WorldWideScience

Sample records for aga muhammad ali

  1. Muhammad Ali, um outsider na sociedade americana?

    Directory of Open Access Journals (Sweden)

    Flávio Py Mariante Neto

    2010-12-01

    Full Text Available O estudo analisa a carreira do boxeador Muhammad Ali segundo as formulações sobre as relações de poder em configurações apresentadas por Norbert Elias. O propósito foi compreender como um atleta que foi contra questões tão profundas da sociedade estabelecida obteve sucesso profissional. Tratou-se de um estudo documental, tendo como fonte livros, artigos e reportagens publicadas sobre a trajetória do lutador. Concluiu-se que apesar de Ali ter se posicionado contra padrões estabelecidos de sua época em questões como a religião, o racismo e o patriotismo, a sua habilidade técnica acima da média, o seu poder de autopromoção e a sua capacidade de participar do jogo no contexto configuracional de que fazia parte, lhe deram condições de sobrevivência no mundo do boxe e conseqüente sucesso profissional.

  2. Muhammad Ali: parel voor de sport en de mensheid

    NARCIS (Netherlands)

    Jan de Leeuw

    2016-01-01

    Begin juni 2016 overleed Muhammad Ali, volgens velen de grootste sportman allertijden. De betekenis van Ali voor de sport is groot geweest. Maar zijn betekenis voor de mensheid is nog groter. Ali stond voor de idealen van gelijkheid, rechtvaardigheid, vrijheid en vrede. Hij staat op een lijn met

  3. Muhammad Ali's Fighting Words: The Paradox of Violence in Nonviolent Rhetoric

    Science.gov (United States)

    Gorsevski, Ellen W.; Butterworth, Michael L.

    2011-01-01

    While Muhammad Ali has been the subject of countless articles and books written by sports historians and journalists, rhetorical scholars have largely ignored him. This oversight is surprising given both the tradition of social movement scholarship within rhetorical studies and Ali's influential eloquence as a world renowned celebrity espousing…

  4. Fighting Injustice and Intolerance: Re-Presentations of Race and Religion at the Muhammad Ali Center

    Directory of Open Access Journals (Sweden)

    Michael Brandon McCormack

    2017-11-01

    Full Text Available This article explores the significance of the Muhammad Ali Center as a site where meanings associated with “race” and “religion” are constructed, contested and potentially transformed. The Muhammad Ali Center is examined as an example of an increasing number of cultural institutions (i.e., cultural centers, museums, arts spaces etc. engaged in the strategic re-presentation of issues of cultural difference and socio-political conflict, towards the ends of promoting social justice and/or human rights. The article draws upon theories and methods in cultural studies, religious studies, and museums studies in order to explore the significance of the representational and curatorial strategies of such cultural institutions for understanding alternative approaches to influencing and/or intervening in public discourses and practices surrounding issues of racial injustice and religious intolerance.

  5. Greater self-enhancement in Western than Eastern Ukraine, but failure to replicate the Muhammad Ali effect.

    Science.gov (United States)

    Kemmelmeier, Markus; Malanchuk, Oksana

    2016-02-01

    Based on the cross-cultural research linking individualism-collectivism and self-enhancement, this research examines regional pattern of self-enhancement in Ukraine. Broadly speaking, the western part of Ukraine is mainly Ukrainian speaking and historically oriented towards Europe, whereas Eastern Ukraine is mainly Russian speaking and historically oriented towards the Russian cultural sphere. We found self-enhancement on a "better than average" task to be higher in a Western Ukrainian sample compared to an Eastern Ukrainian sample, with differences in independent self-construals supporting assumed regional variation in individualism. However, the Muhammad Ali effect, the finding that self-enhancement is greater in the domain of morality than intelligence, was not replicated. The discussion focuses on the specific sources of this regional difference in self-enhancement, and reasons for why the Muhammad Ali effect was not found. © 2015 International Union of Psychological Science.

  6. The Danish Muhammad Cartoon Conflict

    DEFF Research Database (Denmark)

    Hervik, Peter

    The “Muhammad crisis,” the “Muhammad Cartoon Crisis,” or “The Jyllands-Posten Crisis” are three different headings used for the global, violent reactions that broke out in early 2006. The cartoon crisis was triggered by the publication of 12 cartoons in the largest Danish daily newspaper...... theme in IMER studies, which has consequences for most immigrants of non-Western countries to the Nordic countries....

  7. (AGA) Pre Term Babies

    African Journals Online (AJOL)

    Haematological Indices in Healthy Appropriate For-Gestational-Age (AGA) Pre Term Babies. ... International Journal of Medicine and Health Development. Journal Home ... Patient and Methods: All consecutive healthy pre-term new born babies delivered at UNTH and admitted into the hospital NBSCU were included.

  8. Muhammad y el monacato palestino

    Directory of Open Access Journals (Sweden)

    José María Blázquez Martínez

    2011-01-01

    Full Text Available Los grandes genios religiosos son Jesús, Buda y Muhammad. Ni Jesús ni Muhammad quisieron crear una religión, sino corregir la primitiva revelación, que se había desviado. Muhammad ha creado una religiosidad que ha dado alimento espiritual durante muchos siglos a millones de fieles, y una mística fabulosa que ha durado más de 1.000 años. Tor Andrae señala influjos de la iglesia y del monacato sirio. D.J. Sahas indica influjo fuerte del monacato sirio en el Corán. Se comparan en este trabajo puntos fundamentales de la religiosidad del Corán con el del monacato palestino: infierno, Juicio Final, Demonología, Angeología, el Paraíso, Oración, Ayunos, Limosna, prohibición de alimento, Eucaristía, etc. Muhammad es un hereje cristiano para S. Juan Damasceno, que vivió muchos años en la corte de los Omeyas y desempeñó altos cargos. Muhammad admite que Cristo es el Mesías, un grandísimo profeta, la palabra de Dios y el enviado de Dios. Niega que sea Dios, ni la redención, ni la crucifixión, que es sólo aparente; acepta la resurrección y la subida a los cielos. No admite la Trinidad. Los grandes investigadores protestantes, Harnack, Schlatter, Wellhausen, en el siglo XX, afirman que era un ebionita, o sea, un judeo-cristiano heterodoxo, que vivían en Palestina y Siria, tesis que aceptó el gran teólogo católico H. Küng, partidario de un diálogo con el Islam. Muhammad llevó, al principio, una vida en la montaña, muy parecida a la de los monjes cristianos. En el arte musulmán hay pinturas que representan a Muhammad con monjes que él conocía de sus viajes a Siria. No se puede dudar de un fuerte influjo del monacato palestino y sirio en la religiosidad de Muhammad, como indica D.J. Sahas, excelente conocedor de S. Juan Damasceno. La religiosidad de Muhammad, del monacato palestino y de Jesús, tienen un fuerte carácter social, al igual que la de los grandes profetas de Israel. El presente estudio confirma la frase de

  9. Muhammad Rif`at dan Turath Bacaannya

    Directory of Open Access Journals (Sweden)

    WAN HILMI WAN ABDULLAH

    2013-12-01

    Full Text Available Shaykh Muhammad Rif`at is one of the famous reciters in Egypt in the era of the 90's. His stature continues evident after officially been invited as a qari to the opening ceremony of Qari al-Misriyyah Idha`at in 1934. During his involvement in the world of Quranic recitation, Shaykh Muhammad Rif`at had recited the Quran in the mosque of Fadil Basha for 25 years. His determinations to deliver and spread Holy Quran with an intermediate reading in mosques, haflah-haflah and ma’tam also have strongly influenced the next generations of qurra’. Many of the reciters like Shaykh Mustafa Isma`il, Shaykh Abu al-`Aynin Sha`isha', Shaykh `Abdul Fattah and others recognize that he has the greatness and uniqueness of its own in the art of reading the Quran. This is evidenced by some of the titles given to him as Amir al-Qurra’, Qitharah al-Sama’ and Sawt al-Malaikah by his contemporary reciters. After Shaykh Muhammad Rif`at died in 1950, then relics of his recited turath were uncovered which compiled by his friend, Zakaria Basha and compatriot Muhammad Khamis, as they managed to gather a total of 278 cds contains 19 chapters with the duration of 21 hours.

  10. PENDIDIKAN MUHAMMAD ABDUH VERSUS PENDIDIKAN KARAKTER BANGSA

    Directory of Open Access Journals (Sweden)

    Cucum Novianti

    2015-01-01

    Full Text Available Education in Islam can not be separated from the history as a foothold guideline in an effort to improve the quality of education. The earlier leaders in the education field has provided a scientific concept for reconstructing the less well structure established in his time, so due to their brilliant thinking in education field we can use as a guide to dissect the our education phenomenon today. Muhammad Abduh is a Muslim philosophers and the education thinkers in world caliber. Many things that have been done in reconstructing of education through the thoughts and concrete step in order to be consistent with the purpose of human life for raise the dignity of human life. The reformation carried out by Muhammad Abduh in the field of education are able to be applied in the present by giving more attention to the character building of students. Hopefully, Indonesian people become intelligent in mind and having moral character.

  11. PERSONALITY EDUCATION ACCORDING TO ALLAMA MUHAMMAD IQBAL

    Directory of Open Access Journals (Sweden)

    Imam Bahroni

    2015-12-01

    Full Text Available         This paper is aimed at discussing the concept of Personality Education according to Allama Muhammad Iqbal. In relation with the concept, Muhammad Iqbal (1873-1938, emphasized the proper development of the individuality of man. He maintained that an individual should be exposed to all kinds of formative and challenging experiences; otherwise his individuality will shrink and wither[1]. Iqbal underscored the importance of freedom, which allowed for experimentation with the environment, for the exercise of choice and discrimination in the use of methods and substance, and for learning by direct, firsthand experience. Despite his emphasis on the individual, Iqbal did not ignore the role of the community and its culture in the give-and-take dynamics with the individual. Iqbal also subscribed to the view that there must be harmony between the material and spiritual elements in man, which educational theory should consider. He valued intellect, but he criticized contemporary thought for overstressing it at the expense of intuition or love. From Iqbal's writings, the characteristics of the good man could be inferred. First, the good man is creative and original, for creativity is the most precious and distinctive gift of man. He must be able to use his intelligence to harness the forces of nature for his own good and also to increase his knowledge and power. Secondly, the good man lives his life in the name of the Lord, dedicating his powers and knowledge to working out His purpose and thereby deserving himself for the position of God's vicegerent on earth.[1] K.G. Saiyidain, (1977, Iqbal's educational philosophy, 8th ed.,Lahore: SH Muhammad Ashraf, p. 14.

  12. Social innovation og Muhammad Yunus i en dansk kontekst

    DEFF Research Database (Denmark)

    2008-01-01

    Hvorfor er social innovation og Muhammad Yunus' arbejde relevant i en dansk kontekst? Kan social innovation være med til at skabe fremtidens danske velfærdssamfund?......Hvorfor er social innovation og Muhammad Yunus' arbejde relevant i en dansk kontekst? Kan social innovation være med til at skabe fremtidens danske velfærdssamfund?...

  13. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  14. New ALI and its relevant factors

    International Nuclear Information System (INIS)

    Zhou Yongzeng; Wang Jiadong

    1993-01-01

    ALI is secondary limit. The method of calculating ALI, changes of some parameters used in calculation of ALI and their influences on ALI were discussed. A comparison between old and new ALI was made. The most part of the ratios of old ALI/new ALI (about 75%) ranges from 2 to 4. Reduction of annual dose limit from 50 mSv to 20 mSv seems to be the main reason causing reduction of values of new ALI

  15. Muhammad Abduh Dan Ijtihadnya Dalam Bidang Pendidikan

    Directory of Open Access Journals (Sweden)

    Suhaimi Suhaimi

    2017-05-01

    Full Text Available Since the arrival of Napoleon Bonaparte to Egypt in the late 19th century AD, the Islamic world can be said to have been aware of the lag in many areas including in the field of education. Therefore, among the scholars at the same time Muslim intellectuals in the Islamic world when it started thinking to bounce back and catch up with the Islamic world experienced such a variety of ways that may be carried out according to the conditions at that time. Among them was Sheikh Muhammad Abduh. In the course of his life, Abduh has done ijtihad and renewal through the various ideas put forward ideas or even gets serious challenges from various parties, including the scholars of al-Azhar itself. But all of that does not make him despair and retreat, so that his ideas had a great influence for the next generation. Abduh brilliant ideas include the fields of education, legal, social, administrative, political and others. This article only focuses his discussion on his thoughts about education which would still be relevant to observe in order to be an afterthought for students of education in this country. Abduh's ideas include the following educational objectives, curriculum, methods and the importance of education for women. ABSTRAK Sejak kedatangan Napoleon Bonaparte ke Mesir pada akhir abad ke 19 Masehi, dunia Islam dapat dikatakan telah menyadari akan ketertinggalan di berbagai bidang termasuk di bidang pendidikan. Karena itu, di antara ulama sekaligus intelektual muslim di dunia Islam saat itu mulai berfikir untuk bangkit kembali serta mengejar ketertinggalan yang dialami dunia Islam tersebut dengan berbagai cara yang mungkin dilakukan sesuai kondisi saat itu. Di antara mereka adalah Syeikh Muhammad Abduh. Dalam perjalanan hidupnya, Abduh telah melakukan ijtihad dan pem-baharuannya melalui berbagai ide atau gagasan yang dikemukakannya sekalipun mendapat tantangan yang berat dari berbagai pihak termasuk pihak ulama al-Azhar sendiri. Akan tetapi semua

  16. The similarity of Ali (as and Jesus (PBUH in Islamic tradition

    Directory of Open Access Journals (Sweden)

    Mahdi Hasanzadeh

    2015-12-01

    Full Text Available According to the teachings of the Shia, Imam Ali (AS has unique features by which he earned the merits of becoming the successor to the Prophet (pbuh as the Imam and Wali. One of the most important of his features is his similarity to the Jesus as one of the greatest prophets before Prophet Muhammad (pbuh. This similarity was first mentioned in some Islamic traditions, especially the ones narrated through Shiite Isnad in interpretation of the verses 57-59 of the Surta Az-Zukhruf. In these traditions, the Prophet has regarded the Position of Imam Ali (AS in his nation the same as Jesus's Position among the Israel. The Quran has cited the inimical arguments of the Arab infidels against this prophet's saying: they considered the worshiping of their own gods better than accepting Prophet's remark in equating his cousin with Jesus (pbuh. By resorting to this remark, the infidels regarded worshiping their own gods more preferable than deifying a man. Therefore, the first and most prominent similarity between Imam Ali (AS and Jesus Christ (pbuh is attributing divinity to Imam Ali (AS, at least by some of his extreme lovers. The Quranic command saying: "Do not Exaggerate about your religion… .(Quran 4:17 refers to the Christian extremism in deifying Jesus, But soon word Ghali was borrowed from this verse and used to refer to Shiite extremists. Moreover, the Quran (4: 159, talks about the advent of Jesus Christ to his followers before their death .The same concept has been mentioned in Shiite traditions about Imam Ali (AS, according to which, he is believed to be present beside every dying Muslim individual. This appearance of Imam Ali (AS would remind us the idea of Imam Ali's (AS return to this world. Thus, the return of Imam Ali (AS to this world is the third similarity between Imam Ali (AS and Jesus Christ (PBUH. Not only the return of Jesus has been mentioned in in the Christian tradition as the one manifested to the apostles after his ascension

  17. The similarity of Ali (as and Jesus (PBUH in Islamic tradition

    Directory of Open Access Journals (Sweden)

    Sorush Ghanbari

    2016-01-01

    Full Text Available According to the teachings of the Shia, Imam Ali (AS has unique features by which he earned the merits of becoming the successor to the Prophet (pbuh as the Imam and Wali. One of the most important of his features is his similarity to the Jesus as one of the greatest prophets before Prophet Muhammad (pbuh. This similarity was first mentioned in some Islamic traditions, especially the ones narrated through Shiite Isnad in interpretation of the verses 57-59 of the Surta Az-Zukhruf. In these traditions, the Prophet has regarded the Position of Imam Ali (AS in his nation the same as Jesus's Position among the Israel. The Quran has cited the inimical arguments of the Arab infidels against this prophet's saying: they considered the worshiping of their own gods better than accepting Prophet's remark in equating his cousin with Jesus (pbuh. By resorting to this remark, the infidels regarded worshiping their own gods more preferable than deifying a man. Therefore, the first and most prominent similarity between Imam Ali (AS and Jesus Christ (pbuh is attributing divinity to Imam Ali (AS, at least by some of his extreme lovers. The Quranic command saying: "Do not Exaggerate about your religion… .(Quran 4:17 refers to the Christian extremism in deifying Jesus, But soon word Ghali was borrowed from this verse and used to refer to Shiite extremists. Moreover, the Quran (4: 159, talks about the advent of Jesus Christ to his followers before their death .The same concept has been mentioned in Shiite traditions about Imam Ali (AS, according to which, he is believed to be present beside every dying Muslim individual. This appearance of Imam Ali (AS would remind us the idea of Imam Ali's (AS return to this world. Thus, the return of Imam Ali (AS to this world is the third similarity between Imam Ali (AS and Jesus Christ (PBUH. Not only the return of Jesus has been mentioned in in the Christian tradition as the one manifested to the apostles after his ascension

  18. KONTRIBUSI PEMIKIRAN MUHAMMAD SAW PRA DAN PASCA KENABIAN ERA MAKKIAH

    Directory of Open Access Journals (Sweden)

    Agus Jaya

    2011-11-01

    Full Text Available Abstract:Muhammad is the greatest phenomenon in human history. Signs He enshrined in the presence of the holy scriptures is  as a justification former glory. His presence was expected by every group and interest, although later become a boomerang for them because the treatise was carrying remodel beliefs and traditions handed down from their ancestors. The suffering experiences completed His life’s history  as a candidate of  a prophet. Born with orphan status, grew by profession and lived as a shepherd, had suffering experiences has  formed  the identity of Muhammad to become an intelligent and wise leader. Muhammad's intelligence and wisdom in deciding the issue and genius as well as the accuracy of missionary strategy embedded in the period of Mecca is the contribution of thinking which is priceless. Keywords: the contribution of ideas, leadership training, intelligence, wisdom, leadership characteristics

  19. WAHYU DAN KEBERHASILAN DAKWAH MUHAMMAD (Sebuah Kajian Sosiologis

    Directory of Open Access Journals (Sweden)

    Khadziq Khadziq

    2016-11-01

    Full Text Available Islam is embraced by many people through a relatively fast spread. This fact cannot be separated firom the role of its preacher, Muhammad. His success in da’wa activities was contributed by his social roles as well as the revelation that he brought. This article tries to explain that both the revelation and the social factors greatly supported his da’wa. Beside his positives, the existence of Quran as a revelation contributed the social legitimacy that Muhammad was considered as a figure to be followed in spite of his contrary values to the cultures of his time.

  20. The Muhammad cartoon controversy and the globalization of humor

    NARCIS (Netherlands)

    Kuipers, G.

    2008-01-01

    At the 2006 conference of the International Society for Humor Studies (Danish University of Education, Copenhagen), several panels addressed issues raised by the Muhammad cartoon story. Among these, a colloquium organized by Paul Lewis and decorously titled "Transnational Ridicule and Response"

  1. AGA answers complaints on burner tip prices

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This paper reports that the American Gas Association has rebutted complaints that natural gas prices have dropped at the wellhead but not at the burner tip. AGA Pres. Mike Baly the an association study of the issue found that all classes of customers paid less for gas in 1991 than they did in 1984, when gas prices were at their peak. He the, the study also shows that 100% of the wellhead price decline has been passed through to natural gas consumers in the form of lower retail prices. Baly the the average cost of gas delivered to all customers classes fell by $1.12/Mcf from 1984 to 1991, which exceeds the $1.10/Mcf decline in average wellhead prices during the same period

  2. AliPDU Package Upgrade

    CERN Document Server

    "Martin, Michael

    2015-01-01

    "AliPDU Package" is a set of script, panels, and datapoints designed in WinCC to manage and monitor PDU's. PDU is an essential component in the data center, in order to make data center working properly through the monitoring of power distribution and environmental condition of the data center. In this project "AliPDU Package" is upgraded so it can be used to monitor environmental condition of data center using PDU's and external environmental sensor connected to PDU.

  3. AliPDU Package Upgrade

    CERN Document Server

    Martin, Michael

    2015-01-01

    AliPDU Package is a set of script, panels, and datapoints designed in WinCC to manage and monitor PDU's. PDU is an essential component in the data center, in order to make data center working properly through the monitoring of power distribution and environmental condition of the data center. In this project "AliPDU Package" is upgraded so it can be used to monitor environmental condition of data center using PDU's and external environmental sensor connected to PDU.

  4. RELEVANSI STRATEGI DAKWAH HIZBUT TAHRIR INDONESIA DENGAN STRATEGI DAKWAH NABI MUHAMMAD SAW

    Directory of Open Access Journals (Sweden)

    Eunis Khoerunnisa

    2017-01-01

    Full Text Available Hizbut Tahrir Indonesia is a unique and phenomenal propaganda institution. For one decade (1998-2008 it has exercised a very intensive preaching, conception of Islam, enforcement of Syari’ah and the Khilafah ruling system. The purpose of this study is to determine the Hizbut Tahrir Indonesia thinking about: (1 the arguments used by Hizbut Tahrir Indonesia in preaching; (2 the purpose of the preaching of Hizbut Tahrir Indonesia; (3 the method used in the propaganda activities of Hizbut Tahrir Indonesia; (4 the program of propaganda in the view of Hizbut Tahrir Indonesia; and (5 the relevance of Hizbut Tahrir Indonesia propagation strategy with the strategy of propaganda of the Prophet Muhammad. The results showed that (1 Hizbut Tahrir Indonesia propagation argument is Surah (Chapter Ali-Imran verse 104; (2 the purpose of Hizbut Tahrir Indonesia propaganda is to hold Islamic life and to carry the Islamic propagation to the entire world and to revive Islam in the right way; (3 the method adopted by Hizbut Tahrir Indonesia in carrying out the mission is the laws of Personality which is taken from Prophet Sayings; (4 HizbutTahrir Indonesia propagation program is basically the same as Hizbut Tahrir anywhere, for espousing ideas, ideals and the same activity which reflects on propagation strategy of the Prophet; and (5 selection of Hizbut Tahrir Indonesia toward the Prophet Traditions about the propagation method applied by the Prophet Muhammad SAW tend to choose a more nuanced firm. In fact, the propagation method applied by the Prophet varies depending on the existing situation and conditions.   Hizbut Tahrir Indonesia adalah sebuah lembaga dakwah yang unik dan fenomenal. Selama kurang lebih satu dasawarsa (1998-2008 sangat intensif melakukan dakwahnya, konsepsinya tentang penegakan Syari’at Islam dan sistem pemerintahan Khilafah. Tujuan penelitian ini adalah untuk mengetahui pemikiran Hizbut Tahrir Indonesia tentang: (1 landasan yang digunakan

  5. KONSEP TASAWUF SYEKH MUHAMMAD ARSYAD AL-BANJARI

    Directory of Open Access Journals (Sweden)

    Nuraida Nuraida

    2016-02-01

    Full Text Available Shaykh Muhammad al - Banjari Arsyad , derived from Banjar South Kalimantan . He was a well-known figure in the 18th century. His role was not only in education , but he was known as a great scholar of fiqh and also an expert in field of Sufism . This had been the result obtained for about thirty years studying in Mecca . Therefore , he was recognized as one of the transmission of the Middle East teaching, particularly in Banjar Indonesia South Kalimantan . His study of Sufism was written in “Kanz al Ma'rifah” . In this book,  Ma'rifah is not separated from the concept of knowing God and ourselves . If someone recognizes him, he should recognize his god. Knowing God means knowing the origin of human, aacording to Arsyad, it is called Nur Muhammad ; mortal before death.

  6. Perspektif Gender dalam Tafsir Muhammad ‘Abduh

    OpenAIRE

    Muchamad Samsukadi

    2014-01-01

    This article explains what Muhammad ‘Abduh’s interpretation on gender verses. According to ‘Abduh, Quran has broadly given same roles, duties and rights between men and women. However, sometimes the equal understanding has been forgotten by some mufasirs about verses dealing with leadership in household, polygamy, and inheritance. To ‘Abduh, in household, the relationship between husband and wife is mutualism-symbiosis. Functionally and structurally, it is lead by husband. Meanwhile, polygamy...

  7. Perspektif Gender Dalam Tafsir Muhammad ‘Abduh

    OpenAIRE

    Samsukadi, Muchamad

    2014-01-01

    This article explains what Muhammad ‘Abduh's interpretation on gender verses. According to ‘Abduh, Quran has broadly given same roles, duties and rights between men and women. However, sometimes the equal understanding has been forgotten by some mufasirs about verses dealing with leadership in household, polygamy, and inheritance. To ‘Abduh, in household, the relationship between husband and wife is mutualism-symbiosis. Functionally and structurally, it is lead by husband. Meanwhile, polygamy...

  8. Muhammad Akbar Arzani (-1772): Mughal physician and translator.

    Science.gov (United States)

    Aggarwal, Neil Krishan

    2012-05-01

    Muhammad Akbar Arzānī was an influential Mughal physician famous throughout Iran and South Asia. His reputation is considered from contemporary accounts of his importance within the broader scholarship in South Asian culture and history. A brief synopsis of his life is provided, followed by a bibliography of his writings. Arzānī made Greco-Arabic knowledge accessible for Indo-Persian audiences in the 18th century.

  9. The Legacy of Muhammad Hamidullah in Islamic Economics

    OpenAIRE

    Islahi, Abdul Azim

    2017-01-01

    Dr. Muhammad Hamidullah is famous for his French translation of the Qur'an, and well-known for discovery, editing and bringing in light a number of rare and invaluable hadith manuscripts. He is also rightly acknowledged for his ground-breaking research works on international Islamic law, biography of the Prophet (peace be upon him), Islamic politics and archival heritage of Islam. A less known but significant aspect of his contribution is his pioneering works on Islamic Economics. Spread over...

  10. Ali, Dr Moizuddin Abdul Salim

    Indian Academy of Sciences (India)

    ... Section: Animal Sciences. Ali, Dr Moizuddin Abdul Salim D.Sc. (Andhra), D.Sc. (h.c.), FNA. Date of birth: 12 November 1896. Date of death: 20 June 1987. Specialization: Ecology, Zoogeography, Nature Conservation, Ornithology Last known address: No. 46, Pali Hill, Bombay 400 050. YouTube; Twitter; Facebook; Blog ...

  11. AGA predicts winter jump in residential gas price

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The American Gas Association predicts the average heating bill for residential gas consumers could increase by as much as 18% this winter. AGA Pres. Mike Baly said, Last year's winter was warmer than normal. If the 1992-93 winter is similar, AGA projects that residential natural gas heating bills will go up about 6%. If we see a return to normal winter weather, our projection show the average bill could rise by almost 18%

  12. Perspektif Gender dalam Tafsir Muhammad ‘Abduh

    Directory of Open Access Journals (Sweden)

    Muchamad Samsukadi

    2014-10-01

    Full Text Available This article explains what Muhammad ‘Abduh’s interpretation on gender verses. According to ‘Abduh, Quran has broadly given same roles, duties and rights between men and women. However, sometimes the equal understanding has been forgotten by some mufasirs about verses dealing with leadership in household, polygamy, and inheritance. To ‘Abduh, in household, the relationship between husband and wife is mutualism-symbiosis. Functionally and structurally, it is lead by husband. Meanwhile, polygamy and inheritance are kinds of protection toward women’s rights. Polygamy is forbidden to whom that has no ability to be fair, while inheritance has to be given equally and reasonably.

  13. KONFLIK LINGKUNGAN DI KAMPUNG AGAS, TANJUNG UMA, BATAM (Environmental Conflict in Kampung Agas, Tanjung Uma, Batam

    Directory of Open Access Journals (Sweden)

    Saprial Saprial

    2004-11-01

    Full Text Available ABSTRAK Perkembangan kota Batam sebagai kawasan industri, perdagangan, pelabuhan, dan pariwisata, membawa tidak saja dampak positip, melainkan juga dampak negatif. Salah satu dampak negatif yang muncul adalah konffik lingkungan dalam bentuk pencemaran air di sungai Jodoh yang menganggu pemukiman liar di Kampung Agas, Tanjung Uma. Penelitian ini bertujuan untuk mengkaji akar masalah konflik dan resolusinya. Penelitian ini merupakan studi deskriptif-kualitatip, dengan data yang dikumpulkan melalui wawancara mendalam dengan pihak-pihak yang terlibat dalam konflik. Penelitian ini menemukan bahwa akar masalah konffik adalah konflik spasial antara permukiman liar dan pembangunan ruko yang menimbulkan limbah di sekitar permukiman liar. Tidak dibangunnya IPAL memicu protes warga di permukiman liar dan terjadilah konflik. Penelitian ini melihat bahwa penyelesaian konflik dalam bentuk kompensasi atau “sagu hati" tidak menyelesaikan akar masalah konflik. Walaupun begitu, penyelesaian ini dipandang oleh pihak-pihak yang berkonflik sebagai hasil mufakat yang dimungkinkan untuk menghindari konflik sosial yang lebih besar. Penelitian ini juga menemukan bahwa bentuk penyelesaian konflik melalui musyawarah dan mufakat dapat dilakukan secara efektif sejauh ada mediator yang dipercaya oleh pihak-pihak yang bersengketa.   ABSTRACT The development of Batam City as an area for industry, trade, ship transit, and tourism activities brings not only positive impacts, but negative impact as well. One of the negative impacts is environmental conflict in the form of water pollution in Sei Jodoh downstream which affected informal settlement in Kampung Agas, Tanjung Uma. This research aimed to study the roots of the conflict and evaluated the resolution. It adopted a descriptive, qualitative research method. Data were collected through in-depth interviews with parties involved in the conflict. The research founded that the root causes of the environmental conflict was the

  14. Urinary tract infections at aga Khan University hospital nairobi - a ...

    African Journals Online (AJOL)

    2013-06-11

    Jun 11, 2013 ... (Uti) are normally treated empirically and urine culture is usual ordered for as a last ... symptomatic Uti in patients at aga Khan University hospital by looking at the trends of Uti ... in the context of pyelonephritis in pregnancy(9).

  15. Screening strategies for gestational diabetes mellitus at the Aga ...

    African Journals Online (AJOL)

    Background: Universal screening strategy for gestational diabetes mellitus offers biochemical screening to all women irrespective of risk factor status while selective strategy screens only those with risk factors. The Aga Khan University Hospital adopted a selective screening protocol by consensus. This study compares both ...

  16. AliEn - EDG Interoperability in ALICE

    CERN Document Server

    Bagnasco, S; Buncic, P; Carminati, F; Cerello, P G; Saiz, P

    2003-01-01

    AliEn (ALICE Environment) is a GRID-like system for large scale job submission and distributed data management developed and used in the context of ALICE, the CERN LHC heavy-ion experiment. With the aim of exploiting upcoming Grid resources to run AliEn-managed jobs and store the produced data, the problem of AliEn-EDG interoperability was addressed and an in-terface was designed. One or more EDG (European Data Grid) User Interface machines run the AliEn software suite (Cluster Monitor, Storage Element and Computing Element), and act as interface nodes between the systems. An EDG Resource Broker is seen by the AliEn server as a single Computing Element, while the EDG storage is seen by AliEn as a single, large Storage Element; files produced in EDG sites are registered in both the EDG Replica Catalogue and in the AliEn Data Catalogue, thus ensuring accessibility from both worlds. In fact, both registrations are required: the AliEn one is used for the data management, the EDG one to guarantee the integrity and...

  17. Aga sellepärast, et on po... / Aleksandr Astrov

    Index Scriptorium Estoniae

    Astrov, Aleksandr

    2005-01-01

    Arutledes venekeelse valija hääletuskäitumise ümber juhib autor tähelepanu, et Eestis sätestab üks konkreetne seadus venelastele valimisõiguse, andes neile reaalse poliitilise jõu, teine aga piirab nende juurdepääsu ainult keele kaudu ligipääsetavatele eetikaressurssidele, mis võimaldaksid teha teadlikku valikut

  18. Individuality In the Educational Philosophy of Allama Muhammad Iqbal

    Directory of Open Access Journals (Sweden)

    Imam Bahroni

    2011-06-01

    Full Text Available Nowadays, Muslim Ummah all over the world likely at the cross road,at the position where they watch clearly a phenomenon of life that directsthem into surprising modern civilization with full creativities and innovations,but far away from the true values of Islamic education. On the other hand,they observe vividly numerous dimensions of life that direct every individualinto strong morality, norms and right way of life to discover the Ultimate Reality.This social fact at the end compelled every one of modern people to selectwhich one among these two is the correct ideal for the truth of life.This article tries to elaborate the concept of individuality in the educationalphilosophy of Allama Muhammad Iqbal 2 . In his Lectures, Iqbal elaborated thatindividuality is not a datum but an achievement. It is the fruit of a constant,strenuous effort in and against the forces of the external environment as well asthe disruptive tendencies within man himself. The life of individuality (the Ego,he further explained is a kind of tension caused by the Ego invading theenvironment and the environment invading the Ego.An individual is the basis of all aspects of educations, which then mustbe educated and concerned together with the development of its relationshipto the community. Like the philosopher, the educator must necessarily inquireinto the nature of these two terms of his active individual and the environment,which ultimately determine the solution of all his problems.

  19. An interview with Ali M. Ahad

    DEFF Research Database (Denmark)

    Zoppi, Marco

    2017-01-01

    , and on questions of migration and integration. He is the author of the book “Somali Oral Poetry and the Failed She-Camel Nation State: A Critical Discourse Analysis of the Deelley Poetry Debate (1979-1980)”, published in 2015. Ali is also an eminent voice of Italian post-colonial studies: his “I peccati storici...... del colonialismo” is a must-read for those interested in understanding the legacy of Italian colonialism in Somalia. Marco Zoppi has conducted this interview for WardheerNews.com, and wishes to thank Ali M. Ahad for his kind availability....

  20. AliEnFS - a Linux File System for the AliEn Grid Services

    OpenAIRE

    Peters, Andreas J.; Saiz, P.; Buncic, P.

    2003-01-01

    Among the services offered by the AliEn (ALICE Environment http://alien.cern.ch) Grid framework there is a virtual file catalogue to allow transparent access to distributed data-sets using various file transfer protocols. $alienfs$ (AliEn File System) integrates the AliEn file catalogue as a new file system type into the Linux kernel using LUFS, a hybrid user space file system framework (Open Source http://lufs.sourceforge.net). LUFS uses a special kernel interface level called VFS (Virtual F...

  1. Nobel Peace Laureate Muhammad Yunus: A Banker Who Believes Credit is a Human Right

    Science.gov (United States)

    Szpara, Michelle Yvonne; Ahmad, Iftikhar; Pederson, Patricia Velde

    2007-01-01

    The article profiles Nobel Peace Laureate Muhammad Yunus, founder of Grameen Bank (an independent financial institution in Bangladesh), as well as an economics professor at the University of Chittagong. In his birthplace of Bangladesh, 49.8 percent of people exist below the poverty line, and 73.2 percent of the women are categorized as…

  2. Comparison of Patent Claim Construction between Netherlands and Germany on Basis of AGA v. Occlutech

    NARCIS (Netherlands)

    Tsoutsanis, A.; Kau, C.

    2013-01-01

    This article provides a brief overview on how the Dutch and German courts interpret the claims of a patent. It briefly compares each national approach on the basis of the recent AGA v Occlutech litigation in both countries. The dispute between AGA and Occlutech involved socalled ‘‘occluders’’, a

  3. Interview with Muhammad Affan Othman on Small Changes

    Directory of Open Access Journals (Sweden)

    Vahid Nimehchisalem

    2017-04-01

    Full Text Available Small Changes, a community organization in Malaysia (www.smallchangesmy.org, was founded in 2011 to raise funds and provide support for underprivileged individuals in the community. With an interesting tagline of Cultivating Volunteerism, Empowering Generations this community organizations has raised hundreds of thousands and has attracted tens of Malaysian students from local and overseas universities. The team consists of an enthusiastic group of young Malaysians who believe that it is possible to create big differences in the community with small changes. I had the pleasure of meeting the team in one of their social event in Kuala Lumpur. What you are going to read is the responses provided by the Vice President of Strategic Planning Unit, Mr. Muhammad Affan Othman, who kindly consented to an E-mail interview. The interview VN[1]: Perhaps we could start with a short introduction of Small Changes. Could you please tell our readers about your organization and its objective? MAO[2]: Small Changes started from an idea coined by our founders in which they aspire to create social awareness by making one small change at a time. For example, they started helping flood victims in flood prone locations in Malaysia such as in Kelantan and reaching out orphanage by offering them some help in terms of financial aid. As the organization grows, they started diving into more projects that have diverse aims such as tackling education inequality, which is translated into our Seeds of Deeds initiative, which has been done annually since 2014. However, since 2016, Small Changes has decided to shift gears and start to focus on becoming an organization that offers a platform for volunteering for youths and at the same time empowering both its volunteers and its beneficiaries. These will be made possible through our projects that allow Malaysian youths to participate and become empowered as they are actively participating in a nation building effort. Through these

  4. Stapled hemorrhoidopexy: The Aga Khan University Hospital Experience

    International Nuclear Information System (INIS)

    Athar, Ali; Chawla, Tabish; Turab, Pishori

    2009-01-01

    Stapled hemorrhoidopexy for prolapsing hemorrhoids is conceptually different from excision hemorrhoidectomy. It does not accompany the pain that usually occurs after resection of the sensitive anoderm. This study was carried out to evaluate the clinical outcome of stapled hemorrhoidopexy at The Aga Khan University Hospital. A sample of 140 patients with symptomatic second-, third-, and fourth-degree hemorrhoids and circumferential mucosal prolapse underwent stapled hemorrhoidopexy from July 2002 to July 2007. They were evaluated for postoperative morbidity, analgesic requirement, and recurrence. Seventy-eight percent were males and the mean age was 45 (range 16-90) years. The mean operative time was 35 (15-78) min. The mean parenteral analgesic doses during the first 24 h were 2.1. All patients received oral analgesics alone after 24 h. No significant postoperative morbidity was observed. The mean in-patient hospital stay was 1.3 (0-5) days. Patients were followed-up for 24 (range, 2-48) months. Minor local recurrence of hemorrhoids was seen in four patients and was managed by band ligation. Stapled hemorrhoidopexy procedure was found safe, well tolerated by patients with minimal parenteral analgesic use and early discharge from the hospital. (author)

  5. RELASI-KONFLIK SUKU QURAISH DAN BANI MUSTALIQ DI ERA NABI MUHAMMAD

    Directory of Open Access Journals (Sweden)

    Muhammad Sulthon

    2017-08-01

    Full Text Available This paper examines the role of the prophet Muhammad's preaching in resolving internal conflicts of Quraysh tribe and conflicts between the Quraysh tribe with a descendant of Mustaliq. The goal is to reconstruct their conflicts and Muhammad's position in the middle of the conflict. For that purpose, the data collected from the books of Sirah Nabawiyah as the main source and analyzed so that it can be drawn the conflict relationship between the two tribes and the resolution. The results of the study found the conflict between the Quraysh tribe of the descendant of Mustaliq can be tracked since their ancestors, respectively, before the advent of Muhammad. Fundamental issues regarding with conflicts dealing with political power, self-esteem and group identity. The triggers of conflict that almost rising the violent conflicts between the other were a misunderstanding. In resolving the conflict, the prophet prefers peaceful means despite ever using violence in the form of war. Tulisan ini mengkaji peran dakwah nabi Muhammad dalam menyelesaikan konflik intern suku Quraish maupun konflik antara suku Quraish dengan bani Mustaliq. Tujuannya, merekonstruksi relasi konflik antara mereka dan posisi Muhammad di tengah tengah konflik tersebut. Untuk tujuan itu, data dihimpun dari kitab-kitab Sirah Nabawiyah sebagai sumber utama dan dianalisis sehingga tergambar relasi-konflik tokoh-tokoh dari kedua suku tersebut dan penyelesaiannya. Hasil kajian menemukan, konflik antara suku Quraish dengan bani Mustaliq dapat dilacak sejak nenek moyang mereka masing-masing, sebelum kenabian Muhammad. Issu pokok terjadinya konflik berkenaan dengan persoalan politik kekuasaan, harga diri dan identitas kelompok. Pemicu konflik yang nyaris menimbulkan kekerasan antara lain adalah kesalahpahaman. Dalam menyelesaikan konflik, nabi lebih mengutamakan jalan damai meski pernah menggunakan kekerasan dalam bentuk

  6. Experimental investigation of the Al-Y phase diagram

    International Nuclear Information System (INIS)

    Liu Shuhong; Du Yong; Xu Honghui; He Cuiyun; Schuster, Julius C.

    2006-01-01

    The Al-Y phase diagram has been reinvestigated with 16 key alloys over its whole composition range by means of differential thermal analysis, X-ray diffraction, optical microscopy, and scanning electron microscopy with energy dispersive X-ray techniques. The existence of five intermetallic phases, Al 3 Y, Al 2 Y, AlY, Al 2 Y 3 , and AlY 2 , has been confirmed. Al 2 Y and Al 2 Y 3 melt congruently at 1490 ± 2 and 1105 ± 2 deg. C, respectively. Al 3 Y, AlY, and AlY 2 are formed via the peritectic reactions L + Al 2 Y ↔ Al 3 Y at 980 ± 2 deg. C, L + Al 2 Y ↔ AlY at 1138 ± 2 deg. C, and L + Al 2 Y 3 ↔ AlY 2 at 977 ± 2 deg. C, respectively. Three eutectic reactions L ↔ (Al) + Al 3 Y at 637 ± 2 deg. C, L ↔ AlY + Al 2 Y 3 at 1081 ± 2 deg. C, and L ↔ AlY 2 + (αY) at 955 ± 2 deg. C , are observed. The previously reported Al 3 Y 5 , AlY 3 compounds were not found. A revised Al-Y phase diagram is presented mainly based on the present experimental results

  7. The Efforts of Arab Christians Modernist in Defending the Prophet Muhammad (pbuh

    Directory of Open Access Journals (Sweden)

    Ahmed H. Mekhelef

    2012-12-01

    Full Text Available This paper seeks to monitor the efforts of Arab Christians modernists, in respond to suspicious appellants in the biography of Prophet Muhammad (pbuh. Through researches in books and articles, it had been identified by studying books of writers who emerged in the 20th Century which had been known as the time of writings and researches development in the Arab world. Therefore, the Arab intellectuals began to review and respond what Orientalists have written about Islamic history.

  8. Algunas propuestas innovadoras de Muhammad Yunus para combatir la pobreza y otras carencias socioeconomicas

    OpenAIRE

    Rodr??guez S??nchez de Alva, Alfonso; Rodr??guez L??pez del R??o, Patricia; Rodr??guez L??pez del R??o, Pablo

    2013-01-01

    Aunque son numerosas las iniciativas innovadoras para financiar los programas de desarrollo de los pa??ses menos desarrollados (recargos sobre los billetes a??reos, tasa sobre las transacciones financieras, loter??a solidaria..), la gesti??n de los microcr??ditos por el Banco Grameen fundado por Muhammad Yunus, es probablemente la que ha tenido mayor difusi??n y aceptaci??n.

  9. The role of anthropometric, growth and maturity index (AGaMI) influencing youth soccer relative performance

    Science.gov (United States)

    Bisyri Husin Musawi Maliki, Ahmad; Razali Abdullah, Mohamad; Juahir, Hafizan; Muhamad, Wan Siti Amalina Wan; Afiqah Mohamad Nasir, Nur; Muazu Musa, Rabiu; Musliha Mat-Rasid, Siti; Adnan, Aleesha; Azura Kosni, Norlaila; Abdullah, Farhana; Ain Shahirah Abdullah, Nurul

    2018-04-01

    The main purpose of this study was to develop Anthropometric, Growth and Maturity Index (AGaMI) in soccer and explore its differences to soccer player physical attributes, fitness, motivation and skills. A total 223 adolescent soccer athletes aged 12 to 18 years old were selected as respondent. AGaMI was develop based on anthropometric components (bicep, tricep, subscapular, suprailiac, calf circumference and muac) with growth and maturity component using tanner scale. Meanwhile, relative performance namely physical, fitness, motivation and skills attributes of soccer were measured as dependent variables. The Principal Component Analysis (PCA) and Analysis of Variance (ANOVA) are used to achieve the objective in this study. AGaMI had categorized players into three different groups namely; high (5 players), moderate (88 players) and low (91 players). PCA revealed a moderate to very strong dominant range of 0.69 to 0.90 of factor loading on AGaMI. Further analysis assigned AGaMI groups as treated as independent variables (IV) and physical, fitness, motivation and skills attributes were treated as dependent variables (DV). Finally, ANOVA showed that flexibility, leg power, age, weight, height, sitting height, short and long pass are the most significant parameters statistically differentiate by the groups of AGaMI (p<0.05). As a summary, body fat mass, growth and maturity are an essential component differentiating the output of the soccer players relative performance. In future, information of the AGaMI model are useful to the coach and players for identifying the suitable biological and physiological demand reflects more comprehensive means of youth soccer relative performance. This study further highlights the importance of assessing AGaMI when identifying soccer relative performance.

  10. Analysis list: aly-2 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available aly-2 Larvae + ce10 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/target/aly-2.1....tsv http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/target/aly-2.5.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/target/al...y-2.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/colo/aly-2.Larvae.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/colo/Larvae.gml ...

  11. Remembering for tomorrow: Professor Mansour Ali Haseeb.

    Science.gov (United States)

    Salih, Mustafa Abdalla M

    2013-01-01

    This is a highlight of the obituary ceremony in tribute to Professor Mansour Ali Haseeb (1910 - 1973), organized by the Medical Students Association of the Faculty of Medicine, the University of Khartoum (U of K). Professor Haseeb has been the first Sudanese Professor and first Dean of the Faculty of Medicine. He was an outstanding humane teacher, mentor and researcher, and was awarded the international Dr. Shousha Foundation Prize and Medal by the WHO. He was also an active citizen in public life and became Mayor of Omdurman City. The obituary ceremony reflected the feelings of the medical community and included speeches by Professor Abdalla El Tayeb, President of U of K; the Dean, Faculty of Medicine; the Late Professor Haseeb's colleagues and students, His family representative, and an elegy poem.

  12. MASJID JAMI PITI LAKSAMANA MUHAMMAD CHENG HO PURBALINGGA: SIMBOL KEINDAHAN TOLERANSI DALAM AKULTURASI

    Directory of Open Access Journals (Sweden)

    Dinda Wulan Afriani

    2015-10-01

    terletak di Kabupaten Purbalingga, Jawa Tengah. Masjid Laksamana Muhammad Cheng Ho Purbalingga merupakan salah satu dari tiga masjid Cheng Ho di Indonesia. Kehadiran masjid ini merupakan wujud simbol keindahan toleransi antar etnis dan budaya dalam sebuah akulturasi. Bentuk arsitektur masjid ini merupakan perpaduan dari budaya Islam- Tiongkok-Arab-Jawa. Keistimewaan masjid ini bukan hanya terletak pada bentuk arsitektur bangunan dan ragam hias arsitekturnya saja. Namun juga pada keindahan makna dan nilai falsafah kehidupan yang terkandung di dalamnya, yang tentu saja selaras dengan peran sertanya dalam masyarakat. Dalam membaca tanda dan makna, artikel ini juga menyajikan penalaran melalui metode semiotika visual secara singkat namun cukup padat.

  13. Characterization of ALD grown TixAlyN and TixAlyC thin films

    Science.gov (United States)

    Kinnunen, S. A.; Malm, J.; Arstila, K.; Lahtinen, M.; Sajavaara, T.

    2017-09-01

    Atomic layer deposition (ALD) was used to grow TixAlyN and TixAlyC thin films using trimethylaluminum (TMA), titanium tetrachloride and ammonia as precursors. Deposition temperature was varied between 325 °C and 500 °C. Films were also annealed in vacuum and N2-atmosphere at 600-1000 °C. Wide range of characterization methods was used including time-of-flight elastic recoil detection analysis (ToF-ERDA), X-ray diffractometry (XRD), X-ray reflectometry (XRR), Raman spectroscopy, ellipsometry, helium ion microscopy (HIM), atomic force microscopy (AFM) and 4-point probe measurement for resistivity. Deposited films were roughly 100 nm thick and contained mainly desired elements. Carbon, chlorine and hydrogen were found to be the main impurities.

  14. AliEn: ALICE environment on the GRID

    International Nuclear Information System (INIS)

    Bagnasco, S; Betev, L; Buncic, P; Carminati, F; Cirstoiu, C; Grigoras, C; Hayrapetyan, A; Harutyunyan, A; Peters, A J; Saiz, P

    2008-01-01

    Starting from mid-2008, the ALICE detector at CERN LHC will collect data at a rate of 4PB per year. ALICE will use exclusively distributed Grid resources to store, process and analyse this data. The top-level management of the Grid resources is done through the AliEn (ALICE Environment) system, which is in continuous development since year 2000. AliEn presents several original solutions, which have shown their viability in a number of large exercises of increasing complexity called Data Challenges. This paper describes the AliEn architecture: Job Management, Data Management and UI. The current status of AliEn will be illustrated, as well as the performance of the system during the data challenges. The paper also describes the future AliEn development roadmap

  15. AliEn: ALICE Environment on the GRID

    CERN Multimedia

    Bagnasco, S; Buncic, P; Carminati, F; Cirstoiu, C; Grigoras, C; Hayrapetyan, A; Harutyunyan, A; Peters, A J; Saiz, P

    2007-01-01

    Starting from mid-2008, the ALICE detector at CERN LHC will collect data at a rate of 4PB per year. ALICE will use exclusively distributed Grid resources to store, process and analyse this data. The top-level management of the Grid resources is done through the AliEn (ALICE Environment) system, which is in continuous development since year 2000. AliEn presents several original solutions, which have shown their viability in a number of large exercises of increasing complexity called Data Challenges. This paper describes the AliEn architecture: Job Management, Data Management and UI. The current status of AliEn will be illustrated, as well as the performance of the system during the data challenges. The paper also describes the future AliEn development roadmap.

  16. Pengaruh Muhammad Haqqi al-Nazilli (m. 1884 terhadap Amalan Keagamaan Masyarakat Melayu

    Directory of Open Access Journals (Sweden)

    Wahyu Hidayat Abdullah

    2014-12-01

    Full Text Available Muhammad Haqqi al-Nazilli (m. 1884 merupakan salah seorang tokoh ulama Islam yang penting pada abad kesembilan belas. Walaupun berasal dari Turki, beliau telah menghabiskan kebanyakan usia dan kerjayanya sebagai seorang ilmuwan yang berdomisil di Mekah dan terkenal sebagai pakar dalam bidang ilmu hadis dan tasawuf. Selain aktif mengajar, beliau turut menghasilkan sejumlah karya keagamaan yang penting dalam bahasa Arab. Secara khasnya, adikarya beliau bertajuk Khazinah al-Asrar Jalilah al-Adhkar memainkan peranan yang penting terutama sekali dalam kalangan pelajarnya yang berasal dari Alam Melayu. Ia merupakan karya berasaskan hadis Nabi SAW mengenai kelebihan dan fadilat ayatayat al-Quran dan ibadat-ibadat lain. Walau bagaimanapun, tidak banyak yang diketahui mengenai tokoh ini dan karyanya. Justeru, makalah ini bertujuan untuk membincangkan mengenainya dengan lebih mendalam. Selain membincangkan aspek biografi dan hasil karya Muhammad Haqqi dari perspektif sejarah, kertas ini terfokus untuk menganalisis metodenya dalam penilaian dan penerimaan hadis berdasarkan karyanya Khazinah al- Asrar dan pengaruhnya terhadap sesetengah amalan keagamaan masyarakat Melayu. Dapatan kajian mengetengahkan sikapnya yang mengharmonikan pandangan ulama hadis dan tasawuf dalam aspek penerimaan hadis yang memberikan kesannya terhadap amalan keagamaan masyarakat Islam, terutamanya di Alam Melayu.

  17. BIMBINGAN KONSELING HOLISTIK UNTUK MEMBANTU PENYESUAIN DIRI MUALAF TIONGHOA MESJID MUHAMMAD CHENGHO PALEMBANG

    Directory of Open Access Journals (Sweden)

    Neni Noviza

    2015-12-01

    Full Text Available This study aims to determine how the adjustment itself on converts . Subjects were converts tionghoa mosque Muhammad Chengho Palembang. This study is a qualitative study with a phenomenological approach . Data were obtained and collected through semi-structured interviews and observations by using the interview guide and checklist list . Then , the data were analyzed using analysis of data reduction , display / presentation of data and making conclusions / verification of interactive models of Miles & Huberman ( 1992 . The results showed that the problems experienced by the Muslim convert Muhammad Cheng Ho Mosque is a matter of family , career and employment issues , and marginalized by other communities. The Individuals who have a religious conversion " more tasks " that adjust from changes in themselves and habits to obtain satisfactory relationships with other people and our environment . The problems associated with the present most fundamental change in the lives of converts after deciding to perform religious conversion requires the adjustment mainly in the habit of worship and in the family who did not convert to the faith of the subject . Holistic counseling through religious counseling and bibliotherapy approach is one way to help the adjustment to convert

  18. KOMPARASI PENDIDIKAN ISLAM K.H. AHMAD DAHLAN DAN MUHAMMAD FETHULLAH GÜLEN

    Directory of Open Access Journals (Sweden)

    Mohamad Ali

    2016-05-01

    Full Text Available Islamic education is considered only oriented to the hereafter alone, teach rituals and develop a defensive posture and formisme paradigm. On the other hand, Islamic education is faced with the phenomenon of discontinuity which marked the waning value of respect for the basic values and ethics, such as honesty, discipline, tolerance. This Problem is what ignited K.H. Ahmad Dahlan (1868-1923 and Muhammad Fethullah Gülen (1838 - ... strengthening Islamic education. This study aims to understand the concepts, practices, and comparative Islamic education K.H. Ahmad Dahlan and Muhammad Fethullah Gülen. This type of research is the study of literature  with historical and philosophical approach. The results show: first, the concept of Islamic education K.H. Ahmad Dahlan stressed intregration of religious sciences and the modern sciences, tolerance, open to modernity and perfection of mind (intellect; for Fethullah Gülen education is a manifestation of Allah, which emphasizes ethics, science, and theology. Secondly, the common the sharing concept between the two are at: ideas, foundation, educational goals and teaching methods. Third, while the point of difference lies in the educational materials, dormitory educational models (boarding school and implementing a system of moving class.

  19. Prognostic Significance of Modified Advanced Lung Cancer Inflammation Index (ALI) in Patients with Small Cell Lung Cancer_ Comparison with Original ALI.

    Science.gov (United States)

    Kim, Eun Young; Kim, Nambeom; Kim, Young Saing; Seo, Ja-Young; Park, Inkeun; Ahn, Hee Kyung; Jeong, Yu Mi; Kim, Jeong Ho

    2016-01-01

    Advanced lung cancer inflammation index (ALI, body mass index [BMI] x serum albumin/neutrophil-lymphocyte ratio [NLR]) has been shown to predict overall survival (OS) in small cell lung cancer (SCLC). CT enables skeletal muscle to be quantified, whereas BMI cannot accurately reflect body composition. The purpose was to evaluate prognostic value of modified ALI (mALI) using CT-determined L3 muscle index (L3MI, muscle area at L3/height2) beyond original ALI. L3MIs were calculated using the CT images of 186 consecutive patients with SCLC taken at diagnosis, and mALI was defined as L3MI x serum albumin/NLR. Using chi-squared test determined maximum cut-offs for low ALI and low mALI, the prognostic values of low ALI and low mALI were tested using Kaplan-Meier method and Cox proportional hazards analysis. Finally, deviance statistics was used to test whether the goodness of fit of the prognostic model is improved by adding mALI as an extra variable. Patients with low ALI (cut-off, 31.1, n = 94) had shorter OS than patients with high ALI (median, 6.8 months vs. 15.8 months; p ALI and low mALI (z = 0.000, p = 1.000) and between high ALI and high mALI (z = 0.330, p = 0.740). Multivariable analysis showed that low ALI was an independent prognostic factor for shorter OS (HR, 1.67, p = 0.004), along with advanced age (HR, 1.49, p = 0.045), extensive disease (HR, 2.27, p ALI using BMI. ALI is a simple and useful prognostic indicator in SCLC.

  20. FOLLOWING THE PROPHET MUHAMMAD CHARACTER THROUGH NGABULEH TRADITION IN PONDOK PESANTREN DARUL ULUM BANYUANYAR PAMEKASAN

    Directory of Open Access Journals (Sweden)

    Moh. Wardi

    2018-06-01

    Full Text Available This research is part of the relevance of personality character of the Prophet Muhammad with the ngabuleh tradition in the theory of FAST (fathanah, amanah, siddiq, and tabligh. The purpose of this study is to find out and explain the ngabuleh tradition in religious, cultural, and economic reviews. The study is categorized in phenomenological research using qualitative approach. The data were obtained from observation, in-depth interview, and documentary study. It was then analyzed by data reduction, data presentation, and conclusion phase. Informant in this study is kabuleh in Pondok Pesantren Darul Ulum at Banyuanyar District, Pamekasan Regency. The results show that,in the view of religion ngabuleh is the implementation of Islamic values about following the character of the Prophet Muhammad and sincerity. Culturally, as a form of adherence of high respect to the pillars of culture in Madura, namely bhuppa’-bhabhu’-ghuru-rato (father, mother, teacher/kiai and queen/government. Economical-wise, ngabuleh is a kind of paying respect to the kiai by working in the corporate run by kiai/Pesantren and at once, contributing santri’s skill and competence in the field of entrepreneur. Penelitian ini merupakan bagian dari relevansi karakter kepribadian Nabi Muhammad dengan tradisi kabuleh dalam teori FAST (fathanah, amanah, siddiq, and tabligh. Tujuan penelitian ini adalah untuk mengetahui dan menjelaskan tradisi ngabuleh dalam tinjauan agama, budaya, dan ekonomi. Metode yang digunakan dalam penelitian ini adalah kualitatif dengan jenis penelitian fenomenologis. Data diperoleh dari hasil observasi berperan serta, wawancara mendalam, dan studi dokumentasi. Analisis data dilakukan dengan reduksi data, penyajian data, dan tahap kesimpulan. Informan dalam penelitian ini kabuleh di Pesantren Darul Ulum Banyuanyar Pamekasan. Hasil penelitian menunjukan bahwa, secara agama, ngabuleh merupakan implementasi nila-nilai ajaran Islam tentang keteladanan sifat

  1. AliEn: ALICE Environment on the GRID

    CERN Multimedia

    CERN. Geneva

    2012-01-01

    AliEn is the GRID middleware used by the ALICE collaboration. It provides all the components that are needed to manage the distributed resources. AliEn is used for all the computing workflows of the experiment: Montecarlo production, data replication and reconstruction and organixed or chaotic user analysis. Moreover, AliEn is also being used by other experiments like PANDA and CBM. The main components of AliEn are a centralized file and metadata catalogue, a job execution model and file replication model. These three components have been evolving over the last 10 years to make sure that the satisfy the computing requirements of the experiment, which keep increasing every year.

  2. QADIYAH AL-ISTI'BAD FI SYI'R MUHAMMAD AL-FAYTURI

    Directory of Open Access Journals (Sweden)

    Zamri Arifin

    2017-08-01

    Full Text Available The issue of slavery is one of the most important issues that have plagued mankind, both ancient and modern. The contemporary Arab poet Muhammad Miftah al-Fittouri was the first Arab poet to address this issue and to discuss the issues of African and Zenism in a qualitative and quantitative manner. Therefore, this study is aimed at presenting the efforts of the scholars of this issue in the poetry of this poet. The study revealed the intersections of the poetry with the components and manifestations of the issue of (slavery and the different poetic stages, as demonstrated by the poet's poetic. The research concluded that the literary and monetary field lacked a systematic study of this issue, revealing its motives and artistic manifestations, and the various aspects of it emerge according to a modern scientific method.

  3. Ten Years after the Danish Muhammad Cartoon News Stories: Terror and Radicalization as Predictable Media Events

    DEFF Research Database (Denmark)

    Hervik, Peter

    2018-01-01

    , radicalization as a “pre-terrorist” phase has become the lens through which the category “Muslims” has been represented in much media coverage. In this article, I argue that the dominant hegemonic understanding in Denmark that is based on a certain spatial–racial logic is not a passive production of knowledge......In the tenth year after Danish daily Jyllands-Posten published twelve cartoons, the Muhammad Cartoons, this media event—and the hegemonic understanding behind it—continues to be a discursive reference point for new controversies around national borders and racial boundaries. Then, since late 2010....... It keeps informing news coverage of media events as terror and thereby risking describing the hegemony more than adequately understanding the events at hand....

  4. TAFSIR ALQUR’AN PARADIGMA INTEGRATIF: STUDI ATAS QIRA’AH ALTHANIYAH MUHAMMAD SYAHRUR

    Directory of Open Access Journals (Sweden)

    Abdul Malik

    2017-06-01

    Full Text Available This article describes on the alternative reading (qira'ah altaniyah of Alqur’an proposed by Muhammad Shahrur, in his work “Alkitab wa Alqur’an: Qira'ah Almu'ashirah”. Through this work, Syahrur proposed an integrative-interpretation method which is built through combining analysis of natural science, social science, and tafsir. Based on the descriptive analysis approach to this works, this study found out two important things: (1 Syahrur using mathematical analysis to interpret the muhkamat’s verses and science analysis for mutasyabihat’s verses. (2 Hudud is a result of the integrative analysis interpretation based on the linguistic and mathematic analysis in understanding the Quranic verses about the law, while ta’wil ilmi is an understanding toward mutasyabihat verses, like the revelation, which is based on the analysis of natural science cognitive.

  5. STUDI KOMPARASI PEMIKIRAN ABUL A’LA MAUDUDI DENGAN MUHAMMAD NATSIR TENTANG KONSEP NEGARA ISLAM

    Directory of Open Access Journals (Sweden)

    Ainur Ropik

    2015-12-01

    Full Text Available This paper discusses Abul A'la Maududi comparative thoughts with Muhammad Natsir about the concept of the Islamic State, both in terms of state ideology and form of government. Despite his two live in different social settings, but his political thinking, especially about the Nation of Islam have a lot in common, yet on the other hand there is also the difference, while the striking similarities in the concept of Maududi and M. Natsir are equally wanted the establishment of an Islamic state as a whole. While the difference is the legal basis of each character is like taking Ayat al-Quran and al-Hadith different interpretation. If Maududi considers democracy as shirk, but Natsir considered legitimate democratic origin remains contrary to Islamic law.

