WorldWideScience

Sample records for aga kui tuul

  1. "Vabaduse tuuled" Ungarist

    Index Scriptorium Estoniae

    2006-01-01

    Sõpruse kinos algab homme filmiprogramm "Vabaduse tuuled" Ungari 1956.a. ülestõusule pühendatud mängufilmide programm (6 ungari filmi aastaist 1965-2004) : Ungari Instituudi, kino "Sõprus" ja PÖFFi koostööprojekt

  2. Vabaduse tuuled Ungarist / Aare Ermel

    Index Scriptorium Estoniae

    Ermel, Aare, 1957-2013

    2006-01-01

    Sõpruse kinos algab homme filmiprogramm "Vabaduse tuuled" Ungari 1956.a. ülestõusule pühendatud mängufilmide programm (6 ungari filmi aastaist 1965-2004) : Ungari Instituudi, kino "Sõprus" ja PÖFFi koostööprojekt

  3. (AGA) Pre Term Babies

    African Journals Online (AJOL)

    Haematological Indices in Healthy Appropriate For-Gestational-Age (AGA) Pre Term Babies. ... International Journal of Medicine and Health Development. Journal Home ... Patient and Methods: All consecutive healthy pre-term new born babies delivered at UNTH and admitted into the hospital NBSCU were included.

  4. Kui panga president end maha laseb... / Aarne Ruben

    Index Scriptorium Estoniae

    Ruben, Aarne, 1971-

    2008-01-01

    Autor vaatleb kriise USA majanduses alates Iseseisvussõjast ning järeldab, et USA majanduses vaheldusid depressioonid perioodilises tempos, nagu 1921. aastal väitis Lev Trotski. Autor leiab, et inimnäoline sotsialism ei ole võimalik, kui impeerium ei ava oma piire ega lase soovijaid impeeriumist välja, inimnäoline kapitalism on aga võimalik majandustõusude ja -languste hinnaga

  5. Mis tunne on lippu heisata ... kui lipp tuules plagisema hakkas / Ülo Russak

    Index Scriptorium Estoniae

    Russak, Ülo, 1954-

    2018-01-01

    Eesti vabariigi ja Kaitseliidu loomise 100. aastapäeva puhul on veebruarikuu hommikutel Pika Hermanni tornis lipu heiskamise toimkonnas noorkotkad ja kodutütred kõikidest Eesti maakondadest. Harju malevast heiskasid lipu Liismarii Laane ja Mihkel Vaarmaa

  6. Tiibeti värske tuul / Reet Varblane

    Index Scriptorium Estoniae

    Varblane, Reet, 1952-

    2011-01-01

    Tiibeti kaasaegse kunsti näitus Tallinnas Temnikova & Kasela galeriis 30. sept.-ni. Pikemalt Tenzing Rigdoli loomingust. Näitus "Himaalaja tuuled" Tallinnas Tam Galeriis 17.-31.08.2011. Tiibeti paviljon Venezia biennaalil 3.06.-31.08.2011. Itaalia kunstniku Ruggero Maggi väljaspool ametlikku programmi organiseeritud näitusel oli enamik eksponeeritud töödest pühendatud Tiibetile, kuid tehtud kunstnike poolt, kes ise seal ei ela

  7. Füüsilisest isikust ettevõtja kui ettevõtlusvorm, rõhuasetusega varalise vastutuse problemaatikal : [bakalaureusetöö] / Katri Tomson ; Tartu Ülikool, õigusteaduskond ; juhendaja: Peeter Jerofejev

    Index Scriptorium Estoniae

    Tomson, Katri, 1981-

    2003-01-01

    FIE kui ettevõtlusvorm - lihtne, aga vastutusrikas, varalise vastutuse problemaatika (vastutusele allutatud vara, abielulised suhted FIE varalist vastutust mõjutava asjaoluna, vara, millele ei või pöörata sissenõuet)

  8. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  9. Maksis vähe, aga tähendab oi kui palju / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016

    2011-01-01

    Neljas kategoorias - parim film, parim meesnäitleja, parim lavastaja, parim stsenarist - Oscari pälvinud filmist "Kuninga kõne" (Inglise-Austraalia-USA, 2010). Film räägib kuningas George VI elust. Loetletud Oscari võitjad

  10. The spatial geochemical characteristics of groundwater and surface in the Tuul River basin, Ulaanbatar, Mongolia

    Science.gov (United States)

    Batdelger, Odsuren; Tsujimura, Maki; Zorigt, Byambasuren; Togtokh, Enkhjargal

    2017-04-01

    The capital city, Ulaanbaatar, is located along the Tuul River and its water supply totally dependent on the groundwater, which comes from the aquifer of the Tuul River. Due to the rapid growth of the population and the increasing human pressures in this basin, water quality has been deteriorating and has become a crucial issue for sustainable environmental and socio-economic development. Hydro-chemical and stable isotope tracing approaches were applied into the groundwater and surface water in order to study geochemical characteristics and groundwater and surface water interaction. The Tuul River water was mostly characterized by the Ca-HCO3 type, spatially variable and it changed into Ca-Na-HCO3 type in the downstream of the city after wastewater (WW) meets the river. Also, electrical conductivity (EC) values of Tuul River are increasing gradually with distance and it increased more than 2 times after WW meets the stream, therefore anthropogenic activities influence to the downstream of the river. The dominant hydro-chemical facies of groundwater were the Ca-HCO3 type, which represents 83% of the total analyzed samples, while Ca- HCO3-Cl-NO3, Na-HCO3, Ca-HCO3-SO4 each represent 4%, and Ca-mixed and Ca-Mg-HCO3 each represent 2% of the total samples. This suggests that groundwater chemistry is controlled by rock-water interaction and anthropogenic pollution. The floodplain groundwater chemical characteristics were similar to Tuul River water and showing lowest EC values. Groundwater far from floodplain showed higher EC (mean value of 498 μs/cm) values than river waters and floodplain groundwater. Also, different kinds of hydro-chemical facies were observed. The stable isotopic compositions revealed less evaporation effect on the groundwater and surface water, as well as an altitude effect in the river water. The similarity of stable isotopes and chemical characteristics of floodplain groundwater and river water suggests that alluvial groundwater is recharged by

  11. Kui õppimine ei edene / Tiia Lister

    Index Scriptorium Estoniae

    Lister, Tiia

    2006-01-01

    Soome Instituudis toimus 27. veebruaril õppepäev "Kui õppimine ei edene", et tutvustada, kuidas Soomes on nii riiklikul kui ka koolisisesel tasandil liigutud õpilasele kõige sobivama ja kasulikuma abistamisvormi otsingul

  12. Haridus kui investeering / Silver Meikar

    Index Scriptorium Estoniae

    Meikar, Silver, 1978-

    2004-01-01

    Ilmunud ka: Vali Uudised, 3. märts 2004, lk. 2; Põhjarannik, 3. märts 2004, lk. 2; Severnoje Poberezhje, 3. märts 2004, lk. 2; Sakala, 3. märts 2004, lk. 2; Meie Maa, 4. märts 2004, lk. 2; Koit, 4. märts 2004, lk. 6; Harjumaa, 5. märts 2004, lk. 2; Narvskaja Nedelja, 13. märts 2004, lk. 4; Pärnu Postimees, 17. märts 2004, lk. 15. Autor arutleb küsimuse üle, kui palju peaks haridusest kinni maksma maksumaksja ja kui palju hariduse omandaja

  13. Harry Potter ja Scarlett käivad kohut / Ilona Martson

    Index Scriptorium Estoniae

    Martson, Ilona, 1970-

    2001-01-01

    Alice Randalli romaan "Tuul on läinud" - samad sündmused kui Margaret Mitchelli romaanis "Tuulest viidud", ainult neegerorjade vaatevinklist. Nancy Stofferi raamatud "Larry Potter ja tema parim sõber Lilly" ja "Legend Rah'ist ja Mugudest" ilmusid 1984. a. Joanne Kathleen Rowlingi "Harry Potter" lood aga valmisid hiljem

  14. [Max Weber. Poliitika kui elukutse ja kutsumus. Teadus kui elukutse ja kutsumus] / Hermo Kuusk

    Index Scriptorium Estoniae

    Kuusk, Hermo, 1976-

    2011-01-01

    Tutvustus: Weber, Max. Poliitika kui elukutse ja kutsumus ; Teadus kui elukutse ja kutsumus / tõlkijad: Jaan Isotamm, Henn Käärik, Kaia Sisask. Tallinn : TLU Press, 2010. (Bibliotheca controversiarum)

  15. AGA answers complaints on burner tip prices

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This paper reports that the American Gas Association has rebutted complaints that natural gas prices have dropped at the wellhead but not at the burner tip. AGA Pres. Mike Baly the an association study of the issue found that all classes of customers paid less for gas in 1991 than they did in 1984, when gas prices were at their peak. He the, the study also shows that 100% of the wellhead price decline has been passed through to natural gas consumers in the form of lower retail prices. Baly the the average cost of gas delivered to all customers classes fell by $1.12/Mcf from 1984 to 1991, which exceeds the $1.10/Mcf decline in average wellhead prices during the same period

  16. Eesti kui usuasi / Jaan Kaplinski

    Index Scriptorium Estoniae

    Kaplinski, Jaan, 1941-

    1999-01-01

    Eesti on ühtaegu riik ja riigiusk, mille dogmad määrab president. Ilmunud ka: Molodjozh Estonii, 14. mai 1999, lk. 2. Vastukajad : Vahtre, Lauri. Mäss kui usuasi // Eesti Ekspress (1999) 21. mai, lk. 7; Mutt, Mihkel. Kosmopoliitiline euroskeptitsism // Eesti Ekspress (1999) 27. mai, lk. B7; Langemets, Andres. Meie identiteedi kriitiline eelarve // Postimees (1999) 5. juuni, lk. 7; Ivask, Peeter. Kirjake Kaplinskile, Mutile ja teistele // Eesti Ekspress (1999) 10. juuni, lk. A6; Liiv, Peeter. Veel Eesti Paavstiriigist // Sirp (1999) 18. juuni, lk. 2; Ehin, Andres. Eestlus mahub eurooplusse küll : oleme ühtaegu õhtumaalased, soomeugrilased ja postsovetid // Postimees (1999) 3. juuli, lk. 7

  17. Õõvafilm on fun, aga mitte ainult / Tiina Lokk

    Index Scriptorium Estoniae

    Lokk, Tiina, 1955-

    2006-01-01

    PÖFF-i abiga toimub Haapsalus õudusfilmide festival. Selle sissejuhatuseks annab T. Lokk pikema sissevaate õudusfilmi kui žanri kujunemisse ja väärtustesse. Lisatud festivalil näidatavate filmide nimekiri

  18. AGA predicts winter jump in residential gas price

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The American Gas Association predicts the average heating bill for residential gas consumers could increase by as much as 18% this winter. AGA Pres. Mike Baly said, Last year's winter was warmer than normal. If the 1992-93 winter is similar, AGA projects that residential natural gas heating bills will go up about 6%. If we see a return to normal winter weather, our projection show the average bill could rise by almost 18%

  19. Aidsiennetus kui kõlblusprobleem / Valdar Parve

    Index Scriptorium Estoniae

    Parve, Valdar, 1948-

    2003-01-01

    Aafrika aidsisurmade statistika ekstrapoleerimine Eesti oludesse on väärtegu; neid andmeid paisutatakse arutluslikult, nii mujal maailmas kui ka Eestis - ametliku aidsiennetuse tähtsaimaks vormiks on seni hirmu eskaleerimine

  20. Riigikogulased ongi teistmoodi asendis. Aga mitte nii teistmoodi, kui nad hetkel arvavad / Rein Taagepera ; interv. Urmo Soonvald

    Index Scriptorium Estoniae

    Taagepera, Rein, 1933-

    2007-01-01

    Politoloog Rein Taagepera vastab Riigikogu suurust, tööd ning seaduseelnõu, mis vabastab parlamendiliikmed kuluhüvitiste avalikustamisest, puudutavatele küsimustele. Lisa: Soome parlamendist õpitakse kulutamist, mitte tööl käimist; Rein Taagepera: teadlane, presidendikandidaat, Res Publica looja

  1. KONFLIK LINGKUNGAN DI KAMPUNG AGAS, TANJUNG UMA, BATAM (Environmental Conflict in Kampung Agas, Tanjung Uma, Batam

    Directory of Open Access Journals (Sweden)

    Saprial Saprial

    2004-11-01

    Full Text Available ABSTRAK Perkembangan kota Batam sebagai kawasan industri, perdagangan, pelabuhan, dan pariwisata, membawa tidak saja dampak positip, melainkan juga dampak negatif. Salah satu dampak negatif yang muncul adalah konffik lingkungan dalam bentuk pencemaran air di sungai Jodoh yang menganggu pemukiman liar di Kampung Agas, Tanjung Uma. Penelitian ini bertujuan untuk mengkaji akar masalah konflik dan resolusinya. Penelitian ini merupakan studi deskriptif-kualitatip, dengan data yang dikumpulkan melalui wawancara mendalam dengan pihak-pihak yang terlibat dalam konflik. Penelitian ini menemukan bahwa akar masalah konffik adalah konflik spasial antara permukiman liar dan pembangunan ruko yang menimbulkan limbah di sekitar permukiman liar. Tidak dibangunnya IPAL memicu protes warga di permukiman liar dan terjadilah konflik. Penelitian ini melihat bahwa penyelesaian konflik dalam bentuk kompensasi atau “sagu hati" tidak menyelesaikan akar masalah konflik. Walaupun begitu, penyelesaian ini dipandang oleh pihak-pihak yang berkonflik sebagai hasil mufakat yang dimungkinkan untuk menghindari konflik sosial yang lebih besar. Penelitian ini juga menemukan bahwa bentuk penyelesaian konflik melalui musyawarah dan mufakat dapat dilakukan secara efektif sejauh ada mediator yang dipercaya oleh pihak-pihak yang bersengketa.   ABSTRACT The development of Batam City as an area for industry, trade, ship transit, and tourism activities brings not only positive impacts, but negative impact as well. One of the negative impacts is environmental conflict in the form of water pollution in Sei Jodoh downstream which affected informal settlement in Kampung Agas, Tanjung Uma. This research aimed to study the roots of the conflict and evaluated the resolution. It adopted a descriptive, qualitative research method. Data were collected through in-depth interviews with parties involved in the conflict. The research founded that the root causes of the environmental conflict was the

  2. Urinary tract infections at aga Khan University hospital nairobi - a ...

    African Journals Online (AJOL)

    2013-06-11

    Jun 11, 2013 ... (Uti) are normally treated empirically and urine culture is usual ordered for as a last ... symptomatic Uti in patients at aga Khan University hospital by looking at the trends of Uti ... in the context of pyelonephritis in pregnancy(9).

  3. Screening strategies for gestational diabetes mellitus at the Aga ...

    African Journals Online (AJOL)

    Background: Universal screening strategy for gestational diabetes mellitus offers biochemical screening to all women irrespective of risk factor status while selective strategy screens only those with risk factors. The Aga Khan University Hospital adopted a selective screening protocol by consensus. This study compares both ...

  4. Sotsialistlik realism kui modernsuse projekt / Rein Veidemann

    Index Scriptorium Estoniae

    Veidemann, Rein, 1946-

    2001-01-01

    Artikkel põhineb 19. mail 2001 Tartus peetud konverentsiettekandel ja seda võib vaadelda ka kui üht järjekordset lüli viimastel aastatel modernismi ja postmodernismi ning eesti sõjajärgse kirjandussituatsiooni üle käivast dialoogist

  5. Gaas on paksem kui veri / Andrei Hvostov

    Index Scriptorium Estoniae

    Hvostov, Andrei, 1963-

    2010-01-01

    Muutustest rahvusvahelisel gaasiturul. Poola energeetikaettevõte PGNiG on loomas koos Gazpromiga konsortsiumi maagaasi ühiseks tootmiseks Siberis. Poola hakkab saama maagaasi odavamalt kui ülejäänud Euroopa riigid, Gazprom saab arvatavasti vastutasuks juurdepääsu Poola torutranspordile

  6. Aga sellepärast, et on po... / Aleksandr Astrov

    Index Scriptorium Estoniae

    Astrov, Aleksandr

    2005-01-01

    Arutledes venekeelse valija hääletuskäitumise ümber juhib autor tähelepanu, et Eestis sätestab üks konkreetne seadus venelastele valimisõiguse, andes neile reaalse poliitilise jõu, teine aga piirab nende juurdepääsu ainult keele kaudu ligipääsetavatele eetikaressurssidele, mis võimaldaksid teha teadlikku valikut

  7. Huvi Eesti kui puhkusesihtkoha vastu Hollandi elanikkonna hulgas / Piret Kallas

    Index Scriptorium Estoniae

    Kallas, Piret

    2011-01-01

    EASi tellimusel 2011. aasta veebruaris Hollandi uuringufirma Right Marktonderzoek en Advies B. V korraldusel toimunud 18-74-aastaste Hollandi elanike online-arvamusuuringust Eestist kui puhkusesihtkohast

  8. Parem teine kui viimane / Andreas Kaju

    Index Scriptorium Estoniae

    Kaju, Andreas

    2006-01-01

    Internet peaks olema kõikidele Eesti inimestele tagatud põhiõigus. Sama ka Võrumaa Teataja 25. mai 2006, lk. 2 ; Põhjarannik 25. mai 2006, lk. 2 ; Koit 25. mai 2006, lk. 6 ; Meie Maa 25. mai 2006, lk. 2 ; Sakala 26. mai lk. 2 ; Vooremaa 30. mai 2006, lk. 2 ; Hiiu Leht 30. mai 2006, lk. 2 ; Elva Postipoiss 3. juuni 2006, lk. 4 : Lääne Elu 30. mai 2006, lk. 2, pealkiri kujul : Tasuta internet etrvele riigile - parem teine kui viimane

  9. Comparison of Patent Claim Construction between Netherlands and Germany on Basis of AGA v. Occlutech

    NARCIS (Netherlands)

    Tsoutsanis, A.; Kau, C.

    2013-01-01

    This article provides a brief overview on how the Dutch and German courts interpret the claims of a patent. It briefly compares each national approach on the basis of the recent AGA v Occlutech litigation in both countries. The dispute between AGA and Occlutech involved socalled ‘‘occluders’’, a

  10. Stapled hemorrhoidopexy: The Aga Khan University Hospital Experience

    International Nuclear Information System (INIS)

    Athar, Ali; Chawla, Tabish; Turab, Pishori

    2009-01-01

    Stapled hemorrhoidopexy for prolapsing hemorrhoids is conceptually different from excision hemorrhoidectomy. It does not accompany the pain that usually occurs after resection of the sensitive anoderm. This study was carried out to evaluate the clinical outcome of stapled hemorrhoidopexy at The Aga Khan University Hospital. A sample of 140 patients with symptomatic second-, third-, and fourth-degree hemorrhoids and circumferential mucosal prolapse underwent stapled hemorrhoidopexy from July 2002 to July 2007. They were evaluated for postoperative morbidity, analgesic requirement, and recurrence. Seventy-eight percent were males and the mean age was 45 (range 16-90) years. The mean operative time was 35 (15-78) min. The mean parenteral analgesic doses during the first 24 h were 2.1. All patients received oral analgesics alone after 24 h. No significant postoperative morbidity was observed. The mean in-patient hospital stay was 1.3 (0-5) days. Patients were followed-up for 24 (range, 2-48) months. Minor local recurrence of hemorrhoids was seen in four patients and was managed by band ligation. Stapled hemorrhoidopexy procedure was found safe, well tolerated by patients with minimal parenteral analgesic use and early discharge from the hospital. (author)

  11. Kus oli sinu firma, kui revolutsioon algas? / Andres Kask

    Index Scriptorium Estoniae

    Kask, Andres

    2013-01-01

    EXPO 2015, Milanos. Maailmanäitus kui üks suuremaid riikidevahelisi kommunikatsiooniüritusi, eesmärgiks jagada konkurentidele ja partneritele teavet olulise kohte osaleva riigi arenguetapis. Eesti paviljonist EXPO-l

  12. Tühi galerii kui kunstiteos / Ants Juske

    Index Scriptorium Estoniae

    Juske, Ants, 1956-2016

    2000-01-01

    Soome kunstnikegrupi "Forest Camp" minimalistlik näitus "King kong" Tallinna Linnagaleriis - tühi galerii kui installatsioon. Kunstnikud Juha van Ingen, Pasi Karjula, Antti Keitilä, Markku Kivinen ja Marko Vuokala

  13. Realism tagab rahu paremini kui ideoloogia / Jarmo Virmavirta

    Index Scriptorium Estoniae

    Virmavirta, Jarmo

    2008-01-01

    Gruusia-Venemaa sõjalisest konfliktist, väikeriikide poliitikast, Soome kui OSCE eesistujamaa rahvusvahelisest positsioonist ning suhetest Venemaaga. Gruusia näitab, et rahvusvahelised suhted vajavad rohkem realismi, kirjutab autor

  14. Kui tasuta peab olema tasuta kohustuslik haridus? / Nele Parrest

    Index Scriptorium Estoniae

    Parrest, Nele, 1978-

    2010-01-01

    Põhiõiguse saada tasuta kohustuslikku haridust ja koolikohustuse kui põhikohustuse seostest. Põhiseaduse §-s 37 sätestatud tasuta kohustusliku hariduse piiridest ja sisust. Hariduspõhiõiguse rahvusvahelisest ja põhiseaduslikust taustast

  15. Kui silmus tõmbus koomale / Ants Juske

    Index Scriptorium Estoniae

    Juske, Ants, 1956-2016

    2006-01-01

    Adamson-Ericu autoporteest ja 1949. aastal alanud rünnakutest kunstniku "kui formalisti ja kodanliku natsionalisti" vastu. Illustratsiooniks "Autoportree II (Autoportree silmusega)". Õli, lõuend, 1929. Adamson-Ericu muuseum

  16. The role of anthropometric, growth and maturity index (AGaMI) influencing youth soccer relative performance

    Science.gov (United States)

    Bisyri Husin Musawi Maliki, Ahmad; Razali Abdullah, Mohamad; Juahir, Hafizan; Muhamad, Wan Siti Amalina Wan; Afiqah Mohamad Nasir, Nur; Muazu Musa, Rabiu; Musliha Mat-Rasid, Siti; Adnan, Aleesha; Azura Kosni, Norlaila; Abdullah, Farhana; Ain Shahirah Abdullah, Nurul

    2018-04-01

    The main purpose of this study was to develop Anthropometric, Growth and Maturity Index (AGaMI) in soccer and explore its differences to soccer player physical attributes, fitness, motivation and skills. A total 223 adolescent soccer athletes aged 12 to 18 years old were selected as respondent. AGaMI was develop based on anthropometric components (bicep, tricep, subscapular, suprailiac, calf circumference and muac) with growth and maturity component using tanner scale. Meanwhile, relative performance namely physical, fitness, motivation and skills attributes of soccer were measured as dependent variables. The Principal Component Analysis (PCA) and Analysis of Variance (ANOVA) are used to achieve the objective in this study. AGaMI had categorized players into three different groups namely; high (5 players), moderate (88 players) and low (91 players). PCA revealed a moderate to very strong dominant range of 0.69 to 0.90 of factor loading on AGaMI. Further analysis assigned AGaMI groups as treated as independent variables (IV) and physical, fitness, motivation and skills attributes were treated as dependent variables (DV). Finally, ANOVA showed that flexibility, leg power, age, weight, height, sitting height, short and long pass are the most significant parameters statistically differentiate by the groups of AGaMI (p<0.05). As a summary, body fat mass, growth and maturity are an essential component differentiating the output of the soccer players relative performance. In future, information of the AGaMI model are useful to the coach and players for identifying the suitable biological and physiological demand reflects more comprehensive means of youth soccer relative performance. This study further highlights the importance of assessing AGaMI when identifying soccer relative performance.

  17. "kui see päike nyyd niimoodi paistab..." : [luuletused] / [Mesikepp, Indrek] fs

    Index Scriptorium Estoniae

    fs, pseud., 1971-

    2004-01-01

    Sisu: "kui see päike nyyd niimoodi paistab..." ; Kodus ; "naha- ja suguhaiguste haigla..." ; "vaipadega kaetud..." ; "need vaiksed eraldatud paigad..." ; "kui ykskord lubatakse väsinud olla..." ; "jaamahoone külmal pingil..."

  18. Kristjan Lepik : Olympic puhul on käive olulisem kui kasum / Enn Tosso

    Index Scriptorium Estoniae

    Tosso, Enn, 1976-

    2008-01-01

    Kasiinoketi Olympic Entertainment Group esimese poolaasta kasum oli 97,4 miljonit krooni, mis on 48,4 protsenti vähem kui mullu samal perioodil. Käive kasvas aastaga rohkem kui kolmandiku. Lisa: Tulemused

  19. Teadlase elukutse kui missioon ja pühendumine / Rein Ruutsoo

    Index Scriptorium Estoniae

    Ruutsoo, Rein, 1947-

    2011-01-01

    Tutvustus: Weber, Max. Poliitika kui elukutse ja kutsumus ; Teadus kui elukutse ja kutsumus / tõlkijad: Jaan Isotamm, Henn Käärik, Kaia Sisask. Tallinn : TLU Press, 2010. (Bibliotheca controversiarum)

  20. Kotler : teiste inimeste arvamust usutakse enam kui meediat / Philip Kotler

    Index Scriptorium Estoniae

    Kotler, Philip

    2007-01-01

    Philip Kotler vastab küsimustele, millised faktorid mõjutasid tänapäevase turunduse kujundamist, millised vahendid on kasulikud tarbijate leidmiseks, meelitamiseks ja hoidmiseks ning milline on tema arvamus selle kohta, et internetti ja sotsiaalseid võrgustikke nähakse kui tuleviku turundusvahendeid

  1. Narr kui ajastu metafoor / Kärt Hellerma

    Index Scriptorium Estoniae

    Hellerma, Kärt, 1956-

    2001-01-01

    William Shakespeare'i "Kuningas Lear" (lav. Priit Pedajas) ja Pedro Calder̤n de la Barca "Elu on unenägu" (lav. Ingo Normet) Eesti Draamateatris. Ilmunud ka kogumikus : Hellerma, Kärt. Avanenud ruum. Tallinn : Eesti Keele Sihtasutus, 2006, lk. 213-216. Pealk. Narr kui meie aja kangelane

  2. Riik kui kodu = The state as home / Tiit Sild

    Index Scriptorium Estoniae

    Sild, Tiit, 1977-

    2010-01-01

    Arhitektuurikonverentsist "Riik kui kodu". Pikemalt Euroopa Komisjoni asepresidendi Siim Kallase ettekandest Brüsseli Euroopa kvartali planeerimiskonkursist, Euroopa Komisjonil valmivast arhitektuuripoliitika teatmikust. Regionaalminister Siim Valmar Kiisleri, kultuuriminister Laine Jänese, vandeadvokaat Jüri Raidla ja arhitekt Andres Alveri ettekannetest. Linnakeskkonna kvaliteedi tõstmisest Tartus

  3. Eesti kui Belgia : viimane baltlane Hermann Keyserling / Jaan Undusk

    Index Scriptorium Estoniae

    Undusk, Jaan, 1958-

    2003-01-01

    H. Keyserlingi (1880-1946) "Balti filosoofia" käsitlusest, belgiseerimise plaanist ning Baltikumist kui multikulturalismi taimelavast. Lisad: "Balti küsimus", "Eesti poliitiline tähendus. Suhtumine bolshevismi", "Balti ühisrinne", "Vastus krahv Hermann Keyserlingile tema Balti ühisrinde asjus", "Meie baltlased" lk. 71-78

  4. Alliksaar: rohkem kui legend / Paul-Eerik Rummo

    Index Scriptorium Estoniae

    Rummo, Paul-Eerik, 1942-

    2010-01-01

    Artur Alliksaare avaldusest, mis pärineb tema toimikust (NSVL Justiitsministeeriumi parandusliku töö laagrite režiimi- ja operatiivosakonna toimik nr. 5348). Avalduses annab Artur Alliksaar end üles kui Saksa sõjaväe vabatahtliku. Vt ka Paul-Eerik Rummo artiklit "Artur Alliksaare dokumenteeritud legend" ajakirjas Keel ja Kirjandus, 2003, nr. 4.

  5. Kui too suvi poleks olnud nii vihmane / Theodore K. Rabb

    Index Scriptorium Estoniae

    Rabb, Theodore K.

    2003-01-01

    1520. aastatest, mil olid rängad ilmastiku tingimused, mis takistasid Osmanite sultani Süleyman Toreda sissetungi Euroopasse. Samal teemal : Pierson, Peter. Kui püha liiga poleks kõikuma löönud, lk. 128

  6. Nervous Cowboys ja Eesti kui märk Prahas

    Index Scriptorium Estoniae

    1999-01-01

    16. XI toimus Tšehhi pealinna Praha Karli sillal Eesti Taassünnipäevale pühendatud performance 'Eesti kui märk', mille viis läbi kunstirühmitus Nervous Cowboys koosseisus Kiwa ja Jasper Zoova. Eesti Suursaatkonnas avati näitus, kus eksponeeritakse xerox-tehnikas graafilisi lehti ja performance'i videdokumentatsiooni.

  7. Aasta rosina sai "Kui Arno isaga koolimajja jõudis..."

    Index Scriptorium Estoniae

    2008-01-01

    Eesti Lastekirjanduse Keskus andis 2007. a. Rosina auhinna Oskar Lutsu "Kevade" kommenteeritud kooliväljaandele: "Kui Arno isaga koolimajja jõudis... " / [Oskar Lutsu "Kevade" 14. trüki põhjal koostanud Aili Kalavus, Mare Müürsepp]. Tallinn : Ilo, 2007

  8. Siim Kallas: Rail Baltica edeneb, aga veel pole mõtet kiirrongi oodata / Urmas Jaagant

    Index Scriptorium Estoniae

    Jaagant, Urmas

    2010-01-01

    Euroopa Komisjoni voliniku Siim Kallase sõnul pole mingit põhjust, miks Eestis ei võiks sõita 200 km/h liikuvad kiirrongid, vajaliku raudtee ehitamine võib olla isegi odavam kui uus maantee. Kuid oluline on küsimus, kuidas tekitada erasektoris piisavalt suur kindlustunne, et Rail Baltica projekt ära tasub

  9. Ameerika toode? No tänan, aga jah / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo

    2006-01-01

    Politoloogid Peter Katzenstein ja Robert Keohane uurisid, kas Ameerika firmad kannatavad Ameerika poliitika tõttu. Kuigi küsitlusele vastanud eurooplased arvasid, et nad boikotiksid Coca-Colat ja McDonald'sit, ostsid nad siiski nii kokakoolat kui ka hamburgereid

  10. Kui suudab Steve, suudab ka Apple / Tarvo Vaarmets

    Index Scriptorium Estoniae

    Vaarmets, Tarvo

    2008-01-01

    Ehkki Apple'i kolmanda kvartali kasum kasvas kolmandiku võrra ja oli oodatust kümnendiku jagu suurem, langes ettevõtte aktsia hind börsil. Investoreid teeb rahutuks nii ettevõtte juhi Steve Jobsi tervis kui ka Apple'i majandusprognoos neljandaks kvartaliks. Lisa: Analüütikud on aktsia suhtes üksmeelel. Diagramm: Aktsia hinnal taas suund alla

  11. Hassan Aga and his Government in Algiers. The Consolidation of a Mediterranean Myth

    Directory of Open Access Journals (Sweden)

    Fernando FERNÁNDEZ LANZA

    2014-12-01

    Full Text Available This work tries to describe graphically the consolidation of a social myth in the unsettled Mediterranean of the 16th century, through a personage: the Spanish convert to Islam Hassan Aga (Azan Aga, the Sardinian renegade who succeeded Hayreddin Barbarrosa at the helms of Algiers from 1533 till his death ten years later. This was a period of intense activity, with the climax that came with the expedition of Charles to Algiers in 1541, whose spectacular defeat can be considered as the principal nucleus of the myth of this popular personage who as a Sardinian slave came to defeat the Emperor. A myth of social ascension with maquiavelical profiles of a new prince of the frontiers.

  12. Organisatsiooni rolli mõõtmine kui vahend organisatsiooni potentsiaali määramiseks / Heinrich Ausmees

    Index Scriptorium Estoniae

    Ausmees, Heinrich, 1941-

    2002-01-01

    Kasut. kirj. lk. 102. - Kokkuvõte ingl. k. lk. 103. Organisatsiooni kui vahendi kvaliteedi määramise probleemiks on see, mida, kuidas ja kes mõõdab organisatsiooni kui vahendi sobilikkust kasumi saamisele kaasaaitamises

  13. "Suveöö kui kiisu vagalt ..." : [luuletused] / Aleksandr Martõnov

    Index Scriptorium Estoniae

    Martõnov, Aleksandr

    2004-01-01

    Sisu: "Suveöö kui kiisu vagalt ..." ; "Teede ääres lumehanged ..." ; Kui hea ... ; Las ma lähen ... ; "Võtsin põlluteed ma minna ..." ; "Ei valgus mulle taevast tule ..." ; Tõsta mind, elu! .... Andmeid autori kohta lk. 39. Luuletused paralleelselt eesti ja ersa keeles

  14. Reisikott kui isikupärane reisikaaslane / Karoli Saar

    Index Scriptorium Estoniae

    Saar, Karoli

    2011-01-01

    Uurimuse eesmärgiks oli vaadelda reisikottide liike ja kujundusvõtteid nii ajaloos kui ka tänapäeval, pöörates tähelepanu kottidel kasutatavale dekoorile ja funktsionaalsuse ning mustri koosmõjule. Eraldi on välja toodud reisimise ja meene omavaheline seos, Eesti sümboolika kasutamine suveniiridel ning ülevaade Eestis tegutsevatest ettevõtetest ja konkurssidest. Praktilise tööna valmis reisikottide kollektsioon, mis kajastab eestlaste tasakaalukat ja looduslähedast elutunnetust

  15. A novel base change leading to Hb Vanderbilt [β89(F5)Ser→Arg, AGT>AGA].

    Science.gov (United States)

    Goodyer, Matthew J; Elhassadi, Ezzat I; Percy, Melanie J; McMullin, Mary F

    2011-01-01

    We describe a high oxygen affinity hemoglobin (Hb) variant (Hb Vanderbilt) as a result of a heterozygous novel base change from T to A at codon 89 (AGT>AGA) leading to an amino acid change from serine to arginine.

  16. Ameerikasse õpetama / Tiina Tuuling

    Index Scriptorium Estoniae

    Tuuling, Tiina

    2007-01-01

    Nõo Reaalgümnaasiumi ja Nõo Põhikooli inglise keele õpetaja Tiina Tuulingu töötamisest õpetajana USAs Pennsylvania osariigis Haverfordi Põhikoolis Fulbrighti õpetajate vahetusprogrammi raames

  17. Teater / Mari Tuuling

    Index Scriptorium Estoniae

    Tuuling, Mari

    1999-01-01

    4. juunil Linnateatri hoovil asuvas lavaaugus esietenduvast "Prints ja kerjus", Mark Twaini romaani järgi kirjutanud Peeter Sauter, lavastaja Jaanus Rohumaa. Suvelavastuse tegijate ja näitlejate nimekiri

  18. Põud : [luuletused] / Enn Tuuling

    Index Scriptorium Estoniae

    Tuuling, Enn

    2002-01-01

    Sisu: Põud ; Aian ; Inne pikset ; Süküsõdang tarõn ; Üü tulek ; Rebäse külä vana sann ; Vana maja ; "Kes oll̀ tuu miis, kes sinno ehit ..." ; Pööningul ; Talv 1960/61. Eluloolisi andmeid autori kohta lk. 358-359

  19. Seadusandja peab mõtlema nagu filosoof, aga kirjutama nagu talupoeg / Heiki Raudla

    Index Scriptorium Estoniae

    Raudla, Heiki, 1949-

    2001-01-01

    Ilmunud ka: Põhjarannik : Laupäev, 24. nov. 2001, lk. 2; Severnoje Poberezhje: Subbota, 24. nov. 2001, lk. 2; Meie Maa, 24. nov. 2001, lk. 2; Pärnu Postimees, 24. nov. 2001, lk. 2; Võrumaa Teataja, 24. nov. 2001, lk. 2; Hiiu Leht, 27. nov. 2001, lk. 2; Lääne Elu, 27. nov. 2001, lk. 4; Nädaline, 27. nov. 2001, lk. 4; Vooremaa, 27. nov. 2001, lk. 2; Koit, 27. nov. 2001, lk. 6. Kodanikuühiskond saab tõelise arenguvõimaluse alles siis, kui kodanikud osalevad demokraatlikus juhtimises

  20. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    Energy Technology Data Exchange (ETDEWEB)

    Ermolayev, Vladimir [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Cohrs, Christian M. [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Mohajerani, Pouyan; Ale, Angelique [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Hrabé de Angelis, Martin [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Ntziachristos, Vasilis, E-mail: v.ntziachristos@tum.de [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany)

    2013-03-08

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1{sup Aga2/+}, animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing.

  1. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    International Nuclear Information System (INIS)

    Ermolayev, Vladimir; Cohrs, Christian M.; Mohajerani, Pouyan; Ale, Angelique; Hrabé de Angelis, Martin; Ntziachristos, Vasilis

    2013-01-01

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1 Aga2/+ , animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing

  2. "Parim" on subjektiivne, aga kõhutundest ka ei piisa / Inga Kuusik

    Index Scriptorium Estoniae

    Kuusik, Inga, 1961-

    2007-01-01

    Ilmunud ka: Finansovõi Menedzhment : infovõpusk nr. 13 apr. lk. 6-7. Saku Õlletehase uus finantsjuht oma tööst tubakatootja Imperial Tobacco Grupi Kesk-Aasia regiooni finantsdirektorina Kõrgõzstanis, Saku Õlletehase kapitali struktuurist, finantsdirektori rollist ettevõttes ja tööjõu värbamisest Saku Õlletehases. Lisad: Saku Õlletehas 2006: mõõdukas käibe-, aga suur kasumikasv; Tabel: Saku Õlletehase dividendimaksed 1997-2007

  3. "Kui seisan kodus..." : [luuletused] / Lucille Clifton ; tõlk. Jüri Talvet

    Index Scriptorium Estoniae

    Clifton, Lucille

    2008-01-01

    Sisu: "Kui seisan kodus..." ; Juured ; Hämarale Moosesele ; Testament ; Pihtimus ; Oma puusade austuseks ; Luuletus oma üsale ; Pähklipuuistanduse kalmistul Lõuna-Carolinas, 1989. Elu- ja loomeloolisi andmeid autori kohta lk. 505

  4. Mälu ja liikumine kui ruumipraktikad = Memory and motion as spatial practices / Morten Lund

    Index Scriptorium Estoniae

    Lund, Morten, 1972-

    2015-01-01

    Artiklis on käsitletud nelja uurimust ruumist, mis illustreerivad võimalusi, kuidas sisearhitektuur võib kaasata mälu ja liikumise kui ruumilised praktikad läbi ruumilise kunsti ning 1:1 eksperimentide

  5. Ametnike teenistuslehed kui ajalooallikas Eestimaa kubermanguvalitsuse arhiivifondi näitel / Ilja Davõdov

    Index Scriptorium Estoniae

    Davõdov, Ilja

    2016-01-01

    Teenistulehed kui ametnikkonna arvestuse peamine dokument. Teenistuslehe formularist. Kubermanguvalitsusest ja ametnikkonna struktuurist. Isikutoimikute kogumist Eestimaa kubermanguvalitsuse fondis (nimistu nr 13). Isikutoimikute süstematiseerimisest kronoloogiliselt ja ametkondliku kuuluvuse järgi. Isikutoimikute representatiivsusest

  6. "Kevad uhkelt sammub mal kui jumalanna..." : [luuletused] / Ljubov Dergatshova ; tlk. Arvo Valton

    Index Scriptorium Estoniae

    Dergatshova, Ljubov

    2006-01-01

    Sisu: "Kevad uhkelt sammub mal kui jumalanna..." ; "Maga, pojake, maga mu päike..." ; "Mis kaunis õhtu! Lumi tahke..." ; "Raskel tunnil sirutab kes käe...". Luuletused paralleelselt ersa ja eesti keeles

  7. Kuldlõige kui esteetikamõte ja empiiriline tõik / Vladimir J. Konecni

    Index Scriptorium Estoniae

    Konecni, Vladimir J.

