their appropriate for gestational age (AGA) newborns. The study population included pregnant women that referred to Afzalipour Hospital in Kerman from 2012 to 2013. The case and control group consisted of 40 pregnant mothers with SGA and AGA newborns, respectively. The maternal and infants 25-hydroxy vitamin D levels were measured in the two groups. 25-hydroxy vitamin D deficiency (mothers and infants in both the SGA group and the AGA group was significant. Our study reveals a high prevalence of vitamin D deficiency in women with SGA infants in comparison to women with AGA children. In addition, maternal vitamin D deficiency is associated with its deficiency in newborns.

  15. [Relationship of plasma ghrelin, IGF-1 and insulin with the growth and development of 2 -7 year-old children with small for gestational age at birth].

    Science.gov (United States)

    Cheng, Yaying; Song, Guangyao; Zhou, Lixia; Cai, Baoping; Zhao, Xiumian; Yin, Jianying

    2012-01-01

    To explore the relationship of Ghrelin, insulin-like growth factor-1 (IGF-1) and insulin with the growth and development of 2 -7 year-old children with small for gestational age (SGA) at birth. The levels of ghrelin, IGF-1, IGFBP-3, insulin and glucose were measured in the children with preterm SGA and term SGA and compared with the children with preterm appropriate for gestational age (AGA) and term AGA. The correlation of ghrelin with IGF-1, IGFBP-3 and insulin was analyzed. Plasma ghrelin in preterm SGA was higher than that in term SGA (P 0.05). Plasma ghrelin in preterm AGA and term SGA was higher than that in term AGA (P development of preterm and SGA children, regardless of the magnitude of their catch up growth. As a re-regulatory factor to insulin, ghrelin regulates the energy metabolism in a form of negative feedback.

  16. Effects of different tidal volumes in pulmonary and extrapulmonary lung injury with or without intraabdominal hypertension.

    Science.gov (United States)

    Santos, Cíntia L; Moraes, Lillian; Santos, Raquel S; Oliveira, Mariana G; Silva, Johnatas D; Maron-Gutierrez, Tatiana; Ornellas, Débora S; Morales, Marcelo M; Capelozzi, Vera L; Jamel, Nelson; Pelosi, Paolo; Rocco, Patricia R M; Garcia, Cristiane S N B

    2012-03-01

    We hypothesized that: (1) intraabdominal hypertension increases pulmonary inflammatory and fibrogenic responses in acute lung injury (ALI); (2) in the presence of intraabdominal hypertension, higher tidal volume reduces lung damage in extrapulmonary ALI, but not in pulmonary ALI. Wistar rats were randomly allocated to receive Escherichia coli lipopolysaccharide intratracheally (pulmonary ALI) or intraperitoneally (extrapulmonary ALI). After 24 h, animals were randomized into subgroups without or with intraabdominal hypertension (15 mmHg) and ventilated with positive end expiratory pressure = 5 cmH(2)O and tidal volume of 6 or 10 ml/kg during 1 h. Lung and chest wall mechanics, arterial blood gases, lung and distal organ histology, and interleukin (IL)-1β, IL-6, caspase-3 and type III procollagen (PCIII) mRNA expressions in lung tissue were analyzed. With intraabdominal hypertension, (1) chest-wall static elastance increased, and PCIII, IL-1β, IL-6, and caspase-3 expressions were more pronounced than in animals with normal intraabdominal pressure in both ALI groups; (2) in extrapulmonary ALI, higher tidal volume was associated with decreased atelectasis, and lower IL-6 and caspase-3 expressions; (3) in pulmonary ALI, higher tidal volume led to higher IL-6 expression; and (4) in pulmonary ALI, liver, kidney, and villi cell apoptosis was increased, but not affected by tidal volume. Intraabdominal hypertension increased inflammation and fibrogenesis in the lung independent of ALI etiology. In extrapulmonary ALI associated with intraabdominal hypertension, higher tidal volume improved lung morphometry with lower inflammation in lung tissue. Conversely, in pulmonary ALI associated with intraabdominal hypertension, higher tidal volume increased IL-6 expression.

  17. Androgenic alopecia is associated with less dietary soy, lower [corrected] blood vanadium and rs1160312 1 polymorphism in Taiwanese communities.

    Directory of Open Access Journals (Sweden)

    Ching-Huang Lai

    Full Text Available Although the genetic basis of androgenic alopecia has been clearly established, little is known about its non-genetic causes, such as environmental and lifestyle factors.This study investigated blood and urine heavy metals concentrations, environmental exposure factors, personal behaviors, dietary intakes and the genotypes of related susceptibility genes in patients with androgenic alopecia (AGA.Age, AGA level, residence area, work hours, sleep patterns, cigarette usage, alcohol consumption, betel nut usage, hair treatments, eating habits, body heavy metals concentrations and rs1998076, rs913063, rs1160312 and rs201571 SNP genotype data were collected from 354 men. Logistic regression analysis was performed to examine whether any of the factors displayed odds ratios (ORs indicating association with moderate to severe AGA (≥ IV. Subsequently, Hosmer-Lemeshow, Nagelkerke R(2 and accuracy tests were conducted to help establish an optimal model.Moderate to severe AGA was associated with the AA genotype of rs1160312 (22.50, 95% CI 3.99-126.83, blood vanadium concentration (0.02, 95% CI 0.01-0.04, and regular consumption of soy bean drinks (0.23, 95% CI 0.06-0.85, after adjustment for age. The results were corroborated by the Hosmer-Lemeshow test (P = 0.73, Nagelkerke R(2 (0.59, accuracy test (0.816 and area under the curve (AUC; 0.90, 0.847-0.951 analysis.Blood vanadium and frequent soy bean drink consumption may provide protect effects against AGA. Accordingly, blood vanadium concentrations, the AA genotype of rs1160312 and frequent consumption of soy bean drinks are associated with AGA.

  18. Androgenic alopecia is associated with less dietary soy, lower [corrected] blood vanadium and rs1160312 1 polymorphism in Taiwanese communities.

    Science.gov (United States)

    Lai, Ching-Huang; Chu, Nain-Feng; Chang, Chi-Wen; Wang, Shu-Li; Yang, Hsin-Chou; Chu, Chi-Ming; Chang, Chu-Ting; Lin, Ming-Huang; Chien, Wu-Chien; Su, Sui-Lung; Chou, Yu-Ching; Chen, Kang-Hua; Wang, Wei-Ming; Liou, Saou-Hsing

    2013-01-01

    Although the genetic basis of androgenic alopecia has been clearly established, little is known about its non-genetic causes, such as environmental and lifestyle factors. This study investigated blood and urine heavy metals concentrations, environmental exposure factors, personal behaviors, dietary intakes and the genotypes of related susceptibility genes in patients with androgenic alopecia (AGA). Age, AGA level, residence area, work hours, sleep patterns, cigarette usage, alcohol consumption, betel nut usage, hair treatments, eating habits, body heavy metals concentrations and rs1998076, rs913063, rs1160312 and rs201571 SNP genotype data were collected from 354 men. Logistic regression analysis was performed to examine whether any of the factors displayed odds ratios (ORs) indicating association with moderate to severe AGA (≥ IV). Subsequently, Hosmer-Lemeshow, Nagelkerke R(2) and accuracy tests were conducted to help establish an optimal model. Moderate to severe AGA was associated with the AA genotype of rs1160312 (22.50, 95% CI 3.99-126.83), blood vanadium concentration (0.02, 95% CI 0.01-0.04), and regular consumption of soy bean drinks (0.23, 95% CI 0.06-0.85), after adjustment for age. The results were corroborated by the Hosmer-Lemeshow test (P = 0.73), Nagelkerke R(2) (0.59), accuracy test (0.816) and area under the curve (AUC; 0.90, 0.847-0.951) analysis. Blood vanadium and frequent soy bean drink consumption may provide protect effects against AGA. Accordingly, blood vanadium concentrations, the AA genotype of rs1160312 and frequent consumption of soy bean drinks are associated with AGA.

  19. قَبَسُ الْمَعْرِفَةِ دراسة تحليلية في الموروث الفكري للإمام الحسين (صلوات الله وسلامه عليه

    Directory of Open Access Journals (Sweden)

    سكينة عزيز عباس الفتلي

    2017-09-01

    Full Text Available The stand on the intellectual heritage of the infallible fourteen infallible: Muhammad Ali Fatima, Al_husnan and nine infallible at the heart of Imam Hussein (prayers of Allah and peace be upon them all is his intellectual and cognitive dimensions because the NHL infallibility circle; so I chose inherited intellectual of Imam Hussein (blessings of Allah and peace be upon him to take and learn from the flux cognitive him by standing on the intellectual legacy to him, I have tried very hard to delve in the covenantal thought what you can afford it Vthsalt me interpretive knowledge, and other jurisprudence, so the research is marked: (QBs knowledge: an analytical study inherited intellectual of Imam Hussein, peace and blessings be upon him on the front met the elements provided on according to the scientific method of the importance of research, search label, reasons for choosing the research objectives of the research problem, the research plan, the research methodology, the premise of the research, the area to benefit from it, the limits of research, previous studies , research sources, and a conclusion research, presented after the conclusion pave the guarantee statement Search Title dealt with the meaning of Fezta statement (QBs, knowledge on the level of individuals, namely: the meaning of each word in private, and the additional installation each level (QBs knowledge, meaning the researcher by taking knowledge and her testimony, and learned from Imam Hussein (peace and blessings be upon him, so as to stand on the covenantal intellectual, after the researcher decide that knowledge specifically of science, namely: all knowledge of science, and not all science knowledge, offered after boot two sections, the first section was entitled: knowledge explanatory, and the second section was titled: knowledge of jurisprudence, then seal Balkhatmh search and search results, and recommendations are proposals and affirmed sources and references. It is

  20. Clinical and electrophysiological efficacy of leaf extract of Gingko ...

    African Journals Online (AJOL)

    Ginkgoaceae) in subjects with diabetic sensorimotor polyneuropathy. Ahsan Numan, Faisal Masud, Khadija Irfan Khawaja, Fehmeda Farrukh Khan, Abdul Basit Qureshi, Saira Burney, Kamran Ashraf, Nisar Ahmad, Muhammad Shahbaz Yousaf, ...

  1. Prevalence of resistance to antibiotics according to International Classification of Diseases (ICD-10) in Boo Ali Sina Hospital of Sari, 2011-2012.

    Science.gov (United States)

    Afshar, Parvaneh; Saravi, Benyamin Mohseni; Nehmati, Ebrahim; Farahabbadi, Ebrahim Bagherian; Yazdanian, Azadeh; Siamian, Hasan; Vahedi, Mohammad

    2013-01-01

    One of the issues in health care delivery system is resistance to antibiotics. Many researches were done to show the causes and antibiotics which was resistance. In most researches the methods of classifying and reporting this resistance were made by researcher, so in this research we examined the International Classification of Diseases 10 the edition (ICD-10). This is a descriptive cross section study; data was collected from laboratory of Boo Ali Sina hospital, during 2011-2012. The check list was designed according the aim of study. Variables were age, bacterial agent, specimen, and antibiotics. The bacteria and resistance were classified with ICD-10. The data were analyzed with SPSS (16) soft ware and the descriptive statistics. Results showed that of the 10198 request for culture and antibiogram, there were 1020(10%) resistance. The specimen were 648 (63.5%) urine, blood 127(12.5%), other secretion 125 (12/3%), sputum 102 (10%), lumbar puncture 8 (0/8%), stool 6 (6/0%) and bone marrow 4 (0.4%). The E coli was the most 413 (40.5%) resistance cause to antibiotics which was coded with B96.2 and the most resistance was to multiple antibiotics 885(86.8%) with the U88 code. The results showed that by using the ICD-10 codes, the study of multiple causes and resistance is possible. The routine usage of coding of the ICD-10 would result to an up to date bank of resistance to antibiotics in every hospitals and useful for physicians, other health care, and health administrations.

  2. Evolution and circulation of type-2 vaccine-derived polioviruses in Nad Ali district of Southern Afghanistan during June 2009-February 2011.

    Directory of Open Access Journals (Sweden)

    Salmaan Sharif

    Full Text Available Oral polio vaccine has been used successfully as a powerful tool to control the spread of wild polioviruses throughout the world; however, during replication in under immunized children, some vaccine viruses revert and acquire the neurovirulent phenotypic properties. In this study, we describe the evolution and circulation of Vaccine-Derived Polioviruses (VDPVs in Helmand province of Afghanistan. We investigated 2646 AFP cases of Afghan children from June 2009-February 2011 and isolated 103 (04% vaccine viruses, 45(1.7% wild type polioviruses and six (0.22% type 2 circulating vaccine-derived polioviruses (cVDPVs. These cVDPVs showed 97.7%-98.2% nucleotide and 98%-98.7% amino acid homology in VP1 region on comparison with Sabin type 2 reference strain. All these cVDPVs had two signature mutations of neurovirulent phenotypes and 12 additional mutations in P1 capsid region that might also have contributed to increase neurovirulence and replication. Phylogenetic analysis revealed that all these viruses were closely related and originated from previously reported Sabin like 2 virus from Pakistan which did not conform to the standard definition of VDPVs at that time. It was also observed that initial OPV dose was administered approximately 9 months prior to the collection of first stool specimen of index case. Our findings support that suboptimal surveillance and low routine immunization coverage have contributed to the emergence and spread of these viruses in Afghanistan. We therefore recommend high quality immunization campaigns not only in affected district Nad Ali but also in the bordering areas between Pakistan and Afghanistan to prevent the spread of cVDPVs.

