WorldWideScience

Sample records for ag nanocluster nucleation

  1. First-Principles Investigation of Ag-Doped Gold Nanoclusters

    OpenAIRE

    Fei-Yue Fan; Yi She; Qing-Fen Liu; Liang-An Zhang; Yuan-Ming Sun; Di Wu; Xiao-Dong Zhang; Pei-Xun Liu; Mei-Li Guo

    2011-01-01

    Gold nanoclusters have the tunable optical absorption property, and are promising for cancer cell imaging, photothermal therapy and radiotherapy. First-principle is a very powerful tool for design of novel materials. In the present work, structural properties, band gap engineering and tunable optical properties of Ag-doped gold clusters have been calculated using density functional theory. The electronic structure of a stable Au20 cluster can be modulated by incorporating Ag, and the HOMO–LUM...

  2. Synthesis of biocompatible AuAgS/Ag2S nanoclusters and their applications in photocatalysis and mercury detection

    International Nuclear Information System (INIS)

    In this paper, a facile approach for preparation of AuAgS/Ag2S nanoclusters was developed. The unique AuAgS/Ag2S nanoclusters capped with biomolecules exhibit interesting excellent optical and catalytic properties. The fluorescent AuAgS/Ag2S nanoclusters show tunable luminescence depending on the nanocluster size. The apoptosis assay demonstrated that the AuAgS/Ag2S nanoclusters showed low cytotoxicity and good biocompatibility. Therefore, the nanoclusters can be used not only as a probe for labeling cells but also for their photocatalytic activity for photodegradation of organic dye. Moreover, a highly selective and sensitive assay for detection of mercury including Hg2+ and undissociated mercury complexes was developed based on the quenching fluorescent AuAgS/Ag2S nanoclusters, which provides a promising approach for determining various forms of Hg in the mercury-based compounds in environment. These unique nanoclusters may have potential applications in biological labeling, sensing mercury, and photodegradation of various organic pollutants in waste water.Graphical Abstract

  3. Synthesis of biocompatible AuAgS/Ag{sub 2}S nanoclusters and their applications in photocatalysis and mercury detection

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Qian; Chen, Shenna; Zhang, Lingyang; Huang, Haowen, E-mail: hhwn09@163.com; Liu, Fengping [Hunan University of Science and Technology, Key Laboratory of Theoretical Organic Chemistry and Function Molecule, Ministry of Education, Hunan Provincial University Key Laboratory of QSAR/QSPR, School of Chemistry and Chemical Engineering (China); Liu, Xuanyong, E-mail: xyliu@mail.sic.ac.cn [Chinese Academy of Sciences, State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics (China)

    2014-12-15

    In this paper, a facile approach for preparation of AuAgS/Ag{sub 2}S nanoclusters was developed. The unique AuAgS/Ag{sub 2}S nanoclusters capped with biomolecules exhibit interesting excellent optical and catalytic properties. The fluorescent AuAgS/Ag{sub 2}S nanoclusters show tunable luminescence depending on the nanocluster size. The apoptosis assay demonstrated that the AuAgS/Ag{sub 2}S nanoclusters showed low cytotoxicity and good biocompatibility. Therefore, the nanoclusters can be used not only as a probe for labeling cells but also for their photocatalytic activity for photodegradation of organic dye. Moreover, a highly selective and sensitive assay for detection of mercury including Hg{sup 2+} and undissociated mercury complexes was developed based on the quenching fluorescent AuAgS/Ag{sub 2}S nanoclusters, which provides a promising approach for determining various forms of Hg in the mercury-based compounds in environment. These unique nanoclusters may have potential applications in biological labeling, sensing mercury, and photodegradation of various organic pollutants in waste water.Graphical Abstract.

  4. First-Principles Investigation of Ag-Doped Gold Nanoclusters

    Directory of Open Access Journals (Sweden)

    Fei-Yue Fan

    2011-05-01

    Full Text Available Gold nanoclusters have the tunable optical absorption property, and are promising for cancer cell imaging, photothermal therapy and radiotherapy. First-principle is a very powerful tool for design of novel materials. In the present work, structural properties, band gap engineering and tunable optical properties of Ag-doped gold clusters have been calculated using density functional theory. The electronic structure of a stable Au20 cluster can be modulated by incorporating Ag, and the HOMO–LUMO gap of Au20−nAgn clusters is modulated due to the incorporation of Ag electronic states in the HOMO and LUMO. Furthermore, the results of the imaginary part of the dielectric function indicate that the optical transition of gold clusters is concentration-dependent and the optical transition between HOMO and LUMO shifts to the low energy range as the Ag atom increases. These calculated results are helpful for the design of gold cluster-based biomaterials, and will be of interest in the fields of radiation medicine, biophysics and nanoscience.

  5. Preparation and surface enhanced Raman scattering behavior of Ag-coated C{sub 60} nanoclusters

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Shi-Zhao; Yin, Die-er; Li, Xiangqing; Mu, Jin, E-mail: mujin@sit.edu.cn

    2013-12-01

    Ag-coated C{sub 60} nanoclusters were prepared and characterized with X-ray diffraction, transmission electron microscopy and nitrogen adsorption–desorption isotherm measurement. The Ag-coated C{sub 60} nanoclusters were assembled on the glass substrate to form a thin film using the layer-by-layer technique. Meanwhile, the surface enhanced Raman scattering (SERS) of musk xylene adsorbed on the film of Ag-coated C{sub 60} nanoclusters was explored. The results indicated that the film of Ag-coated C{sub 60} nanoclusters was a unique SERS-active substrate with a detection limit of 10{sup −9} mol L{sup −1} for musk xylene. Furthermore, the surface enhanced mechanisms were discussed preliminarily.