    2003-01-01

    Kuldlõike kui esteetikamõtte tutvustus, tähtsus Lääne maalikunsti struktuuris ja kompositsioonis ning olemuse tunnetatavus esteetikas. Ettekanne XV rahvusvahelisel esteetikakongressil Tokios 2001. aastal

  8. Iisrael paneb ise piirid paika, kui vaja / Yitzhak ben Israel ; interv. Sten A. Hankewitz

    Index Scriptorium Estoniae

    Israel, Yitzhak ben

    2006-01-01

    Iisraeli partei Kadima kandidaat parlamendivalimistel Yitzhak ben Israel selgitab, milline on programm, kui peaministriks saab Ehud Olmert. Tema sõnul Hamas ilmselt ei nõustu Teekaardi-nimelise rahuplaaniga

  9. Eesti keele kui teise keele oskuse riiklik standard üldhariduses / Silvi Vare

    Index Scriptorium Estoniae

    Vare, Silvi, 1939-

    2004-01-01

    Eesti keele kui teise keele riikliku standardiga seotud probleemidest, eesti keeleõpetuse tegelikust tasemest Eesti üldhariduskoolides. Vene gümnaasiumi lõpetajate eesti keele oskusest. Sisaldab tabeleid

  10. Personaliotsinguteenust tasub kasutada siis, kui rahaline kokkuhoid pole esmane / Merike Lees

    Index Scriptorium Estoniae

    Lees, Merike, 1976-

    2006-01-01

    Ilmunud ka: Delovõje Vedomosti 1. veebr. lk. 13. Personaliotsinguteenuse kasutamine on õigustatud siis, kui ettevõttes pole personalispetsialisti ning rahaline kokkuhoid pole esmatähtis. Kommenteerivad: Eero Erastus, Madis Sander ja Marti Rehemaa

  11. Juhtimiskonsultant: Q Vara saneerimiskava kui õudusunenägu / Anne Oja

    Index Scriptorium Estoniae

    Oja, Anne, 1970-

    2009-01-01

    Võlgades Q Vara küsib võlakirjainvestoritelt nelja-aastast armuaega ning õigust maksta laenud tagasi siis, kui neile kinnisvara müügist raha laekub. Vt. samas: Q Vara võlausaldajad kannavad kaotusi

  12. Tuleviku-uuringud kui teadmiste valdkond = Futures studies as a field of knowledge / Anita Rubin

    Index Scriptorium Estoniae

    Rubin, Anita

    2005-01-01

    Tuleviku-uuringute algpunktid. Tuleviku-uuringud kui teaduslik distsipliin. Tuleviku moodustamine olevikust. Bibliograafia lk. 34. Artikli kommentaariks Panu Lehtovuori tuleviku-uuringute meetodite kasutamisest linnauuringutes ja teadusuuringutel põhinevast kavandamisest/disainist

  13. AGA: Interactive pipeline for reproducible gene expression and DNA methylation data analyses [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Michael Considine

    2015-10-01

    Full Text Available Automated Genomics Analysis (AGA is an interactive program to analyze high-throughput genomic data sets on a variety of platforms. An easy to use, point and click, guided pipeline is implemented to combine, define, and compare datasets, and customize their outputs. In contrast to other automated programs, AGA enables flexible selection of sample groups for comparison from complex sample annotations. Batch correction techniques are also included to further enable the combination of datasets from diverse studies in this comparison. AGA also allows users to save plots, tables and data, and log files containing key portions of the R script run for reproducible analyses. The link between the interface and R supports collaborative research, enabling advanced R users to extend preliminary analyses generated from bioinformatics novices.

  14. Looduslikud pühapaigad kui muistised : arheoloogia vaatenurk / Heiki Valk

    Index Scriptorium Estoniae

    Valk, Heiki, 1959-

    2007-01-01

    Looduslikest pühapaikadest kui arheoloogiamälestistest, nende uurimisloost ja hoiakutest. Rahvaluuleteaduse huvist looduslike pühapaikade vastu. Looduslike pühapaikade pühapaiga omandamise tähendusest ajas. Pühakohtade liikidest, tähendusest ja otstarbest. Asustuslikest seostest ja kohtadest rituaalsel maastikul. Pühapaigast kui osast võrgustikust, tema tähtsusastmetest ja hierarhiast. Pühapaikade kohavaliku põhjustest. Lühidalt autorist lk. 317

  15. Inimesel on raske muutuda, aga teistel on veel raskem neid muutusi märgata / Teeli Remmelg

    Index Scriptorium Estoniae

    Remmelg, Teeli

    2005-01-01

    Ilmunud ka: Delovõje Vedomosti : Upravlenije i Obutshenije 12. okt. lk. 6; Juhi ideelaegas. - Tallinn, 2006, lk. 190-193. Firmades 360 kraadi tagasiside meetodit rakendanud juhtide sõnul on teise inimese muutumise märkamine olulisemalt raskem kui endal muutuda. Kommenteerib Aira Tammemäe

  16. An analysis of Canada-US natural gas trade using the AGAS energy model

    International Nuclear Information System (INIS)

    Quon, D.; Wong, S.

    1989-01-01

    The strength of AGAS is that it was structurally designed to address the primary issue of EMF9, namely the medium and long-term prospects for Canada-US natural gas trade. Consequently, it is one of the very few models with the following necessary features: (1) it treats all the regions of Canada and the United States as one continental entity, both with respect to demand and supply; (2) All regional supplies and demands are integrated. Hence, regional gas prices are endogenous; inter-regional gas flows, including Canadian-US gas exchanges, are endogenous. Models that do not have both of these features require that the answers that are being sought have to be specified exogenously. An iterative procedure can be used to reconcile unrealistic results but only with difficulty

  17. Kui kõik on tsitaat, siis pole miski tsitaat : kolm case'i / Anders Härm

    Index Scriptorium Estoniae

    Härm, Anders, 1977-

    2009-01-01

    Inglise popkultuuri ja kunsti vahelistest suhetest, 1960-1970-ndate kontseptualistliku ja minimalistliku kunsti mõjutustest, Gustav Metzgerist kui autodestruktiivse kunsti loojast ja ansamblist The Who, kes teostas eelmise ideid muusikas pillide igaõhtuse purustamisega, bänd oli kui performance, kui kontseptuaalne kunstiteos, mis toimis muusikatööstuse paroodiana, testides kuulajate taluvuse piire. Samas võtmes ka ansamblitest Throbbing Gristle ja Martin Creede loodud Owadast (1994)

  18. Cardiopulmonary dysfunction in the Osteogenesis imperfecta mouse model Aga2 and human patients are caused by bone-independent mechanisms.

    Science.gov (United States)

    Thiele, Frank; Cohrs, Christian M; Flor, Armando; Lisse, Thomas S; Przemeck, Gerhard K H; Horsch, Marion; Schrewe, Anja; Gailus-Durner, Valerie; Ivandic, Boris; Katus, Hugo A; Wurst, Wolfgang; Reisenberg, Catherine; Chaney, Hollis; Fuchs, Helmut; Hans, Wolfgang; Beckers, Johannes; Marini, Joan C; Hrabé de Angelis, Martin

    2012-08-15

    Osteogenesis imperfecta (OI) is an inherited connective tissue disorder with skeletal dysplasia of varying severity, predominantly caused by mutations in the collagen I genes (COL1A1/COL1A2). Extraskeletal findings such as cardiac and pulmonary complications are generally considered to be significant secondary features. Aga2, a murine model for human OI, was systemically analyzed in the German Mouse Clinic by means of in vivo and in vitro examinations of the cardiopulmonary system, to identify novel mechanisms accounting for perinatal lethality. Pulmonary and, especially, cardiac fibroblast of perinatal lethal Aga2/+ animals display a strong down-regulation of Col1a1 transcripts in vivo and in vitro, resulting in a loss of extracellular matrix integrity. In addition, dysregulated gene expression of Nppa, different types of collagen and Agt in heart and lung tissue support a bone-independent vicious cycle of heart dysfunction, including hypertrophy, loss of myocardial matrix integrity, pulmonary hypertension, pneumonia and hypoxia leading to death in Aga2. These murine findings are corroborated by a pediatric OI cohort study, displaying significant progressive decline in pulmonary function and restrictive pulmonary disease independent of scoliosis. Most participants show mild cardiac valvular regurgitation, independent of pulmonary and skeletal findings. Data obtained from human OI patients and the mouse model Aga2 provide novel evidence for primary effects of type I collagen mutations on the heart and lung. The findings will have potential benefits of anticipatory clinical exams and early intervention in OI patients.

  19. A.G.A. program gives utilities a leg up on benchmarking

    International Nuclear Information System (INIS)

    Share, J.

    1997-01-01

    In this era of downsizing, distribution companies are banding together under the aegis of the American Gas Association to improve their performance, ultimately saving money and jobs. The Best Practice Benchmarking program began in 1990 when New Orleans Public Service coordinated an effort by several utilities wanting to compare practices and data. It is not benchmarking in the traditional sense. Best Practices stresses functional rather than competitive or numerical benchmarking by focusing on what utilities have done to improve their operations. In a report on Best Practices, John Bayko, Director of System Operations for Consumers Gas in Toronto, noted these success stories: Building odorant storage and transport facilities were found to save one company $17,500 annually because it could buy odorant in bulk as opposed to 55-gallon drums. Upgrading its cathodic protection system helped a company realize a 40 percent reduction in corrosion leaks over a two-year period, saving $200,000 a year. Another company began studying partnering with contractors which would eliminate the need of a pipeline inspector in each crew. Those potential savings are over $2 million. This paper describes three other Best Practices related to worker safety, system mapping, and activity-based accounting. A.G.A.'s role is briefly discussed

  20. Morbility, clinical data and proteomic analysis of IUGR and AGA newborns at different gestational ages

    Directory of Open Access Journals (Sweden)

    M.D. Ruiz-González

    2016-12-01

    Full Text Available The data are related to the proteomic analysis of 43 newborns with intrauterine growth retardation (IUGR and 45 newborns with appropriate weight for gestational age (AGA carried out by separation via 2DE and analyzed by MS–TOF/TOF. All newborns were separated into three gestational age groups, "Very Preterm" 29–32 weeks, "Moderate Preterm" 33–36 weeks, and, "Term" ≥37weeks. From each newborn, blood was drawn three times from birth to 1 month life. High-abundant serum proteins were depleted, and the minority ones were separated by 2DE and analyzed for significant expression differences. The data reflect analytic and clinic variables analyzed globally and categorized by gestational age in relation to IUGR and the optimization of conditions for 2-DE separation. The data from this study are related to the research article entitled "Alterations of Protein Expression in Serum of Infants with Intrauterine Growth Restriction and Different Gestational Ages" (M.D. Ruis-González, M.D. Cañete, J.L. Gómez-Chaparro, N. Abril, R. Cañete, J. López-Barea, 2015 [1]. The present dataset of serum IUGR newborn proteome can be used as a reference for any study involving intrauterine growth restriction during the first month of life.

  1. "Ma vannun tema niuete kui paleuse nimel ..." : [luuletused] / tlk. Andres Ehin, tlk. Ly Seppel

    Index Scriptorium Estoniae

    2004-01-01

    Sisu: "Ma vannun tema niuete kui paleuse nimel ..." ; "Ta on nagu kuu, kelle kuma kõik kummuli kukutab ..." ; "Kuu südaöösel ennustab me jäävat lahkujääma ..." ; "Ei hinda naisterahvas kasinuse mulli ..." ; "Ta nõtket kaela kutsun ligemale ..." ; "Meid ühte heitma tõmbab armuköis ..." ; "Meil kahel pole mõtet lahku minna ..." ; "Ei kuuga saa võrrelda sind, sest et kuu läheb looja ..." ; "Allah ise su ilude hoob on ja kang ..." ; "Kui meesterahvale läeb korda meesterahvas ..." ; "Ja kuis ka kiremöll tal südames ei hulla ..." ; "Teie jaoks ei ole minu võlurohke kallike ..." ; "Oli see vast poisike, nägu ilu täis ..." ; "Aeg tagasi kalli las toob, et mind suisa salvata ...". Tundmatute autorite kirjutatud luuletused jutukogust "1001 ööd" (9. - 10. saj)

  2. Kool kui kasvukeskkond 10-13-aastaste õpilaste hinnanguis / Leida Talts

    Index Scriptorium Estoniae

    Talts, Leida

    2001-01-01

    Kirjutis tugineb artikli autori - TPÜ kasvatusteaduste teaduskonna algõpetuse õppetooli professori Leida Taltsi ja algõpetuse eriala üliõpilaste poolt 1998-2000.a. kogutud lapse kasvukeskkonda puudutavatel materjalidel. Artikli eesmärgiks on analüüsida 10-13-aastaste hinnanguid koolile ja iseendale kui õpilasele. Analüüs tugineb 1999.a. 10-13-aastaste õpilaste arenguvõimaluste võrdlevaks analüüsimiseks korraldatud üle-eestilisel ankeetküsitlusel, milles käsitleti õpilaste hinnanguid oma kasvukeskkonna tingimustele perekonnas, koolis ja mujal. Küsitluse üheks tervikplokiks oli kool kui kasvukeskkond

  3. Loeb või ei loe : IT on olulisem kui eales varem / James Champy

    Index Scriptorium Estoniae

    Champy, James

    2004-01-01

    Vastukajad ajakirja Think! 2003. aasta 2. numbris avaldatud Nicholas Carr'i artiklile "IT ei loe". Autori sõnul näitab kogemus, et infotehnoloogia (IT) on oluline, kui seda kasutatakse innovaatiliste lahenduste loomiseks ja ettevõtte konkurentsivõime muutmiseks

  4. Siis, kui lõpeb lähiminevik ja algab retro / Andreas Trossek

    Index Scriptorium Estoniae

    Trossek, Andreas, 1980-

    2006-01-01

    2006. aasta presidendivalimiste kampaania kajastamine meedias. Kunstiteosed Arnold Rüütlist. 2006. a. presidendikampaaniat kajastav ja kujundav meedia ei kontsentreerunud mitte niivõrd tulevase presidendi maailmavaadetele, vaid puudutas läbi kandidaatide isikukesksuse kogu eesti kui niinimetatud postkommunistliku rahva lähimineviku problemaatikat

  5. Kui kõik on tsitaat, siis pole miski tsitaat / Anders Härm

    Index Scriptorium Estoniae

    Härm, Anders, 1977-

    2007-01-01

    Tsitaatidest, nihetest kujutava kunsti ja popkultuuri suhetes, bändist kui kontseptuaalsest kunstiteosest. Saksa kunstnikust Gustav Metzgerist (sünd. 1926), ansamblist The Who, performance'i rühmitusest COUM Transmissions, kellest sai bänd Throbbing Gristle, shoti kunstniku Martin Creedi loodud bändist Owada (1994)

  6. Palk kui tööjõuturu tasakaalu tingimus / Olev Raju

    Index Scriptorium Estoniae

    Raju, Olev, 1948-

    2007-01-01

    Autori vaatluse all on kaks probleemi - turu tasakaal kui majanduse parim seisund antud situatsioonis ja tööjõuturu tasakaal Eestis. Joonis: Turutasakaalu ja defitsiidi kujunemine. Tabel 1: Keskmine tunnipalk EL-is 2004 ja 2005; Tabel 2: SKP per capita PPS, Eu25 = 100

  7. Minu isamajakene linnupesa sarnane ehk kui kaua kestab kodu? / Oliver Orro

    Index Scriptorium Estoniae

    Orro, Oliver, 1982-

    2013-01-01

    Arhitektuuriteadlane Oliver Orro kirjutab: "Vahel tundub, et isegi anonüümsele nõukogude inimesele mõeldud, rangelt standardiseeritud hruštsovkad ja paneelikad oma näilises jäikuses on tegelikult võimalusterohkemad kui paljud praegu kavandatud majad ja korterid"

  8. EL toetab piirilepingutülis Venega nii Eestit kui Lätit / Ahto Lobjakas

    Index Scriptorium Estoniae

    Lobjakas, Ahto, 1970-

    2005-01-01

    Suurbritannia välisministri Jack Straw sõnul on nii Eestil kui ka Lätil piirilepingu küsimuses EL-i tugi. Eesti Päevalehe andmeil nõudis Tšehhi esindaja, et Venemaa peab ratifitseerima lepingu koos preambuliga. Lisa: Paet: vaja sama mudeli jätkamist

  9. Director murrab pead : Kui sul on haamer, siis meenutavad kõik asjad naelu / Anni Hartikainen

    Index Scriptorium Estoniae

    Hartikainen, Anni

    2008-01-01

    Mida teha, kui ettevõtte on langenud rutiini ning edasiminekuks oleks vaja kollektiivset ärkamist. Küsimusele otsivad vastust Ragn-Sells AS ärijuht Agu Remmelg. Siin ongi vaja kollektiivset obadust! ja Nixor Eesti AS arendusspetsialist Toomas Arula. Õppimise võlu ja valu

  10. Suitsunurgas sosistatakse siis, kui avalikult öelda ei saa / Anneli Salk

    Index Scriptorium Estoniae

    Salk, Anneli

    2006-01-01

    Kuulujutte saab vältida, andes töötajale ettevõttes toimuvast laiemat infot kui ainult tema kitsast töölõiku puudutav. Kommenteerib Anna Tammerik. Vt. samas: Suhete kujunemisel saab esile tuua nelja etappi

  11. Kui hästi või halvasti ... / Jaak Aaviksoo, Piret Hartman, Heli Aru

    Index Scriptorium Estoniae

    Aaviksoo, Jaak, 1954-

    2003-01-01

    TÜ rektor J. Aaviksoo, Üliõpilaskondade Liidu juhatuse esimees P. Hartman ja Haridus- ja Teadusministeeriumi kõrghariduse talituse juhataja H. Aru vastavad küsimusele, kui hästi või halvasti on end õigustanud kõrghariduses aasta toiminud 3+2 süsteem

  12. Eesti jääb tugevaks, kui jätkab valitud teel / Irene Mia

    Index Scriptorium Estoniae

    Mia, Irene

    2005-01-01

    Maailma Majandusfoorumi analüütiku hinnangul jääb Eesti ka järgmistel aastatel maailma kõige konkurentsivõimelisemate riikide hulka, kui ta jätkab sama teed. Väla on toodud ka parandamist vajavad valdkonnad. Lisa: Eesti koht 2004. aastal majanduskasvu indeksis

  13. Optimism lubab uut kasvu. Kui kõrgelt lennatakse logistikas sel aastal? / Rivo Sarapik

    Index Scriptorium Estoniae

    Sarapik, Rivo, 1981-

    2011-01-01

    2010. aastal kasvas tarbeautode müük kolmandiku võrra, Tallinna Sadam käitles kaupu 16% võrra enam kui aasta varem. Transiidikeskus loodab konteinerkäibe ja ro-ro kaupade 20-protsendilist kasvu. Graafikud, diagrammid

  14. An Assessment of the AGA and CCFA Quality Indicators in a Sample of Patients Diagnosed with Inflammatory Bowel Disease.

    Science.gov (United States)

    Tkacz, Joseph; Brady, Brenna L; Meyer, Roxanne; Lofland, Jennifer H; Ruetsch, Charles; Coelho-Prabhu, Nayantara

    2015-11-01

    Inflammatory bowel disease (IBD) is a chronic relapsing disease characterized by activation of the mucosal immune system and inflammation of the gastrointestinal tract. Management of IBD places a significant burden on the health care system because of the complexity of treatment, variability in patient outcomes, and chronic nature of the disease.  To investigate the American Gastroenterological Association (AGA) and Crohn's and Colitis Foundation of America's (CCFA) quality measurement sets in a sample of IBD patients. Fourteen quality measures were restated for application to a claims database and calculated using Optum Clinformatics DataMart database. Selected measures were calculated over calendar year 2011. Performance measures ranged from 0.4% for AGA measure 9, prophylaxis for venous thromboembolism, to 66.9% for AGA measure 8, testing for Clostridium difficile. CCFA outcome measures ranged from 0.6% qualifying for CCFA O10, report of fecal incontinence, to 32.9% for CCFA O1, prednisone usage. In addition to Clostridium difficile testing, the use of appropriate corticosteroid-sparing therapy (51.1%) and testing for latent tuberculosis before initiating anti-tumor necrosis factor therapy (45.0%) were the highest achieved measures. This is the first examination of IBD quality measures using administrative claims. Rates of achievement across measures were variable and likely affected by the ability to calculate certain measures with claims data. Future studies should further examine measurement of IBD quality indicators in claims data to assess the validity of claims-based analyses and to ascertain whether measure attainment translates into better overall health or IBD-related outcomes.

  15. Pühakoda kui tempel ja korrastatud struktuur : A.W. Hupel arhitektuurihindajana / Krista Kodres ; tõlk. Tiina Randviir

    Index Scriptorium Estoniae

    Kodres, Krista, 1957-

    2008-01-01

    August Wilhelm Hupeli arhitektuuriideaalidest, "arhitektuuriteoloogiast", korrast (order) kirikuruumide ülesehituses ja Vaivara kirikust kui ajastu teoloogilisest sümbolist, esimesest omalaadsest luteri kirikust ja ideaalsest kirikuarhitektuurist - ehitati aastatel 1775-1777, hävis 1944

  16. Does gender affect career satisfaction and advancement in gastroenterology? Results of an AGA institute-sponsored survey.

    Science.gov (United States)

    Gerson, Lauren B; Twomey, Kay; Hecht, Gail; Lee, Linda; McQuaid, Ken; Pizarro, Theresa T; Street, Sarah; Yoshida, Cynthia; Early, Dayna

    2007-04-01

    Women comprise 19% of the American Gastroenterological Association (AGA) membership. We performed a prospective study to determine whether female gastroenterologists were less likely to achieve career advancement and satisfaction. We administered an online survey to AGA members from 2004-2006. The survey contained questions regarding effects of gender on career advancement, satisfaction with career, promotional policies, and integration of family and career. A total of 457 individuals (response rate 9% after 2 major invitations) completed the survey, including 262 (57%) women (20% in private practice, 53% in academic careers, and 27% trainees) and 195 men (23% in private practice, 58% in academic careers, and 19% trainees). The male gastroenterologists were significantly older (P careers for significantly more years (P = .002). There were no significant differences with respect to marital status, number of children, or number of hours worked between the genders. Men were more likely to achieve the rank of full professor (P = .035), and significantly more women reported that gender affected their career advancement (47% vs 9%; P careers reported less satisfaction with their careers (P = .01) and perceived more difficulty in achieving promotion and tenure. Women were more likely to choose private practice careers because of part-time options (P = .025). Equal numbers of men and women in practice reported difficulty balancing work and family life. Significantly more female than male gastroenterologists perceive that gender has affected their career advancement. Female academic gastroenterologists reported less overall career satisfaction and promotion than male academic gastroenterologists.

  17. Tippfirmad toodavad naftat / Harry Tuul

    Index Scriptorium Estoniae

    Tuul, Harry

    2006-01-01

    Financial Timesi ja konsultatsioonifirma McKinsey ühisuuringust selgus, et maailma kallimad firmad toodavad naftat, asuvad arengumaades ja on riigi omanduses. Tabel. Vt. samas: Eesti firmadest kalleim Eesti Energia

  18. Kool kui kasvukeskkond erineva sotsiaalse tausta ja akadeemilise edukusega laste jaoks / Leida Talts

    Index Scriptorium Estoniae

    Talts, Leida

    2001-01-01

    Artiklis sisalduv analüüs tugineb TPÜ algõpetuse õppetooli uurimisgrupi poolt 1999.a. 10-13-aastaste õpilaste arenguvõimaluste võrdlevaks analüüsimiseks korraldatud üle-eestilisel ankeetküsitlusel, milles käsitleti õpilaste hinnanguid oma kasvukeskkonna tingimustele perekonnas, koolis ja mujal. Küsitluse üheks tervikplokiks oli kool kui kasvukeskkond

  19. Ilves näitas Iirile Eestit kui luulelembest mõttekaaslast / Anneli Ammas

    Index Scriptorium Estoniae

    Ammas, Anneli, 1962-

    2008-01-01

    Vabariigi President riigivisiidil Iirimaal 13.-16.04.2008. Ametlike kohtumiste kõrval viidi Eesti riigipea iiri luuletaja William Butler Yeats'i näitusele ning James Joyce'i keskusse, proua Evelin Ilves külastas Iiri rahvuslikku muuseumi. President T. H. Ilves nimetas Iirimaad Euroopa Liidu kontekstis Eestile isegi lähedasemaks naabriks kui Soomet. Juuresoleval fotol Eesti presidendipaar koos Iirimaa presidendi Mary McAleese'iga

  20. Postsotsialistlik Eesti filmikunst kui rahvusülene kino / Ewa Mazierska

    Index Scriptorium Estoniae

    Mazierska, Ewa

    2011-01-01

    Käsitletakse Nõukogude Liidu lagunemise järel valminud Eesti filme, võrreldes neid mujal ja teisel ajal loodud linateostega. Võrdluse tulemusena selgub, et Eesti film on pidevas dialoogis Euroopa ja maailma kinoga, ent suudab rääkida ka oma häälega, et ta on nii rahvuslik kui ka rahvusülene nähtus, suutes ka ise midagi teistele pakkuda

  1. Kui sõnadest enam ei piisa, siis - muusika / Kadri Mälk

    Index Scriptorium Estoniae

    Mälk, Kadri, 1958-

    2008-01-01

    Rahvusvahelisest ehtekunstisündmusest "Schmuckszene" (peakorraldaja Wolfgang Lösche) Münchenis, peanäitusest (kuraator Ralph Turner) Müncheni messikeskuses, satelliitnäitustest. Eestist pääses peanäitusele Maarja Niinemägi, peapreemia sai Jantje Fleischhut. Kaasaegse ehtekunsti toetajate ühenduse (Die Fördergesellschaft Neuer Schmuck) aastapreemia sai Peter Chang. Võrdluseks Tanel Veenre näitusest "Kui sõnadest ei piisa" Hop-galeriis

  2. Me võime, aga me ei saa : eesti kujunduskunst ja disain 1980. aastail = We can, but we can't : Estonian interior design in the 1980s / Krista Kodres

    Index Scriptorium Estoniae

    Kodres, Krista, 1957-

    2010-01-01

    Neid aastaid iseloomustab aktiivne näitusetegevus ning paljude individuaalkujundusega esemete ja ruumikujunduste valmimine. Reaalselt tõsteti esile keskkonnaproblemaatika, kehtestati arhitekti ja disaineri kui ühiskonna vajaduste eestvõitleja renomee, püüti kasutada avalike ruumide kujundamisel ainulahendusi ja keskkonna ilmet hakkas mõjutama graafilne disain nii firma-, info-, plakati- kui ka linnakujunduses

  3. The German Working Group of Obesity in Childhood and Adolescence (AGA): improving the quality of care for overweight and obese children in Germany.

    Science.gov (United States)

    Reinehr, Thomas; Holl, Reinhard W; Wabitsch, Martin

    2008-01-01

    The Working Group of Obesity in Childhood and Adolescence (AGA) comprises scientists, clinicians, and therapists dealing with obesity in children and adolescents. More than 250 pediatricians, psychiatrics, dieticians, psychologists and sports therapists are integrated. On an international level, the AGA cooperates with the European Childhood Obesity Group and the International Obesity Taskforce (IOTF) for Childhood Obesity. The aims of the AGA are to initiate clinical and scientific studies, to join diagnostic, therapeutic and scientific centers, to improve the education, to support self-help groups, and to standardize diagnostic and therapeutic procedures in the field of obesity in childhood and adolescence. The milestones in the history of the AGA are the consensus process to define overweight and obesity in Germany, the development of guidelines for diagnostic procedures and treatment of obesity in childhood and adolescence, the determination of all therapy centers for obese children and adolescents in Germany, the development of a PC software (APV) to document longitudinally diagnostic and therapeutic procedures as well as outcomes by a quality management program, the certification of therapeutic institutions, and the implementation of prevention and treatment studies. As effect of these initiatives, the quality of care in overweight children has been improved in the last years. For example, the APV quality program demonstrated an increase of diagnostic procedures such as blood pressure measurement in the last 4 years. Copyright 2008 S. Karger AG, Basel.

  4. Kui seda mammit seal jalus ei oleks... / Indrek Pajo, Heiti Riisberg, Jaana Liigand... [jt.

    Index Scriptorium Estoniae

    2010-01-01

    Küsimusele, mida peaks noor keskjuht juhtimise osas tegema kui tunneb pärast paarikuist töötamist üha rohkem, et mõned tema alluvad, kes on temast oluliselt vanemad, töötavad talle vastu, vastavad endine Cleaner Ehitus vanemobjektijuht Indrek Pajo, Trigon Kapital pensioni- ja aktsiafondide eest hoolitsev Heiti Riisberg, konsultatsioonifirma Arikano omanik ja juht Jaana Liigand, Pharmadule OÜ personali- ja büroojuht Helen Neeve, Saku Õlletehase brändide Rock ja Carlsberg juht Karin Golubev ning Kaamos Kinnisvara juht Priit Uustulnd

  5. Neoplasia yield and colonoscopic workload of surveillance regimes for colorectal cancer in colitis patients: a retrospective study comparing the performance of the updated AGA and BSG guidelines.

    Science.gov (United States)

    Mooiweer, Erik; van der Meulen, Andrea E; van Bodegraven, Adriaan A; Jansen, Jeroen M; Mahmmod, Nofel; Nijsten, Joyce; van Oijen, Martijn G H; Siersema, Peter D; Oldenburg, Bas

    2013-11-01

    Due to the increased risk of colorectal cancer, colonoscopic surveillance is recommended for patients with ulcerative and Crohn's colitis. Because surveillance intervals differ considerably between the recently updated American Gastroenterological Association (AGA) and British Society of Gastroenterology (BSG) guidelines, we compared the neoplasia yield and colonoscopic workload of these guidelines. Patients with inflammatory bowel disease undergoing surveillance were identified using medical records. Patients were stratified according to the BSG and AGA guidelines, and corresponding colonoscopic workload was calculated based on the risk factors present during follow-up. The incidence of colitis-associated neoplasia (CAN), defined as a low-grade dysplasia in flat mucosa or a non-adenoma-like mass, high-grade dysplasia, or colorectal cancer was compared between the risk groups of either guidelines. In total, 1018 patients with inflammatory bowel disease who underwent surveillance were identified. Using the AGA surveillance intervals, 64 patients (6%) were assigned to annual and 954 patients (94%) to biannual surveillance, resulting in 541 colonoscopies per year. The yield of CAN was 5.3% and 20.3% in the low- and high-risk groups, respectively (P = 0.02). Using the BSG surveillance intervals, 204 patients received surveillance annually (20%), 393 patients every 3 years (39%), and 421 patients every 5 years (41%), resulting in 420 colonoscopies per year, which is 22% lower than the AGA guidelines. The yield of CAN was 3.6%, 6.9%, and 10.8%, for the low-, intermediate-, and high-risk groups, respectively (P = 0.26). Although the BSG surveillance intervals offer the advantage of a lower colonoscopic workload, the risk stratification of the AGA seems superior in distinguishing patients at higher risk of CAN.

  6. The effect of a knowledge-based ergonomic intervention amongst administrators at Aga Khan University Hospital, Nairobi.

    Science.gov (United States)

    Wanyonyi, Nancy; Frantz, Jose; Saidi, Hassan

    2015-01-01

    Low back pain (LBP) and neck pain are part of the common work-related musculoskeletal disorders with a large impact on the affected person. Despite having a multifactorial aetiology, ergonomic factors play a major role thus necessitating workers' education. To determine the prevalence of ergonomic-related LBP and neck pain, and describe the effect of a knowledge-based ergonomic intervention amongst administrators in Aga Khan University Hospital, Nairobi. This study applied a mixed method design utilizing a survey and two focus group discussions (FGD). A self-administered questionnaire was distributed to 208 participants through systematic sampling. A one hour knowledge-based ergonomic session founded on the survey results was thereafter administered to interested participants, followed by two FGDs a month later with purposive selection of eight participants to explore their experience of the ergonomic intervention. Quantitative data was captured and analyzed using SPSS by means of descriptive and inferential statistics, whereas thematic content analysis was used for qualitative data. Most participants were knowledgeable about ergonomic-related LBP and neck pain with a twelve month prevalence of 75.5% and 67.8% respectively. Continual ergonomic education is necessary for adherence to health-related behaviours that will preventwork-related LBP and neck pain.

  7. Mobile Sensor System AGaMon for Breath Control: Numerical Signal Analysis of Ternary Gas Mixtures and First Field Tests

    Directory of Open Access Journals (Sweden)

    Rolf Seifert

    2018-01-01

    Full Text Available An innovative mobile sensor system for breath control in the exhaled air is introduced. In this paper, the application of alcohol control in the exhaled air is considered. This sensor system operates semiconducting gas sensor elements with respect to the application in a thermo-cyclic operation mode. This operation mode leads to so-called conductance-over-time-profiles (CTPs, which are fingerprints of the gas mixture under consideration and can be used for substance identification and concentration determination. Especially for the alcohol control in the exhaled air, ethanol is the leading gas component to be investigated. But, there are also other interfering gas components in the exhaled air, like H2 and acetone, which may influence the measurement results. Therefore, a ternary ethanol-H2-acetone gas mixture was investigated. The establishing of the mathematical calibration model and the data analysis was performed with a newly developed innovative calibration and evaluation procedure called ProSens 3.0. The analysis of ternary ethanol-H2-acetone gas samples with ProSens 3.0 shows a very good substance identification performance and a very good concentration determination of the leading ethanol component. The relative analysis errors for the leading component ethanol were in all considered samples less than 9 %. First field test performed with the sensor system AGaMon shows very promising results.

  8. Maksude tõstmine lööb nii ettevõtlust kui ka tavalist inimest / Mirko Ojakivi

    Index Scriptorium Estoniae

    Ojakivi, Mirko

    2008-01-01

    Konjunktuuriinstituudi direktori Marje Josingu sõnul halvendaks maksutõus nii ettevõtluse konkurentsivõimet kui ka inimeste võimet eluga toime tulla, ka maksumaksjate liidu esimees Lasse Lehis peab maksude tõstmist valeks, eriti vale oleks tema väitel tõsta käibemaksu

  9. Menea kui keskaegse slaavi-kreeka teksti üks tüüpidest / Dimitri Mironov

    Index Scriptorium Estoniae

    Mironov, Dimitri

    2000-01-01

    25. apr. 2000 toimus Tallinna Pedagoogikaülikoolis slaavi filoloogia osakonna vene keele õppetooli dotsendi Natalja Netšunajeva doktoritöö "Menea kui keskaegse slaavi-kreeka teksti üks tüüpidest" kaitsmine

  10. Kannatanu nõusolek kui õigusvastasust välistav asjaolu vägivallategude kontekstis / Allar Nisu

    Index Scriptorium Estoniae

    Nisu, Allar, 1987-

    2015-01-01

    Kannatanu nõusolekust kui õigusvastasust välistavast asjaolust ja nõusoleku kehtivuse eeldustest. Kannatanu nõusolekust kehalise väärkohtlemise (KarS § 121), raske tervisekahjustuse tekitamise (KarS § 118) ja tapmise (KarS § 113) valguses

  11. Enzymatic liquefaction of agarose above the sol-gel transition temperature using a thermostable endo-type β-agarase, Aga16B.

    Science.gov (United States)

    Kim, Jung Hyun; Yun, Eun Ju; Seo, Nari; Yu, Sora; Kim, Dong Hyun; Cho, Kyung Mun; An, Hyun Joo; Kim, Jae-Han; Choi, In-Geol; Kim, Kyoung Heon

    2017-02-01

    The main carbohydrate of red macroalgae is agarose, a heterogeneous polysaccharide composed of D-galactose and 3,6-anhydro-L-galactose. When saccharifying agarose by enzymes, the unique physical properties of agarose, namely the sol-gel transition and the near-insolubility of agarose in water, limit the accessibility of agarose to the enzymes. Due to the lower accessibility of agarose to enzymes in the gel state than to the sol state, it is important to prevent the sol-gel transition by performing the enzymatic liquefaction of agarose at a temperature higher than the sol-gel transition temperature of agarose. In this study, a thermostable endo-type β-agarase, Aga16B, originating from Saccharophagus degradans 2-40 T , was characterized and introduced in the liquefaction process. Aga16B was thermostable up to 50 °C and depolymerized agarose mainly into neoagarooligosaccharides with degrees of polymerization 4 and 6. Aga16B was applied to enzymatic liquefaction of agarose at 45 °C, which was above the sol-gel transition temperature of 1 % (w/v) agarose (∼35 °C) when cooling agarose. This is the first systematic demonstration of enzymatic liquefaction of agarose, enabled by determining the sol-gel temperature of agarose under specific conditions and by characterizing the thermostability of an endo-type β-agarase.

  12. Gordana Kuić: la memoria de las mujeres sefardíes de Bosnia

    Directory of Open Access Journals (Sweden)

    Díaz-Mas, Paloma

    2009-06-01

    Full Text Available Gordana Kuić (1942 es una escritora, hija de madre sefardí y padre serbio, que ha publicado hasta ahora siete novelas en serbio; sólo una de ellas, Miris ki?e na Balkanu ha sido traducida al francés (Parfum de pluie sur les Balkans, publicada con el seudónimo de Ana Gord y al inglés (Scent of rain in the Balkans. En este artículo se presenta a esta escritora y se proponen varias lecturas de esa novela: como novela sobre mujeres, como reconstrucción de la historia reciente de los países balcánicos, como evocación de la evolución de la minoría sefardí de Bosnia en el siglo xx y como historia oral familiar.

  13. "Kuis sa nii võimsalt tuled minu üle..." : [luuletused] / Marie Under

    Index Scriptorium Estoniae

    Under, Marie, 1883-1980

    1998-01-01

    Sisu: "Kuis sa nii võimsalt tuled minu üle..." ; Sügesemaru ; Talvel ; Sinine terrass ; Õnne ootel ; Ekstaas ; Unistus ; Üllatus ; Ehtides ; Ma armastan su armastust ; Valge värav ; Meeletus ; On siiski kurb ; Verivalla ; Surnute rongkäik ; A rebours ; Luukambris ; Kiusaja ; Hingetund ; Inimene ; Koduotsimine ; Surelik ; Saladus ; Memento mori ; Kontvõõras ; Ahastaja ; Ummikus ; Hommikupalve ; Suudlus ; Kutse ; Raismik. Mets ; Valge lind ; Rändav järv ; Porkuni preili ; Lapsehukkaja ; Maarja leid ; Surmamõrsjad ; Taevaminek ; Laul eimillestki ; Õnnevaras ; Puhastus ; Soolaul ; Lõikuspühaks ; "Üksteisest pimesi me mööda käime..." ; Loomine ; Muutus ; Selgus ; Haige unistus ; Jõulutervitus 1941 ; Mõrane hommik ; Pärast ema surma ; Kutse ; Kes? ; Hääl tuulde ; Mine! ; Nägemus ; Veel mitte ; Visioon ; Langes üks täht

  14. Laste seksuaalne väärkohtlemine kui moraalipaanika tekitaja : [magistritöö] / Sirli Urvet ; Tartu Ülikool, õigusteaduskond ; juhendaja: Silvia Kaugia

    Index Scriptorium Estoniae

    Urvet, Sirli, 1987-

    2014-01-01

    Pedofiiliast ja laste seksuaalse väärkohtlemise mõistest, moraalipaanika olemusest ja selle tekkimise põhjustest, laste seksuaalne väärkohtlemine kui moraalipaanika tekitaja Eestis: empiiriline uuring

  15. Laps kui põhiõiguste kandja Eesti õiguses : [bakalaureusetöö] / Külli Pilv ; Tartu Ülikool, õigusteaduskond ; juhendaja: Gaabriel Tavits

    Index Scriptorium Estoniae

    Pilv, Külli

    2003-01-01

    Lastekaitsest ja lapse õigustest üldse, lapse õiguslik staatus, lapse õiguste konventsioon kui lapse põhiõiguste üldgarantii, selle rakendusmehhanismi meetmed ja rahvusvaheline praktika, lapse põhiõiguste rakendamine Eestis

  16. "Kui Eesti ütleb gaasitorule ei, võib ka Rootsi öelda ei" / Carl B. Hamilton ; interv. Argo Ideon

    Index Scriptorium Estoniae

    Hamilton, Carl B.