  3. Study of the growth, reproductive biology and abundance for invasive shrimps Palaemon elegans Rathke from Garmat Ali river Basrah, Southern Iraq

    Directory of Open Access Journals (Sweden)

    Khaled Khasaf Al-Khafaji

    2016-07-01

    Full Text Available Objective: To describe the growth, reproductive biology and abundance of the population of invasive shrimps Palaemon elegans (P. elegans in one of the branches of Garmat Ali river at Basrah, Southern Iraq. Methods: Monthly samples of the prawn P. elegans were collected with a bottom hand net (40 cm, 0.5 mm mesh hauled over a distance of 10 m. A simple random sampling was conducted monthly between December 2012 and November 2013. Results: Seasonal changes were observed in the composition of the population of the species during the study year with the highest abundance in 2013 and the lowest abundance for the males was reported in January and for the females occurred in June. Salinity showed a significant correlation with the abundance of shrimps at the sampling site. The largest female measured 67.90 mm while the corresponding value for males was 61.31 mm. The proportion of ovigerous adults rose during spring season to peak on about July and ovigerous prawns were taken in all months of the year. The sex ratio indicated a preponderance of females over males in all months in the study period. Each females produced around 36–1324 eggs and the incubation period lasted for 11–14 days at 17–29 °C. Conclusions: The results of the present study indicate that this species has a wide distribution range, high density, and great reproduction potential. This study reveals the lack of researches on this species in environments of Shatt Al-Arab river and its branches. Thus, P. elegans has most likely formed a permanent population in all the brackish waters in Basrah area.

  4. Topical adenosine increases thick hair ratio in Japanese men with androgenetic alopecia.

    Science.gov (United States)

    Watanabe, Y; Nagashima, T; Hanzawa, N; Ishino, A; Nakazawa, Y; Ogo, M; Iwabuchi, T; Tajima, M

    2015-12-01

    Hair thickness is more important than hair density in the appearance of baldness in male with androgenetic alopecia (AGA). Adenosine improves hair loss by stimulating hair growth and by thickening hair shafts in women. The objective of this study was to evaluate the hair growth efficacy and safety of topical adenosine in men with AGA. A lotion containing either adenosine or niacinamide was administered to the scalps of 102 Japanese men twice daily for 6 months in a double-blind, randomized study. Efficacy was evaluated by dermatologists who assessed the quality of the hair and by calculating the percentages of vellus-like and thick hairs among the vertex hairs, as well as hair density. Adenosine was significantly (P < 0.05) superior to niacinamide in terms of global improvement of AGA, increase in the percentage of thick hairs (at least 60 μm) and self-assessment of hair thickness by the study participants. No causal adverse event due to the adenosine lotion was observed. These data indicate that adenosine increases thick hair ratio in Japanese men with AGA, and this compound is useful for the improvement of AGA. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  5. Differential effect of assisted reproductive technology and small-for-gestational age on fetal cardiac remodeling.

    Science.gov (United States)

    Valenzuela-Alcaraz, B; Crispi, F; Cruz-Lemini, M; Bijnens, B; García-Otero, L; Sitges, M; Balasch, J; Gratacós, E

    2017-07-01

    Fetuses conceived by assisted reproductive technology (ART) and those that are small-for-gestational age (SGA) show cardiovascular remodeling in utero; however, these two conditions are often associated. We aimed to evaluate the differential effect of ART and SGA on fetal cardiac remodeling. This was a prospective cohort study of term singleton pregnancies seen at our department between April 2011 and September 2013. The cohort was divided according to fetal growth and mode of conception into the following four groups: 102 appropriate-for-gestational-age (AGA) fetuses conceived spontaneously (controls), 72 AGA fetuses conceived by ART (ART-AGA), 31 SGA fetuses conceived by ART (ART-SGA) and 28 SGA fetuses conceived naturally (Spont-SGA). SGA was defined as birth weight Fetal echocardiography was performed at 28-32 weeks to assess cardiac dimensions, geometry and function. ART fetuses had dilated atria (mean left atrium-to-heart area ratio: controls, 15 ± 2.7%; ART-AGA, 18 ± 4.1%; Spont-SGA, 14 ± 3.7%) and more globular ventricles (left ventricular sphericity index: controls, 1.77 ± 0.2; ART-AGA, 1.68 ± 0.2; Spont-SGA, 1.72 ± 0.2), with normally sized hearts. In contrast, SGA fetuses had enlarged hearts (cardiothoracic ratio: controls, 24 ± 3%; ART-AGA, 24 ± 4%; Spont-SGA, 29 ± 6%), preserved atrial size, more globular and concentric hypertrophic ventricles (left ventricle relative wall thickness: controls, 0.48 ± 0.17; ART-AGA, 0.54 ± 0.13; Spont-SGA, 0.63 ± 0.23). Both ART and SGA fetuses had decreased longitudinal motion (tricuspid annular ring displacement: controls, 6.5 ± 0.8 mm; ART-AGA, 5.5 ± 0.7 mm; Spont-SGA, 5.9 ± 0.6 mm) and impaired relaxation (left isovolumetric relaxation time: controls, 47.0 ± 7.3 ms; ART-AGA, 50.0 ± 7.9 ms; Spont-SGA, 49.5 ± 9.3 ms). ART-SGA fetuses presented a combination of features from both ART and SGA groups. SGA and conception with ART

  6. Normative interpretations of diversity

    DEFF Research Database (Denmark)

    Lægaard, Sune

    2009-01-01

    Normative interpretations of particular cases consist of normative principles or values coupled with social theoretical accounts of the empirical facts of the case. The article reviews the most prominent normative interpretations of the Muhammad cartoons controversy over the publication of drawings...... of the Prophet Muhammad in the Danish newspaper Jyllands-Posten. The controversy was seen as a case of freedom of expression, toleration, racism, (in)civility and (dis)respect, and the article notes different understandings of these principles and how the application of them to the controversy implied different...... social theoretical accounts of the case. In disagreements between different normative interpretations, appeals are often made to the ‘context', so it is also considered what roles ‘context' might play in debates over normative interpretations...

  7. Sleep apnea leading to Parkinson’s disease – an important association

    Directory of Open Access Journals (Sweden)

    Shafqat MN

    2017-06-01

    Full Text Available Muhammad Nabeel Shafqat,1 Muhammad Aadil,2 Maria Shoaib3 1Department of Medicine, University of Medical Sciences “Serafin Ruiz de Zarate” Villa Clara (UCMVC, Villa Clara, Cuba; 2Department of Psychiatry, Rush University Medical Center, Chicago, IL, USA; 3Department of Medicine, Dow Medical College, Dow University of Health Sciences, Karachi, Pakistan We read with great interest the recently published article “Sleep apnea and the subsequent risk of Parkinson disease: a 3-year nationwide population-based study” by Chou et al.1 The study is a step forward in understanding the underlying pathophysiology of Parkinson’s disease, the authors have deduced sleep apnea as one of the possible risk factors. View the original paper by Chou and colleagues.

  8. 77 FR 35680 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

    Science.gov (United States)

    2012-06-14

    ..., New York, New York 10045-0001: 1. Muhammad Habib, Zurich, Switzerland; to retain a controlling... of Habib American Bank, New York, New York. B. Federal Reserve Bank of Atlanta (Chapelle Davis...

  9. Islamistid kohtupingis: al-Qaidale saabub esimene tõetund / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2009-01-01

    USA-s astub kohtu ette 2001. aasta 11. septembri terrorirünnakute oletatav peakorraldaja Khalid Shaikh Muhammad koos nelja kaasolsalisega. Al-Qaidast alates selle loomisest 1988. aastal, Osama bin Ladenist, Talibanist

  10. Viagens, tremores e conchas: aspectos da natureza da América em escritos de José Bonifácio de Andrada e Silva, José Hipólito Unanúe e Dámaso Antonio Larrañaga

    Directory of Open Access Journals (Sweden)

    Maria Margaret Lopes

    Full Text Available Este artigo apresenta aspectos da produção científica de três ilustrados que atuaram na América do Sul: José Bonifácio de Andrada e Silva (1763-1838, José Hipólito Unanúe (1755-1833 e Dámaso Antonio Larrañaga (1771-1848. Os três naturalistas - de trajetórias, territórios e crenças diferenciadas - construíram suas versões sobre aspectos da natureza da América. Em comum, contribuíram com seus trabalhos científicos para a construção da geohistória americana. Foram escolhidos para análise por critérios de dispersão territorial e por suas diferentes abordagens sobre aspectos específicos das Ciências da Terra - temas que ainda hoje têm merecido menor atenção, mesmo entre os historiadores latino-americanos das ciências. Este artigo argumenta que estes personagens não só construíram seus próprios conhecimentos sobre temperamentos (climas e territórios, como também utilizaram seu conhecimento científico no implemento de ações políticas para os seus respectivos países em conformação.

  11. Cord Blood Ischemia-Modified Albumin Levels in Normal and Intrauterine Growth Restricted Pregnancies

    Directory of Open Access Journals (Sweden)

    Nicoletta Iacovidou

    2008-01-01

    Full Text Available Ischemia-modified albumin (IMA is a sensitive biomarker of cardiac ischemia. Intrauterine growth restriction (IUGR may imply fetal hypoxia, resulting in blood flow centralization in favour of vital organs (brain, heart, adrenals—‘‘brain sparing effect’’. Based on the latter, we hypothesized that cord blood IMA levels should not differ between IUGR and appropriate-for-gestational-age (AGA full-term pregnancies. IMA was measured in blood samples from doubly-clamped umbilical cords of 110 AGA and 57 asymmetric IUGR pregnancies. No significant differences in IMA levels were documented between AGA and IUGR groups. IMA levels were elevated in cases of elective cesarean section (P = .035, and offspring of multigravidas (P = .021. In conclusion, ‘‘brain sparing effect’’ is possibly responsible for the lack of differences in cord blood IMA levels at term, between IUGR and AGA groups. Furthermore, higher oxidative stress could account for the elevated IMA levels in cases of elective cesarean section, and offspring of multigravidas.

  12. Stylistics of “Tarikh i Balami”

    Directory of Open Access Journals (Sweden)

    Ali Mohammadi asiyabadi

    2016-05-01

    beautiful in prose but these techniques can be avoided these days. We may not be able  to comment on the intellectual level by reading this book, because this book is a translated work of Mohammad ibn Jarir al-Tabari. For example, it can be spoken about sentences that he added to the original book after quoting histories. In this case it can be said he has been logical and wise man. There are some instances of this case. For example, he has written after the three narrations About the death of Moses: “ these three narrations are superstitions and it is not appropriate to this book and those possess knowledge do not accept them.” But about the Iranian pre-Islamic stories he has added to the original book like “Bahram i Choobin” story, it can be said that  it was because of his sense of patriotism. Because he has been one of pure Iranian families, the Balamis, he has tried to revive the Persian language and national rites.References1.      Anonymous Aouthor (1939. Mo’jm ol-Tavarikh va al-Qasas. Tehran: Kulali Khavar press.2.      Arabi, MuhammadAli (1994. Translation Glossary Tabari commentary with The equivalent of Quran for Some words, Theses of MA, Mashad: Firdowsi University press.3.      Ashuri, Daryush (2001. Definitions and the concept of culture.Tehran: agah press.4.      Ayati, Abd al-Mohammad et al. (2007. Encyclopedia of Persian Language and Literature, Tehran: Academy of Persian Language and Literature.5.      Bahar, MuhammadTaqi (1991. Stylistics Or on the evolution of Persian prose. Tehran: Amir Kabir press.6.      Balami, Abu Ali Muhammad ibn Muhammad. (2006. Tarikh i Balami. Tehran: Zavvar press.7.      Chagani, Ibrahim (2003. Encyclopedic dictionary of language and languages. Khurram abad: Luristan University.8.      Dihkhuda, AliAkbar (2011. Persian dictionary. Tehran: Dihkhuda Persian

  13. Risk of hearing loss in small for gestational age neonates

    Directory of Open Access Journals (Sweden)

    Melani Rakhmi Mantu

    2011-02-01

    Full Text Available Background Small for gestational age (SGA neonates often have intrauterine growth restriction due to placental insufficiency and chronic hypoxia. These conditions may cause developmental impairment, psychosocial disabilities, or metabolic dysfunction in later life. Previous studies have shown greater incidence of speech and language disabilities, learning impairment, and neuromotor dysfunction in term SGA infants compared to term appropriate for gestational age (AGA infants. Objective To compare hearing loss in SGA and AGA neonates using otoocoustic emission (OAE tests and to study correlations between maternal risk factors and hearing loss in SGA neonates. Methods A cross-sectional study was performed in St. Borromeus Hospital, Limijati Hospital, and Melinda Hospital in Bandung from February to May 2010. Study subjects consisted of full-term neonates born in these three hospitals. A retrospective medical record review was performed for this study. Statistical analysis was done by multivariable logistic-regression. Results There was a total of 4279 subjects in our study, including 100 SGA neonates and 4179 AGA neonates. We observed a greater percentage of OAE 'refer' (indicating abnormal OAE results in the SGA group compared to the AGA group (P<0.001, Z=13.247. For suhjects with OAE 'refer' results, we also analyzed the correlation to the following maternal risk factors: smoking, hypertension, diabetes mellitus and asthma. We also found significant differences between  those with and without each of the four maternal risk factors studied (P< 0.001. By using multivariant analysis to compare SGA and AGA neonates, we found the odds ratio (OR to he 4.34 (95% CI 2.52 to 7.49, P=0.001, meaning the SGA group had a 4.34 times higher risk of hearing loss than the AGA group. Conclusion SGA neonates had a higher risk of hearing loss than AGA neonates. In addition, maternal smoking, hypertension, diabetes mellitus and asthma significantly correlated to

  14. Beyond Hearts and Minds: How The Operational Commander Must Understand Islamic War-Fighting Doctrine to Secure Victory in the Long War

    National Research Council Canada - National Science Library

    Vartanian, James M

    2008-01-01

    This paper examines the need for the operational commander to fully understand the religious, military and political doctrine of Islam's Prophet Muhammad if success is to be realized in the long war...