  6. Preparation and surface enhanced Raman scattering behavior of Ag-coated C60 nanoclusters

    International Nuclear Information System (INIS)

    Ag-coated C60 nanoclusters were prepared and characterized with X-ray diffraction, transmission electron microscopy and nitrogen adsorption–desorption isotherm measurement. The Ag-coated C60 nanoclusters were assembled on the glass substrate to form a thin film using the layer-by-layer technique. Meanwhile, the surface enhanced Raman scattering (SERS) of musk xylene adsorbed on the film of Ag-coated C60 nanoclusters was explored. The results indicated that the film of Ag-coated C60 nanoclusters was a unique SERS-active substrate with a detection limit of 10−9 mol L−1 for musk xylene. Furthermore, the surface enhanced mechanisms were discussed preliminarily.

  7. Stabilizing subnanometer Ag(0) nanoclusters by thiolate and diphosphine ligands and their crystal structures

    Science.gov (United States)

    Yang, Huayan; Wang, Yu; Zheng, Nanfeng

    2013-03-01

    The combined use of thiolate and diphosphine as surface ligands helps to stabilize subnanometer Ag(0) nanoclusters, resulting in the successful crystallization of two Ag(0)-containing nanoclusters (Ag16 and Ag32) for X-ray single crystal analysis. Both clusters have core-shell structures with Ag86+ and Ag2212+ as their cores, which are not simply either fragments of face-centered cubic metals or their five-fold twinned counterparts. The clusters display UV-Vis absorption spectra consisting of molecule-like optical transitions.The combined use of thiolate and diphosphine as surface ligands helps to stabilize subnanometer Ag(0) nanoclusters, resulting in the successful crystallization of two Ag(0)-containing nanoclusters (Ag16 and Ag32) for X-ray single crystal analysis. Both clusters have core-shell structures with Ag86+ and Ag2212+ as their cores, which are not simply either fragments of face-centered cubic metals or their five-fold twinned counterparts. The clusters display UV-Vis absorption spectra consisting of molecule-like optical transitions. Electronic supplementary information (ESI) available: Experimental details, more pictures of the structure and XPS spectra of the clusters. CCDC 916463 and 916464. For ESI and crystallographic data in CIF or other electronic format see DOI: 10.1039/c3nr34328f

  8. Structural properties of Au and Ag nanoclusters embedded in MgO

    NARCIS (Netherlands)

    Fedorov, A.V.; Veen, A. van; Falub, C.V.; Eijt, S.W.H.; Kooi, B.J.; Hosson, J.Th.M. De; Hibma, T.; Zimmerman, R.L.

    2002-01-01

    Gold and silver nanoclusters embedded in MgO were created by means of ion implantation of 1.0 MeV Au or 600 keV Ag ions to a dose of 10^16 cm–2 into single crystals of MgO(100) and subsequent annealing at 1473 K for a period of 22 h. The structural properties of the nanoclusters were characterised b

  9. Ag29(BDT)12(TPP)4: A Tetravalent Nanocluster

    KAUST Repository

    AbdulHalim, Lina G.

    2015-06-24

    The bottom-up assembly of nanoparticles into diverse ordered solids is a challenge because it requires nanoparticles, which are often quasi-spherical, to have interaction anisotropy akin to atoms and molecules. Typically, anisotropy has been introduced by changing the shape of the inorganic nanoparticle core. Here, we present the design, self-assembly, optical properties and total structural determination of Ag29(BDT)12(TPP)4, an atomically precise tetravalent nanocluster (NC) (BDT: 1,3-benzenedithiols; TPP: triphenylphosphine). It features four unique tetrahedrally symmetrical binding surface sites facilitated by the supramolecular assembly of 12 BDT—wide footprint bidentate thiols—in the ligand shell. When each of these sites was selectively functionalized by a single phosphine ligand, particle stability, synthetic yield and the propensity to self-assemble into macroscopic crystals increased. The solid crystallized NCs have a substantially narrowed optical bandgap compared to that of the solution state, suggesting strong inter-particle electronic coupling occurs in the solid state.

  10. A scalable synthesis of highly stable and water dispersible Ag 44(SR)30 nanoclusters

    KAUST Repository

    AbdulHalim, Lina G.

    2013-01-01

    We report the synthesis of atomically monodisperse thiol-protected silver nanoclusters [Ag44(SR)30] m, (SR = 5-mercapto-2-nitrobenzoic acid) in which the product nanocluster is highly stable in contrast to previous preparation methods. The method is one-pot, scalable, and produces nanoclusters that are stable in aqueous solution for at least 9 months at room temperature under ambient conditions, with very little degradation to their unique UV-Vis optical absorption spectrum. The composition, size, and monodispersity were determined by electrospray ionization mass spectrometry and analytical ultracentrifugation. The produced nanoclusters are likely to be in a superatom charge-state of m = 4-, due to the fact that their optical absorption spectrum shares most of the unique features of the intense and broadly absorbing nanoparticles identified as [Ag44(SR) 30]4- by Harkness et al. (Nanoscale, 2012, 4, 4269). A protocol to transfer the nanoclusters to organic solvents is also described. Using the disperse nanoclusters in organic media, we fabricated solid-state films of [Ag44(SR)30]m that retained all the distinct features of the optical absorption spectrum of the nanoclusters in solution. The films were studied by X-ray diffraction and photoelectron spectroscopy in order to investigate their crystallinity, atomic composition and valence band structure. The stability, scalability, and the film fabrication method demonstrated in this work pave the way towards the crystallization of [Ag44(SR)30]m and its full structural determination by single crystal X-ray diffraction. Moreover, due to their unique and attractive optical properties with multiple optical transitions, we anticipate these clusters to find practical applications in light-harvesting, such as photovoltaics and photocatalysis, which have been hindered so far by the instability of previous generations of the cluster. © 2013 The Royal Society of Chemistry.