  6. La Ode Muhammad Idrus Qaimuddin Sastrawan Sufi Ternama di Buton Abad XIX

    Directory of Open Access Journals (Sweden)

    La Niampe

    2012-11-01

    Full Text Available This article talk about the characterization of La Ode Muhammad Idrus Qaimuddin as a popular mystical in Buton in XIX century. Among the mystical characters at his period, he known as a productive writer. His works in mysticism side was written in some languages (Wolio language, Malay, and Arabic. On of his popular poem entitled "Bula Malino" its content is about seeing which directed to him self. According to him, loving and teaching him self is a main need in the human life, so he clarified through his poem motuyaapa kaasina miya yitu, yinda molawana kaasimu yikaromu, moo sarowu guru Bemo yadariko yinda molawana yoda-yadari karomu. However people love us, it is still better loving ourselves, even though a thousand teachers who teach us, it is better we teach ourselves.

  7. AliEn - ALICE environment on the GRID

    CERN Document Server

    Saiz, P; Buncic, P; Piskac, R; Revsbech, J E; Sego, V

    2003-01-01

    AliEn (http://alien.cern.ch) (ALICE Environment) is a Grid framework built on top of the latest Internet standards for information exchange and authentication (SOAP, PKI) and common Open Source components. AliEn provides a virtual file catalogue that allows transparent access to distributed datasets and a number of collaborating Web services which implement the authentication, job execution, file transport, performance monitor and event logging. In the paper we will present the architecture and components of the system.

  8. AliEn - ALICE environment on the GRID

    International Nuclear Information System (INIS)

    Saiz, P.; Aphecetche, L.; Buncic, P.; Piskac, R.; Revsbech, J.-E.; Sego, V.

    2003-01-01

    AliEn (http://alien.cern.ch) (ALICE Environment) is a Grid framework built on top of the latest Internet standards for information exchange and authentication (SOAP, PKI) and common Open Source components. AliEn provides a virtual file catalogue that allows transparent access to distributed datasets and a number of collaborating Web services which implement the authentication, job execution, file transport, performance monitor and event logging. In the paper we will present the architecture and components of the system

  9. Qalandar-name. Chapter 2. “Praise and blessing upon Muhammad Mustafa”

    Directory of Open Access Journals (Sweden)

    Milyausha Ismagilova

    2014-09-01

    Full Text Available The present fragment contains the translated continuation of a medieval poetic text “Qalandar-name” written by the Crimean Sufi author Abu Bakr Qalandar. This fragment contains the second chapter devoted to praising (Salawat the Prophet Muhammad, after which the poet will glorify his righteous caliphs (al-Khulafa al-rashidun. As it appears from the author’s praises, he was a follower of Sunni Islam and, at the same time, a representative of the Sufi order (tariqa. Titles and names that Abu Bakr Kalandar uses in his chanting of Muhammad, are very familiar both to researchers of the Islamic religion and ordinary Muslims. He calls the Prophet the Lord (Sayyid of both worlds, Elect, Light, Leader of all the prophets and saints. The author mentions some famous miracles of the Messenger of Allah, such as the night journey (Isra and ascension to the seventh heaven (Mi’raj, the moon’s splitting and inanimate objects’ speaking. He also makes an allusion to the mystical interpretation of the Qur’an in relation to the hair of the Prophet. The Persian text is translated by Milyausha Ismagilova, a postgraduate student. Translation edition and comments are supplied by Damir Shagaviyev, Head of the Department of History of Public Thought and Islamic Studies of the Sh.Marjani Institute of History, Academy of Sciences of the Republic of Tatarstan (Kazan. * Continuation of the article. See beginning of the article in: Golden Horde Review, 2014, no. 2(4, pp.243–252.

  10. Prognostic Significance of Modified Advanced Lung Cancer Inflammation Index (ALI in Patients with Small Cell Lung Cancer_ Comparison with Original ALI.

    Directory of Open Access Journals (Sweden)

    Eun Young Kim

    Full Text Available Advanced lung cancer inflammation index (ALI, body mass index [BMI] x serum albumin/neutrophil-lymphocyte ratio [NLR] has been shown to predict overall survival (OS in small cell lung cancer (SCLC. CT enables skeletal muscle to be quantified, whereas BMI cannot accurately reflect body composition. The purpose was to evaluate prognostic value of modified ALI (mALI using CT-determined L3 muscle index (L3MI, muscle area at L3/height2 beyond original ALI.L3MIs were calculated using the CT images of 186 consecutive patients with SCLC taken at diagnosis, and mALI was defined as L3MI x serum albumin/NLR. Using chi-squared test determined maximum cut-offs for low ALI and low mALI, the prognostic values of low ALI and low mALI were tested using Kaplan-Meier method and Cox proportional hazards analysis. Finally, deviance statistics was used to test whether the goodness of fit of the prognostic model is improved by adding mALI as an extra variable.Patients with low ALI (cut-off, 31.1, n = 94 had shorter OS than patients with high ALI (median, 6.8 months vs. 15.8 months; p < 0.001, and patients with low mALI (cut-off 67.7, n = 94 had shorter OS than patients with high mALI (median, 6.8 months vs. 16.5 months; p < 0.001. There was no significant difference in estimates of median survival time between low ALI and low mALI (z = 0.000, p = 1.000 and between high ALI and high mALI (z = 0.330, p = 0.740. Multivariable analysis showed that low ALI was an independent prognostic factor for shorter OS (HR, 1.67, p = 0.004, along with advanced age (HR, 1.49, p = 0.045, extensive disease (HR, 2.27, p < 0.001, supportive care only (HR, 7.86, p < 0.001, and elevated LDH (HR, 1.45, p = 0.037. Furthermore, goodness of fit of this prognostic model was not significantly increased by adding mALI as an extra variable (LR difference = 2.220, p = 0.136.The present study confirms mALI using CT-determined L3MI has no additional prognostic value beyond original ALI using BMI. ALI

  11. AliEn - GRID application for ALICE Collaboration

    International Nuclear Information System (INIS)

    Zgura, Ion-Sorin

    2003-01-01

    AliEn (ALICE Environment) is a GRID framework built on top of the latest Internet standards for information exchange and authentication (SOAP, PKI) and common Open Source components. AliEn provides a virtual file catalogue that allows transparent access to distributed data-sets and a number of collaborating Web services which implement the authentication, job execution, file transport, performance monitor and event logging.The ALICE experiment has developed AliEn as an implementation of distributed computing infrastructure needed to simulate, reconstruct and analyze data from the experiment. The sites that belong to the ALICE Virtual Organisation can be seen and used as a single entity - any available node executes jobs and access to logical and datasets is transparent to the user. In developing AliEn common standards and solutions in the form of Open Source components were used. Only 1% (25k physical lines of code in Perl) is native AliEn code while 99% of the code has been imported in form of Open Sources packages and Perl modules. Currently ALICE is using the system for distributed production of Monte Carlo data at over 30 sites on four continents. During the last twelve months more than 30,000 jobs have been successfully run under AliEn control worldwide, totalling 25 CPU years and producing 20 TB of data. The user interface is compatible to EU DataGrid at the level of authentication and job description language. In perspective AliEn will be interfaced to the mainstream Grid infrastructure in HEP and it will remain to serve as interface between ALICE Offline framework and external Grid infrastructure. (authors)

  12. Site Protection Program and Progress Report of Ali Observatory, Tibet

    Science.gov (United States)

    Yao, Yongqiang; Zhou, Yunhe; Wang, Xiaohua; He, Jun; Zhou, Shu

    2015-08-01

    The Ali observatory, Tibet, is a promising new site identified through ten year site survey over west China, and it is of significance to establish rules of site protection during site development. The site protection program is described with five aspects: site monitoring, technical support, local government support, specific organization, and public education. The long-term sky brightness monitoring is ready with site testing instruments and basic for light pollution measurement; the monitoring also includes directions of main light sources, providing periodical reports and suggestions for coordinating meetings. The technical supports with institutes and manufacturers help to publish lighting standards and replace light fixtures; the research pays special attention to the blue-rich sources, which impact the important application of high altitude sites. An official leading group towards development and protection of astronomical resources has been established by Ali government; one of its tasks is to issue regulations against light pollution, including special restrictions of airport, mine, and winter heating, and to supervise lighting inspection and rectification. A site protection office under the official group and local astronomical society are organized by Ali observatory; the office can coordinate in government levels and promote related activities. A specific website operated by the protection office releases activity propaganda, evaluation results, and technical comparison with other observatories. Both the site protection office and Ali observatory take responsibility for public education, including popular science lectures, light pollution and energy conservation education. Ali Night Sky Park has been constructed and opens in 2014, and provides a popular place and observational experience. The establishment of Ali Observatory and Night Sky Park brings unexpected social influence, and the starry sky trip to Ali becomes a new format of culture

  13. Hassan Aga and his Government in Algiers. The Consolidation of a Mediterranean Myth

    Directory of Open Access Journals (Sweden)

    Fernando FERNÁNDEZ LANZA

    2014-12-01

    Full Text Available This work tries to describe graphically the consolidation of a social myth in the unsettled Mediterranean of the 16th century, through a personage: the Spanish convert to Islam Hassan Aga (Azan Aga, the Sardinian renegade who succeeded Hayreddin Barbarrosa at the helms of Algiers from 1533 till his death ten years later. This was a period of intense activity, with the climax that came with the expedition of Charles to Algiers in 1541, whose spectacular defeat can be considered as the principal nucleus of the myth of this popular personage who as a Sardinian slave came to defeat the Emperor. A myth of social ascension with maquiavelical profiles of a new prince of the frontiers.

  14. ITIJAHAT KAUN AL-NABI WA AL-RASUL FI SYAKHSIYAH MUHAMMAD FI NATSR MAULID AL-BARZANJI

    Directory of Open Access Journals (Sweden)

    Himmah Istomah

    2017-08-01

    Full Text Available One of human personalities is humanist. Based on the understanding of Maslow’s theory of motivation, researcher seeks to uncover kinds of motivational needs of Muhammad Saw contained in Maulid Al-Barzanjiy (the work of Ja 'far bin Hasan al-Barzanji (d. 1763 M. The goal is realized through a descriptive qualitative approach with  text analysis  about Psycholiterature of Endraswara. The results of this study indicate that in Maulid Al-Barzanji there are Muhammad Saw’s five needs and how their satisfying perfectly,  namely: physiological needs, safety, social, esteem, and self-actualization. Thus, it can be interpreted that Muhammad SAW as an ordinary human having motivational needs. His prophetic and apostleship honor is not a direct blessing from Allah, but he had been through some complicated processes in life. This can be applied by his followers, so they can complete their motivational needs to reach the satiation as a caliph and to be useful person in this world.

  15. Implications of the ICRP draft recommendations for ALIs

    International Nuclear Information System (INIS)

    Stather, J.W.; Kendall, G.M.; Phipps, A.W.

    1990-01-01

    The results of the calculations summarised here suggest that under the new scheme for calculating annual limits on intake proposed by ICRP there may still be a need for an organ dose limit. This would lose one of the main advantages of the new scheme, namely that ALIs could be strictly additive. Adjusting the weighting factors and allocating the 'remainder' to possibly two tissues with the highest doses would result in effectances from different radionuclides which were not strictly additive. If, however, for practical purposes effectance could be taken to be additive, then the resulting ALIs could be apportioned between different radionuclides as desired. (author)

  16. High-frequency oscillatory ventilation in ALI/ARDS.

    Science.gov (United States)

    Ali, Sammy; Ferguson, Niall D

    2011-07-01

    In the last 2 decades, our goals for mechanical ventilatory support in patients with acute respiratory distress syndrome (ARDS) or acute lung injury (ALI) have changed dramatically. Several randomized controlled trials have built on a substantial body of preclinical work to demonstrate that the way in which we employ mechanical ventilation has an impact on important patient outcomes. Avoiding ventilator-induced lung injury (VILI) is now a major focus when clinicians are considering which ventilatory strategy to employ in patients with ALI/ARDS. Physicians are searching for methods that may further limit VILI, while still achieving adequate gas exchange. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. A novel base change leading to Hb Vanderbilt [β89(F5)Ser→Arg, AGT>AGA].

    Science.gov (United States)

    Goodyer, Matthew J; Elhassadi, Ezzat I; Percy, Melanie J; McMullin, Mary F

    2011-01-01

    We describe a high oxygen affinity hemoglobin (Hb) variant (Hb Vanderbilt) as a result of a heterozygous novel base change from T to A at codon 89 (AGT>AGA) leading to an amino acid change from serine to arginine.

  18. A discussion about the version of the Bible available to Muhammad

    Directory of Open Access Journals (Sweden)

    Hendrik G. Stoker

    2017-10-01

    This article offers both a response to the Muslim apologist arguments regarding biblical integrity and trustworthiness as well as explains that what Muhammad knew as the Bible through the Syriac Peshitta is essentially the same in biblical content as what most reputable Bible versions contain today. Through the efforts of labour intensive manuscript discovery and exhaustive textual criticism, both Christians and Muslims can know with precision what the early writers of both the Old and New Testament wrote as ‘inspired’ Scripture. In order for the Muslim to be consistent in following the mandate to believe all the books previously given by God as well as the Qur’an, he must believe the Syriac Peshitta, or a Bible version that is a comparable translation, in order for the Muslim mandate to make sense. Such a concession, however, places the Muslim in an extremely difficult position that needs to be discussed between Christians and Muslims if they both wish and desire to be thought of as worshiping the one true God.

  19. Metode Darb al-Amthâl dalam Penafsiran Muhammad ‘Abduh

    Directory of Open Access Journals (Sweden)

    Agus Salim

    2015-09-01

    Full Text Available Muh}ammad ‘Abduh had ground the orientation of the Koran in the line of Muslim life. In other words, interpretations are always aiming to make the Koran as well as applying the guidance in public life as a solution to the problem of street life. Therefore, associated with verses mubham and mutashâbih, ‘Abduh closer to the bow of the salaf scholars who prefer silence and surrender fully to God’s intention (tafwîd. However, on several occasions, he sometimes shifts from the bow, for example, when in contact with mutashâbih verses, verses related to the supernatural, and the stories in the Koran as may be necessary to explain in detail. In this position, he sometimes refers to methods tamthîl as tafwîd form or otherwise as a form of ta’wîl. This article will explore the darb al-amthâl in view of ‘Abduh as one method of interpreting the Koran from his works that contain related ideas and his interpretation of the Koran and the consideration of the methods of darb al-amthâl

  20. New Approach in Religious Studies with Special Reference to Muhammad Abid al-Jabiri

    Directory of Open Access Journals (Sweden)

    Nirwan Syafrin

    2014-11-01

    Full Text Available Beginning from the nineteenth century, Arab-Muslim intelligentsias marched to reform their societies. Many things since then have been carried out. They put forward various proposals, advanced numerous ideas and concepts and established several institutions. Nevertheless, their condition has yet improved. In some context, it even deteriorates. Triggered by this situation, a number of Arab and Muslim scholars then embark on a new reform project. But at this time, their reform attempt is materialized in the form of intellectual and cultural project. For they believe that the basic problem and crisis beset their society lies in their understanding of turâts. Thus, unless this understanding is corrected, no genuine reform would be able to be materialized. Muhammad ‘Abid al-Jabiri, a Moroccan scholar, is one of the many Arab scholars who have taken this course. For this purpose, he constructed his own project which he names Naqd al-‘Aql al-‘Arabi. This article specifically attempts to shed light on conceptual apparatus and methods that he uses which this study finds to have originated from different schools of thought of western philosophy and social sciences, important of which is Marxism and postmodernism.

  1. A Mathematician Hussein Ryfky Tamani ibn Muhammad ibn Kyrym Ghazi »

    Directory of Open Access Journals (Sweden)

    M.A. Useinov

    2015-09-01

    Full Text Available In this article an attempt is made to open up and make the analysis of the creative work of one of the outstanding scholar-mathematician in the Ottoman Empire at the end of the 18th – beginning of the 19th centuries whose origin was from the Crimean Khanate – Hussein Ryfky Tamani ibn Muhammad ibn Kyrym Ghazi. At the beginning of the 19th century, during 11 years, the scholar was a leader (bashkhoja of the Ground forces military-engineering school (Muhendishane-i berry-i Humayun in Istanbul. The article provides a review of translations made by Hussein Ryfky into the Ottoman language of European scientists’ works, as well as of his own research works on Geometry, Engineering and Military science, Astronomy, Geography, and other disciplines. The author also presents the textbooks having for centuries become the basic textbooks in the Ottoman Empire for learning exact sciences in the military educational institutions. The author provides the analysis of the pedagogical and public activity of the scientist during the period of reforms Nizam-i-Jedid, as well as the short description of his activities during the student years. Hussein Ryfky Tamani made a synthesis of Western and Ottoman approaches to the science. His works became the corner-stone in the foundation of Ottoman Mathematical science at the beginning of the 19th century.

  2. Tasawuf Transformatif sebagai Solusi Problematika Manusia Modern dalam Perspektif Pemikiran Tasawuf Muhammad Zuhri

    Directory of Open Access Journals (Sweden)

    Rahmad Yulianto

    2015-09-01

    Full Text Available This article discusses the relevance between Sufism and modernity in the perspective Muhammad Zuhri. This study concludes that transformative Sufism which has been initiated by Zuhri is a sort of Sufism which is grounded to the spirit and values of the fundamental teachings of Sufism, shown in accordance with the context of its time, and discussed with the problems of human beings in dealing with the dynamics of life. Modern life has led to the problem of alienation. Of course, the alienation does not merely occur within individual dimensions (self-consciousness of human (alienation of consciousness, but it also occurs in their relationship to the nature (ecological alienation, and the relationship among human beings (social alienation. The point of relevance is how the human are subsequently able to build their self-consciousness toward the universe and their human brothers. Such awareness is then contextualized into the dimensions of the problems of modern man. The contextualization of this Sufi teaching makes the transformative Sufism not only actual, but also relevant in order to “liberate” the modern man from entanglement of various problems they deal with. The spirit of Sufism brought by Zuhri seems to be laden with social actions and communal aspects.

  3. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    Energy Technology Data Exchange (ETDEWEB)

    Ermolayev, Vladimir [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Cohrs, Christian M. [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Mohajerani, Pouyan; Ale, Angelique [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Hrabé de Angelis, Martin [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Ntziachristos, Vasilis, E-mail: v.ntziachristos@tum.de [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany)

    2013-03-08

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1{sup Aga2/+}, animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing.

  4. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    International Nuclear Information System (INIS)

    Ermolayev, Vladimir; Cohrs, Christian M.; Mohajerani, Pouyan; Ale, Angelique; Hrabé de Angelis, Martin; Ntziachristos, Vasilis

    2013-01-01

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1 Aga2/+ , animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing

  5. MPC and ALI: their basis and their comparison

    International Nuclear Information System (INIS)

    Kennedy, W.E. Jr.; Watson, E.C.

    1981-03-01

    Radiation protection regulations in the United States have evolved from the recommendations of the International Commission on Radiological Protection (ICRP) and the National Council on Radiation Protection and Measurements (NCRP). In 1959, the ICRP issued Publication 2 which contained specific recommendations on dose rate limits, permissible body burdens, metabolic data for radionuclides, and maximum permissible concentrations (MPC) in air or water. Over the next 20 years, new information became available concerning the effects of radiation, the uptake and retention of radionuclides, and the radioactive decay schemes of parent radionuclides. To include this newer information, the ICRP issued Publication 30 in 1978 to supersede Publication 2. One of the secondary limits defined in Publication 30 is the annual limit of intake (ALI). Radionuclide specific ALI values are intended to replace MPC values in determining whether or not ambient air and water concentrations are sufficiently low to maintain the dose to workers within accepted dose rate limits. In this paper, we discuss the derivation of MPC and ALI values, compare inhalation committed dose equivalent factors derived from ICRP Publications 2 and 30, and discuss the practical implications of using either MPC or ALI in determining compliance with occupational exposure limits. 6 references

  6. Sidi Ali Ou Azza (L4): A New Moroccan Fall

    Science.gov (United States)

    Chennaoui Aoudjehane, H.; Agee, C. B.; Aaranson, A.; Bouragaa, A.

    2016-08-01

    Sidi Ali Ou Azza is the latest meteorite fall in Morocco, it occurred on 28 July 2015 very close (about 40 km) to Tissint martian shergottite fall that occurred on 18 July 2011. It's one of the small group of 23 L4 ordinary chondrite falls.

  7. ALI--A Digital Archive of DAISY Books

    Science.gov (United States)

    Forsberg, Asa

    2007-01-01

    ALI is a project to develop an archive for talking books produced by the Swedish universities. The universities produce talking books from the mandatory literature for students with reading disabilities, including mostly journal articles, book chapters and texts written by teachers. The project group consists of librarians and co-ordinators for…

  8. Suurajatolla Ali al-Sistani saabus Najaffi / Kalev Vilgats

    Index Scriptorium Estoniae

    Vilgats, Kalev

    2004-01-01

    Mässulise shiiidivaimuliku Moqtada al-Sadri Mahdi armee võitlejad on pidanud Najafis USA vägedega lahinguid juba kolm nädalat. Iraagi kõrgeim shiiiavaimulik suurajatolla Ali al-Sistani kutsub kõiki iraaklasi endaga Najaffi marssima, et lahingutele lõpp teha

  9. The final story on the ALA3/ALIS1 complex

    DEFF Research Database (Denmark)

    Lopez Marques, Rosa Laura

    The final story on the ALA3/ALIS1 complex. Lisbeth R. Poulsena, Rosa L. López-Marquésa, Alexander Schultza, Stephen C. McDowellb, Juha Okkeric, Dirk Lichtc, Thomas Pomorskic,  Jeffrey F. Harperb, and Michael G. Palmgrena,1 aCentre for Membrane Pumps in Cells and Disease - PUMPKIN, Danish National......).              Through a database search we have previously identified five Cdc50p/Lem3p homologues in Arabidopsis (ALIS1-5 for ALA Interacting Subunit)..We investigated the capacity of ALA3, alone and in combination with expressed ALIS proteins, to functionally complement a battery of yeast mutants carrying deletions...... in endogenous P4-ATPases. Our results indicated that ALIS1 functions as a true ß-subunit for the Arabidopsis putative flippase ALA3, being required for ATP-dependent phospholipid transport and for genetic complementation of the yeast P4-ATPase gene Drs2, which is involved in vesicle budding from the late Golgi...

  10. Enhancing the AliEn Web Service Authentication

    International Nuclear Information System (INIS)

    Zhu Jianlin; Zhou Daicui; Zhang Guoping; Saiz, Pablo; Carminati, Federico; Betev, Latchezar; Lorenzo, Patricia Mendez; Grigoras, Alina Gabriela; Grigoras, Costin; Furano, Fabrizio; Schreiner, Steffen; Datskova, Olga Vladimirovna; Banerjee, Subho Sankar

    2011-01-01

    Web Services are an XML based technology that allow applications to communicate with each other across disparate systems. Web Services are becoming the de facto standard that enable inter operability between heterogeneous processes and systems. AliEn2 is a grid environment based on web services. The AliEn2 services can be divided in three categories: Central services, deployed once per organization; Site services, deployed on each of the participating centers; Job Agents running on the worker nodes automatically. A security model to protect these services is essential for the whole system. Current implementations of web server, such as Apache, are not suitable to be used within the grid environment. Apache with the mod s sl and OpenSSL only supports the X.509 certificates. But in the grid environment, the common credential is the proxy certificate for the purpose of providing restricted proxy and delegation. An Authentication framework was taken for AliEn2 web services to add the ability to accept X.509 certificates and proxy certificates from client-side to Apache Web Server. The authentication framework could also allow the generation of access control policies to limit access to the AliEn2 web services.

  11. Improving performance of AliRoot using C++11

    CERN Document Server

    Agarwal, Abhineet

    2014-01-01

    The aim of the project was to increase the performance and better the memory management which is currently used in AliRoot. For this, we want to look up to certain ROOT libraries and containers which could be replaced using C++ containers and standard libraries. Also, to better the memory management, we wanted to use the smart pointers used in C++11.

  12. Exhaled breath analysis discriminates phenotypes of acute lung injury (ALI)

    NARCIS (Netherlands)

    Bos, L.D.J.; Hemmes, S.N.T.; Nijsen, T.M.E.; Sterk, P.J; Schultz, M.J.

    2012-01-01

    Introduction It has been postulated that the pathophysiology and clinical presentation of ALI based on pulmonary and non-pulmonary etiology represent different phenotypes1. Until now, little biological evidence on the molecular level has been presented to support this hypothesis. Exhaled air

  13. [Research on blood distribution of Tibetan population in Ali area].

    Science.gov (United States)

    Liu, X X; Li, D D; Li, H L; Hou, L A; Liu, Z J; Yang, H Y; Qiu, L

    2017-12-12

    Objective: To explore the distribution of ABO blood group in the healthy population in the Ali area of Tibet, and to analyze the difference of blood group distribution between the Tibetan population in Ali and the Tibet Tibetan population. Methods: The blood distribution of 509 apparent healthy volunteers of Tueti County and Gal County, Tibet, which were randomly selected from September to November in 2016; 137 Tibetan blood donors, from 2016 September to2017 July and 84 Tibetan blood donors from 2015 August to 2017 July was analyzed retrospectively. The blood type was tested by the slide method. By reviewing the Chinese and foreign language database, seven articles on Tibetan blood group distribution were obtained. And the data of the blood distribution of the Ali area population and the Tibet Tibetan population were compared. Results: The ABO phenotype frequencies of 507 apparent healthy people, 137 blood donors and 84 recipients were B>O>A>AB. The composition ratio were 36.1%, 34.5%, 21.5 %, 7.9%; 40.1%, 35.0%, 17.5%, 7.3%; 39.3%, 34.5%, 20.2%, 6.0%.There was no statistically significant difference in blood group distribution between the donors and the recipients ( P >0.05). And there was no significant difference in the blood group distribution between Ali and Shigatse, Nagqu, Lhasa, Shannan. However, the differences between Ali and Qamdo, Nyingchi areas were statistically significant. Conclusion: The geographical position of the blood from the west to east, B type shows a downward trend, O type blood composition ratio shows an upward trend.

  14. "Parim" on subjektiivne, aga kõhutundest ka ei piisa / Inga Kuusik

    Index Scriptorium Estoniae

    Kuusik, Inga, 1961-

    2007-01-01

    Ilmunud ka: Finansovõi Menedzhment : infovõpusk nr. 13 apr. lk. 6-7. Saku Õlletehase uus finantsjuht oma tööst tubakatootja Imperial Tobacco Grupi Kesk-Aasia regiooni finantsdirektorina Kõrgõzstanis, Saku Õlletehase kapitali struktuurist, finantsdirektori rollist ettevõttes ja tööjõu värbamisest Saku Õlletehases. Lisad: Saku Õlletehas 2006: mõõdukas käibe-, aga suur kasumikasv; Tabel: Saku Õlletehase dividendimaksed 1997-2007

  15. Thinking Muhammad Legenhausen's Non-Reductive Pluralism Through: Some Reflections about its Implications

    Directory of Open Access Journals (Sweden)

    STEFANO BIGLIARDI

    2014-12-01

    Full Text Available One of the most vibrant contemporary philosophical debates concerns the definition, and defence, of religious pluralism. The philosophers who address such a topic usually hold widely divergent views regarding its exact definition and the arguments through which it can be upheld. The absence of a general consensus notwithstanding, the debate on religious pluralism has ‘de facto’ become an important area of dialogue between different religions in general, and between Christianity and Islam in particular. At stake in the present paper is the discussion of pluralism developed by the US-American-Persian philosopher Muhammad (Gary Carl Legenhausen (b. 1953, that he presents as a criticism of the views of the late British theologian John Harwood Hick (1922-2012. Hick developed his views mainly influenced by Christianity, yet he also took into account some ideas advanced by Muslim authors. Legenhausen, a convert to Islam, puts forth his own version of pluralism in the framework of a discussion of the concept as it has emerged within Christianity, and advances a refutation of Hick's view complementary to his own theory of pluralism. The aim of the present pages is to offer an overview of Legenhausen’s contribution and discuss some of its possible implications and premises. In other words, rather than producing a defence of Legenhausen’s theory, this study is to analyse the logic behind and beyond his specific ‘Muslim proposal’ and explain what some of its unstated premises might be, as well as the consequences of fully embracing such stance, for philosophers, – not only Muslims ones –, interested in understanding religion from a religious point of view and in advocating that religious differences should not turn into a reason of animosity. The paper is divided into two main sections. The first one reconstructs Legenhausen's version of religious pluralism, while especially recalling the points with which it is presented as clashing with

  16. Peranan Agama dalam Restorasi Peradaban Umat Islam Menurut Muhammad Fethullah Gulen

    Directory of Open Access Journals (Sweden)

    Usman Syihab

    2014-11-01

    Full Text Available This article examines Muhammad Fethullah Gulen’s thought on the roles of religion in reconstruction of a civilization. The article analyzes the problem anatomy of the Ummah, concepts of civilization, relationship between identity and civilization, religion and its roles in formation of civilization identity, the “essential” conditions for Muslim’s renaissance, and the role of Islamic scholars in the renaissance process. The article reveals Gulen’s idea, that the Muslim’ crises is internal in nature, and not because of others, it is a “liability to be colonize” attitude. Religion has a vital role in construction of a civilization identity. A religion can be pillar of a civilization is a religion that has lofty goals, able to apply moral values, upgrade spiritual quality, and fulfill human’s soul needs. According to Gulen, every civilization has its links with the past and its cultural haritage, and that any attempt to reconstruct a future civilization has to consider its own cultural roots. Thus, a civilization is neither a life adopted from colonials nor values that has been deprived from its own noble values. The article, using philosophical, historical and sociological approaches, tries to analyze the “essential” conditions that able to restore Islamic civilization and spawn Muslim’s renaissance, mainly; a moral-spiritual, b knowledge, c aesthetic, and d love. The article also explains critically the roles and missions of ulamâ in making “resurrection from the grave”, renaissance and total reform of the ummah.

  17. AliBaba: PubMed as a graph.

    Science.gov (United States)

    Plake, Conrad; Schiemann, Torsten; Pankalla, Marcus; Hakenberg, Jörg; Leser, Ulf

    2006-10-01

    The biomedical literature contains a wealth of information on associations between many different types of objects, such as protein-protein interactions, gene-disease associations and subcellular locations of proteins. When searching such information using conventional search engines, e.g. PubMed, users see the data only one-abstract at a time and 'hidden' in natural language text. AliBaba is an interactive tool for graphical summarization of search results. It parses the set of abstracts that fit a PubMed query and presents extracted information on biomedical objects and their relationships as a graphical network. AliBaba extracts associations between cells, diseases, drugs, proteins, species and tissues. Several filter options allow for a more focused search. Thus, researchers can grasp complex networks described in various articles at a glance. http://alibaba.informatik.hu-berlin.de/

  18. AGA: Interactive pipeline for reproducible gene expression and DNA methylation data analyses [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Michael Considine

    2015-10-01

    Full Text Available Automated Genomics Analysis (AGA is an interactive program to analyze high-throughput genomic data sets on a variety of platforms. An easy to use, point and click, guided pipeline is implemented to combine, define, and compare datasets, and customize their outputs. In contrast to other automated programs, AGA enables flexible selection of sample groups for comparison from complex sample annotations. Batch correction techniques are also included to further enable the combination of datasets from diverse studies in this comparison. AGA also allows users to save plots, tables and data, and log files containing key portions of the R script run for reproducible analyses. The link between the interface and R supports collaborative research, enabling advanced R users to extend preliminary analyses generated from bioinformatics novices.

  19. An analysis of Canada-US natural gas trade using the AGAS energy model

    International Nuclear Information System (INIS)

    Quon, D.; Wong, S.

    1989-01-01

    The strength of AGAS is that it was structurally designed to address the primary issue of EMF9, namely the medium and long-term prospects for Canada-US natural gas trade. Consequently, it is one of the very few models with the following necessary features: (1) it treats all the regions of Canada and the United States as one continental entity, both with respect to demand and supply; (2) All regional supplies and demands are integrated. Hence, regional gas prices are endogenous; inter-regional gas flows, including Canadian-US gas exchanges, are endogenous. Models that do not have both of these features require that the answers that are being sought have to be specified exogenously. An iterative procedure can be used to reconcile unrealistic results but only with difficulty

  20. MAKNA AMAR MA’RUF NAHI MUNKAR MENURUT MUHAMMAD ASAD DALAM KITAB THE MESSAGE OF THE QUR’AN

    Directory of Open Access Journals (Sweden)

    Kusnadi Kusnadi

    2018-02-01

    Full Text Available This study purpose to understand Amar Ma'ruf Nahi Munkar according to Muhammad Asad in the book The Message of The Quran. In many Islamic literature, the study of amar ma'ruf nahi munkar has been widely practiced, both among theology, civic organizations, religious politics and literary books of commentary. One of the books that also discusses this study is The Message of The Quran, a book of translations and tafsir, written by Muhammad Asad. It is. This work is in the form of translation and interpretation. The explanations in it are in the form of footnotes and comments on translated verses as well as certain attachments related to particular themes. The compilation of this book is based on the orderliness of the letter as adopted by the majority of scholars and based on the reading of Hafs bin Sulaiman al-Asadi. At each beginning of the letter discussed, the letter periodization is first explained, the general explanation of the contents of the letter content. That Asad always interpret the word amar ma'ruf with something right. While nahi munkar with the opposite meaning something is wrong. Asad revealed to do something must be in accordance with the syariah that contained the Qur'an and sunnah. Because, to reach the best community or people is always to do something in accordance with the law or syariah that prevail in Islam.

  1. Epistemology And The Problem Of Cultural Hybridity In Muhammad Iqbal’s Thought

    Directory of Open Access Journals (Sweden)

    Hawasi Hawasi

    2015-12-01

    Full Text Available Abstract : The hegemony of rational-positivistic paradigm of modern Western epistemology contributes greatly to  the  development  of  modern  thought.  The  paradigm,  so  far,  brings  knowledge  and  science  into mere instrumental goals. Scientism is the result of the paradigm which lost of its sacred as science. Therefore,  it  gets  philosophical  attack  from  both  Western  postmodern  thinkers  and  indigenous scholars who already experienced Western colonialism and imperialism. One of the Moslem scholars who criticized the hegemony of Western thought to Islamic culture and civilization is Muhammad Iqbal. For Iqbal, for centuries, Muslim thinkers were unable to see Islam from Quran point of view because they perceive it from the eye of rational-speculative Greek philosophy. Islamic thinking had been under its hegemony for so long that need to be deconstructed. In the postcolonial perspective, Iqbal’s  attempt  to  decolonize  Western  rational-speculative  epistemology  from  Plato  to  Descartes found  him  in  ambivalence.  British  colonialism  experienced  by  Iqbal  in  India  formed  the  hybrid culture in his project of reconstructing Islamic thought in relation to Western thought. Therefore, Iqbal’s  attempt  to  bridge  the  gap  between  rational-speculative  of  Western  thought  and  mystic- religious tendencies of Islamic thought is a process of seeking “the Third Space” through mimicry as consequence of cultural interaction between the colonizer and the colonized. Kata-kata Kunci: decolonization of epistemology, hybrid culture, Islamic epistemology, the Third Space.   Abstrak : Hegemoni  paradigma  epistemologi  Barat  modern  yang  rasional  positivistik  berkontribusi  besar terhadap perkembangan pemikiran modern. Paradigma tersebut sejauh ini, menggiring pengetahuan dan sains pada tujuan-tujuan yang bersifat instrumental. Saintisisme merupakan

  2. 76 FR 62494 - Designation of Ibrahim `Awwad Ibrahim `Ali al-Badri, Also Known as Dr. Ibrahim `Awwad Ibrahim...

    Science.gov (United States)

    2011-10-07

    ... DEPARTMENT OF STATE [Public Notice 7638] Designation of Ibrahim `Awwad Ibrahim `Ali al-Badri, Also Known as Dr. Ibrahim `Awwad Ibrahim `Ali al-Badri, Also Known as Ibrahim `Awad Ibrahim al-Badri al... individual known as Ibrahim `Awwad Ibrahim `Ali al-Badri, also known as Dr. Ibrahim `Awwad Ibrahim `Ali al...

  3. Association of Heme Oxygenase 1 with Lung Protection in Malaria-Associated ALI/ARDS.

    Science.gov (United States)

    Pereira, Marcelo L M; Ortolan, Luana S; Sercundes, Michelle K; Debone, Daniela; Murillo, Oscar; Lima, Flávia A; Marinho, Claudio R F; Epiphanio, Sabrina

    2016-01-01

    Malaria is a serious disease, caused by the parasite of the genus Plasmodium , which was responsible for 440,000 deaths in 2015. Acute lung injury/acute respiratory distress syndrome (ALI/ARDS) is one of the main clinical complications in severe malaria. The murine model DBA/2 reproduces the clinical signs of ALI/ARDS in humans, when infected with Plasmodium berghei ANKA. High levels of HO-1 were reported in cases of severe malaria. Our data indicated that the HO-1 mRNA and protein expression are increased in mice that develop malaria-associated ALI/ARDS (MA-ALI/ARDS). Additionally, the hemin, a HO-1 inducing drug, prevented mice from developing MA-ALI/ARDS when administered prior to the development of MA-ALI/ARDS in this model. Also, hemin treatment showed an amelioration of respiratory parameters in mice, high VEGF levels in the sera, and a decrease in vascular permeability in the lung, which are signs of ALI/ARDS. Therefore, the induction of HO-1 before the development of MA-ALI/ARDS could be protective. However, the increased expression of HO-1 on the onset of MA-ALI/ARDS development may represent an effort to revert the phenotype of this syndrome by the host. We therefore confirm that HO-1 inducing drugs could be used for prevention of MA-ALI/ARDS in humans.

  4. Cardiopulmonary dysfunction in the Osteogenesis imperfecta mouse model Aga2 and human patients are caused by bone-independent mechanisms.

    Science.gov (United States)

    Thiele, Frank; Cohrs, Christian M; Flor, Armando; Lisse, Thomas S; Przemeck, Gerhard K H; Horsch, Marion; Schrewe, Anja; Gailus-Durner, Valerie; Ivandic, Boris; Katus, Hugo A; Wurst, Wolfgang; Reisenberg, Catherine; Chaney, Hollis; Fuchs, Helmut; Hans, Wolfgang; Beckers, Johannes; Marini, Joan C; Hrabé de Angelis, Martin

    2012-08-15

    Osteogenesis imperfecta (OI) is an inherited connective tissue disorder with skeletal dysplasia of varying severity, predominantly caused by mutations in the collagen I genes (COL1A1/COL1A2). Extraskeletal findings such as cardiac and pulmonary complications are generally considered to be significant secondary features. Aga2, a murine model for human OI, was systemically analyzed in the German Mouse Clinic by means of in vivo and in vitro examinations of the cardiopulmonary system, to identify novel mechanisms accounting for perinatal lethality. Pulmonary and, especially, cardiac fibroblast of perinatal lethal Aga2/+ animals display a strong down-regulation of Col1a1 transcripts in vivo and in vitro, resulting in a loss of extracellular matrix integrity. In addition, dysregulated gene expression of Nppa, different types of collagen and Agt in heart and lung tissue support a bone-independent vicious cycle of heart dysfunction, including hypertrophy, loss of myocardial matrix integrity, pulmonary hypertension, pneumonia and hypoxia leading to death in Aga2. These murine findings are corroborated by a pediatric OI cohort study, displaying significant progressive decline in pulmonary function and restrictive pulmonary disease independent of scoliosis. Most participants show mild cardiac valvular regurgitation, independent of pulmonary and skeletal findings. Data obtained from human OI patients and the mouse model Aga2 provide novel evidence for primary effects of type I collagen mutations on the heart and lung. The findings will have potential benefits of anticipatory clinical exams and early intervention in OI patients.

  5. [Advance on human umbilical cord mesenchymal stem cells for treatment of ALI in severe burns].

    Science.gov (United States)

    Wang, Yu; Hu, Xiaohong

    2017-01-01

    Severe burn is often accompanied by multiple organ damage. Acute lung injury (ALI) is one of the most common complications, and often occurs in the early stage of severe burns. If it is not treated in time, it will progress to acute respiratory distress syndrome (ARDS), which will be a serious threat to the lives of patients. At present, the treatment of ALI in patients with severe burn is still remained in some common ways, such as the liquid resuscitation, the primary wound treatment, ventilation support, and anti-infection. In recently, human umbilical cord mesenchymal stem cells (hUCMSCs) have been found having some good effects on ALI caused by various causes, but few reports on the efficacy of ALI caused by severe burns were reported. By reviewing the mechanism of stem cell therapy for ALI, therapeutic potential of hUCMSCs in the treatment of severe burns with ALI and a new approach for clinical treatment was provided.

  6. “Speeches” of Sigismund II’s Courier, Mikhail Garaburda, Addressed to the Crimean Qalga Muhammad Giray (1559

    Directory of Open Access Journals (Sweden)

    A.A. Gorsky

    2017-03-01

    Full Text Available The author of the article for the first time publishes completely the “speeches” of Mikhail Garaburda – the courier of the Polish king and the Great Lithuanian prince Sigismund II – addressed to Qalga of the Crimean Khanate Muhammad Giray, which were intercepted in 1559 by the voivode D.Adashev and presented by Ivan the Terrible to the Lithuanian side in 1562. Both the embassy of Mikhail Garaburda in the Crimea and the Dnieper-Crimean campaign of D.Adashev took place in 1559. The Ambassadorial book of the Grand Duchy of Lithuania speaks about Sigismund’s charter and the “speeches” of his courier. It is noteworthy that Sigismund’s charter and M.Garaburda’s “speeches” were used by the Russian side only in the course of the negotiations in 1562, that is, three years after they had been delivered to Moscow.

  7. A.G.A. program gives utilities a leg up on benchmarking

    International Nuclear Information System (INIS)

    Share, J.

    1997-01-01

    In this era of downsizing, distribution companies are banding together under the aegis of the American Gas Association to improve their performance, ultimately saving money and jobs. The Best Practice Benchmarking program began in 1990 when New Orleans Public Service coordinated an effort by several utilities wanting to compare practices and data. It is not benchmarking in the traditional sense. Best Practices stresses functional rather than competitive or numerical benchmarking by focusing on what utilities have done to improve their operations. In a report on Best Practices, John Bayko, Director of System Operations for Consumers Gas in Toronto, noted these success stories: Building odorant storage and transport facilities were found to save one company $17,500 annually because it could buy odorant in bulk as opposed to 55-gallon drums. Upgrading its cathodic protection system helped a company realize a 40 percent reduction in corrosion leaks over a two-year period, saving $200,000 a year. Another company began studying partnering with contractors which would eliminate the need of a pipeline inspector in each crew. Those potential savings are over $2 million. This paper describes three other Best Practices related to worker safety, system mapping, and activity-based accounting. A.G.A.'s role is briefly discussed

  8. Morbility, clinical data and proteomic analysis of IUGR and AGA newborns at different gestational ages

    Directory of Open Access Journals (Sweden)

    M.D. Ruiz-González

    2016-12-01

    Full Text Available The data are related to the proteomic analysis of 43 newborns with intrauterine growth retardation (IUGR and 45 newborns with appropriate weight for gestational age (AGA carried out by separation via 2DE and analyzed by MS–TOF/TOF. All newborns were separated into three gestational age groups, "Very Preterm" 29–32 weeks, "Moderate Preterm" 33–36 weeks, and, "Term" ≥37weeks. From each newborn, blood was drawn three times from birth to 1 month life. High-abundant serum proteins were depleted, and the minority ones were separated by 2DE and analyzed for significant expression differences. The data reflect analytic and clinic variables analyzed globally and categorized by gestational age in relation to IUGR and the optimization of conditions for 2-DE separation. The data from this study are related to the research article entitled "Alterations of Protein Expression in Serum of Infants with Intrauterine Growth Restriction and Different Gestational Ages" (M.D. Ruis-González, M.D. Cañete, J.L. Gómez-Chaparro, N. Abril, R. Cañete, J. López-Barea, 2015 [1]. The present dataset of serum IUGR newborn proteome can be used as a reference for any study involving intrauterine growth restriction during the first month of life.

  9. Pioneers of paediatrics: Professor Salah Abdelrahman Ali Taha

    Science.gov (United States)

    2013-01-01

    This article highlights the contributions of Professor Salah Abdelrahman Ali Taha (1927–1988), one of the pioneers in paediatrics in Sudan and Saudi Arabia. He graduated from Kitchener School of Medicine (renamed, Faculty of Medicine, University of Khartoum[U of K]) in 1952 and was awarded an MD from the U of K in 1973, having accomplished a survey on the prevalence and underlying causes of childhood malnutrition in 14 villages. His impact was remarkable in establishing child health services in Sudan and Saudi Arabia, and in laying the foundation of the Department of Pediatrics, College of Medicine, King Saud University. He was also an active researcher in various fields in child health, and was pioneering in those related to nutrition. Following his return to Sudan, Dr Salah A Taha was elected Member of Parliament from his rural district in Gezira State and was the Speaker of the House of Parliament in 1986. PMID:27493360

  10. Contamination of mercury in tongkat Ali hitam herbal preparations.

    Science.gov (United States)

    Ang, H H; Lee, K L

    2006-08-01

    The DCA (Drug Control Authority), Malaysia has implemented the phase three registration of traditional medicines on 1 January 1992. As such, a total of 100 products in various pharmaceutical dosage forms of a herbal preparation found in Malaysia, containing tongkat Ali hitam, either single or combined preparations, were analyzed for the presence of a heavy toxic metal, mercury, using atomic absorption spectrophotometer, after performing a simple random sampling to enable each sample an equal chance of being selected in an unbiased manner. Results showed that 26% of these products possessed 0.53-2.35 ppm of mercury, and therefore, do not comply with the quality requirement for traditional medicines in Malaysia. The quality requirement for traditional medicines in Malaysia is not exceeding 0.5 ppm for mercury. Out of these 26 products, four products have already registered with the DCA, Malaysia whilst the rest, however, have not registered with the DCA, Malaysia.

  11. Divider plate leak inspections using an acoustic tool 'ALIS'

    International Nuclear Information System (INIS)

    Kowalewski, J.; Colbert, M.

    1998-01-01

    Divider plate leakage in the primary head of steam generators may be a contributor to high Reactor Inlet Header Temperature (RIHT) which can have a negative effect on the operation of a plant. A method to provide quick information of divider plate leakage can be very useful in helping operators to make timely and cost effective repair and maintenance decisions. As part of a CANDU Owners Group (COG) funded program, a novel acoustic tool for performing inspections in empty steam generators during a shutdown has been developed and successfully demonstrated by Ontario Hydro Technologies (OHT). The basic principle of this technique utilizes sound transmission through the leakage paths of a divider plate assembly for creating a graphic image which reveals the locations and relative sizes of leaks. This is accomplished by injecting one side of the primary head with a series of airborne, ultrasonic sound bursts while scanning the divider plates from the opposite side and collecting transmitted sound pressure levels. Once a scan is completed the results are processed and displayed graphically as a color mapping of the entire divider plate assembly showing an image of the leakage locations and relative severity. The special transducers of the acoustic leak inspection system (ALIS) are installed through the manways of the steam generator at both sides of the primary head. These are clamped to the tube sheet and operated from a convenient remote location within the containment building. This process minimizes radiation exposure of the workers, as well, it reduces risk of contamination of the ALIS equipment. The current version of this tool performs the scans by remote manual control. (author)

  12. ALiEM Blog and Podcast Watch: Toxicology.

    Science.gov (United States)

    Zaver, Fareen; Craddick, Michael; Sanford, Audrey; Sefa, Nana; Hughes, George; Lin, Michelle

    2017-10-01

    The WestJEM Blog and Podcast Watch presents high-quality open-access educational blogs and podcasts in emergency medicine based on the ongoing Academic Life in Emergency Medicine (ALiEM) Approved Instructional Resources (AIR) and AIR-Professional (Pro) series. Both series critically appraise open-access educational blogs and podcasts in EM using an objective scoring instrument. This installment of the blog and podcast watch series curated and scored relevant posts in the specific topic of toxicology emergencies from the AIR-Pro Series. The AIR-Pro Series is a continuously building curriculum covering a new subject area every two months. For each area, eight EM chief residents identify 3-5 advanced clinical questions. Using FOAMsearch.net and FOAMSearcher to search blogs and podcasts, relevant posts are scored by eight reviewers from the AIR-Pro editorial board, which is comprised of EM faculty and chief residents at various institutions across North America. The scoring instrument contains five measurement outcomes based on seven-point Likert scales: recency, accuracy, educational utility, evidence based, and references. The AIR-Pro label is awarded to posts with a score of ≥28 (out of 35) points. An "honorable mention" label is awarded if board members collectively felt that the blogs were valuable and the scores were > 25. A total of 31 blog posts and podcasts were included. Key educational pearls from the six high-quality AIR-Pro posts and four honorable mentions are summarized. The WestJEM ALiEM Blog and Podcast Watch series is based on the AIR and AIR-Pro Series, which attempts to identify high-quality educational content on open-access blogs and podcasts. This series provides an expert-based, crowdsourced approach towards critically appraising educational social media content for EM clinicians. This installment focuses on toxicology emergencies.

  13. Peran Mukti Ali dalam Pengembangan Toleransi Antar Agama di Indonesia

    Directory of Open Access Journals (Sweden)

    Khairah Husin

    2014-06-01

    Full Text Available Agama sebagai sasaran kajian penelitian sudah banyak dilakukan oleh para sarjana disiplin ilmu. Mereka melakukan penelitian terhadap berbagai aspek dari agama, baik aspek ide maupun aspek perwujudan dalam kenyataan. Dimulai dari keyakinan dan ajaran yang dimiliki oleh suatu agama hingga pengaruh agama pada kehidupan masyarakat pemeluk agama tersebut. Kalau yang dimaksud metode dalam ilmu perbandingan agama adalah cara untuk memperoleh dan mamahami kebenaran agama dari realitas empiris, atau lebih tepatnya “kebenaran ilmiah agamis”, maka pendekatan tiada lain adalah suatu sikap ilmiah (persepsi dari seorang yang harus ditunjukkan untuk menemukan kebenaran ilmiah yang hendak diperoleh. Dengan demikian pendekatan sifatnya umum. Dalan suatu pendekatan tertentu dapat digunakan bermacammacam metode, umpamanya seorang Sosiolog akan mengkaji agama pasti akan menerapkan pendekatan metode-metode sosiologis. Begitu pula Sejarawan, Antropolog, Fenomenolog, dan lain-lain akan menerapkan pendekatan dan metode sesuai dengan latar belakang keahliannya. Maka sasaran ideal dari beberapa pendekatan adalah memperoleh interelasi yang sistematis dari fakta-fakta agama, dan bertujuan untuk mencari jawaban tentang fakta-fakta tersebut dengan menggunakan kesangsian sistematis. Pendekatan keilmuan dalam meneliti agama mencoba mendeskripsikan dunia pemeluk agama secara apa adanya (das sein, bukan didasarkan semestinya secara normatif (das sollen. Dengan demikian, pendekatan keilmuan yang empiris ini menggunakan dan mengadaptasi pendekatanpendekatan ilmu-ilmu sosial dan budaya. Dari sekian tokoh ilmu Perbandingan Agama, kebanyakan dari mereka merupakan ilmuwan Barat. Namun demikian ada juga beberapa tokoh perbandingan agama dari duni Islam, antara lain adalah Prof. Dr. H.A. Mukti Ali, Ibnu Hazm dan As-Syahrastani. Sementara Ibnu Hazm Al Andalusy dan As-Syahrastani merupakan tokoh-tokoh Perbaga Muslim dari zaman klasik – zaman ketika Perbaga belum terbentuk sebagai

  14. 76 FR 11756 - Action Affecting Export Privileges; Ali Amirnazmi; Order Denying Export Privileges

    Science.gov (United States)

    2011-03-03

    ... DEPARTMENT OF COMMERCE Bureau of Industry and Security Action Affecting Export Privileges; Ali Amirnazmi; Order Denying Export Privileges In the Matter of: Ali Amirnazmi, Register 63302-066, FCI... release and forfeit $81,277.37. Section 766.25 of the Export Administration Regulations (``EAR'' or...

  15. PENGGUNAAN BIOGRAFI TUAN GURU KIYAI HAJI MUHAMMAD ZAINUDDIN ABDUL MAJID DALAM PEMBELAJARAN SEJARAH LOKAL DI MADRASAH ALIYAH NAHDLATUL WATHAN SENYIUR KABUPATEN LOMBOK TIMUR

    Directory of Open Access Journals (Sweden)

    Ahmad Afandi

    2016-04-01

    Full Text Available Penelitian ini berjudul Penggunaan Biografi Tuan Guru Kiyai Haji Muhammad Zainuddin Abdul Majid dalam Pembelajaran Sejarah Lokal di Madrasah Aliyah Nahdlatul Wathan Senyiur Kabupaten Lombok Timur. Salah satu tujuan dari penelitian ini adalah untuk melihat sejauh mana proses pembelajaran berangsung dan bagaimana dampaknya bagi siswa dalam rangka meningkatkan kreatifitas dan sikap nasionalisme siswa yang berlandaskan beberapa indikator yang peneliti sodorkan, misalnya 1 memiliki rasa bangga terhadap bangsa, 2 peduli terhadap nasib bangsa, 3 mempertahankan identitas atau jati diri sebagai bangsa timur, 4 menerima kemajemukan, 5 memiliki rasa keterpautan dan rasa memiliki (Sense of Belonging. Dari hasil penelitian yang dilakukan menunjukkan bahwa aktifitas siswa di dalam kelas selama proses pembelajaran mengalami peningkatan secara signifikan. Hal tersebut terlihat dari proses tanya jawab selama proses pembelajaran berlangsung. Salah satu kendala dalam pembelajaran ini adalah terkait minimnya sumber-sumber pendukung pembelajran, misalnya buku maupun literatur-literatur yang membahas tentang tokoh Tuan Guru Haji Muhammad Zainuddin Abdul Majid. Kata kunci: biografi, pembelajaran Sejarah.

  16. The Stereotyping of Muslims : An Analysis of The New York Times’ and The Washington Times’ Coverage of Veiling and the Muhammad Cartoon Controversy

    OpenAIRE

    Schønemann, Julie

    2013-01-01

    This thesis investigates the stereotypical portrayal of Muslims in the American media. More specifically, it explores the relative importance of stereotype theory, prejudice theory and the stereotype content model in the media’s remaking and reinforcing of common stereotypes of Muslims. This study argues that that Muslims were stereotypically portrayed in The New York Times’ and The Washington Times’ coverage of the Muhammad cartoons controversy and the tradition of veiling among Muslim women...

  17. IJITIHAD SULTAN MUHAMMAD IDRUS KAIMUDDIN IBNU BADARUDDIN AL BUTHUNI (1824-1851: Akulturasi Islam dengan Budaya di Kesultanan Buton

    Directory of Open Access Journals (Sweden)

    Basrin Melamba

    2014-06-01

    Full Text Available The coming of Islam in the Buton Sultanate has brought a change in the social, political, even in the intellectual aspects. It produced scholars with the thought or ijitihad as a blend of Islamic and local cultures. One of the scholars as well as Buton Sultan was Muhammad Idrus Kaimuddin Ibnu Badaruddin Al Buthuni (1824-1851. His thought or ijitihad found the essence of the concept of manners according to the teachings of the ancestors in kabanti Bula Malino. His several works became the guidance of the public and court authorities in the Sultanate of Buton which were basically rooted from the teachings of Islam. Kaimuddin’s thought in terms of ethics, morals, manners, or advice showed his horizons of knowledge and the depth of leadership thought. The magnitude of Islamic influence in some of his works proves the enduring process of Islamic acculturation done continuously and deeply since the era of Buton Islamic empire. Kaimuddin’s thought is essentially a formation process of Buton’s civilization centered on the palace and passed to Buton society in general through the process of cultural dialogue between Buton culture (Wolio and Islam.

  18. Links between the Prophet Muhammad (PBUH) recommended foods and disease management: A review in the light of modern superfoods.

    Science.gov (United States)

    Ali, Sharique A; Parveen, Naima; Ali, Ayesha S

    2018-01-01

    Nutrition and other bioactive natural products present in specific foods within a balanced diet play an indispensable role in maintaining and promoting human health. Plants are rich sources of a balanced nutrition because of high content of bioactive products; hence, most of them recently have acquired the status of superfoods. It has been used since ancient times for the treatment of various ailments, and these traditional medicines still remain as one of the most affordable and easily accessible sources of treatment in the primary health-care system. The scientifically based use of these superfoods date back to the era of Prophet Muhammad along with other historical uses of plant products. Prescription of a large number of herbal foods such as dates, pomegranate, olives, figs, grapes, and black seeds was successfully proposed by him. These recently have become superfoods with their powerful healing properties and act as favorable dietary interventions for disease prevention as well as for the good maintenance of health. The use of these foods as ingredients of natural origin with fewer side effects seems to be more favorable than the chemical treatment, which is often complicated. The present review is an attempt to provide a brief survey of the literature on scientifically based significance of these superfoods carried out by various researchers and exploration of a wide spectrum of their pharmacological actions which include antidiabetic, anticancer, immune modulator, analgesic, anti-inflammatory, and hepatoprotective properties.

  19. WAKTU PUASA ARAFAH PERSPEKTIF MUHAMMAD BIN SHALIH AL ‘UTSAYMIN: Telaah Kajian Hukum Islam dan Astronomi Islam

    Directory of Open Access Journals (Sweden)

    Benny Afwadzi

    2017-12-01

    Full Text Available All this time there was a different opinion about the time for Arafah fasting. Whether to comply with the provisions of Saudi Arabia or adjust the territory of each person. In Saudi Arabia, there appears a mufti named Muhammad bin Shalih al ‘Utsaymin who holds that fasting of Arafah must follow the country where a person lives. This opinion is interesting because it is different from other Salafis, such as ‘Abd al ‘Aziz bin Baz, Abdul Hakim bin Amir Abdat and HTI. Using the analytical tools of Islamic law and Islamic astronomy, the authors conclude that the fatwa issued by al ‘Utsaymin is considered quite representative, because considering the locality of a country, realizing the time of worship should adjust the kamariyah time of the country, and also in accordance with the mathla‘ in the form of mathla‘ wilayah al hukmi. Opinions as expressed by al ‘Utsaymin is conformable with the implementation of the time of the fasting of Arafat by the majority of Muslims in Indonesia.

  20. Dynamic virtual AliEn Grid sites on Nimbus with CernVM

    International Nuclear Information System (INIS)

    Harutyunyan, A; Buncic, P; Freeman, T; Keahey, K

    2010-01-01

    We describe the work on enabling one click deployment of Grid sites of AliEn Grid framework on the Nimbus 'science cloud' at the University of Chicago. The integration of computing resources of the cloud with the resource pool of AliEn Grid is achieved by leveraging two mechanisms: the Nimbus Context Broker developed at Argonne National Laboratory and the University of Chicago, and CernVM - a baseline virtual software appliance for LHC experiments developed at CERN. Two approaches of dynamic virtual AliEn Grid site deployment are presented.

  1. An Assessment of the AGA and CCFA Quality Indicators in a Sample of Patients Diagnosed with Inflammatory Bowel Disease.

    Science.gov (United States)

    Tkacz, Joseph; Brady, Brenna L; Meyer, Roxanne; Lofland, Jennifer H; Ruetsch, Charles; Coelho-Prabhu, Nayantara

    2015-11-01

    Inflammatory bowel disease (IBD) is a chronic relapsing disease characterized by activation of the mucosal immune system and inflammation of the gastrointestinal tract. Management of IBD places a significant burden on the health care system because of the complexity of treatment, variability in patient outcomes, and chronic nature of the disease.  To investigate the American Gastroenterological Association (AGA) and Crohn's and Colitis Foundation of America's (CCFA) quality measurement sets in a sample of IBD patients. Fourteen quality measures were restated for application to a claims database and calculated using Optum Clinformatics DataMart database. Selected measures were calculated over calendar year 2011. Performance measures ranged from 0.4% for AGA measure 9, prophylaxis for venous thromboembolism, to 66.9% for AGA measure 8, testing for Clostridium difficile. CCFA outcome measures ranged from 0.6% qualifying for CCFA O10, report of fecal incontinence, to 32.9% for CCFA O1, prednisone usage. In addition to Clostridium difficile testing, the use of appropriate corticosteroid-sparing therapy (51.1%) and testing for latent tuberculosis before initiating anti-tumor necrosis factor therapy (45.0%) were the highest achieved measures. This is the first examination of IBD quality measures using administrative claims. Rates of achievement across measures were variable and likely affected by the ability to calculate certain measures with claims data. Future studies should further examine measurement of IBD quality indicators in claims data to assess the validity of claims-based analyses and to ascertain whether measure attainment translates into better overall health or IBD-related outcomes.

  2. ALI and DAC for transuranic elements based on the metabolic data presented in ICRP Publication 48

    International Nuclear Information System (INIS)

    Togawa, Orihiko; Yamaguchi, Yukichi; Homma, Toshimitsu

    1987-07-01

    The recently published ICRP report, ICRP Publication 48, presents the new metabolic data of some transuranic elements, compared with those employed in the calculation of ALI and DAC in ICRP Publication 30. Values of ALI and DAC for 72 radionuclides were calculated using the metabolic data presented in the Publication 48. The calculation was performed by a computer code system DOSDAC, which can systematically calculate ALI and DAC by the same method as that described in the Publication 30. The calculated values of ALI and DAC were tabulated in the same format as that of the supplements to the Publication 30. For the convenience of using in the dose assessment, also given are values of committed effective dose equivalent per intake of unit activity. It is expected that these values will be applied to the radiation protection purposes. (author)

  3. Studying the potential role of ALIS proteins on the functionality of ALA2

    DEFF Research Database (Denmark)

    Lopez Marques, Rosa Laura; Poulsen, Lisbeth Rosager; Meffert, Katharina

    ). Recently we have identified five Cdc50p homologues in Arabidopsis [ALA Interacting Subunit (ALIS) 1 to 5] (1), and demonstrated that these ß-subunits are essential for the functioning of ALA3. We are currently working on a third Arabidopsis P4-ATPase isoform, ALA2. We have shown that this isoform...... is involved in specific translocation of phosphatidylserine analogues. Furthermore, we have found evidence that the substrate specificity is independent of the ß-subunit interacting with this P4-ATPase. ALA2 in combination with ALIS genes complement both the cold and the metal sensitive phenotype caused...... by lack of DRS2 in yeast. Tissue specific expression patterns of ALA2 and ALIS genes indicate that different ALIS isoforms may interact with ALA2 in diverse parts of the plant. At present we are studying the subcellular localization of ALA2 in planta in order to understand better its possible...