  15. USA-s tõsteti terroriohtu kolm aastat vana info peale

    Index Scriptorium Estoniae

    2004-01-01

    Al-Qaida arvutieksperdilt Muhammad Naeem Noor Khaanilt, kes tabati Pakistanis, saadi kätte mitmeid dokumente, luureinfot ja skeeme. Enamik infot oli kogutud enne 11. septembril 2001. aastal toimunud terrorirünnakuid

  16. Comparing American Gastroenterological Association Pancreatic Cyst Management Guidelines with Fukuoka Consensus Guidelines as Predictors of Advanced Neoplasia in Patients with Suspected Pancreatic Cystic Neoplasms.

    Science.gov (United States)

    Ma, Gene K; Goldberg, David S; Thiruvengadam, Nikhil; Chandrasekhara, Vinay; Kochman, Michael L; Ginsberg, Gregory G; Vollmer, Charles M; Ahmad, Nuzhat A

    2016-11-01

    In 2015, the American Gastroenterological Association (AGA) published guidelines to provide recommendations for management of suspected pancreatic cystic neoplasms (PCNs). The aim of this study was to compare efficacy of these with the Fukuoka consensus guidelines in predicting advanced neoplasia (AN) in patients with suspected PCNs. We performed a retrospective study of 239 patients who underwent surgical resection for suspected mucinous PCN at a tertiary care center from 2000 to 2014. Surgical pathology was the gold standard. The AGA and Fukuoka criteria were applied, and their performance in predicting AN, defined as invasive cancer or high-grade dysplasia (HGD), was assessed. Advanced neoplasia was found in 71 of 239 (29.7%) patients (28 invasive cancer, 43 HGD). The Fukuoka "high-risk" (FG-HR) and AGA "high-risk" (AGA-HR) criteria identified patients with AN with sensitivities of 28.2% and 35.2%, specificities of 95.8% and 94.0%, positive predictive values of 74.1% and 71.4%, and negative predictive values of 75.9% and 77.5%, respectively. Overall, there was no significant difference between the guidelines for prediction of AN. There were 7 and 6 cases with invasive cancer, and 23 and 24 cases with HGD missed by the FG-HR and AGA-HR guidelines, respectively. In a retrospective analysis, the AGA guidelines are not superior to the Fukuoka guidelines in identifying AN in suspected PCNs. Both sets of guidelines have fair PPV for detection of AN, which would lead to avoidable resections in patients without AN. Additionally, the high-risk features of both guidelines do not accurately identify all patients with AN. Copyright © 2016 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

  17. Carboxyhemoglobin levels in umbilical cord blood of women with pre-eclampsia and intrauterine growth restriction.

    Science.gov (United States)

    Yusuf, Kamran; Kamaluddeen, Majeeda; Wilson, R Douglas; Akierman, Albert

    2012-11-01

    Pre-eclampsia (PE) and intrauterine growth restriction (IUGR) are associated with abnormal placentation. Heme oxygenase (HO) and carbon monoxide (CO) are involved in normal placental development and function and vasomotor control in the placenta. The objective of our study was to measure CO levels, as assessed by carboxyhemoglobin (COHb) levels in the umbilical cord arterial blood of women with PE, normotensive IUGR (<10th percentile for birth weight), and normotensive pregnancies with appropriate-for-gestational age (AGA) infants. We prospectively analyzed COHb levels in the umbilical arterial blood of women with PE, normotensive IUGR, and normotensive AGA pregnancies. Exclusion criteria included cigarette smoke exposure, hemolytic disorders, a positive direct anti-globulin test, chronic hypertension, fever, and any significant medical illness. COHb levels were measured using the ABL 725 blood gas analyzer. There were 41 women in the normotensive AGA group, 42 in the PE group, and 36 in the normotensive IUGR group. Maternal age, mode of delivery, gravidity, parity, and gender of the infants were similar in the three groups. Gestational age and birth weight were significantly higher in the normotensive AGA group compared with the other two groups. COHb levels were significantly lower in the PE group compared with the normotensive AGA group (0.38±0.06% vs. 0.77±0.11%, P<0.05). COHb levels, although lower in the normotensive IUGR group compared with the normotensive AGA group, did not reach statistical significance. Our data suggests the HO-CO system may have a role in the pathogenesis of PE. We also, for the first time, provide information on umbilical arterial COHb levels in normotensive IUGR pregnancies.

  18. Bayero Journal of Pure and Applied Sciences - Vol 10, No 2 (2017)

    African Journals Online (AJOL)

    Spatio-temporal trends of typhoid fever among youths attending Muhammad ... Electrical resistivity investigation of sub- surface topography of Rafin Bareda ... The influence of physicochemical characteristics of a non-edible oil of yellow ...

  19. The Air Liquid-interface, a Skin Microenvironment, Promotes Growth of Melanoma Cells, but not Their Apoptosis and Invasion, through Activation of Mitogen-activated Protein Kinase

    International Nuclear Information System (INIS)

    Hong Yee, Chong; Aoki, Shigehisa; Uchihashi, Kazuyoshi; Matsunobu, Aki; Yamasaki, Fumio; Misago, Noriyuki; Piao, Meihua; Tetsuji, Uemura; Yonemitsu, Nobuhisa; Sugihara, Hajime; Toda, Shuji

    2010-01-01

    The air-liquid interface (ALI) is a common microenvironment of the skin, but it is unknown whether the ALI affects melanoma cell behaviors. Using a collagen gel invasion assay, immunohistochemistry, and Western blots, here we show that melanoma cell proliferation in cultures with an ALI is higher than melanoma cell proliferation in submerged cultures. Bromodeoxyuridine (BrdU) uptake, an indicator of cell proliferation, of melanoma cells at the ALI was about 3 times that of submerged cells, while ALI and submerged melanoma cells had similar levels of single-stranded DNA (a marker of apoptosis). The ALI enhanced the expression of Raf-1, MEK-1 and pERK-1/2 components of the mitogen-activated protein kinase (MAPK) cascade, in cells more than the submerged condition did. The increases in BrdU uptake and pERK-1/2 expression promoted by ALI was abolished by the MEK inhibitor, PD-98059. ALI-treated and submerged melanoma cells did not infiltrate into the collagen gel, and they showed no significant difference in the expression of the invasion- and motility-related molecules, matrix metalloproteinase-1 and -9, laminin 5, and filamin A. Our data indicate that the ALI, a skin microenvironment, accelerates the growth, but not the apoptosis or invasion, of melanoma cells through MAPK activation

  20. Golden Horde History in the Works of A.N. Kurat

    Directory of Open Access Journals (Sweden)

    I.М. Mirgaleev

    2014-07-01

    Full Text Available The article examines main works of the famous Turkish historian A.N. Kurat, his views and assessments of the Golden Horde history. It is known that A.N. Kurat introduced into scholarly circulation yarlyks-letters of the Golden Horde khans, which he found in the archives of the Topkapi Palace in Istanbul. A number of his works and articles are devoted to the Golden Horde and its rulers. The article discusses the works of A.N. Kurat that are dedicated to the Golden Horde, as well as his main ideas, sources of the author. The works of A.N. Kurat still have not lost their significance. His works on the Golden Horde topics are mainly devoted to the source study, his reconstruction of events is based on primary sources of the Golden Horde origin. Kurat also noted the special importance of his own sources. In his works, he explored the following three Golden Horde documents: Bitik of Ulugh Muhammad Murad II, letter of Mahmud Khan bin Muhammad Khan bin Timur Khan to Fatih Sultan Mehmed, and letter of Ahmad Khan ibn Muhammad ibn Timur Khan to Fatih Sultan Mehmed. Kurat studied yarlyks and bitiks at a high scholarly level of source studies. They still are the basis for the study of the Golden Horde documents. Thanks to the good knowledge of the Ottoman, Russian, European sources, and historiography A.N. Kurat analyzed in detail the political situation in the Golden Horde; especially valuable are his works on the 15th century. His works on the period of Ulug Muhammad are still among the most important works devoted to this outstanding personage of the late Golden Horde. In his works Kurat asked himself: why the Golden Horde disintegrated? In search of answers to this question he put to the first place the confrontation between Tokhtamysh Khan and Timur Aksak. His conclusions about relationship between the Golden Horde and the Ottoman Empire are confirmed by the latest works on this topic.

  1. Hydrothermal synthesis, structures and optical properties of A2Zn3(SeO3)4·XH2O (A=Li, Na, K; X=2 or 0)

    Science.gov (United States)

    Liu, Yunsheng; Mei, Dajiang; Xu, Jingli; Wu, Yuandong

    2015-12-01

    New alkali metal zinc selenites, A2Zn3(SeO3)4·XH2O (A=Li, Na, K; X=2 or 0) were prepared through hydrothermal reactions. Li2Zn3(SeO3)4·2H2O (1) crystallizes in the monoclinic space group P21/c with lattice parameters a=8.123(4), b=9.139(4), c=7.938(3) Å, β=112.838(9)°. Na2Zn3(SeO3)4·2H2O (2) crystallizes in the monoclinic space group C2/c with lattice parameters a=15.7940(18), b=6.5744(8), c=14.6787(17) Å, β=107.396(3)°. K2Zn3(SeO3)4 (3) crystallizes in the monoclinic space group C2/c with lattice parameters a=11.3584(12), b=8.6091(9), c=13.6816(14) Å, β=93.456(2)°. The anionic structures are composed of [Zn3O12]18- sheets, chains, and "isolated" units in compound 1, 2, 3, respectively, and trigonal pyramids SeO32-. The compounds were characterized by the solid state UV-vis-NIR diffuse reflectance spectroscopy, infrared spectra and thermogravimetric analysis.

  2. Hindering factors and suggestions related to organ donation decisions: perspective of the Taiwan Ali-Shan Tsou aboriginal tribe.