    2007-01-01

    Nord Stream on avaldanud soovi gaasijuhtme teenindusplatvormi rajamiseks Gotlandi juurde. Parlamendiliikme hinnangul peaks Rootsi valitsus ütlema ei nii teenindusplatvormile kui ka gaasitorule. Gaasijuhe on tema sõnul Venemaa projekt

  17. "Kohtuniku ees seisab kaks jumalat, kaks õigust ja kibe tarvidus ühte kui teist ehk mõlemaid korraga teenida." / Olja Kivistik

    Index Scriptorium Estoniae

    Kivistik, Olja, 1989-

    2012-01-01

    20. saj. alguses kohaldatud kriminaalseadustikest Tsaari-Venemaal (ka Eestis), nendes sätestatud usuvastaste süütegude koosseisude rakendamisest. Tsaariaegse Tallinna Ringkonnakohtu lahenditest ajal, kui kehtisid samaaegselt vana ja uus nuhtlusseadustik

  18. Riigisaladus kui informatsioonivabaduse piirang ja sellele juurdepääs : [bakalaureusetöö] / Ene Lehiste ; Tartu Ülikool, õigusteaduskond ; juhendaja: Kalle Merusk

    Index Scriptorium Estoniae

    Lehiste, Ene

    2001-01-01

    Salastatud info kui infovabaduse piirang, riigisaladuse mõiste kehtivas õiguses, salastatud teabe kaitse meetodid, riigisaladuse juurdepääsu alused, julgeolekukontrolli läbiviimine (NATO-s, WEU-s)

  19. Veel enne kui ehitatakse konkreetseid ruume : arhitektuuri ja kunsti suhtest Tallinna kooli arhitektide praktikas = Before the spaces are constructed : concerning the relationship between architecture and art in the practice of the Tallinn school arc

    Index Scriptorium Estoniae

    Laanemets, Mari, 1975-

    2008-01-01

    Kunsti kaasamisest arhitektuuripraktikasse ja -projektidesse. Keskkonna kujundamisest: värvimisest tehismaastikeni. Kui uuslinnadest saavad varemed. Kunstnik-arhitekt: kunstniku-müüdi kultiveerimine arhitektuuris. "Ka mina olen maalija". Näitus kui vahend ja manifest. Bibliograafia lk. 82-85

  20. Püsiva andmekandja olemus ja veebilehe kui püsiva andmekandja määratlemine : [magistritöö] / Merili Truup ; Tartu Ülikool, õigusteaduskond ; juhendaja: Kadri Siibak

    Index Scriptorium Estoniae

    Truup, Merili

    2010-01-01

    Püsiva andmekandja kasutusvaldkondadest ja kohaldamisalast, sidevahendi abil sõlmitud lepingu regulatsioonist ja eesmärkidest, lepingu eripärast. Püsiva andmekandja olemusest, veebilehe kui püsiva andmekandja olemusest, püsiv andmekandja kui vorminõue

  1. Evaluation of lipid and glucose metabolism and cortisol and thyroid hormone levels in obese appropriate for gestational age (AGA) born and non-obese small for gestational age (SGA) born prepubertal Slovak children.

    Science.gov (United States)

    Blusková, Zuzana; Koštálová, Ludmila; Celec, Peter; Vitáriušová, Eva; Pribilincová, Zuzana; Maršálková, Marianna; Šemberová, Jana; Kyselová, Tatiana; Hlavatá, Anna; Kovács, László

    2014-07-01

    Obesity is the major determinant of metabolic syndrome. Being born small for gestational age (SGA) may be co-responsible. We aimed at evaluating the association between 1. obesity and 2. being born SGA and the presence of endocrine-metabolic abnormalities in prepubertal Slovak children. The study included 98 children, aged 3-10.9 years: 36 AGA-born obese children (OB), 31 SGA-born children (SGA) and 31 appropriate for gestational age born non-obese children (AGA). Fasting serum levels of glucose, total cholesterol, LDL, HDL, triglycerides, fT4, TSH, cortisol and insulin were determined. HOMA-IR was calculated. Personal data about birth weight and length and family history were collected. Actual anthropometric measurement was done. In every group, high prevalence of positive family history of metabolic disorder was found. In comparison with AGA children, OB children were taller (plevels and homeostasis model assessment for insulin resistance (HOMA-IR) (pcortisol levels (p=0.069) was noted. SGA-born children were shorter (plevels (plevels (p=0.085) and increased fT4 levels (pobese children and twice more metabolic abnormalities were present in SGA-born children in comparison with AGA-born children. SGA-born children are more prone to developing endocrine-metabolic abnormalities than non-obese children born AGA, but they are at less risk than obese AGA-born children. We should provide specialized care for obese children already in prepubertal age and pay attention to SGA-born children.

  2. Lääne-Virumaad kimbutab spetsialistipõud, töötajate eest hoolitsetakse aga ülihästi / Anne Nõgu, Rainer Miltop ; interv. Tiina Saar

    Index Scriptorium Estoniae

    Nõgu, Anne

    2008-01-01

    Rakveres asuva Art Cafe omanik Anne Nõgu kohviku juhtimisest ning endast kui tööandjast. Vt. samas: Õmblusettevõttest turu nõudmisel multitegijaks. Küsimustele vastab Multi Margeri juht Rainer Miltop; Piimatööstus paistab silma stabiilsusega.

  3. Rahumaa omandas Karumsi valmistaja / Harry Tuul

    Index Scriptorium Estoniae

    Tuul, Harry

    2007-01-01

    Indrek Rahumaa juhitav Eesti Investeerimisgrupp Alta Capital Partners ostis Läti piimatööstuse Rigas Piensaimnieksi. CV: Indrek Rahumaa. Diagramm: Majandusnäitajad. Vt. samas: Rahumaa omanduses suur hulk firmasid; Väinu Rozental. Indrek Rahumaa ostu järel võib Eestit pidada kohukesevabariigiks

  4. Uued tuuled annetaja rahakotis / Mariliis Kannukene

    Index Scriptorium Estoniae

    Kannukene, Mariliis

    2006-01-01

    Mittetulundusühingute ja sihtasutuste tulumaksusoodustustest annetamisel. Lisatud: Goldberg-Talts, Marge. Seadusemuudatus pärsiks annetamist. Rammo, Alari. Avalikud huvid vajavad täpsustamist. EML ettepanekud tulumaksuseaduse § 11 muutmise kohta

  5. Analisis Finansial dan Strategi Pengembangan USAha Pengolahan Sabut Kelapa Menjadi Serat Kelapa (Coco Fiber) (Studi Kasus : Kecamatan Batang Kuis, Kabupaten Deli Serdang)

    OpenAIRE

    Sitohang, Adolf Paskaris; Ayu, Salmiah, Sri Fajar

    2014-01-01

    Penelitian ini bertujuan untuk untuk menjelaskan bagaimana proses produksi USAha serat kelapa (coco fiber), menganalisis USAha serat kelapa (coco fiber) sudah layak atau tidak, dan menjelaskan strategi pengembangan yang cocok untuk USAha serat kelapa (coco fiber) di daerah penelitian. Daerah penelitian ditentukan secara sengaja (purposive) berdasarkan pertimbangan tertentu, yaitu di Kecamatan Batang Kuis, Kabupaten Deli Serdang. Penarikan sampel dilakukan dengan metode teknik purposive sampli...

  6. Arhitektuur kui vastuolude distsipliin : dialoogiline praktika ehk Stereomõtlemise poole = Architecture as a Discipline of Contradictions : Dialogical Practices, or Towards a Stereo-Identity / Indrek Peil

    Index Scriptorium Estoniae

    Peil, Indrek, 1973-

    2005-01-01

    Analoogilise ja kriitilise dialektika linnaruumis. Arhitektuur kui vastuolude distsipliin. Identiteetide kokkupõrgete kaudu linnaliku sallivuse ja stereofooniliste mudeliteni. Hübriidide lõhestamine. Ettearvamatus - süsteemi ja vea dialektika. Bibliograafia lk. 55. Artikkel põhineb 2004. a. Berliinis toimunud konverentsil "Architecture and Identity" peetud ettekandel

  7. BIBLIOMETRICS ON ONE OF THE LARGEST TERMITE INVENTORIES IN THE CERRADO: "STUDIES ON TERMITES FROM THE MATO GROSSO STATE, BRAZIL BY AGA MATHEWS 1977"

    Directory of Open Access Journals (Sweden)

    HÉLIDA FERREIRA DA CUNHA

    2015-01-01

    Full Text Available ABSTRACT This paper consists on a bibliometric analysis of the international influences of the book "Studies on termites from the Mato Grosso State, Brazil", by AGA Mathews (1977. The number of citations has increased over the years after the first citation. Mathews book was cited in articles, reviews, theses, dissertations, books, book chapters, abstracts in conference proceedings, comments and scientific notes. Most these studies are empirical and descriptive. The studies were conducted in 35 countries of the Neotropical, Palearctic, Afrotropical, Nearctic, Australasia and Indomalaya regions. 55% of the studies were carried out in Brazil. The journals Sociobiology and Insectes Sociaux, have social insect studies within its scope, and the highest number of articles citing Mathews. Most of the 71 authors that cited Mathews more than twice are Brazilian. Constrictotermes cyphergaster was the most studied in over 80% of the studies addressing Isoptera. The most frequent keywords were termite, Isoptera and taxonomy, generalist terms indexed in most publications carried out in different countries. Most of the research studies were carried out in laboratories and native vegetation areas. Studies in agroecosystems were implemented predominantly in Brazil. This study shows the diversity of application (citations of Mathews' book, and that the number of citations will continue to increase due to the large amount of information presented by the author.

  8. Clinical Practice Update: The Use of Per-Oral Endoscopic Myotomy in Achalasia: Expert Review and Best Practice Advice From the AGA Institute.

    Science.gov (United States)

    Kahrilas, Peter J; Katzka, David; Richter, Joel E

    2017-11-01

    The purpose of this review is to describe a place for per-oral endoscopic myotomy (POEM) among the currently available robust treatments for achalasia. The recommendations outlined in this review are based on expert opinion and on relevant publications from PubMed and EMbase. The Clinical Practice Updates Committee of the American Gastroenterological Association proposes the following recommendations: 1) in determining the need for achalasia therapy, patient-specific parameters (Chicago Classification subtype, comorbidities, early vs late disease, primary or secondary causes) should be considered along with published efficacy data; 2) given the complexity of this procedure, POEM should be performed by experienced physicians in high-volume centers because an estimated 20-40 procedures are needed to achieve competence; 3) if the expertise is available, POEM should be considered as primary therapy for type III achalasia; 4) if the expertise is available, POEM should be considered as treatment option comparable with laparoscopic Heller myotomy for any of the achalasia syndromes; and 5) post-POEM patients should be considered high risk to develop reflux esophagitis and advised of the management considerations (potential indefinite proton pump inhibitor therapy and/or surveillance endoscopy) of this before undergoing the procedure. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  9. Euroopa vahistamismääruse täitmisest keeldumine kui õigusprobleem : [magistritöö] / Joanna Paabumets ; Tartu Ülikool, õigusteaduskond ; juhendaja: Lauri Mälksoo

    Index Scriptorium Estoniae

    Paabumets, Joanna, 1989-

    2013-01-01

    Väljaandmisest kui rahvusvahelise õiguse instrumendist, liikmesriikide konstitutsioonikohtute ja EL Kohtu praktikast raamotsuse 002/584/JSK tõlgendamisel, Eesti praktikast loovutamismääruste rahuldamata jätmisel

  10. Kahju tekitaja tsiviilõiguslik vastutus kui kindlustusandja kahju hüvitamise kohustuse eeldus liikluskindlustuses : [magistritöö] / Mari-Liis Tamme ; Tartu Ülikool, õigusteaduskond ; juhendaja: Janno Lahe

    Index Scriptorium Estoniae

    Tamme, Mari-Liis

    2012-01-01

    Liikluskindlustuse ja liikluskahju hüvitamise kohustuse üldistest eeldustest, kahju tekitaja vastutuse võimalikest alustest, suurema ohu allikale iseloomuliku riski realiseerumisest kui kindlustusandja kahju hüvitamise kohustuse alusest

  11. Kas vanuselist diskrimineerimist diskrimineeritakse? : vanuse alusel diskrimineerimise keelu kui võrdsuspõhiõiguse kaitse Eestis Euroopa Liidu õiguse valguses : [magistritöö] / Siiri Aulik ; Tartu Ülikool, õigusteaduskond ; juhendaja: Julia L

    Index Scriptorium Estoniae

    Aulik, Siiri

    2010-01-01

    Vanuse alusel diskrimineerimise keelust võrdsuspõhiõiguste üldises kontekstis ja Euroopa Liidu õiguse üldpõhimõttena. Vanuse alusel diskrimineerimise keelust kui erilisest võrdsuspõhiõigusest

  12. Management of Clostridium difficile Infection in Inflammatory Bowel Disease: Expert Review from the Clinical Practice Updates Committee of the AGA Institute.

    Science.gov (United States)

    Khanna, Sahil; Shin, Andrea; Kelly, Ciarán P

    2017-02-01

    The purpose of this expert review is to synthesize the existing evidence on the management of Clostridium difficile infection in patients with underlying inflammatory bowel disease. The evidence reviewed in this article is a summation of relevant scientific publications, expert opinion statements, and current practice guidelines. This review is a summary of expert opinion in the field without a formal systematic review of evidence. Best Practice Advice 1: Clinicians should test patients who present with a flare of underlying inflammatory bowel disease for Clostridium difficile infection. Best Practice Advice 2: Clinicians should screen for recurrent C difficile infection if diarrhea or other symptoms of colitis persist or return after antibiotic treatment for C difficile infection. Best Practice Advice 3: Clinicians should consider treating C difficile infection in inflammatory bowel disease patients with vancomycin instead of metronidazole. Best Practice Advice 4: Clinicians strongly should consider hospitalization for close monitoring and aggressive management for inflammatory bowel disease patients with C difficile infection who have profuse diarrhea, severe abdominal pain, a markedly increased peripheral blood leukocyte count, or other evidence of sepsis. Best Practice Advice 5: Clinicians may postpone escalation of steroids and other immunosuppression agents during acute C difficile infection until therapy for C difficile infection has been initiated. However, the decision to withhold or continue immunosuppression in inflammatory bowel disease patients with C difficile infection should be individualized because there is insufficient existing robust literature on which to develop firm recommendations. Best Practice Advice 6: Clinicians should offer a referral for fecal microbiota transplantation to inflammatory bowel disease patients with recurrent C difficile infection. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  13. Rõve kuubis, aga... / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2006-01-01

    Dokumentaalfilm "Aristokraadid", kus ühte roppu habemega anekdooti jutustavad meelelahutustööstusest tuntud tegijad : režissöör Paul Provenza : Ameerika Ühendriigid 2006. Filmi näitab Tallinna Kinomaja

  14. Usalda, aga kontrolli / Manuela Pihlap

    Index Scriptorium Estoniae

    Pihlap, Manuela

    2008-01-01

    Uuest isikuandmete kaitse seadusest. Ilmunud ka Harju Ekspress 22. veeb. 2008, lk. 6 ; Meie Maa 26. veeb. 2008, lk. 2 ; Pärnu Postimees 28. veeb. 2008, lk. 15 ; LõunaLeht 28. veeb. 2008, lk. 4 ; Valgamaalane 28. veeb. 2008, lk. 2

  15. "Astronaudid võivad rääkida, kui raske on seistes magada, ja kinnitatult ..." : [luuletused] / Silje Vethal ; tlk. norra keelest Eha Vain

    Index Scriptorium Estoniae

    Vethal, Silje

    2003-01-01

    Sisu: "Astronaudid võivad rääkida, kui raske on seistes magada, ja kinnitatult ..." = "Astronauter kan fortalle hvor vanskelig det er åsove stående, og dessuten ..."; "Filosoof võib jutustada et ta kahlas kord teatud liiki lestakalade vahel kel ..." = "Filosofen kan fortelle at han en gang vasset blant en type små flyndrer som ..."; "Suvi veedetakse magades ..." = "En sommer tilbringes sovende ..."

  16. Quaternary selenostannates Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs) through rapid cooling of melts. Kinetics versus thermodynamics in the polymorphism of AGaSnSe{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, S -J; Iyer, R G; Kanatzidis, M G

    2004-10-01

    The quaternary alkali-metal gallium selenostannates, Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs), were synthesized by reacting alkali-metal selenide, Ga, Sn, and Se with a flame melting-rapid cooling method. Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} crystallizes in the non-centrosymmetric space group C2 with cell constants a=13.308(3) A, b=7.594(2) A, c=13.842(3) A, {beta}=118.730(4) deg., V=1226.7(5) A{sup 3}. {alpha}-KGaSnSe{sub 4} crystallizes in the tetragonal space group I4/mcm with a=8.186(5) A and c=6.403(5) A, V=429.1(5) A{sup 3}. {beta}-KGaSnSe{sub 4} crystallizes in the space group P2{sub 1}/c with cell constants a=7.490(2) A, b=12.578(3) A, c=18.306(5) A, {beta}=98.653(5) deg., V=1705.0(8) A{sup 3}. The unit cell of isostructural RbGaSnSe{sub 4} is a=7.567(2) A, b=12.656(3) A, c=18.277(4) A, {beta}=95.924(4) deg., V=1741.1(7) A{sup 3}. CsGaSnSe{sub 4} crystallizes in the orthorhombic space group Pmcn with a=7.679(2) A, b=12.655(3) A, c=18.278(5) A, V=1776.1(8) A{sup 3}. The structure of Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} consists of a polar three-dimensional network of trimeric (Sn,Ga){sub 3}Se{sub 9} units with Na atoms located in tunnels. The AGaSnSe{sub 4} possess layered structures. The compounds show nearly the same Raman spectral features, except for Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6}. Optical band gaps, determined from UV-Vis spectroscopy, range from 1.50 eV in Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} to 1.97 eV in CsGaSnSe{sub 4}. Cooling of the melts of KGaSnSe{sub 4} and RbGaSnSe{sub 4} produces only kinetically stable products. The thermodynamically stable product is accessible under extended annealing, which leads to the so-called {gamma}-form (BaGa{sub 2}S{sub 4}-type) of these compounds.

  17. Viking Line visandab oma laevadele purjeid / Sirje Rank

    Index Scriptorium Estoniae

    Rank, Sirje, 1966-

    2008-01-01

    Viking Line'i juht Nils-Erik Eklund leiab, et Tallinki uued laevad on pigem probleem kui konkurentsieelis, sest uue põlvkonna reisilaevad peaks liikuma osaliselt tuule- ja päikeseenergia jõul. Vt. samas: Tallinna-Helsingi liinil on tasakaal lähedal

  18. Energiasääst ei lahenda globaalset energiakriisi / Mikk Salu

    Index Scriptorium Estoniae

    Salu, Mikk, 1975-

    2008-01-01

    Ajakirja The Economist arvates on maailm tehnoloogiabuumi lävel, mille sisuks on üleminek traditsiooniliselt energialt taastuvale energiale, kusjuures tähtsustuvad sellised alternatiivsed allikad kui tuul, päike ja biokütus. Diagramm: Primaarsete energiaallikate osakaal maailmas

  19. Plaadid / Immo Mihkelson

    Index Scriptorium Estoniae

    Mihkelson, Immo, 1959-

    2002-01-01

    Uutest plaatidest Vanessa Carlton "Be Not Nobody", Nine Inch Nails "And All That Could have...", peeter Selis Thomson "Vaba kui tuul", Killer "Sickeningly Pretty", mylene Farmer "Les Mots", Marianne Faithfull "A Stranger On Earth", faultline "Your Love Means Everything" "Mozart in Egyt"

  20. "Kui Tallinna hakkab saabuma mitmesuguseid alaliselt siin resideeruvaid diplomaate..." : dokumente Eesti NSV Välisministeeriumi algusaegadest 1944-1948 / Tõnu Tannberg

    Index Scriptorium Estoniae

    Tannberg, Tõnu, 1961-

    2009-01-01

    1944. aastal loodi liiduvabariiklikud välisasjade- ja kaitserahvakomissariaadid kavatsusega sel moel Ühinenud Rahvaste Organisatsioonis juhtohjad enda kätte haarata. Kuna aga NSV Liit sai vetoõiguse, polnud loodud institutsioone enam sisuliselt vaja. 1946. aastaks on välisasjade rahvakomissar Hans Kruus mõistnud, et liiduvabariigi sisuline tegevus toimub vaid Moskva vahendusel. Kommenteeritud dokumendid : Eesti NSV Välisasjade rahvakomissari Hans Kruusi kiri Nikolai Karotammele ja Arnold Veimerile, 11. detsember 1944 ; Eesti NSV välisministri Hans Kruusi aruanne Nikolai Karotammele ministeeriumi tegevusest aatatel 1944-1948

  1. Keegi ei võta meilt unistusi, kui me ise neid endalt ei võta / Toomas Hendrik Ilves

    Index Scriptorium Estoniae

    Ilves, Toomas Hendrik, 1953-

    2008-01-01

    Vabariigi Presidendi kõne Eesti Vabariigi väljakuulutamise 90. aastapäeval 24. veebruaril 2008 Estonia teatris. Ilmunud ka: Postimees : na russkom jazõke 25. veebr. 2008, lk. 9; Eesti Päevaleht 25. veebr. 2008, lk. 2, pealk.: Ilves: ärme ajame segamini iseseisvust ja vabadust (lüh.); SL Õhtuleht 25. veebr. 2008, lk. 11, pealk.: Eesti on tugevam kui varem (lüh.) SL Õhtulehes vt. ka juhtkiri: Otsene kõne. SL Õhtulehe arvates oli presidendi kõne lihtne ja selge jutt Eesti kodanikule, heale sõbrale. SL Õhtulehes vt. ka Andres Varustini karikatuur; Pärnu Postimees 26. veebr. 2008, lk. 21, pealk.: Vabariigi presidendi Toomas Hendrik Ilvese aastapäevakõne 24. veebruaril Estonia teatris (lüh.); Hiiu Leht 26. veebr. 2008, lk. 2, pealk.: EV 90. aastapäeva peokõne (lüh.); Järva Teataja 26. veebr. 2008, lk. 2, pealk.: Soovid tuleb täita kuldkalakese abita; Virumaa Teataja 26. veebr. 2008, lk. 4, pealk.: Riigi heaolu eest peab seisma iga kodanik (lüh.); Põhjarannik 26. veebr. 2008, lk. 4, pealk.: Keskendugem jäävale! (lüh.); Severnoje Poberežje 26. veebr. 2008, lk. 4; Sakala 26. veebr. 2008, k. 2, pealk.: Mõisa köis ei lohise enam, sest mõis on oma ja köis on oma (lüh.); Maaleht 28. veebr. 2008, lk. 17, pealk.: Miski pole võimatu, kuni pole tõestatud vastupidist (lüh.); Eesti Elu 29. veebr. 2008, lk. 2, 16, pealk.: Vabariigi President Eesti Vabariigi väljakuulutamise 90. aastapäeval 24. veebruaril 2008 Estonia teatris (lüh.); Vaba Eesti Sõna 28. veebr. 2008, lk. 3, 10, pealk.: Vabariigi Presidendi kõne Eesti Vabariigi väljakuulutamise 90. aastapäeva pidulikul kontsertaktusel 24. veebruaril 2008 Estonia teatris; Vaba Eesti Sõna 13. märts 2008, lk. 12, pealk.: "We have assumed respectable responsibility in the family of nations" (lüh.); Läänekaare Postipoiss 2008, nr. 212, lk. 8-11, pealk.: Vabariigi President Eesti Vabariigi väljakuulutamise 90. aastapäeva pidulikul kontsertaktusel 24. veebruaril 2008 Estonia teatris

  2. Meeldis. Mõjus. Mis edasi? / Mati Unt

    Index Scriptorium Estoniae

    Unt, Mati, 1944-2005

    2004-01-01

    Artiklis räägitakse peamiselt Evald Hermaküla lavastusest "Tuul Olümposelt tuhka tõi" (Eesti Draamateater, 1986), mis pakkus Mati Undile toona viimase aja suurima teatrielamuse, aga ka sellest, et teatrisemiootikud pole senini saavutanud üksmeelt, mis on ikkagi etenduse segment

  3. Arvo Pärt: Kui kannatab üks inimene, siis kannatab kogu maailm! / Arvo Pärt, Nora Pärt ; intervjueerinud Yana Toom, Maarja-Liis Arujärv, Aleksandr Zukerman ; kommenteerinud Edgar Savisaar

    Index Scriptorium Estoniae

    Pärt, Arvo, 1935-

    2010-01-01

    Arvo Pärt ja tema abikaasa Nora Pärt andsid Türgis enne Pärdi uudisteose "Aadama itk" esiettekannet intervjuu, kus rääkisid nii nende raskustest Läände elama asumisel kui uudisteose sügavamast mõttest

  4. Hamburg kui hiiglaslik ehitustander

    Index Scriptorium Estoniae

    2003-01-01

    6. novembrist Eesti Arhitektuurimuuseumis Rotermanni soolalaos näitus "arcHH - Architektur made in Hamburg", mis esitleb Hamburgi arhitektide viimase viie aasta loomingut. Näituse koostaja Dirk Meyhöfer, arhitekt Michael Karassowitch

  5. Elu kui konstrueeritud kaos

    Index Scriptorium Estoniae

    2003-01-01

    Hardo Pajula ja Alari Purju osalesid Lõuna-Inglismaal Great Offleys toimunud rahvusvahelisel institutsionaalse ökonoomika seminaril. Vestlusest Pisa ülikooli professori Giovanni Dosi ja Mario Morroniga Itaalia sisepoliitikast ehk äri, poliitika, kuritegevuse ja meedia põimumisest. Itaalia peaministrist Silvio Berlusconist

  6. Staarielu kui teater / Mathura

    Index Scriptorium Estoniae

    Mathura, pseud., 1973-

    2008-01-01

    Režissöör Theo van Goghi mälestuseks tema 2003.a. linastunud filmi põhjal loodud mängufilm "Intervjuu" ("Interview") : režissöör ja peaosatäitja Steve Buscemi : Ameerika Ühendriigid - Holland 2007

  7. Teaduse õpetamine kui missioon

    Index Scriptorium Estoniae

    2010-01-01

    Marika Mikelsaar pälvis teaduse elutöö preemia, millest osa kavatseb kasutada omanimelise fondi loomiseks noorte teadlaste jaoks. Hiljuti valiti ta ülemaailmse ühingu Society for Microbial Ecology and Disease (SOMED) presidendiks

  8. White Paper AGA: An Episode-of-Care Framework for the Management of Obesity-Moving Toward High Value, High Quality Care: A Report From the American Gastroenterological Association Institute Obesity Episode of Care and Bundle Initiative Work Group.

    Science.gov (United States)

    Brill, Joel V; Ashmore, Jamile A; Brengman, Matthew L; Buffington, Daniel E; Feldshon, S David; Friedman, Kelli E; Margolis, Peter S; Markus, Danielle; Narramore, Leslie; Rastogi, Amita; Starpoli, Anthony A; Strople, Kenneth; White, Jane V; Streett, Sarah E

    2017-05-01

    The American Gastroenterological Association acknowledges the need for gastroenterologists to participate in and provide value-based care for both cognitive and procedural conditions. Episodes of care are designed to engage specialists in the movement toward fee for value, while facilitating improved outcomes and patient experience and a reduction in unnecessary services and overall costs. The episode of care model puts the patient at the center of all activity related to their particular diagnosis, procedure, or health care event, rather than on a physician's specific services. It encourages and incents communication, collaboration, and coordination across the full continuum of care and creates accountability for the patient's entire experience and outcome. This paper outlines a collaborative approach involving multiple stakeholders for gastrointestinal practices to assess their ability to participate in and implement an episode of care for obesity and understand the essentials of coding and billing for these services. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  9. Tuul väljal / Ene-Reet Soovik

    Index Scriptorium Estoniae

    Soovik, Ene-Reet

    1997-01-01

    Arvustus: Woolf, Virginia. Esseed/ inglise k. tlk. Malle Talvet, Jaak Rähesoo. Tallinn : Hortus Litterarum, 1997; Woolf, Virginia. Orlando : elulugu / inglise k. tlk. Riina Jesmin. Tallinn : Perioodika, 1997. (Loomingu Raamatukogu; 31-34)

  10. WSJ muutub Äripäevaks? / Harry Tuul

    Index Scriptorium Estoniae

    Tuul, Harry

    2007-01-01

    Maailma ühe mõjukaima majanduslehe Wall Street Journali ostnud Austraalia miljardärist meediamogul Rupert Murdoch plaanib lehele lugejaid juurde võita, tehes lehe vähem spetsialiseerituks. Kommenteerivad Villu Zirnask, Martin Hendre, Igor Rõtov

  11. Tuul võib hakata Saaremaale elektrit andma / Andres Sepp

    Index Scriptorium Estoniae

    Sepp, Andres, 1976-

    2001-01-01

    Taani kapitalil põhinev OÜ Roomapark asub uurima, kas investeerida sadu miljoneid kroone Kuressaare lähistele Roomassaare poolsaarele tuulegeneraatorite püstitamiseks. Taani kontsern World Wide Wind (WWW)

  12. Gerd Kanter alistas keerulised tuuled ja tugevad vastased / Peep Pahv

    Index Scriptorium Estoniae

    Pahv, Peep, 1970-

    2008-01-01

    Vt. ka Postimees : na russkom jazõke 17. märts, lk. 13. Maailmameister Gerd Kanter võitis viiendat korda Euroopa talvised karikavõistlused. Mihkel Kukk viskas oda 78.41 ning täitis Pekingi olümpia B-normi

  13. OECD ukse avamine tooks siia raha / Harry Tuul

    Index Scriptorium Estoniae

    Tuul, Harry

    2007-01-01

    Poola pensionifondid ei taha Eestisse investeerida, sest Eesti ei kuulu Majandusliku Koostöö ja Arengu Organisatsiooni. Vt. samas: OECD liikmeskond; Romet Kreek. OECD ukse avamine tooks siia raha. Kommenteerib Andre Nõmm

  14. Natura 2000 sai tuule tiibadesse Raplamaal / Ain Aivela

    Index Scriptorium Estoniae

    Aivela, Ain

    2004-01-01

    Natura 2000 idee jõudis Eestisse 2000. aastal, mil pilootprojekti raames ning Taani riigi rahalisel toel alustati Natura-võrgustiku eelvalikualade mahamärkimist Lääne- ja Raplamaal. Kommenteerinud Aleksei Lotman

  15. Taanduva Kruuda asemele astub ambitsioonikas Kusmin / Harry Tuul

    Index Scriptorium Estoniae

    Tuul, Harry

    2006-01-01

    Ilmunud ka: Delovõje Vedomosti 2. aug. lk. 7. Kalevi müügi- ja teenindusdirektor Kati Kusmin asub juhtimisest taanduva Oliver Kruuda asemele Kalevi tütarfirmade AS-i Kalev Chocolate Factory, AS-i Vilma ja AS-i Kalev Jõhvi Tootmine juhatuses. Lisa: Kati Kusmini CV. Vt. samas: Kruuda: taandun suuresti isiklikel põhjustel

  16. Soome valitsuskommunikatsioonis puhuvad muutuste tuuled / Päivi Tampere

    Index Scriptorium Estoniae

    Tampere, Päivi

    2016-01-01

    Soome riigikantselei moodustas 2016. a. veebruaris töörühma, et hinnata valitsuse ja ministeeriumite kommunikatsiooni. Kogutud informatsiooni põhjal koostatud kommunikatsiooni SWOT-analüüsist, kus loetleti põhilised tugevused, nõrkused, võimalused ja ohud ning soovitused muutusteks ja uuendusteks

  17. Maailma parimad näevad vaeva motiveerimisega / Harry Tuul

    Index Scriptorium Estoniae

    Tuul, Harry

    2011-01-01

    Rahvusvahelises juhtimiskonsultatsiooni ettevõttes Hay Group ja majandusajakirjas Fortune töötavad Tom McMullen, Mel Stark ning Mark Royal jõudsid oma artiklis Rewards-program effectiveness: What makes the world's Most Admired Companies great? järeldusele, et oluline pole niivõrd tasustamispõhimõtete ülesehitus, kuivõrd nende rakendamine ja tööshoidmine. Diagrammid

  18. Venemaa haridusministeerium kui müüt ja möödapääsmatus : haridustemaatikast eestlaste 1864. ja 1881. aasta suurmärgukirjades / Väino Sirk

    Index Scriptorium Estoniae

    Sirk, Väino, 1942-

    2016-01-01

    Märgukirja saksakeelses kavandis räägitakse koolide allutamisest kroonule. Eestikeelses tekstis on tajutav lootus riigi ainelisele abile. Venekeelses versioonis on rõhutatud halduslik, valitsuslik aspekt. 1881. aasta märgukirja erinevusest 1864. aasta märgukirjast. Teine suurmärgukiri esitati venestamise eelõhtul. Haridust käsitlev punkt kajastas eriarvamusi eestlaste eneste keskel, veelgi enam aga eesti ühiskonna ootuste ja Vene poliitika vahelist varjatud pinget

  19. Aga miks mitte panustada teraviljale? / Tarvo Vaarmets

    Index Scriptorium Estoniae

    Vaarmets, Tarvo

    2007-01-01

    Üha populaarsust koguvate ETFide ehk börsil kaubeldavate fondide hulka on lisandunud ka viimaste variatsioonid ETCd ehk börsil kaubeldavad toorained, nende perspektiivikust tõstab tarbimise kasv maailmas. Tabel: Millistel börsidel tehakse tehinguid ETF-idega

  20. Hiilgav, aga... / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Earth 2" (1994), "EZ Streets" (1996), "Profit" (1996), "Strange World" (1999), "The Inside" (2005), "Drive" (2007), "Aliens in America" (2007)

  1. Edasi loodusesse! Aga kuhu? / Riina Oruaas

    Index Scriptorium Estoniae

    Oruaas, Riina

    2007-01-01

    Tantsulavastustest: Oksana Titova, Päär Pärenson ja Juhan Ulfsak "Roots", Kaja Kanni sooloetendus "There are Laika dogs living in Estonia", Tiina Mölder, Kaja Kann ja Bush Hartshor "Naine ja Hunt"

  2. On-line retailing : a Canadian perspective / Brent McKenzie

    Index Scriptorium Estoniae

    McKenzie, Brent

    2002-01-01

    Kaanel ajak. ilmumisaeg 2001/2002. Kanadas on interneti teel ostjaid alla 2% neist, kes vastavaid interneti-lehekülgi külastavad. Konservatiivset suhtumist saab aga muuta, kui pakkuda head ja turvalist teenust ning kaupa hea hinnaga

  3. Huvi või sundus - meie valik / Rein Rebane

    Index Scriptorium Estoniae

    Rebane, Rein

    2011-01-01

    Eesti õpilaste tulemused rahvusvaheliste PISA ja TIMSS-i testide põhjal on olnud head. Samadest uuringutest on aga selgunud, et nii Eesti õpilaste kui ka õpetajate rahulolu kooliga on üks madalamaid maailmas

  4. Liivid eesti kultuuriloos (I - II) / Viive Kaljula

    Index Scriptorium Estoniae

    Kaljula, Viive

    2008-01-01

    Liividest kui väikerahva ühe perekonna väljarabelemisest teoorjuse pimedusest, ennekõike aga eneseharimisest kõigi takistuste kiuste, samuti üldsuse kasvatamisest inimlikest ideaalidest lähtudes

  5. Report: Paksas scandal raises privacy concerns / Steven Paulikas

    Index Scriptorium Estoniae

    Paulikas, Steven

    2004-01-01

    Inimõiguste ekspertide uuring näitab, et nii Leedu presidendi Rolandas Paksase administratsiooni töötajad, presidendi tegevuse uurijad kui ka Leedu ajakirjandus rikkusid mitmeid inimõigusi, eelkõige aga õigust privaatsusele

  6. 40 000 riigiteenistuses olijat ootab märgatav töötasu tõus / Kai Kalamees

    Index Scriptorium Estoniae

    Kalamees, Kai

    2007-01-01

    Ilmunud ka: Postimees : na russkom jazõke, 12. sept. 2007, lk. 3. Riigieelarvekavast, mis näeb ette 2008. aastal keskmiselt enam kui 15%-list palgatõusu õpetajatele, politseinikele, päästjatele ja vangivalvuritele ning kultuuritöötajatele ja lasteaednikele, arst-residentidele ja kiirabiarstidele. TALO juhatuse esimees Ago Tuuling ei lepi alla 20%-lise palgatõusuga. Vt. samas: IRLi ministrid erimeelel

  7. Luna : [luuletused] / Kristjan Jaak Peterson ; lühibiograafia: S. S. [Svetlan Semenenko

    Index Scriptorium Estoniae

    Peterson, Kristian Jaak, 1801-1822

    1999-01-01

    Sisu: Luna / tlk. Vs. Rozhdestvenski; Druzhba ; Pesnja, slozhennaja v kortshme Tuule po doroge iz Tartu v Rigu, kuda ja otpravilsja navestit rodnõh ; Pesnja Jaaka (on sidit v odinotshestve na gore) / tlk. A. Sokolov ; V den Martina Lutera / tlk. Vs. Rozhdestvenski. Orig.: Kuu ; Sõprus ; Laul, kui ma Tartust läksin Riia poole oma vanemaid vaatama... ; Mardi Lutheruse päeval ; Jaagu laul. Ta istub üksi mäe peal

  8. Ühiskondlik lepe keskendugu peaeesmärgile / Märt Rask

    Index Scriptorium Estoniae

    Rask, Märt, 1950-

    2003-01-01

    Eesti arengu iseärasustest ja ühiskondliku leppe tähendusest kogu ühiskonnale. Kuni ühiskondliku leppe protsessis ei osale valijatelt mandaadi saanud erakonnad, saab ühiskondlikust leppest rääkida üksnes kui algatusest, mitte aga kui ühiskonna põhisuundumusi määravast foorumist

  9. Kvoodiraha jagati Tambovi konstandi alusel / Nils Niitra

    Index Scriptorium Estoniae

    Niitra, Nils, 1975-

    2011-01-01

    Riik sai CO₂ kvoodiraha vähemalt 234 enda hoonele ja omavalitsused 239 objektile, see raha jagati aga 106 omavalitsusele ehk vähem kui pooltele kõigist 226 vallast ja linnast. Kaart: CO₂ kvoodiraha jagus vähem kui pooltele omavalitsustele; Diagramm: Riigi ja omavalitsuste objektid maakonniti

  10. Kas seadus tõesti seljatab terve talupojamõistuse? / Aive Sarjas ; kommenteerinud Karina Loi, Andres Heinver

    Index Scriptorium Estoniae

    Sarjas, Aive

    2009-01-01

    Kuusalu vallas toimuvad kord nädalas kaubavahetuspäevad "Otse tootjalt tarbijale", millega on rahul nii tootjad kui ka ostjad. Veterinaar- ja Toiduamet peab seda aga seadusevastaseks, kui müüjad pole maksnud riigilõivu ja taotlenud vastavat tunnustust

  11. Muuseum kui katedraal, kuraator kui kunstnik / Harry Liivrand

    Index Scriptorium Estoniae

    Liivrand, Harry, 1961-

    2000-01-01

    AICA 34. kongressilt Londonis 14.-16. sept. 2000. Kunstimuuseumi ja kuraatoriga seotud ettekannetest rahvusvahelise kunstikriitikute assotsiatsiooni kongressil (Charles Jencks jt.). Vastavatud Tate Modernist Londonis

  12. Teater kui katk, teater kui haiguste ravi / Kalev Kudu

    Index Scriptorium Estoniae

    Kudu, Kalev, 1961-

    2005-01-01

    Antonin Artaud' projekt tegevuskunsti festivalil "Diverse Universe". Projekti lavastas Tartu Üliõpilasteatri näitlejate ja Tartu Ülikooli kahe teatritudengiga Ph. Brehse Berliini performance'irühmast Open Space. Workshop Tartu Üliõpilasmajas 3.-6. maini ja 6. mail Sadamateatris etendus "Katk". Lisatud lavastaja ja osalejate arvamused õpikojast

  13. Kasumlikkus kui kunst. Neurolingvistika kui hirmus keeruline asi / Aavo Kokk

    Index Scriptorium Estoniae

    Kokk, Aavo, 1964-

    2004-01-01

    Rets. rmt.: Adrian Slywotzky. Kasumlikkuse kunst. Tallinn, 2003 ja Anthony Robbins. Sisemine jõud. Tartu, 2003. Vt. samas: Rets. rmt.: Leif Edvinsson. Ettevõtluse pikkuskraadid. Avastusretk teadmusmajandusse. Tallinn, 2003. Kommenteerib Arvo Pihl

  14. Altkäemaksu või pistise võtmise või andmise kui korruptiivse käitumisega tekitatud kahju hüvitamise nõue juhtorgani liikme vastu : [magistritöö] / Asso Prii ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Prii, Asso, 1986-

    2013-01-01

    Juriidilise isiku juhtorgani liikmest KarS-i ametialaste süütegude toimepanijana, juhtorgani liikme altkäemaksu või pistise andmise või võtmisega seotud korruptiivsest käitumisest kui kohustuse rikkumisest tsiviilõiguslikus mõttes, tekitatud kahjust

  15. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

    2016-01-01

    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  16. Kriminaalmenetlus kui kullakaevandus / Eerik Kergandberg

    Index Scriptorium Estoniae

    Kergandberg, Eerik, 1953-

    2016-01-01

    Tõe mõiste otsimisest põhiseadusest ja kriminaalmenetluse seadustikust, õigustegelikkusest, kriminaalmenetlusest, tõe mõistest, tõest kriminaalmenetluse eesmärgina. Sisaldab statistilist ülevaadet asjakohasest kohtupraktikast

  17. Keisriportree kui ajalooteos / Aleksandra Murre

    Index Scriptorium Estoniae

    Murre, Aleksandra

    2006-01-01

    Näitusest "Vene valitsejad" Kadrioru kunstimuuseumis ja Mikkeli muuseumis. Venemaa valitsejast Paul I-st ja temast maalitud portreedest. Peeter III portreest. Prantsuse kunstniku Jean Louis Voille' (1744 - u. 1806) elust ja loomingust

  18. Sardiinia kirjandus kui hea idee

    Index Scriptorium Estoniae

    2007-01-01

    Toimetuse artikkel Elsbeth Gut Bozzetti artikli "Vana maailm ja uus laine" (Alte Welt und neue Welle. - Neue Zürcher Zeitung 16.12. 2006) ning internetis avaldatud materjali põhjal. Gavino Ledda, Salvatore Satta, Salvatore Niffoi jt.