  4. Infrared dim small target segmentation method based on ALI-PCNN model

    Science.gov (United States)

    Zhao, Shangnan; Song, Yong; Zhao, Yufei; Li, Yun; Li, Xu; Jiang, Yurong; Li, Lin

    2017-10-01

    Pulse Coupled Neural Network (PCNN) is improved by Adaptive Lateral Inhibition (ALI), while a method of infrared (IR) dim small target segmentation based on ALI-PCNN model is proposed in this paper. Firstly, the feeding input signal is modulated by lateral inhibition network to suppress background. Then, the linking input is modulated by ALI, and linking weight matrix is generated adaptively by calculating ALI coefficient of each pixel. Finally, the binary image is generated through the nonlinear modulation and the pulse generator in PCNN. The experimental results show that the segmentation effect as well as the values of contrast across region and uniformity across region of the proposed method are better than the OTSU method, maximum entropy method, the methods based on conventional PCNN and visual attention, and the proposed method has excellent performance in extracting IR dim small target from complex background.

  5. Aerosolized prostacyclin for acute lung injury (ALI) and acute respiratory distress syndrome (ARDS)

    DEFF Research Database (Denmark)

    Afshari, Arash; Brok, Jesper; Møller, Ann

    2010-01-01

    Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) are critical conditions that are associated with high mortality and morbidity. Aerosolized prostacyclin has been used to improve oxygenation despite the limited evidence available so far.......Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) are critical conditions that are associated with high mortality and morbidity. Aerosolized prostacyclin has been used to improve oxygenation despite the limited evidence available so far....

  6. Neutrophil extracellular traps contribute to the pathogenesis of acid-aspiration-induced ALI/ARDS.

    Science.gov (United States)

    Li, Haitao; Zhou, Xiaoting; Tan, Hongyi; Hu, Yongbin; Zhang, Lemeng; Liu, Shuai; Dai, Minhui; Li, Yi; Li, Qian; Mao, Zhi; Pan, Pinhua; Su, Xiaoli; Hu, Chengpin

    2018-01-05

    Acute lung injury/acute respiratory distress syndrome (ALI/ARDS) is a manifestation of systemic inflammation in the lungs, but the factors that trigger inflammation in ALI/ARDS are unclear. We hypothesized that neutrophil extracellular traps (NETs) contribute to the pathogenesis of acid aspiration-induced ALI/ARDS. Analysis of bronchial aspirates from ARDS patients showed that NETs were significantly correlated with the degree of ARDS (r = -0.5846, p = 0.0359). NETs in bronchoalveolar lavage fluid of acid-aspiration mice were significantly higher (141.6 ± 23.08) at 3 h after injury than those in the sham group (1234 ± 101.9; p = 0.003, n = 5 per group). Exogenous NETs aggravated lung injury, while alvelestat and DNase markedly attenuated the intensity of ARDS. We investigated whether NETs are involved in the severity of gastric aspiration-induced ARDS. Then, a hydrochloric acid aspiration-induced ALI murine model was used to assess whether NETs are pathogenic and whether targeting NETs is protective. Exogenous NETs were administered to mice. Alvelestat can inhibit neutrophil elastase (NE), which serves an important role in NET formation, so we investigated whether alvelestat could protect against ALI in cell and mouse models. NETs may contribute to ALI/ARDS by promoting tissue damage and systemic inflammation. Targeting NETs by alvelestat may be a potential therapeutic strategy.

  7. Does gender affect career satisfaction and advancement in gastroenterology? Results of an AGA institute-sponsored survey.

    Science.gov (United States)

    Gerson, Lauren B; Twomey, Kay; Hecht, Gail; Lee, Linda; McQuaid, Ken; Pizarro, Theresa T; Street, Sarah; Yoshida, Cynthia; Early, Dayna

    2007-04-01

    Women comprise 19% of the American Gastroenterological Association (AGA) membership. We performed a prospective study to determine whether female gastroenterologists were less likely to achieve career advancement and satisfaction. We administered an online survey to AGA members from 2004-2006. The survey contained questions regarding effects of gender on career advancement, satisfaction with career, promotional policies, and integration of family and career. A total of 457 individuals (response rate 9% after 2 major invitations) completed the survey, including 262 (57%) women (20% in private practice, 53% in academic careers, and 27% trainees) and 195 men (23% in private practice, 58% in academic careers, and 19% trainees). The male gastroenterologists were significantly older (P careers for significantly more years (P = .002). There were no significant differences with respect to marital status, number of children, or number of hours worked between the genders. Men were more likely to achieve the rank of full professor (P = .035), and significantly more women reported that gender affected their career advancement (47% vs 9%; P careers reported less satisfaction with their careers (P = .01) and perceived more difficulty in achieving promotion and tenure. Women were more likely to choose private practice careers because of part-time options (P = .025). Equal numbers of men and women in practice reported difficulty balancing work and family life. Significantly more female than male gastroenterologists perceive that gender has affected their career advancement. Female academic gastroenterologists reported less overall career satisfaction and promotion than male academic gastroenterologists.

  8. Ground-based multi-station spectroscopic imaging with ALIS. - Scientific highlights, project status and future prospects

    Science.gov (United States)

    Brändström; Gustavsson, Björn; Pellinen-Wannberg, Asta; Sandahl, Ingrid; Sergienko, Tima; Steen, Ake

    2005-08-01

    The Auroral Large Imaging System (ALIS) was first proposed at the ESA-PAC meeting in Lahnstein 1989. The first spectroscopic imaging station was operational in 1994, and since then up to six stations have been in simultaneous operation. Each station has a scientific-grade CCD-detector and a filter-wheel for narrow-band interference-filters with six positions. The field-of-view is around 70°. Each imager is mounted in a positioning system, enabling imaging of a common volume from several sites. This enables triangulation and tomography. Raw data from ALIS is freely available at ("http://alis.irf.se") and ALIS is open for scientific colaboration. ALIS made the first unambiguous observations of Radio-induced optical emissions at high latitudes, and the detection of water in a Leonid meteor-trail. Both rockets and satellite coordination are considered for future observations with ALIS.

  9. Olaitan and Muhammad (12)

    African Journals Online (AJOL)

    DELL

    various selective media such as MacConkey agar, mannitol salt agar .... Yemen. Journal of Pharmacy and. Pharmacognosy Research.3(1), 6 – 12. Amira, E. E., Abdel, M. E. S. ... of Natural and Social Sciences.2: 54 – 59. Ferreria, A. C., Morais ...

  10. Pemikiran Ali Syari’ati dalam Sosiologi (Dari Teologi Menuju Revolusi

    Directory of Open Access Journals (Sweden)

    Faiq Tobroni

    2016-09-01

    Full Text Available Ali Syari’ati is muslim brilliant philosopher, graduated from doctoral of Sorbonne France. He created social teology perspective, based from his experience in west sociology perspective about Capitalism or Marxism. He succeed seek the Capitalism and Marxism weaknes if this perspective is used in Muslim Society. He mapping structure of society, insist of: Habil and Qobail. Habil is common people in society, Qabil is high class, likes: prince, aristocrats or capital owner. Qabil was repressedHabil trough social, politic, economy and religious system. This tragedy happen in Iran whenSyah Reza rezim. The consequences, Ali Syari’ati propagandist rebellion Habil to Qabil. Because of his activities, he to be prisoner one more time, then he is going abroad, until he pass away in England (with suspicious that he killed by Syah Reza people. The Iran Revolution happen, after 2 years Ali Syaria’ti pass away

  11. The German Working Group of Obesity in Childhood and Adolescence (AGA): improving the quality of care for overweight and obese children in Germany.

    Science.gov (United States)

    Reinehr, Thomas; Holl, Reinhard W; Wabitsch, Martin

    2008-01-01

    The Working Group of Obesity in Childhood and Adolescence (AGA) comprises scientists, clinicians, and therapists dealing with obesity in children and adolescents. More than 250 pediatricians, psychiatrics, dieticians, psychologists and sports therapists are integrated. On an international level, the AGA cooperates with the European Childhood Obesity Group and the International Obesity Taskforce (IOTF) for Childhood Obesity. The aims of the AGA are to initiate clinical and scientific studies, to join diagnostic, therapeutic and scientific centers, to improve the education, to support self-help groups, and to standardize diagnostic and therapeutic procedures in the field of obesity in childhood and adolescence. The milestones in the history of the AGA are the consensus process to define overweight and obesity in Germany, the development of guidelines for diagnostic procedures and treatment of obesity in childhood and adolescence, the determination of all therapy centers for obese children and adolescents in Germany, the development of a PC software (APV) to document longitudinally diagnostic and therapeutic procedures as well as outcomes by a quality management program, the certification of therapeutic institutions, and the implementation of prevention and treatment studies. As effect of these initiatives, the quality of care in overweight children has been improved in the last years. For example, the APV quality program demonstrated an increase of diagnostic procedures such as blood pressure measurement in the last 4 years. Copyright 2008 S. Karger AG, Basel.

  12. Neoplasia yield and colonoscopic workload of surveillance regimes for colorectal cancer in colitis patients: a retrospective study comparing the performance of the updated AGA and BSG guidelines.

    Science.gov (United States)

    Mooiweer, Erik; van der Meulen, Andrea E; van Bodegraven, Adriaan A; Jansen, Jeroen M; Mahmmod, Nofel; Nijsten, Joyce; van Oijen, Martijn G H; Siersema, Peter D; Oldenburg, Bas

    2013-11-01

    Due to the increased risk of colorectal cancer, colonoscopic surveillance is recommended for patients with ulcerative and Crohn's colitis. Because surveillance intervals differ considerably between the recently updated American Gastroenterological Association (AGA) and British Society of Gastroenterology (BSG) guidelines, we compared the neoplasia yield and colonoscopic workload of these guidelines. Patients with inflammatory bowel disease undergoing surveillance were identified using medical records. Patients were stratified according to the BSG and AGA guidelines, and corresponding colonoscopic workload was calculated based on the risk factors present during follow-up. The incidence of colitis-associated neoplasia (CAN), defined as a low-grade dysplasia in flat mucosa or a non-adenoma-like mass, high-grade dysplasia, or colorectal cancer was compared between the risk groups of either guidelines. In total, 1018 patients with inflammatory bowel disease who underwent surveillance were identified. Using the AGA surveillance intervals, 64 patients (6%) were assigned to annual and 954 patients (94%) to biannual surveillance, resulting in 541 colonoscopies per year. The yield of CAN was 5.3% and 20.3% in the low- and high-risk groups, respectively (P = 0.02). Using the BSG surveillance intervals, 204 patients received surveillance annually (20%), 393 patients every 3 years (39%), and 421 patients every 5 years (41%), resulting in 420 colonoscopies per year, which is 22% lower than the AGA guidelines. The yield of CAN was 3.6%, 6.9%, and 10.8%, for the low-, intermediate-, and high-risk groups, respectively (P = 0.26). Although the BSG surveillance intervals offer the advantage of a lower colonoscopic workload, the risk stratification of the AGA seems superior in distinguishing patients at higher risk of CAN.

  13. El cuerpo extendido : indumentaria mutante en la obra de Ali Schachtschneider

    OpenAIRE

    Nóvoa Vicente, Elena Fernández

    2017-01-01

    The issue of this paper is to explore the concept of the extended body reflecting on clothing and biotechnology activated through Ali Schachtschneider´s work. Going through the different scopes articulated by the Vivorium project, we will look over the taxonomy review that these pieces of work arouse info:eu-repo/semantics/publishedVersion

  14. Põhja-Küprose liider soovib isolatsiooni lõppemist / Mehmet Ali Talat ; interv. Erkki Bahovski

    Index Scriptorium Estoniae

    Talat, Mehmet Ali

    2004-01-01

    Põhja-Küprose liidri väitel soovib türklaste kogukond diplomaatilise tunnustuse asemel isolatsiooni lõppemist. Intervjuus käsitletavad teemad: Küprose saare tulevik, liitumine Euroopa Liiduga, Türgi liitumine euroliiduga. Lisad: Kahe kogukonna - kreeklaste ja türklaste - vahel lõhestatud Küpros; Mehmet Ali Talat

  15. Cross calibration of the Landsat-7 ETM+ and EO-1 ALI sensor

    Science.gov (United States)

    Chander, G.; Meyer, D.J.; Helder, D.L.

    2004-01-01

    As part of the Earth Observer 1 (EO-1) Mission, the Advanced Land Imager (ALI) demonstrates a potential technological direction for Landsat Data Continuity Missions. To evaluate ALI's capabilities in this role, a cross-calibration methodology has been developed using image pairs from the Landsat-7 (L7) Enhanced Thematic Mapper Plus (ETM+) and EO-1 (ALI) to verify the radiometric calibration of ALI with respect to the well-calibrated L7 ETM+ sensor. Results have been obtained using two different approaches. The first approach involves calibration of nearly simultaneous surface observations based on image statistics from areas observed simultaneously by the two sensors. The second approach uses vicarious calibration techniques to compare the predicted top-of-atmosphere radiance derived from ground reference data collected during the overpass to the measured radiance obtained from the sensor. The results indicate that the relative sensor chip assemblies gains agree with the ETM+ visible and near-infrared bands to within 2% and the shortwave infrared bands to within 4%.

  16. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

  17. Book featuring Grand Egyptian Museum design proposals by Ahmed Ali published

    OpenAIRE

    Chadwick, Heather Riley

    2009-01-01

    "Silence, Darkness and Light," a new book by Ahmed K. Ali, adjunct professor of architecture in the School of Architecture + Design and program leader for study abroad in Egypt for Virginia Tech's College of Architecture and Urban Studies, has been published by VDM Verlag in Saarbrucken, Germany.

  18. Simultaneous quantitation of six major quassinoids in Tongkat Ali dietary supplements by liquid chromatography with tandem mass spectrometry.

    Science.gov (United States)

    Han, Young Min; Jang, Moonhee; Kim, In Sook; Kim, Seung Hyun; Yoo, Hye Hyun

    2015-07-01

    Tongkat Ali (Eurycoma longifolia) is one of the most popular traditional herbs in Southeast Asia and generally consumed as forms of dietary supplements, tea, or drink additives for coffee or energy beverages. In this study, the liquid chromatography with tandem mass spectrometry method for the simultaneous quantitation of six major quassinoids of Tongkat Ali (eurycomanone, 13,21-dihydroeurycomanone, 13α(21)-epoxyeurycomanone, 14,15β-dihydroxyklaineanone, eurycomalactone, and longilactone) was developed and validated. Using the developed method, the content of the six quassinoids was measured in Tongkat Ali containing dietary supplement tablets or capsules, and the resulting data were used to confirm the presence of Tongkat Ali in those products. Among the six quassinoids, eurycomanone was the most abundant quassinoid in all samples tested. The developed method would be useful for the quality assessment of Tongkat Ali containing dietary supplements. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. The effect of a knowledge-based ergonomic intervention amongst administrators at Aga Khan University Hospital, Nairobi.

    Science.gov (United States)

    Wanyonyi, Nancy; Frantz, Jose; Saidi, Hassan

    2015-01-01

    Low back pain (LBP) and neck pain are part of the common work-related musculoskeletal disorders with a large impact on the affected person. Despite having a multifactorial aetiology, ergonomic factors play a major role thus necessitating workers' education. To determine the prevalence of ergonomic-related LBP and neck pain, and describe the effect of a knowledge-based ergonomic intervention amongst administrators in Aga Khan University Hospital, Nairobi. This study applied a mixed method design utilizing a survey and two focus group discussions (FGD). A self-administered questionnaire was distributed to 208 participants through systematic sampling. A one hour knowledge-based ergonomic session founded on the survey results was thereafter administered to interested participants, followed by two FGDs a month later with purposive selection of eight participants to explore their experience of the ergonomic intervention. Quantitative data was captured and analyzed using SPSS by means of descriptive and inferential statistics, whereas thematic content analysis was used for qualitative data. Most participants were knowledgeable about ergonomic-related LBP and neck pain with a twelve month prevalence of 75.5% and 67.8% respectively. Continual ergonomic education is necessary for adherence to health-related behaviours that will preventwork-related LBP and neck pain.

  20. Mobile Sensor System AGaMon for Breath Control: Numerical Signal Analysis of Ternary Gas Mixtures and First Field Tests

    Directory of Open Access Journals (Sweden)

    Rolf Seifert

    2018-01-01

    Full Text Available An innovative mobile sensor system for breath control in the exhaled air is introduced. In this paper, the application of alcohol control in the exhaled air is considered. This sensor system operates semiconducting gas sensor elements with respect to the application in a thermo-cyclic operation mode. This operation mode leads to so-called conductance-over-time-profiles (CTPs, which are fingerprints of the gas mixture under consideration and can be used for substance identification and concentration determination. Especially for the alcohol control in the exhaled air, ethanol is the leading gas component to be investigated. But, there are also other interfering gas components in the exhaled air, like H2 and acetone, which may influence the measurement results. Therefore, a ternary ethanol-H2-acetone gas mixture was investigated. The establishing of the mathematical calibration model and the data analysis was performed with a newly developed innovative calibration and evaluation procedure called ProSens 3.0. The analysis of ternary ethanol-H2-acetone gas samples with ProSens 3.0 shows a very good substance identification performance and a very good concentration determination of the leading ethanol component. The relative analysis errors for the leading component ethanol were in all considered samples less than 9 %. First field test performed with the sensor system AGaMon shows very promising results.

  1. DYNAMICS OF LOCAL ISLAM: FATWA OF MUHAMMAD BASIUNI IMRAN, THE GRAND IMAM OF SAMBAS, ON THE FRIDAY PRAYER ATTENDED BY FEWER THAN FORTY PEOPLE

    Directory of Open Access Journals (Sweden)

    Hamka Siregar

    2013-12-01

    Full Text Available This article is an analitical work based on local Islam dynamic of Sambas society in the era of Sambas Sultanate. The work attempts to promote intellectual heritages such as the book of Cahaya Suluh, which could at least give us an idea that in a process of setting certain rules or istinbat, there is a need for flexibility. As can be observed from the whole argument built in this book, the process is completely flexible, not merely following one school of thought. As indicated in this paper, especially in the discussion of his thought, Muhammad Basiuni Imran used various references for his propositions. Although he was an advocate of the school of Syafi’i, he was still open to the other schools of thought. As a matter of fact, in the case of Friday prayer, his position was different from the school of thought he supported. He took that position because he considered the socio cultural conditions of Sambas at the time. Intellectual spirit shown by the Grand Imam of Sambas should continue to be emulated and expanded. It is a way to avoid the ‘blind’ taqlid against a certain school of thought, as such attitude can narrow human intelligence and reasoning which will eventually lead to collision with local reality that sometimes contains values that do not contradict with religion. In addition, the approach to the interpretation of law should look at its socio-cultural and historical background as this will keep the law strong and sustainable. In this way, Islam will be easily accepted without having to impose foreign culture on local people. Keywords: Dynamic, Islam, Sambas, Grand Imam, Muhammad Basuni Imran

  2. 75 FR 2921 - In the Matter of the Designation of Said Ali al-Shihri, Also Known as Abu-Sayyaf, Also Known as...

    Science.gov (United States)

    2010-01-19

    ... DEPARTMENT OF STATE [Public Notice 6872] In the Matter of the Designation of Said Ali al-Shihri... Known as Abu Sufian Kadhdhaab Matrook, Also Known as Sa'id Ali Jabir al-Khathim al-Shihri, Also Known as... January 23, 2003, I hereby determine that the individual known as Said Ali al- Shihri, and also known as...

  3. Enzymatic liquefaction of agarose above the sol-gel transition temperature using a thermostable endo-type β-agarase, Aga16B.

    Science.gov (United States)

    Kim, Jung Hyun; Yun, Eun Ju; Seo, Nari; Yu, Sora; Kim, Dong Hyun; Cho, Kyung Mun; An, Hyun Joo; Kim, Jae-Han; Choi, In-Geol; Kim, Kyoung Heon

    2017-02-01

    The main carbohydrate of red macroalgae is agarose, a heterogeneous polysaccharide composed of D-galactose and 3,6-anhydro-L-galactose. When saccharifying agarose by enzymes, the unique physical properties of agarose, namely the sol-gel transition and the near-insolubility of agarose in water, limit the accessibility of agarose to the enzymes. Due to the lower accessibility of agarose to enzymes in the gel state than to the sol state, it is important to prevent the sol-gel transition by performing the enzymatic liquefaction of agarose at a temperature higher than the sol-gel transition temperature of agarose. In this study, a thermostable endo-type β-agarase, Aga16B, originating from Saccharophagus degradans 2-40 T , was characterized and introduced in the liquefaction process. Aga16B was thermostable up to 50 °C and depolymerized agarose mainly into neoagarooligosaccharides with degrees of polymerization 4 and 6. Aga16B was applied to enzymatic liquefaction of agarose at 45 °C, which was above the sol-gel transition temperature of 1 % (w/v) agarose (∼35 °C) when cooling agarose. This is the first systematic demonstration of enzymatic liquefaction of agarose, enabled by determining the sol-gel temperature of agarose under specific conditions and by characterizing the thermostability of an endo-type β-agarase.

  4. Interoperating AliEn and ARC for a Distributed Tier1 in the Nordic Countries

    CERN Document Server

    Gros, Philippe; Lindemann, Jonas; Saiz, Pablo; Zarochentsev, Andrey

    2011-01-01

    To reach its large computing needs, the ALICE experiment at CERN has developed its own middleware called AliEn, centralised and relying on pilot jobs. One of its strength is the automatic installation of the required packages. The Nordic countries have offered a distributed Tier-1 centre for the CERN experiments, where the job management should be done with the NorduGrid middleware ARC. We have developed an interoperation module to allow to unify several computing sites using ARC, and make them look like a single site from the point of view of AliEn. A prototype has been completed and tested out of production. This talk will present implementation details of the system and its performance in tests.

  5. Stress field during early magmatism in the Ali Sabieh Dome, Djibouti, SE Afar rift

    Science.gov (United States)

    Sue, Christian; Le Gall, Bernard; Daoud, Ahmed Mohamed

    2014-09-01

    The so-called Ali Sabieh range, SE Afar rift, exhibits an atypical antiform structure occurring in the overall extensional tectonic context of the Afar triple junction. We dynamically analyzed the brittle deformation of this specific structural high using four different methods in order to better constrain the tectonic evolution of this key-area in the Afar depression. Paleostress inversions appear highly consistent using the four methods, which a posteriori validates this approach. Computed paleostress fields document two major signals: an early E-W extensional field, and a later transcurrent field, kinematically consistent with the previous one. The Ali Sabieh range may have evolved continuously during Oligo-Miocene times from large-scale extensional to transcurrent tectonism, as the result of probable local stress permutation between σ1 and σ2 stress axes.

  6. Tongkat Ali (Eurycoma longifolia Jack): a review on its ethnobotany and pharmacological importance.

    Science.gov (United States)

    Bhat, Rajeev; Karim, A A

    2010-10-01

    Eurycoma longifolia Jack is an herbal medicinal plant of South-East Asian origin, popularly recognized as 'Tongkat Ali.' The plant parts have been traditionally used for its antimalarial, aphrodisiac, anti-diabetic, antimicrobial and anti-pyretic activities, which have also been proved scientifically. The plant parts are rich in various bioactive compounds (like eurycomaoside, eurycolactone, eurycomalactone, eurycomanone, and pasakbumin-B) among which the alkaloids and quassinoids form a major portion. Even though toxicity and safety evaluation studies have been pursued, still a major gap exists in providing scientific base for commercial utilization and clearance of the Tongkat Ali products with regard to consumer's safety. The present review aims at reviewing the research works undertaken till date, on this plant in order to provide sufficient baseline information for future works and for commercial exploitation. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Pemikiran Ali Syari’ati dalam Sosiologi (Dari Teologi Menuju Revolusi)

    OpenAIRE

    Faiq Tobroni

    2016-01-01

    Ali Syari’ati is muslim brilliant philosopher, graduated from doctoral of Sorbonne France. He created social teology perspective, based from his experience in west sociology perspective about Capitalism or Marxism. He succeed seek the Capitalism and Marxism weaknes if this perspective is used in Muslim Society. He mapping structure of society, insist of: Habil and Qobail. Habil is common people in society, Qabil is high class, likes: prince, aristocrats or capital owner. Qabil was repressedHa...

  8. Pemikiran Ali Syari'ati Dalam Sosiologi (Dari Teologi Menuju Revolusi)

    OpenAIRE

    Tobroni, Faiq

    2015-01-01

    Ali Syari'ati is muslim brilliant philosopher, graduated from doctoral of Sorbonne France. He created social teology perspective, based from his experience in west sociology perspective about Capitalism or Marxism. He succeed seek the Capitalism and Marxism weaknes if this perspective is used in Muslim Society. He mapping structure of society, insist of: Habil and Qobail. Habil is common people in society, Qabil is high class, likes: prince, aristocrats or capital owner. Qabil was repressedHa...

  9. JAliEn - A new interface between the AliEn jobs and the central services

    CERN Document Server

    Grigoras, A G; Pedreira, M M; Saiz, P; Schreiner, S

    2014-01-01

    Since the ALICE experiment began data taking in early 2010, the amount of end user jobs on the AliEn Grid has increased signif icantly. Presently 1/3 of the 40K CPU cores available to ALICE are occupied by jobs submitted by about 400 distinct users, individually or in organized analysis trains. The overall stability of the AliEn middleware has been excellent throughout the 3 years of running, but the massive amount of end-user analysis and its specific requirements and load has revealed few components which can be improved. One of them is the interface between users and central AliEn services (catalogue, job submission system) which we are currently re-implementing in Java . The interface provides persistent connection with enhanced data and job submission authenticity. In this paper we will describe the architecture of the new interface, the ROOT binding which enables the use of a single interface in addition to the standard UN IX-like access shell and the new security-related features.

  10. Securing the AliEn File Catalogue - Enforcing authorization with accountable file operations

    International Nuclear Information System (INIS)

    Schreiner, Steffen; Banerjee, Subho Sankar; Betev, Latchezar; Carminati, Federico; Vladimirovna Datskova, Olga; Furano, Fabrizio; Grigoras, Alina; Grigoras, Costin; Mendez Lorenzo, Patricia; Peters, Andreas Joachim; Saiz, Pablo; Bagnasco, Stefano; Zhu Jianlin

    2011-01-01

    The AliEn Grid Services, as operated by the ALICE Collaboration in its global physics analysis grid framework, is based on a central File Catalogue together with a distributed set of storage systems and the possibility to register links to external data resources. This paper describes several identified vulnerabilities in the AliEn File Catalogue access protocol regarding fraud and unauthorized file alteration and presents a more secure and revised design: a new mechanism, called LFN Booking Table, is introduced in order to keep track of access authorization in the transient state of files entering or leaving the File Catalogue. Due to a simplification of the original Access Envelope mechanism for xrootd-protocol-based storage systems, fundamental computational improvements of the mechanism were achieved as well as an up to 50% reduction of the credential's size. By extending the access protocol with signed status messages from the underlying storage system, the File Catalogue receives trusted information about a file's size and checksum and the protocol is no longer dependent on client trust. Altogether, the revised design complies with atomic and consistent transactions and allows for accountable, authentic, and traceable file operations. This paper describes these changes as part and beyond the development of AliEn version 2.19.

  11. Ali Emirî'nin Osmanlı Tarih ve Edebiyat Mecmuası Ali Emiri's Ottoman History And Literature Periodicals

    Directory of Open Access Journals (Sweden)

    Seher ERDOĞAN ÇELTİK

    2013-03-01

    Full Text Available Periodicals are the documents which constitute resources for ourhistory. A kind of literary atmosphere forms around the magazines;feuilleton novel, story, poetry, critics and similar literary works cometogether with the reader via these magazines. Founder of the PublicLibrary, Ali Emirî published two literary periodicals named OttomanHistory and Literature and History and Literature which are thesuccessor to each other. Totally comprising of 36 issues, the first ispublished as 31 and the latter is published as 5 issues. During theirpublication years, the periodical constituted highly literary atmosphereand this atmosphere undertook an encoring mission in youth’s literaryworks.In this study, these periodicals are introduced and theircontributions to our literary and cultural life are mentioned.First of all Ali Emirî published Ottoman History and Literatureand History and Literature with the aim of being useful for his countryand nation. Later he aimed to illuminate the information/sources ofabout Ottoman history and literature and correct document mistakes.He also wanted to replay to the works that were published as anopposition for him through the magazine and, including Mehmet FuatKöprülü he criticized many other people and institutions.Ali Emiri introduces Divanu Lügati't-Türk to Turkish world. Hewho travelled a lot because of his occupation and thus he continuouslycollected new information and documents. As he enlarged Emirisometimes introduced this information to the readers. Ettik şeref-i hizmet-i ecdâdı ferâmûşÂsârına eslâfımızın rağbet olunmazBir gün bilinir kıymeti mecmûamın ammâPek çok aranır ortada mecmûa bulunmazSüreli yayınlar, edebiyat tarihimize kaynaklık eden dokümanlardandır. Dergiler çevresinde genelde edebî bir muhit oluşur; tefrika roman, hikâye, şiir, tenkit ve benzeri gibi edebî ürünler onlar vasıtasıyla okuyucusuyla buluşur. Millet Kütüphanesinin kurucusu olan Ali Emir

  12. Expounding a Few Key Strategies of Imam Ali (AS on Prevention of Diseases by Means of Improving Nutrition Style

    Directory of Open Access Journals (Sweden)

    Hossein Moradi

    2016-06-01

    Conclusion: Using the guidelines of Imam Ali (AS, new dimensions of prevention practices and treatment of chronic diseases can be achieved. Furthermore, many other hypotheses can be raised making available a wide range of scientific researches

  13. Prognostic Value of the Pretreatment Advanced Lung Cancer Inflammation Index (ALI) in Diffuse Large B Cell Lymphoma Patients Treated with R-CHOP Chemotherapy.

    Science.gov (United States)

    Park, Young Hoon; Yi, Hyeon Gyu; Lee, Moon Hee; Kim, Chul Soo; Lim, Joo Han

    2017-01-01

    The Advanced Lung Cancer Inflammation Index (ALI, body mass index × albumin/neutrophil-to-lymphocyte ratio) has been demonstrated to be a prognostic factor of survival in some solid cancers. We retrospectively investigated the usefulness of the ALI to predict chemotherapy response and survival in 212 patients with diffuse large B cell lymphoma (DLBCL) treated with R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone) chemotherapy. Patients were allocated to a low ALI group (n = 82, 38.7%) or a high ALI group (n = 130, 61.3%) according to an optimal pretreatment ALI cut-off value of 15.5 as determined by receiver operating curve analysis. The low ALI group displayed more adverse clinical characteristics, lower rates of complete remission (54.9 vs. 75.4%, p = 0.008), and poorer 5-year progression-free (PFS, 58.1 vs. 77.3%, p = 0.006) and overall (OS, 64.2 vs. 80.2%, p = 0.008) survival. Multivariate analysis showed that low ALI was found to independently predict shorter PFS and OS. Interestingly, a low ALI reverted to a high ALI during treatment in 58 patients (27.4%), and the 5-year OS of these patients was better than that of patients whose ALI remained low (n = 24, 72.5 vs. 24%, p ALI might be an easily available marker for predicting clinical outcomes in DLBCL patients treated with R-CHOP chemotherapy. © 2017 S. Karger AG, Basel.

  14. INSAN KAMIL DALAM PEMIKIRAN MUHAMMAD NAFIS AL-BANJARI DAN ABDUSH-SHAMAD AL-FALIMBÂNÎ DALAM KITAB AD-DURR AN-NAFIS DAN SIYAR AS-SÂLIKÎN (SEBUAH STUDI PERBANDINGAN

    Directory of Open Access Journals (Sweden)

    Rodiah Rodiah

    2015-10-01

    Full Text Available This paper tries to explore the concept of Insan Kamil through two books of Sufism, ad-Durr an-Nafis by Muhammad Nafis al-Banjari and Siyar as-Salikin by Abdush-Shamad al-Falimbânî. The method used in this paper comparative descriptive approach, because the studies referred to in this study aims to look at the similarities and differences of the concept of Insan Kamil contained in both books. These results indicate that the thought of Muhammad Nafis al-Banjari in the book ad-Durr an-Nafis and Abdush-Samad al-Falimbânî in the book Siyar al-Salikin against the concept of Insan Kamil has the same basic concept, in addition to the typical thinking its own distinct between the two.

  15. Browse Title Index

    African Journals Online (AJOL)

    Items 4851 - 4900 of 11090 ... Salman Mushtaq, Ishfaq Ahmad Hafiz, Syed Zia Ul Hasan, Muhammad Arif, Muhammad Asif Shehzad, Rizwan Rafique, Misbah Rasheed, Muhammad Ali, Muhammad Shahid Iqbal. Vol 7, No 24 (2008), Evaluation of seed production of scots pine (Pinus sylvestris L.) clonal seed orchard with cone ...

  16. Analysis and Study of Muhammad Husayn Tabataba'i's Theory about the origin of secondary philosophical intelligibles using Morteza Motahhari's Commenting

    Directory of Open Access Journals (Sweden)

    Alireza Dorri Nogoorani

    2018-02-01

    Full Text Available Secondary philosophical intelligibles are general philosophical concepts such as existence, non-existence, cause, effect and accident on which the life of Islamic philosophy depends. Muhammad Husayn Tabataba'I has tried to propose a comprehensive theory about the way through which secondary philosophical intelligibles are originated. He believes that these intelligibles are first understood through relational concepts and then non-relational concepts are abstracted from those relational ones and generalized. This article tries to give a clear formulation of the theory with four phases (in addition to its foundations using Tabataba'i's works and Motahhari's comments. The resuts of this research study shows that these concepts are not delusion. It also depicts that these concepts are not extracted from internal or external experiences or primordial human nature (fitrah but are created from perceptive faculty. In addition, some other key issues to which Allameh has not paid enough attention, such as how to generalize the concept of secondary intelligible which has been abstracted from a special mental state to the whole world and the relationship between secondary intelligible obtained in the mind and the object to which the secondary intelligible refers, have been stated and the researcher has tried to find answers for these questions.

  17. Audito pasiūlos Baltijos šalių kapitalo rinkoms tyrimas

    OpenAIRE

    Černelis, Vidmantas

    2011-01-01

    Šiame darbe yra atskleidžiama ir analizuojama audito pasiūla tenkanti kapitalo rinkoms, nagrinėjama jos nepakankamumo problema. Darbo tikslas yra, įvertinus globalius audito pasiūlos pokyčius ir jų įtaką kapitalo rinkoms, atlikti audito pasiūlos ir auditoriaus pasirinkimo veiksnių Baltijos šalių kapitalo rinkoms tyrimą. Darbas skirstomas į tris pagrindines dalis. Pirmojoje dalyje apibūdinamas auditoriaus vaidmuo bei jo reikšmė ekonomikai, atskleidžiamas sisteminės rizikos, kylančios iš audito...

  18. Summary of Current Radiometric Calibration Coefficients for Landsat MSS, TM, ETM+, and EO-1 ALI Sensors

    Science.gov (United States)

    Chander, Gyanesh; Markham, Brian L.; Helder, Dennis L.

    2009-01-01

    This paper provides a summary of the current equations and rescaling factors for converting calibrated Digital Numbers (DNs) to absolute units of at-sensor spectral radiance, Top-Of- Atmosphere (TOA) reflectance, and at-sensor brightness temperature. It tabulates the necessary constants for the Multispectral Scanner (MSS), Thematic Mapper (TM), Enhanced Thematic Mapper Plus (ETM+), and Advanced Land Imager (ALI) sensors. These conversions provide a basis for standardized comparison of data in a single scene or between images acquired on different dates or by different sensors. This paper forms a needed guide for Landsat data users who now have access to the entire Landsat archive at no cost.

  19. ALI and DAC for transuranic elements based on the metabolic data presented in ICRP publication 48

    OpenAIRE

    外川 織彦; 山口 勇吉; 本間 俊充

    1987-01-01

    最近刊行されたICRPの報告書、ICRP Publication 48にはICRP Publication 30の年摂取限度(ALI)と誘導空気中濃度(DAC)の計算に採用されたデータと比較して、いくつかの超ウラン元素について新しい代謝データが示されている。

  20. Odonata (Insecta diversity of Salim Ali Bird Sanctuary and its adjacent areas in Thattekkad, Kerala, India

    Directory of Open Access Journals (Sweden)

    A.P. Varghese

    2014-06-01

    Full Text Available Odonata diversity of Salim Ali Bird Sanctuary and its adjacent areas in Thattekkad, Kerala, India were documented from 2010 to 2012. Opportunistic observations were carried out to record species diversity. Eighty-two species of Odonata, which included 51 species of Anisoptera (dragonflies and 31 species of Zygoptera (damselflies, were recorded during the study. Of this 21 species are endemic to the Western Ghats. The presence of the IUCN categorized nearly threatened species like Megalogomphus hannyngtoni and vulnerable species like Platysticta deccanensis and Protosticta sanguinostigma is remarkable.

  1. Ab-initio study of phase stability, elastic and thermodynamic properties of AlY alloy under pressure

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Dawei [College of Physics and Electronic Engineering, Nanyang Normal University, Nanyang 473061 (China); Su, Taichao [Institute of Materials Science and Engineering, Henan Polytechnic University, Jiaozuo 454000 (China); Song, Haizhen; Lu, Cheng; Zhong, Zhiguo; Lu, Zhiwen [College of Physics and Electronic Engineering, Nanyang Normal University, Nanyang 473061 (China); Pu, Chunying, E-mail: puchunying@126.com [College of Physics and Electronic Engineering, Nanyang Normal University, Nanyang 473061 (China)

    2015-11-05

    Using the particle swarm optimization algorithm combined with first-principles methods, we explore the diagram of AlY alloy up to 250 GPa. It is found that AlDy phase, rather than the experimentally observed B2 phase, is the most stable structure at 0 K and 0–20 GPa. However, our results show that B2 phase can exist as a stable phase at 20–27.6 GPa. At higher pressure, four new high-pressure phases with Cmcm-I, Cmcm-II, I4/mmm and P4/nmm structure are identified for the first time. The hardness, elastic and thermodynamic properties of the newly found phases are investigated and compared with B2 phase. The calculated hardness of AlDy, Cmcm-I, Cmcm-II, I4/mmm and P4/nmm phases is in the range of 7–9 GPa, higher than that of B2 phase. In addition, it is found that AlDy phase is a brittle material at 0 GPa, which changes to a ductile material above 12 GPa. Except for AlDy phase, all the other AlY compounds exhibit completely ductile behavior under pressure. Compared with the other phases, B2 phase is found to have the best ductility and the largest elastic anisotropy over the whole pressure investigated. Moreover, all AlY intermetallics exhibit a nearly elastic isotropy in compressibility but a comparatively large elastic anisotropy in shear. The structural stability, electronic structure, bulk and shear modulus, Debye temperature as well as sound velocities of AlY alloy under pressure are also deeply discussed. - Graphical abstract: Pressure-induced phase transition of AlY alloy up to 250 GPa. - Highlights: • The diagram of AlY alloy was explored and four new stable phases were predicted. • B2 phase shows the largest ductility and elastic anisotropy among AlY alloys. • All AlY alloys exhibit ductile behavior except for AlDy phase under pressure. • All AlY alloys show strong isotropy in compressibility and anisotropy in shear.

  2. STS-45 Earth observation of the Persian Gulf and the island of Abu Ali

    Science.gov (United States)

    1992-01-01

    STS-45 Earth observation taken aboard Atlantis, Orbiter Vehicle (OV) 104, is of the northern reaches of the Persian Gulf with the sunglint pattern centered on the Saudi Arabian island of Abu Ali. Bright features along the coast are thought to be deposits of oil, released from a terminal offshore of Kuwait during the recent Persian Gulf War. Further up the coast, in Kuwait, the black, oil-soaked desert surrounding the site of the oil well fires is clearly visible. View was taken from an altitude of 160 nautical miles with OV-104 located at 28 degrees north and 52.8 degrees east. During the STS-45 mission, an international survey team focused on oil contamination of the shallow-water habitants in the area north of Abu Ali Island. Crewmembers contacted the NOAA survey vessel, the R/V Mt. Mitchell, several times and photographed water color and sunglint within the study area and throughout the entire Persian Gulf. These photographic data are expected to aid the Persian Gulf researchers in

  3. Magma-driven antiform structures in the Afar rift: The Ali Sabieh range, Djibouti

    Science.gov (United States)

    Le Gall, Bernard; Daoud, Mohamed Ahmed; Maury, René C.; Rolet, Joël; Guillou, Hervé; Sue, Christian

    2010-06-01

    The Ali Sabieh Range, SE Afar, is an antiform involving Mesozoic sedimentary rocks and synrift volcanics. Previous studies have postulated a tectonic origin for this structure, in either a contractional or extensional regime. New stratigraphic, mapping and structural data demonstrate that large-scale doming took place at an early stage of rifting, in response to a mafic laccolithic intrusion dated between 28 and 20 Ma from new K-Ar age determinations. Our 'laccolith' model is chiefly supported by: (i) the geometry of the intrusion roof, (ii) the recognition of roof pendants in its axial part, and (iii) the mapping relationships between the intrusion, the associated dyke-sill network, and the upper volcanic/volcaniclastic sequences. The laccolith is assumed to have inflated with time, and to have upwardly bent its sedimentary roof rocks. From the architecture of the ˜1 km-thick Mesozoic overburden sequences, ca. 2 km of roof lifting are assumed to have occurred, probably in association with reactivated transverse discontinuities. Computed paleostress tensors indicate that the minimum principal stress axis is consistently horizontal and oriented E-W, with a dominance of extensional versus strike-slip regimes. The Ali Sabieh laccolith is the first regional-scale magma-driven antiform structure reported so far in the Afro-Arabian rift system.

  4. Ali Canip Yöntem’in Sanata ve Edebiyata Bakışı Ali Canip Yöntem’s Perspective to Art and Literature

    Directory of Open Access Journals (Sweden)

    Abdullah HARMANCI

    2012-09-01

    Full Text Available Ali Canip Yöntem (1887-1967 who is one of the prominent names of the national literary movement gave many works relating to literary theory and criticism as well as poem. Before being connected to national literary, author who has largely been seeking on the line extending from Muallim Naci to Cedideci (New Literature movement and Fecr-i Aticis (Dawn of the Future has deep thoughts in his many articles that will light the way for today’s artists and researchers either due to hiscommand of our classical literature or of Western Literature. From hiswritings in question, in our article, opinions of Yöntem about somematters such as what is the art and literature, why it is existing, whatcould be its power and effect, how to take advantage of art andliterature, the place and importance of the imitation in art, pleasure,beauty, perception and genius concepts, purpose of art, relationshipbetween artist and school of art, art and dialectic, poem and knowledge,poem and sensation etc were scanned and these opinions were whollyattempted to be assessed. Apart from these, problems collected undersome titles such as what, in fact, is the concept of national literature adhow it should be understood, our mistakes when assessing the concept“national”, dimensions of artist and public when assessing within thecontext of national literature have been the topic of the Ali CanipYöntem’s articles and opinions of author about these issues wereattempted to be examined by us. Yöntem also referred to the problemsabout limits of literary criticism and features which a reviewer musthave, and attached importance to the relationship of literary criticismwith literary text. Milli edebiyat akımının önde gelen isimlerinden olan Ali Canip Yöntem (1887 – 1967, şiirin yanı sıra edebiyat teorisine ve eleştirisine ilişkin eserler de vermiştir. Milli edebiyata mensup olmadan önce, Muallim Naci’den Edebiyatı Cedidecilere, Fecr-i Âticilere uzanan

  5. His Excellency Mr Ali Naci Koru Ambassador extraordinary and plenipotentiary Permanent Representative of Turkey to the United Nations Office at Geneva and other international organisations in Switzerland

    CERN Multimedia

    Bennett, Sophia Elizabeth

    2017-01-01

    His Excellency Mr Ali Naci Koru Ambassador extraordinary and plenipotentiary Permanent Representative of Turkey to the United Nations Office at Geneva and other international organisations in Switzerland

  6. Toplumcu gerçekçilik ve Sabahattin Ali'nin hikâye kişileri

    OpenAIRE

    Hasdedeoğlu, Mehmet Onur

    2008-01-01

    Bu çalısmanın konusu, günümüzde devrini tamamlamıs olan toplumcu gerçekçilik akımının ilkeleri dorultusunda, Sabahattin Ali'nin hikâye kisilerini tanımaktır. Ulasılması hedeflenen amaç, edebiyatın çesitli türlerinde eserler vermis olmasına karsın daha çok hikâyeci kimligiyle öne çıkan Sabahattin Ali'nin, hikâyelerinde yarattıgı kahramanları inceleme yoluyla, temsilcisi oldugu toplumcu gerçekçilik akımı içerisindeki yerini belirlemektir. Çalısmanın çekirdegini olusturan ?Sabahattin Ali'nin Hik...

  7. Differential expression of THOC1 and ALY mRNP biogenesis/export factors in human cancers

    International Nuclear Information System (INIS)

    Domínguez-Sánchez, María S; Sáez, Carmen; Japón, Miguel A; Aguilera, Andrés; Luna, Rosa

    2011-01-01

    One key step in gene expression is the biogenesis of mRNA ribonucleoparticle complexes (mRNPs). Formation of the mRNP requires the participation of a number of conserved factors such as the THO complex. THO interacts physically and functionally with the Sub2/UAP56 RNA-dependent ATPase, and the Yra1/REF1/ALY RNA-binding protein linking transcription, mRNA export and genome integrity. Given the link between genome instability and cancer, we have performed a comparative analysis of the expression patterns of THOC1, a THO complex subunit, and ALY in tumor samples. The mRNA levels were measured by quantitative real-time PCR and hybridization of a tumor tissue cDNA array; and the protein levels and distribution by immunostaining of a custom tissue array containing a set of paraffin-embedded samples of different tumor and normal tissues followed by statistical analysis. We show that the expression of two mRNP factors, THOC1 and ALY are altered in several tumor tissues. THOC1 mRNA and protein levels are up-regulated in ovarian and lung tumors and down-regulated in those of testis and skin, whereas ALY is altered in a wide variety of tumors. In contrast to THOC1, ALY protein is highly detected in normal proliferative cells, but poorly in high-grade cancers. These results suggest a differential connection between tumorogenesis and the expression levels of human THO and ALY. This study opens the possibility of defining mRNP biogenesis factors as putative players in cell proliferation that could contribute to tumor development

  8. Does advanced lung inflammation index (ALI) have prognostic significance in metastatic non-small cell lung cancer?

    Science.gov (United States)

    Ozyurek, Berna Akinci; Ozdemirel, Tugce Sahin; Ozden, Sertac Buyukyaylaci; Erdoğan, Yurdanur; Ozmen, Ozlem; Kaplan, Bekir; Kaplan, Tugba

    2018-01-22

    Lung cancer is the most commonly diagnosed and death-related cancer type and is more frequent in males. Non-small-cell lung cancer (NSCLC) accounts for about 85% of all case. In this study, it was aimed to research the relationship between advanced lung inflammation index (ALI) and the primary mass maximum standardized uptake value (SUVmax) and C-reactive protein (CRP) at initial diagnosis and the prognostic value of ALI in determining the survival in metastatic NSCLC. A total of 112 patients diagnosed as stage 4 non-small-lung cancer in our hospital between January 2006 and December 2013 were included in this study. ALI was calculated as body mass index (BMI) × serum albumin/neutrophil-to-lymphocyte ratio (NLR). The patients were divided into two groups as ALI ALI ≥ 18 (low inflammation). The log-rank test and Cox proportional hazard model were used to identify predictors of mortality. Evaluation was made of 94 male and 18 female patients with a mean age of 59.7 ± 9.9 years. A statistically significant negative relationship was determined between ALI and CRP values (P ALI and SUVmax values (P = .436). The median survival time in patients with ALI ALI ≥ 18, it was 16 months (P = .095). ALI is an easily calculated indicator of inflammation in lung cancer patients. Values <18 can be considered to predict a poor prognosis. © 2018 John Wiley & Sons Ltd.

  9. Gene expression of bovine embryos developing at the air-liquid interface on oviductal epithelial cells (ALI-BOEC).

    Science.gov (United States)

    van der Weijden, Vera A; Chen, Shuai; Bauersachs, Stefan; Ulbrich, Susanne E; Schoen, Jennifer

    2017-11-25

    We recently developed an air-liquid interface long-term culture of differentiated bovine oviductal epithelial cells (ALI-BOEC). This ex vivo oviduct epithelium is capable of supporting embryo development in co-culture up to the blastocyst stage without addition of embryo culture medium. However, blastocyst rates in co-culture were markedly lower than in conventional in vitro embryo production procedures. In the present study, we assessed target gene expression of ALI-BOEC derived embryos to test their similarity to embryos from conventional in vitro embryo culture. We screened previously published data from developing bovine embryos and selected 41 genes which are either differentially expressed during embryo development, or reflect differences between various in vitro culture conditions or in vitro and in vivo embryos. Target gene expression was measured in 8-cell embryos and blastocysts using a 48.48 Dynamic Array™ on a Biomark HD instrument. For comparison with the ALI-BOEC system, we generated embryos by two different standard IVP protocols. The culture conditions lead to differential gene expression in both 8-cell embryos and blastocysts. Across the expression of all target genes the embryos developing on ALI-BOEC did not depart from conventional IVP embryos. These first results prove that gene expression in ALI-BOEC embryos is not largely aberrant. However, there was no clear indication for a more in vivo-like target gene expression of these embryos. This calls for further optimization of the ALI-BOEC system to increase its efficiency both quantitatively and qualitatively.

  10. Land cover mapping with emphasis to burnt area delineation using co-orbital ALI and Landsat TM imagery

    Science.gov (United States)

    Petropoulos, George P.; Kontoes, Charalambos C.; Keramitsoglou, Iphigenia

    2012-08-01

    In this study, the potential of EO-1 Advanced Land Imager (ALI) radiometer for land cover and especially burnt area mapping from a single image analysis is investigated. Co-orbital imagery from the Landsat Thematic Mapper (TM) was also utilised for comparison purposes. Both images were acquired shortly after the suppression of a fire occurred during the summer of 2009 North-East of Athens, the capital of Greece. The Maximum Likelihood (ML), Artificial Neural Networks (ANNs) and Support Vector Machines (SVMs) classifiers were parameterised and subsequently applied to the acquired satellite datasets. Evaluation of the land use/cover mapping accuracy was based on the error matrix statistics. Also, the McNemar test was used to evaluate the statistical significance of the differences between the approaches tested. Derived burnt area estimates were validated against the operationally deployed Services and Applications For Emergency Response (SAFER) Burnt Scar Mapping service. All classifiers applied to either ALI or TM imagery proved flexible enough to map land cover and also to extract the burnt area from other land surface types. The highest total classification accuracy and burnt area detection capability was returned from the application of SVMs to ALI data. This was due to the SVMs ability to identify an optimal separating hyperplane for best classes' separation that was able to better utilise ALI's advanced technological characteristics in comparison to those of TM sensor. This study is to our knowledge the first of its kind, effectively demonstrating the benefits of the combined application of SVMs to ALI data further implying that ALI technology may prove highly valuable in mapping burnt areas and land use/cover if it is incorporated into the development of Landsat 8 mission, planned to be launched in the coming years.

  11. Catalytically important amino-acid residues of abalone alginate lyase HdAly assessed by site-directed mutagenesis

    OpenAIRE

    Yamamoto, Sayo; Sahara, Takehiko; Sato, Daisuke; Kawasaki, Kosei; Ohgiya, Satoru; Inoue, Akira; Ojima, Takao

    2008-01-01

    Alginate lyase is an enzyme that degrades alginate chains via β-elimination and has been used for the production of alginate oligosaccharides and protoplasts from brown algae. Previously, we deduced the amino-acid sequence of an abalone alginate lyase, HdAly, from its cDNA sequence and, through multiple amino-acid sequence alignment, found that several basic amino-acid residues were highly conserved among the polysaccharide-lyase family 14 (PL-14) enzymes including HdAly. In the present study...

  12. Occurrence and genesis of Quaternary microbialitic tufa at Hammam Al Ali, Oman

    Science.gov (United States)

    Khalaf, Fikry I.

    2017-05-01

    Remnants of late Quaternary microbialitic tufa occurs within a shallow depression in the Hammam Al Ali hot spring area, which is located approximately 14.5 km to the southwest of Muscat, Oman. The tufa precipitated from hot spring water supersaturated with respect to calcium carbonate and is mostly of a porous phytogenic type, with occasional detrital and stromatolitic types. Microscopic and nanoscopic examination revealed that the tufa deposits developed through two successive processes of calcite precipitation, biotic and abiotic, preceded by limited precipitation of unstable aragonite. It is suggested that biologically mediated precipitation results in the construction of incomplete skeletal calcite crystals. The latter provide a base for classical physiochemical precipitation and, eventually, the development of complete sparry calcite crystals. The initiation of dendritic calcite crystals in the stromatolitic tufa as incomplete biogenic skeletal crystals and their characteristic growth pattern indicates that the tufa represents a clear example of hot spring calcitic microbialite.

  13. Effet des conditions climatiques sur le niveau du lac Sidi Ali (Moyen Atlas, Maroc)

    OpenAIRE

    Sayad, Ahmed; Chakiri, Saïd; Martin, Claude; Bejjaji, Zohra; Echarfaoui, Hassan

    2012-01-01

    Le lac Sidi Ali est un lac naturel d'altitude (2070-2080 m), sans exutoire superficiel, déterminé par le barrage d'une coulée basaltique. Doté d'un bassin versant apparent de 15,6 km2, il est alimenté par des eaux de ruissellement et par des sources karstiques. Son niveau subit des variations très fortes, annuelles et interannuelles, sous le contrôle des conditions climatiques, et en particulier des pluies et de l'évapotranspiration. Les périodes de sécheresse qui ont marqué les trois dernièr...

  14. Porphyry Cu-Au mineralization in the Mirkuh Ali Mirza magmatic complex, NW Iran

    Science.gov (United States)

    Maghsoudi, A.; Yazdi, M.; Mehrpartou, M.; Vosoughi, M.; Younesi, S.

    2014-01-01

    The Mirkuh Ali Mirza Cu-Au porphyry system in East Azerbaijan Province is located on the western part of the Cenozoic Alborz-Azerbaijan volcanic belt. The belt is also an important Cu-Mo-Au metallogenic province in northwestern Iran. The exposed rocks in the study area consist of a volcaniclastic sequence, subvolcanic rocks and intermediate to mafic lava flows of Neogene age. The volcanic rocks show a typical subduction-related magmatic arc geological and geochemical signature, with low concentration of Nb, Ta, and Ti. Mineralization is hosted by Neogene dacitic tuff and porphyritic dacite situated at the intersections of northeast and northwest faults. Field observations, alteration zonation, geochemical haloes and isotopic data of the Mirkuh Ali Mirza magmatic complex show similarities with typical convergent margin Cu-Au porphyry type deposits. The following features confirm the classic model for Cu-Au porphyry systems: (a) close spatial association with high-K calcalkaline to shoshonitic rock related to post-collision extensional setting (b) low grade Cu (0.57%) (c) stockworks as well as disseminated sulfides (c) zonality of the alteration patterns from intense phyllic at the center to outward weak-phyllic, argillic, and propylitic (d) the presence of a pyritic halo (e) accompanied by sheeted veins and low-sulfidation epithermal gold (f) mineralization spatially associated with intersection of structures, (g) genetically related to diorite porphyry stocks at depth (h) geochemical zonation of (Cu ± Au ± Ag ± Bi) → (Cu + Mo ± Bi ± Au ± Pb ± Zn ± As) → (Au + Mo ± Pb ± Zn) → (As + Ag + Sb + Mn + Ba + Pb + Zn + Hg) → Hg from center to outwards (i) The range of sulfur isotopic values is approximately zero (interpreted to have magmatic source) and similar to other subduction-related porphyry Cu deposits.

  15. VizieR Online Data Catalog: AKARI IRC asteroid sample diameters & albedos (Ali-Lagoa+, 2018)

    Science.gov (United States)

    Ali-Lagoa, V.; Mueller, T. G.; Usui, F.; Hasegawa, S.

    2017-11-01

    Table 1 contains the best-fitting values of size and beaming parameter and corresponding visible geometric albedos for the full AKARI IRC sample. We fitted the near-Earth asteroid thermal model (NEATM) of Harris (1998Icar..131..291H) to the AKARI IRC thermal infrared data (Murakami et al., 2007PASJ...59S.369M, Onaka et al., 2007PASJ...59S.401O, Ishihara et al., 2010A&A...514A...1I, Cat. II/297, Usui et al., 2011PASJ...63.1117U, Cat. J/PASJ/63/1117, Takita et al., 2012PASJ...64..126T, Hasegawa et al., 2013PASJ...65...34H, Cat. J/PASJ/65/34). The NEATM implementation is described in Ali-Lagoa and Delbo' (2017A&A...603A..55A, cat. J/A+A/603/A55). Minimum relative errors of 10, 15, and 20 percent are given for size, beaming parameter and albedo in those cases where the beaming parameter could be fitted. Otherwise, a default value of the beaming parameter is assumed based on Eq. 1 in the article, and the minimum relative errors in size and albedo increase to 20 and 40 percent (see the discussions in Mainzer et al., 2011ApJ...736..100M, Ali-Lagoa et al., 2016A&A...591A..14A, Cat. J/A+A/591/A14). We also provide the asteroid absolute magnitudes and G12 slope parameters retrieved from Oszkiewicz et al. (2012), the number of observations used in each IRC band (S9W and L18W), plus the heliocentric and geocentric distances and phase angle (r, Delta, alpha) based on the ephemerides taken from the MIRIADE service (http://vo.imcce.fr/webservices/miriade/?ephemph). (1 data file).

  16. Evaluation of lipid and glucose metabolism and cortisol and thyroid hormone levels in obese appropriate for gestational age (AGA) born and non-obese small for gestational age (SGA) born prepubertal Slovak children.

    Science.gov (United States)

    Blusková, Zuzana; Koštálová, Ludmila; Celec, Peter; Vitáriušová, Eva; Pribilincová, Zuzana; Maršálková, Marianna; Šemberová, Jana; Kyselová, Tatiana; Hlavatá, Anna; Kovács, László

    2014-07-01

    Obesity is the major determinant of metabolic syndrome. Being born small for gestational age (SGA) may be co-responsible. We aimed at evaluating the association between 1. obesity and 2. being born SGA and the presence of endocrine-metabolic abnormalities in prepubertal Slovak children. The study included 98 children, aged 3-10.9 years: 36 AGA-born obese children (OB), 31 SGA-born children (SGA) and 31 appropriate for gestational age born non-obese children (AGA). Fasting serum levels of glucose, total cholesterol, LDL, HDL, triglycerides, fT4, TSH, cortisol and insulin were determined. HOMA-IR was calculated. Personal data about birth weight and length and family history were collected. Actual anthropometric measurement was done. In every group, high prevalence of positive family history of metabolic disorder was found. In comparison with AGA children, OB children were taller (plevels and homeostasis model assessment for insulin resistance (HOMA-IR) (pcortisol levels (p=0.069) was noted. SGA-born children were shorter (plevels (plevels (p=0.085) and increased fT4 levels (pobese children and twice more metabolic abnormalities were present in SGA-born children in comparison with AGA-born children. SGA-born children are more prone to developing endocrine-metabolic abnormalities than non-obese children born AGA, but they are at less risk than obese AGA-born children. We should provide specialized care for obese children already in prepubertal age and pay attention to SGA-born children.

  17. [VEGF165 transfected endothelial progenitor cells mediated by lentivirus alleviated ALI in rats].

    Science.gov (United States)

    He, Zhaohui; He, Huiwei; Lu, Yuanhua; Chen, Zhi; Xu, Fanghua; Wang, Rongsheng; Yang, Chunli

    2017-11-01

    To investigate the protective effects of vascular endothelial growth factor-165 (VEGF165) transfected the endothelial progenitor cells (EPCs) mediated by lentivirus on acute lung injury (ALI) in rats. The mononuclear cells from the male Sprague-Dawley (SD) rats were isolated and cultured to get the EPCs for study. The lentivirus vector carrying the human VEGF165 gene was constructed. According to the random number table method, 90 male SD rats were divided into ALI model group, phosphate buffer solution (PBS) group, EPCs treatment group, none transfected EPCs treatment group and VEGF165 transfected EPCs treatment group, and the rats in each group were subdivided into 4, 12 and 48 hours subgroups, with 6 rats in each subgroup. The rat model of ALI was reproduced by intravenous injection of oleic acid (0.15 μL/g). Then each treatment group was given PBS, EPCs, none transfected EPCs and VEGF165 transfected EPCs respectively with the same volume of 0.2 mL. For the groups with cells, about 1×10 6 cells were contained. Abdominal aortic blood and lung tissue were harvested at 4, 12 and 48 hours. Arterial blood gas analysis was performed. The lung wet/dry weight ratio (W/D) was calculated. The expressions of induced nitric oxide synthase (iNOS), endothelin-1 (ET-1) and VEGF165 were determined by enzyme-linked immunosorbent assay (ELISA). After dyed with hematoxylin-eosin (HE), the lung tissue pathology was observed and the lung injury score was performed. Compared with the ALI model group, the arterial partial pressure of oxygen (PaO 2 ) in EPCs, none transfected EPCs and VEGF165 transfected EPCs treatment groups was significantly increased from 4 hours, and lung W/D, expressions of iNOS and ET-1 were significantly decreased, and VEGF165 expression was significantly increased. Compared with the EPCs treatment group, the increase in PaO 2 , the decrease in lung W/D and expressions of iNOS and ET-1, and the increase in VEGF165 expression in VEGF165 transfected EPCs

  18. AL ITTIJAHAT AL MUNHARIFAH FI AT TAFSIR LI BADLI ASHAB AL MADZAHIB AL NAHWIYYAH WA BADL MAN YAJHALUNA QAWAID AL LUGHAH AL ARABIYYAH FI NADHAR MUHAMMAD HUSAIN AL DZAHABIY

    Directory of Open Access Journals (Sweden)

    Misbakhudin Misbakhudin

    2017-06-01

    Full Text Available One of the most precious achievement in qur’anic studies was the book of Al-Ittijâhât al-Munharifah fî al-Tafsîr: Dawâfi’uha wa Daf’uha written by A great Islamic scholar, Muhammad Husein al-Dzahabî. He was succeeded in discussing several issues of corruptions of the exegesis of the holy Qur’an. This article is aimed to explain and to describe his analysis toward several corrupted linguist interpretations in their originations and such corrupted linguistic interpretations of the holy Qur’an which are ignoring Arabic structures and grammers

  19. An Approach to the Stories of Sabahattin Ali within the Context of Marxist Literary Aesthetics: The Conflict between Peasants and the Intelligentsia

    Science.gov (United States)

    Yigit, Murat

    2016-01-01

    This study will try to read the stories of Sabahattin Ali, who has written various books in Turkish, within the context of Marxist literary aesthetics, assess the types and characters in the stories of Sabahattin Ali within that framework, and observe the social levels and the gaps between them based on the relationships between the two extreme…

  20. 40 CFR 721.9527 - Bis(1,2,2,6,6-pentamethyl-4-piperidin-4-ol) ester of cy-clo-ali-phatic spiroketal.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Bis(1,2,2,6,6-pentamethyl-4-piperidin-4-ol) ester of cy-clo-ali-phatic spiroketal. 721.9527 Section 721.9527 Protection of Environment...-piperidin-4-ol) ester of cy-clo-ali-phatic spiroketal. (a) Chemical substance and significant new uses...