    Science.gov (United States)

    Chen, A N; Chen, K F; Chang, P C; Shih, F Jong; Chen, C R; Shih, F-Jin; Huang, C-Y

    2014-05-01

    Ali-San Tsou (AST) is one of leading aboriginal tribes in Taiwan with traditional godly beliefs related to life and death. Lacking related knowledge, health professionals (HPs) often failed to help them reach good dying or organ donation (OD). This study aimed to explore hindering factors and suggestions related to OD for good dying from Taiwan AST's own perspective. An explorative qualitative design was employed using a purposive sample of the AST tribes from Taiwan. Data were collected with AST residents by face-to-face interviews and analyzed by content analysis. Thirty AST residents (16 females and 14 males) with ages ranging from 28 to 78 (mean, 54.5) years completed interviews. Of them, 85% reported various diseases. In this study 73% were Catholics and Christians, 17% held traditional godly believes, and 10% had no religious affiliation. Eight hindering factors were reported: (1) limited information about organs and OD; (2) no qualified organs for donation; (3) worry about lack of forgiveness by ancestors; (4) tribe elders who might not accept concept of OD; (5) intact bodies were required at home during spirit-companion rituals; (6) earth burial with intact bodies was preferred; (7) bodies due to accidental and bad death were impermissible for OD; and (8) worry about possession by the donor's spirit. Seven suggestions were also reported for HPs to enhance AST's OD decisions: (1) starting with friendship and a caring relationship; (2) providing spiritual support from reverent religions; (3) stressing good deeds and honoring tribe folks by OD; (4) avoiding accidental/bad death; (5) providing relevant modern medical knowledge of human organs and OD; (6) introducing OD as part of a good-dying care plan; and (7) demonstrating a respectful discussion mindset about OD. Eight hindering factors and 7 types of suggestions for enhancing AST aboriginal people's OD decisions were first explored in this project. In the future, HPs are encouraged to invite AST to share

  3. A double base change in alternate base pairs induced by ultraviolet irradiation in a glycine transfer RNA gene

    International Nuclear Information System (INIS)

    Coleman, R.D.; Dunst, R.W.; Hill, C.W.; Pennsylvania State Univ., Hershey

    1980-01-01

    The glyUsusub(AGA) mutation affects Escherichia coli tRNAsup(Gly)sub(GGG), changing it to an AGA missense suppressor tRNA. Sequence studies have shown that the mutation involves a double base substitution at the first and third positions of the tRNA anticodon, the result being a change in the anticodon from CCC to UCU. A system has been developed to facilitate the detection of this novel mutation, and we have shown that ultraviolet irradiation and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) are effective in causing the double base change. A single observation of the mutation occuring spontaneously has been made also. The frequency of MNNG-induced glyUsusub(AGA) mutations is compatible with their being caused by two separate mutagenic events. The frequency of UV-induced glyUsusub(AGA) mutations, however, strongly suggests that the occurence of one base substitution strongly enhances the chance of finding the second substitution at the alternate position. In addition to the double change in the anticodon, the glyUsusub(AGA) tRNA differs from tRNAsup(gly)sub(GGG) in that it bears a modification of the A adjacent to the 3' position of the anticodon. Most likely, this modified base is N-[9-(β-D-ribofuranosyl)-purin-6-ylcarbamoyl] threonine. (orig.) 891 AJ/orig. 892 BRE [de

  4. Evaluation of hyperandrogenemia and metabolic risk profile in women with postadolescent acne

    Directory of Open Access Journals (Sweden)

    Leyla Baykal Selçuk

    2016-06-01

    Full Text Available Background and Design: Postadolescent acne is a disease with relapses frequently seen in women. Treatment is difficult. In our study, we aimed to investigate the clinical and biochemical characteristics of hyperandrogenism and the prevalence of metabolic disorders, such as metabolic syndrome (MS and dyslipidemia in women with postadolescent acne. Materials and Methods: This study was conducted on 50 women who attended our department with the complaint of postadolescent acne between July 2014 and December 2014. The presence of androgenetic alopecia (AGA, hirsutism, polycystic ovary syndrome (PCOS, MS, dyslipidemia, and obesity was evaluated. Results: Seborrhea was present in 56%, hirsutism in 40%, AGA in 26%, and PCOS in 24% of women with postadolescent acne. The prevalence of MS and dyslipidemia was 24% and 44%, respectively. The prevalence of MS was significantly higher in patients with AGA and hirsutism. There was no association of MS with menstrual irregularity and PCOS. There was no significant association of dyslipidemia with AGA, hirsutism, PCOS, and menstrual irregularity. Conclusion: Clinical symptoms of hyperandrogenism, such as hirsutism, AGA, and PCOS were more common in women with postadolescent acne but androgenic hormone profile abnormalities were minimal. As a result, postadolescent acne resistant to treatment may be considered as an early marker in the early diagnosis of PCOS in women to prevent the development of type 2 diabetes mellitus, MS and hypercholesterolemia.

  5. Conventional and novel stem cell based therapies for androgenic alopecia

    Directory of Open Access Journals (Sweden)

    Talavera-Adame D

    2017-08-01

    Full Text Available Dodanim Talavera-Adame,1 Daniella Newman,2 Nathan Newman1 1American Advanced Medical Corp. (Private Practice, Beverly Hills, CA, 2Western University of Health Sciences, Pomona, CA, USA Abstract: The prevalence of androgenic alopecia (AGA increases with age and it affects both men and women. Patients diagnosed with AGA may experience decreased quality of life, depression, and feel self-conscious. There are a variety of therapeutic options ranging from prescription drugs to non-prescription medications. Currently, AGA involves an annual global market revenue of US$4 billion and a growth rate of 1.8%, indicating a growing consumer market. Although natural and synthetic ingredients can promote hair growth and, therefore, be useful to treat AGA, some of them have important adverse effects and unknown mechanisms of action that limit their use and benefits. Biologic factors that include signaling from stem cells, dermal papilla cells, and platelet-rich plasma are some of the current therapeutic agents being studied for hair restoration with milder side effects. However, most of the mechanisms exerted by these factors in hair restoration are still being researched. In this review, we analyze the therapeutic agents that have been used for AGA and emphasize the potential of new therapies based on advances in stem cell technologies and regenerative medicine. Keywords: stem cells, stem cell therapies, hair follicle, dermal papilla, androgenic alopecia, laser, hair regeneration

  6. 77 FR 60118 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

    Science.gov (United States)

    2012-10-02

    ..., New York, New York 10045-0001: 1. Muhammad Habib, Kusnacht, Switzerland, and Hamza Habib, Dubai, U.A.E..., Switzerland, and thereby indirectly retain control of Habib American Bank, New York, New York. B. Federal...

  7. DOKTRIN WIRAUSAHA ALA RASÛLULLÂH

    Directory of Open Access Journals (Sweden)

    Farid Firmansyah

    2013-09-01

    Full Text Available Indonesia face the challenge of economy globalization era that isfree trade system that has been agreed by the world. Tradesystem and free-opened investment becomes globalcommitment signed by agreement of GATT (General Agreementon Tariffs and Trade and the form of world trade organization,WTO. Indonesia must be able to prepare human resource to facethis global challenge. Indonesian government needs younggeneration that has competitive advantage. It means that theyare ready to do business by following the model of a truebusinessman figure, our prophet Muhammad saw. It is hopedthat young Indonesians can develop the Indonesian economy byapplying business management that had been applied by theprophet Muhammad saw. It has been proved that hismanagement principle that he did was accurate and reliable thatmade his business form always get profit and never loss.

  8. ISLAM IN THE NON-MUSLIM AREAS OF NORTHERN NIGERIA, c

    African Journals Online (AJOL)

    QUADRI Y A

    On that ground, Prophet Muhammad ... processes on issues that can be proven practically. .... itself par excellence, even though human perceptual faculties, operating within .... In this figure (Figure 1), letters A-Z represent different objects of.

  9. Aga miks mitte panustada teraviljale? / Tarvo Vaarmets

    Index Scriptorium Estoniae

    Vaarmets, Tarvo

    2007-01-01

    Üha populaarsust koguvate ETFide ehk börsil kaubeldavate fondide hulka on lisandunud ka viimaste variatsioonid ETCd ehk börsil kaubeldavad toorained, nende perspektiivikust tõstab tarbimise kasv maailmas. Tabel: Millistel börsidel tehakse tehinguid ETF-idega

  10. Pension tõuseb - aga edasi? / Eiki Nestor

    Index Scriptorium Estoniae

    Nestor, Eiki, 1953-

    2008-01-01

    Pensionide uuest indekseerimise korrast. Ilmunud ka Nädaline 20. märts 2008, lk. 4 ; Valgamaalane 20. märts 2008, lk. 2 ; LõunaLeht 20. märts 2008, lk. 4 ; Põhjarannik 20. märts 2008, lk. 4 ; Võrumaa Teataja 25. märts 2008, lk. 2 ; Vali Uudised 26. märts 2008, lk. 2 ; Sõnumitooja 26. märts 2008, lk. 6 ; Meie Maa 25. märts 2008, lk. 2 ; Lääne Elu 25. märts 2008, lk. 2 ; Kuulutaja 28. märts 2008, lk. 4 ; Türi Rahvaleht 28. märts 2008, lk. 4 ; Oma Saar 28. märts 2008, lk. 5 ; Vooremaa 22. märts 2008, lk. 2 ; Pärnu Postimees 27. märts 2008, lk. 15 ; Narva Postiljon 5. aprill 2008, lk. 2 ; Videvik 3. aprill 2008, lk. 2 ; Virumaa Teataja 8. aprill 2008, lk. 11 ; Nädalaleht 20. märts 2008, lk. 5

  11. Lack of concordance and linkage disequilibrium among brothers for androgenetic alopecia and CAG/GGC haplotypes of the androgen receptor gene in Mexican families.

    Science.gov (United States)

    Arteaga-Vázquez, Jazmín; López-Hernández, María A; Svyryd, Yevgeniya; Mutchinick, Osvaldo M

    2015-12-01

    Androgenetic alopecia (AGA) or common baldness is the most prevalent form of hair loss in males. Familial predisposition has been recognized, and heritability estimated in monozygotic twins suggests an important genetic predisposition. Several studies indicate that the numbers of CAG/GGC repeats in exon 1 of the androgen receptor gene (AR) maybe associated with AGA susceptibility. To investigate a possible correlation between AR CAG/GGC haplotypes and the presence or not of alopecia in sibships with two or more brothers among them at least one of them has AGA. Thirty-two trios including an alopecic man, one brother alopecic or not, and their mother were enrolled. Sanger sequencing of the exon 1 of the AR gene was conducted to ascertain the number of CAG/GGC repeats in each individual. Heterozygous mother for the CAG/GGC haplotypes was an inclusion criterion to analyze the segregation haplotype patterns in the family. Concordance for the number of repeats and AGA among brothers was evaluated using kappa coefficient and the probability of association in the presence of genetic linkage between CAG and GGC repeats and AGA estimated by means of the family-based association test (FBAT). The median for the CAG and GGC repeats in the AR is similar to that reported in other populations. The CAG/GGC haplotypes were less polymorphic than that reported in other studies, especially due to the GGC number of repeats found. Kappa coefficient resulted in a concordance of 37.3% (IC 95%, 5.0-69.0%) for the AGA phenotype and identical CAG/GGC haplotypes. There was no evidence of linkage disequilibrium. Our results do not confirm a possible correlation or linkage disequilibrium between the CAG/GGC haplotypes of the AR gene and androgenetic alopecia in Mexican brothers. © 2015 Wiley Periodicals, Inc.

  12. Aminoglycoside antibiotics as a tool for the study of the biological role of calcium ions. Historical overview.

    Science.gov (United States)

    Corrado, A P; de Morais, I P; Prado, W A

    1989-01-01

    Beginning with the pioneering work of Vital-Brazil and Corrado (1957), which suggested a possible interaction between aminoglycoside antibiotics (AGA) and calcium ions at the neuromuscular junction, the authors review the studies that demonstrated the existence of a competitive antagonism between AGA and calcium ions. In view of the low liposolubility of AGA and their inability to cross biological membranes, this antagonism seems to occur exclusively at calcium-binding sites at the level of the outer opening of calcium channels of the N-subtype, which are also the sites of interaction of omega-conotoxin. Being highly water soluble, AGA are easily removed from their binding sites with a consequent rapid reversal of their effects, a factor of primary importance to explain their wide use as tools in the pharmacological analysis of the study of the biological role of calcium ion on the membrane's outer surface. This use has advantages over the use of inorganic di- and trivalent cations such as Mg2+, Mn2+, Cd2+, Ni2+, La3+, etc., since the latter, though they are considered to be the most specific competitive antagonists of calcium ions, may induce biphasic effects due to their ability to cross the membranes and replace calcium and/or increase intracellular calcium concentration. The performance of AGA is also superior when compared with the so-called "specific" organic calcium antagonists--verapamil and nifedipine derivatives--since the latter, in addition to inducing possible biphasic effects, antagonize calcium in a non-competitive manner. Finally, the authors remark that AGA-Ca2+ antagonism relevance is not limited only to basic aspects and that it may have therapeutic implications since it provides alternatives for reducing the toxic adverse effects of this important group of antibiotics.

  13. American Gastroenterological Association guidelines are inaccurate in detecting pancreatic cysts with advanced neoplasia: a clinicopathologic study of 225 patients with supporting molecular data.