  11. Synthesis of Ag nanoclusters by a pH-dependent etching method in aqueous solution

    Science.gov (United States)

    Zhang, Chunxiao; Sun, Xiaoyi; Li, Juan; Liu, You-Nian

    2013-06-01

    We developed a pH-dependent etching method for the synthesis of stable fluorescent silver nanoclusters (AgNCs) in aqueous solution. The AgNCs emit at 530 nm when excited at 380 nm and can be used for Hg2+ detection with a low detection limit and high selectivity.We developed a pH-dependent etching method for the synthesis of stable fluorescent silver nanoclusters (AgNCs) in aqueous solution. The AgNCs emit at 530 nm when excited at 380 nm and can be used for Hg2+ detection with a low detection limit and high selectivity. Electronic supplementary information (ESI) available: Materials and experimental details, Fig. S1-5, and Table S1. See DOI: 10.1039/c3nr00725a

  12. Plasmonic resonance of Ag nanoclusters diffused in soda-lime glasses.

    Science.gov (United States)

    Kumar, Promod; Mathpal, Mohan Chandra; Tripathi, Anand Kumar; Prakash, Jai; Agarwal, Arvind; Ahmad, M M; Swart, H C

    2015-04-14

    Silver nanoclusters were prepared in a soda-lime glass matrix through the ion-exchange (Ag(+)↔ Na(+)) method followed by thermal annealing in an air atmosphere. The nanoscale patterning of Ag nanoclusters embedded in a soda lime glass matrix in an air atmosphere at different annealing temperatures has been investigated. During annealing, Ag(+) is reduced to Ag(0) and subsequently forms silver nanoparticles inside the glass matrix. A blue shift of 20 nm has been observed as a function of the post annealing temperature. The photoluminescence intensity is highest for an annealing temperature of 500 °C for 1 h and continuously decreases as annealing temperature increases up to 600 °C. The presence of spherical nanoparticles with a maximum particle size of 7.2 nm has been observed after annealing at 600 °C for 1 hour, which is consistent with Mie theory based results. PMID:25738191

  13. Ag nanocluster-based label-free catalytic and molecular beacons for amplified biosensing.

    Science.gov (United States)

    Gong, Liang; Kuai, Hailan; Ren, Songlei; Zhao, Xu-Hua; Huan, Shuang-Yan; Zhang, Xiao-Bing; Tan, Weihong

    2015-08-01

    By employing DNAzyme as a recognition group and amplifier, and DNA-stabilized silver nanoclusters (DNA/AgNCs) as signal reporters, we reported for the first time a label-free catalytic and molecular beacon as an amplified biosensing platform for highly selective detection of cofactors such as Pb(2+) and L-histidine. PMID:26120805

  14. Supersensitive and selective detection of picric acid explosive by fluorescent Ag nanoclusters.

    Science.gov (United States)

    Zhang, Jian Rong; Yue, Yuan Yuan; Luo, Hong Qun; Li, Nian Bing

    2016-02-01

    Picric acid (PA) explosive is a hazard to public safety and health, so the sensitive and selective detection of PA is very important. In the present work, polyethyleneimine stabilized Ag nanoclusters were successfully used for the sensitive and selective quantification of PA on the basis of fluorescence quenching. The quenching efficiency of Ag nanoclusters is proportional to the concentration of PA and the logarithm of PA concentration over two different concentration ranges (1.0 nM-1 μM for the former and 0.25-20 μM for the latter), thus the proposed quantitative strategy for PA provides a wide linear range of 1.0 nM-20 μM. The detection limit based on 3σ/K is 0.1 nM. The quenching mechanism of Ag nanoclusters by PA is discussed in detail. The results indicate that the selective detection of PA over other nitroaromatics including 2,4,6-trinitrotoluene (TNT), 2,4-dinitrotoluene (2,4-DNT), p-nitrotoluene (p-NT), m-dinitrobenzene (m-DNB), and nitrobenzene (NB), is due to the electron transfer and energy transfer between PA and polyethyleneimine-capped Ag nanoclusters. In addition, the experimental data obtained for the analysis of artificial samples show that the proposed PA sensor is potentially applicable in the determination of trace PA explosive in real samples. PMID:26661456

  15. Synthesis and Optical Properties of Au-Ag Alloy Nanoclusters with Controlled Composition

    Directory of Open Access Journals (Sweden)

    J. F. Sánchez-Ramírez

    2008-01-01

    Full Text Available Colloidal solid-solution-like Au-Ag alloy nanoclusters of different compositions were synthesized through citrate reduction of mixed metal ions of low concentrations, without using any other protective or capping agents. Optical absorption of the alloy nanoclusters was studied both theoretically and experimentally. The position of the surface plasmon resonance (SPR absorption band of the nanoclusters could be tuned from 419 nm to 521 nm through the variation of their composition. Considering effective dielectric constant of the alloy, optical absorption spectra for the nanoclusters were calculated using Mie theory, and compared with the experimentally obtained spectra. Theoretically obtained optical spectra well resembled the experimental spectra when the true size distribution of the nanoparticles was considered. High-resolution transmission electron microscopy (HREM, high-angle annular dark field (HAADF imaging, and energy dispersive spectroscopy (EDS revealed the true alloy nature of the nanoparticles with nominal composition being preserved. The synthesis technique can be extended to other bimetallic alloy nanoclusters containing Ag.