  19. Teater kui teater / Luule Epner

    Index Scriptorium Estoniae

    Epner, Luule, 1953-

    2003-01-01

    Vaadeldakse fenomenoloogilisest aspektist eesti teatrit, erinevaid lavastusi ("Peiarite õhtunäitus", "Potteri lõpp", "Tango", "Hot", "No More Tears", "Roberto Zucco", "Merimees") ja erinevaid lavastajakäekirju (P. Pedajas ja Kõivu-teater, M. Unt, L. Peterson, T. Ojasoo)

  20. "Improtest" kui "improbleem" / Tõnis Kahu

    Index Scriptorium Estoniae

    Kahu, Tõnis, 1962-

    2009-01-01

    Improvisatsioonilise muusika kontserdisarjast "Improtest", sarja hooaja avakontserdist, kus esines prantsuse kitarrist Jean-Francois Pauvros. "Improtesti" eestvedajad Taavi Kerikmäe ja Mart Soo vastavad küsimustele

  1. Elu kui muinasjutt / Andrus Villem

    Index Scriptorium Estoniae

    Villem, Andrus

    2004-01-01

    Ilmunud ka: Sakala, 20. okt. 2004, lk. 2; Pärnu Postimees, 20. okt. 2004, lk. 15; Järva Teataja, 21. okt. 2004, lk. 2; Nädaline, 21. okt. 2004, lk. 4; Koit, 21. okt. 2004, lk. 6; Hiiu Leht, 22. okt. 2004, lk. 2; Lääne Elu, 26. okt. 2004, lk. 2; Virumaa Teataja, 2. nov. 2004, lk. 7. Autor käsitleb mõistujutuna erakondade omavahelisi suhteid

  2. Lendamine kui religioon / Erkki Luuk

    Index Scriptorium Estoniae

    Luuk, Erkki, 1971-

    2003-01-01

    Arvustus: Saint-Exupéry, Antoine de. Lõuna postilennuk : [romaan] / prantsuse keelest tõlkinud Merike Riives ; Inimeste maa : [romaan] / prantsuse keelest tõlkinud Merike Riives ja Maria Hange. [Tallinn] : Varrak, 2003

  3. Hullem kui tuumapomm / Urmas Kiil

    Index Scriptorium Estoniae

    Kiil, Urmas

    2007-01-01

    Jaapani kaitseministri Fumio Kyuma arvamusavaldus Hiroshima ja Nagasaki tuumapommide rolli kohta sõja lõpetamisel ja Jaapani terviklikkuse säilitamisel maksid ministrile ametikoha ja tekitasid segadust valimiste-eelses poliitikas

  4. Valimised kui supermarket / Urmas Varblane

    Index Scriptorium Estoniae

    Varblane, Urmas, 1961-

    2007-01-01

    Autor võrdleb parlamendivalimiste kampaaniat supermarketis toimuvaga: poliitikud tegelevad vaid lühiajaliste rahalubadustega, kuid Eestit ohustab väga suur laenukoormus. Valimiskampaanias peaks olema arutelu, mis suunas ja kuidas tuleks edasi liikuda, kirjutab autor

  5. Rahvuspaviljon kui lakmuspaber / Reet Varblane

    Index Scriptorium Estoniae

    Varblane, Reet, 1952-

    2003-01-01

    50. Veneetsia biennaal "Unistused ja konfliktid". Kuraator Francesco Bonami. Võrdlus 49. Veneetsia biennaaliga. Šveitsi paviljonis näidatud Emanuelle Antille'i filmist "Angels Camp", iisraeli kunstniku Michal Rovneri ja Luksemburgi esindava Su-Mei Tse (rahvusväljapaneku preemia) ruumist, Eesti väljapanekust "Marko und Kaido" - Marko Mäetamm ja Kaido Ole

  6. Programmeerimine kui keeleoskus / Raivo Hool

    Index Scriptorium Estoniae

    Hool, Raivo

    2015-01-01

    Tutvustus: Carol Vorderman. Õpime üheskoos programmeerima : visuaalne teejuht algajale kahendkoodist kuni mängude koostamiseni; Õpime üheskoos matemaatikat : visuaalne teejuht arvutamisest statistikani. Tallinn, 2015

  7. "Juba õhtu on käes..." : [luuletused] / Sergei Jessenin ; tlk. Helvi Jürisson, Artur Alliksaar, Muia Veetamm, Linda Ruud, Jaan Kross, Ellen Niit, Debora Vaarandi, Venda Sõelsepp

    Index Scriptorium Estoniae

    Jessenin, Sergei, 1895-1925

    2006-01-01

    Sisu: "Juba õhtu on käes..." ; "Seal, kus koit valab kapsaste vahel..." ; "Tulvavesi suitsev..." ; "Tegin oja kaldal vene..." ; "Laia taevaliua sinal..." ; "Kallis kodu! Näen kui unes..." ; "Olen karjus; minu valdus..." ; Venemaa ; Joobumus ; Hobused ; Laul koerast ; "Milleks punakuldseis põõsais nuuksed..." ; "Teispool jõge lõkkeread..." ; "Mind väsitand on kodunurk..." ; "See on mu kodu, mõtlik-hell..." ; Sinendus ; "Õhtul, kui kõik jooned nõrgemad..." ; "Homme varakult üles mind aja..." ; "Isamaja, kuhu jäid..." ; "Paljad põllud, metsaveered..." ; "Su juus on roheline..." ; "Laulud, laulud, kuhu te viite..." ; "Õnn, sina rumal! Mu aknad..." ; "Valged teed kinni tuiskab..." ; "Taas kiindumust ma vajan uut..." ; "Tiigipinnale kuldlehti liibub..." ; "Tuuled, tuuled, oo lund tooge, tuuled..." ; "Olen viimane külapoeet ma..." ; "Pole tarvis palvet, kurtmist, nuttu..." ; "Jah! Nüüd kindel on küll, et ei iial..." ; "Samasugune lihtne kui muud..." ; "Mingi troika on värava taga..." ; Kiri emale ; "Kõik me vähehaaval kaome sinna..." ; "Shagane, minu hea Shagane..." ; "Elurõõmus maailm, sinine ja lai..." ; "Koju ma ei leia teed..." ; "Sinav mai. Eha punerdav joom..." ; "Magab stepp. Koirohu tinast värskust..." ; "Meretäis sädinat õues..." ; "Elu pettus on, mis kestab päevast päeva..." ; "Mängi, lõõtspill, julgelt, mängi, lõõtspill, valju..." ; "Pole näinud ma kaunimat sinust..." ; "Laula nüüd mõnda laulukest, mida..." ; "Selle maailma kiiresti läbin..." ; "Sinistkirja pluus ja sinisilmadki..." ; "Tukub heledas kuuvalges..." ; "Küll on tuisk, tont võtaks, taevas ära kaob..." ; "Kes ma olen? Ainult unistaja..." ; "Sõber, hüvasti, mul ees on minek...". Eluloolisi andmeid autori kohta lk. 821

  8. Viagens, tremores e conchas: aspectos da natureza da América em escritos de José Bonifácio de Andrada e Silva, José Hipólito Unanúe e Dámaso Antonio Larrañaga

    Directory of Open Access Journals (Sweden)

    Maria Margaret Lopes

    Full Text Available Este artigo apresenta aspectos da produção científica de três ilustrados que atuaram na América do Sul: José Bonifácio de Andrada e Silva (1763-1838, José Hipólito Unanúe (1755-1833 e Dámaso Antonio Larrañaga (1771-1848. Os três naturalistas - de trajetórias, territórios e crenças diferenciadas - construíram suas versões sobre aspectos da natureza da América. Em comum, contribuíram com seus trabalhos científicos para a construção da geohistória americana. Foram escolhidos para análise por critérios de dispersão territorial e por suas diferentes abordagens sobre aspectos específicos das Ciências da Terra - temas que ainda hoje têm merecido menor atenção, mesmo entre os historiadores latino-americanos das ciências. Este artigo argumenta que estes personagens não só construíram seus próprios conhecimentos sobre temperamentos (climas e territórios, como também utilizaram seu conhecimento científico no implemento de ações políticas para os seus respectivos países em conformação.

  9. Ernst Enno 121 : [Ernst Enno nimelise kirjandusliku omaloominguvõistluse 1996. aasta paremad luuletused

    Index Scriptorium Estoniae

    1996-01-01

    Janek Nee (Haapsalu Wiedemanni gümnaasiumi 11. kl.). Teed lõpmatusse; Liina Krips (Haapsalu gümnaasiumi 12. kl.). Inimene, 'Olin arvanud, et minust hoolitakse...'; Loola Hütt (Haapsalu sanatoorse internaatkooli 13. kl.). 'Mäletad kui hele oli kuu..., 'Jälle ei jõa kuu...', 'Suveöö sumedates silmapilkudes...'; Evelin Lillepuu (Taebla gümnaasiumi 9. kl.). Tuul; Anne Roovere (Kullamaa keskk. 8. kl.). See on koht; Martin Kaasik (Haapsalu Wiedemanni gümnaasiumi 7. kl.). Vembumehed; Külli Kivi (Haapsalu Wiedemanni gümnaasiumi 9. kl.). Vaikus

  10. Lesnoi tsvetok : [luuletused] / Anna Haava ; lühibiograafia: O. K. [Oskar Kruus

    Index Scriptorium Estoniae

    Haava, Anna, pseud., 1864-1957

    1999-01-01

    Sisu: Lesnoi tsvetok 1-2 / tlk. Bronislav Kezhun ; Net, stih ne vetrõ navevajut / tlk. Nora Javorskaja ; Odin lish raz ljubov bõvajet / tlk. B. Kezhun ; "Zabotõ svoi shoronila..." / tlk. Marina Tervonen ; Sodom i Gomorra / tlk. V. Sokolov ; Oh, rodina ; Vetra, tshto mansardu moju produvali / tlk. Nora Javorskaja. Orig.: Nõmmelill 1-2 ; Ei tule luule tuulest ; Üks ainus kord ; Mu mured kõik matsin ma maha ; Sina, Soodom ja Gomorra ; Oh kodumaa ; Kui puhus mu katusekambri tuul

  11. Bone marrow examination findings at Aga Khan University Hospital ...

    African Journals Online (AJOL)

    Nutritional anaemia as a group was the most common haematological disorder ... examination in our patients with megaloblastic anaemia predominating. ... indication for bone marrow examination was anaemia followed by diagnostic work up ...

  12. Pola Spasial Permukiman Tradisional Bali Aga di Desa Sekardadi, Kintamani

    Directory of Open Access Journals (Sweden)

    Ni Ketut Agusintadewi

    2017-03-01

    Full Text Available The Bayung Gede village has derived smaller traditional settlements around Kintamani. Sekardadi is one of these settlements that has an inherent consociates with the village of origin, or the Bayung Gede. Despite the fact that the Sekardadi has a uniqueness on spatial pattern and house lay out, this village has not been welldocumented as an old village in Bali. These uniqueness are interesting to be indepth explored. It is not only on the basic philosophy of the house pattern, but also how this pattern to be physical implemented. This study aims to describe some characteristics of the village, both physical and nonphysical aspects, through the way of descriptive exploratory qualitative approach. According to the theory housing pattern of Habraken (1978 and Turgut (2001, research variables are determined into three variables: 1 Cultural setting; 2 Behavioural setting; and 3 Spatial setting. The result shows that macro spatial pattern of the Sekardadi village is divided into three zones: 1 Utama Mandala locates in the north of the village; 2 Madya Mandala is in the middle of the village, and 3 Nista Mandala in the south. Spatial pattern follows the hulu-teben conception or linear pattern with the main road as a cardinal orientation. Higher land means a sacred area (parahyangan that is characterized by the existence of Pura Puseh. Meanwhile, the opposite is defined as a profane area (palemahan with the presence of graves; and in the middle is the settlement (pawongan. Keywords: spatial pattern; traditional settlement; Sekardadi village

  13. Elu on muinasjutuline, aga muinasjutt ei ole / Neeme Korv

    Index Scriptorium Estoniae

    Korv, Neeme, 1974-

    2005-01-01

    Koguperefilm "Lemony Snicket sari õnnetuid lugusid" ("Lemony Snicket's A Series of Unfortunate Events") : režissöör Brad Silberling : Ameerika Ühendriigid 2004. Lisatud kommentaarid kirjastaja Leelo Märjamaalt ja toimetaja Rein Põderilt

  14. Efektiivne, aga mitte väga innovatiivne / Villu Zirnask

    Index Scriptorium Estoniae

    Zirnask, Villu, 1966-

    2006-01-01

    World Economic Forumi (WEF) hinnangul kuulub Eesti nende üheksa riigi hulka, mis on teel efektiivsusel põhinevast arengustaadiumist innovatsioonil põhinevasse staadiumi. Eesti kohast WEF-i konkurentsivõime edetabelis. Lisad: Eesti innovatsiooninäitajad võrreldes Euroopa Liidu keskmise tasemega; Innovatsioon: Eesti 2014. aasta eesmärgid. Tabel

  15. Mazda6 - moodne, aga kisub riidu / Taivo Paju

    Index Scriptorium Estoniae

    Paju, Taivo, 1968-

    2003-01-01

    Suur osa Mazda6 edus on kindlasti reklaamiagentuuri Rapp Collins turunduskampaanial, leiab autor. Artikli aluseks on Rapp Collins Eesti tegevdirektori Anu Brümmeli ettekanne turunduskonverentsil Password 2003.

  16. Optimism kasvab, aga head ajad ei tule tagasi? / Stan Nahkor

    Index Scriptorium Estoniae

    Nahkor, Stan

    2011-01-01

    Heaoluühiskondadesse jõuab üha selgemini arusaamine, et eluiga pikeneb ja rahvastik vananeb, levib ka ebakindlus riiklike pensionide jätkusuutlikkuse suhtes. Seda ilmestab hoiuste mahu järjekindel kasv. Pankade probleemiks on peale vähenevate tulude ka suurenev valitsussektori sekkumine

  17. Hiilgav, aga... vol.2 / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Action" (1999), "Now and Again" (1999), "Firefly" (2002), "Freaks and Geeks" (1999), "Undeclared" (2001)

  18. Pension tõuseb - aga edasi? / Eiki Nestor

    Index Scriptorium Estoniae

    Nestor, Eiki, 1953-

    2008-01-01

    Pensionide uuest indekseerimise korrast. Ilmunud ka Nädaline 20. märts 2008, lk. 4 ; Valgamaalane 20. märts 2008, lk. 2 ; LõunaLeht 20. märts 2008, lk. 4 ; Põhjarannik 20. märts 2008, lk. 4 ; Võrumaa Teataja 25. märts 2008, lk. 2 ; Vali Uudised 26. märts 2008, lk. 2 ; Sõnumitooja 26. märts 2008, lk. 6 ; Meie Maa 25. märts 2008, lk. 2 ; Lääne Elu 25. märts 2008, lk. 2 ; Kuulutaja 28. märts 2008, lk. 4 ; Türi Rahvaleht 28. märts 2008, lk. 4 ; Oma Saar 28. märts 2008, lk. 5 ; Vooremaa 22. märts 2008, lk. 2 ; Pärnu Postimees 27. märts 2008, lk. 15 ; Narva Postiljon 5. aprill 2008, lk. 2 ; Videvik 3. aprill 2008, lk. 2 ; Virumaa Teataja 8. aprill 2008, lk. 11 ; Nädalaleht 20. märts 2008, lk. 5

  19. Kõik, millest on raske loobuda (aga peab) / Mark Earls

    Index Scriptorium Estoniae

    Earls, Mark

    2003-01-01

    Katkend raamatust "Welcome to creative age. Bananas, Business and Death of Marketing", milles autor seab kahtluse alla mitmed turundusega seotud käibetõed, kutsub üles neist loobuma ja võtma suuna loovusele. Vt. ka: Sissejuhatuse asemel

  20. Miks projektivõrgustikud projektmeeskondadele tuule alla teevad ? / Jonathan Cummings, Carol Pletscher

    Index Scriptorium Estoniae

    Cummings, Jonatahan

    2011-01-01

    Õige ja asjakohase oskusteabe leidmise keerukusest teadmistemahukate meeskonnaprojektide realiseerimisel. Projektvõrgustike analüüs. Skeemid: Mille poolest finaalijõudnud meeskonnad erinesid?, Kuidas projektvõrgustikud laiendavad meeskonna haaret?, Kuidas kasutada projektvõrgustikke?

  1. Vike-Freiberga on sunnitud kleite müüma / Harry Tuul

    Index Scriptorium Estoniae

    Tuul, Harry

    2007-01-01

    Läti endine president Vaira Vike-Freiberga kavatseb oma esindusriided eBays maha müüa. Koos abikaasa Imants Freibergsiga asutati konsultatsioonifirma VVF Consulting, mis annab nõu diplomaatia, poliitika ja läbirääkimiste kunstis. Ekspresidendi tulevikuplaanidest. Vaira Vike-Freiberga kohta avaldavad arvamust Eesti suursaadik Riias 2002-2006 Toomas Lukk ja president Toomas Hendrik Ilves. T.H. Ilvese sõnul on Vaira Vike-Freiberga Läti patrioot, kes oli ühtlasi rahvusvahelises rindes kõigi kolme Balti riigi eestkõneleja

  2. Eesti võib ka teisel korral eurota jääda / Harry Tuul

    Index Scriptorium Estoniae

    Tuul, Harry

    2006-01-01

    Eesti Panga teatel mõjutab Lähis-Ida konflikti tõttu tõusta võiv naftahind Eesti võimet euroga liitumiseks vajalikku inflatsioonikriteeriumi täita. Vt. samas: OPEC: hinnatõus peatub 2007. aastal; Eesti Pank ohjab laenuriske. Lisa: Eestil täitmata vaid üks nõue

  3. Millised tuuled puhuvad noorte tööturumaastikul? / Maali Pert

    Index Scriptorium Estoniae

    Pert, Maali

    2012-01-01

    20. septembril toimus kolmas SA Innove karjääri- ja nõustamisteenuste arenduskeskuste korraldatud tööturuinfo seminar karjäärispetsialistidele. Ajalehe "Aken" küsmustele vastasid koolitaja Siim Krusell ning karjäärispetsialistid Sirli Kriisa ja Kätlin Adamsoo

  4. Koolieelne kasvatus jätkuvalt aktuaalne / Aino Saar, Lehte Tuuling, Gaili Suursaar

    Index Scriptorium Estoniae

    Saar, Aino, 1952-

    1997-01-01

    Münchenis toimunud EECERA (European Early Childhood Education Research Association) konverents. EECERA - rahvusvaheline organisatsioon, mis on pühendunud koolieelse kasvatusega seotud uurimuste soodustamisele ja uurimistulemuste levitamisele

  5. Kui Savisaar oli peaminister ja Ilves ajakirjanik

    Index Scriptorium Estoniae

    2011-01-01

    Valitud katkendeid Tarmo Vahteri raamatust "Vaba riigi tulek". Tallinn, 2011. Muuhulgas on ära toodud väljavõte Raadio Vaba Euroopa Eesti toimetuse juhi Toomas Hendrik Ilvese intervjuust Edgar Savisaarega 9. mail 1991

  6. Ei enamat kui halb illustratsioon / Kristiina Davidjants

    Index Scriptorium Estoniae

    Davidjants, Kristiina, 1974-

    2006-01-01

    Patrick Süskindi krimiromaani "Parfüüm" ekraniseering "Parfüüm : ühe mõrva lugu" ("Perfume: The Story of a Murderer") : režissöör Tom Tykwer : peaosas Ben Whishaw : Ameerika Ühendriigid - Saksamaa 2006. Võrdlus raamatuga

  7. Ai kui vahva idabisnis! / Hans H. Luik

    Index Scriptorium Estoniae

    Luik, Hans H., 1961-

    2006-01-01

    Ilmunud ka: Infopress 25. aug. nr. 34 lk. 155. Seoses Pakterminali käibelanguse põhjuste ja väiksemate Vene-suunaliste ebaõnnestumistega meenutab autor sõjaeelse Eesti Vabariigi äri bolshevike röövitud Tsaari-Venemaa kullaga

  8. Midagi enamat kui hea film / Peep Pedmanson

    Index Scriptorium Estoniae

    Pedmanson, Peep

    2006-01-01

    Mängufilm "Libahundi needus" : stsenaristid Margus Kasterpalu, Ilmar Raag ja Rainer Sarnet : režissöör Rainer Sarnet : osades Katariina Lauk, Rene Reinumägi : Shop of Dreams - Eesti Televisioon 2005

  9. Kui Euroopa ongi teistsugune / Mihkel Mutt

    Index Scriptorium Estoniae

    Mutt, Mihkel, 1953-

    1997-01-01

    Viljandi Kultuurikolledži teatrikateedri diplomietendusest 'Spoon River' (Edgar Lee Mastersi "Spoon Riveri koolnud" järgi dramat. ja lav. Jaanus Rohumaa) ning Sven Holmi 'Schumanni öö' Eesti Draamateatris, lavastaja Eva Jorgensen Taanist

  10. Pärmiseen kui Metuusala / Priit Ennet

    Index Scriptorium Estoniae

    Ennet, Priit

    2008-01-01

    Lõuna-California ülikooli biogerontoloog Valter Longo ja tema kolleegid lülitasid tavalise pagaripärmi rakkudes kaks geeni välja ja pärmi eluiga pikenes kümme korda. Nüüd uuritakse, kas meetod võib töötada ka inimesel

  11. Pragmaatika kui hea kunsti garant / Indrek Grigor

    Index Scriptorium Estoniae

    Grigor, Indrek, 1981-

    2007-01-01

    Tartu Kõrgema Kunstikooli diplomitöödest: Martti Poomi (S'Poom "Na'Miin") ja Asko Kikkuli (Iconcrash "My Sky") muusikavideotest, Kaisa Eiche teoreetilisest uurimusest "Kultuuritehase vajalikkus ja teostatavus Tartus", Carl-Christian Frey animafilmist "Pärastlõuna", Andrus Lauringsoni installatsioonist "Capaskoop", Berit Talpsepa robootilisest skulptuurist "Superheterodüünvastuvõtt", Eike Epliku installatiivsest skulptuurist "Ma saan aru, et ma ei ole orav", Anna-Stina Treumundi fotoinstallatsioonist "Vaikiv dialoog", Kalev Vapperi sotsiaalkollaazhist "Vapper Kalev lõpetab kooli"

  12. Edinburghi festival kui kogemus / Riina Oruaas

    Index Scriptorium Estoniae

    Oruaas, Riina

    2008-01-01

    Edinburghis toimuvast rahvusvahelisest teatri- ehk etenduskunstide festivalist Fringe 2008 (8. - 31. VIII 2008). Pikemalt mõningatest tantsu- ja sõnalavastusest ning teatrikriitikute tööst seoses festivaliga

  13. Kui vana on kunstnik? / Anneli Porri

    Index Scriptorium Estoniae

    Porri, Anneli, 1980-

    2003-01-01

    Rahvusvahelise kunstihariduse konverentsi "InSea on Sea" raames Kunstiakadeemia galeriis Karin Laansoo kureeritud Tallinna Kunstikooli õpilaste tööde näitus "MÄRKmed", Draakoni galeriis Mari Sobolevi kureeritud Viljandi Maagümnaasiumi kunstistuudio näitus "Sisseastumiseksam maailma", rahvusraamatukogus Anneli Porri kureeritud näitus "Kokkuvõte" EKA tänavuste lõpetajate töödest ja näitus "Leitud tagahoovist", Kullo galeriis rahvusvaheline näitus "Dialoog erinevuste vahel"

  14. Vaktsineerimine kui hoop Eesti maaelule / Ivari Padar

    Index Scriptorium Estoniae

    Padar, Ivari, 1965-

    2001-01-01

    Põllumajandusminister selgitab põllumajandusministeeriumi tegevust Eestit ähvardava suu- ja sõrataudi tõrjumisel. Autor: Rahvaerakond Mõõdukad. Ilmunud ka: Maaleht, 12. apr. 2001, lk. 15; Nädaline, 12. apr. 2001, lk. 4; Meie Maa, 12. apr. 2001, lk. 4; Virumaa Teataja, 11. apr. 2001, lk.7; Vooremaa, 17. apr. 2001, lk. 3; Järva Teataja, 20. apr. 2001, lk. 2

  15. Šveitsi arhitektuur kui kunstiteos

    Index Scriptorium Estoniae

    2004-01-01

    Rotermanni soolalao arhitektuurimuuseumi näitusesaalides Jacques Lucani kureeritud šveitsi kaasaegse arhitektuuri näitus "A Matter of Art", mis esitleb šveitsi tipparhitekte (Peter Zumthor, Anette Gigon, Mike Guyer, arhitektuuribürood Herzog & de Meuron, Diener & Diener jt.) ja aastail 1997-2001 ehitatud hooneid. Filmiprogramm

  16. Kui Julia armastab Juliat / Kaisa Karu

    Index Scriptorium Estoniae

    Karu, Kaisa

    2007-01-01

    Inglise 3-osaline draamasari "Apelsinid pole ainsad viljad" ("Oranges Are Not the Only Fruit"), stsenarist oma esikromaani alusel Jeanette Winterson, peaosas Charlotte Coleman. Sama ka : Teleleht nr. 45, lk. 9 : ill

  17. Kui kaugel on Peruu? / Ricardo Mateo Durand

    Index Scriptorium Estoniae

    Durand, Ricardo Mateo

    2002-01-01

    Peruu Vabariigi aukonsul Eestis Ricardo Mateo Durand Eesti-Portugali diplomaatilistest suhetest, Eesti viisa hankimise raskustest Peruus, Lõuna-Ameerikast. Vt. samas Tiina Maiberg "Välisministeerium loodab saata Peruusse aukonsuli"

  18. Kui sulg ei jookse... / Jaanus Noormets

    Index Scriptorium Estoniae

    Noormets, Jaanus

    2003-01-01

    Kuidas stsenarist Charlie Kaufman kirjutas stsenaariumi oma loomevaevadest Susan Orleani raamatu filmiks kirjutamisel : mängufilm "Kuidas kirjutada kassafilmi" ("Adaptation") : režissöör Spike Jonze : Ameerika Ühendriigid 2002

  19. Digitaalne kood kui materia prima / Raivo Kelomees

    Index Scriptorium Estoniae

    Kelomees, Raivo, 1960-

    2003-01-01

    Festival "Ars Electronica 2003" Austrias Linzis 6.-11. IX oli pühendatud koodile: seaduse-, kunsti-, bioloogilise ja arvutikoodi tähenduses. Tarkvarakunstiteemalisest (software art) diskussioonist. Peapreemia Goldene Nica - Blast Theory "Can you see me now?"

  20. Rohkem kui lihtsalt tantsufilm / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2005-01-01

    Rahvusvahelises ühistöös valminud tantsufilm "Teine" ("Another") : režissöör Rene Vilbre : stsenaristid Rene Vilbre, Teet Kask, Helena Jonsdottir : produtsent Heidi Pruuli : koreograaf ja peaoaline Helena Jonsdottir : osatäitjad Mait Malmsten, Ruslan Stepanov : Eesti - Island 2005

  1. Pensionidest nii eakatele kui keskealistele / Hannes Rumm

    Index Scriptorium Estoniae

    Rumm, Hannes, 1968-

    2007-01-01

    Ilmunud ka: Lääne Elu, 20. sept. 2007, lk. 2; Vali Uudised, 21. sept. 2007, lk. 2; Harjumaa, 21. sept. 2007, lk. 2; Nädalaleht, 21. sept. 2007, lk. 3; Molodjozh Estonii, 22. sept. 2007, lk. 5; Põhjarannik, 22. sept. 2007, lk. 5; Severnoje Poberzhje, 22. sept. 2007, lk. 2; Sakala, 25. sept. 2007, lk. 2; Valgamaalane, 25. sept. 2007, lk. 2; Järva Teataja, 27. sept. 2007, lk. 2; Lõunaleht, 27. sept. 2007, lk. 2; Koit, 27. sept. 2007, lk. 6; Pärnu Postimees, 2. okt. 2007, lk. 19; Nädaline, 2. okt. 2007, lk. 4. Parlamendiliige tutvustab valitsusliidu poolt paika pandud pensionitõusu plaani aastani 2011

  2. Seks on parem kui Pelevin / Vaapo Vaher

    Index Scriptorium Estoniae

    Vaher, Vaapo, 1945-

    2011-01-01

    Tutvustus: Pelevin, Viktor. Libalooma Püha Raamat / tõlkinud Maiga Varik. Tallinn : Varrak, 2011 ; Weber, Andreas. Kõik me tunneme / tõlkinud Krista Räni. Tallinn : Varrak, 2011 ; Vella, Juri. Järvetuul / tõlkinud Art Leete. Tallinn : Varrak, 2011

  3. Kunstnike aastanäitus kui kobarkino

    Index Scriptorium Estoniae

    2003-01-01

    19. detsembrist Tallinnas Eesti Kunstnike Liidu IV aastanäitus: Hobusepea ja Draakoni galeriis Andrus Joonase kuraatoriprojekt "Rehabilitatsioon" (avamisel esineb rühmitus Fashist Lendas Üle), Tallinna Kunstihoones ja Kunstihoone galeriis Ants Juske kureeritud "Mina ja Teine" (kujundaja Jaan Elken, avamisel esitles Eesti Litograafiakeskus oma uut litomappi)

  4. Kui koolist saab villand / Aivi Pargi

    Index Scriptorium Estoniae

    Pargi, Aivi, 1950-

    2004-01-01

    Mitme riigi pedagoogid leiavad, et põhikoolieas kooli pooleli jätmine on uus sotsiaalne nähtus, mida saab ennetada õpetajatele uusi oskusi andes ning vanematega koostööd tehes. Kommenteerivad Riina Veidenbaum, Tiina Kivirand

  5. Parteide sisekultuur kui edu valem? / Ruth Alas

    Index Scriptorium Estoniae

    Alas, Ruth, 1960-2018

    2011-01-01

    Tallinna Euroopa kultuuripealinnaks saamisel uuris Estonian Business School (EBS) Eesti organisatsioonide kultuuri. Autori hinnangul oleks huvitav valimiseelses olukorras sama metoodikat rakendada ka meie parteide sisekultuuri hindamisel

  6. Vene tank kui force majeure / Andrei Hvostov

    Index Scriptorium Estoniae

    Hvostov, Andrei, 1963-

    2008-01-01

    Autor on seisukohal, et eestlane ei taha oma ametnikke ülal pidada. Küsimus laieneb tema sõnul eksistentsiaalseks: kas eestlane tahab üldse oma riiki ülal pidada? Rahvas näeb riigis vaid küllusesarve, poliitikud oma ambitsioonide realiseerimise vahendit

  7. Kui sind ei ole siin, siis...

    Index Scriptorium Estoniae

    Käesel, Tiina, 1943-

    2010-01-01

    Münchenis 62. rahvusvahelise käsitöömessi raames toimunud rahvusvahelisest konkurssnäitusest "Ehe" (Schmuck"), kuhu Eestist oli valitud Tanel Veenre tööga "Flora talv", konkurssnäitusest "Talendid" ("Talente"), Eesti ehtekunstnike rühmituse ÕhuLoss näitusest Müncheni Vana põhjakalmistu surnuaiavahi majas jt. ehtenäitustest

  8. Keskmaa kui Euroopa Liit / Juhan Habicht

    Index Scriptorium Estoniae

    Habicht, Juhan, 1954-

    2002-01-01

    Tänasest linastub Tallinnas ja Tartus esimene Peter Jacksoni käe all valmivast kolmest filmist J.R.R. Tolkieni triloogia "Sõrmuste isand" alusel - "Sõrmuse vennaskond", "The Lord of the Rings : The Fellowship of the Ring" : Uus-Meremaa, Ameerika Ühendriigid 2001. J.R.R. Tolkieni raamatutest

  9. Kaasaegne kunst kui ekstreemne meelelahutus / Sandra Jõgeva

    Index Scriptorium Estoniae

    Jõgeva, Sandra, 1976-

    2005-01-01

    Tutvustatakse kümmet kaasaegset kunstirühmitust ja -projekti: USA anonüümne kollektiiv The Yes Men, rahvusvaheline rühmitus The Biotic Pie Bacing Brigade, Hispaania rühmitus Yomango, taani disainerite rühmitus N55, poolaka Krzystof Wodiczko projekt, USA rühmitus Basekamp, Austraalia tegevuskunstniku Stelarc' projekt, USA rühmitus Pink Bloque ja Inglismaa rühmitus My Dads Strip Club

  10. Kui suur on maailmakirjandus? / Cornelius Hasselblatt

    Index Scriptorium Estoniae

    Hasselblatt, Cornelius, 1960-

    2015-01-01

    Arvustus: Aija Sakova-Merivee. Ausgraben und Erinnern. Denkbilder des Erinnerns und der moralischen Zeugenschaft im Werk von Ene Mihkelson und Christa Wolf. Tartu : University of Tartu Press, c2014. (Dissertationes litterarum et contemplationis comparativae Universitatis Tartuensis, 1406-913X ; 13)

  11. Skulptuur kui avaliku ruumi keskkond / Rael Artel

    Index Scriptorium Estoniae

    Artel, Rael, 1980-

    2004-01-01

    Skulptuuri mõistest, keskkonnana lahendatud skulptuuridest. Daniel Libeskindi projekteeritud Holokausti tornist ja Eksiili aiast Berliini juudimuuseumis, Maya Lini (sünd. 1959) Vietnami sõja veteranide memoriaalist (1982) Washington DC-s, Joseph Beuysi aiaskulptuurist "7000 tamme" (1982-1987) Kasselis, Raoul Kurvitza "Katedraalist kodututele" (1999) Vabaduse väljakul, Andres Kure heliinstallatsioonist "Metroopol" (1999) Tallinna Liivalaia t. jalakäijate tunnelis

  12. Kui palju on vaja ohvreid / Silver Meikar

    Index Scriptorium Estoniae

    Meikar, Silver, 1978-

    2008-01-01

    Ilmunud ka: Sakala 27. märts lk. 2, Keskus apr. nr. 4 lk. 56-57, Pärnu Postimees 2. mai lk. 15. Parlamendiliikme sõnul peab maailma üldsus Hiina suhtes otsustavalt käituma ning ta kutsub Eesti sportlasi ja poliitikuid üles Pekingi olümpiamängude avatseremoonial mitte osalema. Ajalehes Keskus kommenteerib Urmas Pappel

  13. Kui KINO tuli Rakverre / Aivi Pargi

    Index Scriptorium Estoniae

    Pargi, Aivi, 1950-

    1999-01-01

    30. sept. - 3. okt. Exclusive'i ööklubis toimuva Põhjamaade ja Baltikumi noorte videofilmide filmifestivali "Visions of Light" raames toimis Rakvere linna keskraamatukogu lasteosakonnas nukufilmi ja animafilmi õpikoda

  14. Ksenofoobia kui rahvuslik uhkus / Tanel Mazur

    Index Scriptorium Estoniae

    Mazur, Tanel, 1971-

    2008-01-01

    Eestlaste võõrastekartusest. Autori hinnangul oleme olukorras, kus vaid sadakond aastat tagasi ise koloonia staatusest vabanenuna peame hakkama käituma samaväärselt postkoloniaalsete suurriikidega

  15. Festival kui uurimus inimesest / Kristo Kruusman

    Index Scriptorium Estoniae

    Kruusman, Kristo

    2005-01-01

    Rahvusvahelisest teatrifestivalist Sirenos, mis toimus 24. sept. 3. okt. Vilniuses. G. Varnase lavastused Kaunase Draamateatris : F. Dostojevski "Kuritöö ja karistus" ja J.-L. Lagarce'i "Kauge maa" ; O. Korshunovase lavastused: W. Shakespeare'i "Romeo ja Julia" Oskaras Korshunovase Teatris ja M. von Mayenburgi "Külm laps" Klaipeda Teatris ; W. Shakespeare'i "Kuningas Lear " Rahvuslikus Draamateatris V. Masalskise lavastuses

  16. Kindlustuspakett kui Lego torn / Liina Leiten

    Index Scriptorium Estoniae

    Leiten, Liina

    1999-01-01

    Koduse vara kindlustamise tingimused. Tabelid: 1999.a. 1. kvartali usaldusreiting varakindlustuse osas, valik koduse vara kindlustamise hinnapakkumisi. Kommenteerivad maaklerfirma In Bro & Partners kindlustusdirektor Jaak Rikson ja Kindlustusabi OÜ direktor Toivo Voit

  17. Keskkonnakasutuse kava kui halduse tegevusvorm / Ivo Pilving

    Index Scriptorium Estoniae

    Pilving, Ivo, 1975-

    2010-01-01

    Keskkonnaõiguslike kavade (õhusaaste tegevuskava, müra vähendamise tegevuskava, veemajanduskava, jäätmekava, hoiu- või kaitseala kaitsekorralduskava ja liigi kaitse ja ohjamise tegevuskava) kasutamise võimalustest Eesti õiguskorras

  18. Maailm kui globaalne piirsituatsioon / Jan Kaus

    Index Scriptorium Estoniae

    Kaus, Jan, 1971-

    2007-01-01

    Mängufilm "Paabel" ("Babel") : stsenarist Guillermo Arriaga : režissöör Alejandro Gonzalez Inarritu : operaator Rodrigo Prieto : peaosades Cate Blanchett, Brad Pitt, Gael Garcia Bernal, Koji Yokusho : Ameerika Ühendriigid - Mehhiko, 2006