  1. The ALI-ARMS Code for Modeling Atmospheric non-LTE Molecular Band Emissions: Current Status and Applications

    Science.gov (United States)

    Kutepov, A. A.; Feofilov, A. G.; Manuilova, R. O.; Yankovsky, V. A.; Rezac, L.; Pesnell, W. D.; Goldberg, R. A.

    2008-01-01

    The Accelerated Lambda Iteration (ALI) technique was developed in stellar astrophysics at the beginning of 1990s for solving the non-LTE radiative transfer problem in atomic lines and multiplets in stellar atmospheres. It was later successfully applied to modeling the non-LTE emissions and radiative cooling/heating in the vibrational-rotational bands of molecules in planetary atmospheres. Similar to the standard lambda iterations ALI operates with the matrices of minimal dimension. However, it provides higher convergence rate and stability due to removing from the iterating process the photons trapped in the optically thick line cores. In the current ALI-ARMS (ALI for Atmospheric Radiation and Molecular Spectra) code version additional acceleration of calculations is provided by utilizing the opacity distribution function (ODF) approach and "decoupling". The former allows replacing the band branches by single lines of special shape, whereas the latter treats non-linearity caused by strong near-resonant vibration-vibrational level coupling without additional linearizing the statistical equilibrium equations. Latest code application for the non-LTE diagnostics of the molecular band emissions of Earth's and Martian atmospheres as well as for the non-LTE IR cooling/heating calculations are discussed.

  2. Assessments of Ali, Dome A, and Summit Camp for mm-wave Observations Using MERRA-2 Reanalysis

    Science.gov (United States)

    Kuo, Chao-Lin

    2017-10-01

    NASA’s latest MERRA-2 reanalysis of the modern satellite measurements has made atmospheric data easily accessible with unprecedented uniformity, fidelity, and completeness. In this paper, these data are used to evaluate five sites for millimeter-wave (mm-wave) observations. These include two established sites (South Pole and Chajnantor, Atacama), and three new sites (Ali in Tibet, Dome A in Antarctica, and Summit Camp in Greenland). Atmospheric properties including precipitable water vapor (PWV), sky brightness temperature fluctuations, and ice and liquid water paths are derived and compared. Dome A emerges to be the best among those evaluated, with PWV and fluctuations smaller than the second-best site, South Pole, by more than a factor of 2. It is found that the higher site in Ali (6100 m) is on par with Cerro Chajnantor (5612 m) in terms of transmission and stability. The lower site in Ali (5250 m) planned for the first stage of observations at 90/150 GHz provides conditions comparable to those on the Chajnantor Plateau. These analyses confirm Ali to be an excellent mm-wave site in the Northern Hemisphere that will complement well-established Southern sites. According to MERRA-2 data, the observing conditions at Summit Camp are also comparable to Cerro Chajnantor. However, it is more affected by the presence of liquid water clouds.

  3. Assessments of Ali, Dome A, and Summit Camp for mm-wave Observations Using MERRA-2 Reanalysis

    International Nuclear Information System (INIS)

    Kuo, Chao-Lin

    2017-01-01

    NASA's latest MERRA-2 reanalysis of the modern satellite measurements has made atmospheric data easily accessible with unprecedented uniformity, fidelity, and completeness. In this paper, these data are used to evaluate five sites for millimeter-wave (mm-wave) observations. These include two established sites (South Pole and Chajnantor, Atacama), and three new sites (Ali in Tibet, Dome A in Antarctica, and Summit Camp in Greenland). Atmospheric properties including precipitable water vapor (PWV), sky brightness temperature fluctuations, and ice and liquid water paths are derived and compared. Dome A emerges to be the best among those evaluated, with PWV and fluctuations smaller than the second-best site, South Pole, by more than a factor of 2. It is found that the higher site in Ali (6100 m) is on par with Cerro Chajnantor (5612 m) in terms of transmission and stability. The lower site in Ali (5250 m) planned for the first stage of observations at 90/150 GHz provides conditions comparable to those on the Chajnantor Plateau. These analyses confirm Ali to be an excellent mm-wave site in the Northern Hemisphere that will complement well-established Southern sites. According to MERRA-2 data, the observing conditions at Summit Camp are also comparable to Cerro Chajnantor. Furthermore, it is more affected by the presence of liquid water clouds.

  4. Mir Masoom Ali: A Distinguished and Dedicated Statistician Who Never Gets Old – Even at Seventy-Five

    Directory of Open Access Journals (Sweden)

    Aylin Alin

    2012-07-01

    Full Text Available I first met Distinguished Professor Dr. Mir Masoom Ali at the International Conference on Mathematics and Statistics held in Athens, Greece in 2007. He was there as an invited speaker and he also chaired my session. After my session we had a chance to chat on our way to the restaurant where the banquet was held.  Even though it was the first time we hadmet, he was very kind to me.  He was there with his wife Firoza (Leena Ali. They looked great together.  Family is the most important part of our lives.  It was immediately apparent to me that Professor Ali, apart from being an outstanding statistician and a great teacher, is also a dedicated husband, father and grandfather. We have always kept in touch since our first meeting. I am very lucky to have had a chance to recently collaborate with him in a research paper. It is also a great honor for me to have been asked to serve as a guest editor for this special issue and to be able to be part of this undertaking to celebrate Dr. Ali’s 75th birthday anniversary. To some people, age is only an indicator of the year they were born but inside they feel much younger. Professor Ali is onesuch person who not only looks very young both physically and emotionally for his age but who also has the personality and mentality of a very active younger person. That is why I have chosen the title "Mir Masoom Ali: A Distinguished and Dedicated Statistician Who Never Gets Old - Even at Seventy-Five."  

  5. 50 - 55_Muhammad and Massawe

    African Journals Online (AJOL)

    USER

    2015-06-01

    Jun 1, 2015 ... PHOTOSYNTHETIC GAS EXCHANGE AND CHLOROPHYLL IN BAMBARA ... The study evaluated the response of two Bambara groundnut (Vigna subterranea L. ..... processes due to the decreased tissue water content.

  6. Lithospheric mantle evolution in the Afro-Arabian domain: Insights from Bir Ali mantle xenoliths (Yemen)

    Science.gov (United States)

    Sgualdo, P.; Aviado, K.; Beccaluva, L.; Bianchini, G.; Blichert-Toft, J.; Bryce, J. G.; Graham, D. W.; Natali, C.; Siena, F.

    2015-05-01

    Detailed petrological and geochemical investigations of an extensive sampling of mantle xenoliths from the Neogene-Quaternary Bir Ali diatreme (southern Yemen) indicate that the underlying lithospheric mantle consists predominantly of medium- to fine-grained (often foliated) spinel-peridotites (85-90%) and spinel-pyroxenites (10-15%) showing thermobarometric estimates in the P-T range of 0.9-2.0 GPa and 900-1150 °C. Peridotites, including lherzolites, harzburgites and dunites delineate continuous chemical, modal and mineralogical variations compatible with large extractions of basic melts occurring since the late Proterozoic (~ 2 Ga, according to Lu-Hf model ages). Pyroxenites may represent intrusions of subalkaline basic melts interacting and equilibrated with the host peridotite. Subsequent metasomatism has led to modal changes, with evidence of reaction patches and clinopyroxene and spinel destabilization, as well as formation of new phases (glass, amphibole and feldspar). These changes are accompanied by enrichment of the most incompatible elements and isotopic compositions. 143Nd/144Nd ranges from 0.51419 to 0.51209 (εNd from + 30.3 to - 10.5), 176Hf/177Hf from 0.28459 to 0.28239 (εHf from + 64.4 to - 13.6), and 208Pb/204Pb from 36.85 to 41.56, thus extending from the depleted mantle (DM) towards the enriched OIB mantle (EM and HIMU) components. 3He/4He (R/RA) ratios vary from 7.2 to 7.9 with He concentrations co-varying with the most incompatible element enrichment, in parallel with metasomatic effects. These metasomatic events, particularly effective in harzburgites and dunites, are attributable to the variable interaction with alkaline basic melts related to the general extensional and rifting regime affecting the East Africa-Arabian domain during the Cenozoic. In this respect, Bir Ali mantle xenoliths resemble those occurring along the Arabian margins and the East Africa Rift system, similarly affected by alkaline metasomatism, whereas they are

  7. Effet des conditions climatiques sur le niveau du lac Sidi Ali (Moyen Atlas, Maroc

    Directory of Open Access Journals (Sweden)

    Claude Martin

    2011-11-01

    Full Text Available Le lac Sidi Ali est un lac naturel d'altitude (2070-2080 m, sans exutoire superficiel, déterminé par le barrage d'une coulée basaltique. Doté d'un bassin versant apparent de 15,6 km2, il est alimenté par des eaux de ruissellement et par des sources karstiques. Son niveau subit des variations très fortes, annuelles et interannuelles, sous le contrôle des conditions climatiques, et en particulier des pluies et de l'évapotranspiration. Les périodes de sécheresse qui ont marqué les trois dernières décennies, se sont traduites par un abaissement du niveau de près de 7 m. Mais les précipitations abondantes des années 2008-09 et 2009-10 ont provoqué une nette remontée. Une régression multiple d'assez bonne qualité (r = 0,87 lie la variation annuelle du niveau (d'août à août à différents paramètres (conditions climatiques et niveau initial du lac.Lake Sidi Ali is a natural lake at high altitude (2070-2080 m, without surface outlet, determined by the dam of a basalt flow. With an apparent catchment of 15.6 km2, it is fed by runoff and karst springs. Its level shows strong annual and interannual variations, depending on weather conditions, particularly rainfall and evapotranspiration. Droughts that have marked the last three decades have resulted in a lowering of about 7 m of the water level. But heavy rainfall that occurred in 2008-09 and 2009-10 caused a marked rise. A multiple regression of sufficient quality (r = 0.87 binds the annual change (from august to august at differents parameters (weather conditions and initial level of the lake.

  8. Professor Mansour Ali Haseeb: Highlights from a pioneer of biomedical research, physician and scientist.

    Science.gov (United States)

    Salih, Mustafa Abdalla M

    2013-01-01

    The article highlights the career of Professor Mansour Ali Haseeb (1910 - 1973; DKSM, Dip Bact, FRCPath, FRCP [Lond]), a pioneer worker in health, medical services, biomedical research and medical education in the Sudan. After his graduation from the Kitchener School of Medicine (renamed, Faculty of Medicine, University of Khartoum [U of K]) in 1934, he devoted his life for the development of laboratory medicine. He became the first Sudanese Director of Stack Medical Research Laboratories (1952 - 1962). He made valuable contributions by his services in the vaccine production and implementation programs, most notably in combating small pox, rabies and epidemic meningitis. In 1963 he became the first Sudanese Professor of Microbiology and Parasitology and served as the first Sudanese Dean of the Faculty of Medicine, U of K (1963-1969). He was an active loyal citizen in public life and served in various fields outside the medical profession. As Mayor of Omdurman, he was invited to visit Berlin in 1963 by Willy Brandt, Mayor of West Berlin (1957-1966) and Chancellor of the Federal Republic of Germany (1969 to 1974). Also as Mayor of Omdurman, he represented the City in welcoming Queen Elizabeth II during her visit to Sudan in February 1965. He also received State Medals from Egypt and Ethiopia. In 1973 he was appointed Chairman of the Sudan Medical Research Council, and was awarded the international Dr. Shousha Foundation Prize and Medal by the WHO for his contribution in the advancement of health, research and medical services.

  9. The Effect of Dramatized Instruction on Speaking Ability of Imam Ali University EFL Learners

    Directory of Open Access Journals (Sweden)

    Sadegh Khosronejad

    2013-09-01

    Full Text Available Teaching language as a second or foreign language, undoubtedly, is so demanding and seeking to find methods for facilitating this prominent practice whets the appetite of any practitioner who works in this field. Research shows that using drama in the classroom as a means of teaching helps students learn socially, academically, and developmentally. This study was an attempt to determine the effect of dramatized instruction on the speaking ability of EFL learners of Imam Ali University. Sixty EFL male students at the intermediate level participated in the study. Their age range was 19-22. Two instruments were utilized in this study; pretest, and posttest.  The data were analyzed through t-test. The data analysis indicated that the mean scores of the experimental group students (M = 72.80 were significantly different (3.29>2; df = 58 from the control group students (M = 65.39. In other words, the experimental group outperformed the control group in the posttest significantly. Moreover, the findings indicated that dramatized instruction does have a great effect on the speaking skills. This study supported the idea of effectiveness of dramatized instruction on developing speaking skill and the teachers can help the learners at lower levels promote their speaking skill through dramatized instruction in EFL classes.

  10. Worlds Apart: Nam Le’s The Boat and Ali Alizadeh’s Transactions

    Directory of Open Access Journals (Sweden)

    Lachlan Brown

    2015-05-01

    Full Text Available This paper reads Ali Alizadeh’s transnational book of short stories (Transactions, 2013 as a curious and pointed response to the kind of literary internationalism seen in Nam Le’s The Boat (2008. Le’s work was first published in the same year as Alizadeh’s The New Angel (which was set during the Iranian revolution. There is a sense in which the spectacular success of Le’s book ‘overshadowed’ the publicity for Alizadeh’s novel in the year of its arrival. But Le’s also work contains a story about an American woman visiting Tehran, and his mimicry perhaps signifies a more problematic representational point of comparison. With this in mind, this paper examines Alizadeh’s Transactions exploring the ways in which Alizadeh’s brutally connected global vision is coded through certain aesthetic choices (including structural, tonal and descriptive that offer something very different to the artisanal and paratactic sensibility of The Boat.

  11. Digital Workflow for the Conservation of Bahrain Built Heritage: the Sheik Isa Bin ALI House

    Science.gov (United States)

    Barazzetti, L.; Mezzino, D.; Santana Quintero, M.

    2017-08-01

    Currently, the commercial market offers several tools for digital documentation of historic sites and buildings. Photogrammetry and laser scanning play a fundamental role in the acquisition of metric information, which is then processed to generate reliable records particularly useful also in the built heritage conservation field. Although potentially very fast and accurate, such techniques require expert operators to produce reliable results, especially in the case of complex and large sites. The aim of this paper is to present the digital workflow developed for data acquisition and processing of the Shaikh Isa Bin Ali house in Muharraq, Bahrain. This historic structure is an outstanding example of Bahrain architecture as well as tangible memory of the country history, with strong connotations in the Bahrain cultural identity. The building has been documented employing several digital techniques, including: aerial (drone) and terrestrial photogrammetry, rectifying photography, total station and laser scanning. The documentation project has been developed for the Bahrain Authority for Culture and Antiquities (BACA) by a multidisciplinary team of experts from Carleton Immersive Media Studio (CIMS, Carleton University, Canada) and Gicarus Lab (Politecnico di Milano, Italy).

  12. Expounding a Few Key Strategies of Imam Ali (AS) on Prevention of Diseases by Means of Improving Nutrition Style

    OpenAIRE

    Hossein Moradi

    2016-01-01

    diseases are due to lifestyle changes, especially in the field of nutrition. The Iranian Islamic teachings have extensive guidelines on the issue of healthy lifestyle and nutrition in particular. On that account, there are many sayings and traditions related to nutrition and its practices. The sayings of Imam Ali (AS) like avoiding eating when you are full, not eating your fill when mealtime, and masticating food well are among those traditions. In the light of Imam’s view, the role of ...

  13. ALICE distributed analysis of the K*(892)0 signal in pp events with the AliEn package

    International Nuclear Information System (INIS)

    Badala, A.; Barbera, R.; Lo Re, G.; Palmeri, A.; Pappalardo, G.S.; Pulvirenti, A.; Riggi, F.

    2004-01-01

    A simulation study concerning the K*(892)0 resonance was carried out within the ALICE Collaboration, in order to evaluate the capability of the detector in the reconstruction of this signal in pp collisions at the Large Hadron Collider (LHC) energy. A description of the analysis procedure which makes use of AliEn, the ALICE package for distributed computing, is given together with the obtained results

  14. ALICE distributed analysis of the $K^{*}(892)^{0}$ signal in pp events with the AliEn package

    CERN Document Server

    Badalà, A; Palmeri, A; Pappalardo, G S; Pulvirenti, A; Lo Re, G; Riggi, F

    2004-01-01

    A simulation study concerning the K*(892)**0 resonance was carried out within the ALICE Collaboration, in order to evaluate the capability of the detector in the reconstruction of this signal in pp collisions at the Large Hadron Collider (LHC) energy. A description of the analysis procedure which makes use of AliEn, the ALICE package for distributed computing, is given together with the obtained results.

  15. Factors influencing development of management strategies for the Abou Ali River in Lebanon. I: Spatial variation and land use

    OpenAIRE

    Massoud, MA; El-Fadel, M; Scrimshaw, MDirector; Lester, JN

    2006-01-01

    Surface water bodies are progressively subject to increasing stress as a result of environmentally degrading processes primarily related to anthropogenic activities. This study assesses and examines the impact of land use and anthropogenic activities on the spatial variation in water quality of the Abou Ali River in North Lebanon. It is the first detailed study of its kind in Lebanon and adds to the existing Knowledge by shedding light on a relatively small Mediterranean river in a developing...

  16. JAliEn – A new interface between the AliEn jobs and the central services

    International Nuclear Information System (INIS)

    Grigoras, A G; Grigoras, C; Pedreira, M M; Saiz, P; Schreiner, S

    2014-01-01

    Since the ALICE experiment began data taking in early 2010, the amount of end user jobs on the AliEn Grid has increased significantly. Presently 1/3 of the 40K CPU cores available to ALICE are occupied by jobs submitted by about 400 distinct users, individually or in organized analysis trains. The overall stability of the AliEn middleware has been excellent throughout the 3 years of running, but the massive amount of end-user analysis and its specific requirements and load has revealed few components which can be improved. One of them is the interface between users and central AliEn services (catalogue, job submission system) which we are currently re-implementing in Java. The interface provides persistent connection with enhanced data and job submission authenticity. In this paper we will describe the architecture of the new interface, the ROOT binding which enables the use of a single interface in addition to the standard UNIX-like access shell and the new security-related features

  17. THE ROLE OF HABITUS IN DEVELOPING INTELLECTUAL CAPITAL STUDENT AT MA'HAD ALY AL FURQON, PONOROGO

    Directory of Open Access Journals (Sweden)

    Katni dan Anip Dwi Saputro

    2017-12-01

    Full Text Available The institution always expects the output quality and personality, but if the surroundings of education never give appropriate habitus, then the result will not be achieved. On the basis of this research, trying to peel about the role of habitus in developing intellectual capital which is a student at Ma'had synergy between the structure with an agency, how an intellectual capital created and run in a Ma'had university. The question of the Islamic College during this time, when students are extremely variable input, its ability to be tough in the formation and determination of the standard of their abilities.  The results of this study found that the role of habitus intellectual capital improvement done in Mahad Aly Al Furqon Ponorogo there are seven models of the structure that supports the students ' intellectual capital development in Ma'had Aly Al Furqon Ponorogo. As for overcoming the Burnout, the students do a variety of activities that make students fresh so avoid burnout. The results of the intellectual capital developed in the Mahad Aly Al Furqon students achieved the target of memorizing a set amount and the more intellectual growth of students marked with a creative, independent inquiries, in drawing up the scientific agenda, active removing the arguments in different ways.

  18. Molecular detection of the carriers of Staphylococcus aureus golden in referred to the Imam Ali Clinic in Shahrekord, Iran

    Directory of Open Access Journals (Sweden)

    Maryam Reisi

    2014-12-01

    Full Text Available Objective: To conduct for the molecular detection of Staphylococcus aureus (S. aureus (Golden staph carriers among patients referred to the Imam Ali Clinic, Shahrekord, Iran. Methods: This sectional-descriptive study was conducted with 200 persons with suspected upper respiratory tract infections, who were referred to the Imam Ali Clinic in Shahrekord, Iran, in 2012. After culturing the nasal swab samples in mannitol salt agar and blood agar, S. aureus colonies were confirmed by biochemical methods. To determine the susceptibility of S. aureus strains isolated, molecular methods were used. Results: Among the 200 investigated samples, 60 cases (30%, comprising 25 men (41.66% and 35 women (58.33%, were found to be S. aureus carriers. Conclusions: The results of the present study showed that the frequency of the S. aureus strain isolated from the nasal swabs of patients with respiratory tract infections admitted to the Imam Ali Clinic in Shahrekord, Iran, was remarkable. Thus, knowing detection of S. aureus carriers, who are at a risk of spreading nosocomial infection among the staff, is vital to control and prevent nosocomial infections.

  19. BIBLIOMETRICS ON ONE OF THE LARGEST TERMITE INVENTORIES IN THE CERRADO: "STUDIES ON TERMITES FROM THE MATO GROSSO STATE, BRAZIL BY AGA MATHEWS 1977"

    Directory of Open Access Journals (Sweden)

    HÉLIDA FERREIRA DA CUNHA

    2015-01-01

    Full Text Available ABSTRACT This paper consists on a bibliometric analysis of the international influences of the book "Studies on termites from the Mato Grosso State, Brazil", by AGA Mathews (1977. The number of citations has increased over the years after the first citation. Mathews book was cited in articles, reviews, theses, dissertations, books, book chapters, abstracts in conference proceedings, comments and scientific notes. Most these studies are empirical and descriptive. The studies were conducted in 35 countries of the Neotropical, Palearctic, Afrotropical, Nearctic, Australasia and Indomalaya regions. 55% of the studies were carried out in Brazil. The journals Sociobiology and Insectes Sociaux, have social insect studies within its scope, and the highest number of articles citing Mathews. Most of the 71 authors that cited Mathews more than twice are Brazilian. Constrictotermes cyphergaster was the most studied in over 80% of the studies addressing Isoptera. The most frequent keywords were termite, Isoptera and taxonomy, generalist terms indexed in most publications carried out in different countries. Most of the research studies were carried out in laboratories and native vegetation areas. Studies in agroecosystems were implemented predominantly in Brazil. This study shows the diversity of application (citations of Mathews' book, and that the number of citations will continue to increase due to the large amount of information presented by the author.

  20. Clinical Practice Update: The Use of Per-Oral Endoscopic Myotomy in Achalasia: Expert Review and Best Practice Advice From the AGA Institute.

    Science.gov (United States)

    Kahrilas, Peter J; Katzka, David; Richter, Joel E

    2017-11-01

    The purpose of this review is to describe a place for per-oral endoscopic myotomy (POEM) among the currently available robust treatments for achalasia. The recommendations outlined in this review are based on expert opinion and on relevant publications from PubMed and EMbase. The Clinical Practice Updates Committee of the American Gastroenterological Association proposes the following recommendations: 1) in determining the need for achalasia therapy, patient-specific parameters (Chicago Classification subtype, comorbidities, early vs late disease, primary or secondary causes) should be considered along with published efficacy data; 2) given the complexity of this procedure, POEM should be performed by experienced physicians in high-volume centers because an estimated 20-40 procedures are needed to achieve competence; 3) if the expertise is available, POEM should be considered as primary therapy for type III achalasia; 4) if the expertise is available, POEM should be considered as treatment option comparable with laparoscopic Heller myotomy for any of the achalasia syndromes; and 5) post-POEM patients should be considered high risk to develop reflux esophagitis and advised of the management considerations (potential indefinite proton pump inhibitor therapy and/or surveillance endoscopy) of this before undergoing the procedure. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  1. Paparan Debu Kayu Dan Gangguan Fungsi Paru Pada Pekerja Mebel (Studi di PT Alis Jaya Ciptatama

    Directory of Open Access Journals (Sweden)

    Wenang Triatmo

    2015-12-01

    Full Text Available ABSTRACT Background : Wood dust generated from processes of sawing, planning and sanding can disperse in the workplace air and harm to the workers. Exposed to low concentration of wood dust for a long time can cause respiratory tract disorders  such as restriction, obstruction or mixed. Generally, organic dust exposure will effect on obstruction of respiratory tract which is indicated by decreasing of % FEV – 1 / FVC. Workers of wood industries have a high risk from wood dust deposition on their respiratory tract. Absorption of wood dust particles in the lung occurred by respiration mechanism. Methods : This research purpose was to analyze the exposure of wood dust and lung function disorder on furniture workers (Study  at  PT Alis Jaya Ciptatama in Jepara Regency. This research was an observational study with a cross Sectional approach with 55 samples. Sampling was carried out by using a Probability Systematic Sampling. Data of respirable wood dust concentration  was measured by a using Personal Dust Sampler. Whereas data of lung function was resulted from Sprirometry test  using a spirometer. Other data was collected from interview with the workers with age limitation is up to 40 years old. Data analyze by Chi Square Test was used to   identity the wood dust exposure, age, gender, time of exposure, working years, smoking habit, excercise habit, nutrient status and awareness in using of Personal Protective Equipment, in the correlation of occuring the lung function disorder.Multivariat analysis was carried out by regression test with the method of backward stepwise. Results: The result of this research was wood dust exposure significantly influence and correlate to the occuring of the lung function disorder on furniture workers ( Study at PT Alis Jaya Ciptatama , using appliance Personal Dust Sampler, highest result wood dust exposure 1,848 mg/m³ and the low result wood dust exposure 0,833 mg/m³, with the result : for wood dust

  2. Quality and storage characteristics of yogurt containing Lacobacillus sakei ALI033 and cinnamon ethanol extract

    Directory of Open Access Journals (Sweden)

    Yu Jin Choi

    2016-04-01

    Full Text Available Abstract Background This study was conducted to examine the quality and storage characteristics of yogurt containing antifungal-active lactic acid bacteria (ALH, Lacobacillus sakei ALI033 isolated from kimchi and cinnamon ethanol extract. The starter was used for culture inoculation (1.0 % commercial starter culture YF-L812 and ALH. Results The antifungal activity of cinnamon extracts was observed in treatments with either cinnamon ethanol extracts or cinnamon methanol extracts. Changes in fermented milk made with ALH and cinnamon extract during fermentation at 40 °C were as follows. The pH was 4.6 after only 6 h of fermentation. Titratable acidity values were maintained at 0.8 % in all treatment groups. Viable cell counts were maintained at 4 × 109 CFU/mL in all groups except for 1.00 % cinnamon treatment. Sensory evaluations of fermented milk sample made with ALH and 0.05 % cinnamon ethanol extract were the highest. Changes in fermented milk made with ALH and cinnamon ethanol extract during storage at 4 °C for 28 days were as follows. In fermented milk containing ALH and cinnamon ethanol extracts, the changes in pH and titratable acidity were moderate and smaller compared with those of the control. Viable cell counts were maintained within a proper range of 108 CFU/mL. Conclusions The results of this study suggest that the overgrowth of fermentation strains or post acidification during storage can be effectively delayed, thereby maintaining the storage quality of yogurt products in a stable way, using cinnamon ethanol extract, which exhibits excellent antifungal and antibacterial activity, in combination with lactic acid bacteria isolated from kimchi.

  3. Alteration zone Mapping in the Meiduk and Sar Cheshmeh Porphyry Copper Mining Districts of Iran using Advanced Land Imager (ALI Satellite Data

    Directory of Open Access Journals (Sweden)

    A. Beiranvand Pour

    2015-10-01

    Full Text Available This study evaluates the capability of Earth Observing-1 (EO1 Advanced Land Imager (ALI data for hydrothermal alteration mapping in the Meiduk and Sar Cheshmeh porphyry copper mining districts, SE Iran. Feature-oriented principal components selection, 4/2, 8/9, 5/4 band ratioing were applied to ALI data for enhancing the hydrothermally altered rocks associated with porphyry copper mineralization, lithological units and vegetation. Mixture-tuned matched-filtering (MTMF was tested to discriminate the hydrothermal alteration areas of porphyry copper mineralization from surrounding environment using the shortwave infrared bands of ALI. Results indicate that the tested methods are able to yield spectral information for identifying vegetation, iron oxide/hydroxide and clay minerals, lithological units and the discrimination of hydrothermally altered rocks from unaltered rocks using ALI data.

  4. Incorporation of Tongkat Ali and Ginseng extracts from mass propagated roots derived from bioreactor technology as supplements in energy chocolate confectionery

    International Nuclear Information System (INIS)

    Seri Cempaka Mohd Yusof; Sobri Hussein; Salmah Moosa; Salahbiah Badul Majid; Azhar Mohammad; Foziah Ali; Shafii Khamis; Rusli Ibrahim

    2012-01-01

    Tongkat Ali (Eurycoma longifolia) and Ginseng (Panax ginseng) are well known herbs among Asians and have been sought after by Europeans and others for the benefits to health, especially as aphrodisiac and nourishing stimulants. They have high antioxidant level and were reported to be used in the treatment of type II diabetes, as well as for sexual dysfunction in men. Since Tongkat Ali and Ginseng are difficult to cultivate and have a long cultivation period, the bioreactor technology is the alternative method to produce huge amount of raw materials for the herbal industry and continuous supply of standardized raw materials that is not affected by geographical and environmental factors, soil less and free from pesticides and other contaminants. Tongkat Ali and Ginseng extracts from mass propagated roots derived from bioreactor technology have similar profiles as extracts derived from normal cultivation. Liquid Chromatography-Mass Spectrometer (LC-MS) profiles showed presence of active compounds in the Tongkat Ali and Ginseng extracts from the mass propagated roots. Cytotoxicity test using the brine shrimp (Artemia salina Leach) lethality assay, revealed that higher concentration of Tongkat Ali and Ginseng extracts from mass propagated roots did not kill or affect the brine shrimps, implying that the extracts were safe for consumption. Incorporation of combination of Tongkat Ali and Ginseng total extracts from mass propagated roots derived from bioreactor technology energy chocolate confectionery was accepted by the panelists in sensory evaluation and showed that the chocolate product has good potential as a carrier besides beverages and capsules. (author)

  5. Pretreatment advanced lung cancer inflammation index (ALI) for predicting early progression in nivolumab-treated patients with advanced non-small cell lung cancer.

    Science.gov (United States)

    Shiroyama, Takayuki; Suzuki, Hidekazu; Tamiya, Motohiro; Tamiya, Akihiro; Tanaka, Ayako; Okamoto, Norio; Nakahama, Kenji; Taniguchi, Yoshihiko; Isa, Shun-Ichi; Inoue, Takako; Imamura, Fumio; Atagi, Shinji; Hirashima, Tomonori

    2018-01-01

    Programmed death-ligand 1 (PD-L1) expression status is inadequate for indicating nivolumab in patients with non-small cell lung cancer (NSCLC). Because the baseline advanced lung cancer inflammation index (ALI) is reportedly associated with patient outcomes, we investigated whether the pretreatment ALI is prognostic in NSCLC patients treated with nivolumab. We retrospectively reviewed the medical records of all patients treated with nivolumab for advanced NSCLC between December 2015 and May 2016 at three Japanese institutes. Multivariate logistic regression and Cox proportional hazards models were used to assess the impact of the pretreatment ALI (and other inflammation-related parameters) on progression-free survival (PFS) and early progression (i.e., within 8 weeks after starting nivolumab). A total of 201 patients were analyzed; their median age was 68 years (range, 27-87 years), 67% were men, and 24% had an Eastern Cooperative Oncology Group (ECOG) performance status of 2 or higher. An ECOG performance status ≥2, serum albumin ALI ALI ALI was found to be a significant independent predictor of early progression in patients with advanced NSCLC receiving nivolumab, and may help identify patients likely to benefit from continued nivolumab treatment in routine clinical practice. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  6. Muhammed Esed’de Dini Değişimin Psikolojik Analizi The Psychological Analysis Of Religious Conversion In Muhammad Asad

    Directory of Open Access Journals (Sweden)

    Saffet KARTOPU

    2013-07-01

    Full Text Available At this work on Which religious conversion in Muhammad Asad isstudied, in terms of religious conversion models, first of all the conceptof religious conversion, the Works in this topic and the place of religiousconversion concept in Psychology of Religion are mentioned. Then, abrief life story of Asad is mentioned, by dealing with the religiousconversion in Asad in a theoretical approach, the motives of religiousconversion, the developmental factors in religious conversion, the stagesof religious conversion and the figures of religious conversion arestudied. The religious conversion in Asad is analyzed in terms ofconversion models accepted in Psychology of Religion taking his ownWorks as a base. In this sence, while the motives of religious conversionin Asad are considered by the approaches of Snow & Phillips, Glock andGillespie, the developmental factors in religious conversion areconsidered by Erikson’s thoughts. The stages of religious conversion isconsidered by gradual classification of Lofland & Stark, Clark, Batson &Ventis and Köse. Lofland and Skonovd’s types are used while analyzingthe figures of conversion.When considered the effects of psychological factors on thereligious conversion of Asad, we see that beginning from his earlyadolescence his willing to understanding and his need to mentalsatisfaction are explicit. Asad is in need of reviewing the main pointsimposed by his cultere. He is disturbed by the ambiguities in societyand his own life and he looks for answers to the universal meaning oflife and questions ‘what is right? what is wrong?’. As a result of hisseeking, he accepts Islam as his religion and he gains a feeling ofbelonging, admission and a change of rearranging himself radically. Byaccepting Islam he feels that all his seekings finish and his desire ofdepending on a certain intellectua orbit and being a part of fellowscommunity come true. Dini değişim modelleri açısından Muhammed Esed’de dini de

  7. Comparison of the X-ray features between child Hirschsprung alied disease and Hirschsprung disease

    International Nuclear Information System (INIS)

    Wu Shuochun; Yuan Xinyu; Bai Fengsen; Ma Lishuang; Li Long

    2010-01-01

    Objective: To compare the X-ray features between Hirschsprung alied disease (HAD) and Hirschsprung disease (HD), and analyze the differentiations. Methods: From December 2004 to December 2009, nineteen cases of HAD, aged from 30 days to 10 years (median, 14 months), received barium enema examinations in our institution. Other 19 cases with HD, also received barium enema examinations, were chosen randomly. They were aged from 42 days to 8 years (median, 8 months). The imaging features of HAD and HD were analyzed retrospectively. The incidence rate of colon stenosis, 'truncation sign' and spasm notch and R/C ratio (the longest diameter of rectum/colon) were calculated and compared between these two groups. In all these cases, diagnosis was confirmed by postoperative histopathology. The position of barium retained was also evaluated. These parameters of both groups were compared by χ 2 and Fisher test. Results: There was statistical significance in the incidence rate of' colon stenosis between HAD (9/19) and HD (18/19) (χ 2 =10.364, P 0.05 for both). R/C ratio was 0.42±0.15 in HAD group and 0.29±0.12 in HD group, and there was statistical significance between them (t=2.892, P<0.01). In HAD group, barium retained in distal sigmoid colon in 1 case (1/19), in distal descending colon in 7 cases (7/19), in distal transverse colon in 1 case (1/19), in total colon in 6 cases (6/19); However, in HD group, barium retained in distal rectum in 3 cases (3/19), in distal sigmoid colon in 13 cases (13/19), in distal descending colon in 3 cases (3/19). Conclusions: There were some differences in the imaging features between HAD and HD though they presented similar clinic experience. HAD cases presented a lower incidence rate of colon stenosis and a higher R/C ratio than HD cases. In HAD cases, the most common site of barium retained is distal descending colon, while in HD cases, it is distal sigmoid colon. (authors)

  8. Aliénor, une infante entre la Castille, l’Aragon et le Portugal

    Directory of Open Access Journals (Sweden)

    Ana Maria S. A. RODRIGUES

    2008-07-01

    Full Text Available Aliénor (?-1445, fille de l’infant Ferdinand de Castille, est devenue infante d’Aragon par l’accession de son père à la couronne d’Aragon et princesse puis reine du Portugal par son mariage avec Édouard (1391-1438. Dans cette étude, nous essayons de démontrer qu’elle ne se contenta pas d’être un simple pion dans les jeux de pouvoir des hommes de ses deux familles – la famille d’origine et la famille d’alliance –, mais qu’elle y prit part activement sans pourtant manquer à ses obligations spécifiquement féminines. Elle mit au monde neuf enfants, garantissant ainsi la continuité dynastique et de fructueuses alliances avec d’autres monarchies, prodigua à son mari affection et conseils et assura la régence du royaume au nom de son fils, tout en gardant un contact étroit avec ses frères et les aidant le cas échéant. Elle fut pourtant déchue du pouvoir par ses beaux-frères. Abandonnée par les infants d’Aragon, elle mourut en exil dans un dénuement presque complet.Leonor (?-1445, hija del infante Fernando de Castilla, fue infanta de Aragón por la elevación de su padre a ese trono, princesa y luego reina de Portugal por su matrimonio con Eduardo (1391-1438. En este estudio, intentamos demostrar que ella no se contentó con ser un simple peón en los juegos de poder de los hombres de sus dos familias – la familia de origen y la familia de alianza – sino que participó en ellos activamente sin por eso faltar a sus deberes específicamente femeninos. Tuvo nueve hijos, garantizando así la continuidad dinástica y fructuosas alianzas con otras monarquías, prodigó a su marido afecto y consejos, y aseguró la regencia del reino en nombre de su hijo, guardando al mismo tiempo un contacto estrecho con sus hermanos y ayudándoles en caso de necesidad. Sin embargo fue descartada del poder por sus cuñados. Abandonada por los infantes de Aragón, murió en exilio en la más extrema necesidad.

  9. Management of Clostridium difficile Infection in Inflammatory Bowel Disease: Expert Review from the Clinical Practice Updates Committee of the AGA Institute.

    Science.gov (United States)

    Khanna, Sahil; Shin, Andrea; Kelly, Ciarán P

    2017-02-01

    The purpose of this expert review is to synthesize the existing evidence on the management of Clostridium difficile infection in patients with underlying inflammatory bowel disease. The evidence reviewed in this article is a summation of relevant scientific publications, expert opinion statements, and current practice guidelines. This review is a summary of expert opinion in the field without a formal systematic review of evidence. Best Practice Advice 1: Clinicians should test patients who present with a flare of underlying inflammatory bowel disease for Clostridium difficile infection. Best Practice Advice 2: Clinicians should screen for recurrent C difficile infection if diarrhea or other symptoms of colitis persist or return after antibiotic treatment for C difficile infection. Best Practice Advice 3: Clinicians should consider treating C difficile infection in inflammatory bowel disease patients with vancomycin instead of metronidazole. Best Practice Advice 4: Clinicians strongly should consider hospitalization for close monitoring and aggressive management for inflammatory bowel disease patients with C difficile infection who have profuse diarrhea, severe abdominal pain, a markedly increased peripheral blood leukocyte count, or other evidence of sepsis. Best Practice Advice 5: Clinicians may postpone escalation of steroids and other immunosuppression agents during acute C difficile infection until therapy for C difficile infection has been initiated. However, the decision to withhold or continue immunosuppression in inflammatory bowel disease patients with C difficile infection should be individualized because there is insufficient existing robust literature on which to develop firm recommendations. Best Practice Advice 6: Clinicians should offer a referral for fecal microbiota transplantation to inflammatory bowel disease patients with recurrent C difficile infection. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  10. Rõve kuubis, aga... / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2006-01-01

    Dokumentaalfilm "Aristokraadid", kus ühte roppu habemega anekdooti jutustavad meelelahutustööstusest tuntud tegijad : režissöör Paul Provenza : Ameerika Ühendriigid 2006. Filmi näitab Tallinna Kinomaja

  11. Usalda, aga kontrolli / Manuela Pihlap

    Index Scriptorium Estoniae

    Pihlap, Manuela

    2008-01-01

    Uuest isikuandmete kaitse seadusest. Ilmunud ka Harju Ekspress 22. veeb. 2008, lk. 6 ; Meie Maa 26. veeb. 2008, lk. 2 ; Pärnu Postimees 28. veeb. 2008, lk. 15 ; LõunaLeht 28. veeb. 2008, lk. 4 ; Valgamaalane 28. veeb. 2008, lk. 2

  12. Study of the raw materials used in the manufacture of ceramics in Fran Ali (Oued Laou, Marruecos); Estudio de materiales usados en la fabricacion de las ceramicas de Fran Ali (Oued Laou, Marruecos)

    Energy Technology Data Exchange (ETDEWEB)

    Barrios Neira, J.; Martin de la Cruz, J. C.; Montealegre Contreras, L.

    2012-11-01

    The thermal behaviour, mineralogy, texture and micro-structure of the original rocks used as raw materials in the manufacture of ceramics of the potter community in Fran Ali (Oued Laou, Tetouan, Morocco) were studied. The original rocks of the alteration deposit are metapelites and altered philites from the Units Malaguide-Gomaride in the Baetic-Rifian mountain system. The techniques used by local potters and the water used to prepare the ceramic bodies were also studied. Original rocks are metapelites or filadios and raw materials belong to levels caused by exogenous or supergene alteration (quartz-illite and chlorite type clays). The ceramics studied by microscopy exhibit anisotropy. (Author) 15 refs.

  13. La Roma della diaspora somala: i grovigli spaziali ed identitari della narrativa di Cristina Ali Farah - The Somali Diaspora within Rome: Entanglements of Space and Identity in Cristina Ali Farah's novels

    Directory of Open Access Journals (Sweden)

    Nora Moll

    2017-12-01

    Full Text Available Scenario urbano principale dei due romanzi Madre piccola (2007 e Il comandante del fiume (2014, la città di Roma viene ricostruita narrativamente dalla scrittrice italo-somala Cristina Ali Farah secondo prospettive e tensioni nuove e significative. Le geografie degli spazi esterni ed interni della città rispondono in entrambi i testi a delle dinamiche identitarie le quali sono attraversate da temi comuni agli scrittori contemporanei della diaspora africana: la dialettica tra presenza ed assenza (di persone, di luoghi, la precarietà e l’instabilità della dimora d’arrivo, il conflitto tra la memoria traumatica e la necessità di radicarsi nell’hic et nunc spaziale ed esistenziale, la rilettura degli spazi urbani in chiave postcoloniale. A partire da tale matrice tematica, la narrativa di Ali Farah si carica di simbologie e di metafore nuove, che rimandano alla sua poetica e al suo immaginario ben personali. Subentra, nella lettura critica dei testi in questione, anche la considerazione dell’aspetto generazionale, che contrassegna i personaggi, e del diverso vivere la città d’approdo nel caso di biografie finzionali segnate dalla fuga e dalla diaspora, o viceversa dai legami con essa degli esponenti delle “seconde generazioni”.   The city of Rome is the main urban scenario of Cristina Ali Farah's two novels Madre piccola (2007 and Il comandante del fiume (2014, being constructed narratively from new perspectives and using significant narrative strategies. In both fictional texts, the Italian author of Somali and Italian origin depicts external and internal geographies of the Italian Capital, which are connected with identitary dynamics expressed by themes frequently used by contemporary diasporic writers: the dialectics between the presence and the absence (of people and places, the precariousness and instability of the new abode, the conflict between a traumatic memory and the necessity of establishing roots in the spacial

  14. Permanentnost primitivne akumulacije, ali o privatni lastnini, komodifikaciji in povratku rente

    Directory of Open Access Journals (Sweden)

    Jernej Prodnik

    2011-06-01

    Full Text Available Namen teksta je prispevati k razumevanju ideje o skupnem v obstoječih zgodovinskih okvirih. Avtor opozarja na množico pomenov, ki jih je potrebno vzeti v ozir, ko poizkušamo konceptualizirati skupno, vsaj če ga hočemo razumeti kar se le da celovito. Tega koncepta namreč nikakor ne smemo dojemati le v povezavi s skupnimi viri, področji ali dobrinami, torej v pomenu tega, kar se najpogosteje dojema za skupno posest ali skupno »lastnino«. Skupno je namreč v prvi vrsti koncept, ki ga je nemogoče misliti brez družbenih odnosov, ki so njegov neizogiben del. Omenjen ožji oziroma zamejen pristop, ki je značilen predvsem za politično-ekonomski pogled na skupno, sicer lahko nudi enega izmed ključev za razumevanje raznolikosti skupnega in s kakšnimi tehnikami se ga v epohi bio-lingvističnega kapitalizma eksploatira, vendar bi ekskluzivno osredotočanje le na ta pomen reduciralo kompleksnost tako samega koncepta, kot tudi družbe, v kateri nastaja, s čimer bi lahko tvegali naturalizacijo nekaterih delov družbenega. Prvi del teksta je zato namenjen razjasnitvi mnoštva obrazov in pristopov, iz katerih je mogoče opazovati skupno, čemur šele v drugem delu in s pridržki sledi poizkus politično-ekonomske tipologizacije skupnega. V tem delu sta izpostavljeni predvsem dve »neotipljivi« obliki skupnega, ki postajata žrtvi novih procesov ograjevanja in privatizacije. V obeh primerih se lastnini same informacije, za katere je značilna nerivalska logika ter nizka subtraktivnost, s tem pa se ustvarja nove monopole nad znanjem, ki posredno vplivajo na delovanje celotne družbe. Ti procesi so omogočeni z zunaj-ekonomskimi posegi, predvsem prek uveljavljanja t.i. intelektualne lastnine, ki se na globalni ravni širi prek novih in rigidnih lastniških sistemov (npr. TRIPS, lastnikom pa omogoča omejevanje dostopa ter jim s tem potencialno prinaša ‘profit, ki postaja renta’. Avtor k skupnemu pristopa iz radikalne pozicije alternativne

  15. Outcome prediction in pneumonia induced ALI/ARDS by clinical features and peptide patterns of BALF determined by mass spectrometry.

    Science.gov (United States)

    Frenzel, Jochen; Gessner, Christian; Sandvoss, Torsten; Hammerschmidt, Stefan; Schellenberger, Wolfgang; Sack, Ulrich; Eschrich, Klaus; Wirtz, Hubert

    2011-01-01

    Peptide patterns of bronchoalveolar lavage fluid (BALF) were assumed to reflect the complex pathology of acute lung injury (ALI)/acute respiratory distress syndrome (ARDS) better than clinical and inflammatory parameters and may be superior for outcome prediction. A training group of patients suffering from ALI/ARDS was compiled from equal numbers of survivors and nonsurvivors. Clinical history, ventilation parameters, Murray's lung injury severity score (Murray's LISS) and interleukins in BALF were gathered. In addition, samples of bronchoalveolar lavage fluid were analyzed by means of hydrophobic chromatography and MALDI-ToF mass spectrometry (MALDI-ToF MS). Receiver operating characteristic (ROC) analysis for each clinical and cytokine parameter revealed interleukin-6>interleukin-8>diabetes mellitus>Murray's LISS as the best outcome predictors. Outcome predicted on the basis of BALF levels of interleukin-6 resulted in 79.4% accuracy, 82.7% sensitivity and 76.1% specificity (area under the ROC curve, AUC, 0.853). Both clinical parameters and cytokines as well as peptide patterns determined by MALDI-ToF MS were analyzed by classification and regression tree (CART) analysis and support vector machine (SVM) algorithms. CART analysis including Murray's LISS, interleukin-6 and interleukin-8 in combination was correct in 78.0%. MALDI-ToF MS of BALF peptides did not reveal a single identifiable biomarker for ARDS. However, classification of patients was successfully achieved based on the entire peptide pattern analyzed using SVM. This method resulted in 90% accuracy, 93.3% sensitivity and 86.7% specificity following a 10-fold cross validation (AUC = 0.953). Subsequent validation of the optimized SVM algorithm with a test group of patients with unknown prognosis yielded 87.5% accuracy, 83.3% sensitivity and 90.0% specificity. MALDI-ToF MS peptide patterns of BALF, evaluated by appropriate mathematical methods can be of value in predicting outcome in pneumonia induced

  16. Landslide detection using LiDAR data and data mining technology: Ali Mountain Highway case study (Taiwan)

    Science.gov (United States)

    Cheng, Youg-Sin; Yu, Teng-To; Tarolli, Paolo

    2017-04-01

    Taiwan mountains are severely affected each year by landslides, rock falls, and debris flows where the roads system suffer the most critical consequences. Among all mountain highways, Ali Highway, located into the main entrance of Alishan Mountain region, is one of the most landslide-prone areas in southern Taiwan. During the typhoon season, between May and August, the probability of occurrence of mass movements is at higher level than usual seeing great erosion rates. In fact, during Typhoon Morakot, in 2009, the intense rainfall caused abrupt interruption of the circulation for three months triggering several landslides (Liu et al. 2012). The topographic features such as slope, roughness and curvature among others have been extracted from 1 m DTM derived by a LiDAR dataset (collected in 2015) to investigate the slope failures along the Ali Mountain Highway. The high-resolution DTM highlighted that the hydrogeomorphological (e.g. density of stream, the distance from the ridge and terrain) features are one of the most influencing factors affecting the change and the instability of the slopes. To detect the landslide area, the decision tree classifier and the random forest algorithm (RF) have been adopted. The results provided a suitable analysis of the area involved in the failure. This will be a useful step in the understanding (and management) landslide processes of study area. References Liu CN, Dong JJ, Chen CJ, Lee WF (2012) Typical landslides and related mechanisms in Ali Mountain highway induced by typhoon Morakot: Perspectives from engineering geology. Landslides 9:239-254.

  17. Factors influencing development of management strategies for the Abou Ali River in Lebanon I: spatial variation and land use.

    Science.gov (United States)

    Massoud, May A; El-Fadel, Mutasem; Scrimshaw, Mark D; Lester, John N

    2006-06-01

    Surface water bodies are progressively subject to increasing stress as a result of environmentally degrading processes primarily related to anthropogenic activities. This study assesses and examines the impact of land use and land-based activities on the spatial variation in water quality of the Abou Ali River in North Lebanon. It is the first detailed study of its kind in Lebanon and adds to the existing knowledge by shedding light on a relatively small Mediterranean river in a developing country where there is a paucity of such studies. The assessment was conducted at the end of the dry season in 2002 and 2003 and the end of the wet season in 2003 and 2004. The study has demonstrated the importance of anthropogenic influences on the water quality of the Abou Ali River Basin, as concentrations of most contaminants were higher at locations with greatest human activity. The most adversely affected area was the section of the river that flows through an entirely urbanized and highly populated region, the Tripoli conurbation. Upstream rural sites were enriched by contaminants primarily from non-point sources such as agricultural runoff and poultry litter whereas contaminant concentrations at the urban sites were enriched by a combination of sewage discharge and flow of contaminants from upstream. If the Abou Ali River is to be utilized as a managed water resource and its water quality sustained, point source discharges will require treatment and land use management must be planned to minimize the impact of diffuse source pollution on the river. A high priority should be given to the implementation and enforcement of the precautionary and polluter pays principles. Moreover, an effective legal, economic and institutional framework is required to encourage investment in waste reduction and control and to introduce environmentally sound practices.

  18. Parallelization of the AliRoot event reconstruction by performing a semi- automatic source-code transformation

    CERN Multimedia

    CERN. Geneva

    2012-01-01

    side bus or processor interconnections. Parallelism can only result in performance gain, if the memory usage is optimized, memory locality improved and the communication between threads is minimized. But the domain of concurrent programming has become a field for highly skilled experts, as the implementation of multithreading is difficult, error prone and labor intensive. A full re-implementation for parallel execution of existing offline frameworks, like AliRoot in ALICE, is thus unaffordable. An alternative method, is to use a semi-automatic source-to-source transformation for getting a simple parallel design, with almost no interference between threads. This reduces the need of rewriting the develop...

  19. The Political Structure at Basra Gulf in the Period of Ali b. Ebu Talib and Yezid b. Muaviye

    OpenAIRE

    Taner YILDIRIM

    2011-01-01

    At this work about the political structure of the Basra Gulf, we dwelled upon the general geography of the district and its political history. The political situation of the district in this period is assessed in a way that comprises especially the period of Hz. Ali the fourth caliph of early islamic period Muaviya, the first Emevi caliph, and his son Yazid in the light of political developments in that period. When we took up Gulf of Basra we saw that the region of the Gulf is a very importa...

  20. Examining Reliability and Validity of an Online Score (ALiEM AIR) for Rating Free Open Access Medical Education Resources.

    Science.gov (United States)

    Chan, Teresa Man-Yee; Grock, Andrew; Paddock, Michael; Kulasegaram, Kulamakan; Yarris, Lalena M; Lin, Michelle

    2016-12-01

    Since 2014, Academic Life in Emergency Medicine (ALiEM) has used the Approved Instructional Resources (AIR) score to critically appraise online content. The primary goals of this study are to determine the interrater reliability (IRR) of the ALiEM AIR rating score and determine its correlation with expert educator gestalt. We also determine the minimum number of educator-raters needed to achieve acceptable reliability. Eight educators each rated 83 online educational posts with the ALiEM AIR scale. Items include accuracy, usage of evidence-based medicine, referencing, utility, and the Best Evidence in Emergency Medicine rating score. A generalizability study was conducted to determine IRR and rating variance contributions of facets such as rater, blogs, posts, and topic. A randomized selection of 40 blog posts previously rated through ALiEM AIR was then rated again by a blinded group of expert medical educators according to their gestalt. Their gestalt impression was subsequently correlated with the ALiEM AIR score. The IRR for the ALiEM AIR rating scale was 0.81 during the 6-month pilot period. Decision studies showed that at least 9 raters were required to achieve this reliability. Spearman correlations between mean AIR score and the mean expert gestalt ratings were 0.40 for recommendation for learners and 0.35 for their colleagues. The ALiEM AIR scale is a moderately to highly reliable, 5-question tool when used by medical educators for rating online resources. The score displays a fair correlation with expert educator gestalt in regard to the quality of the resources. The score displays a fair correlation with educator gestalt. Copyright © 2016 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  1. 77 FR 70548 - Designation of one (1) individual Pursuant to Executive Order 13224 of September 23, 2001...

    Science.gov (United States)

    2012-11-26

    ... follows: Individual 1. AL-MUSAWI, Ali Mussa Daqduq (a.k.a. 'ABD AL-YUNIS, Hamid Majid; a.k.a. AL-LAMI.... AL-MUSAWI, Hamid Muhammad Jabur; a.k.a. AL-MUSUI, Hamid Muhammad Jabur; a.k.a. DAQDUQ, Ali Mussa; a.k...

  2. Investigation of thermodynamic and mechanical properties of AlyIn1-yP alloys by statistical moment method

    Science.gov (United States)

    Ha, Vu Thi Thanh; Hung, Vu Van; Hanh, Pham Thi Minh; Tuyen, Nguyen Viet; Hai, Tran Thi; Hieu, Ho Khac

    2018-03-01

    The thermodynamic and mechanical properties of III-V zinc-blende AlP, InP semiconductors and their alloys have been studied in detail from statistical moment method taking into account the anharmonicity effects of the lattice vibrations. The nearest neighbor distance, thermal expansion coefficient, bulk moduli, specific heats at the constant volume and constant pressure of the zincblende AlP, InP and AlyIn1-yP alloys are calculated as functions of the temperature. The statistical moment method calculations are performed by using the many-body Stillinger-Weber potential. The concentration dependences of the thermodynamic quantities of zinc-blende AlyIn1-yP crystals have also been discussed and compared with those of the experimental results. Our results are reasonable agreement with earlier density functional theory calculations and can provide useful qualitative information for future experiments. The moment method then can be developed extensively for studying the atomistic structure and thermodynamic properties of nanoscale materials as well.

  3. Synthesis of Multispectral Bands from Hyperspectral Data: Validation Based on Images Acquired by AVIRIS, Hyperion, ALI, and ETM+

    Science.gov (United States)

    Blonski, Slawomir; Glasser, Gerald; Russell, Jeffrey; Ryan, Robert; Terrie, Greg; Zanoni, Vicki

    2003-01-01

    Spectral band synthesis is a key step in the process of creating a simulated multispectral image from hyperspectral data. In this step, narrow hyperspectral bands are combined into broader multispectral bands. Such an approach has been used quite often, but to the best of our knowledge accuracy of the band synthesis simulations has not been evaluated thus far. Therefore, the main goal of this paper is to provide validation of the spectral band synthesis algorithm used in the ART software. The next section contains a description of the algorithm and an example of its application. Using spectral responses of AVIRIS, Hyperion, ALI, and ETM+, the following section shows how the synthesized spectral bands compare with actual bands, and it presents an evaluation of the simulation accuracy based on results of MODTRAN modeling. In the final sections of the paper, simulated images are compared with data acquired by actual satellite sensors. First, a Landsat 7 ETM+ image is simulated using an AVIRIS hyperspectral data cube. Then, two datasets collected with the Hyperion instrument from the EO-1 satellite are used to simulate multispectral images from the ALI and ETM+ sensors.

  4. Pharmacognostic and phytochemical analyses of leaves and seed storage of abutilon pakistanicum jafri and ali an endemic plant of pakistan

    International Nuclear Information System (INIS)

    Fatima, H.; Munir, U.

    2014-01-01

    There are vast varieties of medicinal plant in the world having therapeutical importance. With increasing popularity of herbal medicine as a curative measure, the need for correct identification and standardization of the plant is also increased. Present work was performed to study the pharmacognostic and phytochemical characters of leaves and exsitu seed conservation by seed storage of Abutilon pakistanicum Jafri and Ali. It is an endemic plant, found in the sub tropical regions of Pakistan and is used in traditional medicine for treating rheumatism. The leaves of Abutilon pakistanicum Jafri andAli were investigated for pharmacognostic parameters. Phytochemical screening, macroscopic characters, physiochemical attributes and fluorescence analysis. The results revealed the presence of pharmacologically active compounds like alkaloids, flavonoids, terpinoids, saponins and phenolic compounds, leaf constant values and the extractive values obtained were found close to the values reported for other Abutilon species, while high ash value indicated presence of impurities in the crude drug. The investigation provides information for correct identification and authentication of plant species for further studies and medicinal evaluation of the species. (author)

  5. Ventilation distribution measured with EIT at varying levels of pressure support and Neurally Adjusted Ventilatory Assist in patients with ALI.

    Science.gov (United States)

    Blankman, Paul; Hasan, Djo; van Mourik, Martijn S; Gommers, Diederik

    2013-06-01

    The purpose of this study was to compare the effect of varying levels of assist during pressure support (PSV) and Neurally Adjusted Ventilatory Assist (NAVA) on the aeration of the dependent and non-dependent lung regions by means of Electrical Impedance Tomography (EIT). We studied ten mechanically ventilated patients with Acute Lung Injury (ALI). Positive-End Expiratory Pressure (PEEP) and PSV levels were both 10 cm H₂O during the initial PSV step. Thereafter, we changed the inspiratory pressure to 15 and 5 cm H₂O during PSV. The electrical activity of the diaphragm (EAdi) during pressure support ten was used to define the initial NAVA gain (100 %). Thereafter, we changed NAVA gain to 150 and 50 %, respectively. After each step the assist level was switched back to PSV 10 cm H₂O or NAVA 100 % to get a new baseline. The EIT registration was performed continuously. Tidal impedance variation significantly decreased during descending PSV levels within patients, whereas not during NAVA. The dorsal-to-ventral impedance distribution, expressed according to the center of gravity index, was lower during PSV compared to NAVA. Ventilation contribution of the dependent lung region was equally in balance with the non-dependent lung region during PSV 5 cm H₂O, NAVA 50 and 100 %. Neurally Adjusted Ventilatory Assist ventilation had a beneficial effect on the ventilation of the dependent lung region and showed less over-assistance compared to PSV in patients with ALI.