  16. Fluorescence switch for silver ion detection utilizing dimerization of DNA-Ag nanoclusters.

    Science.gov (United States)

    Lee, Jihyun; Park, Juhee; Hee Lee, Hong; Park, Hansoo; Kim, Hugh I; Kim, Won Jong

    2015-06-15

    A fluorescence switch that consists of DNA-templated silver nanoclusters (DNA-AgNCs) triggered by silver ion (Ag(+)) is developed to detect Ag(+). The mechanism of the fluorescence switching of DNA-AgNCs is investigated by fluorescence spectroscopy, circular dichroism spectroscopy, DNA hybridization assay and mass spectrometry. Ag(+) induces a dimeric structure of Cyt12-AgNCs by forming a bridge between two Cyt12-AgNCs, where Cyt12 is cytosine 12-mer; this dimer formation causes the fluorescence change of Cyt12-AgNCs from red to green. Using this Ag(+)-triggered fluorescence switch, we successfully detected Ag(+) at concentrations as low as 10nM. Furthermore, we quantitatively detected the Ag(+) in the Silmazin(®), which is dermatological burn ointment having silver sulfadiazine. Ag(+) detection using this fluorescence switch has high selectivity and sensitivity, and short response time, and can be used successfully even in the presence of other metal ions. PMID:25658488

  17. Optical and magnetic properties of Cu-doped 13-atom Ag nanoclusters

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Yi [State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xian 710072 (China); Lei, Yimin [State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xian 710072 (China); Australian Centre for Microscopy and Microanalysis, The University of Sydney, Sydney, New South Wales 2006 (Australia); Cui, Xiangyuan [Australian Centre for Microscopy and Microanalysis, The University of Sydney, Sydney, New South Wales 2006 (Australia); School of Aerospace Mechanical and Mechatronic Engineering, The University of Sydney, Sydney, New South Wales 2006 (Australia); Liu, Zongwen, E-mail: fuyichen@nwpu.edu.cn [Australian Centre for Microscopy and Microanalysis, The University of Sydney, Sydney, New South Wales 2006 (Australia); Chen, Fuyi, E-mail: zongwen.liu@sydney.edu.au [State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xian 710072 (China)

    2013-07-15

    Highlights: •Cu atom tends to occupy the core position in the Ag–Cu nanoclusters. •Global minimum of Ag{sub 12}Cu{sub 1} cluster is predicted to be cuboctahedral shape. •High symmetry clusters have high magnetic moment. •Icosahedral core–shell Ag{sub 12}Cu{sub 1} cluster has ferromagnetic properties. -- Abstract: The structural, optical and magnetic properties of Ag{sub 13}, Ag{sub 12}Cu{sub 1} and Cu{sub 13} clusters have been investigated using density functional theory calculations. The global minimum of the Ag{sub 12}Cu{sub 1} cluster is predicted to be cuboctahedral (COh) core–shell structure with O{sub h} point group symmetry while the icosahedral (Ih) core–shell isomer has a higher HOMO–LUMO gap and higher magnetic moment. The optical absorption spectrum of the Ih Ag{sub 12}Cu{sub 1} has three absorption peaks at 2.17, 2.41 and 2.65 eV, compared with that the COh Ag{sub 12}Cu{sub 1} has one main absorption peak at 2.51 eV. The characteristics in electronic density of states (DOSs) show that Ih core–shell Ag{sub 12}Cu{sub 1} has ferromagnetic properties like pure Au{sub 13}, Ag{sub 13} nanoclusters. The sizable split between spin up and spin down DOS of d states in the inner Cu atom and sp states in the outer Ag atoms bring in large magnetic moment to Ih Ag{sub 12}Cu{sub 1} cluster.

  18. Charge-transfer optical absorption mechanism of DNA:Ag-nanocluster complexes

    Science.gov (United States)

    Longuinhos, R.; Lúcio, A. D.; Chacham, H.; Alexandre, S. S.

    2016-05-01

    Optical properties of DNA:Ag-nanoclusters complexes have been successfully applied experimentally in Chemistry, Physics, and Biology. Nevertheless, the mechanisms behind their optical activity remain unresolved. In this work, we present a time-dependent density functional study of optical absorption in DNA:Ag4. In all 23 different complexes investigated, we obtain new absorption peaks in the visible region that are not found in either the isolated Ag4 or isolated DNA base pairs. Absorption from red to green are predominantly of charge-transfer character, from the Ag4 to the DNA fragment, while absorption in the blue-violet range are mostly associated to electronic transitions of a mixed character, involving either DNA-Ag4 hybrid orbitals or intracluster orbitals. We also investigate the role of exchange-correlation functionals in the calculated optical spectra. Significant differences are observed between the calculations using the PBE functional (without exact exchange) and the CAM-B3LYP functional (which partly includes exact exchange). Specifically, we observe a tendency of charge-transfer excitations to involve purines bases, and the PBE spectra error is more pronounced in the complexes where the Ag cluster is bound to the purines. Finally, our results also highlight the importance of adding both the complementary base pair and the sugar-phosphate backbone in order to properly characterize the absorption spectrum of DNA:Ag complexes.