  19. Luule kui sõjakunst / Mihhail Lotman

    Index Scriptorium Estoniae

    Lotman, Mihhail, 1952-

    2005-01-01

    Luulekeele arhetüüpset motiivi, luule ja sõjanduse omavahelist seost, kirjeldatakse värsistruktuuri semiootiliste meetoditega. Näidetena kasutatakse kahte poeemi: Puškini "Majake Kolomnas" ning Majakovski "150 000 000"

  20. Kui Arno isaga ... / Kati Saara Vamann

    Index Scriptorium Estoniae

    Vatmann, Kati Saara, 1967-

    2016-01-01

    Portreelood ühise eesnimega tegusatest meestest, pankrotihaldur Arno Mägist, meelelahutajatest ja muusikutest Arno Kukest ning Arno Suislepast, spordimehest Arnold Tokkost ja pedagoogist, Sillamäe gümnaasiumi direktorist Arno Kaseniidust

  1. Laabani Lenin kui lendkalade armastus / Vaapo Vaher

    Index Scriptorium Estoniae

    Vaher, Vaapo, 1945-

    2005-01-01

    Arvustus: Laaban, Ilmar. Sõnade sülemid, sülemite süsteemid. Tartu : Ilmamaa, 2004 ; Rosenthal, Heinrich. Eesti rahva kultuuripüüdlused ühe inimpõlve vältel. Tartu : Ilmamaa, 2004 ; Salum, Ants. Raiusin kõik raamatusse. Tartu : Ilmamaa, 2005

  2. Klaaspudelist loobumine vähendab Coca-Cola brändi eeliseid / Eda-Liis Kann

    Index Scriptorium Estoniae

    Kann, Eda-Liis, 1979-

    2005-01-01

    BRAND sense uuringu kohaselt, milles uuriti pakendi mõju brändilojaalusele, eelistab enam kui 60% Ameerika ja Suurbritannia tarbijaist juua kokakoolat klaaspudelist. Majanduslikel põhjustel on Coca-Cola Company aga viimased kümme aastat tegelenud klaaspudelite poelettidelt ära korjamisega. Diagramm

  3. Spinario - tornen i foden = Spinario : the thorn in the foot / Lise Gotfredsen

    Index Scriptorium Estoniae

    Gotfredsen, Lise

    2006-01-01

    Hellenistlikust skulptuurist "Okkatõmbaja" - "Spinario" ja selle hilisematest variantidest, mis sümboliseerivad ilu, edevust, aga ka pattu. Seda motiivi on kasutatud 12. sajandil ka Ojamaa, Taani ja Norra kirikutes ristimisastjatel, kujutades negatiivset, kahtlevat inimest, kes võib pääseda, kui ta valib õige tee ja vabastab end "okkast"

  4. USA üritab leida Teherani agente Iraagist / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    USA süüdistab Iraani, et see abistab Iraagis mahdiste, mida juhib Muqtada al-Sadri. Autori sõnul on Iraani eliitüksuse Qudsi korpuse koostööd al-Sadriga aga sama vähe tõestatud kui omal ajal USA väidet Saddam Husseini ja al-Qaida vahel

  5. Svetlana Gannushkina : kuidas luua vaenlase kuvandit? / Svetlana Gannushkina ; interv. Brigitta Davidjants

    Index Scriptorium Estoniae

    Gannushkina, Svetlana

    2008-01-01

    Vene inimõiguslane vastab küsimustele, miks suhtutakse Venemaal nii kriitiliselt venelaste olukorda Eestis, aga pööratakse vähe tähelepanu nt. Kesk-Aasia venelastele, millega ta seletab fashismi levikut Venemaal, millal tekkis kuvand tshetsheenist kui venelase vaenlasest, milline on tema hinnang Gruusia-Vene sõjale

  6. Lemminkäinen valas vaidluses õli tulle / Katariina Krjutškova, Tea Taruste

    Index Scriptorium Estoniae

    Krjutškova, Katariina

    2010-01-01

    Lemminkäinen Eesti AS-i juhi Sven Pertens on arvamusel, et kui Aruvalla-Kose tee-ehituse riigihankes sõlmitakse leping Nordecon Infraga, aga kohtuvaidluses selgub hiljem, et hankeprotsessis on tehtud vigu, võib EL oma abiraha tagasi küsida. Lemminkäineni ja Nordeconi vaidlusest. Rahandusministeeriumi kommentaar

  7. EL nõuab USA vangilaagri sulgemist / Krister Paris

    Index Scriptorium Estoniae

    Paris, Krister, 1977-

    2006-01-01

    EL on seisukohal, et Guantanamo vangla tuleb sulgeda. Amnesty International nimetas kolme enesetappu Guantanamo vanglas aastatepikkuse õigusevastase ja lõputu vangistuse tagajärjeks. Vangilaagi komandant aga peab neid enesetappe osaks USA-vastasest asümmeetrilisest sõjast. Lisa: Enam kui 40 enesetapukatset

  8. Euroopa globaalne missioon / George Soros

    Index Scriptorium Estoniae

    Soros, George, 1930-

    2006-01-01

    Ilmunud ka: Molodjozh Estonii 23. nov. lk. 8. On tarvis, et Euroopa inimesi inspireeriks mõte Euroopa Liidust kui globaalse avatud ühiskonna prototüübist. See tähendab põhimõtteliselt, et Euroopa Liit vajab ühtset välispoliitikat, mis aga ei tohi olla USA-vastane

  9. Rahvuse või kodanike riik? / Timothy Garton Ash ; intervjueerinud Ahto Lobjakas

    Index Scriptorium Estoniae

    Garton Ash, Timothy, 1955-

    2009-01-01

    Briti ajaloolane ja politoloog ei usu, et Euroopa Liidu mõistet saaks või tuleks eraldada Euroopa ajaloolisest, geograafilisest ja kultuurilisest järjepidevusest, ta eelistab eripartnerlust nii Türgi kui ka Venemaa puhul, aga mitte liikmestaatust

  10. On-line retailing : a Canadian perspective / Brent McKenzie

    Index Scriptorium Estoniae

    McKenzie, Brent

    2001-01-01

    Kaanel ajak. ilmumisaeg Winter 2001/2002. Kanadas on interneti teel ostjaid alla 2% neist, kes vastavaid interneti-lehekülgi külastavad. Konservatiivset suhtumist saab aga muuta, kui pakkuda head ja turvalist teenust ning kaupa hea hinnaga

  11. Doonorfond on vaesuse, mitte Iraagi pärast / Jeffrey D. Sachs

    Index Scriptorium Estoniae

    Sachs, Jeffrey D.

    2003-01-01

    Autor leiab, et Iraagi pikaajaline ülesehitamine ei vaja finantsabi välismaalt, vaid poliitilist reguleerimist, mis pole võimalik niikaua, kui USA jääb Iraagis okupatsioonijõuks. USA taotletav raha tuleks aga suunata ülemaailmsete hädade, nagu AIDS ja nälg, vastu võitlemiseks.

  12. Jussi Mustonen: Soome investorid ootavad kuni Eestis hinnad langevad / Jussi Mustonen ; intervjueerinud Mikk Salu

    Index Scriptorium Estoniae

    Mustonen, Jussi

    2009-01-01

    Soome tööstuse keskliidu peaökonomist ütleb seoses Eesti eesmärgiga ühineda euroalaga, et euro annab stabiilsust, aga see ei ole imerohi. Eesti muutub Soome investoritele atraktiivseks investeerimispiirkonnaks, kui hinnad alanevad, varade väärtus langeb. Soome majanduse olukorrast, abinõudest oma majanduse stimuleerimiseks

  13. Psühhodraama - spontaansuse kool / Taimi Elenurm

    Index Scriptorium Estoniae

    Elenurm, Taimi

    2010-01-01

    Viinis ja New Yorgis tegutsenud psühhiaatri Jakob Levy Moreno loodud psühhodraamast, mis võimaldab rollimängu kaudu näha ennast läbi teiste silmade, aga ka vabaneda pingetest andes võimaluse käituda teisiti kui tavaelus

  14. Sissejuhatus / Kjell A Eliassen, Jan Kooiman

    Index Scriptorium Estoniae

    Eliassen, Kjell A

    2002-01-01

    Avaliku sektori juhtimise käsitluses eristatakse üldistavalt 2 analüüsitaset: üks on üldine, avaliku sektori kui terviku juhtimine, teine tase aga tegeleb avalike organisatsioonide sisemise käigushoidmise küsimustega. Tabelid

  15. Märkmeid ja viiteid Ojasoo-Semperi teatri kohta / Aare Pilv

    Index Scriptorium Estoniae

    Pilv, Aare, 1976-

    2006-01-01

    Tiit Ojasoo ja Ene-Liis Semperi NO99 teater Eesti teatripildis kui uudne nähtus. Peatutakse pikemalt lavastustel "Vahel on tunne, et elu saab otsa ja armastust polnudki", "Seitse samuraid", aga ka "Verevennad" ja Draamateatris tehtud lavastusel "Julia". Kommentaarid, lk. 20

  16. Elisabeth Egel: Kui ma sporti ei teeks, oleksin kindlasti palju rohkem haige kui praegu / Jakob Rosin

    Index Scriptorium Estoniae

    Rosin, Jakob

    2015-01-01

    Elisabeth Egel on 15 aastane pime ujuja, kes üle maailma toimunud puuetega inimeste ujumisvõistlustelt on koju toonud mitmeid medaleid. Ta on pälvinud noore sportlase preemia 2011. aastal ning on aasta parasportlane 2014

  17. Rain Uusküla korter Tiskre-Hansu elamurajoonis / Ivi Piho, Stina Kasemägi ; fotod: Toomas Tuul

    Index Scriptorium Estoniae

    Piho, Ivi

    2008-01-01

    7 vaadet; korterelamu projekteeris arhitektuuribüroo Nafta; sisearhitekt Ivi Piho, kelle jooniste järgi on tellitud ka suurem osa mööblist firmast Borg ja Rigor; elutoa seinal Stina Kasemäe maal "Merineitsi"

  18. Sõrve laulupüha peeti tugeva tuule kiuste väljas / Veljo Kuivjõgi

    Index Scriptorium Estoniae

    Kuivjõgi, Veljo, 1951-

    2009-01-01

    Salmel peetud Sõrvemaa 146. aastapäeva laulupühal esinesid Salme külakoor ja Kärla külakoor (juhendaja Anita Kangur), Taritu segakoor (juhendaja Reet Laht), meesansambel Punased Sõstrad ja tantsurühm Lender Taritust (juhendaja Aili Salong)

  19. Palve : [luuletused] / Ernst Enno ; [Impressioonid]: Viiu Härm

    Index Scriptorium Estoniae

    Enno, Ernst, 1875-1934

    2004-01-01

    Sisu: Palve ; Ma kuulan ; Imeline helin ; Nad langesid tasa, tasa ; Nii tasa mängisid lained ; Mu õnn ; iks ruttad, väsinud rändaja? ; Valge öö ; Kui ärkab ; Kui virmalised vehklevad ; Vii ära ; Väike paju ; Kui sõuaks igavikku ; Ei me suutnud ; Sügisel ; Su silmis ; Ja jälle sõuab ; Jõulurõõm ; Igatseja kodu ; Hääd ööd! ; Õhtu Pühajärvel ; Peipsi kaldal ; Õhtu ; Kodune ilu! ; Rannal ; Ma tulen hilja ; Märgitud ; Nõmmeallik, Õhtule! ; Kurbus ; Vesiroos ; Kojuigatsus ; Õhtu kodutalus ; Kevade õhtul ; Mu tuba on väike ; Kodukask ; Kallimeelsed ; Jutluse ajal ; Kauge kõlin ; Suvel ; Hall laul ; Igatsus ; Põud ; Ta tuli ; Suvi ; Hõõgamine ; Rändaja õhtulaul ; Tuul alulis ; Võiks otsast alata ; Kolm eite ; Nõmme pääl ; Nõmmeigatsus ; Vanaisa surm ; Karjamaal, Kas sa iial ei küsi ; Imelikku rada pikka! ; Üks lilleke ; Sütti, sütti! ; Noore suve muinasjutt ; Su omasem silmapilk ; Igatsus; Kullerkupp ; Öö valge on õnn ; Tartu valgel ööl ; Vari ; Hääd jällenägemist ; Ühele sõbrale ; Nii läbisegi jooned ; Hõbemeelne luul ; Kui suri lill ; Sind jumalaga jätsin sääl ; Ja eluvalgus, see on nende and ; Ja saadus hing ; Sügise ; Kodu imelisem töö ; Ja pisarad sul kipuvad silma ; Nad läevad pikas reas ; Nad ei vaata tagasi! ; Kadunud kodu! ; Sa oled inime ; Meil kõigil ühine on pulmapidu ees ; Ja jahtund süda jäta ilmale ; Siis vaikivad kõik mõtted ; Nii vaikseks kõik on jäänud ; Siin-sääl kui katkend viisid ; Nii, nii see küll ikka oli ; Ei ole tühi jutt ; Oli viisiks koju tulla ; Tuba, väike tuba ; Sa ära küsi ; Kuulmata kuskil kumiseb kodu ; Mere ääres tuba vaikne ; Ei ükski neist armasta mind ; Igatsus ; Lumesõda ; Tuul käib tühjal rannal ringi ; Üks rohutirts läks kõndima ; Hilissuvi ; Tähte väli vaatas vette ; Valge unustus

  20. Organizational and sectoral changes in transition banking : Estonian experience / Kari Liuhto, Olga Lushtshik, Mart Sõrg...[jt.

    Index Scriptorium Estoniae

    2007-01-01

    Teadustöö käsitleb organisatsioonilisi ja sektoriaalseid arenguid Eesti pangandussektoris. Uuringu tulemuste põhjal võib järeldada, et vaatamata ebastabiilsele majanduslikule ja õiguslikule keskkonnale üleminekuperioodil, on pangandus Eestis olnud palju tulutoovam kui paljudes arenenud riikides, samal ajal on aga siirdemajanduse panganduse efektiivsus volatiilne ning ebaõnnestumise risk kõrge. Tabelid, joonised, diagrammid

  1. Venemaa parandab Rüütli-Putini vestlust / Toomas Sildam

    Index Scriptorium Estoniae

    Sildam, Toomas, 1961-

    2005-01-01

    Vene presidendi asepressiesindaja Dmitri Peskovi sõnul on praegusel ajal võimalik ainult Molotovi-Ribbentropi pakti ajalooline hinnang ning Venemaale oleks parim variant, kui piirileping ja poliitiline deklaratsioon kirjutataks alla Teise maailmasõja lõpu 60. aastapäeva pidustuste ajal Moskvas. President Arnol Rüütel aga teatas pärast kohtumist Vladimir Putiniga, et Vene president nõustus lahutama piirilepingu poliitiliste suhete deklaratsioonist

  2. "Sügis on salali maa peale laskumas..." : [luuletused] / Maksõm Rõlski ; tlk. Harald Rajamets

    Index Scriptorium Estoniae

    Rõlski, Maksõm

    2004-01-01

    Sisu: "Sügis on salali maa peale laskumas..." ; "Küpsenud on õunad, punetavad õunad..." ; "Möödas on kõu, mähib maad magus raugus ja hõngab..." ; "Siin kõrgel on vaid kivi, karm ja vaik..." ; "Ühtäkki kardin õõtsus aknasuul..." ; "Lõksatas lukku mu uks. Taas töötama toa rahus üksi..." ; "Haab väriseb, ning tüve hõbedase..." ; "Erootika on väsitanud mind..." ; Kolm meest paadis (rääkimata koerast) ; "Ürglaanes, kus on üksnes loomarajad..." ; "Tuul peksab külmi aknaid jäisel uhal..." ; "Näe, hirmuähmis pageb lambakari..." ; Ausammas ; Haned ; "Kord katab laotust pilv ja paiskab piisku alla..." ; Sadamasillal ; "Oo vaikne sadam sa, mu töölaud, reisi eel ..." ; Chopin ; "Kevad suitsedes on teel ..." ; "Laht tukub, päikses roheliselt särav..." ; "Öösse nagu kaevuvette..." ; "Jõeluhalt kõlas vileviis..." ; Lumikelluke torkas salus..." ; "Ja meenus (aknasse lõi kerge tuul ja lõhnav pimedus) üks pilt, nii kauge..." ; "Glütsiiniatel tung on ikka kõrgemale..." ; Tasa ; Sügisele ; Äike ; Öökülm ; Sonett ; "Ikka tuleb habras õhtu meelde..." ; Flamingod ; Notre Dame ; Aadria meri ; "Mets on hõbesulgses suitsuvines..." ; Kuis ma ei armastaks... ; Luulekunst ; "Käod lahkumist kukkusid kaugel..." ; "Kui mõnus elada on sel..." ; Kiir ; "Ju kustus õhtu punav lee..."

  3. Kui vana on su keha? / Evelin Kivilo-Paas

    Index Scriptorium Estoniae

    Kivilo-Paas, Evelin, 1979-

    2012-01-01

    Keha vanuse testimisest Polar BodyAge'i programmi abil. Treener Kristi Roosimägi analüüsib osalejate, TV3 uudisteankur Marek Lindmaa, ilmateadustaja Liis Lusmäe ja reporter Feliks Unduski tulemusi

  4. Kui oled puutunud ussipesa / Ken-Marti Vaher

    Index Scriptorium Estoniae

    Vaher, Ken-Marti, 1974-

    2005-01-01

    Ilmunud ka: Sakala 15. november lk. 2, Meie Maa 30. november lk. 2. Ken-Marti Vaher kritiseerib Keskerakonna juhi Edgar Savisaare majaostu Keila-Joal ning kummutab laimu oma perekonna varade kohta nende päritolu selgitades

  5. "Rohkem naisest kui näitlejast..." / Meelis Kapstas

    Index Scriptorium Estoniae

    Kapstas, Meelis, 1963-

    2006-01-01

    Ilmus Ita Everi elulooraamat "Ita Ever. Elu suuruses". Näitlejannad Viire Valdma, Mari-Liis Lill, Ülle Kaljuste, Britta Vahur, Elina Reinold, Kersti Kreismann, Merle Palmiste ja Ülle Ulla avaldavad oma esmamulje raamatust

  6. CSR kui äristrateegia osa / Tuuliki Kasonen-Lins

    Index Scriptorium Estoniae

    Kasonen-Lins, Tuuliki

    2008-01-01

    Autor selgitab, et ettevõtte ühiskondlik vastutus ei ole kord aastas korraldatav heategevuskampaania. Näitena ettevõtte ühiskondlikust vastutusest nimetab autor panustamist tööjõu koolitusse või töötute sotsiaalsete gruppidega tegelemisse

  7. Pedagoogiline koolipraktika kui otsustav tegur õpetajakoolituse ajakohastamisel / Edgar Krull

    Index Scriptorium Estoniae

    Krull, Edgar

    2003-01-01

    Pedagoogilise praktika roll õpetajakoolituses. Õpetajakoolituse orientatsioonid ja õpetajate kutsepildi kujunemine. Kutsekompetentsuse sõltuvus koolipraktikast. Pedagoogilise koolipraktika uuendamisvajadused ja kohanemisaasta

  8. Film ja festival - ilusam kui elu / Andres Maimik

    Index Scriptorium Estoniae

    Maimik, Andres, 1970-

    1998-01-01

    Tallinna I Rahvusvahelisel Filmifestivalil mängufilmid "Õnnelikult koos" ("Happy Together"), režissöör Wong Kar-Wai : Hongkong 1997 ja "Elu on ilus" ("La vita e bella"), režissöör Roberto Benigni : Itaalia 1997

  9. Seelikutriibud on kui lugu / Taavet Jansen ; interv. Margus Haav

    Index Scriptorium Estoniae

    Jansen, Taavet, 1978-

    2007-01-01

    Loomingulise kollektiivi Interaktiivne Üksus (int.act.union) tantsulavastusest "algorytm", autorid Taavet Jansen, Päär Pärenson, Maike Lond, Kalle Tikas ja Andreas W. Esietendus Kanuti Gildi saalis 20. veebr

  10. Klapptool meeldis nii leiutajale kui ka presidendile / Merit Pettai

    Index Scriptorium Estoniae

    Pettai, Merit

    2008-01-01

    1877. a. Inglismaal patenteeritud klapptooli adapteerisid 1938. a. argentiinlased Bonet, Ferrari-Hardoy ja Kurchan (Grupo Austral), kes lõid toolile jäigema konstruktsiooni. Materjaliks lakitud teras ja nahk. Tooli nimi: B.K.F. (Hardoy Chair)

  11. Obamad kui Kennedyte taastulek 21. sajandil / Barbi Pilvre

    Index Scriptorium Estoniae

    Pilvre, Barbi, 1963-

    2008-01-01

    USA demokraatide presidendikandidaadile Barack Obamale ja tema abikaasale Michelle'ile on loodud kennedylik imago, selle imago taga on demokraat Ted Sorensen, kes aitas kunagi võimule tulla John F. Kennedyl. Ka Kennedyd ise on üles astunud B. Obama toetajana

  12. Eesti kirjandus on suurem kui paistab / Pille-Riin Larm

    Index Scriptorium Estoniae

    Larm, Pille-Riin, 1981-

    2015-01-01

    Tartu Ülikoolis kaitstud Kairit Kauri, Mart Velskeri ja Aija Sakova-Merivee kirjandusalastest doktoritöödest. Lähemalt Aija Sakova-Merivee saksakeelsest dissertatsioonist "Väljakaevamine ja mäletamine. Mälutöö ja moraalse tunnistamise mõttepildid Ene Mihkelsoni ja Christa Wolfi romaanides". Tartu, 2014

  13. Peaosa nii teatrilaval kui ka kinolinal / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016

    2010-01-01

    Natalja Murina-Puustusmaast, kes mängib peaosa Vene Teatri uuslavastuses "Besame mucho", mille Afolf Käis on lavastanud Eduardo de Filippo näidendi "Silinder" järgi, ja Andres Puustusmaa filmis "Rotilõks", mille võtted algavad peagi

  14. Kilekott kui kineskoop = Plastic Bag as Viewer / Johannes Saar

    Index Scriptorium Estoniae

    Saar, Johannes, 1965-

    2004-01-01

    Anu Järsi ja Kristi Kaljumäe kureeritud näitus "Kile kotti!" Eesti Rahva Muuseumis. Eksponeeriti 1980. aastatel Tartu Plastmasstoodete Katsetehases tehtud piltidega kilekotte, mälestusi kilekottide ümber keerelnud kultuurilisest tähendusest ja väärtusüsteemidest. Ameerikaliku massikultuuri, skandinaavia tarbimiskultuuri ja omarahvusluse ja -riikluse latentsed sümbolid

  15. Baltikumi aktsiaturud tõusevad enne kui reaalmajandus / Paul Lukka

    Index Scriptorium Estoniae

    Lukka, Paul

    2008-01-01

    Autori hinnangul on jahtuvas Balti majanduses märgata positiivseid tendentse ning kuna inflatsioon on jõudnud oma kõrgpunkti, võib juba oodata selle langemist. Enamike börsiettevõtete ühtlasest langemisest võivad enim võita pikaajalised investorid. Tabel: Positiivsed näited Leedu börsi ettevõtete tulemustest. Graafik: OMX Baltic Benchmark GI Indeks

  16. Britten kui Tulve (tehis)kaaslane / Anneli Remme

    Index Scriptorium Estoniae

    Remme, Anneli, 1968-

    2004-01-01

    Eesti Filharmoonia Kammerkoor lõpetab hooaja orienditeemaliste kammerooperitega Tallinna Linnateatri Taevalaval - B. Britteni ooper "Curlew River" (lavastaja M. Koldits) ja H. Tulve "It's getting so Dark" (lavastaja A. Lamp), kunstnik I. Hermeliin ja videokunstnik T. H. Varres, dirigent P. Hillier. Esietendus 16. juunil

  17. Kui suurt aktsia- või osakapitali on vaja?

    Index Scriptorium Estoniae

    2008-01-01

    Äriseadustikus sätestatud äriühingu netovarast. Koostatud ettekande põhjal, mille advokaadibüroo Luiga Mody Hääl Borenius advokaat Marko Saar pidas 31. jaanuaril toimunud seminaril "Dividendid, omakapital ja maksud"

  18. Kui usaldus maksab kätte / Aita Kivi

    Index Scriptorium Estoniae

    Kivi, Aita, 1954-

    2002-01-01

    Sisu: Emmanuel Carrére. Vaenlane; Pam Rhodes. Siduvad köidikud; Truman Capote. Hommikueine Tiffany juures; Betty Mahmoody, William Hoffer. Ainult koos tütrega; Kerttu Rakke. Susanna ja mina; Elizabeth George. Saatuslik mäng; Panait Istrari. Chira Chiralin; Daniil Harms.Ootamatu jooming; Jüri Ehlvest. Hobune eikusagilt; Kurt Vonnegut. Komejant, ehk Hüvasti üksildus

  19. "Keisri hull" kui müstiline fantasy / Siimon Prii

    Index Scriptorium Estoniae

    Prii, Siimon

    2006-01-01

    30. sept. Ugalas esietendunud Jaan Krossi "Keisri hull" (autoridramatiseering), lavastajad Jaak Allik ja Peeter Tammearu. Kunstnik on Jaanus Laagriküll ja muusikaline kujundaja Peeter Konovalov. Peaosas Peeter Tammearu

  20. Rahvusvahelise kaitse taotlejate ümberpaigutamine kui solidaarsusmeede / Kristel Urke

    Index Scriptorium Estoniae

    Urke, Kristel, 1991-

    2016-01-01

    Euroopa Liidu Nõukogu 2015. aasta otsustest ümberpaigutamismehhanismi rakendamise kohta ja otsuste seostest Dublini süsteemiga. Otsuste kooskõlast Euroopa Liidu õiguses tunnustatud proportsionaalsuse ning solidaarsuse põhimõtetega

  1. Insener kui spetsialist, looja ja administraator / Tiit Tiidemann

    Index Scriptorium Estoniae

    Tiidemann, Tiit, 1934-

    2005-01-01

    Autor vahendab Shoichi Sano artiklit 21 sajandi nõuetest, mida ettevõte insenerile esitab: loomevõime, globaalne mõtlemine, sõltumatus tõekspidamistes, võime ideedega kaasa minna, akadeemilised baasteadmised

  2. Luulud on lõbusamad kui reaalsus / Mari Laaniste

    Index Scriptorium Estoniae

    Laaniste, Mari, 1977-

    2006-01-01

    George Clooney ja tema teine mängufilm "Ohtliku mehe pihtimused" ("Cofessions of a Dangerous Mind") : stsenarist teleprodutsent Chuck Barris'e memuaaride põhjal Charlie Kaufman : pearollis Sam Rockwell : Ameerika Ühendriigid - Saksamaa 2002

  3. Jaan Valbet - valikutes kindel kui kalju / Toomas Reisalu

    Index Scriptorium Estoniae

    Reisalu, Toomas

    2007-01-01

    Ilmunud ka: Stroitel 2007 nr. 2 lk. 22-25. Portreeartikkel Pärnu Betoonimeistrite nõukogu esimehest Jaan Valbetist. Vt. samas: Jaan Valbet peab alati sõna. Kommenteerib Merko Ehituse juhatuse esimees Tõnu Toomik

  4. Mürgised sojaoad : mmmm, kui halb! / Silvia Lotman

    Index Scriptorium Estoniae

    Lotman, Silvia, 1980-

    2007-01-01

    Sojaoa kasvatamisest Lõuna-Ameerikas ja Paraguays, kus on suures osas erastatud maad maha müüdud välismaistele suurkorporatsioonidele, mis kasutavad maad põllumajandustööstuseks. Pestitsiidide kasutamisest, mürgitamisjuhtudest ja kohtuotsusest, kus Paraguay ülemkohus mõistis süüdi Herman Schlenderi ja Alfredo Lautenschlageri

  5. Tõde jälitab meid kui vari / Vaapo Vaher

    Index Scriptorium Estoniae

    Vaher, Vaapo, 1945-

    2006-01-01

    Erich Maria Remarque'ist seoses romaani "Lissaboni öö" kordustrüki ilmumisega (kirj. Tänapäev). Raamatututvustused: Vaarandi, Debora. Aastad ja päevad : nooruselugu. Tallinn : Tänapäev, 2006 ; Loosaar, Evald. Eesti mehe lugu. Tallinn : Varrak, 2006 ; Kangro, Bernard, Ristikivi, Karl. Kirjad romaanist : 31 kirja aastaist 1966-1977. Tallinn : Varrak, 2006

  6. Kui vajad lojaalsust, siis võta koer! / Hando Sinisalu

    Index Scriptorium Estoniae

    Sinisalu, Hando, 1970-

    2008-01-01

    Briti kaubanduskontserni Tesco kliendilojaalsusprogrammist. Lisa: Lojaalsusprogrammi juhtimismudel; Eduka kliendiprogrammi kuus kriteeriumi. Vt. samas: Tarmo Hõbe. Me ei müü üksikuid tooteid, vaid elustiili ja emotsioone

  7. Film kui mälestus / Alina Kurvits

    Index Scriptorium Estoniae

    Kurvits, Alina

    2003-01-01

    Dokumentaalfilm "Pildi sisse minek" kunstnik Agu Pildist : režissöör, operaator, monteerija Marianne Kõrver : produtsent Peeter Urbla : Exitfilm 2002. Lisatud "Dialoogid ühevaatuselisest näidendist "Anna mulle põhjus siia jäämiseks"", kus Alina Kurvits, Marianne Kõrver, Urmas Muru, Urve Eslas ja Agu Pilt vestlevad filmi tegemisest, kunstniku identiteedist

  8. Cinamon kui uus nähtus kinomaastikul / Dagmar Reinolt

    Index Scriptorium Estoniae

    Reinolt, Dagmar

    2009-01-01

    Cinamoni kinoketi perspektiividest Eestis. Cinamoni nõukogu esimees Peeter Rebane, Tallinnfilmi juht Margit Vremmert ja kinoketi Forum Cinemas levijuht Lauri Kaare esitavad oma vaateid kinode ja filmilevi kohta Eestis

  9. Ühistransport kui ühiskonna peegel / Rudolf Tigasing

    Index Scriptorium Estoniae

    Tigasing, Rudolf

    2007-01-01

    Ilmunud ka: Sakala, 10. apr. 2007, lk. 2; Nädaline, 10. apr. 2007, lk. 4; Meie Maa, 20. apr. 2007, lk. 2; Vooremaa, 10. apr. 2007, lk. 2; Põhjarannik, 11. apr. 2007, lk. 2; Severnoje Poberezhje, 11. apr. 2007, lk. 2; Koit, 12. apr. 2007, lk. 6; Lääne Elu, 14. apr. 2007, lk. 2; Tartu Postimees, 16. apr. 2007, lk. 2; Pärnu Postimees, 5. mai 2007, lk. 19; Järva Teataja, 21. juuli 2007, lk. 2. Transpordi Ametiühingu bussijuhtide sektsiooni asejuhataja Eesti bussijuhtide olukorrast

  10. Linn kui meelelahutuskeskus = An Urban Entertainment Centre / Jaap Jan Berg

    Index Scriptorium Estoniae

    Berg, Jaap Jan

    2007-01-01

    Uue näo saanud Hollandi uuslinna Almere linnakeskusest, kus on panustatud arhitektuurile, meelelahutuslikkusele ja kesklinna autosõbralikkusele. Arhitektuuribüroo OMA Almere üldplaneeringust. Uue keskuse väljaehitamisse kaasatud arhitekte ja büroosid. 8 värv. vaadet

  11. Euro võib viibida rohkem kui aasta / Sirje Rank

    Index Scriptorium Estoniae

    Rank, Sirje, 1966-

    2006-01-01

    Ilmunud ka: Delovõje Vedomosti 24. mai lk. 7. Reitinguagentuuri Fitch avaldatud Kesk- ja Ida-Euroopa arenevate turgude ülevaatest selgub, et Balti riikide eurole üleminek viibib eelkõige kõrge inflatsiooni tõttu, mida kannustavad välistegurid koos kiire majanduskasvu ja süveneva tööjõupuudusega fikseeritud valuutakursi tingimustes. Lisa: Eesti hinne Baltimaade parim. Vt. samas: Leedukad kiidavad Euroopa Komisjoni otsust

  12. Kui suur oli "Suur Oktoober 1917" / David Vseviov

    Index Scriptorium Estoniae

    Vseviov, David, 1949-

    2009-01-01

    Kuivõrd oli Oktoobrirevolutsioon paratamatu? Vassili Šulginist, kes jagas seisukohta revolutsiooni paratamatusest. Kas Lenini saabumine pealinna Saksamaaga peetava sõja ajal vihavaenlaste plommitud vagunis oli saksa luure plaan? Oktoobrirevolutsiooni sarnasusest Prantsuse revolutsiooniga. Oktoobrirevolutsiooni vaimu kestmisest tänapäeval

  13. Kui klassikaaslasest saab aastaks sinu boss / Sirje Pärismaa

    Index Scriptorium Estoniae

    Pärismaa, Sirje, 1958-

    2014-01-01

    Õpilasfirmade võistlusest. Tänavu võitis Tallinna Õismäe Vene Lütseumi õpilasfirma DK Koolitus, kes hakkas pakkuma algkoolilastele suhtlemisabi. 2. koht - Tallinna 21. Kooli võistkond EasyClip, 3. koht - Tallinna Reaalkooli võistkond Sants

  14. Vadja sõnaraamat kui kunstiteos / Kristiina Ross

    Index Scriptorium Estoniae

    Ross, Kristiina, 1955-

    2011-01-01

    Arvustus: Vadja keele sõnaraamat. 1 / toimetanud Elna Adler, Merle Leppik. Tallinn : AE Signalet, 1990 ; Vadja keele sõnaraamat. 2, [K -küüttöseltšä] = Словарь водского языка. 2 / toimetanud Elna Adler, Merle Leppik. [Tallinn] ; [Tallinn] : Teaduste Akadeemia Kirjastus, 1994 ; Vadja keele sõnaraamat. 3, L - müüäG] = Словарь водского языка / toimetanud Elna Adler, Merle Leppik. [Tallinn] ; [Tallinn] : Eesti Keele Instituut, 1996 ; Vadja keele sõnaraamat. 4, [N - P] = Словарь водского языка. 4, [N - P] / toimetanud: Elna Adler, Merle Leppik. [Tallinn] : Eesti Keele Sihtasutus, 2000 ; Vadja keele sõnaraamat. 5, [R-S] = Словарь водского языка. 5, [R-S] / toimetanud Silja Grünberg. Tallinn : Eesti Keele Sihtasutus, 2006 ; Vadja keele sõnaraamat. 6, [Š-T] = Словарь водского языка. 6, [Š-T] / toimetanud Silja Grünberg. Tallinn : Eesti Keele Sihtasutus, 2010 ; Vadja keele sõnaraamat. 7 = Словарь водского языка / toimetanud Silja Grünberg. Tallinn : Eesti Keele Sihtasutus, 2011

  15. See mees on rikkam kui Bill Gates / Reet Alas

    Index Scriptorium Estoniae

    Alas, Reet

    2007-01-01

    Mehhiko telefonioperaatori Telefonos de Mexico (Telmex) ja mobiiliettevõtte Telcel ning Lõuna-Ameerika suurima mobiilsideoperaatori America Movil omanik Carlos Slim Helu Aglamazi karjäärist ja tõusust maailma rikkaimaks meheks. Lisa: Mida saaks Carlose rahaga peale hakata?; Mida rikas mees on öelnud?

  16. Kui riskantne on India? / Mehul Srivastava, Nandini Lakshman

    Index Scriptorium Estoniae

    Srivastava, Mehul

    2008-01-01

    Seni suure majanduskasvuga välisinvestoreid ja välisettevõtjaid ahvatlenud India on pärast 26. novembril 2008 aset leidnud tulistamisi Mumbai lõunaosas sattunud vastamisi olukorraga, kus on paljastunud lõhe riigi positiivse maine ja reaalsuse vahel. Aruteludest riigi tuleviku üle

  17. Sõnal on suurem jõud kui relval / Marianne Mikko

    Index Scriptorium Estoniae

    Mikko, Marianne, 1961-

    2008-01-01

    Terroristliku rühmituse FARC käes pantvangis olnud Colombia naispoliitik, endine presidendikandidaat Ingrid Betancourt, pääses sel suvel prantslaste erioperatsiooniga vabadusse. Oktoobris esines Ingrid Betancourt Euroopa Parlamendis. Ilmunud ka Pärnu Postimees 18. okt. lk. 19; Hiiu Leht : Nädalalõpp 24. okt. lk. 6

  18. Elu kui näitemäng / Helju Koger

    Index Scriptorium Estoniae

    Koger, Helju, 1943-

    2007-01-01

    VI kihelkonnapäevadest Juurus. Juuru Mihkli kirikus esines ansambel Resonabilis. Konverentsil räägiti Järlepa mõisast, Anu Allikvee pidas ettekande "August von Kotzebue elu nagu näitemäng" jm. Näitemängu "Pärmi Jaagu unenägu" nägi kohalike asjaarmastajate esituses

  19. Ühistransport kui Augeiase tallid / Arvo Sarapuu

    Index Scriptorium Estoniae

    Sarapuu, Arvo, 1953-

    2004-01-01

    Ilmunud ka: Põhjarannik, 22. jaan. 2004, lk. 2; Severnoje Poberezhje, 22. jaan. 2004, lk. 2; Valgamaalane, 29. jaan. 2004, lk. 2; Harjumaa, 23. jaan. 2004, lk. 2; Pärnu Postimees, 24. jaan. 2004, lk. 15; Virumaa Teataja, 28. jaan. 2004, lk. 7; Sakala, 28. jaan. 2004, lk. 2; Vooremaa, 3. veebr. 2004, lk. 2. Ühistranspordi riigihankekonkursside korraldamisest ja Järvamaa kogemustest

  20. Kui kapital veab alt, siis turvaliselt / Aleksander Tsapov

    Index Scriptorium Estoniae

    Tsapov, Aleksander

    2006-01-01

    Kuraatorinäitus "Kapital (see veab meid alt)" Tallinna Kunstihoones. Kuraator Simon Sheikh. Fia-Stina Sandlundi, Katya Sanderi, Oliver Ressleri, Ashley Hunti ja Susan Kelly&Stephen Mortoni töödest näitusel

  1. Mineviku esitamine kui osa ajaloo loomisprotsessist / Tiiu Jaago

    Index Scriptorium Estoniae

    Jaago, Tiiu, 1960-

    2011-01-01

    Tutvustus: Heimo, Anne. Kapina Sammatissa : vuoden 1918 paikalliset tulkinnat osana historian yhteiskunnallisen rakentamisen prosessia. Helsinki : Suomalaisen Kirjallisuuden Seura, 2010 (dissertatsioon)

  2. Värdjatest, kui mitte muust / Karlo Funk

    Index Scriptorium Estoniae

    Funk, Karlo, 1971-

    1999-01-01

    Mängufilmid "Tantsija aeg" ("Vremja tantsora") : Stsenarist Aleksandr Mindadze : režissöör Vadim Abdrashitov : Venemaa 1997 ja "Värdjatest ja inimestest" ("Pro urodov i ljudei") : Stsenarist ja režissöör Aleksei Balabanov : Venemaa - Ameerika Ühendriigid 1998

  3. Uus seadus on mõistlikum kui vana / Eugen Veges

    Index Scriptorium Estoniae

    Veges, Eugen, 1955-

    2008-01-01

    Uue töölepingu seaduse eelnõust. Ilmunud ka Tartu Ekspress 14. veeb. 2008, lk. 6, pealkiri kujul: Veel kord uuest töölepinguseaduse eelnõust ; Valgamaalane 19. veeb. 2008, lk. 2 ; Kuulutaja 29. veeb. 2008, lk. 4, pealkiri kujul: Töölepinguseadus nõuab selgeltnägemist

  4. Kunst kui aheldatud kaup / Peeter Künstler

    Index Scriptorium Estoniae

    Künstler, Peeter, 1958-2009

    2000-01-01

    Välismaale näitusele saadetavate tööde tollis vormistamine on keeruline. Reti Saksa viie raamatuillustratsiooni, mida ta saatis raamatuillustratsiooninäitusi korraldavale Jaapani Hiroko Mori & Stasys Museum'i direktorile Nadayuki Hasegawale, tollis vormistamisest.