    Science.gov (United States)

    Singhi, Aatur D; Zeh, Herbert J; Brand, Randall E; Nikiforova, Marina N; Chennat, Jennifer S; Fasanella, Kenneth E; Khalid, Asif; Papachristou, Georgios I; Slivka, Adam; Hogg, Melissa; Lee, Kenneth K; Tsung, Allan; Zureikat, Amer H; McGrath, Kevin

    2016-06-01

    The American Gastroenterological Association (AGA) recently reported evidence-based guidelines for the management of asymptomatic neoplastic pancreatic cysts. These guidelines advocate a higher threshold for surgical resection than prior guidelines and imaging surveillance for a considerable number of patients with pancreatic cysts. The aims of this study were to assess the accuracy of the AGA guidelines in detecting advanced neoplasia and present an alternative approach to pancreatic cysts. The study population consisted of 225 patients who underwent EUS-guided FNA for pancreatic cysts between January 2014 and May 2015. For each patient, clinical findings, EUS features, cytopathology results, carcinoembryonic antigen analysis, and molecular testing of pancreatic cyst fluid were reviewed. Molecular testing included the assessment of hotspot mutations and deletions for KRAS, GNAS, VHL, TP53, PIK3CA, and PTEN. Diagnostic pathology results were available for 41 patients (18%), with 13 (6%) harboring advanced neoplasia. Among these cases, the AGA guidelines identified advanced neoplasia with 62% sensitivity, 79% specificity, 57% positive predictive value, and 82% negative predictive value. Moreover, the AGA guidelines missed 45% of intraductal papillary mucinous neoplasms with adenocarcinoma or high-grade dysplasia. For cases without confirmatory pathology, 27 of 184 patients (15%) with serous cystadenomas (SCAs) based on EUS findings and/or VHL alterations would continue magnetic resonance imaging (MRI) surveillance. In comparison, a novel algorithmic pathway using molecular testing of pancreatic cyst fluid detected advanced neoplasias with 100% sensitivity, 90% specificity, 79% positive predictive value, and 100% negative predictive value. The AGA guidelines were inaccurate in detecting pancreatic cysts with advanced neoplasia. Furthermore, because the AGA guidelines manage all neoplastic cysts similarly, patients with SCAs will continue to undergo unnecessary MRI

  14. Nazariyat Ibnu Bajah ‘an al-Nafs

    Directory of Open Access Journals (Sweden)

    Rif’at Husnul Ma’afi

    2016-03-01

    Full Text Available The soul is one of the central issues focused on by prominent Muslim philosophers due to its crucial role in constructing thoughts, acts, and human behaviour. One of these eminent philosopher was Abu Bakr Muhammad bin Yahya bin Bajah or who is more commonly known as Ibnu Bajah. Although he discussed the soul at great length, he did not explicitly define what it is, such as what other philosophers had tried to do. However, Ibnu Bajah expressed what is known about the soul by the improvements of al-Jism al-‘Ali (the Automatic Body, which has 4 kinds of strengths: to consume, to sense, to move, and to talk. Man with these in one word herit strengths are able to direct his body to grow and live in order to fulfill his physical needs, and at the same time pursue and attain information, knowledge, and understanding. It is important to acknowledge that the human mind reaches its perfection with the aid of rational knowledge. The rational knowledge enables them to understand the matter essentially, and when man may attain ultimate happiness. Therefore human perfection is the combination and interrelation between the active mind and rational view working together. This correlation will be attained gradually, with knowledge representing rational objects from material objects, then transcending it to relate with the active mind. Human knowledge then begins from the sense of representation of the object physically, abstracting its representation by the power of imagination, interpreting the meaning in the mind from the senses. Thus if will deliver humans to the right knowledge of himself and the active mind.

  15. Antioxidant benzophenones and xanthones from the root bark of ...

    African Journals Online (AJOL)

    Antioxidant benzophenones and xanthones from the root bark of Garcinia smeathmannii. Alain Meli Lannang, Justin Komguem, Fernande Ngounou Ngninzeko, Jean Gustave Tangmouo, David Lontsi, Asma Ajaz, Muhammad Iqbal Choudhary, Beiban Luc Sondengam, Atta -ur-Rahman ...

  16. Lean body mass in small for gestational age and appropriate for gestational age infants

    International Nuclear Information System (INIS)

    Petersen, S.; Gotfredsen, A.; Knudsen, F.U.

    1988-01-01

    Dual photon absorptiometry using 153 Gd in a whole-body scanner was used to measure lean body mass (LBM) in 51 newborn infants. LBM% decreased exponentially with increasing gestational age in both small for gestational age (SGA) and appropriate for gestational age (AGA) infants. In preterm SGA and AGA infants LBM was 104% and 103%, respectively, indicating that no fat was detectable. In term SGA infants LBM was 98%, which corresponded to 48 gm fat on average, and in term AGA infants LBM was 87%, which corresponded to 452 gm fat on average. The LBM%, ponderal index, and skinfold thickness were significantly different between AGA and SGA infants. Infants with clinical signs of intrauterine wastage had significantly higher LBM% than did infants without signs of weight loss. Our results on LBM% by dual photon absorptiometry agree with earlier dissection data; the clinically applicable methods of (1) height combined with weight (i.e., ponderal index), (2) skinfold thickness, and (3) scoring by clinical observations are useful for the estimation of lack of fat as an indicator of intrauterine growth retardation

  17. Genetics and other factors in the aetiology of female pattern hair loss.

    Science.gov (United States)

    Redler, Silke; Messenger, Andrew G; Betz, Regina C

    2017-06-01

    Pattern hair loss is the most common form of hair loss in both women and men. Male pattern hair loss, also termed male androgenetic alopecia (M-AGA), is an androgen-dependent trait that is predominantly genetically determined. Androgen-mediated mechanisms are probably involved in female pattern hair loss (FPHL) in some women but the evidence is less strong than in M-AGA; other non-androgenic pathways, including environmental influences, may contribute to the aetiology. Genome-wide association studies have identified several genetic loci for M-AGA and have provided better insight into the underlying biology. However, the role of heritable factors in Female Pattern Hair Loss (FPHL) is largely unknown. Recently published studies have been restricted to candidate gene approaches and could not clearly identify any susceptibility locus/gene for FPHL but suggest that the aetiology differs substantially from that of M-AGA. Hypotheses about possible pathomechanisms of FPHL as well as the results of the genetic studies performed to date are summarized. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Evaluation of the relationship between androgenetic alopecia and demodex infestation

    Directory of Open Access Journals (Sweden)

    Zari Javidi

    2008-01-01

    Full Text Available Introduction: Androgenetic alopecia (AGA is one of the most common dermatologic disorders with a multifactorial etiology. Inflammatory activators such as Demodex infestation may play a role in the pathogenesis of some cases of androgenetic alopecia that do not respond to common treatments such as minoxidil and finasteride. The goal of this study is to evaluate the relationship between Demodex infestation and AGA. Materials and Methods: In this case-control study, 41 patients with AGA referred to the Dermatology Clinic of Imam Reza Hospital and 33 healthy individuals were evaluated as control. All of them were between 20 and 40 years old men. In order to identify Demodex infestation they were referred to the Parasitology laboratory. Results: Demodex was detected in 19.5% of patients and 15.2% of controls; therefore, there was no significant relationship between them statistically ( P = 0.0787. Most of patients (85.4% had greasy hair. The most common pattern of baldness was II degree in Hamilton scale. Conclusion: There is no relation between AGA and Demodex.

  19. X-ray induction of immortalization in primary rat embryo cells associated with and without tumorigenicity

    International Nuclear Information System (INIS)

    Sierra, E.; Oberley, L.W.; Guernsey, D.L.

    1985-01-01

    Cultures of primary rat embryo fibroblasts were irradiated with X-rays (3 Gy). After 14 days the majority of colonies in both irradiated and control plates had senesced. Surviving clones were ring isolated from irradiated and control plates and grown in culture. A phase of rapid proliferation after isolation was observed, followed by a decline (crisis) leading to senescence. Several clones from the irradiated plates were able to recover from this crisis and gave rise to continuous cell lines, while all colonies from control plates senesced. Three types of cells have been identified among the irradiated survivors: (1) immortal fully transformed, capable of growth in soft agar (Aga/sup +/) and tumor formation, (2) immortal normal, not able to grow in soft agar (Aga/sup -/) and nontumorigenic, and (3) immortal Aga/sup -/ cells which progressed to malignancy (Aga/sup +/, tumorigenicity) after further sub-culture. These data support the suggestion that X-rays can induce immortalization of mammalian cells in the absence of tumorigenicity, in addition to (and separate from) the fully tumorigenetic state

  20. Inflammatory markers in umbilical cord blood from small-for-gestational-age newborns

    DEFF Research Database (Denmark)

    Lausten-Thomsen, Ulrik; Olsen, Marianne; Greisen, Gorm

    2014-01-01

    This study investigates the role of inflammation in intrauterine growth retardation by exploring the levels of inflammatory markers in umbilical cord blood from neonates who were born small-for-gestational-age (SGA) and comparing them to neonates who were born appropriate-for-gestational-age (AGA...... of elevated inflammatory markers in the cord blood from SGA infants compared to AGA infants, and consequently the results suggest an inflammatory component in intrauterine growth restriction (IUGR).......This study investigates the role of inflammation in intrauterine growth retardation by exploring the levels of inflammatory markers in umbilical cord blood from neonates who were born small-for-gestational-age (SGA) and comparing them to neonates who were born appropriate-for-gestational-age (AGA...

  1. CSC9000T A Toll Bell to "Sweat Shops"

    Institute of Scientific and Technical Information of China (English)

    Feng Yuan

    2007-01-01

    @@ CRS:A New Requirement for All "We cannot simply consider doing business is making more money, that's a humiliation to human being." So said Muhammad Yunus, founder of Grameen Bank and who received Nobel Peace Prize 2006.

  2. Download this PDF file

    African Journals Online (AJOL)

    BRIAN

    and simulation game. These key ... continue the dynamics generated by the FFS process: to build local institutions to ..... action at group and community levels; and incorporate bottom-up and interactive ... Hein, B and Muhammad, A.I (2007).

  3. Response of a Promiscuous Soybean Cultivar to Rhizobial ...

    African Journals Online (AJOL)

    acer

    Phosphorus in Nigeria's Southern Guinea Savanna Alfisol. A. Muhammad ... in the Guinea savanna (Carsky et al., 1996 and Yusuf et al., .... difference (P>0.05) in number of nodules .... balance in the northern Guinea savanna of. Nigeria.

  4. Efficacy of a cosmetic phyto-caffeine shampoo in female androgenetic alopecia.

    Science.gov (United States)

    Bussoletti, Carolina; Tolaini, Maria V; Celleno, Leonardo

    2018-03-06

    Androgenetic alopecia (AGA) is the most common type of hair loss in both males as well as females, occurring in up to 57% of women by the age of 80 years. Androgenetic alopecia is associated with a high psychological burden and often results in substantially reduced quality of life, poor body image and low self-esteem, particularly in women. Caffeine-based products have shown promise, both in vitro and in vivo, as potential treatments for AGA. This study was performed to determine the efficacy of a phyto-caffeine- containing shampoo used over a 6-month period in female subjects with AGA. This was a single-centre, double-blind parallel trial in which female subjects with AGA were randomized to either a phyto-caffeine-containing shampoo or a control shampoo. The primary endpoint was the change from baseline in the number of hairs pulled in a hair pull test at 6 months. Hair loss intensity, hair strength, subject satisfaction and tolerability were also assessed. Subjects using the phyto-caffeine-containing shampoo had significantly fewer hairs pulled in a hair pull test at 6 months, compared with subjects using the control shampoo (-3.1 vs -0.5 hairs; pshampoo, compared with controls. Both products were very well tolerated. Compared with a control shampoo, a phyto-caffeine-containing shampoo was more efficacious, with respect to the number of hairs being pulled out at 6 months, hair loss intensity and hair strength in subjects with AGA.

  5. Quantitative Shear-Wave Elastography of the Liver in Preterm Neonates with Intra-Uterine Growth Restriction.

    Directory of Open Access Journals (Sweden)

    Marianne Alison

    Full Text Available The feasibility and reproducibility of liver stiffness measurements using Supersonic Shear-wave Imaging (SSI in preterm neonate have not been reported. Our aim was to determine if liver stiffness differs between intra-uterine growth restriction (IUGR and appropriate for gestational age (AGA preterm infants with/without cholestasis. We measured liver stiffness (in kPa in 45 AGA and 18 IUGR preterm infants, and assessed reproducibility in 26 preterms using Intraclass Correlation Coefficients (ICC and Bland-Altman tests. Liver stiffness values were compared between AGA and IUGR with and without cholestasis and correlated with birth weight. Measurements showed high reproducibility (ICC = 0.94-0.98 for intra-operator, 0.86 for inter-operator with good agreement (95% limits: -1.24 to 1.24 kPa. During the first postnatal week, liver stiffness was higher in IUGR (7.50 ±1.53 kPa than in AGA infants (5.11 ±0.80 kPa, p<0.001. After day 8, liver stiffness remained unchanged in AGA but increased progressively in IUGR infants (15.57 ±6.49 kPa after day 21. Liver stiffness was higher in IUGR neonates with cholestasis (19.35 ± 9.80 kPa than without cholestasis (7.72 ± 1.27 kPa, p<0.001. In conclusion, quantitative liver SSI in preterms is feasible and reproducible. IUGR preterms who will develop cholestasis present high liver stiffness even at birth, before biological cholestasis occurs.

  6. Overweight and Obesity Based on Four Reference Systems in 18,382 Paediatric Patients with Type 1 Diabetes from Germany and Austria

    Directory of Open Access Journals (Sweden)

    M. Flechtner-Mors

    2015-01-01

    Full Text Available Aim. To evaluate the prevalence of overweight and obesity in paediatric type 1 diabetes (T1D subjects, based on four commonly used reference populations. Methods. Using WHO, IOTF, AGA (German pediatric obesity, and KiGGS (German Health Interview and Examination Survey for Children and Adolescents reference populations, prevalence of overweight (≥90th percentile and obesity (≥97th percentile and time trend between 2000 (n = 9,461 and 2013 (n = 18,382 were determined in 2–18-year-old T1D patients documented in the German/Austrian DPV database. Results. In 2000, the overweight prevalence was the highest according to IOTF (22.3%, followed by WHO (20.8%, AGA (15.5%, and KiGGS (9.4%. The respective rates in 2013 were IOTF (24.8%, WHO (22.9%, AGA (18.2%, and KiGGS (11.7%. Obesity prevalence in 2000 was the highest according to WHO (7.9%, followed by AGA (4.5%, IOTF (3.1%, and KiGGS (1.8%. In 2013, the respective rates were WHO (9.6%, AGA (6.2%, IOTF (4.5%, and KiGGS (2.6%. Overall, the prevalence of overweight and obesity increased from 2000 to 2006 (p < 0.001 but showed stabilization thereafter in girls and overweight in boys. Conclusion. Overweight and obesity prevalence in T1D subjects differs significantly if it is assessed by four separate reference populations. More detailed assessment of each child is required to determine obesity-related risks.