  19. Two-photon absorption of ligand-protected Ag15 nanoclusters. Towards a new class of nonlinear optics nanomaterials.

    Science.gov (United States)

    Sanader, Željka; Krstić, Marjan; Russier-Antoine, Isabelle; Bertorelle, Franck; Dugourd, Philippe; Brevet, Pierre-François; Antoine, Rodolphe; Bonačić-Koutecký, Vlasta

    2016-05-14

    We report theoretical and experimental results on two-photon absorption (TPA) cross section of thiolated small silver cluster Ag15L11 exhibiting extraordinary large TPA in red. Our findings provide the responsible mechanism and allow proposing new classes of nanoclusters with large TPAs which are promising for biological and medical applications. PMID:26821589

  20. Enhanced nucleation of Ag nanoparticles by vacancy-type defects in Ar-ions implanted spinel

    International Nuclear Information System (INIS)

    Vacancy-type defects are introduced into magnesium aluminate spinel (MgAl2O4 (1 1 0)) by Ar-ions implantation, and then Ag-ions are implanted into the depth rich in vacancy-type defects. The ultraviolet-visible spectrometry (UV-VIS) and positron annihilation spectroscopy (PAS) are used to study the influence of vacancy-type defects on nucleation of Ag nanoparticles. After introduction of vacancy-type defects the pronounced increase of surface plasmon resonance (SPR) absorbance intensity indicates that defects enhance the nucleation of Ag nanoparticles. The PAS results reveal that vacancy-type defects provide pre-nucleating centers for Ag nanoparticles nucleation and growth.

  1. LEEM study of nucleation, growth, and decay of Ag nanowires on Cu(110)

    Science.gov (United States)

    Senevirathne, Indrajith; Bussmann, Ezra; Kellogg, Gary; Kurtz, Richard; Sprunger, Phillip

    2007-03-01

    Low energy electron microscopy (LEEM) has been used to study the nucleation, growth, and ripening of Ag nanowires on Cu(110). Previous STM and LEED studies of Ag on the Cu(110) surface have shown that for a Ag coverage of below 0.3 ML, Ag forms a surface alloy, followed by the formation of a 2D Ag(111) flat superstructure through dealloying at one monolayer. For Ag coverages above 1.3 ML , nanowires of Ag(110), with widths/heights of 12 nm / 2nm, grow along the [110] crystallographic direction with highly anisotropic aspect ratios. LEEM reveals that Ag initially alloys at Cu/Ag step edges producing a distortion of the steps. Upon deposition above 1 ML, nucleation of Ag nanowires was observed across terraces, however nucleation still occurred at defect and step edges. LEEM showed that the nanowires grow to micron lengths and have highly anisotropic aspect ratios. Annealing above 573K resulted in rapid Oswald ripening of nanowires to Ag clusters of several micron dimensions. Quantitative details of the growth and decay mechanisms will be discussed. Sandia Corporation is a Lockheed Martin Company, for the US DOE's NNSA under Contract DE-AC04-94AL85000. Work was supported CINT-U2006A123 and NSF-DMR-0504654.

  2. Synthesis of unidirectional structures of SiO2-Ag using Au nanoparticles as nucleation centers

    International Nuclear Information System (INIS)

    This paper reports a method to synthesize Ag unidirectional structures covered with SiO2 by sol-gel technique using Au nanoparticles as nucleation centers of the unidirectional structures. In the first phase unidirectional structures of SiO2-Ag CI are obtained by sol-gel, using TEOS as a precursor of metallic structures (Ag) and the incorporation of Au nanoparticles as nucleation centers for growth of unidirectional structures. In the second stage, one-way systems are subjected to thermal treatment in H2 atmosphere for obtain AG0 particles through mechanisms that diffusion and coalescence of silver to form structures that have a thin cover of SiO2. Analysis by scanning electron microscopy, transmission and atomic force microscopy allowed to determine the chemical composition and microstructural properties of unidirectional systems SiO2-Ag. (Author)

  3. Fast, high-yield synthesis of amphiphilic Ag nanoclusters and the sensing of Hg2+ in environmental samples

    Science.gov (United States)

    Xia, Nan; Yang, Jie; Wu, Zhikun

    2015-05-01

    We report the high-yield (74%) synthesis of Ag30(Capt)18 (abbreviated as Ag30) in a very time-saving fashion (half an hour). The cluster composition was determined by high-resolution mass spectrometry combined with TG analysis, and the structure was probed by 1D and 2D NMR. Interestingly, the nanoclusters can dissolve in water and methanol, as well as in most organic solvents such as ethanol, acetone, acetonitrile, dichloromethane and ethyl acetate with the assistance of acetic acid. Such a good solubility in a range of various polar solvents was not reported previously in nanoclusters' research and is important for applications. An important result from this work is that Ag30 can sense a low concentration of Hg2+ in environmental samples (including lake water and soil solution), indicating that Ag30 can be a potential colorimetric probe for Hg2+. The sensing mechanism was revealed to be related to the anti-galvanic reduction process.We report the high-yield (74%) synthesis of Ag30(Capt)18 (abbreviated as Ag30) in a very time-saving fashion (half an hour). The cluster composition was determined by high-resolution mass spectrometry combined with TG analysis, and the structure was probed by 1D and 2D NMR. Interestingly, the nanoclusters can dissolve in water and methanol, as well as in most organic solvents such as ethanol, acetone, acetonitrile, dichloromethane and ethyl acetate with the assistance of acetic acid. Such a good solubility in a range of various polar solvents was not reported previously in nanoclusters' research and is important for applications. An important result from this work is that Ag30 can sense a low concentration of Hg2+ in environmental samples (including lake water and soil solution), indicating that Ag30 can be a potential colorimetric probe for Hg2+. The sensing mechanism was revealed to be related to the anti-galvanic reduction process. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr00705d

  4. Detection and size determination of Ag nanoclusters in ion-exchanged soda-lime glasses by waveguided Raman spectroscopy

    Science.gov (United States)

    Ferrari, M.; Gonella, F.; Montagna, M.; Tosello, C.