  5. Näitus kui publiku-uuring / Margaret Tali

    Index Scriptorium Estoniae

    Tali, Margaret

    2008-01-01

    Eve Kiileri näitus "Muuseumilabor" Tallinna Kunstihoone galeriis 26. IX-19. X. Tutvuda saab Kiasmas, Kumus, Briti Muuseumis, Palais de Tokyos, Hamburger Bahnhofis, Vatikani muuseumis, Veneetsia biennaalil läbi viidud publiku-uuringute tulemustega. Publikuteemaline seminar-ümarlaud 16. X

  6. "Macbeth": pigem silmale kui kõrvale / Maris Peters

    Index Scriptorium Estoniae

    Peters, Maris

    2010-01-01

    Gruusia kultuurinädala raames 28. mail Eesti Draamateatris etendunud Shakespeare'i "Macbethi" versioon Vaso Abashidze nimelise Thbilisi Muusika- ja Draamateateri lavastuses. Lavastaja David Doiašvili

  7. Sotsiaalne tegevusluba: kui õigustatud on su tegevus? / Eero Loonurm

    Index Scriptorium Estoniae

    Loonurm, Eero

    2016-01-01

    Euroopa juhtiv kommunikatsioonitöötajate võrgustik EACD (European Association of Communication Directors) tähistas oma aastasündmuse Communication Summit toimumisega kümnendat sünnipäeva. Konverentsi tähelepanu all oli ettevõtte eesmärk ja ühiskondlik kontekst ning eelkõige sotsiaalne tegevusluba

  8. Taaskinnitati Raplamaa kui turvaliste paikkonna staatus / Maire Kõrver

    Index Scriptorium Estoniae

    Kõrver, Maire, 1961-

    2009-01-01

    Rapla maakond kuulub aastast 2004 ainsana Eestis rahvusvahelisse Safe Community ehk turvalise kodupaiga võrgustikku. Ülevaade Raplas toimunud Eesti II Safe Community konverentsist, kus tervitusega Riigikogust ja tunnustussõnadega Rapla maakonna tervisedendajatele esines parlamendi sotsiaalkomisjoni esimees Urmas Reinsalu

  9. Pariis kui uus peatus inimese teekonnal / Katre Talviste

    Index Scriptorium Estoniae

    Talviste, Katre

    2003-01-01

    Karl Ristikivi "Inimese teekonna" tõlkest prantsuse keelde ("Chemin terrestre", tõlkija Tarah Montbélialtz, pseud, kirj. La Guillotine, Pariis, 2002). Ka Claude Merlini ja Ene Rämmeldi lavastusest "Inimese teekond"

  10. Kodu kui kunstiprojekt = Home as an Art Project / David Crowley

    Index Scriptorium Estoniae

    Crowley, David

    2004-01-01

    Londonis avatud saksa kunstniku Gregor Schneideri installatsioonist "Die Familie Schneider" ja tema projektist "Dead House UR" tema kodulinnas Rheydtis. Inglise kunstniku Michael Landy (sünd. 1963) 2001. a. Londoni endises C&A kaubamajas korraldatud kunstisündmusest "Breakdown", mille käigus M. Landy laskis kõik oma 7227 isiklikku eset teatraalsel tehaseliinil hävitada, ja tema installatsioonist "Semi-detached" Tate Britainis. 5 ill

  11. Kui vähe president meist teab! / Heimar Lenk

    Index Scriptorium Estoniae

    Lenk, Heimar, 1946-

    2011-01-01

    President Toomas Hendrik Ilves avaldas Briti ajalehes arvamust nõukogudeaegsete restoranide kohta: Kitman, Jamie. President Ilves: the man who made E-stonia. The Guardian, 3. nov. 2011. Riigikogu liikme vastukaja. Lisatud karikatuur

  12. Kui parim näitleja on karu / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016

    2001-01-01

    6. septembril esilinastunud mängufilm "Karu süda" : stsenarist ja režissöör Arvo Iho : kaasstsenarist oma romaani põhjal Nikolai Baturin : kaasstsenarist Rustam Ibragimbekov : produtsent Mati Sepping : operaator Rein Kotov : muusika Peeter Vähi : Faama Film ja Cumulus Projekt koos Vene, Saksa ja Tšehhi stuudiodega, 2001. Põhiliselt režissööri töö puudujääkidest näitlejatega

  13. TOEFL-test sobib nii Pekingis kui Tallinnas / Eha Teder

    Index Scriptorium Estoniae

    Teder, Eha

    2003-01-01

    Tulemas on uue põlvkonna TOEFL (Test of English as a Foreign Language) test, mis toob kaasa uue arusaama standardiseeritud (keele)testidest. Testi saab teha Põhja-Ameerika ülikoolide teabekeskuses Tallinna Tehnikaülikoolis

  14. Kui parimast ei piisa, siis piisab erinevast / Gustav Hafren

    Index Scriptorium Estoniae

    Hafren, Gustav

    2003-01-01

    Autor leiab, et turul, kus ei võida mitte kvaliteetsemad tooted, vaid tooted, mis omavad kindlat kohta klientide teadvuses, on kõige olulisem eristuda konkurentidest. Lisa: Milline on kliendi teadvus? Kokkuvõte autori ettekandest turunduskonverentsil "Password 2003".

  15. Alytuse biennaal kui kaitsepolügon / Sandra Jõgeva

    Index Scriptorium Estoniae

    Jõgeva, Sandra, 1976-

    2007-01-01

    Leedus Alytuse väikelinnas 20.-26.08.2007 toimunud eksperimentaalkunsti festivalist. II Alytuse biennaali korraldaja Mantas Kazakevicius, osalejad Inglismaalt, Tšehhist, Iirimaalt, Madalmaadest, Lätist, Leedust ja Eestist (Erik Alalooga, Ville Karel Viirelaid ja Sandra Jõgeva)

  16. Kui hoolid keskkonnast, anna sellest ka teistele teada / Liina Joller

    Index Scriptorium Estoniae

    Joller, Liina

    2008-01-01

    Turundusharu, mis kasutab peamise argumendina just keskkonnasõbralikkust, on hakatud kutsuma roheliseks turunduseks (green marketing). Vt. samas: Vastutustundliku ettevõtluse ja rohelise turunduse seosed; E-dokumendid - lihtne viis keskkonda hoida

  17. Kui avatud peaks olema avatud Eesti? / Jüri Estam

    Index Scriptorium Estoniae

    Estam, Jüri, 1951-

    2007-01-01

    Eesti ja eestlaste avatusest, Georg Sorosest ja neoliberalismist, multikultuursusest, homoseksuaalsusest ning ultimatiivsest avatusest. Autor tahaks Eestis rohkem näha filtreerivat avatust, kriitlise mõtlemise õpetamist ja suutlikkust loobuda kõigest, mis kahjustab eestlust

  18. Kui palju ühte plaati osta / Siim Nestor

    Index Scriptorium Estoniae

    Nestor, Siim, 1974-

    2009-01-01

    Plaaditööstuse tegemistest rockmuusikaga heliplaatide uute versioonide väljaandmisel. Uutest väljalasetest: ansambli The Beatles plaadikataloogi taasüllitamisest firma Apple/EMI poolt, Frank Zappa, ansambli Loits jt. ansamblite loomingu taasilmumisest

  19. "Spikker" kui tööotsija ABC / Pille Rõivas

    Index Scriptorium Estoniae

    Rõivas, Pille

    2006-01-01

    Praktilisest õppefilmist "Spikker. Dokumentaalne õppefilm: noored esmakordselt tööturul", mille eesmärgiks on õpetada otsima esimest töökohta. Filmis jälgitakse kahe noore tööotsinguid. Kommenteerivad Jaana Pikalev, Kaija-Liisa Koovit

  20. Konversatsiooniagendi modelleerimine argumenteerimisdialoogis: suhtlus kui infoseisundite värskendamine

    Directory of Open Access Journals (Sweden)

    Mare Koit

    2012-05-01

    Full Text Available Artiklis modelleeritakse sellist vestlusprotsessi, milles üks osaleja püüab mõjutada teist, et see otsustaks teha teatava tegevuse. Keskendutakse konversatsiooniagendi infoseisundite esitusele ja värskendamisreeglitele, mille rakendamise tulemusel liigub agent suhtluses ühest infoseisundist teise. Infoseisundi koosseisu kuulub partneri mudel, mis koosneb partneri oletatavatest hinnangutest vaadeldava tegevuse erinevatele aspektidele. Partneri mudel muutub suhtluse käigus, vastavalt argumentidele ja vastuargumentidele, mida osalejad esitavad tegevuse tegemise poolt või vastu. Konversatsiooniagendi mudeli praktilise realisatsioonina kavandatakse dialoogsüsteemi, nn suhtlustreenerit. Artiklis arutatakse ka inimestevahelise suhtluse modelleerimise üle, tuues näiteid eestikeelsetest argivestlustest.DOI: http://dx.doi.org/10.5128/ERYa8.07

  1. Nii hea, kui keegi mõtleb absoluudi peale

    Index Scriptorium Estoniae

    2008-01-01

    11. I avatakse Tallinna Kunstihoones Arne Maasiku fotode näitus. Kuraator Karin Paulus, kujundaja Urmas Luure. Detsembris 2007 ilmus Urmas Luure monograafia, fotod 1994-2007, kujundaja Martin Pedanik. Lõigud Eero Epneri, Jan Kausi ja Peeter Lauritsa sissejuhatavatest kirjutistest

  2. Tartu kui märk / Jüri Talvet

    Index Scriptorium Estoniae

    Talvet, Jüri, 1945-

    1996-01-01

    Ilmus algkujul hispaania keeles Sevillas Andaluusia Semiootikaassotsiatsiooni ajakirja Discurso Tartu semiootikakoolkonnale pühendatud erinumbris (nr. 8, 1993). Ilmunud ka kogumikus: Talvet, Jüri. Ameerika märkmeid, ehk, Kaemusi Eestist. Tartu : Ilmamaa, 2000, lk. 62-71, pealk.: Tartu vaim

  3. Kui nuustakulased Berliinis käisid / Jaak Lõhmus

    Index Scriptorium Estoniae

    Lõhmus, Jaak

    2007-01-01

    57. Berliini filmifestivali peaauhinna Kuldkaru sai Hiina režissööri Wang Quanani film "Tuya abielu" ("Tuya de hun shi"). Ka teistest auhinnasaajatest. Kokkuvõte festivalist ja eestlastest festivalil

  4. Nii ungarlane kui eestlane / Urmas Bereczki ; interv. Livia Viitol

    Index Scriptorium Estoniae

    Bereczki, Urmas, 1957-

    2001-01-01

    Intervjuu ajaloolase ja keraamiku, Ungari Instituudi direktori Urmas Bereczkiga, kes on sündinud Eestis ja kelle ema on eestlane. 2001. a. suvel Tallinna Kunstihoones Ungari Instituudi üritusena ungari kaasaegse kunsti ülevaatenäitus

  5. Kino kui grafiti = Cinema as graffiti / Karin Paulus

    Index Scriptorium Estoniae

    Paulus, Karin, 1975-

    2001-01-01

    Kobarkinost Coca-Cola Plaza Tallinnas. Projekteerija: Arhitektuuristuudio Kirsima ja Niineväli. Arhitekt Andri Kirisma. Üldruumide sisekujundus: Kaire Kemp-Tisler, Ea Andla. II korruse baari kujundas Ursula Sõber. Konstruktsioonid: Marti Sein, Priit Luure Neoprojektist. Akustiline osa: Linda Madalik. Seinamaalingud: Anu Samarüütel. Projekt 1999-2001, valmis 2000-2001. 12 ill.: lõige, I ja V korruse plaanid, välis- ja sisevaated

  6. Kui Thatcher kiidab ja Pinochet teeb pai / Erik Terk

    Index Scriptorium Estoniae

    Terk, Erik

    2006-01-01

    Thatcheri ja Reagani nimedega seostatav neoliberaalne revolutsioon on saanud piisavalt vanaks, et kujundada pilt, mis toimus ja kuhu see meid viib. See ongi uue neoliberalismiraamatu David Harvey. A Brief History of Neoliberalism aineks

  7. Kui näitlejal on oma etendus / Margot Visnap

    Index Scriptorium Estoniae

    Visnap, Margot

    1990-01-01

    Patrick Süskindi "Kontrabass" Vanalinnastuudios, lavastaja Eino Baskin ja Noorsooteatris William Luce'i "Amhersti kaunitar", lavastaja Rudolf Allabert ning Jerome Kilty "Armas luiskaja", näitejuht Kalju Orro

  8. Kui Kerry saab USA presidendiks, siis... / Anvar Samost

    Index Scriptorium Estoniae

    Samost, Anvar, 1971-

    2004-01-01

    Autor võrdleb USA presidendi George W. Bushi ja presidendikandidaat John Kerry välispoliitilisi seisukohti ning leiab, et peaaegu kõigis välispoliitika küsimustes on nad ühel meelel ja mõnes küsimuses on Kerry vaated pigem radikaalsemad

  9. Kui ma oleksin rahvas... / Jürgen Rooste

    Index Scriptorium Estoniae

    Rooste, Jürgen, 1979-

    2007-01-01

    Anders Härmi kuraatorinäitus "Poliitiline/Poeetiline" Tallinna IV graafikatriennaali raames Tallinna Kunstihoones kuni 25. XI. Abel Abidini, Michael Baersi, Johansoni ja Johansoni, Jakob Koldingu, Teemu Mäki, Dan Perjovschi, Hanno Soansi ning Aleksandr Breneri & Barbara Schurzi töödest

  10. Kui palju toodab õpilane kooliteel CO₂? / Daisy Kärner

    Index Scriptorium Estoniae

    Kärner, Daisy

    2010-01-01

    Euroopa Liidu toetatud säästva arengu programm "SUPPORT" kuulutas möödunud kevadel välja kampaania "CO₂ - meie kooliteel", mille eesmärk oli teadvustada inimmõju kliima soojenemisele. Koole osales kogu Euraasiast. Parima uurimistöö tegi Pärnu-Jaagupi gümnaasium

  11. Kui tegelikkusest on kõrini / Tiina Väljaste

    Index Scriptorium Estoniae

    Väljaste, Tiina, 1964-

    2008-01-01

    Eesti, läti ja leedu nüüdiskunsti näitus Pariisi kunstikeskuses Cité Internationale des Arts. Eesti väljapaneku kuraator on Aili Vahtrapuu. Pikemalt Jüri Ojaveri installatsioonist "Kirves ja kuu", Urmas Viigi graafilis-tekstilisest karusaagast. Nimetatud teisi osalejaid

  12. Multifilm kui tõsine asi / Marko Mägi

    Index Scriptorium Estoniae

    Mägi, Marko

    1998-01-01

    Esilinastus 6 animafilmi : "Vares ja hiired", autorid Priit Tender ja Mikk Rand; "Just märried", autor Peep Pedmanson; "Päevavalgus", autor Mait Laas; "Tom ja Fluffy", režissöörid Janno Põldma ja Heiki Ernits; "Bermuda", autor Ülo Pikkov; "Primavera", režissöörid Riho Unt ja Hardi Volmer

  13. Kriis levib maailmas kui vähkkasvaja / Mikk Salu

    Index Scriptorium Estoniae

    Salu, Mikk, 1975-

    2007-01-01

    Maailma finantsturgude kriisi juured ulatuvad USA subprime-laenude turule, need on kinnisvaralaenud, mis on antud väikese sissetulekuga ja tihti ka ilma sissetulekuta inimestele. Vt. samas: Kriisi kronoloogia; Kas finantskriis uputab maailma majanduse?; Mõju Eesti majandusele

  14. Elus on pornot rohkem kui kunstis / Aarne Mäe

    Index Scriptorium Estoniae

    Mäe, Aarne, 1967-

    2009-01-01

    Erootilise kunsti näitusest "Elu 69" Rakvere Näitustemajas, näituse kuraator Teet Veispak, kujundaja Liina Siib. Lisa: Mis on kunstis porno ja erootika vahe? / vastavad Jaan Paavle, Leonhard Lapin, Simson von Seakyll, Teet Veispak

  15. Muusikaanalüüs kui kuulamine / Kerri Kotta

    Index Scriptorium Estoniae

    Kotta, Kerri, 1969-

    2009-01-01

    Artikli eesmärgiks on visandada ühe võimaliku formaalse kuulamisviisi ehk analüüsimeetodi piirjooned. Käsitletud on kuulaja/analüüsija dialoogi teosega peamiselt muusikalise lauseehituse seisukohalt. Analüüsi aluseks on võetud W. A. Mozarti klaverisonaadi C-duur, K 278 I osa

  16. Kriis kui võimalus / Mike Seymour ; interv. Kristo Kiviorg

    Index Scriptorium Estoniae

    Seymour, Mike

    2008-01-01

    Riskijuhtimise ja kriisikommunikatsiooni spetsialist Mike Seymouri sõnul on infoühiskonna areng pannud ettevõtted olukorda, kus nad peavad olema iga hetk valmis sattuma enda suhtes vaenulikult meelestatud avalikkuse tähelepanu alla. Vt. samas: Urve Vilk. Eesti ettevõtete valmisolek kriisikommunikatsiooniks on madal

  17. Kuritegevus kui ühiskondlik probleem / Hurma Kiviloo

    Index Scriptorium Estoniae

    Kiviloo, Hurma

    1996-01-01

    Kriminaalpreventsiooni Nõukogu korraldatud üleriigiline nõupidamine, 15. mai 1996. Ettekanded: T. Vähi, P. Varul, M. Rask, J. Laaniste. Sõnavõtud: Ü. Kotkas, V. Veskiväli, J. Sootak, J. Ilvest, I. Meelak

  18. Linn kui rikastav keskkond kultuuri peeglis / Sander Alfred Liivak

    Index Scriptorium Estoniae

    Liivak, Sander Alfred

    1999-01-01

    12.-13. VIII Tartu Ülikooli kunstide osakonna korraldatud rahvusvaheline seminar "Linnakultuur ja keskkonnakunst". Aasa Musta, Rein Veidemanni, Agnes Trump'i, Martti Preemi, Paulina Ahokase, Enn Siimeri, Raho Langsepa, Riitta Mänty, Irja Alakivi, Katriin Fischi, Hanna Johanssoni ettekannetest. Janna Syvänoja loomingust näidati videofilmi.

  19. Baltoscandal kui meeste pidu / Inna Grünfeldt

    Index Scriptorium Estoniae

    Grünfeldt, Inna, 1961-

    2006-01-01

    Baltoscandal 2006 huvitavamaid esinejaid : Houkka Bros. Soomest muusikalise etendusega "Lapsi, linde ja lillekesi", Rabih Mroue "Otsides kadunud töötajat", Rui Horta "SETUP", Amir Reza Koohestani lavastusega "Recent Experiences"

  20. Fassaadi viimistlusvead kinni nii teadmatuses kui ka hoolimatuses / Eneken Laasme

    Index Scriptorium Estoniae

    Laasme, Eneken

    2006-01-01

    Viimistlusvigade tagajärjeks on hoone konstruktiivse osa lagunemine ning sise- ja välisseinte hallitus. Kommenteerivad SIA Caparol Baltica Eesti filiaali juhataja Jaan Vikat ja Heiki Tuisk OÜ Värvikeskuste Grupist

  1. Jutustamine kui kunst / Tuula Hyyrö ; kommenteerinud Meeli Pandis

    Index Scriptorium Estoniae

    Hyyrö, Tuula

    2009-01-01

    Suulised rahvatraditsioonid ei ole tänapäevalgi oma tähtsust minetanud, vaid on muutunud kunstiharuks, mida saab ülikoolis valikainena õppida. Juttude jutustamisest, muinasjuttude rääkimisest. Kommenteerib Eesti Lugemisühingu juhatuse liige Meeli Pandis

  2. Tase '08 - kui tase siis ikkagi? / Maarin Ektermann

    Index Scriptorium Estoniae

    Ektermann, Maarin

    2008-01-01

    Eesti Kunstiakadeemia lõputööde näitustest, mis toimuvad festivali "Tase '08" raames: vabade kunstide teaduskonna magistritööde väljapanekust Kumu Kunstimuuseumis; disainiteaduskonna lõputööde, mis valmisid koostöös IT Kolledzhi üliõpilastega, näitusest "Arukalt" "SooSoo" galeriis

  3. Rahvuslus kui parasiitlus? / Miroslav Hroch ; interv. Katri Vallaste

    Index Scriptorium Estoniae

    Hroch, Miroslav

    2005-01-01

    Praha Karli Ülikooli ajalooprofessor Miroslav Hroshi väitel on rahvuslus sageli nagu parasiit, mis kasutab võimu, prestiizhi või mõnel muul eesmärgil ära majanduslikke, keelelisi või poliitilisi olusid. Eesti ja Tšehhi Euroopa Liidus

  4. On aeg, mil vajame enam leiba kui lilli / Ants Juske

    Index Scriptorium Estoniae

    Juske, Ants, 1956-2016

    2009-01-01

    Marge Monko isikunäitus "Leib ja lilled" Tallinnas Draakoni Galeriis 21. märtsini. Eksponeeritud fotod ja video "Nora õed". Kunstnik on majanduses ja tööhõives asetleidvaid muutusi uurides aluseks võtnud Narva Kreenholmi Manufaktuuri näited

  5. Riik kui tellija ehk avaliku teenindamise kohustus õhutranspordisektoris / Sandor Elias

    Index Scriptorium Estoniae

    Elias, Sandor

    2017-01-01

    Avaliku teenindamise kohustusest õhutranspordi valdkonnas, selle kehtestamise menetlusest ja avaliku teenindamise kohustuse seotusest riigiabi andmise keeluga. Riigiabi andmise keelust Euroopa Liidu toimimise lepingu alusel

  6. "Mida ma teen, kui ma tõlgin?" / Rita Niineste

    Index Scriptorium Estoniae

    Niineste, Rita

    2011-01-01

    26. septembril Tallinna Ülikoolis Euroopa keeltepäeva raames peetud tõlketeemalise konverentsi ettekannetest. Konverentsi korraldasid Euroopa Komisjoni esindus Eestis ja Tallinna Ülikooli Kirjastus

  7. Enne kui Rakvere teatrisse saabub vananaistesuvi / Pille-Riin Purje

    Index Scriptorium Estoniae

    Purje, Pille-Riin, 1963-

    2007-01-01

    Rakvere teatri suvest, valmistumisest suurejoonelise "Cyrano de Bergerac'i" väljatoomiseks septembris. Imaveres etendati William Shakespeare'i "MacBethi", Tallinnas Pirita kloostris avas 10. ja 11. augustil Birgitta Festivali Arthur Honeggeri-Paul Claudeli dramaatiline oratoorium "Jeanne d'Arc tuleriidal". Mõlemad lavastas Üllar Saaremäe

  8. Inimese papilloomiviiruse vastane vaktsiin imet ei tee, aga kaitseb siiski / Marika Kusnets

    Index Scriptorium Estoniae

    Kusnets, Marika

    2006-01-01

    5. oktoobril korraldas ravimifirma Merck Sharp & Dohme koostöös erialaarstide, Eesti Vähiliidu ja Quattromediga ajakirjanikele ümarlaua, kus räägiti emakakaelavähi põhjustest ja ravist, HPV tüüpidest, nakatumis- ja kaitsemehhanismidest ning uuest Eesti turule jõudvast vaktsiinist

  9. "Berlinale 2008" - küll jahe, aga lahe! / Annika Koppel

    Index Scriptorium Estoniae

    Koppel, Annika

    2008-01-01

    Berliini 58. filmifestivali auhinnasaajatest : Kuldkaru võitis Brasiilia produtsendi ja režissööri Jose Padilha mängufilm "Eliitrühm", Hõbekaru USA režissööri Errol Morrise dokfilm "Tavaprotseduur". Parima režissööri Hõbekaru läks Paul Thomas Andersonile mängufilmi "Veri hakkab voolama" eest. Parima näitleja auhinna said Sally Hawkins ja Reza Naji, Alfred Baueri auhinna sai Fernando Eimbcke "Tahoe järv"

  10. Siin on kõik mustrid - aga kuidas lugeda ? / Andres Noormets

    Index Scriptorium Estoniae

    Noormets, Andres, 1963-

    2007-01-01

    Loomingulise kollektiivi Interaktiivne Üksus (int.act.union) tantsulavastusest "Algorytm", autorid Taavet Jansen, Päär Pärenson, Maike Lond, Kalle Tikas ja Andreas W. Esietendus Kanuti Gildi saalis 20. veebr

  11. Mina olin tubli, aga teised keerasid s***a kokku / Maarius Suviste

    Index Scriptorium Estoniae

    Suviste, Maarius, 1966-

    2007-01-01

    SL Õhtuleht uuris riigikogu X koosseisu parlamendiliikmetelt töö käigus tehtud vigade kohta. Parlamendiliikmete vastustest. Lisad: Nemad ei vastanud; Suurimad popipanijad; Suurimad välismaal reisijad; Suurimad Eestis reisijad; Suurimad rääkijad; Suurimad vaikijad; Haiged rahvasaadikud

  12. Kõik on nii nagu enne, aga miski pole enam endine / Martin Rünk

    Index Scriptorium Estoniae

    Rünk, Martin

    2010-01-01

    Anders Härmi kuraatoriprojekt "Next to Nothing" ("Eimillestki edasi") Eesti Kaasaegse Kunsti Muuseumis 22. augustini 2010. Pikemalt Martin Creedi (Suurbritannia), Laura Tootsi, Triin Tamme, Dénes Farkasi, Neeme Külma ja Kaido Ole töödest

  13. Räägime siis rahust... Aga kellega? / Sten A. Hankewitz

    Index Scriptorium Estoniae

    Hankewitz, Sten A., 1979-

    2006-01-01

    Palestiinlaste välisminister Mahmoud al-Zahar unistab maailmakaardist, kus pole Iisraeli riiki. Et Iisraelil pole partnerit, kellega läbi rääkida, plaanib Iisraeli peaministri kohusetäitja Ehud Olmert piirid ühepoolselt paika panna. Lisa: Iisrael vahistas Hamasi ministri

  14. The rare codon AGA is involved in regulation of pyoluteorin biosynthesis in Pseudomonas protegens Pf-5

    Science.gov (United States)

    The soil bacterium Pseudomonas protegens Pf-5 can colonize root and seed surfaces of many plants, protecting them from infection by plant pathogenic fungi and oomycetes. This capacity to suppress disease is attributed in part to Pf-5’s production of a large spectrum of antibiotics, which is controll...

  15. Filmiarhiivid karjuvad, aga seda kuulevad vähesed / Ivi Tomingas ; interv. Tarmo Teder

    Index Scriptorium Estoniae

    Tomingas, Ivi

    2008-01-01

    Vestlusringis, mille teemadeks on filmide digiteerimine, restaureerimine, arhiveerimine, säilitamine ja demonstreerimine, arutlevad Eesti Filmiarhiivi direktor I. Tomingas, Eesti Rahvusringhäälingu filmiarhiivi vastutav toimetaja K. Kanter, "Eesti film 100" projektijuht A. Koppel, ERR arendusjuht H. Männik, Balti Filmi- ja Meediakooli arendusjuht M. Aadamsoo, filmimees E. Säde ja filmiajakirjanik J. Lõhmus

  16. Vana ja tuttav, aga liiga turvaline / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Steven Spielbergi neljas Indiana Jones'i film Harrison Fordiga nimiosas "Indiana Jones ja kristallpealuu kuningriik" ("Indiana Jones and the Kingdom of the Crystal Skull") : Ameerika Ühendriigid 2008

  17. Väikefirma börsile? Aga palun! / Kaidi Oone

    Index Scriptorium Estoniae

    Oone, Kaidi

    2006-01-01

    Börsi poolt loodavatest võimalustest noortele ja väikestele ettevõtetele kapitali hankimiseks ja börsil tegutsemiseks. Väärtpaberibörsi, vabaturu ja alternatiivturu tutvustus. Lisad: Mida börsil olemine firmale annab?, Vaba- ja alternatiivturud mujal maailmas. Võrdlus: väärtpaberibörs, vabaturg ja alternatiivturg

  18. Andrzej Wajda : maailm küll teadis, aga ei hoolinud / Eda Post

    Index Scriptorium Estoniae

    Post, Eda, 1983-

    2008-01-01

    Poola filmi- ja teatrilavastaja Andrzej Wajda, kes pälvis sel aastal president Toomas Hendrik Ilveselt Maarjamaa Risti III klassi teenetemärgi. Tema viimasest mängufilmist "Katõn". Lisatud andmed elu ja töö kohta. Ordenit vastu võtma A. Wajda ei tule, sest 24. veebruaril 2008 läheb ta Los Angeleses Oscarite galale, kus tema film "Katõn" on parima võõrkeelse filmi auhinna nominent

  19. Hamid Karzai on küll Afganistani riigipea, aga Massoud on kangelane / Leslie Leino

    Index Scriptorium Estoniae

    Leino, Leslie

    2005-01-01

    Afganistani valimistel võitsid opositsionäärid, tugevaim figuur nende hulgas on Ahmad Shah Massoudi kunagine kaasvõitleja Yunus Qanun, kelle siht on võõrväed riigist välja viia ja riik ühendada. Ameeriklased ja nende liitlased on ärevil, sest Qanun pole võõrvägede hulgas populaarne. Lisa: Põhimõtteliselt ameeriklaste vastu. Vt. samas: Afganistanis alustas pärast 30-aastast pausi tööd parlament

  20. Metsanduse 100-aastane roheline ring : kasuta puitu rohkem, aga teadlikumalt / Marku Lamp ; interv. Rain Uusen

    Index Scriptorium Estoniae

    Lamp, Marku

    2008-01-01

    Vestlus keskkonnaministeeriumi metsaosakonna juhatajaga metsade heaperemehelikust majandamisest, puidu aktiivsemast kasutuselevõtust eri majandusharudes ning raiutud metsade asendamisest uutega, mis tagab kasvuhoonegaaside piisava sidumise atmosfäärist, pidurdades nii ka kliimamuutusi

  1. August välja küll, aga kunas ja kuidas? / Andres Arrak

    Index Scriptorium Estoniae

    Arrak, Andres, 1958-2017

    2009-01-01

    USA majandustsüklite uurija Victor Zarnowitz väidab, et järsule majanduslangusele järgneb kiire tõus. Autor leiab, et Eestit võimaldavad majanduskriisist välja tuua mitte ainult õiged otsused valitsussektoris, vaid ka erasektoris

  2. Kosmosetööstusel hiigelideid jätkub, aga raha napib... / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2009-01-01

    Barcelonas tegutsev firma Galactic Suite LTD kavandab kosmosehotelli. Richard Branson on lubanud pakkuda kosmoseturismi 200 000 dollari eest, kuid tema plaanid on hakanud edasi lükkuma. NASA, ESA ning mõnede riikide kosmose-eelarvetest 2008. a.

  3. Majandus kasvab, aga Eesti on ikka kriisis / Villu Reiljan ; tõlk. Jelena Vassiljeva

    Index Scriptorium Estoniae

    Reiljan, Villu, 1953-

    2002-01-01

    Ilmunud ka: Molodjozh Estonii 27. juuni lk. 6, Estonija 1. juuli lk. 2. Venek. art. autoriks märgitud Janno Reiljan. Eesti väljatoomiseks regionaalsest, sotsiaalsest ja eetilisest kriisist ning majanduskasvu rakendamiseks kogu ühiskonna teenistusse tuleb lahti öelda rahaeliidi võimu tugevdavast võltsliberalismist, kirjutab autor. Autor: ERL. Parlamendisaadik

  4. Vahutab nagu seep, aga puhtaks ei pese / Lauri Kärk

    Index Scriptorium Estoniae

    Kärk, Lauri, 1954-

    2005-01-01

    Täispikk lastefilm "Röövlirahnu Martin" : stsenaristid Mihkel Ulman, Jaak Urmet, R. Vilbre jt. : režissöör Rene Vilbre : produtsent ja operaator Manfred Vainokivi : helilooja Kaspar Jancis : Parunid ja Vonid, Taska Film, Amrion 2005

  5. Privaatpankur: varastasin miljoneid, aga keegi ei märganud / Lynnley Browning, Diana B. Henriques

    Index Scriptorium Estoniae

    Browning, Lynnley

    2009-01-01

    New Yorgi privaatpankuri, UBSi ja JPMorgan Chase'i varakamate klientide haldurina töötanud Hernan E. Arbizu pettusest, mille käigus võttis ta ebaseaduslikult oma Lõuna-Ameerika klientidelt miljoneid dollareid

  6. Väga suur ja vana, aga ikka pooleli / Alexander Birnbaum

    Index Scriptorium Estoniae

    Birnbaum, Alexander

    2007-01-01

    Bologna San Petronio Basilica ehk Püha Petroniuse katedraalist. Kiriku fassaadist, interjöörist, seal asuvast päikesekellast. Lühidalt Strasbourgi, Kölni, Siena, Milano ja Barcelona Sagrada Familia katedraalide ehitamisest

  7. Rein Pakk: olen Jumala trumm, aga sina oled ka / Rein Pakk ; intervjueerinud Tiiu Laks

    Index Scriptorium Estoniae

    Pakk, Rein, 1968-

    2010-01-01

    Intervjuu Rein Pakuga, kellel meeldib kirjutada artikleid ja näidendeid, laval ja filmis mängida, teha sisekujunduslahendusi ja karikatuure. 27. augustil esietendus Tallinna Draamateatris tema esimene lavastajatöö, teatri Vanemuine lavastus "Kaos". Andmeid Rein Paku elu ja loomingu kohta

  8. Suvi on lühike, kunst aga pikk / Ille Rohtlaan

    Index Scriptorium Estoniae

    Rohtlaan, Ille

    2009-01-01

    Suvised kunstinäitused Pärnus: "Mees ja naine" Pärnu uue kunsti muuseumis, Tarmo Roosimöldri graafika ja maalid Endla teatrigaleriis, Piret Vapajeva graafika teatrikohvikus, Haapsalu graafilise disaini festivali külalisnäitused Linnagaleriis ja kontserdimajas, Lea Tomsoni maalid "Monkey Business"kunstnike majas

  9. Meediamagnaat Murdoch võitleb, aga vist veel mitte elu eest / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo

    2011-01-01

    Häkkimisskandaali ohjeldamiseks sulges Rupert Murdoch väljaande News of the World ja loobus tasulise televõrgu BSkyB ülevõtmisest. Autori väitel Murdoch oma Briti ajaleheäri müüma ilmselt ei kiirusta. Murdoch on koos oma News Corpi asetegevjuhist poja James Murdochiga Briti parlamendi komitee ette kutsutud

  10. Scaling Value: Transnationalism and the Aga Khan's English as a "Second Language" Policy

    Science.gov (United States)

    Bolander, Brook

    2018-01-01

    Against the backdrop of growing sociolinguistic interest in transnationalism, this paper uses the notion of "scale" as an "ideological project" (Irvine in "Scale. Discourse and dimensions of social life," University of California Press, California, 2016: 214) to study situated discursive performances of…

  11. Kristiina Nurk: ilus võib olla, aga mugav peab olema / Kristiina Nurk ; intervjueerinud Tiiu Laks

    Index Scriptorium Estoniae

    Nurk, Kristiina, 1982-

    2009-01-01

    Intervjuu Kristiina Nurgaga, kes õpib Eesti Kunstiakadeemias disaini ja rakenduskunsti eriala nahakunsti suuna magistrantuuris, on lõpetanud Tartu Kõrgema Kunstikooli reklaamikunsti eriala, soovib saada kingadisaineriks, pälvis Prantsusmaal Saint Rémy-lès-Chevreuse'is toimunud rahvusvahelisel köitekunsti biennaalil ühe peapreemiatest. Kristiina Nurga eluloolisi andmeid, pälvitud preemiad

  12. America: AGA [American Gas Association] initiative aims to boost gas demand

    International Nuclear Information System (INIS)

    Fraser, K.M.

    1992-01-01

    This article focuses on the aim of the American Gas Association to increase natural gas demand in the key areas of gas electric generation, natural gas vehicles, gas cooling, and conversion of oil burning facilities, electric water heaters and household appliances such as space heating, stoves, washers and lighting. The need to improve the reliability of natural gas supplies is discussed. It is anticipated that natural gas will not replace coal as the main energy source for power generation, but that it will help utilities to meet environmental regulations. (UK)

  13. Poliitikud vajavad kaastunnet, aga seda ei tohi anda tasuta / Mohamed A. El-Erian

    Index Scriptorium Estoniae

    El-Erian, Mohamed A.

    2011-01-01

    Euroopas, USA-s ja Jaapanis on majanduses valitsev meeleolu uuesti halvenemas, kõik need piirkonnad on hädas võlgade vähendamisega. Poliitikud seisavad praegu silmitsi ebatavaliselt raskete väljakutsetega, me peaksime neid muutusteks survestama

  14. Tõlkija kui nähtamatu maag: näiteid hispaaniakeelse kirjanduse tõlgetest Jüri Talveti tõlkemõtte valguses / Translator as an Invisible Magician: Some Examples of Spanish Literature Translations in the Light of Jüri Talvet’s Translational Thought

    Directory of Open Access Journals (Sweden)

    Klaarika Kaldjärv

    2016-12-01

    Full Text Available Teesid: Tõlkimine Eestis olnud seotud isiksuste ja missiooniga, eesti keele ja kirjanduse arendamisega, lugeja valgustamise ja harimisega. Tõlkimise oluline roll eesti kirjakeele ja omakirjanduse arengus on vastavalt ajalooperioodile mõjutanud valitseva tõlkemeetodi kujunemist. Jüri Talveti kui ühe olulisema kultuurivahendaja tõlkemõte on tõlget ikka vaadelnud osana üleüldisest kirjandustegevusest, tõlkekirjandust osana maailmakirjanduses, tõlkivaid väikerahvaid maailmakirjanduse loojana. Talveti ideaalne tõlkija-isiksus teeb tõlkest suurepärase teose ilma, et sellesse jääks jälge tema kunstilistest seisukohtadest, see isiksus muutub tõlketekstis ise nähtamatuks ja võimaldab tõlkel sulanduda vastuvõtva kirjanduse osaks.   The importance of translation and translated literature in Estonian culture and literature does not need to be stressed, yet the recording of Estonian translation history is still in its early stage and, among other topics, it requires seeking answers to questions of why translation is as it is, why the translator deemed it necessary to emphasize certain qualities of a literary work and allowed others to get “lost in translation” and what these absent qualities could mean to the reader forming their opinion of the work and its author. As one of the most influential cultural mediators, Jüri Talvet has always seen translation as part of general literary activity, literary translations as part of world literature, and the translating small nations as creators of world literature. Talvet’s attention has been drawn to the translator’s personality and the problem of their visibility and invisibility. While Talvet admits that the work of many literary translators has remained undeservedly unrecognized, he still argues that the matter of translators’ invisibility does not justify the attention it has received. Translator’s visibility can only be guaranteed by their role as a cultural

  15. Triatloniteel käänakuktega / Evelin Kivilo-Paas, Reeli Maasikamäe, Maret Einmann

    Index Scriptorium Estoniae

    Kivilo-Paas, Evelin, 1979-

    2012-01-01

    Kolme mehe, Tarmo Tuule, Martin Toomi ja Peeter Lume eksperimendist saavutamaks 9 kuuga paremat sportlikku vormi ja tervislikumat eluviisi. Ülevaade neljandal kuul saavutatust ja Tarmo Tuule triatloniks valmistumisest

  16. Environmental survey in the Tuul and Orkhon River basins of north-central Mongolia, 2010: metals and other elements in streambed sediment and floodplain soi

    Science.gov (United States)

    Brumbaugh, William G.; Tillitt, Donald E.; May, Thomas W.; Choijil, J.; Komov, T.V.

    2013-01-01

    Streambed sediment and subsurface floodplain soil were sampled for elemental analyses from 15 locations in river basins of north-central Mongolia during August 2010. Our primary objective was to conduct a reconnaissance-level assessment of potential inputs of toxicologically important metals and metalloids to Lake Baikal, Russia, that might originate from mining and urban activities within tributaries of the Selenga River in Mongolia. Samples were collected in triplicate from all sites, then dried, and sieved to city of Ulaanbaatar, but those concentrations were considerably less than probable effects benchmarks. Historical and possibly present mining activities have led to considerable metal contamination in certain tributaries of the Orkhon River in north-central Mongolia; however, metals originating from those sources did not appear to be accumulating in sediments at our downstream-most sampling sites located near the border between Mongolia and Russia.