  7. A Comparison of the Hormonal Profile of Early Androgenetic Alopecia in Men With the Phenotypic Equivalent of Polycystic Ovarian Syndrome in Women.

    Science.gov (United States)

    Sanke, Sarita; Chander, Ram; Jain, Anju; Garg, Taru; Yadav, Pravesh

    2016-09-01

    Early androgenetic alopecia (AGA) is patterned hair loss occurring before age 30 years. Early AGA in men is frequently reported as the phenotypic equivalent of polycystic ovarian syndrome (PCOS) in women, which carries the risk of developing obesity, metabolic syndrome, and cardiovascular diseases. Very few studies have been conducted to evaluate this. To study the hormonal profile of men with early AGA and to evaluate if early AGA in men can be considered as the phenotypic equivalent of PCOS, the associated risks of which are well known. This case-control study was conducted from January 1, 2014, to March 31, 2015, in a tertiary care government hospital. Fifty-seven men aged 19 to 30 years presenting with patterned hair loss were recruited as study participants. Thirty-two age-matched men with no evidence of hair loss were recruited as controls. Men who had any established endocrine disorder, diabetes mellitus, or cardiovascular disease and those who took any oral medication or hormonal treatment for hair loss were excluded from the study. The serum concentrations of total testosterone, sex hormone-binding globulin (SHBG), dehydroepiandrosterone sulfate (DHEAS), luteinizing hormone (LH), follicle-stimulating hormone (FSH), prolactin, fasting plasma glucose, and insulin levels were measured. Insulin resistance (IR) and free androgen index (FAI) were calculated and compared with age- and sex-matched controls. The primary outcome was to measure the clinico-endocrinological profiles (LH, FSH, SHBG, DHEAS, and testosterone levels) of men with early AGA and to compare it with the PCOS profile; the secondary outcome was to establish a relationship between this endocrinological profile and IR. Compared with the 32 controls, the 57 participants with AGA showed significantly increased mean (SD) levels of testosterone (24.61 [7.97] vs 20.57 [4.9] nmol/L; P = .04), DHEAS (3.63 [2.19] vs 2.64 [1.49] µg/mL; P = .02), LH (7.78 [3.19] vs 4.56 [2.01] mIU/mL; P PCOS. The

  8. TRUTH AS DETERMINANT OF RELIGIOUS FAITH

    African Journals Online (AJOL)

    Admin

    engendered by either the myths of the religion or the historical personages. The truth we intend to .... personage and source of Islamic religion was an orphan boy Muhammad, born ... The Fundamental Truth about Some Religions of the World.

  9. Correlation between spinal column length and the spread of ...

    African Journals Online (AJOL)

    Correlation between spinal column length and the spread of subarachnoid hyperbaric bupivacaine in the term parturient. W.M Wan Rahiza, A.R Raha, A Muhd, M.N Nadia, M Muhammad, Z Azmil, I Azarinah, M.Z Jaafar ...

  10. Research Article Special Issue

    African Journals Online (AJOL)

    2018-02-01

    Feb 1, 2018 ... FOR SPEAKER ADAPTATION USING DYNAMIC TIME WARPING ... length in time series segments based on formant frequency frame ..... [3] N. W. Arshad, S. M. Sukri, L. N. Muhammad, H. Ahmad, R. Hamid, F. Naim, and N.

  11. Association between insertion/deletion polymorphism in angiotensin-converting enzyme gene and acute lung injury/acute respiratory distress syndrome: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Matsuda Akihisa

    2012-08-01

    Full Text Available Abstract Background A previous meta-analysis reported a positive association between an insertion/deletion (I/D polymorphism in the angiotensin-converting enzyme gene (ACE and the risk of acute lung injury (ALI/acute respiratory distress syndrome (ARDS. Here, we updated this meta-analysis and additionally assessed the association of this polymorphism with ALI/ARDS mortality. Methods We searched electronic databases through October 2011 for the terms “angiotensin-converting enzyme gene”, “acute lung injury”, and “acute respiratory distress syndrome,” and reviewed all studies that reported the relationship of the I/D polymorphism in ACE with ALI/ARDS in humans. Seven studies met the inclusion criteria, comprising 532 ALI/ARDS patients, 3032 healthy controls, and 1432 patients without ALI/ARDS. We used three genetic models: the allele, dominant, and recessive models. Results The ACE I/D polymorphism was not associated with susceptibility to ALI/ARDS for any genetic model. However, the ACE I/D polymorphism was associated with the mortality risk of ALI/ARDS in Asian subjects ( Pallele Pdominant = 0.001, Precessive = 0.002. This finding remained significant after correction for multiple comparisons. Conclusions There is a possible association between the ACE I/D polymorphism genotype and the mortality risk of ALI/ARDS in Asians.

  12. Rule base system for identification of patients with specific critical care syndromes: The "sniffer" for acute lung injury.

    Science.gov (United States)

    Herasevich, V; Yilmaz, M; Khan, H; Chute, C G; Gajic, O

    2007-10-11

    Early detection of specific critical care syndromes, such as sepsis or acute lung injury (ALI)is essential for timely implementation of evidence based therapies. Using a near-real time copy of the electronic medical records ("ICU data mart") we developed and validated custom electronic alert (ALI"sniffer") in a cohort of 485 critically ill medical patients. Compared with the gold standard of prospective screening, ALI "sniffer" demonstrated good sensitivity, 93% (95% CI 90 to 95) and specificity, 90% (95% CI 87 to 92). It is not known if the bedside implementation of ALI "sniffer" will improve the adherence to evidence-based therapies and outcome of patients with ALI.

  13. Hypospadias in a German Shepherd dog | Muhammad | Nigerian ...

    African Journals Online (AJOL)

    Nigerian Veterinary Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 38, No 1 (2017) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected should load ...

  14. Metodologi Fatwa K.H. Muhammad Syaf’i Hadzami

    Directory of Open Access Journals (Sweden)

    Muhammad Ardiansyah

    2018-01-01

    Full Text Available Fatwa is one of the heavy mandates on the shoulders of Moslem scholars. There are some conditions that must be fulflled before the fatwa could be used to solve the problems of the people. Basically, the fatwa replaces the task of the Prophet in conveying the shari’a law, then the scholars did not dare to be reckless in declaring any fatwa. Therefore, being a mufti is not only required by reading the translation of al-Qur’an or Hadith, or by searching on the google, or by copying broadcasts in social media. According to al-Shirazi, the intellectual condition that must be required to be a mufti is deep understanding toward al-Qur’an and Hadith, also understanding sources of speech such as ḥaqîqah-majâz, ‘âmm-khâṣṣ, Arabic language, nâsikh-mansûkh, ijmâ’, ikhtilaf, and tartîb al-adillah. While the moral requirements to be a mufti according to Imam Ahmad bin Hanbal are having pure intention, having broad knowledge, patience, and soul, having strong mentality to fulfl the task, having suffciency of life to avoid being influenced by others, and understanding the condition of society. This paper attempts to examine the fatwas of a mufti from Betawi who had lived in the modern era known as Mu’allim Syaf’i Hadzami. The fatwas were collected in a work entitled Tawḍîḥ al-Adillah. In this article, the author has concluded that Mu’allim uses eight complementary and relevant fatwa methodologies to solve today’s problems

  15. Interview with Muhammad Affan Othman on Small Changes

    OpenAIRE

    Vahid Nimehchisalem

    2017-01-01

    Small Changes, a community organization in Malaysia (www.smallchangesmy.org), was founded in 2011 to raise funds and provide support for underprivileged individuals in the community. With an interesting tagline of Cultivating Volunteerism, Empowering Generations this community organizations has raised hundreds of thousands and has attracted tens of Malaysian students from local and overseas universities. The team consists of an enthusiastic group of young Malaysians who believe that it is pos...

  16. Husein Muhammad antara Feminis Islam dan Feminis Liberal

    Directory of Open Access Journals (Sweden)

    Susanti Susanti

    2015-10-01

    Full Text Available This article focuses on the discussion about Hussein Muhammad’s thought related to the empowerment of women. Hussein is aware of the oppression in interpretation related to understanding about women. Husein is also fully aware of the role of religion and religious experts in such oppression and subordination against women. According to Hussein, women and men are equal before God as His servants. There is no such superiority among them before God except by their piety. It implies that the assumption which sees women as “the complementary creature” and places them only in domestic sphere is not true. Women also have their contribution to khilâfah on earth and they also have the same duty to commanding the good and forbidding the evil. Women can freely determine which path to choose, either to become merely a housewife or to be a career woman to earn a living. This is because every woman has different economic situation. Therefore, it is permissible for women to work to gain wealth for the sake of her life and her family.

  17. Molecular dynamics of a proguanil derivative | Muhammad | Bayero ...

    African Journals Online (AJOL)

    ... ab-initio Quantum chemical calculations at the Restricted Hatree-Fock (RHF) ... and 6-31++G basis sets were carried out for inclusion of electron correlation. ... The dipole moment of the Proguanil's derivative at both levels of theory is ... Keywords: Proguanil, Density Functional Theory, Restricted Hartree Fock, Gaussian ...

  18. Euroopa netomaksjad tallavad Lissaboni sihil / Krister Paris

    Index Scriptorium Estoniae

    Paris, Krister, 1977-

    2005-01-01

    Kuus EL-i nn. netomaksjat on seisukohal, et EL-i ühiste kulutuste määr ei tohiks ületada 1% SKT-st. Euroopa Komisjon ja Euroopa Parlament aga leiavad, et rahaeraldised peavad olema suuremad, muidu satub ohtu ühiste eesmärkide saavutamine. Graafik: Eelarve järjest kahanenud. Vt. samas: Rohkem Euroopat, aga vähem raha selle jaoks?

  19. The Sclerotic Scatter Limbal Arc Is More Easily Elicited under Mesopic Rather Than Photopic Conditions.

    Directory of Open Access Journals (Sweden)

    Eric Denion

    Full Text Available We aimed to determine the limbal lighting illuminance thresholds (LLITs required to trigger perception of sclerotic scatter at the opposite non-illuminated limbus (i.e. perception of a light limbal scleral arc under different levels of ambient lighting illuminance (ALI.Twenty healthy volunteers were enrolled. The iris shade (light or dark was graded by retrieving the median value of the pixels of a pre-determined zone of a gray-level iris photograph. Mean keratometry and central corneal pachymetry were recorded. Each subject was asked to lie down, and the ALI at eye level was set to mesopic values (10, 20, 40 lux, then photopic values (60, 80, 100, 150, 200 lux. For each ALI level, a light beam of gradually increasing illuminance was applied to the right temporal limbus until the LLIT was reached, i.e. the level required to produce the faint light arc that is characteristic of sclerotic scatter at the nasal limbus.After log-log transformation, a linear relationship between the logarithm of ALI and the logarithm of the LLIT was found (p<0.001, a 10% increase in ALI being associated with an average increase in the LLIT of 28.9%. Higher keratometry values were associated with higher LLIT values (p = 0.008 under low ALI levels, but the coefficient of the interaction was very small, representing a very limited effect. Iris shade and central corneal thickness values were not significantly associated with the LLIT. We also developed a censored linear model for ALI values ≤ 40 lux, showing a linear relationship between ALI and the LLIT, in which the LLIT value was 34.4 times greater than the ALI value.Sclerotic scatter is more easily elicited under mesopic conditions than under photopic conditions and requires the LLIT value to be much higher than the ALI value, i.e. it requires extreme contrast.