  6. Agama Sebagai Kesadaran Ideologis: Refleksi Perubahan Sosial Ali Syari’ati

    Directory of Open Access Journals (Sweden)

    Imam Bonjol Jauhari

    2016-06-01

    Full Text Available Abstract: In the context of social change, the thought of Ali Syar'ati, if seen from the perspective of its frameworks and methods,is different from the thought of other Islamic movements.On the one hand, Shari'ati’s thought opposes the Iranian authority, Shah Pahlavi, but on the other hand, it is totally different from the traditional Iranian anti-change cleric, and it is also in contrast to the radical Islamic movements that do political rebellion against the ruler.Shari'atiput up political resistance through revolutionary ideas influencing public opinion to understand Islam as a doctrine which has an emancipatory interest, that is, the belief of Islam as a school of thought and action in the fight against social and economic injustice, despotic ruler, and the fetters of culture. Efforts to comprehend Islamic meanings in modern and contextual Islamic thought presents two patterns of social changes; first is the pattern of moderatemovement and second is extreme one. The formerleads more specifically to how to implement Islamic values in the national way of life, and   sense of nationalitywithout being trapped inreligious symbols and labels, while the latter leads totheimplementation of Islamic values and symbolismand labeling whichare both considered to be important. So the former tends to take more substantive values of Islam that is essentially concerned with the purpose of realization of the ideals of Islam, while the latter tends to the enactment of Islamic lawin all aspects of community life.  الملخص: في سياق التغيير الاجتماعي، يعتقد أن فكرة علي شريعتي لها إطار وأساليب تختلف عن أساليب رواد الفكر والحركات الإسلامية الأخرى. من ناحية ،أن شريعتي يكافح ضد سلطة مستبدة في إيران، شاه بهلوي. ومن ناحية أخرى، كان مختلفا تماما عن علماء الدين

  7. Outcome prediction in pneumonia induced ALI/ARDS by clinical features and peptide patterns of BALF determined by mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Jochen Frenzel

    Full Text Available BACKGROUND: Peptide patterns of bronchoalveolar lavage fluid (BALF were assumed to reflect the complex pathology of acute lung injury (ALI/acute respiratory distress syndrome (ARDS better than clinical and inflammatory parameters and may be superior for outcome prediction. METHODOLOGY/PRINCIPAL FINDINGS: A training group of patients suffering from ALI/ARDS was compiled from equal numbers of survivors and nonsurvivors. Clinical history, ventilation parameters, Murray's lung injury severity score (Murray's LISS and interleukins in BALF were gathered. In addition, samples of bronchoalveolar lavage fluid were analyzed by means of hydrophobic chromatography and MALDI-ToF mass spectrometry (MALDI-ToF MS. Receiver operating characteristic (ROC analysis for each clinical and cytokine parameter revealed interleukin-6>interleukin-8>diabetes mellitus>Murray's LISS as the best outcome predictors. Outcome predicted on the basis of BALF levels of interleukin-6 resulted in 79.4% accuracy, 82.7% sensitivity and 76.1% specificity (area under the ROC curve, AUC, 0.853. Both clinical parameters and cytokines as well as peptide patterns determined by MALDI-ToF MS were analyzed by classification and regression tree (CART analysis and support vector machine (SVM algorithms. CART analysis including Murray's LISS, interleukin-6 and interleukin-8 in combination was correct in 78.0%. MALDI-ToF MS of BALF peptides did not reveal a single identifiable biomarker for ARDS. However, classification of patients was successfully achieved based on the entire peptide pattern analyzed using SVM. This method resulted in 90% accuracy, 93.3% sensitivity and 86.7% specificity following a 10-fold cross validation (AUC = 0.953. Subsequent validation of the optimized SVM algorithm with a test group of patients with unknown prognosis yielded 87.5% accuracy, 83.3% sensitivity and 90.0% specificity. CONCLUSIONS/SIGNIFICANCE: MALDI-ToF MS peptide patterns of BALF, evaluated by appropriate

  8. Confronting a Divided Past for a Shared Future: The Lieux de Mémoire of the Altab Ali Park in London

    OpenAIRE

    Vékony, Dániel

    2017-01-01

    This paper deals with the Altab Ali Park and its significance in regards to the Muslim community in the London borough of Tower Hamlets. Using Pierre Nora’s concept of lieux de Mémoire, I would like to demonstrate how the Bangladeshi Muslim minority and the rest of the community of Tower Hamlets construct their collective memory through the transformation of the park. The article argues that the Altab Ali Park is in Pierre Nora's term a lieu de Mémoire with a multiple layers, which has been d...

  9. New insights into the structure of Om Ali-Thelepte basin, central Tunisia, inferred from gravity data: Hydrogeological implications

    Science.gov (United States)

    Harchi, Mongi; Gabtni, Hakim; El Mejri, Hatem; Dassi, Lassaad; Mammou, Abdallah Ben

    2016-08-01

    This work presents new results from gravity data analyses and interpretation within the Om Ali-Thelepte (OAT) basin, central Tunisia. It focuses on the hydrogeological implication, using several qualitative and quantitative techniques such as horizontal gradient, upward continuation and Euler deconvolution on boreholes log data, seismic reflection data and electrical conductivity measurements. The structures highlighted using the filtering techniques suggest that the Miocene aquifer of OAT basin is cut by four major fault systems that trend E-W, NE-SW, NW-SE and NNE-SSW. In addition, a NW-SE gravity model established shows the geometry of the Miocene sandstone reservoir and the Upper Cretaceous limestone rocks. Moreover, the superimposition of the electrical conductivity and the structural maps indicates that the low conductivity values of sampled water from boreholes are located around main faults.

  10. Regions of Different Confinement in Low-Dimensional AlyInxGa1−x−yN Quantum Structures

    Directory of Open Access Journals (Sweden)

    A. Gröning

    2007-01-01

    Full Text Available The optical properties of metal-organic vapor phase epitaxy grown AlyInxGa1−x−yN quantum dot structures have been studied by time-resolved photoluminescence experiments. We investigated the recombination dynamics of the photo-exited carriers in dependence of the growth parameters such as aluminium flow and the duration of the growth interruption after the dot deposition. Our results confirm the presence of localized states, where the degree of localization is strongly dependent on the growth conditions. To describe this behavior, we propose a band structure with coupled potentials for these nanostructures. Finally, we demonstrate state filling to prove the zero-dimensional character of the strongly localized states in our quaternary quantum dots.

  11. Plasticité du droit constitutionnel et dynamique de l’autoritarisme dans la Tunisie de Ben Ali

    Directory of Open Access Journals (Sweden)

    Éric Gobe

    2012-02-01

    Full Text Available Le droit des institutions politiques dans la Tunisie de Ben Ali apparaît particulièrement plastique et instable car ce sont les échéances politiques liées à la pérennisation du régime autoritaire qui dictent le rythme et la nature des changements institutionnels. Ce droit est conçu de façon à rendre impensable l’éventualité d’une alternance au sommet de l’État tout en permettant aux pouvoirs publics tunisiens de tenir un discours sur la résolution de la Tunisie à approfondir son engagement démocratique. Les récents textes constitutionnels et législatifs organisant la vie politique concourent, dans le même temps à limiter formellement les pratiques autoritaires tout en les autorisant si nécessaire.

  12. Assessment of a volume-dependent dynamic respiratory system compliance in ALI/ARDS by pooling breathing cycles

    International Nuclear Information System (INIS)

    Zhao, Zhanqi; Möller, Knut; Guttmann, Josef

    2012-01-01

    New methods were developed to calculate the volume-dependent dynamic respiratory system compliance (C rs ) in mechanically ventilated patients. Due to noise in respiratory signals and different characteristics of the methods, their results can considerably differ. The aim of the study was to establish a practical procedure to validate the estimation of intratidal dynamic C rs . A total of 28 patients from intensive care units of eight German university hospitals with acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) were studied retrospectively. Dynamic volume-dependent C rs was determined during ongoing mechanical ventilation with the SLICE method, dynostatic algorithm and adaptive slice method. Conventional two-point compliance C 2P was calculated for comparison. A number of consecutive breathing cycles were pooled to reduce noise in the respiratory signals. C rs -volume curves produced with different methods converged when the number of pooling cycles increased (n ≥ 7). The mean volume-dependent C rs of 20 breaths was highly correlated with mean C 2P (C 2P,mean = 0.945 × C rs,mean − 0.053, r 2 = 0.968, p < 0.0001). The Bland–Altman analysis indicated that C 2P,mean was lower than C rs,mean (−2.4 ± 6.4 ml cm −1 H 2 O, mean bias ± 2 SD), but not significant according to the paired t-test (p > 0.05). Methods for analyzing dynamic respiratory mechanics are sensitive to noise and will converge to a unique solution when the number of pooled cycles increases. Under steady-state conditions, assessment of the volume-dependent C rs in ALI/ARDS patients can be validated by pooling respiratory data of consecutive breaths regardless of which method is applied. Confidence in dynamic C rs determination may be increased with the proposed pooling. (note)

  13. Near-critical density filling of the SF6 fluid cell for the ALI-R-DECLIC experiment in weightlessness

    Science.gov (United States)

    Lecoutre, C.; Marre, S.; Garrabos, Y.; Beysens, D.; Hahn, I.

    2018-05-01

    Analyses of ground-based experiments on near-critical fluids to precisely determine their density can be hampered by several effects, especially the density stratification of the sample, the liquid wetting behavior at the cell walls, and a possible singular curvature of the "rectilinear" diameter of the density coexisting curve. For the latter effect, theoretical efforts have been made to understand the amplitude and shape of the critical hook of the density diameter, which depart from predictions from the so-called ideal lattice-gas model of the uniaxial 3D-Ising universality class. In order to optimize the observation of these subtle effects on the position and shape of the liquid-vapor meniscus in the particular case of SF6, we have designed and filled a cell that is highly symmetrized with respect to any median plane of the total fluid volume. In such a viewed quasi-perfect symmetrical fluid volume, the precise detection of the meniscus position and shape for different orientations of the cell with respect to the Earth's gravity acceleration field becomes a sensitive probe to estimate the cell mean density filling and to test the singular diameter effects. After integration of this cell in the ALI-R insert, we take benefit of the high optical and thermal performances of the DECLIC Engineering Model. Here we present the sensitive imaging method providing the precise ground-based SF6 benchmark data. From these data analysis it is found that the temperature dependence of the meniscus position does not reflect the expected critical hook in the rectilinear density diameter. Therefore the off-density criticality of the cell is accurately estimated, before near future experiments using the same ALI-R insert in the DECLIC facility already on-board the International Space Station.

  14. Quaternary selenostannates Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs) through rapid cooling of melts. Kinetics versus thermodynamics in the polymorphism of AGaSnSe{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, S -J; Iyer, R G; Kanatzidis, M G

    2004-10-01

    The quaternary alkali-metal gallium selenostannates, Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs), were synthesized by reacting alkali-metal selenide, Ga, Sn, and Se with a flame melting-rapid cooling method. Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} crystallizes in the non-centrosymmetric space group C2 with cell constants a=13.308(3) A, b=7.594(2) A, c=13.842(3) A, {beta}=118.730(4) deg., V=1226.7(5) A{sup 3}. {alpha}-KGaSnSe{sub 4} crystallizes in the tetragonal space group I4/mcm with a=8.186(5) A and c=6.403(5) A, V=429.1(5) A{sup 3}. {beta}-KGaSnSe{sub 4} crystallizes in the space group P2{sub 1}/c with cell constants a=7.490(2) A, b=12.578(3) A, c=18.306(5) A, {beta}=98.653(5) deg., V=1705.0(8) A{sup 3}. The unit cell of isostructural RbGaSnSe{sub 4} is a=7.567(2) A, b=12.656(3) A, c=18.277(4) A, {beta}=95.924(4) deg., V=1741.1(7) A{sup 3}. CsGaSnSe{sub 4} crystallizes in the orthorhombic space group Pmcn with a=7.679(2) A, b=12.655(3) A, c=18.278(5) A, V=1776.1(8) A{sup 3}. The structure of Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} consists of a polar three-dimensional network of trimeric (Sn,Ga){sub 3}Se{sub 9} units with Na atoms located in tunnels. The AGaSnSe{sub 4} possess layered structures. The compounds show nearly the same Raman spectral features, except for Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6}. Optical band gaps, determined from UV-Vis spectroscopy, range from 1.50 eV in Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} to 1.97 eV in CsGaSnSe{sub 4}. Cooling of the melts of KGaSnSe{sub 4} and RbGaSnSe{sub 4} produces only kinetically stable products. The thermodynamically stable product is accessible under extended annealing, which leads to the so-called {gamma}-form (BaGa{sub 2}S{sub 4}-type) of these compounds.

  15. Examination of the "Theory of Guidance" in the View of 'Ali Ibn Abi Talib (A): An Exploration into the Nahj Al-Balaghah

    Science.gov (United States)

    Rostami-Nasab, Abas Ali; Tajedini, Oranus; Sadatmoosavi, Ali

    2016-01-01

    This study examines the "Theory of Guidance" according to 'Ali ibn Abi Talib (a). This theory is based on three divine covenants or fundamentals in guidance including the divine Prophet, the divine Book, and the divine human nature ("fitrat"). Research in this regard seems essential because this theory has not been previously…

  16. Muusikamaailm : Ozawa festival Matsumotos. Pidustused Utrechtis ülehomseni. Philip Glassi uusteos Salzburgis. Alexandre Lagoya surnud. Frangiz Ali-Zade asutamine Luzernis. Wolfgang Wagner 80 / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    1999-01-01

    H.Saito mälestusfestivalist "Saito Kinen" 29.08-12.09 Jaapanis. Utrechti varajase muusika pidustustest 27.08-5.09. P.Glassi teose "Requiem, Bardo and Nimanakaya" maailmaesiettekandest Salzburgi suvefestivalil 28.08. A. Lagoya elust ja tegevusest. Luzerni festivali resideerivaks heliloojaks oli F.Ali-Zade. W. Wagneri tegevusest impressaariona

  17. Aesthetics of the Classical Period of the Islamic Mughal Empire in India through a Portrait of Abū al-Fath Jalāl al-Dīn Muhammad Akbar

    Directory of Open Access Journals (Sweden)

    Nina PETEK

    2018-01-01

    Full Text Available The reign of Abū al-Fath Jalāl al-Dīn Muhammad Akbar (1556–1605 was a fruitful period of the political, cultural and spiritual synthesis of Persian, Indian, and European tradition, as well as an artistic and aesthetic renaissance. This cosmopolitan, universal and charismatic ruler strived for the external, political, material and spiritual well-being of his colourful empire. In search of a balance between the external and internal, and in his endeavours for the unification and uniformity of India he gradually created a completely new style of Mughal arts, which is a stunning reflection of his personality’s transformations, principles, insights, interests, and spiritual growth. The paper focuses on a psychological portrait of the ruler, who dictated aesthetics and the style of the classical period of Mughal arts which consists of the three basic developmental phases of Akbar’s enigmatic character. The thesis on the parallel development of Akbar’s personality and Mughal arts is supported by research on the influence of certain European and Persian aesthetic elements, and mainly on the influence of Indian philosophical-religious tradition (the doctrines on rasa, bhakti, yoga, and tantra. The early period of Mughal arts, with predominantly realistic elements, coincides with the ruler’s dynamic, youthful enthusiasm and immense curiosity to acquaint himself the most varied aspects of external events and appearances. The second, the mature period, which enriches this earlier realism by means of mystical elements and the symbolism of Indian pre-Mughal painting, is marked by the shift into the interior and by searching for the harmony between the material and spiritual. In the late period of Mughal painting, however, reflexive and lyrical works prevail, which are a reflection of completion of Akbar’s spiritual quests, and the unique project of multifaceted synthesis that he undertook and promoted.

  18. The Shah-Ali-Beiglou Zn-Pb-Cu (-Ag Deposit, Iran: An Example of Intermediate Sulfidation Epithermal Type Mineralization

    Directory of Open Access Journals (Sweden)

    Khadijeh Mikaeili

    2018-04-01

    Full Text Available The Shah-Ali-Beiglou epithermal base metal-silver deposit is located in the Tarom-Hashjin metallogenic province (THMP in northwestern Iran. This deposit is hosted by quartz monzonite dikes of Oligocene age and surrounded by andesite to trachyandesite volcanic and volcaniclastic rocks of Eocene age. The subvolcanic rocks in the study area vary in composition from quartz-monzonite to monzonite and have metaluminous, calc-alkaline to shoshonitic affinity. These rocks have I-type geochemical characteristic and are related to post-collisional tectonic setting. The mineralization occurs as NE-SW and E-W-trending brecciated veins controlled by strike-slip and normal faults, which are associated to the Late Oligocene compressional regime. The mineral paragenesis of the vein mineralization is subdivided into pre-ore stage, ore stage, post-ore stage, and supergene stage. Pre-ore stage is dominated by quartz, sericite, and subhedral to anhedral pyrite as disseminated form. Ore-stage is represented by quartz, sphalerite (from 0.1 mol % to 4 mol % FeS, galena, chalcopyrite, tetrahedrite-tennantite, minor seligmannite and enargite, as vein-veinlet, cement and clast breccias. Post-ore stage is defined by deposition of quartz and carbonate along with minor barite, and supergene stage is characterized by bornite, chalcocite, covellite, hematite, goethite, and jarosite. The ore mineralization is associated with the silicic alteration. The styles of alteration are silicic, carbonate, sericitic, chloritic, and propylitic. Fluid inclusions in sphalerite have a wide range of salinities between 0.35 wt % and 21.4 wt % NaCl equivalent and homogenization temperatures range from 123 to 320 °C. The isotopic values of sulfides vary from 2.8‰ to 6.7‰ suggesting a magmatic source for the sulfur. In the present study, based on geological setting, alteration style of the host and wall rocks, main textures, mineral assemblages, composition of ore minerals, and structural

  19. CHEMICAL COMPOSITION AND NUTRITIONAL EVALUATION OF Paracalyx scariosus (ROXB. ALI A WILD RELATIVE OF CAJANUS FROM SOUTHERN PENINSULAR INDIA

    Directory of Open Access Journals (Sweden)

    Kondragunta Sri Rama Murthy

    2008-12-01

    Full Text Available Seeds of Paracalyx scariosus (Roxb. Ali locally known as ";;adavi tellakandulu";; in Telugu, used as food by local tribes people in the Rollapenta forest, Kurnool district, Nallamalais of Andhra Pradesh of southern Peninsular India. The mature seed samples were analysed for proximate composition, total (true seed protein fractions, amino acid composition, fatty acids profile, mineral and antinutritional factors. They contained higher amount of crude protein, crude fat, ash and nitrogen free extractives constitute 20.56, 5.19, 5.12 and 56.25 % respectively of the seed weight. The calorific value of 100g dry matter of seed material was 1680.92 kJ DM. The essential amino acids, isoleucine, tyrosine and phenylalanine, were present in relatively large quantities.  The fatty acid profiles revealed that the seed lipids contained higher concentrations of palmitic and linoleic acids. The seeds are rich in sodium, phosphorus, calcium, zinc, manganese and iron. Anti-nutritional factors such as total free phenols, (5.56% tannins (2.78%, L -DOPA (0.63%, hydrogen cyanide (0.065% and phytic acid (0.85% are present in variable quantities. From the results these plant have a good potential as food crops in Andhra Pradesh.  This paper presents the chemical composition and nutritional potential of Paracalyx scariosus seeds with regard to its suitability as a regular component in human diet.

  20. Structural Study and Evaluation of Previous Restoration Work of Mohammad 'Ali Pasha Mosque at the Citadel in Cairo

    Directory of Open Access Journals (Sweden)

    dr.Yaser Yehya Amin Abdel-Aty

    2011-01-01

    Full Text Available Mohammad 'Ali Pasha Mosque at the Citadel in Cairo is considered one of the main landmarks in Egypt. It majestically stands at a northwestern bend of the Citadel and it is visible from numerous locations in Cairo. It has become the symbol of the Citadel, to the point that its name is given to the whole complex in the colloquial Egyptian parlance. This paper studies analytically the static and dynamic structural behavior of this great mosque using computer numerical modeling techniques, to reach the main reasons for past cracking and failures in its domed-roof and other structural elements, which occurred by the end of 19th Century. A number of 3D-models are analyzed to study the mosque, in both original and after restoration conditions, under static (i.e. dead and live loads and dynamic (i.e. Eigenvector modal analysis, response-spectrum and time-history cases of loading. Besides, structural evaluation of major restoration project, in 1930s, is conducted to determine the current structural safety status of the mosque

  1. The Political Structure at Basra Gulf in the Period of Ali b. Ebu Talib and Yezid b. Muaviye

    Directory of Open Access Journals (Sweden)

    Taner YILDIRIM

    2011-06-01

    Full Text Available At this work about the political structure of the Basra Gulf, we dwelled upon the general geography of the district and its political history. The political situation of the district in this period is assessed in a way that comprises especially the period of Hz. Ali the fourth caliph of early islamic period Muaviya, the first Emevi caliph, and his son Yazid in the light of political developments in that period. When we took up Gulf of Basra we saw that the region of the Gulf is a very important strategic lacation. So since the most prohestoric period this area have got a lot of civilizations, big wars, social events and contentions. We saw that in the time of the region that we take up, the pozition of the Gulf area have gotten similar events in the past. Consequently, the area of the Gulf have owned most active pozition in that term that we take up. Especially because of the land trade roads, sea trade roads and riwer trade roads, Gulf of Basra have owned a very active junction at all time in the past and we easily guess that it will be protect its status in the future, too

  2. Measurement of Radon (222Rn) in the High School of Medicine 'Dr.Ali Sokoli' in Prishtina

    International Nuclear Information System (INIS)

    Kadiri, S.; Hodolli, G.; Pllana, X.; Dumani, S.; Hasani, F.

    2011-01-01

    Measurements of radon concentration (222Rn) were performed in the largest High School of Medicine ''Dr. Ali Sokoli'' in Prishtina. We choose four locations (classrooms) at ground level, three at first and three on the second floor. In the same premises, the measurements were performed with two methods: using a scintillation cell and a continuous method. The maximum value of radon concentration, measurements with scintillation cells, were obtained by the ground level moving to (573 ± 26) Bq m -3 , while the minimum value of (176 ± 11) Bq m -3 was obtained in the second floor. The maximum value of radon concentration measurements with the continuous method was 116 Bq m -3 in ground level, and the minimum value was 70 Bq m -3 . Based on these results, we calculated annual effective dose, which ranges between (0.76 ± 0.06) mSv and (2.48 ± 0.11) mSv, by scintillation cells. Whereas, the annual effective dose measuring by continuous method was between 0.30 mSv and 0.50 mSv. Based on those results, we conclude that radon concentration and annual effective doses were within accepted international standards. (author)

  3. TINJAUAN SEJARAH TERHADAP NASKAH DAN TEKS KITAB PENGETAHUAN BAHASA, KAMUS LOGAT MELAYU JOHOR PAHANG RIAU LINGGA KARYA RAJA ALI HAJI

    Directory of Open Access Journals (Sweden)

    Ellya Roza

    2012-11-01

    Full Text Available Kingdom of Riau in the 19th century recognized by many historians as the center of culture and intellectual development. While at the same time, the kingdom of Riau no longer holds hegemony and succeeding in politics, economy and trade, but they have a tradition of excellence in the form of writing that many writers with works of quality that is not only in the field of literature and language alone but also in the fields of religion, history, socio-political, legal, and cultural. Although the tools for writing like paper and ink difficulty encountered in those days, and must be imported from European countries, but the author and the author's Riau while still concentrating on the activities making up the reef. For instance, Raja Ali Haji (1808-1873 is the third descendant of Raja Haji Fi Sabilillah most productive in writing activities. One of his works, entitled The Book of Knowledge of Language, Slang Dictionary Pahang Malay Johor Riau linga which was completed in 1858 is a Malay Dictionary Malay First Nature books can even be regarded as Malay Einsiklopedi containing approximately 2000 sentences basic and advanced script written as Bustanul Katibin which intends to foster Malay language became the language of the standard on its own. The manuscript of the book, now the mistress Foundation Indrasakti in Penyengat. In connection with that paper will review the history of the manuscript and are contained in the text.

  4. White Paper AGA: An Episode-of-Care Framework for the Management of Obesity-Moving Toward High Value, High Quality Care: A Report From the American Gastroenterological Association Institute Obesity Episode of Care and Bundle Initiative Work Group.

    Science.gov (United States)

    Brill, Joel V; Ashmore, Jamile A; Brengman, Matthew L; Buffington, Daniel E; Feldshon, S David; Friedman, Kelli E; Margolis, Peter S; Markus, Danielle; Narramore, Leslie; Rastogi, Amita; Starpoli, Anthony A; Strople, Kenneth; White, Jane V; Streett, Sarah E

    2017-05-01

    The American Gastroenterological Association acknowledges the need for gastroenterologists to participate in and provide value-based care for both cognitive and procedural conditions. Episodes of care are designed to engage specialists in the movement toward fee for value, while facilitating improved outcomes and patient experience and a reduction in unnecessary services and overall costs. The episode of care model puts the patient at the center of all activity related to their particular diagnosis, procedure, or health care event, rather than on a physician's specific services. It encourages and incents communication, collaboration, and coordination across the full continuum of care and creates accountability for the patient's entire experience and outcome. This paper outlines a collaborative approach involving multiple stakeholders for gastrointestinal practices to assess their ability to participate in and implement an episode of care for obesity and understand the essentials of coding and billing for these services. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  5. Patandžali jogas un Kundalīni jogas sintēze Tantra jogas doktrīnā

    OpenAIRE

    Hvoraks, Antons

    2007-01-01

    Antons Hvoraks, Patandžali Jogas un Kundalīni Jogas sintēze Tantra Jogas doktrīnā, Rīga, 2007. Darba tēze: „Tantra-joga” skolas filozofija ir Patandžali jogas un Kundalīni jogas sintēze. Darbs sastāv no ievada, trim nodaļām, kuras ir sadalītas 20 apakšnodaļās, un no noslēguma daļas ar secinājumiem. Pirmajā nodaļā tiek aplūkoti klasiskās jogas uzskati par Visumu un cilvēku, par iespējām sasniegt atbrīvošanu un jogas kustības lielo izplatību. Otrajā nodaļā aprakstīti tantrisma uzs...

  6. Investigation on the neutral and anionic BxAlyH2 (x + y = 7, 8, 9) clusters using density functional theory combined with photoelectron spectroscopy.

    Science.gov (United States)

    Ding, Li-Ping; Shao, Peng; Lu, Cheng; Zhang, Fang-Hui; Ding, Lei; Yuan, Tao Li

    2016-08-17

    The structure and bonding nature of neutral and negatively charged BxAlyH2 (x + y = 7, 8, 9) clusters are investigated with the aid of previously published experimental photoelectron spectra combined with the present density functional theory calculations. The comparison between the experimental photoelectron spectra and theoretical simulated spectra helps to identify the ground state structures. The accuracy of the obtained ground state structures is further verified by calculating their adiabatic electron affinities and vertical detachment energies and comparing them against available experimental data. The results show that the structures of BxAlyH2 transform from three-dimensional to planar structures as the number of boron atoms increases. Moreover, boron atoms tend to bind together forming Bn units. The hydrogen atoms prefer to bind with boron atoms rather than aluminum atoms. The analyses of the molecular orbital on the ground state structures further support the abovementioned results.

  7. Selon une étude réalisée en Amérique latine, l'investissement dans l ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Selon une étude réalisée en Amérique latine, l'accès à Internet haute vitesse ... contribuer au développement social et économique, mais uniquement s'il est ... Le réseau a aussi découvert que l'impact des services à large bande sur la ...

  8. Comparison of hyperspectral transformation accuracies of multispectral Landsat TM, ETM+, OLI and EO-1 ALI images for detecting minerals in a geothermal prospect area

    Science.gov (United States)

    Hoang, Nguyen Tien; Koike, Katsuaki

    2018-03-01

    Hyperspectral remote sensing generally provides more detailed spectral information and greater accuracy than multispectral remote sensing for identification of surface materials. However, there have been no hyperspectral imagers that cover the entire Earth surface. This lack points to a need for producing pseudo-hyperspectral imagery by hyperspectral transformation from multispectral images. We have recently developed such a method, a Pseudo-Hyperspectral Image Transformation Algorithm (PHITA), which transforms Landsat 7 ETM+ images into pseudo-EO-1 Hyperion images using multiple linear regression models of ETM+ and Hyperion band reflectance data. This study extends the PHITA to transform TM, OLI, and EO-1 ALI sensor images into pseudo-Hyperion images. By choosing a part of the Fish Lake Valley geothermal prospect area in the western United States for study, the pseudo-Hyperion images produced from the TM, ETM+, OLI, and ALI images by PHITA were confirmed to be applicable to mineral mapping. Using a reference map as the truth, three main minerals (muscovite and chlorite mixture, opal, and calcite) were identified with high overall accuracies from the pseudo-images (> 95% and > 42% for excluding and including unclassified pixels, respectively). The highest accuracy was obtained from the ALI image, followed by ETM+, TM, and OLI images in descending order. The TM, OLI, and ALI images can be alternatives to ETM+ imagery for the hyperspectral transformation that aids the production of pseudo-Hyperion images for areas without high-quality ETM+ images because of scan line corrector failure, and for long-term global monitoring of land surfaces.

  9. Les « faux » mariages homosexuels de Sidi Ali au Maroc : enjeux d’un scandale médiatique

    Directory of Open Access Journals (Sweden)

    Florence Bergeaud-Blackler

    2012-01-01

    Full Text Available Les affaires de « mariages homosexuels » à Ksar el Kebir puis à Sidi Ali ont fait grand bruit dans la presse marocaine. Au-delà de l’émotion soulevée par le scandaleux amalgame entre l’institution respectée du mariage et une forme illégale de sexualité, elle a mis en évidence une transformation du traitement public de la question homosexuelle. Le changement de ton de la presse reflète-t-il celui de l’attitude de la société marocaine vis-à-vis de l’homosexualité ? Assiste-t-on à l’émergence d’une communauté homosexuelle militant pour la défense de ses droits ? Les « mariages » de Ksar el Kebir et de Sidi Ali constituent-ils des démonstrations visant à briser le tabou de l’homosexualité par l’émergence d’une « fierté » homosexuelle ? D’enquêtes menées à Sidi Ali, Fez et Casablanca, nous concluons que la médiatisation autour des affaires de mariages d’homosexuels a été un instrument d’une stratégie d’un « retour de la morale » aux relents nationalistes consécutive à la période d’establishement du roi Mohamed VI. L’article s’attache à montrer les enjeux locaux et nationaux d’une fausse chasse aux sorcières dans un pays où les conditions d’un débat sur la dépénalisation de l’homosexualité ne semblent pas encore réalisées.

  10. Mass propagation of in vitro plantlets and extraction of bioactive compounds from Eurycoma Longifolia Jack (Tongkat Ali) using cell and organ cultures

    International Nuclear Information System (INIS)

    Sobri Hussein; Rusli Ibrahim

    2006-01-01

    Eurycoma longifolia Jack or better known in Malaysia as Tongkat Ali is an important herbal plant that owes its popularity locally and worldwide to its aphrodisiac claim and has been sought after as an essential component for the treatment of anti-malarial, anti-ulcer, anti-tumour promoting and anti-parasitic agent and also as health supplements. Quassinoids and canthin-6-one alkaloids contained in Tongkat Ali roots are the main substances having active functions for human body. Propagation is commonly done through seeds or some vegetative means such as cuttings of stems and root, grafting or layering. However, propagation by conventional method is inadequate to meet the demand due to low viability, low germination rate, delayed rooting and long life cycle. Tissue culture has been successfully applied for mass production of plantlets and extraction of many useful secondary metabolites, including pharmaceuticals, pigments and other fine chemicals. Tongkat Ali active substances have also been derived through cell culture technology but its processes need to be optimized before the product can be commercialized. Cell and organ cultures have been proven to be an efficient alternative method for biomass production due to its fast growth and stable metabolite production. In view of its potential commercial value as a plantation crop as well as to conserve its germplasm, micropropagation technique using cell culture system is an attractive method for regeneration and mass propagation. (Author)

  11. Comparative alteration mineral mapping using visible to shortwave infrared (0.4-2.4 μm) Hyperion, ALI, and ASTER imagery

    Science.gov (United States)

    Hubbard, B.E.; Crowley, J.K.; Zimbelman, D.R.

    2003-01-01

    Advanced Land Imager (ALI), Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER), and Hyperion imaging spectrometer data covering an area in the Central Andes between Volcan Socompa and Salar de Llullaillaco were used to map hydrothermally altered rocks associated with several young volcanic systems. Six ALI channels in the visible and near-infrared wavelength range (0.4-1.0 ??m) were useful for discriminating between ferric-iron alteration minerals based on the spectral shapes of electronic absorption features seen in continuum-removed spectra. Six ASTER channels in the short wavelength infrared (1.0-2.5 ??m) enabled distinctions between clay and sulfate mineral types based on the positions of band minima related to Al-OH vibrational absorption features. Hyperion imagery embedded in the broader image coverage of ALI and ASTER provided essential leverage for calibrating and improving the mapping accuracy of the multispectral data. This capability is especially valuable in remote areas of the earth where available geologic and other ground truth information is limited.

  12. Nosocomial infections and antibiotic resistance pattern in open-heart surgery patients at Imam Ali Hospital in Kermanshah, Iran.

    Science.gov (United States)

    Heydarpour, Fatemeh; Rahmani, Youssef; Heydarpour, Behzad; Asadmobini, Atefeh

    2017-01-01

    Background: Patients undergoing open heart surgery have a relatively high risk of acquiring nosocomial infections. The development of antibiotic-resistant infections is associated with prolonged hospital stays and mortalities. Objectives: The present study was conducted to investigate nosocomial infections and the antibiotic resistance pattern in bacteria causing these infections in open heart surgery patients at Imam Ali Hospital in Kermanshah in the west of Iran over a 4-year period from March 2011 to March 2014. Materials and methods: The present cross-sectional study was conducted on 135 cases of nosocomial infection among open heart surgery patients. The demographic characteristics and the risk factors of each case of infection were recorded. The antibiotic susceptibility test was carried out using the Minimum Inhibitory Concentration (MIC) method based on the Clinical and Laboratory Standards Institute (CLSI) protocol. The data collected were then analyzed in SPSS-16. Results: Out of the 6,000 patients who underwent open heart surgery during this 4-year period at the selected hospital, nosocomial infections developed in 135 patients (2.25%), 59.3% of whom were female and 40.7% male. Surgery site infection (SSI), pneumonia (PNEU), urinary tract infection (UTI) and blood stream infection (BSI) affected 52.6%, 37%, 9.6% and 0.8% of the cases, respectively. E.coli , Klebsiella spp. and S. aureus were the most common bacteria causing the nosocomial infections. E. coli was most frequently resistant to imipenem (23.3%) Klebsiella spp. to gentamicin (38.5%) S. aureus to co-trimoxazole (54.2%). Conclusion: SSI had a high prevalence in this study. Further studies should therefore be conducted to examine the risk factors associated with SSI in open heart surgery. Various studies have shown that antibiotic resistance patterns are different in different regions. Finding a definitive treatment therefore requires an antibiogram.

  13. Discharge Against Medical Advice in the Pediatric Wards in Boo-ali Sina Hospital, Sari, Iran 2010.

    Science.gov (United States)

    Mohseni Saravi, Benyamin; Reza Zadeh, Esmaeil; Siamian, Hasan; Yahghoobian, Mahboobeh

    2013-12-01

    Since children neither comprehended nor contribute to the decision, discharge against medical advice is a challenge of health care systems in the world. Therefore, the current study was designed to determine the rate and causes of discharge against medical advice. This descriptive cross-sectional study was done by reviewing the medical records by census method. Data was analyzed using SPSS software and x(2) statistics was used to determine the relationship between variables. The value of P<0.05 was considered significant. Rate of discharged against medical advice was 108 (2.2%). Mean of age and length of stay were 2.8±4 (SD).3 years old and 3.7±5.4 (SD) days, respectively. Totally, 95 patients (88.7%) had health insurance and 65 (60.2%) patients lived in urban areas. History of psychiatric disease and addiction in 22 (20.6%) of the parents were negative. In addition, 100 (92.3%) patients admitted for medical treatment and the others for surgery. The relationship of the signatory with patients (72.3%) was father. Of 108 patients discharged against medical advice, 20 (12%) were readmitted. The relationship between the day of discharge and discharge against medical advice was significant (ρ =0/03). Rate of discharge against medical advice in Boo-ali hospital is the same as the other studies in the same range. The form which is used for this purpose did not have suitable data elements about description of consequence of such discharge, and it has not shown the real causes of discharge against medical advice.

  14. JGME-ALiEM Hot Topics in Medical Education: An Analysis of a Virtual Discussion on Resident Well-Being.

    Science.gov (United States)

    Chung, Arlene; Battaglioli, Nicole; Lin, Michelle; Sherbino, Jonathan

    2018-02-01

    Physician well-being is garnering increasing attention. In 2016, the Journal of Graduate Medical Education ( JGME ) published a review by Kristin Raj, MD, entitled "Well-Being in Residency: A Systematic Review." There is benefit in contextualizing the literature on resident well-being through an academic journal club. We summarized an asynchronous, online journal club discussion about this systematic review and highlighted themes that were identified in the review. In January 2017, JGME and the Academic Life in Emergency Medicine (ALiEM) blog facilitated an open-access, online, weeklong journal club on the featured JGME article. Online discussions and interactions were facilitated via blog posts and comments, a video discussion on Google Hangouts on Air, and Twitter. We performed a thematic analysis of the discussion and captured web analytics. Over the first 14 days, the blog post was viewed 1070 unique times across 52 different countries. A total of 130 unique participants on Twitter posted 480 tweets using the hashtag #JGMEscholar. Thematic analysis revealed 5 major domains: the multidimensional nature of well-being, measurement of well-being, description of wellness programs and interventions, creation of a culture of wellness, and critique of the methodology of the review. Our online journal club highlighted several gaps in the current understanding of resident well-being, including the need for consensus on the operational definition, the need for effective instruments to evaluate wellness programs and identify residents in distress, and a national research collaboration to assess wellness programs and their impact on resident well-being.

  15. A Review on the Concepts of Traditional Architecture by Mulla Sadra’s Al-Hikmat Al-Mota'alie

    Directory of Open Access Journals (Sweden)

    Zeinab Soleimani Sheijani

    2017-12-01

    Full Text Available Paying little attention to the roots of today's architecture has departed the contemporary architecture from its conceptual origins. However, the single application of traditional architecture principles does not fulfill the demands of today's life. Although by peering into the traditional Iranian architecture, principles and specific ideas implicit in the Islamic wisdom of Iran are revealed. In addition to maintaining the values of traditional architecture, a new approach to architectural design can also be achieved by recognizing and integrating these principles with the necessities of today's life. The article aims to answer whether it is possible to create a link between the traditional Iranian architecture concepts and the principles of contemporary rational architecture, similar to what Mulla Sadra, the great Persian philosopher, created between the Iranian ancient wisdom and al-Hikmat al-Masha which was solely a rational philosophy. To achieve the mentioned aim, first Mulla Sadra's intellectual structure has been studied, after modeling al-Hikmat al-Mota'alie. Then the traditional architecture has been analyzed in order to recognize its being (al-Wojud and essence (al-Mahiyat. The priority of being has been introduced in the next step, followed by levels of being. The next pace was to discuss the structure of Mulla Sadra's thinking method in architecture. The results of study indicate that the process of communication between ancient wisdom and al-Hikmat al-Mashaexplained by Sadra can be classified in two phases, cognizing and integrating. In the stage of integration Sadra used rational reasoning to prove the issues that have been obtained through intuition and the same trend can be applied in architecture. The intuitive aspects of traditional architecture can also be presented within the framework of today's rationalist architecture in two steps, including cognizing and integrating.

  16. Asymptomatic bacteriuria in pregnant women attending Boo-Ali Hospital Tehran Iran: Urine analysis vs. urine culture.

    Science.gov (United States)

    Etminan-Bakhsh, Mina; Tadi, Sima; Darabi, Roksana

    2017-11-01

    Asymptomatic bacteriuria is one of the common problems in pregnancy. Asymptomatic bacteriuria is associated with pyelonephritis, preterm labor and low birth weight infants. The physiological and anatomical changes in pregnancy facilitate urinary tract infection (UTI) during pregnancy. Several tests are available for diagnosis of asymptomatic bacteriuria. The urine culture is a gold standard diagnostic test for asymptomatic bacteriuria but it is expensive and time-consuming. Screening methods may be useful in detecting high-risk pregnant women for asymptomatic bacteriuria. The aim of the present study was to compare urine analysis as a rapid screening test to urine culture in diagnosis of asymptomatic bacteriuria. A total of 123 pregnant women attending the obstetrics clinic of Boo-Ali hospital in Tehran, Iran from March 2013 to September 2014 were included in the present diagnostic cross-sectional study. One hundred twenty three mid-stream urine samples were inoculated into cultures and were processed by dipstick (nitrite test and leucocyte esterase test) and microscopic pus cell count. The sensitivity, specificity, positive predictive value and negative predictive value of nitrite test, leucocyte esterase test and microscopic pus cell count were compared with urine culture in diagnosis of asymptomatic bacteriuria by using SPSS version 19. Of 123 urine samples, significant asymptomatic bacteriuria (≥10 4 cfu/Ml) was detected in 8 (6.5%) subjects. The sensitivity and specificity of nitrite test were 37% and 100% respectively. The sensitivity of pus cell count alone and leucocyte esterase test alone were 100% but the specificity of them were 64% and 65% respectively. We found high negative predictive value by Pus cell count and the leucocyte esterase test (100%) and low positive predictive value by them (16% and 17% respectively). Urine culture is the most useful test for diagnosis of asymptomatic bacteriuria. None of our screening tests had a sensitivity and

  17. Summer students and professor from the United Arab Emirates - from left to right : Alya Ali Binghurair, Shaikha Al Kalbani, Professor Chafia Hejase de Trad, Mariam Al Hassani, Aminah Al Abdouli.

    CERN Multimedia

    Maximilien Brice

    2004-01-01

    Summer students and professor from the United Arab Emirates - from left to right : Alya Ali Binghurair, Shaikha Al Kalbani, Professor Chafia Hejase de Trad, Mariam Al Hassani, Aminah Al Abdouli.

  18. (Tongkat Ali) for callus

    African Journals Online (AJOL)

    hope&shola

    2010-12-06

    Dec 6, 2010 ... The induction of callus cultures using leaf, petiole, rachis, stem, tap root, fibrous root, cotyledon and ... other countries of the South-East Asia region and widely distributed ..... Indian ginseng plantlets from stem callus. Plant Cell ...

  19. TOURE ALI.xps

    African Journals Online (AJOL)

    HP Pro 2000

    irrigated-rice production enterprise revealed positive economic profitability for both ... marketing in which a great number of women rice traders are active. ..... Table 3 : Summary results for single-factor change scenarios: increase in yield and ...

  20. Ali, Prof. Sher

    Indian Academy of Sciences (India)

    Elected: 2005 Section: Animal Sciences ... Specialization: Molecular Genetics of Humans & Animals, Gene Expression, Cancer Genomics and Genomics of Endangered Species ... Biotechnology techniques in Biodiversity conservation

  1. 2029-IJBCS-Article-Muhammad abdullahi

    African Journals Online (AJOL)

    hp

    NUS have the potential to fight malnutrition and improve human health particularly ... pulp for yoghurt production using different mixtures of milk and A. digitata fruit pulp powder in ratios of 4:1,. 3:2, 2:3, ..... characteristic flavor of yoghurt. Ibrahim ...

  2. 1 - 6_Abubakar and Muhammad_1

    African Journals Online (AJOL)

    User

    phosphorus availability in soil using Sokoto Rock Phosphate. The experiment ... essential macro-nutrient required by plants (Srinivasan ... microbial metabolites such as organic acids (Singh and ..... Adaptations by Plants for Securing a Non-.

  3. Muhammad Junaid Sulaiman Shairon wa Adibon

    OpenAIRE

    Safa, Najmuddin H. Abd.

    2014-01-01

    ???????????? ?????????? ?????????? ???????? ???????? ???????????? ???? ???????????????? ?????????????? ???????? ???????? ?????????? ?????????? ?????????? ???????????????????? . ???????? ???????? ???? ???????????? ?????? ???????? 1921 ??? 1996 ?? . ?????????? ?????????? ?????? ?????????? ???????????? ???? ???????? ?? ???? ?????????? ?????????? ?????????????????? ???????????????? ???????? ???????? ???????? ?????????? . ???????? ?????????? ???????? ???????? ?????? ?????????? ???? ????...

  4. 24__170 - 177_Muhammad and Mukhtar

    African Journals Online (AJOL)

    pc

    , the ... as rain crops that turn from green to golden as grain ripens ..... Mean. LSD. IT89KD-288. 3.438. 3.011. 2.888. 3.112. 0.198. Kanannado. 3.943. 3.788. 3.225. 3.652. 0.266. Mean. 3.690. 3.399. 3.056. LSD (0.05%) 0.282. 0.756. 0.807.

  5. Shaft line systems draw the line systems (Kawam Din Muhammad ibn Mohammed Hussein al-Husseini (رمح الخط في نظم رسم الخط نظم (قوام الدين محمد بن محمد حسين الحسيني

    Directory of Open Access Journals (Sweden)

    Qassim Raheem Hassan المدرس. قاسم رحيم حسن

    2011-06-01

    Full Text Available We pray For Allah For Aid and Praise be to Allah, and peace be upon Muhammad and The God of the good and virtuous, and companions Almentajabin. After A. Scientists in this science a lot of acronyms and shaft line one important condensed systems in line and spelling rules which was written by Mirza strength Din Muhammad ibn Muhammad Mahdi al-Husseini Saifi Qazwini Alhily. The flag line systems of healing morphological eyebrow. Finished their Isfahan years (1123 AH and explained disciple famous with Mawla Mohsen and Alnhoi Qazwini. He called his explanation (font calendar not only governing the organized aware the systems in all branches of knowledge Fenrah regulated in the account (Account Summary and (systems message astrolabe In fiqh (systems Includes index In praise (Ithnaa Ashraat in Madaih In ethics him Orjosp has Orjosp in jurisprudence has Orjosp in the statement has Orjosp in intonation has Orjosp modulated with Orjosp in equalizer and Altrajih name of justice and charity has Orjosp in census Quran and some rules of Quran has Orjosp in exchange has Orjosp has Orjosp in as he has a cabinet Saifi Qazwini has Alchukaat almonzomma and Nozim Zobdat Alssol with the statement in the science system.

  6. العلامة السيد أبو القاسم رضي الدين علي بن موسى بن جعفر الحسني المعروف بابن طاووس(589هـ 664هـ ومنهجه في كتاب (سعد السعود للنفوس Alalmaa ALSayyed Abu al-Qasim Radhi al-Din Ali ibn Musa ibn Jaafar al-Hassani known as Ibn Tawoos (589 Ah 664 Ah And His method in the book (Saad Al Saud of souls

    Directory of Open Access Journals (Sweden)

    Dr. Mohmed Abbass Noemman Aljobry أ.م.د. محمد عباس نعمان الجبوري

    2012-06-01

    Full Text Available Praise be to Allah who created man, aware man of the statement, and peace and blessings on the pillow creatures Muhammad and his Generous family, and after: Jurists and scholars alive in the hearts and thoughts of the faithful and if they departed this world, their careers and their works live what remains forever, they are sponsored by it for the hearts and neighborhoods of hearts, that Mr. Radhi al-Din Ali bin Tawoos (God's mercy Beauty walk and role models who know her place above the level of the mind, knowledge is infinite factor the satisfaction of God Almighty Mahtata so most reservists, pride of Hilla city, his efforts to raise the nation and Asaaffha, and access to the height of greatness and integrity through Asudaih of tips and guidance gained from his grandfather and Ram and his father and his life. know religion his main concern and suggesting that arguments and evidence relied upon, teaches others how to derive rulings of the conversations of the Prophet (them blessings and peace. wrote books have scientific value and features Balothaqh text transfer in a topping books written in his time. His books (Saad Al Saud of souls have ways a new kind of authorship in this book, the first mention of suspicions and discussed and the response based on evidence and arguments. Vmnahjah Mr. Saad Saud book include the following: the oath on two fronts: Part One: Transfer of Qurans binoculars and Rabat Mecca. Part II: What transfer of interpretations of the Koran and the specialty, has explained in detail the methodology on which the book was keeping conclusion to reach the most important included in the search results.

  7. Hindering factors and suggestions related to organ donation decisions: perspective of the Taiwan Ali-Shan Tsou aboriginal tribe.

    Science.gov (United States)

    Chen, A N; Chen, K F; Chang, P C; Shih, F Jong; Chen, C R; Shih, F-Jin; Huang, C-Y

    2014-05-01

    Ali-San Tsou (AST) is one of leading aboriginal tribes in Taiwan with traditional godly beliefs related to life and death. Lacking related knowledge, health professionals (HPs) often failed to help them reach good dying or organ donation (OD). This study aimed to explore hindering factors and suggestions related to OD for good dying from Taiwan AST's own perspective. An explorative qualitative design was employed using a purposive sample of the AST tribes from Taiwan. Data were collected with AST residents by face-to-face interviews and analyzed by content analysis. Thirty AST residents (16 females and 14 males) with ages ranging from 28 to 78 (mean, 54.5) years completed interviews. Of them, 85% reported various diseases. In this study 73% were Catholics and Christians, 17% held traditional godly believes, and 10% had no religious affiliation. Eight hindering factors were reported: (1) limited information about organs and OD; (2) no qualified organs for donation; (3) worry about lack of forgiveness by ancestors; (4) tribe elders who might not accept concept of OD; (5) intact bodies were required at home during spirit-companion rituals; (6) earth burial with intact bodies was preferred; (7) bodies due to accidental and bad death were impermissible for OD; and (8) worry about possession by the donor's spirit. Seven suggestions were also reported for HPs to enhance AST's OD decisions: (1) starting with friendship and a caring relationship; (2) providing spiritual support from reverent religions; (3) stressing good deeds and honoring tribe folks by OD; (4) avoiding accidental/bad death; (5) providing relevant modern medical knowledge of human organs and OD; (6) introducing OD as part of a good-dying care plan; and (7) demonstrating a respectful discussion mindset about OD. Eight hindering factors and 7 types of suggestions for enhancing AST aboriginal people's OD decisions were first explored in this project. In the future, HPs are encouraged to invite AST to share

  8. Radiometric cross-calibration of EO-1 ALI with L7 ETM+ and Terra MODIS sensors using near-simultaneous desert observations

    Science.gov (United States)

    Chander, Gyanesh; Angal, Amit; Choi, Taeyoung; Xiong, Xiaoxiong

    2013-01-01

    The Earth Observing-1 (EO-1) satellite was launched on November 21, 2000, as part of a one-year technology demonstration mission. The mission was extended because of the value it continued to add to the scientific community. EO-1 has now been operational for more than a decade, providing both multispectral and hyperspectral measurements. As part of the EO-1 mission, the Advanced Land Imager (ALI) sensor demonstrates a potential technological direction for the next generation of Landsat sensors. To evaluate the ALI sensor capabilities as a precursor to the Operational Land Imager (OLI) onboard the Landsat Data Continuity Mission (LDCM, or Landsat 8 after launch), its measured top-of-atmosphere (TOA) reflectances were compared to the well-calibrated Landsat 7 (L7) Enhanced Thematic Mapper Plus (ETM+) and the Terra Moderate Resolution Imaging Spectroradiometer (MODIS) sensors in the reflective solar bands (RSB). These three satellites operate in a near-polar, sun-synchronous orbit 705 km above the Earth's surface. EO-1 was designed to fly one minute behind L7 and approximately 30 minutes in front of Terra. In this configuration, all the three sensors can view near-identical ground targets with similar atmospheric, solar, and viewing conditions. However, because of the differences in the relative spectral response (RSR), the measured physical quantities can be significantly different while observing the same target. The cross-calibration of ALI with ETM+ and MODIS was performed using near-simultaneous surface observations based on image statistics from areas observed by these sensors over four desert sites (Libya 4, Mauritania 2, Arabia 1, and Sudan 1). The differences in the measured TOA reflectances due to RSR mismatches were compensated by using a spectral band adjustment factor (SBAF), which takes into account the spectral profile of the target and the RSR of each sensor. For this study, the spectral profile of the target comes from the near-simultaneous EO-1

  9. Reasons for not receiving thrombolytic therapy in patients with acute myocardial infarction admitted to Bu-Ali Sina Hospital in Qazvin (2013-14)

    OpenAIRE

    MM. Daei; M. Karimi Rad; M. Khalaja

    2017-01-01

    This hospital-based cross-sectional study was conducted in 2013-14 in Qazvin Bu-Ali Sina Hospital. 170 patients with acute myocardial infarction who not receiving thrombolytic therapy entered the study and were analyzed. Medical history, physical examination, twelve lead ECG and cardiac biomarkers were obtained. The mean age of the patients was 63.4±14.4 years (from 19 to 90 years). 110 (64.7%) of the patients were male and 48 (28.2%) were diabetic. 86 (50%) of patients due to late present...

  10. Technical feasibility of a seabed gallery seawater intake at Ras Abu Ali Island, Arabian Gulf, Saudi Arabia

    KAUST Repository

    Rachman, Rinaldi

    2014-07-23

    Open-ocean intake systems require extensive and advanced pretreatment unit operation to produce feed water with low membrane fouling potential in seawater reverse osmosis (SWRO) facilities. Alternatively, subsurface intake systems tend to produce high quality raw seawater even before pretreatment. Subsurface intakes extract seawater indirectly through the geological structure of shoreline or nearshore sediments. Water percolation through geological units provides physical and biological treatment, so that the raw seawater is microbiologically stable with relatively low particulate and organics content. Overall, utilization of subsurface intakes will reduce the intensity of pretreatment, which reduces operating cost, lowers chemical and energy consumption, and reduces environmental impacts. An important aspect in the feasibility of a subsurface intake is the compatibility of the local geological environment. In this study, a field investigation was conducted at Ras Abu Ali Island in the Arabian Gulf. This location currently contains an of existing oil company facilities and a proposed governmental marine fish hatchery facility. Recreational, commercial, and domestic potable water uses require the need to use the SWRO process to meet demands. Characterization of the shoreline and marine offshore bottom were performed as well as observation of tidal fluctuations and wave heights. A specific grid area was chosen where 35 sediment samples were collected from the seabed floor for laboratory analysis of grain size distribution, sediment porosity, and hydraulic conductivity. Onsite observation showed that the marine bottom has a low slope creating a wide intertidal area. The lowest tidal zone is more than 150 m from the shoreline defining a far seaward boundary for the intake construction point. A relatively thin layer of mixed-type sediment (carbonate and siliciclastic) covers the marine hardground bottom. The unlithified bottom sediment contains a low mud percentage

  11. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Mohammad Sadiq1 Muhammad Ali1 Rashid Iqbal1 Khalid Saeed1 Aimal Khan1 Muhammad Naveed Umar1 Haroon Ur Rashid2. Department of Chemistry, University of Malakand, Chakdara, Dir (L), Khyber Pakhtunkhwa, Pakistan; Department of Chemistry, Sarhad University of Science and Information Technology, ...

  12. African Journal of Biotechnology - Vol 11, No 46 (2012)

    African Journals Online (AJOL)

    Punjabi population data for seven X-chromosome short tandem repeat (X-STR) loci using a new miniplex system · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Muhammad Israr, Ahamad Ali Shahid, Ziaur Rahman, Muhammad Saqib Shahzad, Obaid Ullah, ...

  13. Turkish Postmodernism through the “Second Wave” Paradigm: The Example of Creative Work by Hasan Ali Toptaş and Perihan Mağden

    Directory of Open Access Journals (Sweden)

    Kseniya V. Grebenshcikova

    2017-11-01

    Full Text Available This paper describes the aspects of Turkish postmodernism of the "second wave", which is justified by an insignificant number of theoretical works and inadequate elaboration of studies concerning the representatives of Turkish postmodernism "second wave". The exception is represented by the works of Russian turkologists M.M. Repenkova and O.V. Kareva, who consider the features of the postmodern paradigm in their studies within the novelistics of the leading representatives of the Turkish postmodernism "second wave". The representatives of the "second wave" (Hasan Ali Toptaş, İhsan Oktay Anar, Perihan Mağden, Kürşat Başar, etc. were not the object of close research before, and therefore the consideration of their creativity as the next stage in the development of Turkish postmodernism is relevant. The "second wave" of postmodernism is characterized by the appeal to the literature of symbolic modeling in 1990s. During this period, the literature of postmodernism develops into a powerful trend, which becomes the predominant trend of the cultural life of Turkey in 2000s. It is worth noting that, if in the postmodern prose of 1980s was marked by the dominance of "lyrical stream", then in 1990s and 2000s the dominant trend was represented by narrative modification. Hasan Ali Toptaş, known for his mastery of language use, is regarded as one of the main representatives of the second wave of postmodern literature.

  14. Şiî Kaynaklarda Ali B. Ebî Tâlib ve Fatıma Mushafı

    Directory of Open Access Journals (Sweden)

    Mehmet Atalan

    2015-11-01

    Full Text Available It isimportant to note that the issue of the mushaf of Ali b. Ebi Talib is neither based on inference nor is it a matter of belief but it is rather a historical and well-researched fact, and if there exists any dispute over this issue, it is regarding certain details and the eventual fate of this mushaf Most of the narrations indicate that Imam Ali mushaf was compiled on the basis of the order of the revelation of the surahs. However, there are differing views as regards the contents of the mushaf had whether it contained only the revealed text or the al-nuzul and the nasikh and mansukh. In one tradition it is said that Fatimah, after the Prophet passed away, used to write what she was told that would happen to her descendants and stories about other rulers to come. Fatimah recorded those information, which was kept in her family of Imams, and was called The Mushaf of Fatimah. But, The Mushaf of Fatimah is not a part of Quran. It does not have anything to do with Shari’ah and the religious practices

  15. The Impact of Vocational Schools on the Regional Development Akören Ali Rıza Ercan Vocational School Example

    Directory of Open Access Journals (Sweden)

    Refika Atalay

    2017-07-01

    Full Text Available The regional development difference which has globally become a major problem even for developing countries is one of important problems of Turkey's economy. The regional dualism in the country's economy brings with many economic and social problems such as the immigration, the income inequality, the unplanned urbanization etc. The vocational schools established generally in localities less than ten thousand people contribute to remove the development difference of these localities by providing social and economic benefits as well as by training skilled staff to the locality where they are located. In this study we investigated the impact of vocational schools in the removal of the regional development difference and we made use of primary and secondary sources. Firstly, we scanned the literatures concerning this study, then we made survey with the students which study in Akören Ali Riza Ercan Vocational School. By taking the 5% significance level and the 5% margin of error into consideration in this study we used the SPSS for Windows statistics program in the evaluation of data taken as 317 students sample among the main body of 1,240 students. We tried to present solution proposals by studying the expectations and problems of the students as well as the contribution of the Akören Ali Riza Ercan Vocational School to the development of Akören district.

  16. Evaluation of Three Commercial Backpack Sprayers with Aqualuer (registered trademark) 20-20 Against Caged Adult Aedes aegypti

    Science.gov (United States)

    2016-03-11

    Sprayers with Aqualuer® 20–20 Against Caged Adult Aedes Aegypti Author(s): Derrick Conover, Ali Fulcher, Michael L. Smith, Muhammad Farooq, Marcia K... AEDES AEGYPTI DERRICK CONOVER,1 ALI FULCHER,1 MICHAEL L. SMITH,1 MUHAMMAD FAROOQ,2 MARCIA K. GAINES1 AND RUI-DE XUE1,3 ABSTRACT. Three commercially...adult Aedes aegypti in semifield trials in northeastern Florida. Two battery-powered sprayers, Birchmeier and Hudson, were compared with the standard

  17. Aga miks mitte panustada teraviljale? / Tarvo Vaarmets

    Index Scriptorium Estoniae

    Vaarmets, Tarvo

    2007-01-01

    Üha populaarsust koguvate ETFide ehk börsil kaubeldavate fondide hulka on lisandunud ka viimaste variatsioonid ETCd ehk börsil kaubeldavad toorained, nende perspektiivikust tõstab tarbimise kasv maailmas. Tabel: Millistel börsidel tehakse tehinguid ETF-idega

  18. Hiilgav, aga... / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Earth 2" (1994), "EZ Streets" (1996), "Profit" (1996), "Strange World" (1999), "The Inside" (2005), "Drive" (2007), "Aliens in America" (2007)

  19. Edasi loodusesse! Aga kuhu? / Riina Oruaas

    Index Scriptorium Estoniae

    Oruaas, Riina

    2007-01-01

    Tantsulavastustest: Oksana Titova, Päär Pärenson ja Juhan Ulfsak "Roots", Kaja Kanni sooloetendus "There are Laika dogs living in Estonia", Tiina Mölder, Kaja Kann ja Bush Hartshor "Naine ja Hunt"

  20. Pb-Zn mineralization of Ali ou Daoud area (Central High Atlas, Morocco: characterisation of deposit and relationship with the clay assemblages

    Directory of Open Access Journals (Sweden)

    Daoudi, L.

    2008-12-01

    Full Text Available Zn-Pb-Fe ores in the Ali ou Daoud deposit (Central High Atlas are found as stratiform levels and as karst fillings in carbonate platforms facies of Bajocian age. Tectonic structures (e.g., synsedimentary faults played a relevant role in the ore emplacement. The dolomitic ore-related host-rock levels are characterized by the presence of kaolinite enrichment in clay levels in amounts directly related to the proportion of the clay minerals. The latter is evidenced by correlation between kaolinite and sulphide contents, suggesting that the installation of kaolinite and mineralisations would result from the same hydrothermal fluid.[Français] Dans les séries sédimentaires carbonatées d’Ali ou Daoud (Haut Atlas Central, les minéralisations à Zn, Pb et Fe en amas stratiformes forment les faciès de remplissage des karsts d’une plateforme carbonatée bajocienne. Le contrôle structural joue un rôle capital dans la localisation du gîte en bordure de plateforme sur des failles synsédimentaires. Dans les niveaux dolomitiques encaissants des minéralisations, les assemblages argileux sont caractérisés par la présence de kaolinite dont la teneur varie parallèlement avec celle du minerai. Ceci suggère que la mise en place de la kaolinite et des minéralisations résulterait du même fluide hydrothermal. [Español] En las series sedimentarias carbonatadas de Ali ou Daoud (Alto Atlas Central, las mineralizaciones de Zn, Pb y Fe aparecen en niveles estratiformes como facies de reemplazamiento de los karsts de una plataforma carbonatada Bajociense. El control estructural desempeña un papel crucial en la localización del yacimiento a lo largo de la plataforma sobre fallas sinsedimentarias. En los niveles dolomíticos que incluyen las mineralizaciones, las asociaciones arcillosas se caracterizan por la presencia de caolinita, cuyo contenido varía paralelamente al de la mineralización. Esto sugiere que la creación de caolinita y de la

  1. Geochemistry of rare earth elements in the Baba Ali magnetite skarn deposit, western Iran – a key to determine conditions of mineralisation

    Directory of Open Access Journals (Sweden)

    Zamanian Hassan

    2016-03-01

    Full Text Available The Baba Ali skarn deposit, situated 39 km to the northwest of Hamadan (Iran, is the result of a syenitic pluton that intruded and metamorphosed the diorite host rock. Rare earth element (REE values in the quartz syenite and diorite range between 35.4 and 560 ppm. Although the distribution pattern of REEs is more and less flat and smooth, light REEs (LREEs in general show higher concentrations than heavy REEs (HREEs in different lithounits. The skarn zone reveals the highest REE-enriched pattern, while the ore zone shows the maximum depletion pattern. A comparison of the concentration variations of LREEs (La–Nd, middle REEs (MREEs; Sm–Ho and HREEs (Er–Lu of the ore zone samples to the other zones elucidates two important points for the distribution of REEs: 1 the distribution patterns of LREEs and MREEs show a distinct depletion in the ore zone while representing a great enrichment in the skarn facies neighbouring the ore body border and decreasing towards the altered diorite host rock; 2 HREEs show the same pattern, but in the exoskarn do not reveal any distinct increase as observed for LREEs and MREEs. The ratio of La/Y in the Baba Ali skarn ranges from 0.37 to 2.89. The ore zone has the highest La/Y ratio. In this regard the skarn zones exhibit two distinctive portions: 1 one that has La/Y >1 beingadjacent to the ore body and; 2 another one with La/Y < 1 neighbouring altered diorite. Accordingly, the Baba Ali profile, from the quartz syenite to the middle part of the exoskarn, demonstrates chiefly alkaline conditions of formation, with a gradual change to acidic towards the altered diorite host rocks. Utilising three parameters, Ce/Ce*, Eu/Eu* and (Pr/Ybn, in different minerals implies that the hydrothermal fluids responsible for epidote and garnet were mostly of magmatic origin and for magnetite, actinolite and phlogopite these were of magmatic origin with low REE concentration or meteoric water involved.