  17. Pilveteenuse osutamisel tekkiva õigussuhte kvalifitseerimine Eesti õiguses : [magistritöö] / Kristel Tuul ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Tuul, Kristel, 1990-

    2014-01-01

    Pilveteenuse mõistest ja pilveteenuste liikidest, pilveteenuse osutamisel sõlmitava lepingu esemest, pilveteenuse lepingu subjektidest, pilveteenuse lepingu sisu kujunemisest, pilveteenuse lepingu sisu vastavusest litsentsi-, teenuse osutamise ja kasutuslepingu tunnustele

  18. "Uni katab meid ühele palju kahele vähe..." : [luuletused] / Jaan Kaplinski

    Index Scriptorium Estoniae

    Kaplinski, Jaan, 1941-

    2001-01-01

    Tekst eesti ja inglise k. J. Kaplinski lühibiograafia eesti ja inglise k. lk. 93. Sisu: "Uni katab meid ühele palju kahele vähe..." = "Sleep covers us too much for one, too little for two..." ; "Olematus ulatub kõikjale ja olemasolu on täis rahu..." = "Non-being pervades everything and being is full of peace..." ; "See mis meid äratas..." = "What woke us..." ; "Seesama meri meis kõigis..." = "The same sea in us all..." ; Dana paramita ; "Ida ja Lääne vaheline piir rändab ikka, vahel itta, vahel läände..." = "The East-West border is always wandering..." ; "Pesu ei saa kunagi pestud..." = "The washing never gets home..." ; "Neli ja pool tonni sileesia sütt..." = "Four-and-a-half tons of Silesian coal..." ; "Ei teagi, kas ma tohin rääkida roheline..." = "I don't even know if I have the right to say "green"..." ; "Maailmu on nii palju kui liivateri mere ääres..." = "There are as many worlds as grains of sand on a beach..." ; "Viimane pilv läheb üle taeva läänest itta..." = "A last cloud goes over the sky from West to East..." ; "Taevas on pilves. Soe tuul tuleb hõlma alla..." = "The sky is overcast. The warm wind is creeping under your shirt..." ; "Mu tädi tundis neid hästi, mina ei tea..." = "My aunt knew them well, I know of them..." ; "Hommikul tutvustati mind president Mitterrandile..." = "In the morning, I was presented to President Mitterrand..." ; "Meri ei taha lainetada. Tuul ei taha puhuda..." = "The sea doesn't want to wave...".Poems written in English: "Om svabhavasuddhah sarva dharmah. No selfhood..." ; "My little boy..." ; "After many bitterly cold days..." ; "You can forget nature..." ; I walk facing East..." ; "A skier going south..."

  19. Konditsionaali omandamisest eesti lapsekeeles

    Directory of Open Access Journals (Sweden)

    Tiia Tulviste

    2011-05-01

    Full Text Available Artiklis käsitletakse verbi konditsionaalivormide arengut eesti lapsekeeles. Kasutatakse kahte korpust: Andrease CHILDES-i korpust, milles leidub ühe lapse salvestisi vanusest 1;7 kuni 3;1, ja 3–5-aastaste laste mängude salvestisi. Esimesed preesensi konditsionaali vormid ilmuvad Andrease keelde 2 aasta vanuses, regulaarseks ja sagedaseks saab neid aga pidada umbes vanuses 2;6. Laps kasutab neid kõige rohkem et-konstruktsioonides, ema aga lapsele suunatud kõnes kõige rohkem modaalverbikonstruktsioonides. Mänguvestluste põhjal võib öelda, et konditsionaali preesens esineb juba kõigis täiskasvanupärastes funktsioonides (s.t nii kujuteldava olukorra tähenduses kui viisakusvahendina, kuid perfektivormid on veel selleski vanuses piiratud väheste kasutuskontekstidega. http://dx.doi.org/10.5128/ERYa7.09

  20. Ülo Õun : Skulptor katkenud avastusterajal = Sculptor on a broken trail of discovery / Juta Kivimäe

    Index Scriptorium Estoniae

    Kivimäe, Juta, 1952-

    2007-01-01

    Ülo Õuna loominguga tuli 1970-ndatel eesti skulptuuri seni kogematu sõbralik grotesk, mis väljendus nii tema portreedes kui ka figuraalkompositsioonides. Teda köitis värv skulptuuris, vormide voolavus, nende muutlikkus. Ta püüdis tuua skulptuuri omadusi, mis on olnud omased muusikale, aga ka graafika ja maali väljenduslikkusele, fikseerides sügavalt inimlikke seisundeid, mida seni polnud Eestis üritatudki portreteerida. Tema inimesekäsitlus on lähtunud eelkõide kujuri erakordsest emotsionaalsest tundlikkusest ning tõsisest sisevaatlusest

  1. Ajutine juht - jube kallis, aga see-eest väga kasu(m)lik / Irja Rae

    Index Scriptorium Estoniae

    Rae, Irja

    2005-01-01

    Ajutise juhi (interim manager) ehk üleminekujuhi palkamisest ettevõttes. Vt. samas: Kus teda näha võib. Kommenteerib juhtimiskonsultatsioonide firma PW Partnersi vanemkonsultant Jana Võrk. Vt. samas: Keskpaik, Ivar. Eesti tuntuim üleminekujuht

  2. Turumajandus on käkitegu, aga püüdke demokraatiat ehitada! / Lauri Linnamäe

    Index Scriptorium Estoniae

    Linnamäe, Lauri

    2008-01-01

    Postkommunistlike riikide vastu huvi tundva majandusteadlase Anders Aslundi raamatust "How capitalism was built", mis annab põhjaliku ja süstemaatilise ülevaate ajast ja protsessidest, mis jäävad Nõukogude Liidu lagunemise ja tänapäeva vahele

  3. Validation of acute physiologic and chronic health evaluation II scoring system software developed at The Aga Khan University, Pakistan.

    Science.gov (United States)

    Hashmi, M; Asghar, A; Shamim, F; Khan, F H

    2016-01-01

    To assess the predictive performance of Acute Physiologic and Chronic Health Evaluation II (APACHE II) software available on the hospital intranet and analyze interrater reliability of calculating the APACHE II score by the gold standard manual method or automatically using the software. An expert scorer not involved in the data collection had calculated APACHE II score of 213 patients admitted to surgical Intensive Care Unit using the gold standard manual method for a previous study performed in the department. The same data were entered into the computer software available on the hospital intranet (http://intranet/apacheii) to recalculate the APACHE II score automatically along with the predicted mortality. Receiver operating characteristic curve (ROC), Hosmer-Lemeshow goodness-of-fit statistical test and Pearson's correlation coefficient was computed. The 213 patients had an average APACHE II score of 17.20 ± 8.24, the overall mortality rate was 32.8% and standardized mortality ratio was 1.00. The area under the ROC curve of 0.827 was significantly >0.5 (P test showed a good calibration (H = 5.46, P = 0.71). Interrater reliability using Pearson's product moment correlations demonstrated a strong positive relationship between the computer and the manual expert scorer (r = 0.98, P = 0.0005). APACHE II software available on the hospital's intranet has satisfactory calibration and discrimination and interrater reliability is good when compared with the gold standard manual method.

  4. Üritatakse parimat, aga välja tuleb nagu tavaliselt / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2009-01-01

    Bryan Singeri mängufilm "Operatsioon "Valküür"" ("Valkyrie"), peaosas Tom Cruise. Film räägib Claus von Stauffenbergi (1907-1944) poolt juhitud operatsioonist, mille eesmärgiks oli atendaat Adolf Hitlerile

  5. Igavese armastuse sõdalane : mitte just klassika, aga ajaloo verstapost küll / Ilmar Raag

    Index Scriptorium Estoniae

    Raag, Ilmar, 1968-

    2006-01-01

    Soome ja Hiina mütoloogiat ühendavast fantaasiafilmist "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina, Hollandi, Eesti ühistöö) : stsenarist Iiro Küttner, režissöör Antti-Jussi Annila, võitluskunstide koreograaf Yu Yan Kai, osades - Tommi Eronen, Zhang Jingchu, Markku Peltola, Elle Kull

  6. Validation of acute physiologic and chronic health evaluation II scoring system software developed at The Aga Khan University, Pakistan

    Directory of Open Access Journals (Sweden)

    M Hashmi

    2016-01-01

    Conclusion: APACHE II software available on the hospital′s intranet has satisfactory calibration and discrimination and interrater reliability is good when compared with the gold standard manual method.

  7. Üheksa ametit kindlasti, aga kümnes nälg ei ole / Tiia Truu

    Index Scriptorium Estoniae

    Truu, Tiia, 1948-

    2009-01-01

    Raplamaa käsitööseltsingu "Süstik" juhatuse esimehest Ivi Sargast ja tema tegemistest. Ivi Sark on lõpetanud Tartu Ülikooli kehakultuuriteaduskonna, tegeleb lapitööga, on tuntud laatade ja teiste ürituste korraldajana, 2007. aastast on Järvakandi gümnaasiumis käsitöö- ja võimlemisõpetaja

  8. Palju kära, aga mitte kuigi palju villa = Talkin' loud and saying not that much / Mika Hannula

    Index Scriptorium Estoniae

    Hannula, Mika, 1967-

    2015-01-01

    Kunstikriitik analüüsib nüüdisaegse kunsti poliitiliste aktide õnnestumisi ja ebaõnnestumisi Kiasma rahvusvahelisel rühmanäitusel "Demonstrating minds - disagreements in contemporary art" (Meele avaldused - erimeelsused nüüdisaegses kunstis) eksponeeritud tööde näitel. Vaatluse all on Cristina Lucase, Tanja Boukali, Jonathan Meese, Cinthia Marselle'i & Tiago Mata Machado ning Kader Attia teosed

  9. "Ringlemise viis, millesse me kinni jäime : kurvad, heitlikud, lootusrikkad..." : [luuletused] / Joni Pyysalo ; soome keelest tõlkinud Marko Martinson

    Index Scriptorium Estoniae

    Pyysalo, Joni

    2007-01-01

    Sisu: "Ringlemise viis, millesse me kinni jäime: kurvad, heitlikud, lootusrikkad..." ; "Tundmatu linnu huige öisel nõmmel, kordub saamata vastust, vannitoa..." ; "Aga armastus on umbrohi: leiab üles iga võimaluse, iga prao, iga nõrga koha." ; "Oma nõrkuse asetad sõrmeotsa ta silmalaule..." ; "Sa magad kaua, äratad ikka veel selle igatsuse..." ; "Mitu korda ütleb ta lihtsat su nime ja ei jõua lõpuni..." ; "Su hingamine on meister, kui on kiirus peal..." ; "Haige männi latv nagu riidepuu konks..." ; "Aga mingid rahustid ei rahusta enam..." ; "Harva nii ärkvel, et saad aru, mis lahti..." ; "Kui 90-ndate muusikat mängitakse raadios nagu minevikku..." ; "Hommikud peavad olema õrnad siin, kus magatakse üksi..." ; "Kõik on võimalik..." ; "Laps uninub lõpuks..." ; "Maailm, et oleks ometi, millega kalibreerida..." ; "Naine püüab pimeduses nutta nii tasakesi..:" ; "Õunapuu all istub tool..." ; "Mälu tahab meile öelda..." ; "Nii nagu väikeste tissidega naisel ei lähe vaja rinnahoidjaid..." ; "Ma sätin su tekki paremini, nagu kohendaksin tuld..." ; "Mitte keegi pole mu tahtele niimoodi vastu hakanud..." ; "Kolgin vana maja keldris mutrivõtmega..." ; "Naine magab, nägu seina poole, mees tuleb teki alla, kõverdab põlved..." I-III ; "Katus sulab ööga kokku..."

  10. Iirimaale : [luuletused] / Percy Bysshe Shelley ; tlk. Minni Nurme, Ants, Oras

    Index Scriptorium Estoniae

    Shelley, Percy Bysshe

    2006-01-01

    Sisu: Iirimaale ; Armastuse roos ; Harrietile ; Muutlikkus ; Vangist vabanenud sõbrale ; Minevik ; Byronile ; Kaduvik ; Laul : "Maa magas, külm kui surm..." ; Hümn vaimsele ilule ; Laul : "Too aeg on läind, mu armsam, läind..." ; Ozymandias ; Sonett ; India serenaad ; Leonardo da Vinci Medusa Firenze kunstikogus ; Armu filosoofia ; Ood läänetuulele ; Mary Shelleyle ; Laul briti meestele ; Uus rahvushümn ; Inglismaa 1819. a. ; Ära madu ärata ; Head ööd! ; Pilv ; Apolloni hümn ; Paani hümn ; Lõoke ; Vabadus ; Suvi ja talv ; Maailmarändurid ; Küsimus ; Aeg, mis hajus ; Ööle ; -le : "Üht sõna on labastand suud..." ; -le : "Kui kirg kord mööduks, aga jääks..." ; Õhtu Ponte al Marel, Pisas ; Mälestus ; Muusika ; Aeg ; Põgenejad ; Ma olla kuningas ei tahaks ; "Homne päev, kus oled praegu..." ; "Laps rahus kord on emaihus..." ; Üksik lind ; "Kui lamp pihuks langend..." ; Epitaaf ; Kutse Janeþile ; Tähed vilkusid valgust ; Leinalaul ; Pühendus. Eluloolisi andmeid autori kohta lk. 389

  11. South Park : meil on rohkem peeretusi kui USA-s / Märt Milter

    Index Scriptorium Estoniae

    Milter, Märt

    2000-01-01

    Animafilm "South Park : suurem, pikem ja lõikamata" ("South Park . Bigger, Longer & Uncut") : Stsenaristid Trey Parker, Matt Stone ja Pam Brady : režissöör Trey Parker : Ameerika Ühendriigid 1999

  12. Jörg Specht: toetan niikaua, kui suudan / Jörg Specht ; interv. Elina Kononenko

    Index Scriptorium Estoniae

    Specht, Jörg

    2005-01-01

    Võru maakonna 2004. a. parimaks toetajaks valiti Jörg Specht, kes töötab Bad Segebergis ehitusettevõtjana ning on Võrumaale toonud suurel hulgal abipakke ja kingitusi. Mullu autasustati teda päästeameti hõberistiga. Vt. samas: Specht kinkis Kandlele oma auto

  13. Kunstnikud kui ajastu südametunnistus / Evelyne Jouanno, Ieva Kalnina ; interv. Reet Varblane

    Index Scriptorium Estoniae

    Jouanno, Evelyne

    2006-01-01

    Tšetšeenia toetuseks organiseeritud emergency biennale'ist vestlevad kuraator Evelyne Jouanno ja Riia linna näitusehalli juhataja Ieva Kalnina. Projekt liigub kahte ringi mööda: üks Tšetšeenias, teine mööda maailma. Pariisis avati näitus 23. II, sealt läks Brüsselisse, Itaaliasse Bolzanosse ja Milanosse, Riiga (Lätist osales projektis 16 kunstnikku, näitusega kaasnes konverents) ja Tallinna. Lühidalt väljapanekust Tallinna Kunstihoones

  14. Minu kogemus: Facebook kui töö- ja õppevahend / Jaak Juske

    Index Scriptorium Estoniae

    Juske, Jaak, 1976-

    2015-01-01

    Jaak Juske jaoks on FB hindamatu ühismälu kandja. Kuna ta paneb oma seinale pidevalt koos kommentaaridega üles vanu pilte, linke blogilugudele jne., siis hakkab see silma ka FB aktiivselt kasutatavatele noortele

  15. Teismeliste üksindus ja kommerts - teema nii Londonis kui ka meil / Tõnis Mägi

    Index Scriptorium Estoniae

    Mägi, Tõnis, 1948-

    2007-01-01

    Muusik räägib, mida huvitavat ta nägi Londonis. Lähemalt Peter Shafferi näidendi "Equus" lavastusest, peaosades Richard Griffith ja Daniel Radcliffe. Artikkel ilmub Teatrikülgedel rubriigis "Teater & küljed" 5/17

  16. Suveteater kui bränd ja trend. Teatrisuvi 2006 / Jaak Allik

    Index Scriptorium Estoniae

    Allik, Jaak, 1946-

    2006-01-01

    Suvelavastustest: "Vargamäe kuningriik" A. H. Tammsaare "Tõe ja õiguse" I ja V osa ainetel Endla teatri ja Rakvere Teatri ühisprojekt Vargamäel (lavastaja Jaanus Rohumaa), Urmas Lennuk "Koidula" Emajõe Suveteatris (lavastaja Andres Dvinjaninov), "Romeo & Julia" Eesti Nuku- ja Noorsooteatris (lavastaja Andres Dvinjaninov), Andrus Kivirähk "Sürrealistid" Viinistus (lavastaja Hendrik Toompere jun), Mart Kivastik "Kits viiuli ja õngega" Viinistus (lavastaja Raimo Pass), Jaan Kross "Vastutuulelaev" Naissaarel (lavastaja Aleksander Eelmaa), Alfred Jarry "Kuningas Ubu" Teater NO99 Haapsalu Kiltsi lennuvälja angaarides (lavastajad Ene-Liis Semper ja Tiit Ojasoo), Mart Laar ja Lauri Vahtre "Minust jäävad ainult laulud" Munamäe nõlval (lavastaja Tõnu Lensment), A. H. Tammsaare - H. Rekkor "Tõde:ei:õigus" Vargamäe aidas (lavastaja Helen Rekkor), Rudolf Reiman "Painaja" Leigo Järveteatris (lavastajad Jaan Tooming ja Anne Türnpu), Brian Friel "Kodukoht" Eesti Draamateater Keila-Joa mõisas (lavastaja Priit Pedajas), A. Tshehhov - P. Tammearu "Kolm klaasikest kirsiviina" Ugala tiigi kaldal (lavastaja Peeter Tammearu), Jaan Tätte "Kaev" Tallinna Linnateatri siseõues (lavastaja Indrek Sammul), Jim Ashilev "Nagu poisid vihma käes" Endla teater Muuseumiaidas (lavastaja Andres Noormets)

  17. Sügisene dzhässielu kui magus assortii / Madli-Liis Parts

    Index Scriptorium Estoniae

    Parts, Madli-Liis, 1969-

    2005-01-01

    Uuest hooajast Eesti Jazziliidu dzhässiklubis (teater NO99s) Tallinnas, Jazzkaare Sügisjazzi kontsertidest Rock Cafés Tallinnas, üritusest RainbowJazz Tartus 5.-7. oktoobrini. Uutest heliplaatidest: Toomas Rull "Eesti Hääled", Oleg Pissarenko "The Book's Burning"

  18. Kodanikuõpetus kui õppeaine ja selle sisu kujundavad faktorid / Edgar Krull

    Index Scriptorium Estoniae

    Krull, Edgar

    2001-01-01

    Kodanikuõpetuse korraldusest ja sisust eri riikides, toetudes CICE4 (Childrens̀ Identity and Citizenship in Europe) andmebaasidele, mis sisaldavad informatsiooni õpilaste identiteeditaju ja kodanikuteadvuse, kodanikuõpetuse ainekavade ning õpetajakoolituse panuse kohta õpetajate ettevalmistamisel kodanikuõpetuseks

  19. Vaimuliku ja ajalookirjutaja Timann Brakeli "Kristlik vestlus" (1579) kui alahinnatud ajalooallikas / Aija Sakova-Merivee

    Index Scriptorium Estoniae

    Sakova-Merivee, Aija, 1980-

    2014-01-01

    Arvustus: Timann Brakel, Peter von Brakel. Christlich Gesprech. Darstellung der Geshcichte Livlands vor und während des "Livländischen Krieges" bis 1578 in gereimter Dialogform und Prosa von dem Prediger und Geschichtsschreiber Timann Brakel. Originaltext und Kommentaren, Erzählungen, Bildern und dem Lebenslauf des Timann Brakel. (Beiträge zur baltischen Geschichte, Band 19). Hirschheydt, 2012

  20. Maja kui diagnoos ja kommentaar = House as a diagnosis and a comment / Ingrid Ruudi

    Index Scriptorium Estoniae

    Ruudi, Ingrid, 1978-

    2009-01-01

    Korterelamust Tallinna vanalinnas Aia 4 / Vana-Viru 13, hoone sobivusest vanalinna. Autorid Ott Kadarik, Villem Tomiste ja Mihkel Tüür, projekteerija AB Kosmos, konstruktor Maru Ehitus. Projekt 2003-2009, valmis 2009

  1. Hispaania elab majanduskriisi ajal paremini, kui võiks arvata / Priit Kivi

    Index Scriptorium Estoniae

    Kivi, Priit

    2010-01-01

    Hispaania peaminister Jose Luis Rodriguez Zapatero lubas pikendada töötuabiraha maksmist 6 kuult 12 kuuni, kohalikes omavalitsustes on mitmesugused stardipaketid väikeettevõtluse käivitamiseks. Hispaanlaste kulutused majandpidamisele on vähenenud vaid 5% ja nn. halbade laenude osa pankade laenuportfellis on samuti 5%. Meetmetest turismi edendamiseks, töötute ametlikust ja mitteametlikust arvust

  2. Varssavi börs saab tänavu enam kui poolsada uustulnukat / Annika Matson

    Index Scriptorium Estoniae

    Matson, Annika, 1976-

    2005-01-01

    Ilmunud ka: Delovõje Vedomosti 16. märts lk. 29. Hollandi panga ING Securities Varssavi analüütik Piotr Palenik on kindel et sealsetesse börsifirmadesse voolab hetkel suurel hulgal välisinvestorite raha ning seetõttu on börsile tulemas rekordarv firmasid. Tabel: Suuremad Poola ettevõtted, mis tulevad tänavu börsile. Vt. samas: Välismaale investeerimise piirang; Eesti investor saab osta kõiki Varssavi börsi aktsiaid

  3. Sven Heiberg lahkub Viljandist õnnelikumana, kui siia tuli / Sven Heiberg ; interv. Margus Haav

    Index Scriptorium Estoniae

    Heiberg, Sven

    2007-01-01

    Tartu ülikooli Viljandi kultuuriakadeemia näitlejatudengite kuues kursus toob lavale diplomietenduse Janusz Glowacki "Fortinbras jõi end täis", lavastajad Kalju Komissarov ja Sven Heiberg. Noor lavastaja räägib kultuuriakadeemias õppimisest ja Viljandist

  4. Vaip kui väärikas mööbliese

    Index Scriptorium Estoniae

    2008-01-01

    Vaipu valmistavast ettevõttest Valley OÜ. Tuftitud ja rüiuvaipadest. Tüüpilisteks tellijateks on sisekujundajad. Kavand on soovitav kooskõlastada ettevõtte kunstnikuga. Valley OÜ ekspordib vaipu Euroopasse ja Skandinaaviasse

  5. Lutheri vabriku maadele kerkib enam kui poolteist tuhat korterit / Mari Kodres

    Index Scriptorium Estoniae

    Kodres, Mari

    2009-01-01

    Tallinna Veerenni asumis kerkib suure avaliku haljasalaga elamurajoon. Tallinna linnavalitsus otsustas saata ala detailplaneeringu linnavolikokku kehtestamisele. Kevadel toimunud arhitektuurivõistluse võitis arhitekt Mihkel Tüür võistlustööga "Kullo". Arendaja: Satnam Europe OÜ. Uue kortermaja ehitamisest Grove Investile

  6. Varandusinventarid kui luksuse ajaloo uurimise allikad varauusaegse Eesti linnades 18. sajandil / Raimo Pullat, Lauri Suurmaa

    Index Scriptorium Estoniae

    Pullat, Raimo, 1935-

    2008-01-01

    Eesti linnakodanike elukvaliteedi tasemest varauusajal. Varaloendid tõestavad, et Eesti linnakodanike kultuur ja elulaad oli 18. sajandil Euroopa linnakodanike omaga üsna sarnane. Oma eluruumi kujundamisel lähtus Eesti linnakodanik Euroopas levinud sisustuskultuurist

  7. Kui homme on üks päev liiga hilja / Magnus Lepasalu

    Index Scriptorium Estoniae

    Lepasalu, Magnus

    2007-01-01

    Ilmunud ka: Delovõje Vedomosti 3. okt. lk. 19. Logistikaturul on oma kindla koha leidnud nn. kiirabilogistikat (emergency logistics) pakkuvad ettevõtted, mis on spetsialiseerunud eriti ajakriitiliste saadetiste toimetamisele ja suudavad pakkuda erinevaid transpordiliike

  8. Laste seksuaalse väärkohtlemise kui kuriteoliigi tendentsid / Elmar Nurmela

    Index Scriptorium Estoniae

    Nurmela, Elmar

    2000-01-01

    Seadusandlikest muudatustest laste seksuaalse ärakasutamise tõkestamiseks. Lisatud statistilised tabelid laste kallal toime pandud seksuaalkuritegude ja alaealiste prostituutide kohta aastatel 1994-1999

  9. Pigem klaas kihisevat kui Ferrari / Sathnam Sanghera ; tõlk. Erik Aru

    Index Scriptorium Estoniae

    Sanghera, Sathnam

    2005-01-01

    Autor kirjeldab oma kohtumist Ferrari peatestisõitja Dario Benuzziga ja GlaxoSmithKline'i mustsõstrajoogi Ribena maitsja Isobel Hoare'iga ning järeldab, et võib teha tööga rahulolu olemusest järeldusi, mida eksperdid ei näi märkavat

  10. President Ilves New Yorgi eestlaskonnale : vaadake "Talendid koju" programmi kui võimalust

    Index Scriptorium Estoniae

    2010-01-01

    President Toomas Hendrik Ilves ja proua Evelin Ilves külastasid 25. septembril 2010 New Yorgi Eesti Majas tegutsevat Eesti kooli ja osalesid New Yorgi eestlaskonnale korraldatud vastuvõtul. Ilmunud ka: Meie Kodu 6. okt. 2010, lk. 2, pealk.: President Ilves kutsus New Yorgi eestlasi kodumaale tagasi. Töövisiit Ameerika Ühendriikidesse 20.-27.09.2010

  11. Sõprus kui kultuurifenomen / Roman Leibov ; venekeelsest käsikirjast tõlkinud Mall Jõgi

    Index Scriptorium Estoniae

    Leibov, Roman

    2017-01-01

    Arvustus: Ю. М. Лотман - Б. А. Успенский : переписка 1964-1993 / составление, подготовка текста и комментарии О. Я. Кельберт и М. В. Трунина ; под общей редакцией Б. А. Успенского. Таллинн : Издательство ТЛУ, 2016. (Bibliotheca Lotmaniana)

  12. "Kui tehnoloogiline üleolek" kõlab õõnsalt

    Index Scriptorium Estoniae

    2003-01-01

    Kaanel nr. 4 2003/nr. 1 2004. Artiklis refereeritakse Ameerika Ühendriikide armee reservkolonel-leitnandi R. Scott Moore'i artiklit "When "technological superiority" rings hollow". Oma kirjutises hoiatab autor liigse usu eest kõrgtehnoloogiasse ja rõhutab, et tehnoloogia aitab võita lahinguid, kuid mitte sõdu

  13. Pikaro: hull, kui Pärnu jätkab samade juhtoinastega / Tuuli Koch

    Index Scriptorium Estoniae

    Koch, Tuuli

    2008-01-01

    Kaitsepolitsei asub üle kuulama Pärnu linnapead Mart Viisitamme ja abilinnapead Simmo Saart, keda kahtlustatakse riigihangetes omade soosimises, samal ajal arutlevad kriisi sattunud linna volikogu liikmed selle üle, kuidas linnajuhtimisega antud olukorras edasi minna. Vt. samas: Pärnu linnavalitsus; Pärnu linnavolikogu

  14. Ericssoni juhi Svanbergi sõnul on firma praegu tugevam kui kunagi varem / Sirje Rank

    Index Scriptorium Estoniae

    Rank, Sirje, 1966-

    2005-01-01

    Mobiilsidevõrkude tootja Ericsson puhaskasum oli 2004. aastal 19 miljardit Rootsi krooni. Firma juhi Carl Henric Svanbergi sõnul kujunes 2004. aastast läbimurdeaasta tänu 3G tehnoloogia rakendamisele

  15. Arhitektuur kui tervikprotsess: ümber hinnates ehitusinseneride panust 20. sajandi ehituskultuuri / Carl-Dag Lige

    Index Scriptorium Estoniae

    Lige, Carl-Dag, 1982-

    2010-01-01

    Taani päritolu ehitusinsenerist Ove Arupist ja terviklikult läbimõeldud projekteerimise protsessist, kus ühtivad esteetilised, ehitustehnoloogilised ning funktsionaalsed kvaliteedid. Taani ehitusinsenerist Herluf Trolle Forchhammerist, kes juhtis Tallinna vesilennukite angaaride projekteerimist. Eesti ehitusinseneridest August Komendandist ja Heinrich Laulust

  16. Gija Kantšeli kui kontrastide guru / Igor Garšnek

    Index Scriptorium Estoniae

    Garšnek, Igor, 1958-

    2010-01-01

    Gruusia nüüdishelilooja Gija Kantšeli 75. sünnipäeva tähistamisest Eestis - EMTA kammersaalis 11. novembril toimunud avalikust kohtumisest ja vestlusringist ning 12, novembril toimunud autoriõhtust Estonia kontserdisaalis, kus esines ERSO Andres MUstoneni dirigeerimisel

  17. Karzai sai vähem kui kolmandiku küsitud rahast / Evelyn Kaldoja

    Index Scriptorium Estoniae

    Kaldoja, Evelyn, 1980-

    2008-01-01

    Pariisis toimuval Afganistani doonorite konverentsil 50 miljardit dollarit lisaraha nõutanud president Hamid Karzai sai esialgu 14 miljardit dollarit. Välisminister Urmas Paet lubas oma sõnavõtus, et Eesti suurendab oma abi

  18. Kui igapäevast elu häirivad kõrvetised... / Selma Teesalu

    Index Scriptorium Estoniae

    Teesalu, Selma, 1930-

    2003-01-01

    Vt. ka Hiiumaa 1. märts, lk. 8, Meie Maa 8. märts, lk. 5, Lääne-Harju Ekspress 15. märts, lk. 6, Hiiu Leht 25. märts lk. 4. Kõrvetava tunde taga võib peituda haigus. Arsti poole pöördumise vajalikkuse üle otsustamiseks on lisaks küsimustik

  19. Selma Lagerlöf kui ülima õiguse eestkostja / Kärt Hellerma

    Index Scriptorium Estoniae

    Hellerma, Kärt, 1956-

    1998-01-01

    Arvustus: Lagerlöf, Selma. Portugali keiser; Surmakutsar; Liljecrona kodu / tlk. Tõnu Arnover. Tallinn : Eesti Raamat, 1998. (Nobeli laureaat). Ilmunud ka kogumikus: Hellerma, Kärt. Kohanenud kirjandus : valik kirjanduskriitikat 1987-2006. Eesti Keele Sihtasutus : Tallinn, 2006. Lk. 155-157, pealk. Ülima õiguse eestkostja

  20. Terror kui näitemäng meedias / Mart Raudsaar

    Index Scriptorium Estoniae

    Raudsaar, Mart, 1973-

    2005-01-01

    Terrorirünnakute iseloom on muutunud üha verisemaks ning see tendents jätkub. Terroristid ihalevad üha enam ülemaailmset rambivalgust. Teoreetikud arutavad, kas ja kuivõrd tuleks piirata terrorismi meediakajastust

  1. Tiina Gilli võluvad nii Ameerika kui ka Eesti / Maire Kõrvel

    Index Scriptorium Estoniae

    Kõrver, Maire, 1961-

    2009-01-01

    Fotograaf Tiina Gillist ja tema lennundusinstruktorist abikaasast James Frederick Gillist, kes elasid USA-s Seattle`is ning 2006. aastast elavad Märjamaa lähedal Rangu külas. James tegeleb maalimisega. Tiina on teinud looduse-, linna- ja lillepilte, vähem portreesid

  2. Põhja-Ameerika Eesti Päevad kui eestlaste esimene suurkogunemine / Kaire Tensuda

    Index Scriptorium Estoniae

    Tensuda, Kaire

    2007-01-01

    tagasivaade Robert Kreemi raamatu "Uus algus" ning Mai Kreemi mälestuste ja materjalide põhjal ESTOde eelkäijale, esimesele eestlaste suurüritusele Ameerika mandril - I Põhja-Ameerika Eesti Päevadele, mis toimusid 30. maist 2. juunini 1957. a. Torontos ja millest tänavu möödus 50. aastat. Robert Kreemi tegevusest ürituse peakomitee esimehe ja suurorganiseerijana. Ülevaade ka II, III, IV Põhja-Ameerika Eesti Päevadest ja Rootsi Eesti Päevadest 1968. a.

  3. Kui filminälg näpistab... / Margit Tõnson

    Index Scriptorium Estoniae

    Tõnson, Margit, 1978-

    2008-01-01

    Autor reastas kümme filmifestivali, mida tasub külastada. Ära on toodud "Armastus ja Anarhia", PÖFF, Venezia, Berlinale, Karlovy Vary, Cannes, Rotterdam, Amsterdam, Aasia ja Ameerika - (Goa, Pusan, Toronto, Sundance) lühitutvustused koos kodulehekülgede internetiaadressiga

  4. Omandiõiguse reserveerimise printsiip kui kaasaegne tagatis Euroopa tsiviilseadusandluses / Margus Kingisepp

    Index Scriptorium Estoniae

    Kingisepp, Margus, 1969-

    1996-01-01

    Omandiõiguse reserveerimine kaubandussuhete tagatisvahendina Saksa, Hollandi ja Inglise tsiviilõiguses. Ostja ja müüja õiguslik positsioon, omandiõiguse reserveerimine laiendatud alusel ja uute kaupade suhtes

  5. Ajalugu kui teater : pidamata jäänud loeng Juhan Viidingu teatritudengitele / David Vseviov

    Index Scriptorium Estoniae

    Vseviov, David, 1949-

    2009-01-01

    Ühiskonna hierarhiline ülesehitus ja sellega kaasnev soov sarnaneda tipus olijatega põhjustades matkimist soosib ju iseenesest teatrikunsti. Kohati on piir ajaloo ja teatri vahel peaaegu olematu. Kõige teatraalsemaks ajastuks peab autor absolutismi

  6. Raivo Vare : kui laseme noortel Eestist lahkuda, siis on see raiskamine / Raivo Vare ; interv. Jana Toom

    Index Scriptorium Estoniae

    Vare, Raivo, 1958-

    2008-01-01

    Ilmunud ka: Stolitsa 22. sept. 2008, lk. 6-7. Intervjuu ärimehe ja endise poliitiku ning Kodurahu foorumi moderaatori Raivo Varega, kes vastab küsimustele, mis puudutavad rahvussuhteid ja aprillisündmusi Eestis, Gruusia sündmusi

  7. Parem nägev poliitika kui pime turg / Jarmo Virmavirta

    Index Scriptorium Estoniae

    Virmavirta, Jarmo

    2008-01-01

    Autor küsib, kas kapitalism, turgude ülemvõim on 1990. aastate suure murrangu järel arenenud niiviisi, et turuvabadus on pöördunud iseenda vastu ja järeldab, et just uue Euroopa riikides on palju selliseid jooni, et demokraatia ja turumajanduse suhe on paigast ära

  8. Kui pidu on läbi / Kristi Grišakov

    Index Scriptorium Estoniae

    Grišakov, Kristi

    2009-01-01

    5. Euroopa maastikuarhitektuuri biennaalist Barcelonas, biennaali finalistidest, arhitektuuriajakirja 2G võistluse paremate tööde näitusest. Parkidest Parc Central de Poble Nou (arhitekt Jean Nouvel, 2008) ja Parc de Diagonal Mar (Enric Miralles, Benedetta Tagliabue, 2005) Barcelonas. Pingetest Barcelona arhitektuuri ja linnaplaneerimise küsimustes

  9. Kui ei maksa nüüd, maksad hiljem rohkem / Villu Zirnask

    Index Scriptorium Estoniae

    Zirnask, Villu, 1966-

    2008-01-01

    Autor toob kohe maksmise näitena Rootsi pankade päästmise 1990. aastate alguses ning hiljem maksmise näitena Jaapani, kus lasti hädas olevatel pankadel edasi toimetada. IMF-i analüütikute Luc Laeveni ja Fabian Valencia analüüsi põhjal on kohe maksmise variant üldiselt parem. Graafikud: Maailma finantskriisid 1970-2007. Lisa: Ei aastatki ilma kriisita

  10. Estraadi comeback. Ojasoo - Semperi "Nafta!" kui XXI sajandi estraadilavastus / Ott Karulin

    Index Scriptorium Estoniae

    Karulin, Ott, 1980-

    2006-01-01

    Estraadi sugemetega etendustest ja estraaditeatrist Eestis. Pikemalt peatutakse Ene-Liis Semperi ja Tiit Ojasoo lavastustel "Nafta", "No More Tears", "Julia" (aut. W. Shakespeare - T. Ojasoo) ja "Kuningas Ubu" (aut. A. Jarry)

  11. Kui avatud on Tallinna avalik ruum? = How public are Tallinn's public places? / Georgiana Varna, Kaur Sarv

    Index Scriptorium Estoniae

    Varna, Georgiana

    2012-01-01

    Eesti Kunstiakadeemia arhitektuuriteaduskonnas toimunud seminaril "From the ancient agora to Facebook - how public are public places?" osalenud tudengid analüüsisid Tallinna avaliku ruumi avalikkust, s.t. headust, kasutades Georgiana Varna "Avaliku ruumi mudelit". Hinnati Tammsaare parki, Rotermanni kvartali väljakut ja Raekoja platsi 26. jaanuaril 2012

  12. Kui toit teeb haigeks / Anu Viita-Neuhaus ; kommenteerib Maie Jürisson

    Index Scriptorium Estoniae

    Viita-Neuhaus, Anu

    2010-01-01

    Toidu talumatusest ja allergiast: allergeenid; millised allergia diagnoosimise teste kasutatakse; allergia ravi. Kommenteerib Tallinna Lastehaigla Kesklinna Lastepolikliiniku nahaarst ja Eesti Allergialiidu juhataja Maie Jürisson

  13. Ministri nõunik kui poliitilise missiooniga ametnik / Maria Keris, Jako Salla

    Index Scriptorium Estoniae

    Keris, Maria

    2006-01-01

    Ministri nõuniku roll ja positsioon Eesti avalikus teenistuses ja poliitikas. Kahes Eesti ministeeriumis 2005. aastal tehtud juhtumiuuringu analüüs. Ministri nõuniku roll ja staatus Eesti administratiivsüsteemis pole veel kinnistunud ning tõenäoliselt kujunebki sellest ametikoht, mille täitmine sõltub ühelt poolt vajadusest ja ministri soovidest ning teiselt poolt ministeeriumi töökorraldusest ja valdkonna spetsiifikast

  14. Mari Rahumägi kui särav piksevarras / Katri Soe

    Index Scriptorium Estoniae

    Soe, Katri

    2006-01-01

    Euroopa suurima postimüügi kontserni Karstadt-Quelle Eesti tütarfirma tegevjuhi karjäärist, oma äri alustamisest ja siirdumisest palgatööle. Kommenteerivad Jaanus Rahumägi, Helina Tuuna, Matthias Fink

  15. Raoul Kurvitz: moodne kunst peab olema sotsiaalsem kui iial varem / intervjueerinud Mart Niineste

    Index Scriptorium Estoniae

    Kurvitz, Raoul, 1961-

    2011-01-01

    3. veebruaril oma 50. sünnipäeva tähistanud kunstnik Raoul Kurvitz oma näituset "VOOL tööd" Kultuurikatlas, sooloplaadist, endast, oma loomingust, kaasaegsest kunstist, kunstniku vastutusest, noorte kunstnike õpetamisest, nende ettevalmistuse tasemest, loomemajandusest

  16. Ajakirjandus kui integratsiooni avalik foorum / Külliki Korts, Ragne Kõuts

    Index Scriptorium Estoniae

    Korts, Külliki

    2000-01-01

    Eestikeelses meedias on esikohal keele-, venekeelses õiguslik-poliitilised probleemid. Mõlemas meedias on sotsiaal-majandusliku integratsiooni kajastamine jäänud tahaplaanile. Tabelid. Ilmunud ka: Integration of Estonian Society : Monitoring 2000. - Tallinn ; Integratsija Estonskogo obshtshestva : monitoring 2000. - Tallinn

  17. Suveräänsus kui organiseeritud silmakirjalikkus / Stephen Krasner ; interv. Erkki Bahovski

    Index Scriptorium Estoniae

    Krasner, Stephen

    2007-01-01

    USA poliitikateadlane räägib suveräänsuse mõistest Euroopa Liidu ja Eesti-Vene suhete näiteil, külma sõja puhkemise võimalusest, maailma riikide poliitikast ja ÜRO reformimisest. Lisa: Krasner, Stephen. Vt. samas: Paindlik suveräänsus

  18. Kui saastad, siis maksad! / Margus Kört ; intervjueerinud Juhani Püttsepp

    Index Scriptorium Estoniae

    Kört, Margus

    2010-01-01

    Keskkonnauuringute keskuse juhatuse esimees vastab küsimustele, mis puudutavad Eesti õhu kvaliteeti, ettevõtete valmisolekut vähendada CO₂ heidet, keelustatud putukamürgi DDT jääkide leidumist, naftareostusi

  19. Sotsiaalne kunst kui kodanikuõigus ja -kohustus / Rael Artel, Elena Šmakova

    Index Scriptorium Estoniae

    Artel, Rael, 1980-

    2010-01-01

    Vastukaja: Siram. Kunst, mis ei räägi inimestega (Eesti Ekspress, 2010, 8. apr., lk. 32). Kuraator Rael Artel Kumu Kunstimuuseumis eksponeeritud näitusest "Räägime rahvuslusest! Ideoloogia ja identiteedi vahel", kaasaegse kunsti mõistmisest. Elena Šmakova Rael Arteli kureeritud näitusest ja Tallinna Kunstihoones avatud Kristina Normani isikunäitusest "Me ei ole universumis üksi", kaasaegse kunsti kohta ilmunud kriitilistest artiklitest

  20. "Kompromissitu naine. Kui õudne võiks see olla." / Jaanus Kulli

    Index Scriptorium Estoniae

    Kulli, Jaanus, 1955-

    2008-01-01

    Eesti tuntuima bluusiansambli Compromise Blue kahekümnest tegevusaastast räägib ansambli juht ja laulja Emil Rutiku. Vt. samas: President Ilves on Compromise Blue suur fänn. Emil Rutiku sõnul on ansamblil olnud au musitseerida kolm korda laval ka koos Toomas Hendrik Ilvesega

  1. "Kui Teile minu kirjutis meeldis, siis levitage, kuidas heaks arvate..." / Peeter Kaasik

    Index Scriptorium Estoniae

    Kaasik, Peeter, 1974-

    2013-01-01

    Nõukogude perioodil ajalehetoimetustele saadetud kirjadest liigitus osa dissidentlikeks, kuid samas oli ka kirju, mis ei liigitunud dissidentlikeks, kuid oma olemuselt olid ikkagi "nõukogudevastased". Dokumenditekstidena avaldatakse 1983. aastal ajalehele "Edasi" saadetud värvikas stiilis saadetud kirjad.