  20. Propofol attenuates oxidant-induced acute lung injury in an isolated perfused rabbit-lung model.

    Science.gov (United States)

    Yumoto, Masato; Nishida, Osamu; Nakamura, Fujio; Katsuya, Hirotada

    2005-01-01

    Reactive oxygen species have been strongly implicated in the pathogenesis of acute lung injury (ALI). Some animal studies suggest that free radical scavengers inhibit the onset of oxidant-induced ALI. Propofol (2,6-diisopropylphenol) is chemically similar to phenol-based free radical scavengers such as the endogenous antioxidant vitamin E. Both in vivo and in vitro studies have suggested that propofol has antioxidant potential. We hypothesized that propofol may attenuate ALI by acting as a free-radical scavenger. We investigated the effects of propofol on oxidant-induced ALI induced by purine and xanthine oxidase (XO), in isolated perfused rabbit lung, in two series of experiments. In series 1, we examined the relationship between the severity of ALI and the presence of hydrogen peroxide (H2O2). In series 2, we evaluated the effects of propofol on attenuating ALI and the dose dependence of these effects. The lungs were perfused for 90 min, and we evaluated the effects on the severity of ALI by monitoring the pulmonary capillary filtration coefficient (Kfc), pulmonary arterial pressure (Ppa), and the pulmonary capillary hydrostatic pressure (Ppc). In series 1, treatment with catalase (an H2O2 scavenger) prior to the addition of purine and XO resulted in complete prevention of ALI, suggesting that H2O2 may be involved closely in the pathogenesis of ALI. In series 2, pretreatment with propofol at concentrations in excess of 0.5 mM significantly inhibited the increases in the Kfc values, and that in excess of 0.75 mM significantly inhibited the increase in the Ppa values. Propofol attenuates oxidant-induced ALI in an isolated perfused rabbit lung model, probably due to its antioxidant action.

  1. (Tongkat Ali) for callus

    African Journals Online (AJOL)

    hope&shola

    2010-12-06

    Dec 6, 2010 ... The induction of callus cultures using leaf, petiole, rachis, stem, tap root, fibrous root, cotyledon and ... other countries of the South-East Asia region and widely distributed ..... Indian ginseng plantlets from stem callus. Plant Cell ...

  2. The use of low-level light therapy in the treatment of androgenetic alopecia and female pattern hair loss.

    Science.gov (United States)

    Gupta, Aditya K; Daigle, Deanne

    2014-04-01

    Androgenetic alopecia (AGA) or female pattern hair loss (FPHL) is the most common form of hair loss in men and women. Despite its common occurrence, our understanding of the etiology of AGA and FPHL remains incomplete. As such, traditional therapies demonstrate modest efficacies and new therapies continue to be sought. Low-level light therapy (LLLT) is a relatively new technique used to promote hair growth in both men and women with AGA and FPHL. Currently, there exist several LLLT devices marketed for the treatment of alopecia, which claim to stimulate hair growth; yet marketing these devices only requires that safety, not efficacy, be established. A handful of studies have since investigated the efficacy of LLLT for alopecia with mixed results. These studies suffered from power, confounding and analysis issues which resulted in a high risk of bias in LLLT studies. Due to the paucity of well-conducted randomized controlled trials, the efficacy of LLLT devices remains unclear. Randomized controlled trials of LLLT conducted and reported according to the Consolidated Standards of Reporting Trials (CONSORT) statement would greatly increase the credibility of the evidence and clarify the ambiguity of the effectiveness of LLLT in the treatment of AGA and FPHL.

  3. Use of low-level laser therapy as monotherapy or concomitant therapy for male and female androgenetic alopecia.

    Science.gov (United States)

    Munck, Andréia; Gavazzoni, Maria Fernanda; Trüeb, Ralph M

    2014-04-01

    Androgenetic alopecia (AGA) is the most common form of hair loss in men and in women. Currently, minoxidil and finasteride are the treatments with the highest levels of medical evidence, but patients who exhibit intolerance or poor response to these treatments are in need of additional treatment modalities. The aim was to evaluate the efficacy and safety of low-level laser therapy (LLLT) for AGA, either as monotherapy or as concomitant therapy with minoxidil or finasteride, in an office-based setting. Retrospective observational study of male and female patients with AGA, treated with the 655 nm-HairMax Laser Comb(®), in an office-based setting. Efficacy was assessed with global photographic imaging. Of 32 patients (21 female, 11 male), 8 showed significant, 20 moderate, and 4 no improvement. Improvement was seen both with monotherapy and with concomitant therapy. Improvement was observed as early as 3 months and was sustained up to a maximum observation time of 24 months. No adverse reactions were reported. LLLT represents a potentially effective treatment for both male and female AGA, either as monotherapy or concomitant therapy. Combination treatments with minoxidil, finasteride, and LLLT may act synergistic to enhance hair growth.

  4. Uncoupling of glomerular IgA deposition and disease progression in alymphoplasia mice with IgA nephropathy.

    Directory of Open Access Journals (Sweden)

    Masashi Aizawa

    Full Text Available Previous clinical and experimental studies have indicated that cells responsible for IgA nephropathy (IgAN, at least in part, are localized in bone marrow (BM. Indeed, we have demonstrated that murine IgAN can be experimentally reconstituted by bone marrow transplantation (BMT from IgAN prone mice in not only normal mice, but also in alymphoplasia mice (aly/aly independent of IgA+ cells homing to mucosa or secondary lymphoid tissues. The objective of the present study was to further assess whether secondary lymph nodes (LN contribute to the progression of this disease. BM cells from the several lines of IgAN prone mice were transplanted into aly/aly and wild-type mice (B6. Although the transplanted aly/aly showed the same degree of mesangial IgA and IgG deposition and the same serum elevation levels of IgA and IgA-IgG immune-complexes (IC as B6, even in extent, the progression of glomerular injury was observed only in B6. This uncoupling in aly/aly was associated with a lack of CD4+ T cells and macrophage infiltration, although phlogogenic capacity to nephritogenic IC of renal resident cells was identical between both recipients. It is suggested that secondary LN may be required for the full progression of IgAN after nephritogenic IgA and IgA/IgG IC deposition.

  5. Consumers’ and Retailers’ Attitudes Towards a Mexican Native Species of Aztec Lily as an Ornamental Plant

    Directory of Open Access Journals (Sweden)

    Yesica Mayett-Moreno

    2018-01-01

    Full Text Available The use of native ornamental plants in urban landscapes and ornamental consumers’ designs is one strategy to preserve biodiversity. Sprekelia formosissima (L. Herb., known as Aztec lily (ALY, is one of the nearly 4000 species of native ornamental plants of Mexico. However, its domestic market is not yet developed and is virtually unknown. The objectives of this study were to: (1 compare consumers’ and retailers’ knowledge of ALY, and (2 to identify potential clusters of consumers and retailers based on their knowledge and preferences, such that marketing of the ALY could be best tailored to different market segments, leading to its sustainable commercialization. There were 464 interviews conducted in four nurseries in Mexico. Results showed only one consumer knew about the ALY; additionally, we found different behaviors in consumers and in retailers: those not interested in the ALY, but when they know it is Mexican they will acquire it; those interested no matter the ALY origin, and those who dislike the ALY because it is Mexican. Those answers suggest that improving consumers/retailers knowledge about this native flower could lead to a sustainable commercialization in Mexico, helping to ensure its conservation as well.

  6. Comparison of bone age in small-for-gestationalage children vs appropriate-for-getational-age children

    Directory of Open Access Journals (Sweden)

    Lionardus Edward

    2010-04-01

    Full Text Available BackgroundAbout 10-15% small-for-gestational-age children are in higher risk for having linear growth retardation due to growth hormone-insulin like growth factor 1 axis defect (GH-IGF 1 which causes bone age delay.ObjectivesTo compare bone age in 24-36 month old children born small-for-gestational-age (SGA to that in children born appropriate-for-gestational-age (AGA.MethodsA cross-sectional study was conducted in Hasan Sadikin General Hospital, Bandung, from January to April 2009.Subjects consisted of50 healthy children of 24-36 months old (25 children born at term, SGA, 25 children born at term, AGA. We compared the appropriateness and delay of bone age between the two groups. ResultsMean bone age in the SGA group was 20.8 (SD 7.7 months, and in the AGA group was 25.7 (SD 7.1 months (P=0.022. Mean bone age deficit was -10.5 (6.5 months in the SGA group and -5.5 (SD 5.7 months in the AGA group (P=0.009. The prevalence ratio was 1.77 (95% CI: 1.19–2.62. Bone age delay was found to be higher in children born SGA than that in children of the other group (23 vs 13. On the contrary, appropriate bone age was found more in children born AGA (12 vs 2 (P=0.002.Conclusion Bone age delay in 24-36 months old children born small-for-gestational-age was found to be higher than in those born appropriate-for-gestational-age.

  7. Influences of impurities on iodine removal efficiency of silver alumina adsorbent

    Energy Technology Data Exchange (ETDEWEB)

    Fukasawa, Tetsuo; Funabashi, Kiyomi [Hitachi, Ltd., Ibaraki (Japan); Kondo, Yoshikazu [Hitachi, Ltd., Ibaraki (Japan)

    1997-08-01

    Silver impregnated alumina adsorbent (AgA), which was developed for iodine removal from off-gas of nuclear power and reprocessing plants has been tested laying emphasis on investigation of the influences gaseous impurities have on adsorbent chemical stability and iodine removal efficiency. The influences of the major impurities such as nitrogen oxides and water vapor were checked on the chemical state of impregnated silver compound (AgNO{sub 3}) and decontamination factor (DF) value. At 150{degrees}C, a forced air flow with 1.5% nitrogen oxide (NO/NO{sub 2}=1/1) reduced silver nitrate to metallic silver, whereas pure air and air with 1.5% NO{sub 2} had no effect on the chemical state of silver. Metallic silver showed a lower DF value for methyl iodide in pure air (without impurities) than silver nitrate and the lower DF of metallic silver was improved when impurities were added. At 40{degrees}C, a forced air flow with 1.5% nitrogen dioxide (NO{sub 2}) increased the AgA weight by about 20%, which was caused by the adsorption of nitric acid solution on the AgA surface. AgA with l0wt% silver showed higher weight increase than that with 24wt% silver which had lower porosity. Adsorption of acid solution lowered the DF value, which would be due to the hindrance of contact between methyl iodide and silver. The influences of other gaseous impurities were also investigated and AgA showed superior characteristics at high temperatures. 14 refs., 11 figs.

  8. 1961 / Eiki Nestor

    Index Scriptorium Estoniae

    Nestor, Eiki, 1953-

    2007-01-01

    Hollandis või Taanis oli 1961. aastal Teise maailmasõja lõpust möödas 16 aastat, Eestis aga aastal 2007. Eesti ühiskonnas pakitsevatest probleemidest: ühtede jaoks on tähtis otsustada, kummal pool rindejoont Teises maailmasõjas eestlased sõdisid, teistele aga näib möödapääsmatu ja vajalik välja vabandada okupatsiooniaja kaasajooksiklust

  9. Ascertainment of acute liver injury in two European primary care databases

    NARCIS (Netherlands)

    Ruigómez, A.; Brauer, R.; Rodríguez, L. A García; Huerta, C.; Requena, G.; Gil, M.; de Abajo, Francisco; Downey, G.; Bate, A.; Tepie, M. Feudjo; de Groot, M.C.H.; Schlienger, R.; Reynolds, R.; Klungel, O.

    2014-01-01

    Purpose The purpose of this study was to ascertain acute liver injury (ALI) in primary care databases using different computer algorithms. The aim of this investigation was to study and compare the incidence of ALI in different primary care databases and using different definitions of ALI. Methods

  10. A neonatal piglet model for investigating brain and cognitive development in small for gestational age human infants.

    Directory of Open Access Journals (Sweden)

    Emily C Radlowski

    Full Text Available The piglet was investigated as a potential model for studying brain and cognitive deficits associated with being born small for gestational age (SGA. Naturally farrowed SGA (0.7-1.0 kg BW and average for gestational age (AGA, 1.3-1.6 kg BW piglets were obtained on postnatal day (PD 2, placed in individual cages, and provided a nutritionally adequate milk replacer diet (285 ml/kg/d. Beginning at PD14, performance in a spatial T-maze task was assessed. At PD28, piglets were anesthetized for magnetic resonance (MR imaging to assess brain structure (voxel-based morphometry, connectivity (diffusion-tensor imaging and metabolites in the hippocampus and corpus callosum (proton MR spectroscopy. Piglets born SGA showed compensatory growth such that BW of SGA and AGA piglets was similar (P>0.05, by PD15. Birth weight affected maze performance, with SGA piglets taking longer to reach criterion than AGA piglets (p<0.01. Total brain volume of SGA and AGA piglets was similar (P<0.05, but overall, SGA piglets had less gray matter than AGA piglets (p<0.01 and tended to have a smaller internal capsule (p = 0.07. Group comparisons between SGA and AGA piglets defined 9 areas (≥ 20 clusters where SGA piglets had less white matter (p<0.01; 2 areas where SGA piglets had more white matter (p<0.01; and 3 areas where SGA piglets had more gray matter (p<0.01. The impact of being born SGA on white matter was supported by a lower (p<0.04 fractional anisotropy value for SGA piglets, suggesting reduced white matter development and connectivity. None of the metabolites measured were different between groups. Collectively, the results show that SGA piglets have spatial learning deficits and abnormal development of white matter. As learning deficits and abnormalities in white matter are common in SGA human infants, the piglet is a tractable translational model that can be used to investigate SGA-associated cognitive deficits and potential interventions.