  2. Actividades económicas primarias predominantes en la Reserva Paisajística Nor Yauyos Cochas, Perú. Caso: distritos de Huancaya, Alis y Vitis

    Directory of Open Access Journals (Sweden)

    Wilfredo Bulege Gutiérrez

    2011-12-01

    Full Text Available Objetivos: Determinar las actividades económicas primarias predominantes en los distritos de Huancaya, Alis y Vitis de la provincia de Yauyos, región Lima, ubicados en la zona de aprovechamiento directo de la Reserva Paisajística Nor Yauyos Cochas. Métodos: Es una investigación de tipo básica, alcance descriptiva, diseño transversal, en el proceso de recolección de datos se aplicó un cuestionario estructurado a una muestra no probabilística de 79 personas con edades mayores a 18 años entre varones y mujeres de los distritos de Huancaya, Alis y Vitis, quienes participaron en un evento académico sobre “Econegocios para el desarrollo” organizado por Grupo de Proyección Social “Eco-negocios” de la Universidad Continental, este mismo instrumento se aplicó a personas ubicadas circunstancialmente en la vía pública de los mencionados distritos hasta completar el tamaño muestral de 79. Resultados: El 42% manifiesta que se dedica principalmente a la agricultura; 37%, a la ganadería; 5%, a la acuicultura; 5%, a la artesanía y un 11% a otras actividades entre las cuales se puede identificar el comercio, servicios turísticos, minería, etc. Las personas cuya actividad principal es la agricultura manifestaron que el 44% de su producción es maíz; 28%, papa; 23%, trigo y 5% otros productos. Las personas dedicadas a la ganadería manifestaron que el 41%, cría camélidos; 28%, vacunos; 14%, ovinos y un 17%, otros. Conclusiones: La población de los distritos de Huancaya, Alis y Vitis dedican como una de sus actividades económicas de mayor predominancia a la agricultura, luego la ganadería, siendo este un indicador importanteque caracteriza a estos distritos como zonas con una economía basada en actividades primarias, es decir extractiva de recursos naturales y aprovechada prioritariamente para autoconsumo y su comercialización.

  3. Makna menjadi keluarga ‘teroris’ bagi keluarga tersangka terorisme Amrozi dan Ali Ghufron di Desa Tenggulun, Kecamatan Solokuro, Kabupaten Lamongan

    Directory of Open Access Journals (Sweden)

    Anis Ulfiyatun

    2015-04-01

    Full Text Available In understanding terrorism, comprehensive perspective is strongly needed in order to explain terrorism activity in a boarder structure. The main purpose of this article is to understand the circumstances that were redefined by terrorism suspect's family about their existence in the society. Another objective of this research was also to prove the presumption of being a terrorist's family and their response of massive terrorism related reportage from media. This research uses qualitative method to comprehend value and socio-cultural context in many terrorism cases, considering terrorits's family position and situation after the bombing. Primary data were collected by in-depth interview with Amrozy and Ali Ghufron's family. The research shows that terrorist's family has redefined their identity as terrorist's family by saying "us" are different with common family around them. The difference meant in this context was about life principal that was based on Islamic value and behaviour which had to be preserved by the terrorist's family

  4. Pb-Zn mineralization of the Ali ou Daoud area (Central High Atlas, Morocco): characterisation of the deposit and relationships with the clay assemblages; Mineralisation Pb-Zn du type MVT de la region d'Ali ou Daoud (Haut Atlas Central, Maroc): caracterisations du gite et relations avec les corteges de mineraux argileux

    Energy Technology Data Exchange (ETDEWEB)

    Mouguina, E. M.; Daoudi, L.

    2008-07-01

    Zn-Pb-Fe ores in the Ali ou Daoud deposit (Central High Atlas) are found as stratiform levels and as karst fillings in carbonate platforms facies of Bajocian age. Tectonic structures (e.g., syn sedimentary faults) played a relevant role in the ore emplacement. The dolomitic ore-related host-rock levels are characterized by the presence of kaolinite enrichment in clay levels in amounts directly related to the proportion of the clay minerals. The latter is evidenced by correlation between kaolinite and sulphide contents, suggesting that the installation of kaolinite and mineralizations would result from the same hydrothermal fluid. (Author) 55 refs.

  5. Synthesis and optical properties of turquoise- and green-colored brownmillerite- type Ba2In2-x-yMnxAlyO5+x codoped with manganese and aluminum

    Institute of Scientific and Technical Information of China (English)

    Peng Jiang; Wen-hui Yang; Yun-cheng Zhou; Jian-lei Kuang; Yong Li; Ting Xiao

    2016-01-01

    Brownmillerite-type oxides Ba2In2−x−yMnxAlyO5+x (0≤x≤ 0.6, 0≤y≤ 0.5) were prepared at 1300°C through solid-state reaction. X-ray diffraction (XRD) analysis showed that the structure symmetry evolved from orthorhombic to cubic with increasing Mn and Al con-tents. Wheny was greater than 0.3, peaks associated with small amounts of BaAl2O4 and Ba2InAlO5 impurities were observed in the XRD patterns. When substituted with a small amount of Mn (x≤ 0.3), the Ba2In2−x−yMnxAlyO5+x samples exhibited an intense turquoise color. The color changed to green and dark-green with increasing Mn concentration. UV–vis absorbance spectra revealed that the color changed only slightly upon Al doping. The valence state of Mn ions in Ba2In2−x−yMnxAlyO5+x was confirmed to be +5 on the basis of X-ray photoelectron spectroscopic analysis. According to this analysis, the intense turquoise color of the Ba2In2−x−yMnxAlyO5+x samples is rooted in the existence of Mn5+; thus, the introduction of Al does not affect the optical properties of the compounds.

  6. Geology, Alteration, Mineralization, Geochemistry and Petrology of intrusive units in the Shah Soltan Ali prospect area (Southwest of Birjand, South Khorasan province

    Directory of Open Access Journals (Sweden)

    Samaneh Nadermezerji

    2017-07-01

    Full Text Available Introduction The Shah Soltan Ali area is located 85 km southwest of Birjand in the South Khorasan province. This area is part of the Tertiary volcanic-plutonic rocks in the east of the Lut block. The Lut block is bounded to the east by the Nehbandan and associated faults, to the north by the Doruneh and related faults (Sabzevar zone, to the south by the Makran arc and Bazman volcanic complex and to the west by the Nayband Fault. The Lut block is the main metallogenic province in the east of Iran (Karimpour et al., 2012, that comprises of numerous porphyry Cu and Cu–Au deposits, low and high sulfidation epithermal Au deposits, iron oxide deposits, base-metal deposits and Cu–Pb–Zn vein-type deposits. The geology of Shah Soltan Ali area is dominated by volcanic rocks, comprised of andesite and basalt, which are intruded by subvolanic units such as monzonite porphyry, monzodiorite porphyry and diorite porphyry. Materials and methods 1. 170 thin sections of the rock samples as well as 25 polished and thin polished sections were prepared for petrography, alteration and mineralization. 2. Twenty five samples were analyzed for Cu, Pb, Zn, Sb, Mo and As elements by the Aqua regia method in the Zarazama laboratory in Tehran, Iran. 3. Nine samples were analyzed for trace elements [including rare earth elements (REEs]. As a result of these analyses, trace elements and REE were determined by inductively coupled plasma mass spectrometry (ICP-MS in the ACME Analytical Laboratories (Vancouver Ltd., Canada. 4. Ten samples were analyzed for major elements by wavelength dispersive X-ray fluorescence spectrometry in the East Amethyst laboratory in Mashhad, Iran. 5. Five samples were analyzed for Firre Assay analysis in the Zarazma Laboratory in Tehran, Iran. 6. The results of XRD analysis were used for 4 samples. Discussion and results Petrographic studies indicate that subvolcanic rocks consist of diorite porphyry, monzonite porphyry and monzodiorite

  7. Ionic ASi{sub 2}N{sub 3} (A=Li, Na, K and Rb) stabilized by the covalent Si–N bonding: First-principles calculations

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Huijun [College of Information Science and Engineering, Yanshan University, Qinhuangdao 066004 (China); Ren, Jiadong, E-mail: jdren@ysu.edu.cn [College of Information Science and Engineering, Yanshan University, Qinhuangdao 066004 (China); Wu, Lailei [Key Laboratory of Metastable Materials Science and Technology, College of Material Science and Engineering, Yanshan University, Qinhuangdao 066004 (China); Zhang, Jingwu, E-mail: zjw@ysu.edu.cn [Key Laboratory of Metastable Materials Science and Technology, College of Material Science and Engineering, Yanshan University, Qinhuangdao 066004 (China)

    2017-01-15

    The structural, elastic and electronic properties of LiSi{sub 2}N{sub 3} and its substitutions by Na, K and Rb were investigated through first-principles computations. The expansion of lattice parameters of ASi{sub 2}N{sub 3} from Li, Na, K to Rb is found to be determined by the bond angle of Si–N1–Si, which suggests a possible way to improve the lithium ionic conductivity by substitutions. ASi{sub 2}N{sub 3} (A=Li, Na, K and Rb) shows the similar elastic behaviors, while the electronic band gap gradually decreases from 5.1 to 3.4 eV from LiSi{sub 2}N{sub 3} to RbSi{sub 2}N{sub 3}. Interestingly, the analysis of electronic structure, crystal orbital Hamiltonian populations and Bader charges shows that the covalence of Si–N bonding is critical for the stability of ASi{sub 2}N{sub 3} phase. Among ASi{sub 2}N{sub 3} phases, there is a relatively high ionicity in NaSi{sub 2}N{sub 3}; the Si–N bond strength in [Si{sub 2}N{sub 3}]{sup −} net for KSi{sub 2}N{sub 3} and RbSi{sub 2}N{sub 3} is comparable to LiSi{sub 2}N{sub 3}, but stronger than NaSi{sub 2}N{sub 3}. - Graphic abstract: Universal trend of structural and electronic properties in alkaline metal silicon nitrides, ASi{sub 2}N{sub 3}, A=Li, Na, K and Rb. - Highlights: • Trend in structure, electronic and mechanical properties of ASi{sub 2}N{sub 3} (A=Li-Rb) were predicted. • Lattice expansion of ASi{sub 2}N{sub 3} induced by the bond angle of Si–N1–Si was found. • Calculated band gap decreases from 5.1 to 3.4 eV from LiSi{sub 2}N{sub 3} to RbSi{sub 2}N{sub 3}. • Covalent Si–N bonding is critical for the stability of ASi{sub 2}N{sub 3}.

  8. Study of the hydrodynamic of groundwater karst system of Laraos and Alis, upper basin of the Canete river using environmental isotopes

    International Nuclear Information System (INIS)

    Valencia, Jacinto; Mamani, Enoc; Magina, Jose

    2014-01-01

    In this study, seven water samples have been characterized, collected from the upper Canete river micro-basins Laraos and Alis. They were analyzed by Oxygen-18 (δ18O), deuterium (δ2H) and radioactive tritium (3H) using the technique of laser spectrometry and characterized in order to establish the recharge-discharge relationship karst system under study, formed by the dissolution of limestone from the Cretaceous age formation Jumasha, and forming watertight groundwater that by connection and hydraulic gradient of fractures discharge into springs. The interpretation of the isotopic analysis performed according to the diagram δ18O/δ2H indicates that the springs are originated from infiltrating rainwater into the karst system due to the structural design and make the connection between micro-basins. Groundwater has a different dynamic, and to a lesser extent, receives contributions from waters lagoons, this fact makes them vulnerable to contamination. In the karst hydrogeological system, groundwater from micro-basins has a dynamic part of water with a long residence time with 1.8 units of tritium (RC-7) and another water dynamic of short residence time of 3 and 3.2 tritium units (RC-4, RC-5, RC-6). (authors).

  9. Effect of integrated pest management on controlling zoonotic cutaneous leishmaniasis in Emamzadeh Agha Ali Abbas (AS) District, Isfahan province, 2006-2009.

    Science.gov (United States)

    Nilforoushzadeh, Mohammad Ali; Shirani-Bidabadi, Leila; Saberi, Sedigheh; Hosseini, Seyed Mohsen; Jaffary, Fariba

    2014-01-01

    Cutaneous leishmaniasis (CL) is still considered as a health problem in the world. Several methods of control in different regions, together with obtaining integrated information on its natural foci, are needed to decrease its prevalence. This study was designed to evaluate the effects of simultaneous interventions on CL control. A standard questionnaire was used to identify patients among pilgrims to Emamzadeh Agha Ali Abbas (Isfahan Province, Iran). Subsequently, three methods of controlling the disease, including, spraying residential buildings with Baygon, baiting with zinc phosphide poisons, changing the vegetative cover of the region, improving the environment, and mounting a mesh on all doors and windows of buildings in residential areas were used. The control measures were then evaluated by comparing the number of pilgrims affected by CL after and before the interventions. While 23 pilgrims (1.4%) were affected with CL before the intervention (pretest), five (0.3%) persons were found to have CL after taking control measures. The Chi-square test did not indicate any significant difference in the relative frequency of CL (P = 0.731). The only scientific method for preventing and controlling zoonotic CL (ZCL) is a combination of the control methods (improving the environment and fighting off the disease districts and vectors) together with changing the vegetative cover of the region. Any measure for controlling this disease must be taken and programmed in accordance with the relevant experts' views, in coordination with the participation of other organizations and the society.

  10. Reasons for not receiving thrombolytic therapy in patients with acute myocardial infarction admitted to Bu-Ali Sina Hospital in Qazvin (2013-14

    Directory of Open Access Journals (Sweden)

    MM. Daei

    2017-04-01

    Full Text Available This hospital-based cross-sectional study was conducted in 2013-14 in Qazvin Bu-Ali Sina Hospital. 170 patients with acute myocardial infarction who not receiving thrombolytic therapy entered the study and were analyzed. Medical history, physical examination, twelve lead ECG and cardiac biomarkers were obtained. The mean age of the patients was 63.4±14.4 years (from 19 to 90 years. 110 (64.7% of the patients were male and 48 (28.2% were diabetic. 86 (50% of patients due to late presentation and 47 (28% due to lack of diagnosis and 29 (17% due to contraindication and 8 (5% due to autolysis or coronary spam were not received thrombolytic therapy. We could reduce failure of receiving thrombolytic therapy more than seventy five percent with increasing people's awareness about the symptoms of myocardial infarction and skills of health staff in relation to the proper and timely diagnosis of myocardial infarction.

  11. IMPACT DE L’ORIENTATION SUR LE CONFORT THERMIQUE INTERIEUR DANS L’HABITATION COLLECTIVE : Cas de la nouvelle ville Ali Mendjeli, Constantine

    Directory of Open Access Journals (Sweden)

    S BELLARA LOUAFI

    2009-06-01

    Une étude est effectuée sur le site de la nouvelle ville ALI MENDJELI de Constantine afin de comparer et de chercher la relation entre les éléments du climat et l’orientation. Une investigation sur terrain (relevé des températures, humidité relatives, températures de surfaces est entreprise pour évaluer la réponse quantitative globale pour ce type de climat (semi aride. Parallèlement à cela une simulation à l’aide d’un logiciel TRNSYS (version 14.1 a été effectuée pour tester plusieurs possibilités d’orientations et d’améliorations afin de déterminer les éléments qui peuvent servir à des conditions meilleures. Les résultats montrent que la prise en compte du critère orientation fait participer le bâtiment à une conception plus performante thermiquement et plus économe énergétiquement.

  12. Statement from the 1983 meeting of the International Commission on Radiological Protection: annual limits for intakes (ALI) and derived air concentrations (DAC) for members of the public

    International Nuclear Information System (INIS)

    1983-01-01

    The limitation of the committed effective dose equivalent for members of the public is sufficient to provide compliance over a lifetime with the limit for single organs, thus avoiding non-stochastic effects. Relative values for infants and adults of the committed dose equivalent in a number of tissues per unit intake for each of a few radionuclides have been given: the values for infants are just more than 1 up to 100 times greater than those for adult workers. In each of these cases the appropriate annual dose-equivalent limits recommended by the Commission for members of the public are 10 times less than the corresponding values for workers; the resulting ALI for infants aged six months will be smaller than the values given in ICRP Publication 30 for limiting stochastic effects in workers by factors that range from just more than 10 (for caesium-137) to 1,000 (for ingested plutonium-239). Intermediate factors would apply for older members of the public. The magnitude of the range emphasises the need to consider each situation carefully, with particular reference to children and women. (author)

  13. Long-range ferromagnetism and magnetocaloric effects in rapidly quenched Ni50−xCoxMn50−yAly ribbons

    Directory of Open Access Journals (Sweden)

    Nguyen Thi Mai

    2017-03-01

    Full Text Available Ni50−xCoxMn50−yAly (x = 7 and 9; y = 17, 18 and 19 alloy ribbons were prepared by melt-spinning with a tangential velocity of copper wheel of 40 m s−1. X-ray diffraction patterns reveal multi-crystalline phase behavior in the fabricated ribbons. The shape of thermomagnetization curves clearly depends on Co and Al concentrations. The Curie temperatures (TC of the alloy ribbons strongly increase with increasing the Co concentration and slightly decrease with increasing the Al concentration. The martensitic-austenitic phase transition in the alloy ribbons can be manipulated by tuning Co and Al concentrations. The maximum magnetic entropy change |ΔSm|max of about 0.75 J kg−1 K−1 for a field change of 12 kOe at TC ≈ 364 K was achieved for the Ni43Co7Mn32Al18 ribbon. Critical analysis using the Arrott-Noaks and Kouvel–Fisher methods demonstrates the existence of a long-range ferromagnetic order in this ribbon.

  14. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

    2016-01-01

    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  15. Crystal structures of hydrates of simple inorganic salts. III. Water-rich aluminium halide hydrates: AlCl3 · 15H2O, AlBr3 · 15H2O, AlI3 · 15H2O, AlI3 · 17H2O and AlBr3 · 9H2O.

    Science.gov (United States)

    Schmidt, Horst; Hennings, Erik; Voigt, Wolfgang

    2014-09-01

    Water-rich aluminium halide hydrate structures are not known in the literature. The highest known water content per Al atom is nine for the perchlorate and fluoride. The nonahydrate of aluminium bromide, stable pentadecahydrates of aluminium chloride, bromide and iodide, and a metastable heptadecahydrate of the iodide have now been crystallized from low-temperature solutions. The structures of these hydrates were determined and are discussed in terms of the development of cation hydration spheres. The pentadecahydrate of the chloride and bromide are isostructural. In AlI(3) · 15H2O, half of the Al(3+) cations are surrounded by two complete hydration spheres, with six H2O in the primary and 12 in the secondary. For the heptadecahydrate of aluminium iodide, this hydration was found for every Al(3+).

  16. Use of EO-1 Advanced Land Imager (ALI) multispectral image data and real-time field sampling for water quality mapping in the Hirfanlı Dam Lake, Turkey.

    Science.gov (United States)

    Kavurmacı, Murat; Ekercin, Semih; Altaş, Levent; Kurmaç, Yakup

    2013-08-01

    This paper focuses on the evaluation of water quality variations in Hirfanlı Water Reservoir, which is one of the most important water resources in Turkey, through EO-1 (Earth Observing-1) Advanced Land Imager (ALI) multispectral data and real-time field sampling. The study was materialized in 20 different sampling points during the overpass of the EO-1 ALI sensor over the study area. A multi-linear regression technique was used to explore the relationships between radiometrically corrected EO-1 ALI image data and water quality parameters: chlorophyll a, turbidity, and suspended solids. The retrieved and verified results show that the measured and estimated values of water quality parameters are in good agreement (R (2) >0.93). The resulting thematic maps derived from EO-1 multispectral data for chlorophyll a, turbidity, and suspended solids show the spatial distribution of the water quality parameters. The results indicate that the reservoir has average nutrient values. Furthermore, chlorophyll a, turbidity, and suspended solids values increased at the upstream reservoir and shallow coast of the Hirfanlı Water Reservoir.

  17. Evolution and circulation of type-2 vaccine-derived polioviruses in Nad Ali district of Southern Afghanistan during June 2009-February 2011.

    Directory of Open Access Journals (Sweden)

    Salmaan Sharif

    Full Text Available Oral polio vaccine has been used successfully as a powerful tool to control the spread of wild polioviruses throughout the world; however, during replication in under immunized children, some vaccine viruses revert and acquire the neurovirulent phenotypic properties. In this study, we describe the evolution and circulation of Vaccine-Derived Polioviruses (VDPVs in Helmand province of Afghanistan. We investigated 2646 AFP cases of Afghan children from June 2009-February 2011 and isolated 103 (04% vaccine viruses, 45(1.7% wild type polioviruses and six (0.22% type 2 circulating vaccine-derived polioviruses (cVDPVs. These cVDPVs showed 97.7%-98.2% nucleotide and 98%-98.7% amino acid homology in VP1 region on comparison with Sabin type 2 reference strain. All these cVDPVs had two signature mutations of neurovirulent phenotypes and 12 additional mutations in P1 capsid region that might also have contributed to increase neurovirulence and replication. Phylogenetic analysis revealed that all these viruses were closely related and originated from previously reported Sabin like 2 virus from Pakistan which did not conform to the standard definition of VDPVs at that time. It was also observed that initial OPV dose was administered approximately 9 months prior to the collection of first stool specimen of index case. Our findings support that suboptimal surveillance and low routine immunization coverage have contributed to the emergence and spread of these viruses in Afghanistan. We therefore recommend high quality immunization campaigns not only in affected district Nad Ali but also in the bordering areas between Pakistan and Afghanistan to prevent the spread of cVDPVs.

  18. Prevalence of resistance to antibiotics according to International Classification of Diseases (ICD-10) in Boo Ali Sina Hospital of Sari, 2011-2012.

    Science.gov (United States)

    Afshar, Parvaneh; Saravi, Benyamin Mohseni; Nehmati, Ebrahim; Farahabbadi, Ebrahim Bagherian; Yazdanian, Azadeh; Siamian, Hasan; Vahedi, Mohammad

    2013-01-01

    One of the issues in health care delivery system is resistance to antibiotics. Many researches were done to show the causes and antibiotics which was resistance. In most researches the methods of classifying and reporting this resistance were made by researcher, so in this research we examined the International Classification of Diseases 10 the edition (ICD-10). This is a descriptive cross section study; data was collected from laboratory of Boo Ali Sina hospital, during 2011-2012. The check list was designed according the aim of study. Variables were age, bacterial agent, specimen, and antibiotics. The bacteria and resistance were classified with ICD-10. The data were analyzed with SPSS (16) soft ware and the descriptive statistics. Results showed that of the 10198 request for culture and antibiogram, there were 1020(10%) resistance. The specimen were 648 (63.5%) urine, blood 127(12.5%), other secretion 125 (12/3%), sputum 102 (10%), lumbar puncture 8 (0/8%), stool 6 (6/0%) and bone marrow 4 (0.4%). The E coli was the most 413 (40.5%) resistance cause to antibiotics which was coded with B96.2 and the most resistance was to multiple antibiotics 885(86.8%) with the U88 code. The results showed that by using the ICD-10 codes, the study of multiple causes and resistance is possible. The routine usage of coding of the ICD-10 would result to an up to date bank of resistance to antibiotics in every hospitals and useful for physicians, other health care, and health administrations.

  19. Study of the growth, reproductive biology and abundance for invasive shrimps Palaemon elegans Rathke from Garmat Ali river Basrah, Southern Iraq

    Directory of Open Access Journals (Sweden)

    Khaled Khasaf Al-Khafaji

    2016-07-01

    Full Text Available Objective: To describe the growth, reproductive biology and abundance of the population of invasive shrimps Palaemon elegans (P. elegans in one of the branches of Garmat Ali river at Basrah, Southern Iraq. Methods: Monthly samples of the prawn P. elegans were collected with a bottom hand net (40 cm, 0.5 mm mesh hauled over a distance of 10 m. A simple random sampling was conducted monthly between December 2012 and November 2013. Results: Seasonal changes were observed in the composition of the population of the species during the study year with the highest abundance in 2013 and the lowest abundance for the males was reported in January and for the females occurred in June. Salinity showed a significant correlation with the abundance of shrimps at the sampling site. The largest female measured 67.90 mm while the corresponding value for males was 61.31 mm. The proportion of ovigerous adults rose during spring season to peak on about July and ovigerous prawns were taken in all months of the year. The sex ratio indicated a preponderance of females over males in all months in the study period. Each females produced around 36–1324 eggs and the incubation period lasted for 11–14 days at 17–29 °C. Conclusions: The results of the present study indicate that this species has a wide distribution range, high density, and great reproduction potential. This study reveals the lack of researches on this species in environments of Shatt Al-Arab river and its branches. Thus, P. elegans has most likely formed a permanent population in all the brackish waters in Basrah area.

  20. Conformational preferences of DNA following damage by aristolochic acids: Structural and energetic insights into the different mutagenic potential of the ALI and ALII-N(6)-dA adducts.

    Science.gov (United States)

    Kathuria, Preetleen; Sharma, Purshotam; Abendong, Minette N; Wetmore, Stacey D

    2015-04-21

    Aristolochic acids (AAI and AAII), produced by the Aristolochiaceae family of plants, are classified as group I (human) carcinogens by the International Agency for Research on Cancer. These acids are metabolized in cells to yield aristolactams (ALI and ALII, respectively), which further form bulky adducts with the purine nucleobases. Specifically, the adenine lesions are more persistent in cells and have been associated with chronic renal diseases and related carcinogenesis. To understand the structural basis of the nephrotoxicity induced by AAs, the ALI-N(6)-dA and ALII-N(6)-dA lesions are systematically studied using computational methods. Density functional theory calculations indicate that the aristolactam moiety intrinsically prefers a planar conformation with respect to adenine. Nucleoside and nucleotide models suggest that the anti and syn orientations about the glycosidic bond are isoenergetic for both adducts. Molecular dynamics simulations and free energy calculations reveal that the anti base-displaced intercalated conformation is the most stable conformer for both types of AL-N(6)-dA adducted DNA, which agrees with previous experimental work on the ALII-N(6)-dA adduct and thereby validates our approach. Interestingly, this conformer differs from the dominant conformations adopted by other N6-linked adenine lesions, including those derived from polycyclic aromatic hydrocarbons. Furthermore, the second most stable syn base-displaced intercalated conformation lies closer in energy to the anti base-displaced intercalated conformation for ALI-N(6)-dA compared to ALII-N(6)-dA. This indicates that a mixture of conformations may be detectable for ALI-N(6)-dA in DNA. If this enhanced conformational flexibility of double-stranded DNA persists when bound to a lesion-bypass polymerase, this provides a possible structural explanation for the previously observed greater nephrotoxic potential for the ALI versus ALII-N(6)-dA adduct. In addition, the structural

  1. أواصر العناصر الكونية من منظور الأستاذ النورسي - Dr. ‘Uthman Muhammad Gharib: The Bonds of the Universal Elements from the Viewpoint of Bedi‘uzzaman al-Nursi

    OpenAIRE

    غريب, د. عثمان محمد

    2015-01-01

    أواصر العناصر الكونية من منظور ا أواصر العناصر الكونيةمن منظور الأستاذ بديع الزمان النورسي -ABSTRACT- The Bonds of the Universal Elements from the Viewpoint of Bedi'uzzaman al-Nursi Dr. 'Uthman Muhammad Gharib The researcher indicates the bonds of the elements of the universe as reflected in the "Nur Letters", which is a vision that elucidates the comprehensive identity of man. That identity is connected to the manifestations of existence and elements in the universe and i...

  2. Unustatud katakombid / Claudia Haj Ali

    Index Scriptorium Estoniae

    Haj Ali, Claudia

    1999-01-01

    Arheoloog Jean-Yves Empereur leidis Egiptuse Aleksandria linna lähedal asuvasse kaljusse rajatud katakombid, mis on osa hellenistlikul perioodil rajatud ning pikka aega unustuse hõlmas olnud surnute linnast. Leidude seas on kipsist Meduusa pea nind leide Rooma perioodist.

  3. S. Ali. J, Anim. Sci

    African Journals Online (AJOL)

    Line0re regrcssievcrwantskappe nret tritium- of ureumruinrte en lewende massa as onafhanklike veranderlikes en spier, been en dissek- teerbare vet in die bulkarkasse is opgcstel. Dre akkuranthcid van hlerdie verwantskappe is vergelyk met soortgelyke verwantskappe waar die onafhanklike veranderlikes karkasmansa en ...

  4. Centennial-scale vegetation and climate changes in the Middle Atlas, Morocco: new insights from multi-proxy investigations at Lake Sidi Ali

    Science.gov (United States)

    Fletcher, William; Campbell, Jennifer; Joannin, Sebastien; Mischke, Steffen; Zielhofer, Christoph; de Batist, Marc; Mikdad, Abdes

    2016-04-01

    The karstic lakes of the Middle Atlas, Morocco, represent a valuable archive of environmental and climatic change for Northwest Africa. Here we present the results of centennial-scale palynological and charcoal analyses as part of a multiproxy palaeolimnological study of sediment cores from Lake Sidi Ali in the Middle Atlas, Morocco (33° 03 N, 05° 00 W; 2,080 m a.s.l.). Supported by absolute dating including 23 more than twenty AMS 14C dates on pollen concentrates, the record covers the entire Holocene and offers insights into vegetation and climate change at a regionally unprecedented centennial-scale. Pollen assemblages are dominated by steppic herbs, evergreen oaks (Quercus), junipers (Cupressaceae) and Atlantic cedar (Cedrus atlantica). A long-term evolution of the montane vegetation is recorded, reflecting progressive changes in the dominant arboreal taxa and leading to the full establishment of the emblematic cedar forests of the area during the mid-Holocene by 6000 cal BP. Orbital-scale changes in seasonality and growing season moisture availability linked to declining summer insolation are implicated, with a transition from (a) warm, dry summers associated with summer drought tolerant taxa especially evergreen Quercus, high algal productivity in the lake, and high background levels of microcharcoal reflecting distant fire activity during the early Holocene, to (b) cool, relatively humid summers with dominance of montane conifers, declining algal productivity in the lake, and episodic local fire activity during the mid- to late Holocene. Superimposed on the long-term environmental changes are recurrent centennial-scale fluctuations in vegetation composition, reflecting competitive dynamics between the major taxa, initially between steppic and arboreal elements, and later between the major tree taxa. Parallels with hydrological proxies including stable O and C isotopes suggest common responses to climatic drivers (fluctuations in moisture sources and

  5. Review on a Traditional Herbal Medicine, Eurycoma longifolia Jack (Tongkat Ali: Its Traditional Uses, Chemistry, Evidence-Based Pharmacology and Toxicology

    Directory of Open Access Journals (Sweden)

    Shaheed Ur Rehman

    2016-03-01

    Full Text Available Eurycoma longifolia Jack (known as tongkat ali, a popular traditional herbal medicine, is a flowering plant of the family Simaroubaceae, native to Indonesia, Malaysia, Vietnam and also Cambodia, Myanmar, Laos and Thailand. E. longifolia, is one of the well-known folk medicines for aphrodisiac effects as well as intermittent fever (malaria in Asia. Decoctions of E. longifolia leaves are used for washing itches, while its fruits are used in curing dysentery. Its bark is mostly used as a vermifuge, while the taproots are used to treat high blood pressure, and the root bark is used for the treatment of diarrhea and fever. Mostly, the roots extract of E. longifolia are used as folk medicine for sexual dysfunction, aging, malaria, cancer, diabetes, anxiety, aches, constipation, exercise recovery, fever, increased energy, increased strength, leukemia, osteoporosis, stress, syphilis and glandular swelling. The roots are also used as an aphrodisiac, antibiotic, appetite stimulant and health supplement. The plant is reported to be rich in various classes of bioactive compounds such as quassinoids, canthin-6-one alkaloids, β-carboline alkaloids, triterpene tirucallane type, squalene derivatives and biphenyl neolignan, eurycolactone, laurycolactone, and eurycomalactone, and bioactive steroids. Among these phytoconstituents, quassinoids account for a major portion of the E. longifolia root phytochemicals. An acute toxicity study has found that the oral Lethal Dose 50 (LD50 of the alcoholic extract of E. longifolia in mice is between 1500–2000 mg/kg, while the oral LD50 of the aqueous extract form is more than 3000 mg/kg. Liver and renal function tests showed no adverse changes at normal daily dose and chronic use of E. longifolia. Based on established literature on health benefits of E. longifolia, it is important to focus attention on its more active constituents and the constituents’ identification, determination, further development and most

  6. Syria and Iraq: Relations and Prospects

    Science.gov (United States)

    1984-05-01

    Asad TABLE 1 HAFIZ AL-ASAD’S KINSHIP GROUP Position Kinship Adnan Makhluf Muhammad al-Khuli Ali Dubah Ali Arslan Ali Salih Ali Haydar Shafiq...predecessor, General Ahmad Hasan al-Bakr, to neutralize the military’s tendency to overthrow the Party, as it did in 1963 under General Abd al-Salam Arif...SADDAM HUSAYN’S KINSHIP GROUP POSITION KINSHIP General Adnan Khay- rallah (Talfah) Ali Hasan al-Majid Fadhil al-Barrak Izzat Ibrahim al-Duri Kamil

  7. Capacity fade of LiNi(1-x-y)CoxAlyO2 cathode for lithium-ion batteries during accelerated calendar and cycle life test. I. Comparison analysis between LiNi(1-x-y)CoxAlyO2 and LiCoO2 cathodes in cylindrical lithium-ion cells during long term storage test

    Science.gov (United States)

    Watanabe, Shoichiro; Kinoshita, Masahiro; Nakura, Kensuke

    2014-02-01

    Ni-based LiNi(1-x-y)CoxAlyO2 (NCA) and LiCoO2 (LCO) cathode materials taken out of lithium-ion cells after storage for 2 years at 45 °C were analyzed by various spectroscopic techniques. X-ray photoelectron spectroscopy exhibited that there was no difference between NCA and LCO. On the other hand, scanning transmission electron microscopy-electron energy-loss spectroscopy demonstrated there was a remarkably large difference between the two cathode materials. Ni-L2,3 energy-loss near-edge structure (ELNES) spectra of the NCA showed a peak at about 856.5 eV, which was assigned to trivalent nickel, was maintained even after storage, indicating that the NCA had no significant change in its surface structure during storage. On the other hand, in the Co-L2,3 ELNES spectra of the LCO a peak at about 782.5 eV, which was assigned to trivalent cobalt, significantly shifted to the lower energies after storage. These results suggest that crystal structure change of the active material surface is a predominant reason of deterioration during the storage test.

  8. Erken Cumhuriyet Yılları Milli Kimlik Tartışmaları: Hasan Ali Yücel ve Türkiye’de Hümanizma Arayışları Discussions on National Identity in the Early Republican Years: Hasan Ali Yucel and Searching for Turkish Humanism

    Directory of Open Access Journals (Sweden)

    Emre YILDIRIM

    2013-09-01

    Full Text Available This article aims to demonstrate a small group of intellectuals’ thoughts on nationalism and Turkish national identity who had tried to give an answer by searching for a new and unique Turkish humanism in general and particularly former Minister of Education, Hasan Ali Yücel’s period (1939-1946 and his humanist reformist approach to politics during the nation/identity-building process in the early decades of Republican Era. After the historical and social transition, French Revolution spreading the ideas of equality, liberty and fraternity giving rise to nationalist movements throughout Europe ended up with the decline of the multi-national empires and gave birth to the nation-states. Like the others, a new nation-state, Turkish Republic was established after the Ottoman Empire had collapsed. Turkish modernization initially took a form of westernization. Three ideologies; Pan-Ottomanism, Pan-Islamism and Pan-Turkism were seen as an appropriate direction for the society’s search for a new identity. At the same time, Turkish national identity was seen as an appropriate direction for the society’s search for a new identity and The republican elite embarked a radical stand and defined Turkish identiy as western modern secular nation which later became a dominant ideology for the new republic. At the time of early years of Republic, there were seen different acceptions for the content national identity. Hasan Ali Yücel and intellectuals searching for Turkish humanism defined modern Turkish identity by deriving it from Anatolian humanism, which could be realized through a Turkish Renaissance and claimed that it would be possible to create a unique Anatolian identity by this definition. Bu çalışma, Modern Türkiye tarihinin erken Cumhuriyet yıllarının ulus-devletleşme sürecinde milliyetçilik ve milli kimlik üzerine yaşanan tartışmalara katkıları açısından milli kimliğin içeriğini belirlemede Türkiye’ye özgü yeni bir

  9. Accumulation and distribution of heavy metal in perennials parts of vine in five local varieties (Riling, Smederevka, Hamburg, Kratoshija and Afus-Ali ) from Ovche Pole (R. Macedonia)

    International Nuclear Information System (INIS)

    Karakasheva, Elizabeta; Jovanova, Sonja; Boev, Blazho

    2012-01-01

    This work was conducted in vineyards located in Ovče Pole, near the village of Krivi dol , in the eastern part of Macedonia, in order to assess the bio-accumulation and distribution of trace elements in perennial part of grape, in five local varieties (Rizling, Smederevka, Hamburg, Kratošia and Afus-Ali). For this purpose, the content of trace elements in soil and in the perennials parts of the vine: leaves, branches and grapefruit were measured, in all five local varieties.The content of Zn in soils varied from 75.7- 96.33 mg/kg, Ni from 1.69 to 4.45 mg/ kg, Cu from 34.1- 53.6 mg/ kg, Ba from 65.8- 140.5 mg/kg, Sr from 56,3-150,9 mg/kg, As from 5.48 -13.59 mg/kg, Mo from 1.99 to 3.1 mg/kg, Pb from 14.19-26.9 mg/kg, Ti from 119-239 mg/kg, Fe from 2482-3080 mg/kg, Mn from 722-1081 mg/kg and Al from 2646-4012 mg/kg, respectively. The content of Zn in plant varied from 154.8- 188.5 mg/kg, Ni from 145.1 to 191.8 mg/kg, Cu from 31.1 to 51.5 mg/kg, Ba from 15.7 to 24.2 mg/kg, Sr from 186.5 to 287.8 mg/kg, As from 9.78-27.7 mg/kg, Mo from 0.28 to 1.44 mg/kg, Pb from 5.25 to 13.56 mg/kg, Ti from 3.73 to 7.38 mg/kg, Fe from 345 to 464.5 mg/kg, Mn from 352.3 to 400.2 mg/kg and Al from 130.8 to 256.5 mg/kg, respectively. The contents of Zn,Ba, As, Mo, and Pb not exceeded the maximum allowable content (MAC) in all soil (The Now Dutch list). The highest content of Cu and Ni (The Now Dutch list) were founded in all vineyard soil from Ovče pole. Considering the value for bioaccumulation factor (BAF), grape vine for Zn, Sr, Cu and As possessed the characteristics of hyper accumulator. Most of the accumulated metals are mainly concentrated in the leaves of the vine, with the exception of As, which are concentrated in the fruit of the vine. (Author)

  10. Metodologi Fatwa K.H. Muhammad Syaf’i Hadzami

    Directory of Open Access Journals (Sweden)

    Muhammad Ardiansyah

    2018-01-01

    Full Text Available Fatwa is one of the heavy mandates on the shoulders of Moslem scholars. There are some conditions that must be fulflled before the fatwa could be used to solve the problems of the people. Basically, the fatwa replaces the task of the Prophet in conveying the shari’a law, then the scholars did not dare to be reckless in declaring any fatwa. Therefore, being a mufti is not only required by reading the translation of al-Qur’an or Hadith, or by searching on the google, or by copying broadcasts in social media. According to al-Shirazi, the intellectual condition that must be required to be a mufti is deep understanding toward al-Qur’an and Hadith, also understanding sources of speech such as ḥaqîqah-majâz, ‘âmm-khâṣṣ, Arabic language, nâsikh-mansûkh, ijmâ’, ikhtilaf, and tartîb al-adillah. While the moral requirements to be a mufti according to Imam Ahmad bin Hanbal are having pure intention, having broad knowledge, patience, and soul, having strong mentality to fulfl the task, having suffciency of life to avoid being influenced by others, and understanding the condition of society. This paper attempts to examine the fatwas of a mufti from Betawi who had lived in the modern era known as Mu’allim Syaf’i Hadzami. The fatwas were collected in a work entitled Tawḍîḥ al-Adillah. In this article, the author has concluded that Mu’allim uses eight complementary and relevant fatwa methodologies to solve today’s problems

  11. Interview with Muhammad Affan Othman on Small Changes

    OpenAIRE

    Vahid Nimehchisalem

    2017-01-01

    Small Changes, a community organization in Malaysia (www.smallchangesmy.org), was founded in 2011 to raise funds and provide support for underprivileged individuals in the community. With an interesting tagline of Cultivating Volunteerism, Empowering Generations this community organizations has raised hundreds of thousands and has attracted tens of Malaysian students from local and overseas universities. The team consists of an enthusiastic group of young Malaysians who believe that it is pos...

  12. Hypospadias in a German Shepherd dog | Muhammad | Nigerian ...

    African Journals Online (AJOL)

    Nigerian Veterinary Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 38, No 1 (2017) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected should load ...

  13. RELIGIOUS EDUCATION BASED MULTICULTURALISME IN VIEW OF MUHAMMAD FETHULLAH GULEN

    Directory of Open Access Journals (Sweden)

    M. Khoirul Hadi al-Asya'ari

    2015-06-01

    Full Text Available Research is a research-based Library Research, which is based on the reading of the literature on Fethullah Gulen, this research wants to reveal about the importance of education based on the multicultural, multicultural education in this paper pick-tentak Fethullah Gulen figure that gives an integral view of religion and public education, in this paper will show some results of the first study, that multicultural education is important in the effort menghalu radicalism, Fethullah Gulen's second try to give a new reading of Islamic religious education toward a more Humanist and egalitarian, the third understanding of multicultural education is taken from the understanding of the Qur'an.

  14. Husein Muhammad antara Feminis Islam dan Feminis Liberal

    Directory of Open Access Journals (Sweden)

    Susanti Susanti

    2015-10-01

    Full Text Available This article focuses on the discussion about Hussein Muhammad’s thought related to the empowerment of women. Hussein is aware of the oppression in interpretation related to understanding about women. Husein is also fully aware of the role of religion and religious experts in such oppression and subordination against women. According to Hussein, women and men are equal before God as His servants. There is no such superiority among them before God except by their piety. It implies that the assumption which sees women as “the complementary creature” and places them only in domestic sphere is not true. Women also have their contribution to khilâfah on earth and they also have the same duty to commanding the good and forbidding the evil. Women can freely determine which path to choose, either to become merely a housewife or to be a career woman to earn a living. This is because every woman has different economic situation. Therefore, it is permissible for women to work to gain wealth for the sake of her life and her family.

  15. Molecular dynamics of a proguanil derivative | Muhammad | Bayero ...

    African Journals Online (AJOL)

    ... ab-initio Quantum chemical calculations at the Restricted Hatree-Fock (RHF) ... and 6-31++G basis sets were carried out for inclusion of electron correlation. ... The dipole moment of the Proguanil's derivative at both levels of theory is ... Keywords: Proguanil, Density Functional Theory, Restricted Hartree Fock, Gaussian ...

  16. Ibn Rushd, Abu'l Waleed Muhammad Ibn Ahmad Ibn Muhammad [known as Averroes] (1128-98)

    Science.gov (United States)

    Murdin, P.

    2000-11-01

    Islamic philosopher, lawyer, physician and astronomer, born in Cordoba, Spain, became physician to the Caliph of Morocco. Ibn Rushd's controversial views on philosophy—he was the greatest Islamic proponent of ARISTOTLE—led to the burning of his books and banishment by the Caliph. He wrote numerous books (87 survive) dealing with philosophy, logic, medicine, jurisprudence and astronomy, which ...

  17. Hasan Ali Toptaş'ın Kayıp Hayaller Kitabı'nda Büyülü Gerçekçilik In Kayıp Hayaller Kitabı of Hasan Ali Toptaş Megical Realism

    Directory of Open Access Journals (Sweden)

    Oktay YİVLİ

    2013-09-01

    Full Text Available In narrations of magical reality, real and unreal, ordinary andextraordinary, authentic and imaginary elements exist together withoutany conflict. Magical Realism flourishes especially in the twentiethcentury Latin American Literature. This sense results from the struggleof comprehending and narrating new reality as opposed to fantasticfictions and tales. In his novel called Kayıp Hayaller Kitabı, Hasan AliToptaş included the techniques and elements used in the samples ofmagical realism, such as de-familiarization, singularity, indefiniteness,dead people and multiple narrators.As be different fantastic in magical realism fictional people havebeen to become inured to in a world which is together realty and magic,just about accepted it as a natural media. Formal notice of magicalrealism from fantastic is that it selects spaces from realty world notimaginary world.In his novel called Kayıp Hayaller Kitabı, external reality isn’talways reflected one to one. The narration differentiates from classicnarrative structure reality in terms of presentations. Event descriptionsseen, heard and dreamed are presented in an imaginary order. In thenovel, the nature of entities and objects are given as changed Thus ittries to catch to catch another dimension of reality. The people in thenovel doubt from their own realities. What is real, what is not realbecome confused.After all these features, the novel studied should be considered asa magical realistic novel and should be evaluated as use aesthetics ofmagical realism. Büyülü gerçekçi anlatılarda gerçekle gerçek dışı, olağanla olağan olmayan, düşsel ile sahici ögeler aynı dünyanın içinde herhangi bir çatışmaya girmeden yaşarlar. Büyülü gerçekçilik özellikle yirminci yüzyıl Latin Amerikan edebiyatında gelişip serpilmiştir. Bu anlayış fantastikten ve masaldan ayrı olarak yeni gerçekliği kavramanın ve anlatmanın bir çabası olarak ortaya çıkmıştır. Hasan Ali

  18. Synthesis and optimization of novel allylated mono-carbonyl analogs of curcumin (MACs) act as potent anti-inflammatory agents against LPS-induced acute lung injury (ALI) in rats.

    Science.gov (United States)

    Zhu, Heping; Xu, Tingting; Qiu, Chenyu; Wu, Beibei; Zhang, Yali; Chen, Lingfeng; Xia, Qinqin; Li, Chenglong; Zhou, Bin; Liu, Zhiguo; Liang, Guang

    2016-10-04

    A series of novel symmetric and asymmetric allylated mono-carbonyl analogs of curcumin (MACs) were synthesized using an appropriate synthetic route and evaluated experimentally thru the LPS-induced expression of TNF-α and IL-6. Most of the obtained compounds exhibited improved water solubility as a hydrochloride salt compared to lead molecule 8f. The most active compound 7a was effective in reducing the Wet/Dry ratio in the lungs and protein concentration in bronchoalveolar lavage fluid. Meanwhile, 7a also inhibited mRNA expression of several inflammatory cytokines, including TNF-α, IL-6, IL-1β, and VCAM-1, in Beas-2B cells after Lipopolysaccharide (LPS) challenge. These results suggest that 7a could be therapeutically beneficial for use as an anti-inflammatory agent in the clinical treatment of acute lung injury (ALI). Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  19. Poklicna izgorelost ali zavzetost za delo, to je zdaj vprašanje Osebni in skupinski izobraževalni moduli za preprečevanje poklicne izgorelosti (2. del

    Directory of Open Access Journals (Sweden)

    Andreja Pšeničny

    2005-12-01

    Full Text Available Raziskavo sta avtorici posvetili preucevanju potreb po varovanju zaposlenih pred poklicno izgorelostjo, hkrati pa tudi spodbujanju njihove zavzetosti za delo. Podjetje, ki se zaveda pomena svojih virov, lahko v enem in drugem primeru s podobnimi izobrazevalnimi vsebinami in postopki oplemeniti svoj najpomembnejsi vir ljudi. Avtorici ugotavljata, da v zvezi s poklicno izgorelostjo danes ni vec poudarek na preucevanju osebnostnih lastnosti za delo »preveč« vnetih ljudi, marvec predvsem na proucevanju delovnega okolja in psiholoških delovnih okolisCin v podjetju. Poklicno izgorelost lahko prepreCimo tudi z znanstveno utemeljeno organiziranostjo podjetja ali ustanove; taksno, ki spodbuja formalne in neformalne komunikacijske okoliscine, pozitivne medsebojne in kolektivne odnose ter druge ugodne psihološke delovne okoliscine. Izobrazevanje za prepoznavanje in preprečevanje poklicne izgorelosti na eni strani ter izobrazevanje za spodbujanje zavzetosti za delo na drugi strani je posvečeno posameznikom, podjetjem, strokovni in široki javnosti.

  20. Application of multivariate statistical analysis and hydrochemical and isotopic investigations for evaluation of groundwater quality and its suitability for drinking and agriculture purposes: case of Oum Ali-Thelepte aquifer, central Tunisia.

    Science.gov (United States)

    Hassen, Imen; Hamzaoui-Azaza, Fadoua; Bouhlila, Rachida

    2016-03-01

    Groundwater plays a dominant role in arid regions; it is among the most available water resources in Tunisia. Located in northwestern Tunisia, Oum Ali-Thelepte is a deep Miocene sedimentary aquifer, where groundwater is the most important source of water supply. The aim of the study is to investigate the hydrochemical processes leading to mineralization and to assess water quality with respect to agriculture and drinking for a better management of groundwater resources. To achieve such objectives, water analysis was carried out on 16 groundwater samples collected during January-February 2014. Stable isotopes and 26 hydrochemical parameters were examined. The interpretation of these analytical data showed that the concentrations of major and trace elements were within the permissible level for human use. The distribution of mineral processes in this aquifer was identified using conventional classification techniques, suggesting that the water facies gradually changes from Ca-HCO3 to Mg-SO4 type and are controlled by water-rock interaction. These results were endorsed using multivariate statistical methods such as principal component analysis and cluster analysis. The sustainability of groundwater for drinking and irrigation was assessed based on the water quality index (WQI) and on Wilcox and Richards's diagrams. This aquifer has been classified as "excellent water" serving good irrigation in the area. As for the stable isotope, the measurements showed that groundwater samples lay between global meteoric water line (GMWL) and LMWL; hence, this arrangement signifies that the recharge of the Oum Ali-Thelepte aquifer is ensured by rainwater infiltration through mountains in the border of the aquifer without evaporation effects.

  1. Hz. Ali’nin Menkıbevî Hayatına Dair Bir Destan: Dâstân-ı Ejderhâ A Legend about the life of Ali: The Legend of Dragon

    Directory of Open Access Journals (Sweden)

    Ali KOZAN

    2013-07-01

    Full Text Available Following the conversion of Turks to Islam a new structure ofbelief and culture has appeared for them. They recall the individualsthey consubstantiated with Islam by heroic stories in verbal custom. Inthis praxis especially the son in law of Prophet Muhammed, first fourCaliphs and the friends of Prophet have become indispensable part ofthese legendary stories. In the legendary stories which our workincludes, the heroic, warrior and courageous side of Ali have shown asbeing a son in law of Prophet and father of Hasan and Hussein.Thistradition has written down by the works of Islamic Era of TurkishHistory. One of the “Cenknâmes” which Ali's braveness and courageoushas mention is “Destan-ı Ejderha”, The Legend Of Dragon. The legendhas written in the manner of "masnavi" and also it has some features oftale and legend genre.In this work namely “Destan-ı Ejderha” a dragon which Muslimscame to place of Prophet Muhammed in order to complain of it and awar which was fought between dragon and a group of “sahabe” underthe leadership of Ali by the assignment of Prophet Muhammed and thedefeat of dragon were mentioned. At the work Ali combines fantasticpowers in his heroic personality therefore withstands against dragonwhich was symbolized as an enemy of the religion and Ali has apersonality that is not avoid to struggle. In the legend Muslims wereaimed to encourage to “gaza” by underlining Ali’s face up of the death.Also it is aimed to obtain an idea that the true religion is Islam and alsoto make the ideal of gaza and jihad by the pointing the rebellious oneswill be eradicated in a pathetic way.In our work primarily we have compared the copies by collectedthe exemplars of “The Legend of Dragon” then tried to expose theoriginal text. Epic’s implications are discussed in Anatolia and theBalkans, later on an assessment is made about the value and place ofthe mentioned pamphlet in the history of Turkish Culture in Islamicperiod

  2. »Nočem biti odvisna«: Ali javne prevajalske in tolmaške storitve res negativno vplivajo na aktivno vključenost migrantov v državo gostiteljico?

    Directory of Open Access Journals (Sweden)

    Nike Kocijančič Pokorn

    2016-12-01

    Full Text Available Prispevek se sprašuje o upravičenosti določenih političnih ukrepov, ki odrekajo zagotavljanje prevajanja in tolmačenja migrantom, ter zagovarja nove pristope k jezikovni in prevodni politiki, in sicer prek raziskave, ki je bila zasnovana kot odziv na trditve, da prevajalske in tolmaške storitve ovirajo integracijo nedavnih priseljencev. Raziskava je bila izvedena na skupini prosilcev za mednarodno zaščito v azilnem domu v Ljubljani. Najprej smo zbrali podatke o jezikovnem ozadju vseh stanovalcev azilnega doma v avgustu 2014 (56 stanovalcev iz 19 različnih držav, nato pa sestavili reprezentativno skupino 18 prosilcev za mednarodno zaščito na podlagi njihovega maternega jezika in jih razdelili na dve skupini glede na čas bivanja v Sloveniji v času intervjuja (krajše ali daljše obdobje. Kvantitativne podatke o jezikovnih profilih smo zbrali z vprašalnikom, kvalitativne pa s pomočjo polstrukturiranih intervjujev, izvedenih v letu 2014, in dveh ponovitvenih intervjujev v letu 2015. Nato smo kvalitativno analizirali transkripcije vseh posnetih intervjujev, pri čemer smo se osredotočali na jezikovne in komunikacijske rešitve na različnih stopnjah migrantovega življenja v državi gostiteljici. Rezultati kažejo, da je osnovne kompromise mogoče doseči, saj so prevajalske in tolmaške storitve komplementarni koraki do neodvisnosti in kot take ne ovirajo učenja dominantnega oz. nacionalnega jezika države gostiteljice, temveč ga podpirajo.

  3. 27 August 2013 - Signature of an Agreement between KTO Karatay University in Turkey represented by the Dean of Engineering Professor Ali Okatan, CERN represented by Director for Research and Computing Dr Sergio Bertolucci and ALICE Collaboration represented by ALICE Collaboration Spokesperson Dr Paolo Giubellino.

    CERN Multimedia

    Maximilien Brice

    2013-01-01

    27 August 2013 - Signature of an Agreement between KTO Karatay University in Turkey represented by the Dean of Engineering Professor Ali Okatan, CERN represented by Director for Research and Computing Dr Sergio Bertolucci and ALICE Collaboration represented by ALICE Collaboration Spokesperson Dr Paolo Giubellino.

  4. Viagens, tremores e conchas: aspectos da natureza da América em escritos de José Bonifácio de Andrada e Silva, José Hipólito Unanúe e Dámaso Antonio Larrañaga

    Directory of Open Access Journals (Sweden)

    Maria Margaret Lopes

    Full Text Available Este artigo apresenta aspectos da produção científica de três ilustrados que atuaram na América do Sul: José Bonifácio de Andrada e Silva (1763-1838, José Hipólito Unanúe (1755-1833 e Dámaso Antonio Larrañaga (1771-1848. Os três naturalistas - de trajetórias, territórios e crenças diferenciadas - construíram suas versões sobre aspectos da natureza da América. Em comum, contribuíram com seus trabalhos científicos para a construção da geohistória americana. Foram escolhidos para análise por critérios de dispersão territorial e por suas diferentes abordagens sobre aspectos específicos das Ciências da Terra - temas que ainda hoje têm merecido menor atenção, mesmo entre os historiadores latino-americanos das ciências. Este artigo argumenta que estes personagens não só construíram seus próprios conhecimentos sobre temperamentos (climas e territórios, como também utilizaram seu conhecimento científico no implemento de ações políticas para os seus respectivos países em conformação.

  5. Bone marrow examination findings at Aga Khan University Hospital ...

    African Journals Online (AJOL)

    Nutritional anaemia as a group was the most common haematological disorder ... examination in our patients with megaloblastic anaemia predominating. ... indication for bone marrow examination was anaemia followed by diagnostic work up ...

  6. Pola Spasial Permukiman Tradisional Bali Aga di Desa Sekardadi, Kintamani

    Directory of Open Access Journals (Sweden)

    Ni Ketut Agusintadewi

    2017-03-01

    Full Text Available The Bayung Gede village has derived smaller traditional settlements around Kintamani. Sekardadi is one of these settlements that has an inherent consociates with the village of origin, or the Bayung Gede. Despite the fact that the Sekardadi has a uniqueness on spatial pattern and house lay out, this village has not been welldocumented as an old village in Bali. These uniqueness are interesting to be indepth explored. It is not only on the basic philosophy of the house pattern, but also how this pattern to be physical implemented. This study aims to describe some characteristics of the village, both physical and nonphysical aspects, through the way of descriptive exploratory qualitative approach. According to the theory housing pattern of Habraken (1978 and Turgut (2001, research variables are determined into three variables: 1 Cultural setting; 2 Behavioural setting; and 3 Spatial setting. The result shows that macro spatial pattern of the Sekardadi village is divided into three zones: 1 Utama Mandala locates in the north of the village; 2 Madya Mandala is in the middle of the village, and 3 Nista Mandala in the south. Spatial pattern follows the hulu-teben conception or linear pattern with the main road as a cardinal orientation. Higher land means a sacred area (parahyangan that is characterized by the existence of Pura Puseh. Meanwhile, the opposite is defined as a profane area (palemahan with the presence of graves; and in the middle is the settlement (pawongan. Keywords: spatial pattern; traditional settlement; Sekardadi village

  7. Elu on muinasjutuline, aga muinasjutt ei ole / Neeme Korv

    Index Scriptorium Estoniae

    Korv, Neeme, 1974-

    2005-01-01

    Koguperefilm "Lemony Snicket sari õnnetuid lugusid" ("Lemony Snicket's A Series of Unfortunate Events") : režissöör Brad Silberling : Ameerika Ühendriigid 2004. Lisatud kommentaarid kirjastaja Leelo Märjamaalt ja toimetaja Rein Põderilt

  8. Efektiivne, aga mitte väga innovatiivne / Villu Zirnask

    Index Scriptorium Estoniae

    Zirnask, Villu, 1966-

    2006-01-01

    World Economic Forumi (WEF) hinnangul kuulub Eesti nende üheksa riigi hulka, mis on teel efektiivsusel põhinevast arengustaadiumist innovatsioonil põhinevasse staadiumi. Eesti kohast WEF-i konkurentsivõime edetabelis. Lisad: Eesti innovatsiooninäitajad võrreldes Euroopa Liidu keskmise tasemega; Innovatsioon: Eesti 2014. aasta eesmärgid. Tabel

  9. Mazda6 - moodne, aga kisub riidu / Taivo Paju

    Index Scriptorium Estoniae

    Paju, Taivo, 1968-

    2003-01-01

    Suur osa Mazda6 edus on kindlasti reklaamiagentuuri Rapp Collins turunduskampaanial, leiab autor. Artikli aluseks on Rapp Collins Eesti tegevdirektori Anu Brümmeli ettekanne turunduskonverentsil Password 2003.