    1996-02-01

    Waveguided Raman measurements have been performed in order to detect the presence of Ag nanoclusters in soda-lime glass waveguides obtained by ion exchange. By subtracting a strong broadband luminescence and the Raman contribution of the glass matrix, a low frequency Raman peak is resolved. The peak is ascribed to surface acoustic vibrations of silver clusters. The involved modes are the quadrupolar spheroidal ones. The size distribution of the Ag clusters is deduced from the energy and the linewidth of the peak. Silver particles have small dimensions with an upper size limit of about 1.5 nm. This result is in good agreement with recent transmission electron microscopy measurements.

  5. Sensitive and selective detection of Hg2+ and Cu2+ ions by fluorescent Ag nanoclusters synthesized via a hydrothermal method

    Science.gov (United States)

    Liu, Jing; Ren, Xiangling; Meng, Xianwei; Fang, Zheng; Tang, Fangqiong

    2013-09-01

    An easily prepared fluorescent Ag nanoclusters (Ag NCs) probe for the sensitive and selective detection of Hg2+ and Cu2+ ions was developed here. The Ag NCs were synthesized by using polymethacrylic acid sodium salt as a template via a convenient hydrothermal process. The as-prepared fluorescent Ag NCs were monodispersed, uniform and less than 2 nm in diameter, and can be quenched in the presence of mercury (Hg2+) or copper (Cu2+) ions. Excellent linear relationships existed between the quenching degree of the Ag NCs and the concentrations of Hg2+ or Cu2+ ions in the range of 10 nM to 20 μM or 10 nM to 30 μM, respectively. By using ethylenediaminetetraacetate (EDTA) as the masking agent of Cu2+, Hg2+ was exclusively detected in coexistence with Cu2+ with high sensitivity (LOD = 10 nM), which also provided a reusable detection method for Cu2+. Furthermore, the different quenching phenomena caused by the two metals ions such as changes in visible colour, shifts of UV absorbance peaks and changes in size of Ag NCs make it easy to distinguish between them. Therefore the easily synthesized fluorescent Ag NCs may have great potential as Hg2+ and Cu2+ ions sensors.An easily prepared fluorescent Ag nanoclusters (Ag NCs) probe for the sensitive and selective detection of Hg2+ and Cu2+ ions was developed here. The Ag NCs were synthesized by using polymethacrylic acid sodium salt as a template via a convenient hydrothermal process. The as-prepared fluorescent Ag NCs were monodispersed, uniform and less than 2 nm in diameter, and can be quenched in the presence of mercury (Hg2+) or copper (Cu2+) ions. Excellent linear relationships existed between the quenching degree of the Ag NCs and the concentrations of Hg2+ or Cu2+ ions in the range of 10 nM to 20 μM or 10 nM to 30 μM, respectively. By using ethylenediaminetetraacetate (EDTA) as the masking agent of Cu2+, Hg2+ was exclusively detected in coexistence with Cu2+ with high sensitivity (LOD = 10 nM), which also provided a

  6. Tuning Ag29 nanocluster light emission from red to blue with one and two-photon excitation.

    Science.gov (United States)

    Russier-Antoine, Isabelle; Bertorelle, Franck; Hamouda, Ramzi; Rayane, Driss; Dugourd, Philippe; Sanader, Željka; Bonačić-Koutecký, Vlasta; Brevet, Pierre-François; Antoine, Rodolphe

    2016-02-01

    We demonstrate that the tuning of the light emission from red to blue in dihydrolipoic acid (DHLA) capped Ag29 nanoclusters can be trigged with one and two photon excitations. The cluster stoichiometry was determined with mass spectrometry and found to be Ag29(DHLA)12. In a detailed optical investigation, we show that these silver nanoclusters exhibit a strong red photoluminescence visible to the naked eye and characterized by a quantum yield of nearly ∼2% upon one-photon excitation. In the nonlinear optical (NLO) study of the properties of the clusters, the two-photon excited fluorescence spectra were recorded and their first hyperpolarizability obtained. The two-photon absorption cross-section at ∼800 nm for Ag29(DHLA)12 is higher than 10(4) GM and the hyperpolarizability is 106 × 10(-30) esu at the same excitation wavelength. The two-photon excited fluorescence spectrum appears strongly blue-shifted as compared to the one-photon excited spectrum, displaying a broad band between 400 and 700 nm. The density functional theory (DFT) provides insight into the structural and electronic properties of Ag29(DHLA)12 as well as into interplay between metallic subunit or core and ligands which is responsible for unique optical properties. PMID:26765164

  7. Monodispersed bimetallic PdAg nanoparticles with twinned structures: Formation and enhancement for the methanol oxidation

    OpenAIRE

    Zhen Yin; Yining Zhang; Kai Chen; Jing Li; Wenjing Li; Pei Tang; Huabo Zhao; Qingjun Zhu; Xinhe Bao; Ding Ma

    2014-01-01

    Monodispersed bimetallic PdAg nanoparticles can be fabricated through the emulsion-assisted ethylene glycol (EG) ternary system. Different compositions of bimetallic PdAg nanoparticles, Pd80Ag20, Pd65Ag35 and Pd46Ag54 can be obtained via adjusting the reaction parameters. For the formation process of the bimetallic PdAg nanoparticles, there have two-stage growth processes: firstly, nucleation and growth of the primary nanoclusters; secondly, formation of the secondary nanoparticles with the s...