  11. Risk of hearing loss in small for gestational age neonates

    Directory of Open Access Journals (Sweden)

    Melani Rakhmi Mantu

    2011-01-01

    Full Text Available Background Small for gestational age (SGA neonates often have intrauterine growth restriction due to placental insufficiency and chronic hypoxia. These conditions may cause developmental impairment, psychosocial disabilities, or metabolic dysfunction in later life. Previous studies have shown greater incidence of speech and language disabilities, learning impairment, and ncuromotor dysfunction in term SGA infants compared to term appropriate for gestational age (AGA infants. Objective To compare hearing loss in SGA and AGA neonates using otoacoustic emission (OAE tests and to study correlations between maternal risk factors and hearing loss in SGA neonates. Methods A cross-sectional study was performed in St. Borromeus Hospital, Limijati Hospital, and Melinda Hospital in Bandung from February to May 2010. Study subjects consisted of full-term neonates born in these three hospitals. A retrospective medical record review was performed for this Study. Statistical analysis was done by multivariable logistic-regression. Results There was a total of 4279 subjects in our study, including 100 SGA neonates and 4179 AGA neonates. We observed a greater percentage of OAE 'refer' (indicating abnormal OAE results in the SGA group compared to the AGA group (P<0.001, Z=1.3.247. For subjects with OAE ,refer' results, we also analyzed the correlation to the following maternal risk factors: smoking, hypertension, diabetes mellitus and asthma. We also found significant differences between those with and without each of the four maternal risk factors studied (P<0.001. By using multivariant analysis to compare SGA and AGA neonates, we found the odds ratio (OR to be 4.34 (95% CI 2.52 to'7.49, P = 0.001, meaning the SGA group had a 4.34 times higher risk of hearing loss than the AGA group. Conclusion SGA neonates had a higher risk of hearing loss than A(3A neonates. In addition, maternal smoking, hypertension, diabetes mellitus and asthma significantly correlated to

  12. African Journal of Infectious Diseases - Vol 12, No 1 (2018)

    African Journals Online (AJOL)

    Hospital- and community- based surveillance of Zika and Dengue viruses in Indonesia · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Nasronudin Suharto, Muhammad Amin, Diah Puspita Rini, Achmad Chusnu Romdhoni, Purwaningsih Zulfayandi Pawanis, ...

  13. Diagnosis of canine rabies by the direct fluorescent antibody ...

    African Journals Online (AJOL)

    Diagnosis of canine rabies by the direct fluorescent antibody technique in Plateau State, Nigeria. DO Ehizibolo, EA Ogunsan, MJ Muhammad, CI Nwosuh, S Olaleye, OOC Chuckwu, MY Sugun, NM Sati, NE Waziri, OK Egwu, J Kamani, CA Meseko, SE Idachaba, GI Dogo ...

  14. Assessing and Evaluating Ḥadith: Its Value, Significance, Authority and Authenticity in Islamic Thought

    Directory of Open Access Journals (Sweden)

    Dr. Farhat Nisar

    2017-07-01

    Full Text Available Qur’an and Ḥadith as fundamental and primary sources of Shariah stand as hall mark of Islam. Ḥadith called traditions as the second fundamental source of Islam embodies sayings, actions and expressions of Prophet Muhammad (SAW explicit or implicit. Mainly there have been two trends of rejecting the status of Ḥadith. One is rejecting the authority of Ḥadith and other rejects the authenticity of Ḥadith especially “Khabar-al-wahid” or solitary tradition. Other group does not completely reject the authority of Ḥadith rather text of Ḥadith especially in case of weak traditions. This paper discuss the opinion of rejecters of Ḥadith and contribution of Muslim scholars along with their arguments from Qur’an and Sunnah of Prophet Muhammad (SAW to highlight the importance and significance of authority and authenticity of Ḥadith in all disciplines of Islamic thought.

  15. Muhammed Esed’de Dini Değişimin Psikolojik Analizi The Psychological Analysis Of Religious Conversion In Muhammad Asad

    Directory of Open Access Journals (Sweden)

    Saffet KARTOPU

    2013-07-01

    Full Text Available At this work on Which religious conversion in Muhammad Asad isstudied, in terms of religious conversion models, first of all the conceptof religious conversion, the Works in this topic and the place of religiousconversion concept in Psychology of Religion are mentioned. Then, abrief life story of Asad is mentioned, by dealing with the religiousconversion in Asad in a theoretical approach, the motives of religiousconversion, the developmental factors in religious conversion, the stagesof religious conversion and the figures of religious conversion arestudied. The religious conversion in Asad is analyzed in terms ofconversion models accepted in Psychology of Religion taking his ownWorks as a base. In this sence, while the motives of religious conversionin Asad are considered by the approaches of Snow & Phillips, Glock andGillespie, the developmental factors in religious conversion areconsidered by Erikson’s thoughts. The stages of religious conversion isconsidered by gradual classification of Lofland & Stark, Clark, Batson &Ventis and Köse. Lofland and Skonovd’s types are used while analyzingthe figures of conversion.When considered the effects of psychological factors on thereligious conversion of Asad, we see that beginning from his earlyadolescence his willing to understanding and his need to mentalsatisfaction are explicit. Asad is in need of reviewing the main pointsimposed by his cultere. He is disturbed by the ambiguities in societyand his own life and he looks for answers to the universal meaning oflife and questions ‘what is right? what is wrong?’. As a result of hisseeking, he accepts Islam as his religion and he gains a feeling ofbelonging, admission and a change of rearranging himself radically. Byaccepting Islam he feels that all his seekings finish and his desire ofdepending on a certain intellectua orbit and being a part of fellowscommunity come true. Dini değişim modelleri açısından Muhammed Esed’de dini de

  16. Review on a Traditional Herbal Medicine, Eurycoma longifolia Jack (Tongkat Ali: Its Traditional Uses, Chemistry, Evidence-Based Pharmacology and Toxicology

    Directory of Open Access Journals (Sweden)

    Shaheed Ur Rehman

    2016-03-01

    Full Text Available Eurycoma longifolia Jack (known as tongkat ali, a popular traditional herbal medicine, is a flowering plant of the family Simaroubaceae, native to Indonesia, Malaysia, Vietnam and also Cambodia, Myanmar, Laos and Thailand. E. longifolia, is one of the well-known folk medicines for aphrodisiac effects as well as intermittent fever (malaria in Asia. Decoctions of E. longifolia leaves are used for washing itches, while its fruits are used in curing dysentery. Its bark is mostly used as a vermifuge, while the taproots are used to treat high blood pressure, and the root bark is used for the treatment of diarrhea and fever. Mostly, the roots extract of E. longifolia are used as folk medicine for sexual dysfunction, aging, malaria, cancer, diabetes, anxiety, aches, constipation, exercise recovery, fever, increased energy, increased strength, leukemia, osteoporosis, stress, syphilis and glandular swelling. The roots are also used as an aphrodisiac, antibiotic, appetite stimulant and health supplement. The plant is reported to be rich in various classes of bioactive compounds such as quassinoids, canthin-6-one alkaloids, β-carboline alkaloids, triterpene tirucallane type, squalene derivatives and biphenyl neolignan, eurycolactone, laurycolactone, and eurycomalactone, and bioactive steroids. Among these phytoconstituents, quassinoids account for a major portion of the E. longifolia root phytochemicals. An acute toxicity study has found that the oral Lethal Dose 50 (LD50 of the alcoholic extract of E. longifolia in mice is between 1500–2000 mg/kg, while the oral LD50 of the aqueous extract form is more than 3000 mg/kg. Liver and renal function tests showed no adverse changes at normal daily dose and chronic use of E. longifolia. Based on established literature on health benefits of E. longifolia, it is important to focus attention on its more active constituents and the constituents’ identification, determination, further development and most

  17. TRADISI MAULID NABI DALAM MASYARAKAT SASAK

    Directory of Open Access Journals (Sweden)

    Zaenuddin Mansyur

    2005-06-01

    Full Text Available Every community has one or more celebration day that it traditionally celebrates in certain way. One of Muslims’ most impressive celebration day is the birthday of Muhammad (mawlid, the last massenger of God. To Muslims Muhammad is considered the gloriest and the leader of all massenger sent by Allah to human being. He preached Islam and got success in his mission in a relatively short period, 23 years. His 23-year mission period was considered the turning point in the history of Muslims (Arabs civilization from the age of pagan ignorance (jâhiliyah toward a new, enlightened, and civilized era. His very hard strugle and great succesful-end mission took special place in the heart of Muslims all over the world and inspired them to do their best in commemorating his piety and heroic life. All he had done dan gained in preaching Islam rose great proudness and admiration to the Muslim communities all over the world, so that they are always very eager to commemorate his birthday in various ways of celebration in accordance with their own culture and traditions.The Sasak community in Lombok island traditionally named celebration of Muhammad birthday mulud—derivated from Arabic word mawlid—and held constantly every year. The historical, philosophical, and sociological aspects of Sasak tradition simutanously colored mulud celebration. It has lasted for a long time, and the community has endured it through the process of tradition and regeneration but some changes have been in one or more aspects of the commemoration rituals.

  18. Konsep dan Gerakan Tawhîd dalam Perspektif Antropologi Agama

    Directory of Open Access Journals (Sweden)

    Kunawi Basyir

    2016-03-01

    Full Text Available One of the special characteristic of religion is transcendent, holy, absolute and permanent due to the holy revelation of the divinity and culture is human creation in forms of relativity due to its dynamic characteristic. Human culture will take a sort of changing in accordance with the time and space they lived in. Human will have understanding in accordance with their capability and experience in responding and practicing dogma according to their belief. In this point, they try to return to their original form of being oneness or ummah wâh}idah either in social and theological fields. The concept of ummah wâh}idah is well known with the tawhîd movement focused on theological and social realm. This paper attempts to see the religious movement of tawhîd Muh}ammad in anthropological perspective. It aims to respond the exclusive religious understanding of some groups in Indonesia in threatening plurality and social integration. The paper suggests that the movement of tawhîd Muh}ammad is a theological and social movement. Theological movement maintains that all Semitic religions should be tied up with the idea of millah Ibrâhîm, not Islamic religion (aqîdah Islâmîyah as many salafism argue in the recent days. Besides, the social movement of tawhîd Muh}ammad means that tawhîd could unite many groups and ethnics of Arab tribes to build a new face of civilization in more civilized and dynamic.

  19. Characterization of a Novel Alginate Lyase from Marine Bacterium Vibrio furnissii H1

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhu

    2018-01-01

    Full Text Available Alginate lyases show great potential for industrial and medicinal applications, especially as an attractive biocatalyst for the production of oligosaccharides with special bioactivities. A novel alginate lyase, AlyH1, from the marine bacterium Vibrio furnissii H1, which has been newly isolated from rotten seaweed, was purified and characterized. The purified enzyme showed the specific activity of 2.40 U/mg. Its molecular mass was 35.8 kDa. The optimal temperature and pH were 40 °C and pH 7.5, respectively. AlyH1 maintained stability at neutral pH (7.0–8.0 and temperatures below 30 °C. Metal ions Na+, Mg2+, and K+ increased the activity of the enzyme. With sodium alginate as the substrate, the Km and Vmax values of AlyH1 were 2.28 mg/mL and 2.81 U/mg, respectively. AlyH1 exhibited activities towards both polyguluronate and polymannuronate, and preferentially degraded polyguluronate. Products prepared from sodium alginate by AlyH1 were displayed to be di-, tri-, and tetra-alginate oligosaccharides. A partial amino acid sequence (190 aa of AlyH1 analysis suggested that AlyH1 was an alginate lyase of polysaccharide lyase family 7. The sequence showed less than 77% identity to the reported alginate lyases. These data demonstrated that AlyH1 could be as a novel and potential candidate in application of alginate oligosaccharides production with low polymerization degrees.

  20. Validation of an electronic surveillance system for acute lung injury.

    Science.gov (United States)

    Herasevich, Vitaly; Yilmaz, Murat; Khan, Hasrat; Hubmayr, Rolf D; Gajic, Ognjen

    2009-06-01

    Early detection of acute lung injury (ALI) is essential for timely implementation of evidence-based therapies and enrollment into clinical trials. We aimed to determine the accuracy of computerized syndrome surveillance for detection of ALI in hospitalized patients and compare it with routine clinical assessment. Using a near-real time copy of the electronic medical records, we developed and validated a custom ALI electronic alert (ALI "sniffer") based on the European-American Consensus Conference Definition and compared its performance against provider-derived documentation. A total of 3,795 consecutive critically ill patients admitted to nine multidisciplinary intensive care units (ICUs) of a tertiary care teaching institution were included. ALI developed in 325 patients and was recognized by bedside clinicians in only 86 (26.5%). Under-recognition of ALI was associated with not implementing protective mechanical ventilation (median tidal volumes of 9.2 vs. 8.0 ml/kg predicted body weight, P sniffer" demonstrated excellent sensitivity of 96% (95% CI 94-98) and moderate specificity of 89% (95% CI 88-90) with a positive predictive value ranging from 24% (95% CI 13-40) in the heart-lung transplant ICU to 64% (95% CI 55-71) in the medical ICU. The computerized surveillance system accurately identifies critically ill patients who develop ALI syndrome. Since the lack of ALI recognition is a barrier to the timely implementation of best practices and enrollment into research studies, computerized syndrome surveillance could be a useful tool to enhance patient safety and clinical research.