  10. Optimism kasvab, aga head ajad ei tule tagasi? / Stan Nahkor

    Index Scriptorium Estoniae

    Nahkor, Stan

    2011-01-01

    Heaoluühiskondadesse jõuab üha selgemini arusaamine, et eluiga pikeneb ja rahvastik vananeb, levib ka ebakindlus riiklike pensionide jätkusuutlikkuse suhtes. Seda ilmestab hoiuste mahu järjekindel kasv. Pankade probleemiks on peale vähenevate tulude ka suurenev valitsussektori sekkumine

  11. Hiilgav, aga... vol.2 / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Action" (1999), "Now and Again" (1999), "Firefly" (2002), "Freaks and Geeks" (1999), "Undeclared" (2001)

  12. Pension tõuseb - aga edasi? / Eiki Nestor

    Index Scriptorium Estoniae

    Nestor, Eiki, 1953-

    2008-01-01

    Pensionide uuest indekseerimise korrast. Ilmunud ka Nädaline 20. märts 2008, lk. 4 ; Valgamaalane 20. märts 2008, lk. 2 ; LõunaLeht 20. märts 2008, lk. 4 ; Põhjarannik 20. märts 2008, lk. 4 ; Võrumaa Teataja 25. märts 2008, lk. 2 ; Vali Uudised 26. märts 2008, lk. 2 ; Sõnumitooja 26. märts 2008, lk. 6 ; Meie Maa 25. märts 2008, lk. 2 ; Lääne Elu 25. märts 2008, lk. 2 ; Kuulutaja 28. märts 2008, lk. 4 ; Türi Rahvaleht 28. märts 2008, lk. 4 ; Oma Saar 28. märts 2008, lk. 5 ; Vooremaa 22. märts 2008, lk. 2 ; Pärnu Postimees 27. märts 2008, lk. 15 ; Narva Postiljon 5. aprill 2008, lk. 2 ; Videvik 3. aprill 2008, lk. 2 ; Virumaa Teataja 8. aprill 2008, lk. 11 ; Nädalaleht 20. märts 2008, lk. 5

  13. Kõik, millest on raske loobuda (aga peab) / Mark Earls

    Index Scriptorium Estoniae

    Earls, Mark

    2003-01-01

    Katkend raamatust "Welcome to creative age. Bananas, Business and Death of Marketing", milles autor seab kahtluse alla mitmed turundusega seotud käibetõed, kutsub üles neist loobuma ja võtma suuna loovusele. Vt. ka: Sissejuhatuse asemel

  14. Õõvafilm on fun, aga mitte ainult / Tiina Lokk

    Index Scriptorium Estoniae

    Lokk, Tiina, 1955-

    2006-01-01

    PÖFF-i abiga toimub Haapsalus õudusfilmide festival. Selle sissejuhatuseks annab T. Lokk pikema sissevaate õudusfilmi kui žanri kujunemisse ja väärtustesse. Lisatud festivalil näidatavate filmide nimekiri

  15. Le diagnostic anténatal de la trisomie 21 par l'hybridation in situ en fluorescence (FISH): à propos des premiers tests réalisés au Maroc

    Science.gov (United States)

    Lamzouri, Afaf; Natiq, Abdelhafid; Tajir, Mariam; Sendid, Mohamed; Sefiani, Abdelaziz

    2012-01-01

    Introduction Le but de cette étude était de présenter les premiers résultats de diagnostic anténatal de la trisomie 21 par la technique d'hybridation in situ en fluorescence (FISH) au Maroc et discuter son intérêt dans le diagnostic rapide de cette aneuploïdie. Méthodes Ce travail a été réalisé chez 23 femmes avec des grossesses à haut risque de trisomie 21. La moyenne d’âge des gestantes étaient de 37,43 ans avec des extrêmes de 21 et 43 ans. Toutes étaient musulmanes mariées, mariage légitimé par la Charia, dont trois mariages consanguins, sauf une originaire de la République Démocratique du Congo qui était chrétienne et concubine. La majorité des femmes étaient fonctionnaires et avaient un niveau de scolarisation moyen à élevé. Toutes les patientes ont bénéficié d'une consultation de génétique médicale au cours de laquelle il leur a été donné des informations sur la technique, son intérêt et ses limites. Il s'agit de femmes enceintes qui avaient soit un âge maternel élevé ou des signes d'appel échographiques et/ ou biochimiques. Une des patientes était porteuse d'une translocation robertsonienne t(14;21) équilibrée. Une amniocentèse a été réalisée chez toutes les gestantes et aucun avortement n'a était induit par ce geste invasif. L’âge gestationnel moyen à la première consultation était de 14 semaines d'aménorrhée (SA) et à l'amniocentèse était de 16 SA et 5 jours. L'analyse FISH a été réalisée, après consentement des couples, sur des cellules non cultivées à partir des échantillons de liquides amniotiques, en utilisant des sondes spécifiques du chromosome 21. Résultats Parmi les 23 patientes qui ont bénéficiées d'un diagnostic anténatal de la trisomie 21 par la technique FISH, nous avons pu rassurer 21 d'entre elles, et nous avons détecté deux cas de trisomie 21 fœtal. Conclusion La technique FISH permet un diagnostic anténatal rapide, en moins de 48h, de la trisomie 21 sur

  16. Dervîş Muhammed Şifâyî'nin Şerh-i Şebistân-i Hayâl'indeki Muammâ Çözüm Yöntemleri Üzerine Bir İnceleme / An Investigation on Dilemma Resolution Methods in the Sharh Shabistan Khayal of Darwish Muhammad Shifayi

    Directory of Open Access Journals (Sweden)

    Mehmet Özdemir

    2017-04-01

    Full Text Available Abstract Darwish Muhammad Shifayi was born in early seventeenth century, and has been known as the commentator on Masnawi with his commentary on the first two volumes of the Rumi’s Masnawi. This famous commentator also had other works like Hadiyyet al-Fukara in which he translated Esma al-Hüsnâ, which was originally Persian and was translated into Turkish by him; Hadiyye-i Rahmat in which he wrote about Islam, mysticism and religious cults; and Sharh Shabistan Khayal in which he commented on the work of Fattah al-Nishabûrî called Shabistan Khayal. A critical text study was conducted on the first volume of his work with the name Sharh-i Masnawi and the critical text study is being conducted at present time about the second volume of this work and about Hadiyyat al-Fukarâ. There are no studies on Sharh Shabistan Khayal and on Hadiyye-i Rahmat, which is currently not available in Turkey. In this study, the work called Sharh Shabistan Khayal located in Süleymaniye Library Serez 2656 number will be introduced, the purpose of the commentator will be explained, and the commentary method will be dealt with. In Shabistan Khayal, which was originally written in Persian, issues on religion and life were handled with the dilemma style by using letter and word games. For this reason, when determining the commentary method of such a text, the translation and commentary of Persian expressions and the solution ways of the dilemmas must be considered. Based on this context, when explaining the commentary method of the commentator, the translation and commentary of the Persian text will be dealt with firstly; and the dilemma resolution methods such as amel-i tahsîlî, amel-i tekmîlî, amel-i teshîlî, amel-i tezyîlî will be dealt with in the second section under the title of “Art”.  Öz On yedinci yüzyılın başında dünyaya gelen Dervîş Muhammed Şifâyî, Mevlânâ’nın Mesnevî’sinin ilk iki cildine yaptığı şerhle Mesnevî

  17. Five-year outcome of a stroke cohort in Martinique, French West Indies: Etude Réalisée en Martinique et Centrée sur l'Incidence des Accidents vasculaires cérebraux, Part 2.

    Science.gov (United States)

    Chausson, Nicolas; Olindo, Stéphane; Cabre, Philippe; Saint-Vil, Martine; Smadja, Didier

    2010-04-01

    Limited information exists on stroke among black populations outside the United States and United Kingdom. Part 1 of the Etude Réalisée en Martinique et Centrée sur l'Incidence des Accidents vasculaires cérebraux (ERMANCIA) provided strong epidemiologic data on the incidence of first-ever stroke in a black Caribbean population and showed a 40% greater incidence of stroke in Martinique than in continental France. In ERMANCIA part 2, we evaluated the long-term outcomes of our cohort. Survivors of a first stroke from this prospective, community-based, stroke incidence study were reassessed at 5 years according to standardized procedures and criteria, including the modified Rankin scale, Barthel Index, Montgomery-Asberg Depression-Rating Scale, Mini-Mental State Examination, treatment compliance, and blood pressure control. Of the 293 survivors of the original 580 (50.5%) patients who were still alive 5 years after stroke, 262 (89.4%) were assessed. Among these survivors, 66.4% were functionally independent and 43% were completely autonomous for activities of daily living, but 25.8% were depressed and 58.9% were cognitively impaired. Only 50 of 170 (29.4%) of the hypertensive patients achieved their target blood pressure. These results highlight the very poor blood pressure control and the very high rate of cognitive impairment in Martinican patients after stroke. As a consequence, a poststroke prevention network was established in Martinique.

  18. Hydrothermal synthesis, structures and optical properties of A2Zn3(SeO3)4·XH2O (A=Li, Na, K; X=2 or 0)

    Science.gov (United States)

    Liu, Yunsheng; Mei, Dajiang; Xu, Jingli; Wu, Yuandong

    2015-12-01

    New alkali metal zinc selenites, A2Zn3(SeO3)4·XH2O (A=Li, Na, K; X=2 or 0) were prepared through hydrothermal reactions. Li2Zn3(SeO3)4·2H2O (1) crystallizes in the monoclinic space group P21/c with lattice parameters a=8.123(4), b=9.139(4), c=7.938(3) Å, β=112.838(9)°. Na2Zn3(SeO3)4·2H2O (2) crystallizes in the monoclinic space group C2/c with lattice parameters a=15.7940(18), b=6.5744(8), c=14.6787(17) Å, β=107.396(3)°. K2Zn3(SeO3)4 (3) crystallizes in the monoclinic space group C2/c with lattice parameters a=11.3584(12), b=8.6091(9), c=13.6816(14) Å, β=93.456(2)°. The anionic structures are composed of [Zn3O12]18- sheets, chains, and "isolated" units in compound 1, 2, 3, respectively, and trigonal pyramids SeO32-. The compounds were characterized by the solid state UV-vis-NIR diffuse reflectance spectroscopy, infrared spectra and thermogravimetric analysis.

  19. Browse Title Index

    African Journals Online (AJOL)

    Items 101 - 117 of 117 ... FO Olatunji, UF Ibrahim, N Muhammad, AA Msheliza, BB Akku, UY Ibrahim, BT Rano, M Maigoro, MU Ali. Vol 25, No 2 (2011), The use of Anti-Retroviral drugs in the Prevention of Mother to Child Transmission (PMTCT) of HIV, Abstract. KP Manji, MP Manji, FG Sheriff. Vol 25, No 1 (2011), The vital role ...

  20. 15-00115_SI_NP.doc

    Indian Academy of Sciences (India)

    SAID TIGHADOUINI1, SMAAIL RADI*,1, LOIC TOUPET2, MUHAMMAD SIRAJUDDIN*,3, TAIBI BEN HADDA*,4, MEHMET AKKURT5, ISMAIL WARAD6, YAHIA MABKHOT7 and SAQIB ALI8. 1LCAE, Département de Chimie, Faculté des Sciences, Université Mohammed Premier, Oujda 60000, Morocco. 2Institut de Physique ...

  1. ANALISIS KINERJA KEUANGAN PERUSAHAAN PT. ASURANSI JIWASRAYA (PERSERO) CABANG SULAWESI SELATAN

    OpenAIRE

    ARIANTY, ASTRI

    2012-01-01

    ANALISIS KINERJA KEUANGAN PERUSAHAAN PT. ASURANSI JIWASRAYA (PERSERO) CABANG SULAWESI SELATAN COMPANY FINANCIAL PERFORMANCE ANALYSIS PT. INSURANCE JIWASRAYA (LIMITED) SOUTH BRANCH SULAWESI Astri Arianty Prof. Dr. H. Muhammad Ali, SE., M.S Drs. Armayah Sida, M.Si Analisis terhadap kinerja keuangan perusahaan sangat penting dilakukan untuk mengetahui sejauh mana tingkat pencapaian yang telah diperoleh perusahaan sebagaimana tujuan perusahaan dalam menjalankan proses produk...

  2. Tropical Journal of Pharmaceutical Research - Vol 15, No 7 (2016)

    African Journals Online (AJOL)

    Antibacterial and cytotoxic properties of isoprenoids from the red sea soft coral, Lobophytum sp · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Khalid O Al-Footy, Walied M Alarif, Muhammad S Zubair, Mohamed A Ghandourah, Magda M Aly, 1431-1438.

  3. Browse Title Index

    African Journals Online (AJOL)

    Items 901 - 950 of 1250 ... ... No 2 (2016), Physio-chemical evaluation and biological activity of Ajuga bracteosa wall and Viola odoroto Linn, Abstract PDF. Anwar Ali Shad, M. Zeeshan, Hina Fazal, Hamid Ullah Shah, Shabir Ahmed, Hasem Abeer, E. F. Abd_Allah, Riaz Ullah, Hamid Afridi, Akash tariq, Muhammad Adnan Asma.

  4. Physio-chemical evaluation and biological activity of Ajuga ...

    African Journals Online (AJOL)

    Physio-chemical evaluation and biological activity of Ajuga bracteosa wall and Viola odoroto Linn. Anwar Ali Shad, M. Zeeshan, Hina Fazal, Hamid Ullah Shah, Shabir Ahmed, Hasem Abeer, E. F. Abd_Allah, Riaz Ullah, Hamid Afridi, Akash tariq, Muhammad Adnan Asma ...

  5. Electronic properties and structural phase transition in A4 [M4O4] (A=Li, Na, K and Rb; M=Ag and Cu): A first principles study

    Science.gov (United States)

    Umamaheswari, R.; Yogeswari, M.; Kalpana, G.

    2013-02-01

    Self-consistent scalar relativistic band structure calculations for AMO (A=Li, Na, K and Rb; M=Ag and Cu) compounds have been performed using the tight-binding linear muffin-tin orbital (TB-LMTO) method within the local density approximation (LDA). At ambient conditions, these compounds are found to crystallize in tetragonal KAgO-type structure with two different space group I-4m2 and I4/mmm. Nowadays, hypothetical structures are being considered to look for new functional materials. AMO compounds have stoichiometry similar to eight-electron half-Heusler materials of type I-I-VI which crystallizes in cubic (C1b) MgAgAs-type structure with space group F-43m. For all these compounds, by interchanging the positions of atoms in the hypothetical cubic structure, three phases (α, β and γ) are formed. The energy-volume relation for these compounds in tetragonal KAgO-type structure and cubic α, β and γ phases of related structure have been obtained. Under ambient conditions these compounds are more stable in tetragonal KAgO-type (I4/mmm) structure. The total energies calculated within the atomic sphere approximation (ASA) were used to determine the ground state properties such as equilibrium lattice parameters, c/a ratio, bulk modulus, cohesive energy and are compared with the available experimental results. The results of the electronic band structure calculations at ambient condition show that LiCuO and NaMO are indirect band gap semiconductors whereas KMO and RbMO are direct band gap semiconductors. At high pressure the band gap decreases and the phenomenon of band overlap metallization occur. Also these compounds undergo structural phase transition from tetragonal I-4m2 phase to cubic α-phase and transition pressures were calculated.

  6. 2526-IJBCS-Article-Mahamat Seid Ali

    African Journals Online (AJOL)

    hp

    of the world population, which is a real public health problem. The purpose of this scientific work is to ..... Chem. Sci. 9(5): 2719-2734, 2015. 2727. Figure 9 : Variation du taux de diminution en iode durant le suivi avec les emballages au Marché – ..... Ministère de la Santé (Maroc). 2001. Les carences en micronutriments / ...

  7. 1459-IJBCS-Article-Ben Moussa Ali

    African Journals Online (AJOL)

    hp

    L'Oued Khoumane est un cours d'eau traversant du sud-est à l'ouest la ville de Moulay Idriss Zerhoun. L'intérêt porté à ce .... Oxygène, Demande Biologique en Oxygène et les matières en ..... agriculture et au fumier (Dumontier et al.,. 1995).

  8. 1859-IJBCS-Article-Aly Diallo

    African Journals Online (AJOL)

    hp

    Cette étude se propose de déterminer la composition floristique et la structure des peuplements ligneux ... climatique et des actions anthropiques ... Le climat est du type soudano-sahélien ..... du taux global de régénération dans les trois sites.

  9. Siserände rahvuserinevused / Alis Tammur

    Index Scriptorium Estoniae

    Tammur, Alis

    2003-01-01

    Uuringu tulemustest selgus, et eestlaste rändeaktiivsus oli 1990. aastatel oluliselt suurem kui mitte-eestlastel. Kui eestlaste rändes valitses linnastumine, siis mitte-eestlaste vastulinnastumine on uus protsess ja näitab, et nende asustusala on Eestis laienemas. Tabelid. Diagramm. Kaardid

  10. 2582-IJBCS-Article-Mahamat Seid Ali

    African Journals Online (AJOL)

    hp

    55% laquelle, dans 100 kg de matière sèche retient 55 kg de saccharose et 45 kg de matières organiques et non organiques. ... l'alcool éthylique, de levure et de l'acide citrique utilisé dans les ..... Tableau 1 : Effet de la durée de la réaction de 90 mn sur les caractéristiques des solutions de mélasses. Echantillons.

  11. 1902-IJBCS-Article-Ali Garane

    African Journals Online (AJOL)

    hp

    Département de Production Végétale, 01 BP 470 Ouagadougou 01, Burkina Faso. 3 Department of Plant Science, Institute for Agricultural ... Burkina Faso kitchen. For Karnataka (2008), okra is from the most useful ... grown in randomized blocks design with three replications at experimental field of the. University of ...

  12. 1229-IJBCS-Article-Aly Savadogo

    African Journals Online (AJOL)

    DR GATSING

    l'utilisation des starters de microorganismes performants qui assureront leurs qualités ... développement, la majeure partie du lait issue de l'élevage est transformée par de petites unités et les .... incluant leurs principaux métabolites,.

  13. 2421-IJBCS-Article-Ali Doumma

    African Journals Online (AJOL)

    hp

    macrophylla et Prosopis juliflora (Figure 1). Méthodologie. Moyennant une approche participative, il a été question d'identifier les connaissances locales en matière de production de patate douce. Pour cela, des entretiens avec les informateurs clés (organisations paysannes,. ONGs et les services techniques) et des.

  14. Ene Käpp ali optimizem

    Directory of Open Access Journals (Sweden)

    Dušana Findeisen

    1998-12-01

    Full Text Available Na »Konferenci o vlogi in organizaciji izobraževanja odraslih v času prehoda«, ki je bila novembra lani v Tallinnu, glavnem mestu Estonije, smo srečevali nekaj razsvetljenih obrazov organizatorjev. Med njimi je bila Ene Kapp, kratko pristriženih las, živahnega videza in prodornega glasu. Ene Kapp je neprestano bedela nad nami. Tisti, ki so povezani z estonskim izobraževanjem odraslih, jo poznajo že dolgo. Srečujejo se z njo na ANDRAS-u, estonskem združenju za izobraževanje odraslih.

  15. ALI Conservation Scorecards Input Data Layers

    Data.gov (United States)

    Department of the Interior — In 2014 and 2015, the Arid Lands Initiative developed “Conservation Scorecards” for their Priority Core Areas (PCAs) and Priority Linkage Areas (PLAs). To create...

  16. Intraspecific variation in adult Uvitellina iraquensis Dronen, Ali & Al-Amura, 2013 (Cyclocoelidae: Haematotrephinae) from two collection sites of white-tailed lapwing, Vanellus leucurus (Lichtenstein) (Charadriiformes: Charadriidae), in Iraq.

    Science.gov (United States)

    Dronen, Norman O; Al-Kassar, Nothiala R; Ali, Atheer H; Abdulhameed, Mohanad F; Abdullah, Basim H; Al-Mayah, Sabeeh H

    2017-03-09

    A total of 19 white-tailed lapwing, Vanellus leucurus, were collected from Huwazah Marsh, north-eastern Basrah Province, Iraq from February to March and in October, 2011 (collection site #1) and 60 V. leucurus were collected from Al-Hammar Marshes, Thi-Qar Province, southern Iraq from July to November, 2012 (collection site #2), and examined for cyclocoelids. Nineteen Uvitellina iraquensis Dronen, Ali & Al-Amura, 2013 from site #1 and 17 specimens from site #2 were fixed with minimal compression for comparisons of morphological characteristics, measurements, morphometric percentages and morphometric ratios commonly used to distinguish species of cyclocoelids. An additional five adult specimens from site #1 were fixed without compression for comparisons. Specimens from site # 1 (n=24) represented only fully-developed, non-senescing adults, while those from site #2 (n=17) could be divided into fully-developed (non-senescing) adults (n=8); younger (smaller, less developed) adults (n=5) and senescing adults (n=4). The following characteristics were relatively consistent, and appeared to be valuable in identifying groups of similar species and distinguishing species in Uvitellina: the presence or absence of the oral sucker; the oral sucker/pharynx width ratio; the posterior extent of the cirrus sac relative to the intestinal bifurcation; the position of the genital pore relative to the pharynx; the position of the testes in the body; the length of the intertesticular space; the length of the posttesticular space; the lateral disposition of the uterine loops; the presence of a posteriorly-directed, tail-like extension off the posterior confluence of the vitelline fields; the posterior extent of the uterine loops relative to the gonads; and the size of fully-developed eggs. It may be beneficial to calculate the percentage that measurements represent relative to the body length to provide insight into the relationship of the size of a structure to increased size of the

  17. Taking Jihad Out of the Hands of Infidels

    Science.gov (United States)

    2007-06-01

    both Mecca and Medina from the Turks. In taking Mecca, the Wahhabis demonstrated their religious ferocity by destroying the tomb of Muhammad...did not sit well with the Turkish sultan. He tasked Mehmed Ali, the Egyptian Sultan, “to recover the holy cities.”73 On their third attempt, the...notable contributor to this transformation was an Egyptian named Sayyed Qutb, whose book, Milestones, was published in 1964. Qutb developed and

  18. Winning the Strategic Narrative in the Israeli-Palestinian Protracted Conflict

    Science.gov (United States)

    2012-12-01

    Introduction to Islamic Theology and Law (Princeton, NJ: Princeton University Press, 1981), Translated from the German, Vorlesungen uber den Islam...University Press, 1981), Translated from the German, Vorlesungen uber den Islam (Heidelberg, 1910), 3–30; Maulana Muhammad Ali, The Holy Qur’an (Dublin...Nabi, “Exporing the Framing Effects of Emotion: Do Discrete Emotions Differentially Influence Information Accessibility, Information Seeking, and Policy

  19. Syed Mahmood Naqvi (27 August 1941 - 04 September 2009)

    Digital Repository Service at National Institute of Oceanography (India)

    Naqvi, S.W.A.; Rao, Y.J.B.

    -1 SYED MAHMOOD NAQVI (1941-2009) Elected Fellow 1986 LIFE, EDUCATION AND FAMILY Being a descendent of Prophet Muhammad's daughter Syeda (hence the title 'Syed') through the 10 lh Shia Imam Ali Naqi (hence the surname 'Naqvi'). Mahmood's roots into science... living, something that he was not used to. He was only moderately educated. However, both he and his father wanted Bhni to obtain ...

  20. RADIKALISME ATAS NAMA AGAMA: Tafsir Historis Kepemimpinan Nabi Muhammad di Madinah

    Directory of Open Access Journals (Sweden)

    Inayatul Ulya

    2016-02-01

    Full Text Available Lately the radicalism on behalf religion has been exposed more often through the media in the form of terror, bombing, some violent actions and a variety of other religion crime packaged. Religion is regarded to become a precise media as the reason for the emergence of terrorism. Religion in this matter is too sensitive for pitting on behalf of political expediency. The consequence of the radicalism movement in the name of religion can be bad record because religion should has been called for in peace. The emergence of issues and phenomena of Islamic radicalism become the transnational discourse which cornering the Islam and became a new challenge for Muslims to answer it. Islamic radicalism became a historical phenomenon and also sociological becomes a much talked in the political discourse and global civilization. The consequence of the discourse is then popped the stigma that felt less comfortable for Muslims. For example: the stigma about the Islamic radical movement, the Islamic hardliners, fundamentalism, militants, extremists, right Islam, to terrorism.

  1. 121_Ishaq et al.,_Muhammad Abdullahi Wase_SPATIAL AND ...

    African Journals Online (AJOL)

    user pc

    2017-12-02

    Dec 2, 2017 ... and adolescents in developing countries as a result of poor sanitation ... characterized by low river levels (Alajeely, et al., .... 99% confidence were generally observed in areas .... Malaysian Journal of Microbiology, 3(2): 19-.

  2. BKR 27(2) pp. 68-75 (Muhammad et al)

    African Journals Online (AJOL)

    Femi J. Olorunniji

    2015-06-30

    Jun 30, 2015 ... 2Department of Animal Science, University of Maiduguri. P.M.B. 1056, Borno State, ..... Parasitic and Infectious Diseases, Proceeding of American. Animals Hospital Association, South Bend, IN. Anon (1980). Guide to the care ...

  3. The Shadow of Muhammad: Developing a Charismatic Leadership Model for the Islamic World

    Science.gov (United States)

    2002-06-01

    leadership and specific “type” of leader in the Islamic world. It is a work of synthesis in which a theory about one form of successful Islamic...DEVELOPING A CHARISMATIC LEADERSHIP MODEL FOR THE ISLAMIC WORLD by Edward W. Kostrzebski June 2002 Thesis Advisor: Anna Simons...Suite 1204, Arlington, VA 22202-4302, and to the Office of Management and Budget, Paperwork Reduction Project (0704-0188) Washington DC 20503. 1

  4. PEMIKIRAN SYED MUHAMMAD NAQUIB AL-ATTAS TENTANG ISLAMISASI BAHASA SEBAGAI LANGKAH AWAL ISLAMISASI SAINS

    Directory of Open Access Journals (Sweden)

    A. Khudori Soleh

    2011-10-01

    Full Text Available Naguib’s Islamization of science is a response to negative impacts of modern science progress (the West which according to him is not based on Islamic world view. This has an impact on epistemological aspects, so that it can not be used as a method of scientific development in Islamic science. Therefore, there should be reformation of ontology and epistemology to get harmony and usefullness for the development of Islamic sciences. According to Naguib, world view of Islam is monotheism, unity, integration between psyche and physical, spiritual and material, even the spiritual aspect is more important. Based on this, the source of knowledge is not just the material of objects but the meaning of the object, so that knowledge does not fall on positivistic, materialistic and empiric. The method of achieving knowledge is done through the power of observation, rational thought, interpretations of revelation and intuition. The methods are not contradictory but complementary. As the first step of Islamization of science, which change the aspect of metaphysics (world view and epistemology, according to Naguib, can be started by Islamization of language

  5. RELEVANSI STRATEGI DAKWAH HIZBUT TAHRIR INDONESIA DENGAN STRATEGI DAKWAH NABI MUHAMMAD SAW

    OpenAIRE

    Khoerunnisa, Eunis

    2017-01-01

    Hizbut Tahrir Indonesia is a unique and phenomenal propaganda institution. For one decade (1998-2008) it has exercised a very intensive preaching, conception of Islam, enforcement of Syari’ah and the Khilafah ruling system. The purpose of this study is to determine the Hizbut Tahrir Indonesia thinking about: (1) the arguments used by Hizbut Tahrir Indonesia in preaching; (2) the purpose of the preaching of Hizbut Tahrir Indonesia; (3) the method used in the propaganda activities of Hizbut Tah...

  6. Memahami Maslahat Menggunakan Pendekatan Filsafat Utilitarianisme Menurut Muhammad Abû Zahrah

    Directory of Open Access Journals (Sweden)

    Abdul Basith Junaidy

    2014-03-01

    Full Text Available This paper seeks to describe the efforts of Abû Zahrah in making the philosophy of utilitarianism as a means of understanding the concept of maslahah mursalah in legal reasoning. In Zahrah’s view, the principle of utilitarianism can be taken into account as a guide to understand and apply the concept of maslahah. Zahrah goes on to argue that maslahah can be applied quantitatively using the hedonic calculus as a tool of measurement. Zahrah defines maslahah as an action that is valued as having the greatest benefit for the majority of people in the long term. In his opinion, there are seven factors that determine the level of satisfaction and pain resulted from an action, namely intensity, duration, certainty, propinquity, fecundity, purity, and extent. The calculation will produce positive balance if the credit (satisfaction is much greater than the debt (pain. This calculus, according to Zahrah, can be applied to measure the benefit and loss in the discourses of maslahah mursalah.

  7. Jihâd dalam Pandangan Muhammad ‘Abd al-Salâm Faraj

    Directory of Open Access Journals (Sweden)

    Abdul Muis Naharong

    2014-01-01

    Full Text Available Jihâd is one of the Islamic teachings which has been extensively discussed since the last few decades due to the increasing acts of violence perpetrated by some Muslims. This article tries to join this discussion by presenting Muh ammad ‘Abd al-Salâm Faraj’s concept of jihâd and his ideas of Islamic state and Caliphate by referring to his al-Farîd ah al-Ghâ’ibah (the Neglected Duty. We argue that Faraj’s basic perception of the Egyptian politics and society at the time shaped his whole concept of state and Caliphate. We hence contend that his proposal of jihâd is born out of his disappointment of the Egyptian government and even society as far as applying Islamic law is concerned. He uncompromisingly believed that the government and society are hypocrite and apostate for distancing themselves from the divine law of God. This belief prompted four members of Jihâd Organization to which Faraj belongs, to assassinate President Sadat in October 1981. By jihad, Faraj means fighting and confrontation against enemies even through bloodshed. And by enemies he means anyone who is not willing to apply God’s law on earth. The most controversial idea that Faraj has tried to pose is that jihâd is considered to the sixth pillar of Islam, which has to be carried out by each and every member of Muslim ummah.

  8. Évaluation de la réussite de l'ouvrage de protection de berges de la Romanche au barrage de Livet, réalisé à l'aide de techniques de génie végétal

    Directory of Open Access Journals (Sweden)

    DELAGE, Camille

    2017-05-01

    Full Text Available À l’interface entre les écosystèmes aquatiques et terrestres, le génie végétal sur les berges de cours d’eau s’inspire et utilise les capacités naturelles des végétaux comme matériel de base à la reconstruction de berges. Cette alternative au génie civil, confère aux écosystèmes une meilleure capacité de retour vers des systèmes plus naturels et surtout plus diversifiés. Toutefois, la restauration écologique et particulièrement les techniques de génie végétal souffrent de l’absence généralisée d’évaluation du succès et de retours d’expérience sur le développement des espèces et la tenue des différentes techniques. Cet article présente la démarche adoptée ainsi que les principaux résultats du suivi du réaménagement des berges de la Romanche au barrage de Livet, réalisé avec des techniques mixtes associant enrochements et différentes techniques de génie végétal.

  9. Inimese papilloomiviiruse vastane vaktsiin imet ei tee, aga kaitseb siiski / Marika Kusnets

    Index Scriptorium Estoniae

    Kusnets, Marika

    2006-01-01

    5. oktoobril korraldas ravimifirma Merck Sharp & Dohme koostöös erialaarstide, Eesti Vähiliidu ja Quattromediga ajakirjanikele ümarlaua, kus räägiti emakakaelavähi põhjustest ja ravist, HPV tüüpidest, nakatumis- ja kaitsemehhanismidest ning uuest Eesti turule jõudvast vaktsiinist

  10. "Berlinale 2008" - küll jahe, aga lahe! / Annika Koppel

    Index Scriptorium Estoniae

    Koppel, Annika

    2008-01-01

    Berliini 58. filmifestivali auhinnasaajatest : Kuldkaru võitis Brasiilia produtsendi ja režissööri Jose Padilha mängufilm "Eliitrühm", Hõbekaru USA režissööri Errol Morrise dokfilm "Tavaprotseduur". Parima režissööri Hõbekaru läks Paul Thomas Andersonile mängufilmi "Veri hakkab voolama" eest. Parima näitleja auhinna said Sally Hawkins ja Reza Naji, Alfred Baueri auhinna sai Fernando Eimbcke "Tahoe järv"

  11. Siin on kõik mustrid - aga kuidas lugeda ? / Andres Noormets

    Index Scriptorium Estoniae

    Noormets, Andres, 1963-

    2007-01-01

    Loomingulise kollektiivi Interaktiivne Üksus (int.act.union) tantsulavastusest "Algorytm", autorid Taavet Jansen, Päär Pärenson, Maike Lond, Kalle Tikas ja Andreas W. Esietendus Kanuti Gildi saalis 20. veebr

  12. Mina olin tubli, aga teised keerasid s***a kokku / Maarius Suviste

    Index Scriptorium Estoniae

    Suviste, Maarius, 1966-

    2007-01-01

    SL Õhtuleht uuris riigikogu X koosseisu parlamendiliikmetelt töö käigus tehtud vigade kohta. Parlamendiliikmete vastustest. Lisad: Nemad ei vastanud; Suurimad popipanijad; Suurimad välismaal reisijad; Suurimad Eestis reisijad; Suurimad rääkijad; Suurimad vaikijad; Haiged rahvasaadikud

  13. Kõik on nii nagu enne, aga miski pole enam endine / Martin Rünk

    Index Scriptorium Estoniae

    Rünk, Martin

    2010-01-01

    Anders Härmi kuraatoriprojekt "Next to Nothing" ("Eimillestki edasi") Eesti Kaasaegse Kunsti Muuseumis 22. augustini 2010. Pikemalt Martin Creedi (Suurbritannia), Laura Tootsi, Triin Tamme, Dénes Farkasi, Neeme Külma ja Kaido Ole töödest

  14. Räägime siis rahust... Aga kellega? / Sten A. Hankewitz

    Index Scriptorium Estoniae

    Hankewitz, Sten A., 1979-

    2006-01-01

    Palestiinlaste välisminister Mahmoud al-Zahar unistab maailmakaardist, kus pole Iisraeli riiki. Et Iisraelil pole partnerit, kellega läbi rääkida, plaanib Iisraeli peaministri kohusetäitja Ehud Olmert piirid ühepoolselt paika panna. Lisa: Iisrael vahistas Hamasi ministri

  15. The rare codon AGA is involved in regulation of pyoluteorin biosynthesis in Pseudomonas protegens Pf-5

    Science.gov (United States)

    The soil bacterium Pseudomonas protegens Pf-5 can colonize root and seed surfaces of many plants, protecting them from infection by plant pathogenic fungi and oomycetes. This capacity to suppress disease is attributed in part to Pf-5’s production of a large spectrum of antibiotics, which is controll...

  16. Filmiarhiivid karjuvad, aga seda kuulevad vähesed / Ivi Tomingas ; interv. Tarmo Teder

    Index Scriptorium Estoniae

    Tomingas, Ivi

    2008-01-01

    Vestlusringis, mille teemadeks on filmide digiteerimine, restaureerimine, arhiveerimine, säilitamine ja demonstreerimine, arutlevad Eesti Filmiarhiivi direktor I. Tomingas, Eesti Rahvusringhäälingu filmiarhiivi vastutav toimetaja K. Kanter, "Eesti film 100" projektijuht A. Koppel, ERR arendusjuht H. Männik, Balti Filmi- ja Meediakooli arendusjuht M. Aadamsoo, filmimees E. Säde ja filmiajakirjanik J. Lõhmus

  17. Vana ja tuttav, aga liiga turvaline / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Steven Spielbergi neljas Indiana Jones'i film Harrison Fordiga nimiosas "Indiana Jones ja kristallpealuu kuningriik" ("Indiana Jones and the Kingdom of the Crystal Skull") : Ameerika Ühendriigid 2008

  18. Väikefirma börsile? Aga palun! / Kaidi Oone

    Index Scriptorium Estoniae

    Oone, Kaidi

    2006-01-01

    Börsi poolt loodavatest võimalustest noortele ja väikestele ettevõtetele kapitali hankimiseks ja börsil tegutsemiseks. Väärtpaberibörsi, vabaturu ja alternatiivturu tutvustus. Lisad: Mida börsil olemine firmale annab?, Vaba- ja alternatiivturud mujal maailmas. Võrdlus: väärtpaberibörs, vabaturg ja alternatiivturg

  19. Andrzej Wajda : maailm küll teadis, aga ei hoolinud / Eda Post

    Index Scriptorium Estoniae

    Post, Eda, 1983-

    2008-01-01

    Poola filmi- ja teatrilavastaja Andrzej Wajda, kes pälvis sel aastal president Toomas Hendrik Ilveselt Maarjamaa Risti III klassi teenetemärgi. Tema viimasest mängufilmist "Katõn". Lisatud andmed elu ja töö kohta. Ordenit vastu võtma A. Wajda ei tule, sest 24. veebruaril 2008 läheb ta Los Angeleses Oscarite galale, kus tema film "Katõn" on parima võõrkeelse filmi auhinna nominent

  20. Seadusandja peab mõtlema nagu filosoof, aga kirjutama nagu talupoeg / Heiki Raudla

    Index Scriptorium Estoniae

    Raudla, Heiki, 1949-

    2001-01-01

    Ilmunud ka: Põhjarannik : Laupäev, 24. nov. 2001, lk. 2; Severnoje Poberezhje: Subbota, 24. nov. 2001, lk. 2; Meie Maa, 24. nov. 2001, lk. 2; Pärnu Postimees, 24. nov. 2001, lk. 2; Võrumaa Teataja, 24. nov. 2001, lk. 2; Hiiu Leht, 27. nov. 2001, lk. 2; Lääne Elu, 27. nov. 2001, lk. 4; Nädaline, 27. nov. 2001, lk. 4; Vooremaa, 27. nov. 2001, lk. 2; Koit, 27. nov. 2001, lk. 6. Kodanikuühiskond saab tõelise arenguvõimaluse alles siis, kui kodanikud osalevad demokraatlikus juhtimises

  1. Hamid Karzai on küll Afganistani riigipea, aga Massoud on kangelane / Leslie Leino

    Index Scriptorium Estoniae

    Leino, Leslie

    2005-01-01

    Afganistani valimistel võitsid opositsionäärid, tugevaim figuur nende hulgas on Ahmad Shah Massoudi kunagine kaasvõitleja Yunus Qanun, kelle siht on võõrväed riigist välja viia ja riik ühendada. Ameeriklased ja nende liitlased on ärevil, sest Qanun pole võõrvägede hulgas populaarne. Lisa: Põhimõtteliselt ameeriklaste vastu. Vt. samas: Afganistanis alustas pärast 30-aastast pausi tööd parlament

  2. Metsanduse 100-aastane roheline ring : kasuta puitu rohkem, aga teadlikumalt / Marku Lamp ; interv. Rain Uusen

    Index Scriptorium Estoniae

    Lamp, Marku

    2008-01-01

    Vestlus keskkonnaministeeriumi metsaosakonna juhatajaga metsade heaperemehelikust majandamisest, puidu aktiivsemast kasutuselevõtust eri majandusharudes ning raiutud metsade asendamisest uutega, mis tagab kasvuhoonegaaside piisava sidumise atmosfäärist, pidurdades nii ka kliimamuutusi

  3. Siim Kallas: Rail Baltica edeneb, aga veel pole mõtet kiirrongi oodata / Urmas Jaagant

    Index Scriptorium Estoniae

    Jaagant, Urmas

    2010-01-01

    Euroopa Komisjoni voliniku Siim Kallase sõnul pole mingit põhjust, miks Eestis ei võiks sõita 200 km/h liikuvad kiirrongid, vajaliku raudtee ehitamine võib olla isegi odavam kui uus maantee. Kuid oluline on küsimus, kuidas tekitada erasektoris piisavalt suur kindlustunne, et Rail Baltica projekt ära tasub

  4. August välja küll, aga kunas ja kuidas? / Andres Arrak

    Index Scriptorium Estoniae

    Arrak, Andres, 1958-2017

    2009-01-01

    USA majandustsüklite uurija Victor Zarnowitz väidab, et järsule majanduslangusele järgneb kiire tõus. Autor leiab, et Eestit võimaldavad majanduskriisist välja tuua mitte ainult õiged otsused valitsussektoris, vaid ka erasektoris

  5. Kosmosetööstusel hiigelideid jätkub, aga raha napib... / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2009-01-01

    Barcelonas tegutsev firma Galactic Suite LTD kavandab kosmosehotelli. Richard Branson on lubanud pakkuda kosmoseturismi 200 000 dollari eest, kuid tema plaanid on hakanud edasi lükkuma. NASA, ESA ning mõnede riikide kosmose-eelarvetest 2008. a.

  6. Majandus kasvab, aga Eesti on ikka kriisis / Villu Reiljan ; tõlk. Jelena Vassiljeva

    Index Scriptorium Estoniae

    Reiljan, Villu, 1953-

    2002-01-01

    Ilmunud ka: Molodjozh Estonii 27. juuni lk. 6, Estonija 1. juuli lk. 2. Venek. art. autoriks märgitud Janno Reiljan. Eesti väljatoomiseks regionaalsest, sotsiaalsest ja eetilisest kriisist ning majanduskasvu rakendamiseks kogu ühiskonna teenistusse tuleb lahti öelda rahaeliidi võimu tugevdavast võltsliberalismist, kirjutab autor. Autor: ERL. Parlamendisaadik

  7. Maksis vähe, aga tähendab oi kui palju / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016

    2011-01-01

    Neljas kategoorias - parim film, parim meesnäitleja, parim lavastaja, parim stsenarist - Oscari pälvinud filmist "Kuninga kõne" (Inglise-Austraalia-USA, 2010). Film räägib kuningas George VI elust. Loetletud Oscari võitjad

  8. Vahutab nagu seep, aga puhtaks ei pese / Lauri Kärk

    Index Scriptorium Estoniae

    Kärk, Lauri, 1954-

    2005-01-01

    Täispikk lastefilm "Röövlirahnu Martin" : stsenaristid Mihkel Ulman, Jaak Urmet, R. Vilbre jt. : režissöör Rene Vilbre : produtsent ja operaator Manfred Vainokivi : helilooja Kaspar Jancis : Parunid ja Vonid, Taska Film, Amrion 2005

  9. Privaatpankur: varastasin miljoneid, aga keegi ei märganud / Lynnley Browning, Diana B. Henriques

    Index Scriptorium Estoniae

    Browning, Lynnley

    2009-01-01

    New Yorgi privaatpankuri, UBSi ja JPMorgan Chase'i varakamate klientide haldurina töötanud Hernan E. Arbizu pettusest, mille käigus võttis ta ebaseaduslikult oma Lõuna-Ameerika klientidelt miljoneid dollareid

  10. Väga suur ja vana, aga ikka pooleli / Alexander Birnbaum

    Index Scriptorium Estoniae

    Birnbaum, Alexander

    2007-01-01

    Bologna San Petronio Basilica ehk Püha Petroniuse katedraalist. Kiriku fassaadist, interjöörist, seal asuvast päikesekellast. Lühidalt Strasbourgi, Kölni, Siena, Milano ja Barcelona Sagrada Familia katedraalide ehitamisest

  11. Rein Pakk: olen Jumala trumm, aga sina oled ka / Rein Pakk ; intervjueerinud Tiiu Laks

    Index Scriptorium Estoniae

    Pakk, Rein, 1968-

    2010-01-01

    Intervjuu Rein Pakuga, kellel meeldib kirjutada artikleid ja näidendeid, laval ja filmis mängida, teha sisekujunduslahendusi ja karikatuure. 27. augustil esietendus Tallinna Draamateatris tema esimene lavastajatöö, teatri Vanemuine lavastus "Kaos". Andmeid Rein Paku elu ja loomingu kohta

  12. Suvi on lühike, kunst aga pikk / Ille Rohtlaan

    Index Scriptorium Estoniae

    Rohtlaan, Ille

    2009-01-01

    Suvised kunstinäitused Pärnus: "Mees ja naine" Pärnu uue kunsti muuseumis, Tarmo Roosimöldri graafika ja maalid Endla teatrigaleriis, Piret Vapajeva graafika teatrikohvikus, Haapsalu graafilise disaini festivali külalisnäitused Linnagaleriis ja kontserdimajas, Lea Tomsoni maalid "Monkey Business"kunstnike majas

  13. Meediamagnaat Murdoch võitleb, aga vist veel mitte elu eest / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo

    2011-01-01

    Häkkimisskandaali ohjeldamiseks sulges Rupert Murdoch väljaande News of the World ja loobus tasulise televõrgu BSkyB ülevõtmisest. Autori väitel Murdoch oma Briti ajaleheäri müüma ilmselt ei kiirusta. Murdoch on koos oma News Corpi asetegevjuhist poja James Murdochiga Briti parlamendi komitee ette kutsutud

  14. Scaling Value: Transnationalism and the Aga Khan's English as a "Second Language" Policy

    Science.gov (United States)

    Bolander, Brook

    2018-01-01

    Against the backdrop of growing sociolinguistic interest in transnationalism, this paper uses the notion of "scale" as an "ideological project" (Irvine in "Scale. Discourse and dimensions of social life," University of California Press, California, 2016: 214) to study situated discursive performances of…

  15. Ameerika toode? No tänan, aga jah / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo

    2006-01-01

    Politoloogid Peter Katzenstein ja Robert Keohane uurisid, kas Ameerika firmad kannatavad Ameerika poliitika tõttu. Kuigi küsitlusele vastanud eurooplased arvasid, et nad boikotiksid Coca-Colat ja McDonald'sit, ostsid nad siiski nii kokakoolat kui ka hamburgereid

  16. Kristiina Nurk: ilus võib olla, aga mugav peab olema / Kristiina Nurk ; intervjueerinud Tiiu Laks

    Index Scriptorium Estoniae

    Nurk, Kristiina, 1982-

    2009-01-01

    Intervjuu Kristiina Nurgaga, kes õpib Eesti Kunstiakadeemias disaini ja rakenduskunsti eriala nahakunsti suuna magistrantuuris, on lõpetanud Tartu Kõrgema Kunstikooli reklaamikunsti eriala, soovib saada kingadisaineriks, pälvis Prantsusmaal Saint Rémy-lès-Chevreuse'is toimunud rahvusvahelisel köitekunsti biennaalil ühe peapreemiatest. Kristiina Nurga eluloolisi andmeid, pälvitud preemiad

  17. America: AGA [American Gas Association] initiative aims to boost gas demand

    International Nuclear Information System (INIS)

    Fraser, K.M.

    1992-01-01

    This article focuses on the aim of the American Gas Association to increase natural gas demand in the key areas of gas electric generation, natural gas vehicles, gas cooling, and conversion of oil burning facilities, electric water heaters and household appliances such as space heating, stoves, washers and lighting. The need to improve the reliability of natural gas supplies is discussed. It is anticipated that natural gas will not replace coal as the main energy source for power generation, but that it will help utilities to meet environmental regulations. (UK)

  18. Poliitikud vajavad kaastunnet, aga seda ei tohi anda tasuta / Mohamed A. El-Erian

    Index Scriptorium Estoniae

    El-Erian, Mohamed A.

    2011-01-01

    Euroopas, USA-s ja Jaapanis on majanduses valitsev meeleolu uuesti halvenemas, kõik need piirkonnad on hädas võlgade vähendamisega. Poliitikud seisavad praegu silmitsi ebatavaliselt raskete väljakutsetega, me peaksime neid muutusteks survestama

  19. Alexopoulos, Theodoros Benford's Law in Astronomy 639 Ali, Sk ...

    Indian Academy of Sciences (India)

    Since January 2016, the Journal of Astrophysics and Astronomy has moved to Continuous Article Publishing (CAP) mode. This means that each accepted article is being published immediately online with DOI and article citation ID with starting page number 1. Articles are also visible in Web of Science immediately.

  20. A rare neurocutaneous syndrome and a rare association | Ali ...

    African Journals Online (AJOL)

    Among the many causes of ataxia, Ataxia -telangictasia is an autosomal recessive1, multi system disease affecting the skin, nervous system & immune system. It's prevalence has been estimated at 1 to 2 per 100,000 It is a neurodegenerative disorder2 in which there is progressive cerebellar ataxia, occulocutaneous ...

  1. 114_606 - 614_CHM 044 Ali Ahmed

    African Journals Online (AJOL)

    userpc

    ABSTRACT. Liquid phase adsorption experiments were. (MO) ... tential of zero charge (pHpzc) measurements.. Three different ... Surface characterization of the adsorbent revea he cloudy and ..... dye, due to electrostatic attractio adsorption ...

  2. Stylistics of Hajmirza Habib Khorasani's sonnets | Ali Shakaki ...

    African Journals Online (AJOL)

    ... repetitive and vulgar, Habib's sonnets are an exceptional since they are the expression of feelings and his inner experiences. His sonnets in the language level is of the most successful poems from outer music view because, has selected the most appropriate and the most frequent rhythms to express the mystical ideas.

  3. Bacillus thuringiensis and its application in agriculture | Ali | African ...

    African Journals Online (AJOL)

    Presently, a number of approaches to pest control via genetic engineering have been developed and genetically engineered crops expressing insecticidal characteristics are under cultivation for the last 15 years. Use of Bacillus thuringiensis genes encoding o̅ endotoxins with insecticidal characteristics is the major ...

  4. Transgenic crops: Current challenges and future perspectives | Ali ...

    African Journals Online (AJOL)

    resistance, use of selectable marker genes, etc. There exists a thought that the pace of research in genetic engineering of crop plants may some day lead to the development of variations that will not ensure the survival of living creatures including human beings. Most of such concerns are just psychological and are often ...

  5. Factors predisposing to obesity: a review of the literature | Ali ...

    African Journals Online (AJOL)

    The rising prevalence of obesity is a worldwide problem affecting not only the developed world but also developing nations such as South Africa. Excess body fat deposition is caused by an imbalance between energy intake and energy expenditure and there are many genetic and environmental factors that can influence ...

  6. Ibn Sina, Abu Ali [known as Avicenna] (980-1037)

    Science.gov (United States)

    Murdin, P.

    2000-11-01

    Islamic philosopher and scientist, born in Kharmaithen, near Bukhara (now Uzbekistan). Avicenna's life was marked by swings of fortune, from physician and favored scholar of a Samanid prince, to peripatetic country doctor when the Samanid regime fell. He became court physician in Hamadan (Iran), where he was for a time imprisoned as a political prisoner. He ended his life in a peaceful, contem...

  7. Qal'eh Hasan Ali maars, central Iran.

    Science.gov (United States)

    Milton, D.J.

    1976-01-01

    This group of some 15 Late Quaternary explosion craters are typical maars, with rims of bedded pyroclastics. In all but the largest crater, the deposits consist entirely of clasts of country rock (granodiorite and Eocene volcanics). The maars were formed by phreatomagmatic explosions, possibly caused by groundwater originating from a major river. The deposits of the largest maar contain up to 20% juvenile fragments of two types. Tephrite clasts have phenocrysts of phlogopite, clinopyroxene, olivine and anorthoclase; the presence of hauyne as a groundmass phase is notable. Cumulate blocks of phlogopite-clinopyroxene rock also occur. The maar field is part of a distinct province of Quaternary alkaline volcanism, related to a major crustal fracture - the N-S-trending Nayband fault.-R.J.S.

  8. Alexopoulos, Theodoros Benford's Law in Astronomy 639 Ali, Sk ...

    Indian Academy of Sciences (India)

    BetiCiciJoan

    Important Property of GRB Pulse: Power-Law Indices of Time Proper- ties on Energy. 535. Pi, F. P.. Astronomy Education Project for. Guangdong High Schools ... stricted Three-Body Problem with. Oblateness and Potential from a Belt. 107. On the Stability of L4,5 in the Relativis- tic R3BP with Radiating Secondary. 685. 752.

  9. Enchondroma of the scaphoid: a case report | Ali | Pan African ...

    African Journals Online (AJOL)

    Enchondroma represents a common bone tumor of the hand. The scaphoid is a rare location. We report the case of a scaphoid enchondroma presenting as chronic wrist pain following a relatively minor trauma. The diagnosis was suggested by radiological study and then confirmed by histological study after biopsy.

  10. Management of Conjoined Twins During Neonatal Period | Ali ...

    African Journals Online (AJOL)

    Background/Purpose: Conjoined twins are rare and complex anomalies of the newborn. It is reported in 1/50.000 to 1/100.000 live births. The aim of the study was to summarize the experiences gained during separation of 5 sets of conjoined twins with presentation of literature review. Materials & Methods: During the period ...

  11. Atvykstamojo turizmo sektoriaus poveikis šalies ekonomikai

    OpenAIRE

    Antonovė, Milda

    2016-01-01

    The relevance of the study. Inbound tourism industry includes many services in areas such as catering, accommodation, recreational activities, educational activities, etc., But these volumes increase in the overall level of the country's economic growth. Therefore, inbound tourism is seen as relevant and important business area with a positive impact on Lithuania's economic growth. Research object. Inbound tourism sector in Lithuania. The aim. Investigate the inbound tourism sector on t...

  12. Nutraceuticals as natural healers: Emerging evidences | Ali | African ...

    African Journals Online (AJOL)

    The protective effects of tocotrienols in flax seed oil, the curcuminoids in turmeric, carotenoids in carrots, flavonoids in fruits/vegetables, omega-3 fatty acids in sea foods, allyl-sulfides in garlic and -glucans in mush-rooms/cereals are few common examples to be cited here. Excess saturated fat is attributed to pose adverse ...

  13. Aliénation et idéologie

    OpenAIRE

    Kanabus, Benoît; Popa, Délia

    2017-01-01

    Dès lors, on entend mieux la question sur laquelle se referment les mille pages du Marx : « La pensée de Marx nous place devant la question abyssale : qu’est-ce que la vie » ? Cette question peut être reposée à nouveaux frais à l’âge du capitalisme avancé, où, comme le notait Adorno, la vie est devenue « l’idéologie de sa propre absence ». La recherche d’un autre rapport à l’idéologie vient alors prendre le relais de la lutte anti-idéologique de la théorie critique. Cette recherche part du po...

  14. Is the Age Problem Resolved? Ali Akbar Navabi & Nematollah Riazi

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    uncertainties are comparatively studied in the present paper. We are ... the recent estimates of the age of globular clusters have led to the gradual ... Three main streams of research seem to have converged to consistent estimates of the ... ters on the basis of a wide set of observational data including the Abell-ACO cluster.

  15. Editorial: Neglected diseases: burden and attention | Ali | Ethiopian ...

    African Journals Online (AJOL)

    No Abstract. Ethiopian Journal of Health Development Vol. 19 (2) 2005: 88. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · http://dx.doi.org/10.4314/ejhd.v19i2.9976 · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians ...

  16. INVENTORY OF THE INVASIVE ALIE N PLANT SPECIES IN INDONESIA

    Directory of Open Access Journals (Sweden)

    SRI S UDARMIYATI T JITROSOEDIRDJO

    2005-01-01

    Full Text Available An inventory of the alien plant species in Indone sia based on the existing references and herbarium specimens concluded that 1936 alien plant species ar e found in Indonesia which belong to 187 families. Field studies should be done to get the complete figur es of alien plant species in Indonesia. Based on the existing figures of the plant species, the invasive alien plant species can be iden tified, followed by studies on the assessment of losses, biology, management and their possible utilizations. Alien plant species are imported to Indonesia for cultivation, collection of the botanical garden, as experimental plants or other curiosities. Aside from plants purposely imported, there are also introduced plant propagules conta-minating imported agricultural products. These alien plant species can be beneficial or have a potential of being invasive. The alien cultivated species consisted of 67% of the total number. More than half of the cultivated plants are ornamental plants. Some of th e species are naturalized or escaped from cultivation and become wild and invasive. Some other natura lized species, adapted well without any problems of invasion. There are 339 species or 17% of the species r ecorded as weeds. The highest record of weeds is found in the family of Poaceae (57 species, follo wed by Asteraceae (53 species and Cyperaceae (35 species. There are 6 families having more than 10 species of weeds: Amaranthaceae, Asteraceae, Cyperaceae, Euphorbiaceae, Poaceae, and Rubiaceae. Three families have more than 100 species: Asteraceae 162 species, Poaceae 120 species, and Papillionaceae 103 species. Five species of aquatic and 20 species of terrestrial plants considered as important alien plant species in Indonesia were identified and some of their distributions noted

  17. Jonas U. Ezema and Adizetu A. Ali STRATEGIES FOR ENHANCING ...

    African Journals Online (AJOL)

    learning, mobile schools, information repackaging, translation services, book mobile, use of audio visuals .... Audio-visual resources, commonly referred to as instructional materials form a ... appreciation of reading communication and literate.

  18. Biodecolorization of acid violet 19 by Alternaria solani | Ali | African ...

    African Journals Online (AJOL)

    African Journal of Biotechnology ... Microorganisms are the nature's tools for cleaning the environment. Bioremediation using bacteria, fungi and algae is becoming an attractive option for the treatment of industrial effluents containing a

  19. Challenge and Opportunity: the ALI/III Global Principles Project ...

    African Journals Online (AJOL)

    This contribution explains the process whereby the American Law Institute and the International Insolvency Institute (1) developed principles of cooperation with regard to cross-border insolvency; (2) established acceptance of these principles in jurisdictions across the world, subject to any necessary local modifications; and ...

  20. Recovery of Chromium (III) from Tannery wastewater | ALI AWAN ...

    African Journals Online (AJOL)

    Hydrogen peroxide was potentially a suitable oxidant as it could recover chromate (CrO42-) up to 98% (from synthetic Cr3+ solution) and 88% (from effluent I). The percentage recoveries by the hypochlorites were lower than those by hydrogen peroxide i.e. for NaOCl the recoveries were up to 94% (from synthetic Cr3+ ...

  1. 'Les lendemains de révolution avortée' at alie to e's i o at alie to ...

    African Journals Online (AJOL)

    2016-03-28

    Mar 28, 2016 ... social and political reality whose normative limits we now live as the tangible ruins .... the biased visual representations circulated by average Western media. ..... And I would have done anything to disappear before the 1980s.

  2. Trends in incidence and early outcomes in a Black Afro-Caribbean population from 1999 to 2012: Etude Réalisée en Martinique et Centrée sur l'Incidence des Accidents Vasculaires Cérébraux II Study.

    Science.gov (United States)

    Olindo, Stephane; Chausson, Nicolas; Mejdoubi, Mehdi; Jeannin, Severine; Rosillette, Karine; Saint-Vil, Martine; Signate, Aissatou; Edimonana-Kaptue, Mireille; Larraillet, Veronique; Cabre, Philippe; Smadja, Didier; Joux, Julien

    2014-11-01

    Seldom studies are available on trends in stroke incidence in blacks. We aimed to evaluate whether stroke risk prevention policies modified first-ever stroke incidence and outcomes in the black Afro-Caribbean population of Martinique. Etude Réalisée en Martinique et Centrée sur l'Incidence des Accidents Vasculaires Cérébraux (ERMANCIA) I and II are 2 sequential prospective population-based epidemiological studies. There have assessed temporal trends in first-ever stroke incidence, risk factors, pathological types, and early outcomes in the black Afro-Caribbean population of Martinique comparing two 12-month periods (1998-1999 and 2011-2012). Crude and age-standardized incidence and 30-day outcomes for stroke in the 2 study periods were compared using Poisson regression. We identified 580 and 544 first-ever strokes in the 2 studies. World age-standardized incidence rates decreased by 30.6% in overall (111 [95% confidence interval, 102-120] versus 77 [95% confidence interval, 70-84]). Rate decline was greater in women than in men (34% versus 26%) particularly in women aged 65 to 74 years (-69%) and 75 to 84 years (-43%). Frequencies of hypertension and diabetes mellitus were unchanged, whereas dyslipidemia, smoking, and atrial fibrillation significantly increased. Only ischemic stroke types showed significant rate reduction in overall and in women, incidence rate ratio (95% confidence intervals) of 0.69 (0.50-0.97) and 0.61 (0.42-0.88), respectively. The overall 30-day case-fatality ratio remained stable (19.3%/17.6%), whereas a better 30-day outcome was found (modified Rankin Score, ≤2 in 47%/37.6%; P=0.03). Over 13 years, there has been a significant decrease (30.6%) in the age-specific first-ever stroke incidence in our Afro-Carribean population. Although prevention policies seem effective, we need to focus on new risk factors limitation and on male population adherence to prevention program. © 2014 American Heart Association, Inc.

  3. Pemikiran Suksesi Dalam Politik Islam Masa Pra Modern

    Directory of Open Access Journals (Sweden)

    Mazro'atus Sa'adah

    2016-12-01

    Abstrak: Pemikiran politik Islam muncul setelah Islam melalui Nabi Muhammad SAW berhasil membentuk sebuah ummat baru, dari peralihan kekuasaan kerajaan/kesukuan kepada Nabi yang kemudian kepada umat. Nabi Muhammad dinilai berhasil dalam mengatur komunitas barunya yang dikendalikan oleh ajarannya dalam seluruh lini kehidupan. Persoalan muncul kemudian setelah beliau wafat, yang akhirnya memunculkan pemikiran tentang suksesi. Artikel ini akan membahas tentang mengapa terjadi suksesi setelah Nabi Muhammad SAW wafat, bagaimana pemikiran para tokoh politik Islam masa pra modern terkait dengan suksesi, dan apa kontribusi pemikiran suksesi ini terhadap politik Islam di Indonesia. Dengan menggunakan pendekatan sejarah, ditemukan bahwa Nabi Muhammad tidak menetapkan siapa yang akan menggantikannya, dan ketika beliau wafat (632 M, para sahabat memilih seorang pemimpin (imam/khalifah. Masa pemerintahan Abu Bakar, Umar dan Usman banyak terjadi perselisihan yang awalnya terkait kepentingan agama namun berkembang menjadi kepentingan politik. Ketika Ali bin Abi Talib diangkat sebagai khalifah, konflik politik berkepanjangan berkaitan dengan pembunuhan Usman, menjadikan timbulnya perang jamal antara Aisyah dan Ali. Pada masa ini perbedaan kepentingan aqidah dipolitisir lebih jauh menjadi sebuah kepentingan politik. Dinamika politik ini kemudian melahirkan mazhab politik Islam klasik yang terbagi dalam tiga mazhab besar yaitu Sunni, Syi'ah dan Khawarij, yang darinya muncul istilah-istilah khilafah, imamah, ahlul halli wal aqdi, bay’ah, walayah dan lain-lain. Dari ketiga mazhab politik ini, kemudian muncul ide pemikiran politik Islam yang sangat kompleks dan berkepanjangan dari para tokoh politik Islam pra modern yang banyak dipengaruhi oleh filosof Yunani. Di Indonesia, pemikiran suksesi dalam politik Islam masa pra modern ini pernah diwacanakan. Namun untuk pemilihan kepala Negara belum terealisasi mengingat Indonesia bukan Negara Islam.

  4. PENYIMPANGAN PRINSIP KERJA SAMA DAN PRINSIP KESOPANAN WACANA KARTUN PADA BUKU POLITIK SANTUN DALAM KARTUN KARYA MUHAMMAD MICE MISRAD

    Directory of Open Access Journals (Sweden)

    Azizah Malikha Yunitawati

    2015-07-01

    Full Text Available This study deals with the violation of cooperative politeness principle of cartoon discourse found in Politik Santun Dalam Kartun by Misrad. The objectives of the study are as follows: (1 to identify the violation of cooperative principle; (2 to describe the violation of politeness principle; and (3 to describe the pedagogical implication in learning Indonesian language at vocational high school. This is a qualitative research. The data in the form of words, sentences, and discourse both monologues and dialogues containing violation of cooperative and politeness principle. Technique of collecting data used is documentation and technique of data analysis used is comparison and contrast technique. The results are as follows: (1 there are three types of violation of cooperative principles, namely: maxim of quantity, relevance, and manner. The violation of quantity maxim is dominant; (2 the violation of politeness principle covers six types, namely: tact maxim, generosity maxim, approbation maxim, modesty maxim, agreement maxim, and sympath maxim.