  2. Kui raha on vaja, lendab ideoloogia prügikasti / Villu Zirnask

    Index Scriptorium Estoniae

    Zirnask, Villu, 1966-

    2009-01-01

    KPMG 2009. aasta maailma maksuülevaatest. Eesti käibemaksumäär on peaaegu võrdne EL-i keskmisega, kaudsete maksude suhtelt SKT-sse on Eesti samuti EL-i keskmisel tasemel. EL-i keskmisest kõrgem on Eestis aktsiisimaks. EL-is rakendatavatest pisimaksudest. Tabelid, diagrammid, graafikud

  3. Wikipedia : sama täpne kui päris teatmeteos / Aivar Õepa

    Index Scriptorium Estoniae

    Õepa, Aivar, 1967-

    2005-01-01

    2001. aastal asutatud Wikipedia (www.wikipedia.org) on vabatahtlike tööl põhinev interneti-teatmeteos. Wikipediat ja Encyclopedia Britannicat võrrelnud teadlased leidsid, et veebientsüklopeedia ei jää täpsuses EB-le alla

  4. Enam kui pool eestlastest peab Rüütli otsust õigeks

    Index Scriptorium Estoniae

    2005-01-01

    President Arnold Rüütli otsust mitte sõita 9. mail Moskvasse peab õigeks 61 protsensti eestlastest ja kõigest 6,1 protsensti mitteeestlastest. Kommentaarid Tartu Ülikooli politoloogiaosakonna teadurilt Vello Pettai'lt ja sotsioloog Andrus Saar'elt

  5. Kogemus kui ajalugu / David Carr ; inglise keelest tõlkinud Triinu Pakk ; toimetanud Tõnu Viik

    Index Scriptorium Estoniae

    Carr, David, 1940-

    2012-01-01

    Representatsioon, mälu, kogemus. Ajalisus. Intentsionaalsus ja loomuliku hoiaku maailm. Inimmaailm ja ajalooline maailm. Sotsiaalne aeg ning laiendatud minevik ja tulevik. Osalus ja liikmelisus. Ajaloolisus. Ajaloolisus ja ajalooline teadmine. Teaduse ajaloolisus. Ajaloo metafüüsika ja epistemoloogia.

  6. Jooksevkonto defitsiit kui Eesti jätkusuutliku majandusarengu takistaja / Tiia Vissak

    Index Scriptorium Estoniae

    Vissak, Tiia, 1975-

    2004-01-01

    Jookevkonto puudujäägi ja jätkusuutlikkuse vahelistest seostest, Eesti jooksevkonto analüüs ja soovitusi selle defitsiidi vähendamiseks. Skeemid. Graafikud. Tabel: Jooksevkonto defitsiidi mõjutajad

  7. Saksamaal kõlas nii klassika kui "juhtmemuusika" / Aino Siebert ; fotod: Werner Siebert

    Index Scriptorium Estoniae

    Siebert, Aino

    2008-01-01

    Mainzi Maakonnamuuseumis avatud Gottlieb Welté näituse "Lihvimata geniaalsus" raames toimunud Eesti päevast 30. märtsil. Karlsruhe ZKMis (Kunsti- ja Meediatehnoloogia keskus) avatud festivalist Performance-Art - kaasaegne tants ja uued meediad. Festival leiab aset Baden-Württembergi liidumaal toimuvate kultuuriürituste raames

  8. Jaekaubandus kui kullaauk / Ülle Kollo, Vello Rääk

    Index Scriptorium Estoniae

    Kollo, Ülle

    2003-01-01

    Autorid kirjeldavad seitset olulisemat tõenäolist arengusuunda Eesti jaekaubanduses, tuues välja erinevad tendentsid ja aspektid, millega jaekaubandusega seotud ettevõtjad peaksid tulevikus strateegiliste plaanide tegemisel arvestama. Diagrammid

  9. Detsibill : Meie Mees kui ANTI. White Label : Don Erikson. Kuula / DJ Pickney Tiger

    Index Scriptorium Estoniae

    DJ Pickney Tiger, pseud., 1970-

    2006-01-01

    Heliplaatidest: Don Erikson "Israel Mix", Congotronics 2 "Buzz'n'rumble from the urb'n'jungle", Critikal "Chapter One ehk Teine maitse", Nirvana "Silver, The best of the Box", Singer Vinger "Eesti Kullafond", Bullet Train To Vegas "We Put Scissors Where Our Mouths Are", Ludachris "Disturbing tha peace", "Soul Satisfaction 5", The Kurt Webber's Pink Band "Café Regatt", Patrizio Buanne "The Italian", Eminem "Curtain Call"

  10. Kui tulusid ei ole võimalik suurendada, tuleb piirata kulutamist / Eugen Veges

    Index Scriptorium Estoniae

    Veges, Eugen, 1955-

    2008-01-01

    Ilmunud ka: Lääne Elu 17. mai lk. 2, Põhjarannik, Severnoje Poberezhje 22. mai lk. 4, Kuulutaja 30. mai lk. 4, Meie Maa 31. mai lk. 2, Vooremaa 3. juuni lk. 2, Järva Teataja 5. juuni lk. 2. Eesti ettevõtjail on ees raske aeg, ettevõtete tulusus langeb. Autori sõnul tuleb riigi tulubaasi suurendamiseks kehtestada uusi makse või suurendada seniseid maksulaekumisi. Haldusreform on möödapääsmatu

  11. Biomass ja põllumajandustootmise jäätmed kui energiaallikad / Raivo Sihver

    Index Scriptorium Estoniae

    Sihver, Raivo

    2005-01-01

    Tallinnas toimus rahvusvaheline Läänemere maade bioenergeetikaalane konverents, kus arutleti põllumajanduslikult kultiveeritavate energiaallikate ning põllumajandustootmise jäätmetest saadava energia üle. Kohal viibisid ka Euroopa Komisjoni ja ÜRO Toidu- ja Põllumajanduse Organisatsiooni (FAO) esindajad

  12. Legend juba eluajal : kui muidu ei saa, siis Simon Levin ikka aitab / Kärt Anvelt

    Index Scriptorium Estoniae

    Anvelt, Kärt, 1973-

    2008-01-01

    Järelehüüe ning vandeadvokaat Monika Mägi ja Harju maakohtu esimehe Helve Särgava meenutused 2. jaanuaril 2008 surnud Simon Levinile. Lisatud elulugu: Simon Levin advokaat ja õigusteadlane ; katkend intervjuust EPL, 16. august 2005: kuidas kõik algas

  13. Lätis on makse maksta lihtsam ja odavam kui Eestis

    Index Scriptorium Estoniae

    2007-01-01

    Ilmunud ka: Finansovõi Menedzhment : infovõpusk nr. 19 nov. lk. 14-15. Maailmapanga raporti Doing Business 2008 riikide edetabel maksude maksmise lihtsuse järgi. Lisad: Eesti on ärikeskkonna üldarvestuses 17. kohal; Maailma parimad riigid maksude maksmise lihtsuse ja maksukoormuse poolest

  14. Büroohoone kui elus mäng / Urmas Oja

    Index Scriptorium Estoniae

    Oja, Urmas, 1981-2012

    2005-01-01

    Arvutimämgust inspireeritud Martin Aunini projekteeritud büroohoonest Tetris Tallinnas Mustamäel Mustamäe tee 46. 2005. a. valminud hoone fassaadid teeb eriliseks lasuurvärvidega rohe-kollaseks värvitud betoon. Projekteerija: EA Reng. Konstruktor: IB Pike. Infograafika: Andres Rohtla. Kommenteerivad M. Aunin ja Värvistuudio Parem Sein juhataja Margus Pootsmaa

  15. Kui hea pressifoto on hea kunst = Good press photography as good art / Anneli Porri

    Index Scriptorium Estoniae

    Porri, Anneli, 1980-

    2012-01-01

    Pressifoto ja kaasaegse kunsti seostest, pressifotost ja fotokunstist. Erik Prozese fotost "Minister, anna aru!" ja fotoseeriast "Eesti portreed taldrikutel", Andres Puttingu fotoseeriast "Suusakuninga tõehetk", Andres Haabu fotost "Lahing pooltühjas kinosaalis"

  16. Tiit Land: kui saaks Tallinnast Võrru kolme tunni asemel kahega / intervjueerinud Andres Kalvik

    Index Scriptorium Estoniae

    Land, Tiit, 1964-

    2016-01-01

    Intervjuu Tallinna ülikooli rektori valimised võitnud Tiit Landiga. Ülikoolis algatatud reformidest, välistudengitest ülikoolis, väljalangevusest, ülikoolide koostööst ühiste õppekavade osas. Ka Tiit Landi erialast biokeemiast

  17. Biohäkkimine : mikrobioloogia kui kunstimeedium, ehk, Küberkoodist biokoodini / Tiia Johannson

    Index Scriptorium Estoniae

    Johannson, Tiia, 1965-2002

    2001-01-01

    Uus kunstnike kommuun üritab loodust üle kavaldada, kasutades molekulaarbioloogiat uut tüüpi interaktiivse kunsti loomiseks: Eduardo Kac'i jäneseprojekt "GFP Bunny" ja transgeneetiline netiinstallatsioon "Genesis"

  18. Kui palju töötaja töösse panustab? / Urve Vilk

    Index Scriptorium Estoniae

    Vilk, Urve

    2008-01-01

    Tartu Juhtimiskonverentsil ütles London Business Scooli programmidirektor Andrew Mayo, et uuringute järgi kasutab töötaja igapäevatöös ainult 40% oma võimetest. Sampo Panga juht Aivar Rehe arvab, et töötajad panustavad umbes 75 protsendi ulatuses

  19. Raamatututvustus: lugemine kui mäng / Külliki Kask

    Index Scriptorium Estoniae

    Kask, Külliki, 1949-

    2009-01-01

    Tutvustus: Eco, Umberto. Kuus jalutuskäiku kirjandusmetsades / inglise keelest tõlkinud Ene-Reet Soovik. Tallinn : Varrak, 2009 ; Martin, George R. R. Windhaven / tõlkinud Jaana Talja. [Tartu] : Fantaasia, c2009

  20. Eesti keele kui teise keele kirjutamisprotsessi sujuvuse võrdlus keeleoskustasemeti

    Directory of Open Access Journals (Sweden)

    Olga Pastuhhova

    2017-05-01

    Full Text Available "Comparison of fluency across proficiency levels in the writing process of native Russian-speaking learners of Estonian as a second language" The aim of the current article is to describe fluency across proficiency levels in the writing process of native Russian-speaking learners of Estonian as a second language. The data of the study consist of texts written by 34 participants, all of whom were students at Tallinn University. The data were collected with the computer keystroke logging program ScriptLog. The written argumentative and narrative texts were rated by two experts according to the Common European Framework of Reference for Languages (CEFR. The data were representative of four CEFR language proficiency levels: A2 (4 texts, B1 (13, B2 (13, and C1 (4. Fluency was analysed and described according to process, product, revision, pausing behaviour, and keyboard skills. Furthermore, the fluency of the writing process was measured on the basis of online and offline measures. The results of the study were compared across the proficiency levels. The fluency of the writing process increases with growth in proficiency, the greatest development being observed between levels B2 and C1. Artikli eesmärk on uurida venekeelsete eesti keele õppijate kirjutamisprotsessi sujuvust ja selle seost “Euroopa keeleõppe raamdokumendi” A2-, B1-, B2- ja C1- keeleoskustasemega. Uurimuses osales 34 venekeelset üliõpilast, kellel paluti kirjutada loovkirjutis haridusteemal. Materjal on kogutud klaviatuuri klahvivajutuste salvestuse meetodil põhineva ScriptLog-programmiga. Sujuvust analüüsitakse kirjutamisprotsessi, lõpliku teksti, paranduste, pauside ning klaviatuuri kasutamisoskuse seisukohast. Lisaks on sujuvus arvutatud vastavalt protsessi ja produkti indikaatoritele. Uurimuse tulemusi võrreldakse keeleoskustasemeti. Tulemused osutavad, et teksti produtseerimine muutub keeleoskuse arenedes sujuvamaks, suurim areng on märgatav B2- ja C1-taseme vahel.

  1. Tartu Pauluse kirik - made in Finland. Taastatud eksklusiivsemalt kui algupäraselt ehitatud / Egle Tamm

    Index Scriptorium Estoniae

    Tamm, Egle, 1969-

    2016-01-01

    Eliel Saarinen kavandatud Tartu Pauluse kiriku renoveerimisest. 2006. aastal korraldatud konkursi võitsid soome arhitektid Merja Nieminen ja Kari Järvinen. Renoveerimisel kujunes keskseks Saarineni vaimu ja vormikeele tabamine

  2. Keha, ikka see keha, kuid kui palju tähendusi / Reet Varblane

    Index Scriptorium Estoniae

    Varblane, Reet, 1952-

    1999-01-01

    Ameerika feministliku kunsti esindaja Hannah Wilke retrospektiiv Helsingi Tennispalatsis 17. okt.-ni. Marina Abramovici fluxuslikult sahtlitesse paigutatud eksponeerimisviisiga ruumiinstallatsioon "Cleaning the House" Kiasmas 7. novembrini

  3. Kui punane oli Arnold Rüütli punaminevik / Toomas Kümmel

    Index Scriptorium Estoniae

    Kümmel, Toomas

    2001-01-01

    EKP tippjuhtkonda kuulunud peatselt presidendi ametisse astuva Arnold Rüütli punaminevikust. Samas: Arnold Rüütli stiilinäiteid: 1987. a. avaldatud mõtted Eesti ajaloost ja 1989. a. eesti keelest

  4. Leigo tulevärk võimsam kui varem / Christel Karits

    Index Scriptorium Estoniae

    Karits, Christel, 1966-

    2005-01-01

    Leigo Järvemuusika 2005 üritustest Leigo vanal järvel: Tallinna rahvusvahelise orelifestivali avakontsert 30. juulil (Veljo Tormise 75. juubeli tähistamine), rockkontsert "Suurte masinate muusika II" 6. aug., Põhjamaade Sümfooniaorkestri kontsert 13. augustil

  5. Muutuvintressi arvestamine krediidilepingutes, kui baasintressimäär on muutunud negatiivseks / Anni Haas

    Index Scriptorium Estoniae

    Haas, Anni

    2016-01-01

    Krediidilepingutest, milles intressimäär moodustub baasintressimäära ja intressimarginaali summast. Intressimakse negatiivse väärtuse tähendusest laenuandja ja laenusaaja suhte jaoks. Intressiarvestusest lepingu tõlgendamisel

  6. Kui päevapiltnikud Pärnusse jõudsid / Vello Paatsi

    Index Scriptorium Estoniae

    Paatsi, Vello, 1948-2015

    2016-01-01

    Dagerrotüpist Carl Borchardt töötas Pärnus 1844. a. Fotograafide Friedrich Wilhelm Louis Seidlitzi, Theodor Johni, Wilhelm Carl Paul Lanzi jt tegevusest Pärnus. Pärnu linnavaadete albumist (1866)

  7. Kui päevapiltnikud Pärnusse jõudsid / Vello Paatsi

    Index Scriptorium Estoniae

    Paatsi, Vello, 1948-2015

    2012-01-01

    Praegu teadaolevalt jõudis Pärnusse esimese fotograafina dagerrotüpist Carl Borchardt. Carl Borchardti'le järgnenud fotograafidest Pärnus. Friedrich Wilhelm Louis Seidlitzist ja tema 1866. aastal avaldatud Pärnu linnavaadete albumist. 1868. aastal ilmus Seidlitzile konkurent Theodor John. Seidlitz nimetas end fotograafiks kuni 1870. aastani. Edaspidi tunti Pärnus üksnes samanimelist pudukaupmeest. Theodor John lahkus Pärnust 1870. aastal. Samal aastal asus Pärnusse fotograaf Wilhelm Carl Paul Lanz

  8. Skypega saab sügisest helistada sama lihtsalt kui tavatelefoniga / Henrik Roonemaa

    Index Scriptorium Estoniae

    Roonemaa, Henrik

    2004-01-01

    Eesti programmeerijate abiga loodud tasuta helistamist võimaldavast internetitelefonist Skype, mille tarbeks toob Siemens müügile spetsiaalse juhtmeta lauatelefoni koos arvuti külge käiva adapteriga

  9. Kui sa oled mind sellisena loonud : [Patrick Shanley filmi "Kahtlus" arvustus] / Miina Piir

    Index Scriptorium Estoniae

    Piir, Miina

    2009-01-01

    Filmis "Kahtlus" puutume kokku igavese teemaga - katoliku preestrid ja kooripoisid. Katoliku preestrit homoseksuaalsuses kahtlustada on ülimalt lihtne, sest ordineeritakse reeglina vallalisi mehi, kes elavad tsölibaadis

  10. Klassitsismist kui stiilimõistest kujutavas kunstis / Kadi Polli ; tõlk. Hanna Miller

    Index Scriptorium Estoniae

    Polli, Kadi, 1973-

    2008-01-01

    Polemiseeritakse stiilimõiste "klassitsism" kasutamise üle 18.-19. sajandi vahetusel kunsti üldnimetajana ja käsitletakse Balti maastikumaali G.F. Kügelgeni, K.F. Kügelgeni, C. Grassi, K.A. Senffi jt. tööde näitel, mis vastavad küll selle perioodi valgustuslikule mõttele, kuid ei küüni stiiliajaloo klassitsismi kõrgete ideaalideni. Samas nõuaks mõiste täpsustamist ja hinnangu andmiseks uut lähenemist ning ümberväärtustamist

  11. Ekspert : valimised olid kui mikroskoobi all / Levan Ramishvili ; interv. Raigo Pajula, Igor Taro

    Index Scriptorium Estoniae

    Ramishvili, Levan

    2008-01-01

    Gruusia valitsusvälise organisatsiooni Liberty Institute direktor vastab küsimustele, mis puudutavad Gruusia presidendivalimiste tulemusi ja võltsimiskahtlusi, opositsiooni nõudmist keskvalimiskomisjoni esimehe tagasiastumise kohta, konkreetsete asitõendite avalikustamist Badri Patarkatsishvili riigipöördekavatsuste kohta. Vt. samas: Opositsioon loobus miitingutest

  12. Esteetilis-praktiline töö kui eriõppe alternatiiv / Uffe Bjerre

    Index Scriptorium Estoniae

    Bjerre, Uffe

    2005-01-01

    Milleks tuupida lapsele pähe seda, millega ta hakkama ei saa, selle asemel et arendada õpilase tugevaid külgi? Samas ka koolipsühholoogide, eripedagoogide Tove Hvidi ja Howard Gardneri väited eriõpet vajavate laste kohta

  13. Linn kui maastik / Eva Castro ; intervjueerinud Katrin Koov ; toimetanud Carl-Dag Lige

    Index Scriptorium Estoniae

    Castro, Eva

    2011-01-01

    Intervjuus Tallinna arhitektuuribiennaali ühe peaesineja Eva Castroga, kes on AB Groundlab arhitekt ja juhib Londoni Arhitektuuriühingu arhitektuurikoolis maastikuurbanismi magistriprogrammi, maastikuurbanismist ja selle õppekavast, Groundlabi projektide ja Londoni Arhitektuuriühingu arhitektuurikooli tudengite tööde näitusest Eesti Arhitektuurimuuseumis, visioonivõistlusest "Street 2020"

  14. Kui pank lubab korraldada ettevõttele finantseerimise nädalaga, finantseerib ta liiga kallilt

    Index Scriptorium Estoniae

    2007-01-01

    Ilmunud ka: Finansovõi Menedzhment : infovõpusk nr. 16 juuli lk. 5. Tsentraalse varade osakonna loomisest Islandi päritolu ülemaailmsesse farmaatsiafirmasse Actavis. Tabel: Actavis: tormiliselt laienev farmaatsiafirma

  15. Computational Thermodynamics of Materials Zi-Kui Liu and Yi Wang

    Energy Technology Data Exchange (ETDEWEB)

    Devanathan, Ram

    2017-02-01

    This authoritative volume introduces the reader to computational thermodynamics and the use of this approach to the design of material properties by tailoring the chemical composition. The text covers applications of this approach, introduces the relevant computational codes, and offers exercises at the end of each chapter. The book has nine chapters and two appendices that provide background material on computer codes. Chapter 1 covers the first and second laws of thermodynamics, introduces the spinodal as the limit of stability, and presents the Gibbs-Duhem equation. Chapter 2 focuses on the Gibbs energy function. Starting with a homogeneous system with a single phase, the authors proceed to phases with variable compositions, and polymer blends. The discussion includes the contributions of external electric and magnetic fields to the Gibbs energy. Chapter 3 deals with phase equilibria in heterogeneous systems, the Gibbs phase rule, and phase diagrams. Chapter 4 briefly covers experimental measurements of thermodynamic properties used as input for thermodynamic modeling by Calculation of Phase Diagrams (CALPHAD). Chapter 5 discusses the use of density functional theory to obtain thermochemical data and fill gaps where experimental data is missing. The reader is introduced to the Vienna Ab Initio Simulation Package (VASP) for density functional theory and the YPHON code for phonon calculations. Chapter 6 introduces the modeling of Gibbs energy of phases with the CALPHAD method. Chapter 7 deals with chemical reactions and the Ellingham diagram for metal-oxide systems and presents the calculation of the maximum reaction rate from equilibrium thermodynamics. Chapter 8 is devoted to electrochemical reactions and Pourbaix diagrams with application examples. Chapter 9 concludes this volume with the application of a model of multiple microstates to Ce and Fe3Pt. CALPHAD modeling is briefly discussed in the context of genomics of materials. The book introduces basic thermodynamic concepts clearly and directs readers to appropriate references for advanced concepts and details of software implementation. The list of references is quite comprehensive. The authors make liberal use of diagrams to illustrate key concepts. The two Appendices at the end discuss software requirements and the file structure, and present templates for special quasi-random structures. There is also a link to download pre-compiled binary files of the YPHON code for Linux or Microsoft Windows systems. The exercises at the end of the chapters assume that the reader has access to VASP, which is not freeware. Readers without access to this code can work on a limited number of exercises. However, results from other first principles codes can be organized in the YPHON format as explained in the Appendix. This book will serve as an excellent reference on computational thermodynamics and the exercises provided at the end of each chapter make it valuable as a graduate level textbook. Reviewer: Ram Devanathan is Acting Director of Earth Systems Science Division, Pacific Northwest National Laboratory, USA.

  16. Küberrünnakuid tehti nii Lapimaalt kui Iisraelist / Risto Berendson

    Index Scriptorium Estoniae

    Berendson, Risto, 1975-

    2007-01-01

    Riigi Infosüsteemide Arenduskeskuse osakonnajuhataja Hillar Aarelaid rääkis küberkaitset puudutaval seminaril maikuus Eestit põhiliselt Venemaalt tabanud küberrünnakute tõrjumisest, kus aitasid kaasa ka parajasti Viru hotellis konverentsi pidanud 200 välismaist IT-spetsialisti. Rahvusvahelise firma Cisco esindaja, arvutiturbe tippspetsialisti Ivica Ostojici esinemisest. Vt. samas: Häkkimine kahe sekundiga

  17. Korterelamu renoveerimine laenu abil ei tule kallim kui raha kogudes / Mirja Adler

    Index Scriptorium Estoniae

    Adler, Mirja

    2004-01-01

    Ilmunud ka: Severnoje Poberezhje, 28. sept. 2004, lk. 5. KredEx'i eluaseme valdkonna juht tutvustab laenu võtmist korterelamu renoveerimiseks. Lisa: Laen või kogumine?; Finantseerimine laenu ja käendusega

  18. Kui Liisa kirjutas kirja... / Ulrike Plath, Kaarel Vanamölder

    Index Scriptorium Estoniae

    Plath, Ulrike, 1972-

    2016-01-01

    Liisa Pulsti elusaatusest, maakogukonnast pärit vallasemast, kes andis oma kolm last lastekodusse ning kes hiljem Riia baltisaksa perekonnas muutus armastatud perekonnaliikmeks. Artikkel tutvustab Liisa poolt 1946. aastal kirjutatud kirja

  19. Tänavu sünnib ligi 300 last rohkem kui mullu / Mirko Ojakivi

    Index Scriptorium Estoniae

    Ojakivi, Mirko

    2005-01-01

    Demograafilistest protsessidest Eestis lõppeval aastal. TÜ inimgeograafia õppetooli vanemteaduri Tiit Tammaru prognoose lähitulevikuks. Lisa: Rummo rõõmustab edasimineku üle. Graafik: Ligi 300 last enam

  20. Imevaip kui majanduse šanss / Sulev Oll ; kommenteerinud Ants Reinumägi

    Index Scriptorium Estoniae

    Oll, Sulev, 1964-

    2010-01-01

    Ekspordiks tootvad Eesti ettevõtted on uuel tõuslainel - teenivad kasumit ja värbavad uusi töötajaid. Vaibatootja Narma LV, metallkonstruktsioonide valmistaja OÜ Contractor, elektrimootorite komponentide tootja AS Kolmeks

  1. Mida teevad mõtted, kui nad "mõlguvad"? / Ene Vainik

    Index Scriptorium Estoniae

    Vainik, Ene, 1964-

    2013-01-01

    Kognitiivsest semantikast, eriti kehapõhisuse teooriast lähtudes, uuritakse, milline kehaline kogemus on motiveerinud sõna "mõlkuma" kasutuselevõtmist perioodilisi mõtteprotsesse tähistava verbina

  2. Kui Hollywood võitleb Ameerika võimudega / Ilmar Raag

    Index Scriptorium Estoniae

    Raag, Ilmar, 1968-

    2007-01-01

    2.-9. veebr. on kinos "Sõprus" ja 11.-15. veebr. Tartu Sadamateatris 5. kultusfilmide festival Manifest, seekord USA filmid ja teemaks sõnavabadus. Võitlusest viimase eest Manifesti filmiprogrammi filmides. Lisatud festivali filmide nimekiri

  3. Classrooms in the Wild: Learning Language and Life Skills in the KUIS Outdoor Sports Circle.

    Science.gov (United States)

    Wurr, Adrian

    The role of outdoor education activities in the Kanda University English language institute is described. The outdoor program was developed to unite faculty and students interested in recreational activities and provide an opportunity to explore common interests in nature, sports, and language learning. The activities develop self-esteem,…

  4. Urmas Tartes: Hea fotoga parandab maailma rohkem kui poliitikaga / Urmas Tartes ; usutles Helen Arusoo

    Index Scriptorium Estoniae

    Tartes, Urmas, 1963-

    2009-01-01

    Kõigi loendamatute fotokonkursside absoluutsesse tippu kuuluva Veolia Enviroment Wildlife Photographer of the Year 2009. aasta üks võitja Urmas Tartes räägib, miks suurtel fotovõistlustel ei ole juhuslikke võite

  5. Tekstisisesed seosed eesti keele kui teise keele lugemistestis: mõõtmisvahendi valiidsus

    Directory of Open Access Journals (Sweden)

    Tiina Kikerpill

    2013-10-01

    Full Text Available Teksti mõistmine on keerukas protsess olenemata sellest, kas tegu on emakeeles või võõrkeeles lugemisega, sest see kätkeb endas samaaegset sõnade tuvastamist, tekstiga väljendatud otsese tähenduse tuletamist ja lugeja taustteadmiste abil teksti tõlgendamist. Üheks teksti mõistmise aspektiks on oskus ära tunda tekstis sisalduvaid sisulis-loogilisi ja leksikaalseid seoseid. Seega peaks lugemisoskuse arendamisel ja mõõtmisel pöörama tähelepanu ka tekstisisestele seostele. Võõrkeele lugemistestides kasutatakse nende seoste mõistmise kontrollimiseks erinevaid ülesandetüüpe, kuid nende tõhusust on vähe uuritud. Artiklis analüüsitakse kolme ülesandetüüpi – tekstilõikude järjestamist ning lausete ja tekstilõikude sobitamist lünkadesse. Keskendutakse nende valiidsusele, otsides vastust küsimustele, mil määral sõltub ülesannete edukas sooritamine tekstisiseste seoste mõistmisest ning missugune on ülesandetüübi mõju tekstisiseste seoste kasutamisele ülesande soorituses.

  6. Luulesõit kui bänditegemine : [reisikiri] / Igor Kotjuh

    Index Scriptorium Estoniae

    Kotjuh, Igor, 1978-

    2011-01-01

    Neli luuletajat, kes kirjutavad oma riigi vähemuskeeles, Rootsist saamikeelne Rose-Marie Huuva, Soomest rootsikeelne Agneta Enckell, Lätist liivikeelne Valts Ernštreits ja Eestist Igor Kotjuh tegid kirjandusliku tuuri viies linnas: Helsingis, Visbys, Stockholmis, Tallinnas ja Liepajas

  7. Pädaste mõis pakub nii uut kui vana! / Aale Kask

    Index Scriptorium Estoniae

    Kask, Aale

    2008-01-01

    Renoveeritud Pädaste mõisa peahoonest (1875). Omanikud Imre Sooäär ja Martin Breuer. Mõisaansambli restaureerimine toimus aastail 1996-2008. Restaureerimisarhitekt Katrin Etverk. Sisearhitektuur: Imre Sooäär, Kärt Kukkur. Restoranisaal kasvab üle talveaiaks. Kärt Kukkuri, Katrin Etverki ja Ülle Grishakovi kommentaarid. Värv. välisvaade, 14 sisevaadet

  8. Välis- ja kodueesti kunst kui tervik : sõnum Torontost / Mai Levin

    Index Scriptorium Estoniae

    Levin, Mai, 1942-

    2003-01-01

    30. X Tartu Kunstimajas Osvald Timmase näitusel kunstniku loomingule pühendatud õhtust, kus esinesid Mai Levin ja kunstniku vend Evald Timmas, näidati slaide ning Ain Habichti tehtud koduvideosid O. Timmasest ja Abel Leest. A. Lee ja O. Timmas on olnud 1952. a. Torontos loodud Colour and Form Society presidendid. Väliseesti kunsti tuleks käsitleda koos kodueesti kunstiga

  9. Kes teid toidab, kui olete üle 60? / Krister Paris

    Index Scriptorium Estoniae

    Paris, Krister, 1977-

    2004-01-01

    Euroopa elanikkond võib vaatamata sellele, et inimesed elavad kauem, aastaks 2050 väheneda praeguselt 455 miljonilt 430 miljonile. Paindlik pensionileminek aitaks tõrjuda vanurite sotsiaalset marginaliseerumist, anda üle aastakümnetepikkusi kogemusi ning valmistada ettevõtteid ette põlvkondade vahetuseks. Lisad: Pensionäride ülalpidamine kallineb; Elatustase; Vanadus; Mitte ainult raha...

  10. Sugu kui kvalifitseerija - naised ametikandjatena kirikus ja kaitseväes / Kalmer Marimaa

    Index Scriptorium Estoniae

    Marimaa, Kalmer

    2013-01-01

    Artiklis antakse ülevaade naisjuhtidest ja naiste ordineerimisest kristluses, naiste osalusest relvajõududes ning võrreldakse sarnaseid tendentse, mis võivad kaasneda naiste teenimisega juhtivates ametites kirikus ja kaitseväes

  11. Aapo Puki fantastiline menu nii idas kui läänes / Ivo Parbus

    Index Scriptorium Estoniae

    Parbus, Ivo, 1959-

    2004-01-01

    New Yorgi kunstikeskus Art Renewal Center valis 2003. a. konkursil auhinna Honorable Mention laureaadiks Aapo Puki õlimaaliga "Natalja Sigarimajas". Suurbritannia Kuninglik Portreemaalijate Ühing eksponeerib maali oma aastanäitusel

  12. "Külvaja" kui maaelu "Oscar" / Silja Lättemäe

    Index Scriptorium Estoniae

    Lättemäe, Silja, 1952-

    2006-01-01

    Ferdi Sannamehe 1927. a. valminud pronksskulptuuri "Külvaja" vähendatud koopiast, mis antakse Aasta Põllumehe konkursi võitjale esmakordselt 2006. a. Koopia modelleerija Tiiu Kirsipuu. Theodor Poolile 1928. a. kingitud originaalkujul tekst " Riigivanemalt parimale talumajapidamisele Eestis"

  13. James Joyce kui religiooni subjekt ja objekt / Kalle Käsper

    Index Scriptorium Estoniae

    Käsper, Kalle, 1952-

    2003-01-01

    Arvustus: Joyce, James. Dublinlased : [novellid] / inglise keelest tõlkinud Jaak Rähesoo. 2. tr. [Tallinn] : Varrak, 2003 ; Joyce, James. Kunstniku noorpõlveportree : [romaan] / inglise keelest tõlkinud [ja järelsõna:] Jaak Rähesoo. [Tallinn] : Varrak, 2003; vt ka vastukaja: Raudam, Toomas. Kontra Käsper // Sirp (2003) 20. juuni, lk. 5

  14. Kui otsime rahu, ei tohi karta tõe otsimist / Philippe Jourdan

    Index Scriptorium Estoniae

    Jourdan, Philippe, 1960-

    2009-01-01

    Autor selgitab paavst Benedictus XVI otsust tühistada nelja piiskopi ekskommunikatsioon. Prantsuse katoliku piiskopist Marcel Lefebvre'st, kelle allumatus Vatikanile 1970. aastate alguses viis tema teenistuskeelu alla panemiseni ja Püha Pius X vennaskonna moodustamiseni

  15. Charms - Kudu - Heinsaar kui sibul - kala - munaroog / Jüri Ehlvest

    Index Scriptorium Estoniae

    Ehlvest, Jüri, 1967-2006

    2005-01-01

    K. Kudust ja tema kolmest lavastusest Tartu Üliõpilasteatri esituses : M. Heinsaar-D. Charms-L. Carroll "Artur ja Paul ehk veidi enne maailma loomist", M. Heinsaar-D. Charms "Joogem äädikat, härrased!" ja D. Charmsi "Jelizaveta Bam"

  16. Kui palju tuleb juhitöös tegeleda "pean" ja "tahan" tegevustega?

    Index Scriptorium Estoniae

    2003-01-01

    Vastavad Fontes Grupi Nõukogu esimees Tõnis Arro, Aeroc AS-i juhatuse esimees Ivar Paplavskis, Eesti Ehitusettevõtjate Liidu tegevdirektor Tarmo Lige, American Toursi tegevdirektor Anu Eha ja Esmofoni juhatuse esimees Aivar Sirelpuu

  17. Rohkem kui 300 aastat tagasi surnud pere õnnestus tuvastada / Mati Mandel ; Kalev Jaago

    Index Scriptorium Estoniae

    Mandel, Mati, 1945-

    2016-01-01

    Peanse külas Lihula vallas toimunud kaevamistest. Leiti nelja inimese luustikud. Leiumaterjal võimaldas võrrelda ja kokku viia arheoloogi, numismaatiku, atropoloogi ja arhivaari uurimistulemusi. Suure tõenäosusega võisid leitud maetud olla Leti Andrese Mihkel, tema abikaasa ning lapsed Heinrich ja Ann. Tegu võib olla 1710.- 1711. aasta katku ohvritega. Haruldase juhtumina saab luid seostada konkreetsete ajalooliste isikutega

  18. Pärnu fideofest kui maailma köök / Marian Kivila

    Index Scriptorium Estoniae

    Kivila, Marian, 1985-

    2011-01-01

    9.-13. augustini toimunud Pärnu filmi- ja videofestivalist Pärnu Kunstnike Majas, kaubanduskeskuses Port Artur 2 ja "Like-Kuldrula" rulafestivalil. Rahvusvahelise video- ja filmiprogrammi pani kokku Ville-Karel Viirelaid

  19. Ludwig August krahv Mellin kui talurahva sõber ja estofiil / Indrek Jürjo

    Index Scriptorium Estoniae

    Jürjo, Indrek, 1956-2009

    2003-01-01

    Ludwig August Mellini (1754-1835) suhtumisest eesti ja läti talurahvasse, pärisorjusesse ja tema huvist eestlaste rahvuskarakteri ning rahvuskultuuri vastu. Krahv Mellin oli aastatel 1783-1786 Riia kreisi kreisipeamees ja -kohtunik, 1797-1818 osales aktiivselt 19. sajandi esimeste kümnendite agraarreformides, tema isa Carl Johann von Mellin oli esimene mõisnik Läänemere provintsides, kes umbes 18. sajandi keskpaiku andis oma Tuhala mõisa talupoegadele välja eraõiguse. Lisad: Ludwig August v. Mellini kiri Kuramaa Kirjanduse ja Kunsti Seltsile. BÎriņi, 25. juuni 1822 ; Mellini "Rigaische Stadtblätter'is" avaldamata jäänud artikkel

  20. Kui naljamehed pürgisid 1920. aastal riigikokku / Olaf Esna

    Index Scriptorium Estoniae

    Esna, Olaf, 1934-

    2009-01-01

    Pilkeajakirjast "Meie Mats" ja selle tegijate kandideerimisest I riigikogu valimistel 1920. aastal. 1920. aastal ajakirja toimetanud kirjanik Henrik Saarest (alias Kivilombi Ints) ja karikaturist Georg Tõnissonist (alias Gori). Nimekiri riigikogu valimistel, programmist ja hääletustulemustest