  8. Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization

    Science.gov (United States)

    Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao

    2015-02-01

    In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.

  9. Quantum sized Ag nanocluster assisted fluorescence enhancement in Tm3+-Yb3+ doped optical fiber beyond plasmonics

    International Nuclear Information System (INIS)

    We report a process for enhancing fluorescence emission from conventional rare earth ions in optical fiber by metal nanocluster (MNC) in nonresonant indirect pumping. The process is completely different from formal metal enhanced fluorescence phenomenon as the MNCs are too small in size to support localized surface plasmon and the excitation wavelength is far from plasmon resonance frequency. We used an established theory of two coupled oscillators to explain the simultaneous enhancement of Ytterbium (Yb3+) and Thulium (Tm3+) emission by silver (Ag) NCs under nonresonant pumping in optical fiber. The fiber is pumped with a 980 nm fiber pigtailed laser diode with input power of 20–100 mW to excite the Yb3+. Four times enhancement of Yb3+ emission of 900–1100 nm and Tm3+ upconversion emission around 474 nm, 650 nm, and 790 nm is observed in the fiber with Ag NCs

  10. Effect of salts, solvents and buffer on miRNA detection using DNA silver nanocluster (DNA/AgNCs) probes

    International Nuclear Information System (INIS)

    MicroRNAs (miRNAs) are small regulatory RNAs (size ∼21 nt to ∼25 nt) which regulate a variety of important cellular events in plants, animals and single cell eukaryotes. Especially because of their use in diagnostics of human diseases, efforts have been directed towards the invention of a rapid, simple and sequence selective detection method for miRNAs. Recently, we reported an innovative method for the determination of miRNA levels using the red fluorescent properties of DNA/silver nanoclusters (DNA/AgNCs). Our method is based on monitoring the emission drop of a DNA/AgNCs probe in the presence of its specific target miRNA. Accordingly, the accuracy and efficiency of the method relies on the sensitivity of hybridization between the probe and target. To gain specific and robust hybridization between probe and target, we investigated a range of diverse salts, organic solvents, and buffer to optimize target sensing conditions. Under the newly adjusted conditions, the target sensitivity and the formation of emissive DNA/AgNCs probes were significantly improved. Also, fortification of the Tris–acetate buffer with inorganic salts or organic solvents improved the sensitivity of the DNA/AgNC probes. On the basis of these optimizations, the versatility of the DNA/AgNCs-based miRNA detection method can be expanded. (paper)

  11. Effect of salts, solvents and buffer on miRNA detection using DNA silver nanocluster (DNA/AgNCs) probes

    Science.gov (United States)

    Shah, Pratik; Cho, Seok Keun; Waaben Thulstrup, Peter; Bhang, Yong-Joo; Ahn, Jong Cheol; Choi, Suk Won; Rørvig-Lund, Andreas; Yang, Seong Wook

    2014-01-01

    MicroRNAs (miRNAs) are small regulatory RNAs (size ˜21 nt to ˜25 nt) which regulate a variety of important cellular events in plants, animals and single cell eukaryotes. Especially because of their use in diagnostics of human diseases, efforts have been directed towards the invention of a rapid, simple and sequence selective detection method for miRNAs. Recently, we reported an innovative method for the determination of miRNA levels using the red fluorescent properties of DNA/silver nanoclusters (DNA/AgNCs). Our method is based on monitoring the emission drop of a DNA/AgNCs probe in the presence of its specific target miRNA. Accordingly, the accuracy and efficiency of the method relies on the sensitivity of hybridization between the probe and target. To gain specific and robust hybridization between probe and target, we investigated a range of diverse salts, organic solvents, and buffer to optimize target sensing conditions. Under the newly adjusted conditions, the target sensitivity and the formation of emissive DNA/AgNCs probes were significantly improved. Also, fortification of the Tris-acetate buffer with inorganic salts or organic solvents improved the sensitivity of the DNA/AgNC probes. On the basis of these optimizations, the versatility of the DNA/AgNCs-based miRNA detection method can be expanded.

  12. Nucleation and growth mechanism of Ag precipitates in a CuAgZr alloy

    International Nuclear Information System (INIS)

    CuAgZr alloy is a variant of the CuAg alloy that is developed for high strength and high conductivity applications. Its strengthening is accomplished mainly by the precipitation of Ag precipitates, which tend to align on {111} planes in the Cu matrix. This alignment has been reported to be caused by stacking faults on {111} planes. Contrary to these reports, this research presents evidence for Ag precipitates formation on {111} planes due to the minimization of elastic energy. The Ag precipitates were formed by clustering of Ag atoms while maintaining the fcc crystal structure of the matrix. They have faceted {111} interfaces with the matrix. The thickening of precipitates appears to be by the ledge growth mechanism, which is resulted in by misfit dislocation networks on the interface

  13. Strong enhancement of the electrochemiluminescence of luminol by AuAg and PtAg alloy nanoclusters, and its sensitization by phenolic artificial oestrogens

    International Nuclear Information System (INIS)

    This paper reports on the synthesis of AuAg and PtAg alloy nanoclusters (NCs) and their enhancement effect on the electrochemiluminescence (ECL) of luminol. The conditions of synthesis were optimized, and the structure and properties of the NCs were characterized by X-ray diffraction, transmission electron microscopy, electrochemistry, and optical spectroscopy. The NCs are found to intensify (by up to 20 times) the ECL of luminol in solution of pH 8.5. This finding can largely extend the useful pH range of the ECL of luminol. The enhanced ECL is strongly affected by oxygen and hydrogen peroxide, and the mechanism of enhancement is attributed to the accelerated production of reactive oxygen species. The enhanced ECL is also affected by phenolic artificial estrogens, and this was used for their determination with detection limits as low as 700 pg L−1 (with AuAg) and 1.6 ng L−1 (with PtAg). The method was applied to the determination of such estrogens in egg samples using diethylstilbestrol as a reference substance. (author)