  5. MESSAGES FOR HUMANITY IN "BULA MALINO" (QUIET MOON (A POEM BY KAIMUDDIN IDRUS MUHAMMADAL-BUTHUNI IBNU BADARUDDIN

    Directory of Open Access Journals (Sweden)

    K Kamaluddin

    2015-12-01

    Full Text Available "Bula Malino" (Quiet Moon is a literary work found in Buton society and packaged in the form of poem. The manuscript is written in Wolio Language (Butonese main native language using an Arabic-Wolio script modification, commonly called "buri Wolio" (Wolio writing. This article is yielded to report findings of a qualitative study which analyzes the humanity messages revealed in the poem using a content analysis and structuralism genetic approach. This approach follows some gradual procedures such as examining intrinsic elements of poem, reviewing social life of author, and giving a reflection to history and social background of Buton society. The findings show that the poem reveals messages and values for humanity in terms of sobriety or calm mind/heart and soul clarity for being prepared for death. The poem also contains advice addressed to readers. It was noted that the author of the poem was born in the late 18th century AD. At the age of 40, he was inaugurated the 29th sultan of Buton. At this century, Buton social condition was more than enthusiastic in learning science. This was marked by the establishment of a school named "Zaawiah".

  6. ESTETIKA KESENIAN TERBANG PAPAT DALAM TRADISI KARNAVAL AMPYANG MAULUD NABI MUHAMMAD SAW DI DESA LORAM KULON KECAMATAN JATI KABUPATEN KUDUS

    Directory of Open Access Journals (Sweden)

    Idih Tri Relianto

    2015-08-01

    Full Text Available Maraknya kesenian modern yang berkembang dimasyarakat pada saat ini, berakibat terhadap merosotnya eksistensi kesenian daerah. Meskipun demikian karena adanya kearipan lokal diantaranya ada yang masih bertahan. Berdasarkan latar belakang tersebut penelitian peneliti merumuskan permasalahan diantaranya :estetika kesenian terbang papat dalam tradisi karnaval ampyang,bagaimana bentuk interaksi simbolik masyarakat terhadap kesenian terbang papat dalam tradisi karnaval ampyang. Metode penelitian yang dipakai peneliti adalah metode kualitatif dengan memusatkan pada metode riset lapangan, dalam hal ini teknik pengumpulan data dialakukan dengan cara wawancara, observasi, teknik studi dokumen, Berdasarkan data yang diperoleh hal ini dapat disimpulankan sebagai berikut. Dilihat dari segi penampilan antara lain : bentuk esetika kesenian terbang papat terletak pada instrumennya, pola pukulan, teknik permainan, juga pesan dari syair yang dilagukan. Ditemukan dua motif pola irama terbang papat yaitu motif gombrang dan motif krangen, keunikan yang lain adalah pada instrument jedor, seniman terbang papat pada saat memainkan alat musik terbang papat harus dapat menguasai nada dan syair terlebih dahulu. Bentuk dari interaksi sosial masyarakat adalah ditemukan beberapa rangkaian acara terbang papat dalam tradisi karnaval ampyang yaitu; nganten mubeng gapuro padurekso, tradisi nasi kepel, tradisi loram bersholawat atau tradisi albarzanji, dan juga Loram ekspo. The rise of modern art that developed in the community at this time, causes a decline in the existence of local arts. How everdue to the local genius some of which still survive. Based on this background, the study research hers formulate problem ssuch as:aesthetics art terbang papat in ampyang carnival tradition, how the forms of social interaction on the terbang papat art in the tradition of carnival ampyang. The research method is a method of observation, document study techniques, Based on the data obtainedit can be concluded as follows. In terms of appearance among others: esetika art form terbang papat located on the instrument, pattern punch, playing techniques, also the message of the poemsung. Found two motifs terbang papat rhythm patterns and motifs baggy motifs Krangen, another unique nessison jedor instruments, artists terbang papat when playing a musical instrument terbang papat should be able to master the tone and lyrics first. Forms of social interaction is found terbang papat a series of events in the carnival tradition ampyang namely; nganten mubeng gapuro padurekso, nasi kepel tradition, tradition or tradition sloram bersholawatal barzanji, and also loram expo Maraknya kesenian modern yang berkembang dimasyarakat pada saat ini, berakibat terhadap merosotnya eksistensi kesenian daerah. Meskipun demikian karena adanya kearipan lokal diantaranya ada yang masih bertahan. Berdasarkan latar belakang tersebut penelitian peneliti merumuskan permasalahan diantaranya :estetika kesenian terbang papat dalam tradisi karnaval ampyang,bagaimana bentuk interaksi simbolik masyarakat terhadap kesenian terbang papat dalam tradisi karnaval ampyang. Metode penelitian yang dipakai peneliti adalah metode kualitatif dengan memusatkan pada metode riset lapangan, dalam hal ini teknik pengumpulan data dialakukan dengan cara wawancara, observasi, teknik studi dokumen, Berdasarkan data yang diperoleh hal ini dapat disimpulankan sebagai berikut. Dilihat dari segi penampilan antara lain : bentuk esetika kesenian terbang papat terletak pada instrumennya, pola pukulan, teknik permainan, juga pesan dari syair yang dilagukan. Ditemukan dua motif pola irama terbang papat yaitu motif gombrang dan motif krangen, keunikan yang lain adalah pada instrument jedor, seniman terbang papat pada saat memainkan alat musik terbang papat harus dapat menguasai nada dan syair terlebih dahulu. Bentuk dari interaksi sosial masyarakat adalah ditemukan beberapa rangkaian acara terbang papat dalam tradisi karnaval ampyang yaitu; nganten mubeng gapuro padurekso, tradisi nasi kepel, tradisi loram bersholawat atau tradisi albarzanji, dan juga Loram ekspo.

  7. Ajutine juht - jube kallis, aga see-eest väga kasu(m)lik / Irja Rae

    Index Scriptorium Estoniae

    Rae, Irja

    2005-01-01

    Ajutise juhi (interim manager) ehk üleminekujuhi palkamisest ettevõttes. Vt. samas: Kus teda näha võib. Kommenteerib juhtimiskonsultatsioonide firma PW Partnersi vanemkonsultant Jana Võrk. Vt. samas: Keskpaik, Ivar. Eesti tuntuim üleminekujuht

  8. Turumajandus on käkitegu, aga püüdke demokraatiat ehitada! / Lauri Linnamäe

    Index Scriptorium Estoniae

    Linnamäe, Lauri

    2008-01-01

    Postkommunistlike riikide vastu huvi tundva majandusteadlase Anders Aslundi raamatust "How capitalism was built", mis annab põhjaliku ja süstemaatilise ülevaate ajast ja protsessidest, mis jäävad Nõukogude Liidu lagunemise ja tänapäeva vahele

  9. Validation of acute physiologic and chronic health evaluation II scoring system software developed at The Aga Khan University, Pakistan.

    Science.gov (United States)

    Hashmi, M; Asghar, A; Shamim, F; Khan, F H

    2016-01-01

    To assess the predictive performance of Acute Physiologic and Chronic Health Evaluation II (APACHE II) software available on the hospital intranet and analyze interrater reliability of calculating the APACHE II score by the gold standard manual method or automatically using the software. An expert scorer not involved in the data collection had calculated APACHE II score of 213 patients admitted to surgical Intensive Care Unit using the gold standard manual method for a previous study performed in the department. The same data were entered into the computer software available on the hospital intranet (http://intranet/apacheii) to recalculate the APACHE II score automatically along with the predicted mortality. Receiver operating characteristic curve (ROC), Hosmer-Lemeshow goodness-of-fit statistical test and Pearson's correlation coefficient was computed. The 213 patients had an average APACHE II score of 17.20 ± 8.24, the overall mortality rate was 32.8% and standardized mortality ratio was 1.00. The area under the ROC curve of 0.827 was significantly >0.5 (P test showed a good calibration (H = 5.46, P = 0.71). Interrater reliability using Pearson's product moment correlations demonstrated a strong positive relationship between the computer and the manual expert scorer (r = 0.98, P = 0.0005). APACHE II software available on the hospital's intranet has satisfactory calibration and discrimination and interrater reliability is good when compared with the gold standard manual method.

  10. Riigikogulased ongi teistmoodi asendis. Aga mitte nii teistmoodi, kui nad hetkel arvavad / Rein Taagepera ; interv. Urmo Soonvald

    Index Scriptorium Estoniae

    Taagepera, Rein, 1933-

    2007-01-01

    Politoloog Rein Taagepera vastab Riigikogu suurust, tööd ning seaduseelnõu, mis vabastab parlamendiliikmed kuluhüvitiste avalikustamisest, puudutavatele küsimustele. Lisa: Soome parlamendist õpitakse kulutamist, mitte tööl käimist; Rein Taagepera: teadlane, presidendikandidaat, Res Publica looja

  11. Üritatakse parimat, aga välja tuleb nagu tavaliselt / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2009-01-01

    Bryan Singeri mängufilm "Operatsioon "Valküür"" ("Valkyrie"), peaosas Tom Cruise. Film räägib Claus von Stauffenbergi (1907-1944) poolt juhitud operatsioonist, mille eesmärgiks oli atendaat Adolf Hitlerile

  12. Inimesel on raske muutuda, aga teistel on veel raskem neid muutusi märgata / Teeli Remmelg

    Index Scriptorium Estoniae

    Remmelg, Teeli

    2005-01-01

    Ilmunud ka: Delovõje Vedomosti : Upravlenije i Obutshenije 12. okt. lk. 6; Juhi ideelaegas. - Tallinn, 2006, lk. 190-193. Firmades 360 kraadi tagasiside meetodit rakendanud juhtide sõnul on teise inimese muutumise märkamine olulisemalt raskem kui endal muutuda. Kommenteerib Aira Tammemäe

  13. Igavese armastuse sõdalane : mitte just klassika, aga ajaloo verstapost küll / Ilmar Raag

    Index Scriptorium Estoniae

    Raag, Ilmar, 1968-

    2006-01-01

    Soome ja Hiina mütoloogiat ühendavast fantaasiafilmist "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina, Hollandi, Eesti ühistöö) : stsenarist Iiro Küttner, režissöör Antti-Jussi Annila, võitluskunstide koreograaf Yu Yan Kai, osades - Tommi Eronen, Zhang Jingchu, Markku Peltola, Elle Kull

  14. Validation of acute physiologic and chronic health evaluation II scoring system software developed at The Aga Khan University, Pakistan

    Directory of Open Access Journals (Sweden)

    M Hashmi

    2016-01-01

    Conclusion: APACHE II software available on the hospital′s intranet has satisfactory calibration and discrimination and interrater reliability is good when compared with the gold standard manual method.

  15. Üheksa ametit kindlasti, aga kümnes nälg ei ole / Tiia Truu

    Index Scriptorium Estoniae

    Truu, Tiia, 1948-

    2009-01-01

    Raplamaa käsitööseltsingu "Süstik" juhatuse esimehest Ivi Sargast ja tema tegemistest. Ivi Sark on lõpetanud Tartu Ülikooli kehakultuuriteaduskonna, tegeleb lapitööga, on tuntud laatade ja teiste ürituste korraldajana, 2007. aastast on Järvakandi gümnaasiumis käsitöö- ja võimlemisõpetaja

  16. Palju kära, aga mitte kuigi palju villa = Talkin' loud and saying not that much / Mika Hannula

    Index Scriptorium Estoniae

    Hannula, Mika, 1967-

    2015-01-01

    Kunstikriitik analüüsib nüüdisaegse kunsti poliitiliste aktide õnnestumisi ja ebaõnnestumisi Kiasma rahvusvahelisel rühmanäitusel "Demonstrating minds - disagreements in contemporary art" (Meele avaldused - erimeelsused nüüdisaegses kunstis) eksponeeritud tööde näitel. Vaatluse all on Cristina Lucase, Tanja Boukali, Jonathan Meese, Cinthia Marselle'i & Tiago Mata Machado ning Kader Attia teosed

  17. Management in ekonomija: ali je to dvoje ali eno? (Elementi in razumevanje postocializma in managerske revolucije = Management and Economy: Are They the Same Or Not?

    Directory of Open Access Journals (Sweden)

    Tonci Kuzmanic

    2007-03-01

    Full Text Available Author starts from important but suppressed equalisation of economy and management in post socialist and post capitalist circumstances which represents the very essence of post-modern global dominance (globalisation. An attempt to distinguish economy from management is connected with the appearance of neo-liberalism as the central argumentative machinery of management being connected with postmodern type of subjectivity. In comparison with the so-called »objective law« around which economy used to revolve (ideally, of course, management explicitly leaves this terrain and opens itself up to the subjective, even subversive activity at the level of global society. In that sense economy and management are operating on two radically different levels and we could even speak of two different entities which should be analytically distinguished. The very supposition for modern defence with regard to post-modern forms of dominance is exactly a possibility of differentiating between economy and management.

  18. Čemu (ali sploh čemu služi diploma iz družboslovja ali humanistike in pomen izobraževanja odraslih

    Directory of Open Access Journals (Sweden)

    Dušana Findeisen

    2011-03-01

    Full Text Available Avtorica obravnava usklajenost formalne izobrazbe z zaposlitvijo, ki je različna na različnih področjih dela in v različnih evropskih državah. Zaposlenost na svojem področju diplomantom omogoča, da ostanejo na delovnem mestu. Omogoča jim tudi boljši zaslužek. Za boljšo usklajenost izobrazbe z zaposlitvijo je pomembno izobraževanje odraslih in tudi to, kar počnemo v »resnem prostem času«. V nadaljevanju razprave Dušana Findeisen predstavi zbrana pričevanja o tem, kako individualizirano poteka življenjska in poklicna pot diplomantov s področja družboslovja in humanistike, in o pomenu izobraževanja odraslih pri tem.

  19. Isolation and identification of flavonoids from anticancer and ...

    African Journals Online (AJOL)

    Isolation and identification of flavonoids from anticancer and neuroprotective extracts of Trigonella foenum graecum. Shabina Ishtiaq Ahmed, Muhammad Qasim Hayat, Saadia Zahid, Muhammad Tahir, Qaisar Mansoor, Muhammad Ismail, Kristen Keck, Robert Bates ...

  20. Impact of different moisture regimes and nitrogen rates on yield and ...

    African Journals Online (AJOL)

    Impact of different moisture regimes and nitrogen rates on yield and yield attributes of maize (Zea mays L.) Muhammad Maqsood, Muhammad Asif Shehzad, Muhammad Aqeel Sarwar, Hafiz Tassawar Abbas, Salman Mushtaq ...

  1. Magnetic ordering in PrBa2Cu3-yAlyO6+x

    DEFF Research Database (Denmark)

    Longmore, A.; Boothroyd, A.T.; Chen, C.K.

    1996-01-01

    The magnetic ordering in single crystals of PrBa2CU3O6+x has been investigated by elastic neutron scattering over the full range of temperatures for reduced and oxygenated crystals. The crystals were grown in alumina crucibles and therefore contained dissolved aluminum on the Cu(1) site. Both...... aluminum and oxygen contents were analyzed in detail in order to establish their effects on the magnetic ordering, Our crystals exhibited Pr ordering and the two types of antiferromagnetic Cu ordering frequently reported in related compounds, but our results differ in several respects from previous studies...... axis, we find the moment to be aligned well away from the c axis, in agreement with recent Yb-170(3+) Mossbauer spectroscopy results. Ridges of scattering indicative of 2D magnetic ordering were seen in both oxygenated and reduced crystals, though we believe different magnetic moments are responsible...

  2. KURU YONCANIN RUMENDEKİ SİLİALI PROTOZOONLAR ÜZERİNDEKİ ETKİSİ

    OpenAIRE

    KOCABATMAZ, Mehmet; DURGUN, Zafer; EKSEN., Mursayettin

    1987-01-01

    Bu araştırma kuru yoncanın rumen içeriği pH'sı ve silialı protozoonların sayıları üzerindeki etkisini incelemek için yapıldı.Araştırmada biri rumen fistüllü diğeri rumen kanüllü iki Akkaraman koyun kullanıldı. Hayvanlar kuru yonca ve su ile ad. libitum olarak beslendi.Rumen içeriği örnekleri plastik hortum ile fistül ve kanülden girilerek alındı. Rumen içeriği pH'sı elektrometrik yolla hemen ölçüldü. Rumeniçerikli Formalin de tespit edildikten sonra, silialı protozoonların sayıları ...

  3. Design heuristic for parallel many server systems under FCFS-ALIS

    NARCIS (Netherlands)

    Adan, I.J.B.F.; Boon, M.; Weiss, G.

    2016-01-01

    We study a parallel service queueing system with servers of types $s_1,\\ldots,s_J$, customers of types $c_1,\\ldots,c_I$, bipartite compatibility graph $\\mathcal{G}$, where arc $(c_i, s_j)$ indicates that server type $s_j$ can serve customer type $c_i$, and service policy of first come first served

  4. Page 1 Rev. Sci. Technol., Synthese 26: 57 - 64 (2013) D. Ali ...

    African Journals Online (AJOL)

    Une augmentation de la teneur en proline est observee dans les plantes traitees ou non par !'hormone la kinetine. Mots cles: ... hormone in plants under stress induced a proportional increase in chlorophyll (a) and (b) with the concentration of used salt. ..... grains and vegetables, Agronomy Journal, Vol. 66,. 412-421.

  5. VARIETY OF GRAY-SCALE SONOGRAPHIC APPEARANCE OF UNTREATED LIVER METASTASES ALI HADIDI

    Directory of Open Access Journals (Sweden)

    ALI HADIDI

    1982-07-01

    Full Text Available Encountered wit h b izarre patterns o f l i v e r metas t a s es dec l i ned our accuracy rate s o the humi liation o f mist ake s motivated me to re-assess t he value o f hepatic sonography in patients s u spe c t ed o f having metastatic l i ver neoplasms . 43 pat ients , who had no t recieved any prior the r a phy , had been studied by gray-scale ult r a s ound . The echographic evidence i n accordance with o ur e x p e r ~ e n ce can be categorized as fo l l ows : I l a rge echo g enic or ~c ho poor area , II d iscrete masse s wi t.h high-level e c hoes spreaded t hroughout a lobe o f the l i ve r , III e cho f ree mass with i r regular mar q i.n , r .J d i f f use a lterat ion of the homogeneous e cho pattern of t he liver , V Bull ' s - eye ,VI abscess like,VII sol id echogenic mass vei th a centra l hyperechoic hor izontal l i ne , VIII echogenic mass ".;i t;l two l a t eral hypo e choic marg i n s, rX isodense e chog eni c a r ea bounded by an hypoechoic c i r c l e . The f e at u r e s seen i n l iver ultra sonography of t he entire pat t e r ns , a nd those s e en as new c r i teria are presented ~

  6. The Cholesterol Lowering Effects of Eurycoma longifolia Jack (Tongkat Ali Root Extract in Male Rats

    Directory of Open Access Journals (Sweden)

    Ghasak G Faisal

    2017-04-01

    Full Text Available Background: To investigate the effect of Eurycoma longifolia Jack root extract on serum lipids in rats. Methods: Twenty-six mature male albino Wistar rats were used in this study. A group of 18 rats were fed a high fat and high cholesterol diet for 4 weeks, after which their lipid profile was compared to the control group, who were kept on a normal diet. The rats were then further divided into three groups, the Cf group that continued to feed on a high fat and cholesterol diet only, and group A and group B who continued on a high fat diet with the addition of 5 mg/kg and 10 mg/kg of Eurycoma longifolia Jack root extract respectively for 4 weeks. After the 4 week period, the rat's lipid profiles were analysed again. Results: Group A and B showed significant total cholesterol reduction when compared to the Cf group, 140 ± 7.23, 139.63 ± 7.95, 192.14 ± 8.96 mg/dL respectively (p < 0.001. The total cholesterol/HDL ratio in group A was 5 however there was a sharp increase in group B to a high-risk level of 9.2 indicating a significant drop in HDL levels. The LDL level increased significantly in both group A and B compared to the Cf group. Conclusions: Eurycoma longifolia Jack root extract is effective in lowering total cholesterol, however the dose needs to be adjusted to prevent an excessive decrease in HDL levels.

  7. Trade and inter-group relations in the lower Niger 1830-1960 | Ali ...

    African Journals Online (AJOL)

    This study focuses on trade and intergroup relations in the Lower Niger in the period 1830-1960. Trade constitutes an integral aspect of communal relationship in the Lower Niger region from 1830 to 1960. The objective of the study is to show how the people of the Lower Niger related with each other in trade and other ...

  8. Ethnic Relations in Lokoja in the Colonial Period | Ali | Journal of ...

    African Journals Online (AJOL)

    These natural waterways served as major means of communication and transportation especially for the riverside dwellers during the colonial period. Because of its location at the confluence, Lokoja served as a commercial rendezvous during the east-west kolanut trade in West Africa. With the arrival of the Europeans, ...

  9. Aspect physico-chimique et biochimique Assia Amri, Ali Ladjama et ...

    African Journals Online (AJOL)

    ... analysis of sugars by HPLC, diastase, prolin and protein) local honey, ten ... The analysis of the report Fructose/glucose (F/G) shows that the honey of ... honeybee and the botanical wealth of the region where from interest to take into ...

  10. Recommended ALIs and DACs for 10 CFR part 220: A consistent numerical set

    Energy Technology Data Exchange (ETDEWEB)

    Eckerman, K.F.

    1996-05-01

    Appendix B to 10 CFR Part 20 contains numerical data for controlling the intake of radionuclides in the workplace or in the environment. These data, derived from the recommendations of the International Commission on Radiological Protection (ICRP), do not provide a numerically consistent basis for demonstrating compliance with the limitation on dose stated in the regulation. This situation is largely a consequence of the numerical procedures used by the ICRP which did not maintain, in a strict numerical sense, the hierarchial relationship among the radiation protection quantities. In this work recommended values of the quantities in Appendix B to CFR Part 20 are developed using the dose coefficients of the applicable ICRP publications and a numerical procedure which ensures that the tabulated quantities are numerically consistent.

  11. Visitors to Nicopolis in the reigns of Augustus and Ali Pacha

    DEFF Research Database (Denmark)

    Isager, Jacob

    2007-01-01

    Nicopolis, grundlagt af kejser Augustus, efter slaget ved Actium (i 31. f.Kr.) i samtidens litteratur samt i rejselitteraturen fra begyndelsen af 1800-tallet og de ideologiske og moralske overvejelser, som antikkens og 1800-tallets forfattere har gjort sig....

  12. ALI (Autonomous Lunar Investigator): Revolutionary Approach to Exploring the Moon with Addressable Reconfigurable Technology

    Science.gov (United States)

    Clark, P. E.; Curtis, S. A.; Rilee, M. L.; Floyd, S. R.

    2005-01-01

    Addressable Reconfigurable Technology (ART) based structures: Mission Concepts based on Addressable Reconfigurable Technology (ART), originally studied for future ANTS (Autonomous Nanotechnology Swarm) Space Architectures, are now being developed as rovers for nearer term use in lunar and planetary surface exploration. The architecture is based on the reconfigurable tetrahedron as a building block. Tetrahedra are combined to form space-filling networks, shaped for the required function. Basic structural components are highly modular, addressable arrays of robust nodes (tetrahedral apices) from which highly reconfigurable struts (tetrahedral edges), acting as supports or tethers, are efficiently reversibly deployed/stowed, transforming and reshaping the structures as required.

  13. Ali, Cunich: Halley's Churches: Halley and the London Queen Anne Churches

    Science.gov (United States)

    Ali, Jason R.; Cunich, Peter

    2005-04-01

    Edmond Halley's enormous contribution to science has received much attention. New research adds an intriguing chapter to his story and concerns his hitherto unexplored association with the baroque architectural visionary Nicholas Hawksmoor, and some important Temple-inspired churches that were built in London in the early 1700s. We argue that Christchurch Spitalfields and St Anne's Limehouse, which were both started in the summer of 1714, were aligned exactly eastwards using ``corrected'' magnetic-compass bearings and that Halley influenced or aided Hawksmoor. By this time the men had probably known each other for 30 years and had recently worked together on the Clarendon Building in Oxford. Despite there being more than 1500 years of Chinese and about 500 years of Western compass technology at the time, these probably represent the first constructions planned using a modern-day ``scientific'' technique. The research also throws light on Halley's contended religious position.

  14. Ahmad Farooq see Iqbal Naseer, 373 Ali Syed Salman Study of a ...

    Indian Academy of Sciences (India)

    Since January 2016, the Journal of Astrophysics and Astronomy has moved to Continuous Article Publishing (CAP) mode. This means that each accepted article is being published immediately online with DOI and article citation ID with starting page number 1. Articles are also visible in Web of Science immediately.

  15. The role of public library services in societal empowerment | Ali | IFE ...

    African Journals Online (AJOL)

    This could be because they seem not to believe that libraries have vital roles to play in influencing the standard of living of the societies they serve, by way of adequate provision of information. This paper therefore highlights and discuses some agents of poverty; It also examines some poverty eradication measures already ...

  16. Reactive physical vapor deposition of TixAlyN: Integrated plasma-surface modeling characterization

    International Nuclear Information System (INIS)

    Zhang Da; Schaeffer, J.K.

    2004-01-01

    Reactive physical vapor deposition (RPVD) has been widely applied in the microelectronic industry for producing thin films. Fundamental understanding of RPVD mechanisms is needed for successful process development due to the high sensitivity of film properties on process conditions. An integrated plasma equipment-target nitridation modeling infrastructure for RPVD has therefore been developed to provide mechanistic insights and assist optimal process design. The target nitridation model computes target nitride coverage based on self-consistently derived plasma characteristics from the plasma equipment model; target sputter yields needed in the plasma equipment model are also self-consistently derived taking into account the yield-suppressing effect from nitridation. The integrated modeling infrastructure has been applied to investigating RPVD processing with a Ti 0.8 Al 0.2 compound target and an Ar/N 2 gas supply. It has been found that the process produces athermal metal neutrals as the primary deposition precursor. The metal stoichiometry in the deposited film is close to the target composition due to the predominance of athermal species in the flux that reaches the substrate. Correlations between process parameters (N 2 flow, target power), plasma characteristics, surface conditions, and deposition kinetics have been studied with the model. The deposition process is characterized by two regimes when the N 2 flow rate is varied. When N 2 is dilute relative to argon, target nitride coverage increases rapidly with increasing N 2 flow. The sputter yield and deposition rate consequently decrease. For less dilute N 2 mixtures, the sputter yield and deposition rate are stable due to the saturation of target nitridation. With increasing target power, the electron density increases nearly linearly while the variation of N generation is much smaller. Target nitridation and its suppression of the sputter yield saturate at high N 2 flow rendering these parameters insensitive to target power variation. The deposition rate, however, increases with target power as a result of the increased ion energy and flux at the target

  17. 124 The Relevance of Ali (Earth Deity): Ritual Forms And Processes ...

    African Journals Online (AJOL)

    Tracie1

    remained a rhythm of significance in man's response to the sacred and his experience within the .... prototypes the repetition of the action of divine beings or mythical ancestors,” a .... changing and moving concerns of life. For the African, the ...

  18. Chemistry of Carbon Rich Star IRAS 15194–5115 A. Ali

    Indian Academy of Sciences (India)

    We have constructed two gas-phase models to study the chem- ... 1. Introduction. IRAS 15194–5115 is the third brightest carbon star at 12 µm and the brightest one ..... The main formation routes of CN, HCN and HNC in the inner part are.

  19. Development of ferry service on the lower Niger, 1901-1960 | Ali ...

    African Journals Online (AJOL)

    The paper demonstrates colonial government efforts in developing water transportation on the Lower Niger River by maintaining vessels as vehicles of transportation from the beginning of the twentieth century. Government departments were set up at various times to oversee activities of users of the River Niger.

  20. Revalence of Hearing Loss and the Related Factors in BuAli Hospital

    Directory of Open Access Journals (Sweden)

    Shohreh Jalaei

    2004-06-01

    Full Text Available Objective:Determining the prevalence of hearing loss and correlated factors in clients referring to audiology clinic of Buali hospital. Method and Material: This cross-sectional analytic-descriptive survery was carried out on six thousand and twenty ears of 3010 clients (1651 ,a;e amd 1359 female in Audiology clinic of Buali hospital , during Sept 2000 to Sept 2001. Results: Hearing loss is the most common reason for referring the clients (20.5%. 1319 ears (21.9% Showed sensorineural hearing impairment and conductive and mixed hearing loss are observed in 1059 (17.6% and 234 (3.9% ears, respectedly. Hearing loss degree most cases is mild (14% in both ears. There is no significant difference between male and female hearing threshold means (p>0.05 ‘ but a significant difference between hearing thresholds is observed in terms of age (p<0.05. Audiogram configuration in most cases is flat (55.1%. Otoscopic examination reveals abnormal condition in 2333 ears (38.8% . 37.2% of the studied cases have abnormal tympanogram mostly type B (15.9%. 2.2% of the clients wear hearing aid that mostly have B.T.E ones (1.5%. 6.2% of the clients , depends on their hearing impairment type and degree need rehabilitation services. Conclusion: The results are Valid only in the context of this study and it’s generaliztion needs further researches.

  1. Regstellende aksie, aliënasie en die nie-aangewese groep / Dirk Johannes Hermann

    OpenAIRE

    Hermann, Dirk Johannes

    2006-01-01

    Affirmative action is a central concept in South African politics and the workplace. The Employment Equity Act divides society into a designated group (blacks, women and people with disabilities) and a non-designated group (white men and white women). In this study, the influence of affirmative action on alienation of the non-designated group was investigated. Guidelines were also developed for employers in order to lead the non-designated group from a state of alienation to th...

  2. Promotion de l'évaluation d'impact réalisée ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The projects under this initiative will investigate issues surrounding women's ... the school already offers a special program featuring innovative approaches; and ... to climate change; and enhance the problem-solving capacity of governments, ...... examinant les modalités du concept de sièges réservés aux femmes (action ...

  3. Is surfactant a promising additive drug in ALI/ARDS-patients?

    NARCIS (Netherlands)

    Schultz, MJ; Kesecioglu, J

    The rationale for surfactant replacement therapy in patients with acute respiratory distress syndrome (ARDS) is to restore the normal composition of the surfactant system, as well as to overcome ongoing inactivation of present surfactant. Indeed, surfactant replacement therapy call normalize the

  4. Is surfactant a promising additive drug in ALI/ARDS-patients?

    NARCIS (Netherlands)

    Schultz, Marcus J.; Kesecioglu, Jozef

    2004-01-01

    The rationale for surfactant replacement therapy in patients with acute respiratory distress syndrome (ARDS) is to restore the normal composition of the surfactant system, as well as to overcome ongoing inactivation of present surfactant. Indeed, surfactant replacement therapy call normalize the

  5. Development of Resource Sharing System Components for AliEn Grid Infrastructure

    CERN Document Server

    Harutyunyan, Artem

    2010-01-01

    The problem of the resource provision, sharing, accounting and use represents a principal issue in the contemporary scientific cyberinfrastructures. For example, collaborations in physics, astrophysics, Earth science, biology and medicine need to store huge amounts of data (of the order of several petabytes) as well as to conduct highly intensive computations. The appropriate computing and storage capacities cannot be ensured by one (even very large) research center. The modern approach to the solution of this problem suggests exploitation of computational and data storage facilities of the centers participating in collaborations. The most advanced implementation of this approach is based on Grid technologies, which enable effective work of the members of collaborations regardless of their geographical location. Currently there are several tens of Grid infrastructures deployed all over the world. The Grid infrastructures of CERN Large Hadron Collider experiments - ALICE, ATLAS, CMS, and LHCb which are exploi...

  6. Ali et al., Afr J Tradit Complement Altern Med. (2015) 12(2):149-154 ...

    African Journals Online (AJOL)

    Proff.Adewunmi

    Background: Fenugreek (Trigonella foenum graecum L) is receiving global attention as a functional food due to its unique nutritional and medicinal properties ... These fibrous components bind to the toxins present in food and help to protect the colon mucus membrane from cancer causing .... condition, agricultural. Table 1: ...

  7. Ali et al., Afr J Tradit Complement Altern Med. (2015) 12(2):149-154 ...

    African Journals Online (AJOL)

    Proff.Adewunmi

    1Department of Food Science and Nutrition, 2Department of Crop Sciences, College of Agricultural and Marine Sciences,. Sultan Qaboos University, P.O. Box 34, PC 123, Al-Khoud, Muscat, Oman. ..... acute poisoning in humans and animals is relatively rare under normal ... components for improved human health benefits.

  8. Lorenz's attractor applied to the stream cipher (Ali-Pacha generator)

    International Nuclear Information System (INIS)

    Ali-Pacha, Adda; Hadj-Said, Naima; M'Hamed, A.; Belgoraf, A.

    2007-01-01

    The safety of information is primarily founded today on the calculation of algorithms whose confidentiality depends on the number of the necessary bits for the definition of a cryptographic key. If this type of system has proved reliable, then the increasing power of the means of calculation threatens the confidentiality of these methods. The powerful computers are certainly able to quantify and decipher information quickly, but their computing speed allows parallel cryptanalysis, which aims 'to break' a code by discovering the key, for example, by testing all the possible keys. The only evocation of the principle of the quantum computer, with the potentially colossal capacities of calculation, has started a shock, even in the most savaged who are convinced of algorithmic cryptography. To mitigate this concern, we will introduce in this article a new cryptographic system based on chaotic concepts

  9. BIOSKETCH Andrej Šali received his BSc degree in chemistry from ...

    Indian Academy of Sciences (India)

    Savitha Sekhar Nair

    , Slovenia, in 1987; and his PhD from. Birkbeck College, University of London, UK, in 1991, under the supervision of Professor Tom L. Blundell, where he developed the MODELLER program for comparative modeling of protein structures.

  10. Characterization and Quantification of Deposit Build-up and Removal in Straw Suspension-Fired Boilers - Ph.d. thesis Muhammad Shafique Bashir

    DEFF Research Database (Denmark)

    Shafique Bashir, Muhammad

    An increased use of biomass in large suspension-red power plants can be a relatively economic and potentially also efficient way to utilize biomass for heat and power production. However, large deposit formation problems limit the electrical efficiency by limiting the maximum applicable superheat...

  11. Diagnosis of hepatoma using grayscale and Doppler ultrasound in patients with chronic liver disease

    Directory of Open Access Journals (Sweden)

    Idris S

    2011-10-01

    Full Text Available Wasim A Memon, Zishan Haider, Mirza Amanullah Beg, Muhammad Idris, Tanveer-ul-Haq, Waseem Akhtar, Sidra IdrisRadiology Department, Aga Khan University Hospital, Karachi, Pakistan Every author contributed equally to the workObjective: To determine the diagnostic accuracy of liver ultrasound for the detection of hepatoma in chronic liver disease (CLD patients by either taking histopathology or serum α-fetoprotein levels or a biphasic computed tomography (CT scan (whichever is available as the gold standard.Study design: Cross-sectional.Place and duration of study: Radiology Department, The Aga Khan University Hospital, Karachi, Pakistan, from January 2007 to January 2010.Methods: A total of 239 patients (156 males and 83 females with clinical suspicion or surveillance of hepatoma in CLD referred to the radiology department for ultrasound evaluation followed by either liver biopsy and histopathology or serum α-fetoprotein level or biphasic CT scan.Results: The sensitivity of ultrasound for hepatoma detection in CLD was 65%, specificity was 85%, and accuracy was 70%, and positive predictive value and negative predictive value were 92% and 45%, respectively.Conclusion: Ultrasound is a relatively quick, safe, reasonably accurate, and noninvasive imaging modality for the detection of hepatoma in CLD and can be complemented with clinical assessment of screening high-risk patients.Keywords: hepatoma, ultrasound, radiology, chronic liver disease

  12. Lubâb At-Ta’wîl ‘Inda Al-Imâm Al-Khâzîn Baina Al-Ma’tsûr wa Ar-Ra’yi (Dirâsah Maudhu’iyyah fi Ayah al-Qashash

    Directory of Open Access Journals (Sweden)

    Muhammad Shulhi Alhadi siregar

    2018-03-01

    Full Text Available This paper concern to study about one of Tafseer book, namely Lubâb al-Ta'wîl fi Ma'âny at-Tanzîl by Imam al-Khazin. Some scholars differ in the setting of sources of tafseer. Such as, the well-known scholars, Muhammad Ali Iyazi and Muhammad Husain ad-Dzahabi. Ulama Iyazi assumes that Tafseer Khazin belongs to the category of commentary bi al-Ma'tsûr, since this commentary is an ikhtishar of Tafseer al-Baghawi. While some scholars such as adz-Dzahabi, categorized this tafseer into the bi al-Ra'yi. By using the tahlily documentation method and the thematic method associated with Qashash verses in the Qur'an, the researchers found the correct method, namely the tafseer of al-Atsary an-Nazhary or known by tafseer bi al-Ma'tsûr who use Ra'yi as an extension of explanation and the determination of the most powerful law, seen from writing theme related at the end of its tafseer.

  13. AN ANALYSIS OF TRANSLATION TECHNIQUES IN THE ENGLISH VERSION OF ARRAHMAN SURAH

    Directory of Open Access Journals (Sweden)

    Farida Repelita Wati Kembaren

    2018-02-01

    Full Text Available The Holy Qur’an has been translated into many languages including English. However, different translator of the Holy Qur’an produces different English version of Al-Qur’an because every translator uses different translation techniques to translate Al-Qur’an. This study aims to compare the three English versions of Arrahman surah, and describe the most dominant translation techniques used by the three translators to translate the Holy Qur’an. Translation techniques proposed by Molina and Albir (2002, p.509-511 are used to analyze the data. The data for this study are words, phrases, and clauses in the 78 verses of Arrahman surah in Arabic and its three English versions translated by Maulawi Sher ‘Ali, Dr. Muhammad Taqi­ud­Din Al­Hilali and Dr. Muhammad Muhsin Khan, and Talal Itani. The result shows that there are four most dominant techniques used by the three translators in translating the Holy Qur’an; Adaptation, Amplification, Established Equivalent, and Literal Translation technique. The first and the second translator prefer to use Amplification to introduce details in brackets or footnotes, but the third translator prefers to use Established Equivalent to find a term or expression recognized (by dictionaries or language in use as an equivalent.

  14. Analytical Characterization of Rococo Paintings in Egypt: Preliminary Results from El-Gawhara Palace at Cairo

    Directory of Open Access Journals (Sweden)

    Fatma REFAAT

    2012-12-01

    Full Text Available El-Gawhara palace (1813–1814 AD is situated south of the Mosque of Muhammad Ali in the Cairo Citadel. This palace is an important example of the best early 19th century rococo decorations in Egypt. The present study reports some of the results obtained from the application of different analytical techniques to characterize some rococo paintings at El-Gawhara palace at Cairo, Egypt. The characterization of the studied paintings was carried out by means of optical microscopy (OM, scanning electron microscopy equipped with an energy dispersive X-ray detector (EDS and Fourier transform infrared spectroscopy (FT−IR. The obtained results allowed the identification of the chemical composition, structure and the painting technique employed in these paintings. This methodology reveals some useful information on some rococo paintings dating back to the 19th century in Egypt.

  15. Morality and Intimate Partner Violence: Do Men in Court-Mandated Psychological Treatment Hold a Sacred Moral Vision of the World and Themselves?

    Science.gov (United States)

    Vecina, María L; Chacón, José C

    2016-01-01

    This article examines the characterization of men in a court-mandated treatment for violence against their partners as holding a sacred vision of the 5 moral foundations and of their own morality. This characterization is compatible with the assumption that a sacred moral world is easily threatened by reality and that may be associated to violent defensive actions. The results from latent class analyses reveal (a) a 4-class distribution depending exclusively on the intensity with which all participants (violent and nonviolent) tend to sacralize the actions proposed in the Moral Foundations Sacredness Scale and (b) a greater prevalence of the violent participants among the classes that are more prone to sacralize. They also show that they hold an inflated moral vision of themselves: They think they are much more moral than intelligent than others who have never been charged with criminal behavior (Muhammad Ali effect).

  16. PETA GERAKAN SYI’AH DI KALIMANTAN SELATAN

    Directory of Open Access Journals (Sweden)

    Humaidy humaidy

    2014-05-01

    Full Text Available This article traces back the entry of the Shi’a in South Kalimantan through the inclusion of Islamic Wujudiyah (panentheism Sufismwhich was firstspreadin the kingdom of Banjar.  This isdue to the similaritybetween Wujudiyah Sufism with the concept of Irfan in Shi'a. However, the influence of Shia in  South Kalimantan  suffered a setback atthe era  of Syekh Muhammad al-Banjari Arsyad (1710-1812 AD.  According to Habib Ali,Shia began to revive in South Kalimantan after the Iranian revolution in 1979.  Ja’fari school of thought (madhabs  is the growing Shiah in South Kalimantan. The Developmentof Shi’a in South kalimantan faces manychallenges since Muslims in South Kalimantan have a strong belief in Sunni

  17. METAPHOR AS A STYLISTIC DEVICE OF ISLAMIC TEACHING

    Directory of Open Access Journals (Sweden)

    Jumino Suhadi

    2011-06-01

    Full Text Available Metafor Sebagai Sarana Stilistika Pembelajaran Islam. Artikel ini membahas tentang berbagai tipe metafora yang terdapat dalam ayat-ayat suci al-Qur’an dan Hadis berdasarkan kerangka teori sastra dan linguistik modern. Sumber data utama dalam studi ini terdiri dari ayat-ayat suci al-Qur’an yang diterjemahkan dalam Bahasa Inggris oleh Abdullah Yusuf Ali dan beberapa matan Hadis dari buku kumpulan Hadis karangan Habib Muhammad al-Haddar. Tujuan analisis ini adalah untuk memaparkan bukti kuat bahwa metafora merupakan alat stilistika ‘stylistic device’ yang dipergunakan secara luas dalam al-Qur’an dan al-Hadis dalam menyampaikan ajaran Islam. Hasil dari studi ini menunjukkan bahwa semua tipe metafora dalam arti luas terdapat dalam berbagai ayat suci al-Qur’an dan al-Hadis. Argumen tersebut menurut penulis merupakan bukti yang sangat meyakinkan bahwa metafora merupakan salah satu alat stilistika dalam menyampaikan ajaran Islam.

  18. "Aga vene ajal pidi igas õppetunnis siduma õppematerjali poliitikaga" : ideoloogiline kasvatus nõukogude koolitunnis hilisstalinistlikus Eesti NSV-s / Eli Pilve

    Index Scriptorium Estoniae

    Pilve, Eli, 1982-

    2010-01-01

    Nõukogude harisdussüsteemi üldistest ideoloogilistest põhimõtetest ja koolikohustusest. Kooliõpetuse ümberkorraldamisest okupeeritud Eestis, uutest õppeprogrammidest ja õpikutest, ajaloo õpetamisest. Nõukogude patriotismi ja internatsionalismi kasvatamisest teistes ainetundides. Õpetajaskonnast, ideoloogilisest survest õpetajatele ja kaadripuhastusest

  19. A study of photochemical againg of ambient air using Potential Aerosol Mass (PAM) chamber under the different sources and types of emissions

    Science.gov (United States)

    Lee, T.; Son, J.; Kim, J.; Kim, S.; Sung, K.; Park, G.; Link, M.; Park, T.; Kim, K.; Kang, S.; Ban, J.; Kim, D. S.

    2016-12-01

    Recent research proposed that Secondary Aerosol (SA) is important class of predicting future climate change scenarios, health effect, and a general air quality. However, there has been lack of studies to investigate SA formation all over the world. This study tried to focus on understanding potential secondary aerosol formation and its local impact by the photochemical aging of inorganic and organic aerosols in the ambient air using the Potential Aerosol Mass (PAM) chamber under the different sources and types of emissions. PAM chamber manufactured by Aerodyne make an oxidizing environment that simulates oxidation processes on timescales of 12-15 hrs in the atmosphere. Chemical compositions of ambient aerosol and aerosol that was aged in the PAM chamber were alternately measured every 2-minutes using the High Resolution-Time of Flight-Aerosol Mass Spectrometer (HR-ToF-AMS). HR-ToF-AMS provides non-refractory aerosol mass concentrations including nitrate, sulfate, hydrocarbon-like and oxygenated organic aerosol in real time. This study includes a residence area of mixture of sources, a forest site of dominant source of biogenic VOCs, an underground parking lot of dominant vehicle emission, and laboratory experiment of vehicle emissions under different fuels and speeds using the chassis dynamometer. As a result, it was revealed that gasoline and LPG vehicle relatively made more potential SA than diesel vehicle.

  20. Wŏ shuō hànyŭ, nĭne? ehk Mina räägin hiina keelt, aga sina? / Piret Lakson

    Index Scriptorium Estoniae

    Lakson, Piret, 1989-

    2012-01-01

    Hiina keele õpetamisest Eestis ja Mustamäe gümnaasiumi noorest hiina keele õpetajast Wang Weist. Eesti koolidesse hiina keele õpetajate hankimine käib Tallinna ülikooli juurde loodud Konfutsiuse instituudi kaudu

  1. Kaitseväelastele sauna laenanud mees: nad põletasid mu sauna maha, aga süüdi olen mina! / Arvo Uustalu

    Index Scriptorium Estoniae

    Uustalu, Arvo, 1964-

    2014-01-01

    Õppuse "Kevadtorm" ajal toimunud saunapõlengust. Päästeameti inspektori sõnul põhjustas põlengu ülekütmine ja ehitusviga, seega puudub omanikul õiguslik alus nõuda kaitseväelt kompensatsiooni

  2. Tudengiteatrite vaim ja vaev : üliõpilasteater peaks olema julgem: pole ju midagi kaotada, võita aga on palju / Rait Avestik

    Index Scriptorium Estoniae

    Avestik, Rait, 1974-

    2006-01-01

    17.-19. veebr. Viljandis toimunud üliõpilasteatrite festivalist, millest võtsid osa Tartu Üliõpilasteater : S. Kane "Puhastatud", lavastaja Kalev Kudu ; TÜ Pärnu kolledži üliõpilasteater K-äng2 : kohvikuprogramm "Maailma lõpus on kohvik" ; TÜ Viljandi Kultuuriakadeemia üliõpilased (mitte näitlejasuuna õppurid) : lavaline kompositsioon "Actus interruptus" ; Tallinna Tehnikaülikooli T-teater : Kurt Wonneguti "Õnne sünnipäevaks, Wanda June!", lavastaja Tamur Tohver ning Tallinna Ülikooli Tudengiteater : John Boynton Priestley "Nad tulid linna", lavastaja Juta Terali. Eraldi vaadeldakse TÜ Viljandi Kultuuriakadeemia 3. kursuse näitekunsti tudengite tööd : Dario Fo "Müsteerium Buff", lavastaja Peeter Raudsepp

  3. Reekviem rahvale, kelle kogu jõud kulub omavaheliste arvete klaarimisee, aga arved klaariks ei saa / Jüri Reinvere ; intervjueerinud Valner Valme

    Index Scriptorium Estoniae

    Reinvere, Jüri, 1971-

    2010-01-01

    Jüri Reinvere uuest CD+DVD kogumikust "Requiem", milles lauljate hääled ja flöödimuusika on ühendatud sõna ja filmiga, režissöör Catherine Jarvis. Eestis toimuvatest esitluskontsertidest. Intervjuu heliloojaga

  4. Kadrioru skandaali võtmetegelane: Ma olen ühiskonnast välja heidetud, aga mitte väljaheide / Peeter Ernits

    Index Scriptorium Estoniae

    Ernits, Peeter, 1953-

    2006-01-01

    Eesti presidendi residentsis toimunud noortepidude tagamaadest ja meediaskandaalist. Vt. ka intervjuud uurimist juhtinud ülemkomissari Margus Kotteriga: Ülemkomissar Kotter: Paulson valetas avalikkusele

  5. Tallinna Kool - silla ehitajad Eesti aega, aga ka lääne nüüdisaegsesse arhitektuuri / Leonhard Lapin

    Index Scriptorium Estoniae

    Lapin, Leonhard, 1947-

    2008-01-01

    Eesti arhitektide rühmitusest Tallinna Kool. Tegutses 1972-1985. Esimese manifesti koostajad on Tiit Kaljundi, Vilen Künnapu, Leonhard Lapin, Avo-Him Looveer ja Ülev Eljand. Oluline oli Tallinna Kooli arhitektide grupinäitus 1978. a. Näitus "Keskkonnad, projektid, kontseptsioonid. Tallinna Kooli arhitektid 1972-1985" Rotermanni soolalaos

  6. 10 CFR Appendix B to Part 20 - Annual Limits on Intake (ALIs) and Derived Air Concentrations (DACs) of Radionuclides for...

    Science.gov (United States)

    2010-01-01

    ... appendix are the annual intakes of a given radionuclide by “Reference Man” which would result in either (1... effects when the whole body is irradiated uniformly. The values of wT are listed under the definition of..., where 2×104 ml is the volume of air breathed per minute at work by “Reference Man” under working...

  7. JGME-ALiEM Hot Topics in Medical Education: Analysis of a Multimodal Online Discussion About Team-Based Learning.

    Science.gov (United States)

    Riddell, Jeff; Patocka, Catherine; Lin, Michelle; Sherbino, Jonathan

    2017-02-01

    Team-based learning (TBL) is an instructional method that is being increasingly incorporated in health professions education, although use in graduate medical education (GME) has been more limited. To curate and describe themes that emerged from a virtual journal club discussion about TBL in GME, held across multiple digital platforms, while also evaluating the use of social media in online academic discussions. The Journal of Graduate Medical Education ( JGME ) and the Academic Life in Emergency Medicine blog facilitated a weeklong, open-access, virtual journal club on the 2015 JGME article "Use of Team-Based Learning Pedagogy for Internal Medicine Ambulatory Resident Teaching." Using 4 stimulus questions (hosted on a blog as a starting framework), we facilitated discussions via the blog, Twitter, and Google Hangouts on Air platforms. We evaluated 2-week web analytics and performed a thematic analysis of the discussion. The virtual journal club reached a large international audience as exemplified by the blog page garnering 685 page views from 241 cities in 42 countries. Our thematic analysis identified 4 domains relevant to TBL in GME: (1) the benefits and barriers to TBL; (2) the design of teams; (3) the role of assessment and peer evaluation; and (4) crowdsourced TBL resources. The virtual journal club provided a novel forum across multiple social media platforms, engaging authors, content experts, and the health professions education community in a discussion about the importance, impediments to implementation, available resources, and logistics of adopting TBL in GME.

  8. Recours aux cultures céréalières traditionnelles pour améliorer la ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Urging policy formulation on millets : an indispensable source of nutrition for Poraja, Kandha and Penthia tribal communities in Kundra Block, Odisha, India. Téléchargez le PDF. Articles de revue. Newspaper cuttings [appendix 9 of the joint technical final report (October 2010 - March 2013)]. Téléchargez le PDF. Articles de ...

  9. Švedijos ir Baltijos šalių konkurencingumas Europos perspektyvoje – kai kurie kiekybiniai aspektai

    OpenAIRE

    Schuller, Bernd-Joachim

    2011-01-01

    This paper investigates in which way the EU members have achieved the Lisbon Agenda Goals according to the W orld Economic Forum (WEF, 2010) according to itd Lisbon Reviews. Furthermore the Global Competitiveness Index 2010 (WEF) for the EU member countries is shown. In both cases focus is on the Baltic Countries and Sweden. Straipsnyje, remiantis Pasaulio ekonomikos forumu (PEF, 2010) ir Lisabonos atsiliepimais, nagrinėjama, kokiu būdu ES narės pasiekė Lisabonos strategijos tikslus. Taip ...

  10. Recours aux cultures céréalières traditionnelles pour améliorer la ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... ce qui crée des emplois sur place et aide les femmes à offrir des produits transformés nutritifs ayant de meilleures possibilités de mise en marché. Cette approche, qui contribue à l'amélioration de la qualité de vie des petits agriculteurs, fait partie intégrante d'une solution durable à la pauvreté en milieu rural en Inde.

  11. Recours aux cultures céréalières traditionnelles pour améliorer la ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Studies. Physico-chemical and sensory evaluation of commercial chakli and ... conference of McGill's Institute for the Study of International Development. ... Special journal issue highlights IDRC-supported findings on women's paid work.

  12. Said Ali Hassan El-Quliti1* and Neyara Radwan2 1 Prof., Department of Industrial Engineering, King Abdulaziz University

    OpenAIRE

    El-Quliti, Said Ali Hassan; Radwan, Neyara

    2016-01-01

    Faculty of Engineering at King Abdulaziz University plans to redesign its undergraduate courses, which is required for students in 14 different programs. These courses have an annual enrolment of about 2,500 students each year. The Operations Research Teaching Area in the Department of Industrial Engineering will be presented as a case study. This area involves two core and three elective courses.The course redesign involves preparing students for the Fundamentals of Engineering (FE) Exam req...

  13. VizieR Online Data Catalog: WISE/NEOWISE Mars-crossing asteroids (Ali-Lagoa+, 2017)

    Science.gov (United States)

    Ali-Lagoa, V.; Delbo, M.

    2017-07-01

    We fitted the near-Earth asteroid thermal model of Harris (1998, Icarus, 131, 29) to WISE/NEOWISE thermal infrared data (see, e.g., Mainzer et al. 2011ApJ...736..100M, and Masiero et al. 2014, Cat. J/ApJ/791/121). The table contains the best-fitting values of size and beaming parameter. We note that the beaming parameter is a strictly positive quantity, but a negative sign is given to indicate whenever we could not fit it and had to assume a default value. We also provide the visible geometric albedos computed from the diameter and the tabulated absolute magnitudes. Minimum relative errors of 10, 15, and 20 percent should be considered for size, beaming parameter and albedo in those cases for which the beaming parameter could be fitted. Otherwise, the minimum relative errors in size and albedo increase to 20 and 40 percent (see, e.g., Mainzer et al. 2011ApJ...736..100M). The asteroid absolute magnitudes and slope parameters retrieved from the Minor Planet Center (MPC) are included, as well as the number of observations used in each WISE band (nW2, nW3, nW4) and the corresponding average values of heliocentric and geocentric distances and phase angle of the observations. The ephemerides were retrieved from the MIRIADE service (http://vo.imcce.fr/webservices/miriade/?ephemph). (1 data file).

  14. The Effect of Different Treatments on Seed Dormancy Breaking of Weed Stalked Bur Grass Tragus racemosus (L. AlI.

    Directory of Open Access Journals (Sweden)

    Gholam reza doraki

    2017-01-01

    Full Text Available Introduction: Stalked Bur Grass (Tragus racemosus L. is an angiosperm annual plant with C4 photosynthesis pathway and stolon. It grows in hot and dry summers. This plant spreaded throughout the world from hot regions of Africa. It is regularly seen in barren lands or in between the generations with sequential initial stages with light-texture soils. Seed dormancy is in fact a physiological phenomenon which is observed in the seeds of most crops, pasture plants, medicinal herbs and weeds. Dormancy allows the plant to guarantee its germination and survival for long years and to survive through adverse environmental conditions through its spatial and temporal spread. Materials and Methods: In order to evaluation dormancy break of Tragus racemosus L. seeds, an experiment was carried out based a Randomized Complete Block Design with four replications in research laboratory of Department of Agriculture, Birjand University during 2013. The initial experiments showed that the seeds of Stalked Bur Grass had initial dormancy and were unable to germinate at normal conditions, so that less than 5% of the seeds germinated. The studied treatments for breaking seeds dormancy included control (seeds disinfection by distilled water, wet chilling at 4°C for 1, 2, 3 and 4 weeds, treatment with H2SO4 at 97% for 20, 40, 60 and 80 seconds, treatment with KNO3 at 0.2, 0.4, 0.6 and 0.8% for 24 hours and treatment with Gibberellic acid (GA3 at 50, 100, 200 and 400 ppm. In this study, 25 seeds of Stalked Bur Grass were uniformly placed in petri dishes with the diameters of 9 cm on Watmann filter papers and were applied with 5 mL distilled water. The number of germinated seeds was counted on a daily basis for 21 days. In the end, germination percentage and rate was determined. Results and Discussion: The results revealed that the effect of all studied levels of all treatments were significant on germination percentage and rate. The highest germination percentage (76% was observed under wet chilling treatment at 4°C for 4 weeds and the lowest one (6% was observed in control. The highest germination percentage under H2SO4 treatment was 41% obtained at the level of 80 seconds, under KNO3 treatment was 69% obtained at the level of 0.8%, and under GA3 treatment was 62% obtained at the level of 400 ppm. The highest germination rate (18.24 seeds per day was observed at KNO3 treatment (0.8% and the lowest one (0.91 seeds per day was observed in control. In addition, the highest germination rate under H 2SO4 treatment was 15.28 seeds per day obtained at the level of 80 seconds, under wet chilling was 13.25 seeds per day obtained at the level of 3 weeks, and under GA3 treatment was 12.08 seeds per day obtained at the level of 200 ppm. Wet chilling enhances the production of such stimulants as gibberellins. On the other hand, chilling treatment may reduce ABA amount or the sensitivity of embryo to ABA which can play a role in seeds dormancy breaking. KNO3 is likely to increase the sensitivity of germinating seeds to light acting as a complement factor for phytochrome which results in higher germination of the seeds. Most researchers believe that dormancy is broken by the balance between growth inhibitors like abscisic acid and growth stimulators like gibberellins. In addition, gibberellins activate a special signaling pathway that reduces abscisic acid in seeds and in contrast, auxins and cytokinins of the seeds are increased to a level enough for inducing dormancy break. Conclusion: In the present study, the germinated seeds were counted for 21 days. The highest germination percentage (76% was observed under wet chilling treatment for 4 weeks and the lowest one (6% was observed under control treatment. The highest germination rate (18.24 seeds per day was observed under KNO3treatment (0.8% and the lowest rate (0.91 seeds per day was reported under control treatment. According to the results it can be concluded that the dormancy of Stalked Bur Grass seeds belongs to physiological dormancy type.

  15. Technical feasibility of a seabed gallery seawater intake at Ras Abu Ali Island, Arabian Gulf, Saudi Arabia

    KAUST Repository

    Rachman, Rinaldi; Missimer, Thomas M.

    2014-01-01

    high quality raw seawater even before pretreatment. Subsurface intakes extract seawater indirectly through the geological structure of shoreline or nearshore sediments. Water percolation through geological units provides physical and biological

  16. Évaluer les progrès réalisés | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    3 nov. 2010 ... Kenya : De la viande qui fait « bizz ». Quand la professeure Monica Ayieko fait frire des termites ou des criquets dans le laboratoire de l'université de science et technologie Jaramogi O. Voir davantageKenya : De la viande qui fait « bizz » ...

  17. Recours aux cultures céréalières traditionnelles pour améliorer la ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Millet delicacies : enhancing food security of rural families through production, ... IWRA/IDRC webinar on climate change and adaptive water management ... results of its 2017 call for proposals to establish Cyber Policy Centres in the Global South. ... partnering on a new initiative, aimed at reducing the emerging risk that.

  18. Effects of methyl-jasmonate on 9-methoxycanthin-6-one content in Eurycoma longifolia (Tongkat Ali) root culture

    International Nuclear Information System (INIS)

    Chee, F.M.; Rathinam, X.; Danial, M.

    2015-01-01

    Eurycoma longifolia is a flowering plant from the Simaroubaceae family and it has been identified as one of the most intriguing medicinal plants in Malaysia. In the present study, the production of 9-methoxycanthin-6-one, an alkaloid compound was determined with various methyl-jasmonate (MeJA) concentrations using root culture via liquid system. Quantification of 9-methoxycanthin-6-one was confirmed by using thin layer chromatography (TLC) and high performance liquid chromatography (HPLC). Quantitative analysis using HPLC displayed highest concentration of 9-methoxycanthin-6- one content in the absence of MeJA treatment (control) followed by increasing concentrations of MeJA (1, 10 and 100 micro M). Microanatomical analysis using Scanning Electron Microscope (SEM) has shown that root hair morphology of E.longifolia does not change significantly, whereas roots hair displayed rough surfaces with increases MeJA concentrations. Therefore, MeJA is not a suitable elicitor to increase 9-methoxycanthin-6-one compound in E. lon. (author)

  19. Vladimir Nabokov, un exemple d’aliénation créatrice Vladimir Nabokov, an Instance of Creative Alienation

    Directory of Open Access Journals (Sweden)

    Marie Bouchet

    2009-06-01

    Full Text Available The terms “strange” and “stranger” derive from extraneus, a Latin word literally meaning “outside of”. This article proposes to examine the notions of distance and limit which shape the consciousness of a foreigner / outsider—Vladimir Nabokov. Nabokov lost his native land when he was 18, and was condemned to remain a stranger in a foreign land. In his fiction, many “estranged” characters are to be found, especially as main focalizers or first-person narrators. The present article thus demonstrates how the concept of frontier is crucial to interpreting such alien status: these characters are forever estranged, due to geographical borders, temporal distances or linguistic barriers. Nabokov, himself a trilingual writer, challenged the very idea of a foreign language. His English, which he claimed was merely “second rate”, is indeed quite different from the style of American classics, yet it has a unique poetic flavor. Maybe because he “did not think in any language, but in images”, his condition as a foreigner was not felt as alienating. Contrary to most of his characters, hybridization seems to have been a powerful element inspiring his artistic impulse, as illustrated in his extraordinary linguistic virtuosity and his constant playing on words. Similarly, the repeated inclusion of other semiotic codes (painting, photography, advertisements,… shows that by playing with limits and the interpenetration of familiar and strange(r elements, Nabokov found a creative alternative to the usually alienating condition of being a foreigner.

  20. Med humanističnim in poklicnim izobraževanjem ali kaj terja od nas prihodnost

    Directory of Open Access Journals (Sweden)

    Dušana Findeisen

    1996-12-01

    Full Text Available Dušana Findeisen piše o razmerju med humanističnim in poklicnim izobraževanjem v prihodnosti. Ker kvalifikacij, ki bodo potrebne na trgu dela čez petnajst let, ni mogoče z gotovostjo predvideti, lahko razmišljamo predvsem o tem, kakšne ljudi bomo potrebovali: katere bodo bistvene zmožnosti, ki jih bo treba zajeti med cilje izobraževalnih programov mladih in odraslih. Med bistvenimi usposobljenostmi navaja obvladovanje miselnih procesov, zmožnost spo­razumevanja, usposobljenost za dejavno življenje v skupnosti , razmerje do okolja itd. Opozarja tudi na potrebo po drugačnih didaktičnih postopkih in drugačnem vrednotenju, da bi zagotovili uravnoteženost izobraževanja. Humanistično izobraževanje bo moralo prodreti tudi v ozko usposabljanje odraslih, saj podjetja ne potrebujejo samo dobrih strokovnjakov, temveč ljudi, ki so se zmožni prilagajati in se razvijati.