  14. A label-free fluorescent molecular beacon based on DNA-Ag nanoclusters for the construction of versatile Biosensors.

    Science.gov (United States)

    Cao, Qiao; Teng, Ye; Yang, Xuan; Wang, Jin; Wang, Erkang

    2015-12-15

    In this paper, we developed a simple, low-cost and sensitive DNA sequences detection biosensor based on a label-free molecular beacon (MB) whose DNA hairpin structure terminal has a guanine-rich sequence that can enhance fluorescence of silver nanoclusters (Ag NCs). Without hybridization between hairpin probe and target DNA, the Ag NCs presented bright fluorescence for the proximity of guanine-rich sequences (GRSs). After binding with target DNA, the hairpin shape was destroyed which results in a decrease of the Ag NCs fluorescence intensity. With this biosensor, we detected three disease-related genes that were the human immunodeficiency virus (HIV) gene, hepatitis B virus (HBV) gene and human T-lymphotropic virus type I (HTLV-I) gene. The detection limits based on S/N of 3 were 4.4 nM, 6.8 nM and 8.5 nM for HIV gene, HBV gene and HTLV-I gene, respectively. Our sensor was also of high selectivity and could distinguish even one nucleotide mismatched target. PMID:26159151

  15. Irradiation induced dissolution of Cu and growth of Ag nanoclusters in Cu/Ag ion-exchanged soda-lime glass

    CERN Document Server

    Manikandan, D; Magudapathy, P; Nair, K G M

    2002-01-01

    Complex metal nanoclusters of Cu/Ag are formed in a soda-lime glass matrix by sequential copper and silver ion-exchange followed by ion irradiation. Optical absorption measurements showed signature of copper clusters alone in the Cu/Ag ion-exchanged sample. Irradiation of the ion-exchanged sample with He sup + ions of energy 100 keV of different fluences resulted in the growth of the silver clusters with, the optical absorption spectrum exhibiting two peaks corresponding to the surface plasmon resonance of copper and silver in the same matrix. It was found that with increase in fluence the silver clusters begin to grow while the already formed copper clusters segregate, which can be visualized from the absorption spectra, where the copper band disappears while the silver band grows with the increase in dose. Vacuum annealing of the Cu/Ag ion-exchanged samples resulted in complete disappearance of copper clusters while the silver clusters grew till they attained saturation. The glancing incidence X-ray diffrac...

  16. Compound Ag nanocluster-graphene electrodes as transparent and current spreading electrodes for improved light output power in near-ultraviolet light emitting diodes

    International Nuclear Information System (INIS)

    We introduced a two-dimensional graphene network on a Ag nanocluster as a transparent and current spreading electrode (TCSE) for a near-ultraviolet light emitting diode (NUV-LED), and compared the performance with those with graphene electrodes or conventional indium tin oxide (ITO) electrodes. The current–voltage characteristics and electroluminescence (EL) data showed that compound Ag nanocluster-graphene (CA-G) electrodes operated well as TCSEs in NUV-LED devices. The forward voltage at an input current of 20 mA was 4.06 V for the NUV-LED of current spreading electrodes with CA-G electrodes, which is only slightly higher than the value 3.96 V with ITO electrodes as TCSEs. The EL intensity of NUV-LEDs with CA-G electrodes also showed a slight increase, compared to that of NUV-LEDs with planar ITO transparent conducting electrodes. (paper)

  17. Structures of AgPd nanoclusters adsorbed on MgO(100): A computational study

    Czech Academy of Sciences Publication Activity Database

    Negreiros, F. R.; Barcaro, G.; Kuntová, Zdeňka; Rossi, G.; Ferrando, R.; Fortunelli, A.

    2011-01-01

    Roč. 605, 5-6 (2011), s. 483-488. ISSN 0039-6028 Institutional research plan: CEZ:AV0Z10100521 Keywords : AgPd clusters * nanoparticle * bimetallic clusters * superstable polyicosahedra Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.994, year: 2011

  18. Formation and characterisation of the silver hydride nanocluster cation [Ag3H2((Ph2 P)2CH2)](+) and its release of hydrogen.

    Science.gov (United States)

    Girod, Marion; Krstić, Marjan; Antoine, Rodolphe; MacAleese, Luke; Lemoine, Jérome; Zavras, Athanasios; Khairallah, George N; Bonačić-Koutecký, Vlasta; Dugourd, Philippe; O'Hair, Richard A J

    2014-12-01

    Multistage mass spectrometry and density functional theory (DFT) were used to characterise the small silver hydride nanocluster, [Ag3 H2 L](+) (where L=(Ph2 P)2 CH2 ) and its gas-phase unimolecular chemistry. Collision-induced dissociation (CID) yields [Ag2 HL](+) as the major product while laser-induced dissociation (LID) proceeds via H2 formation and subsequent release from [Ag3 H2 L](+) , giving rise to [Ag3 L](+) as the major product. Deuterium labelling studies on [Ag3 D2 L](+) prove that the source of H2 is from the hydrides and not from the ligand. Comparison of TD-DFT absorption patterns obtained for the optimised structures with action spectroscopy results, allows assignment of the measured features to structures of precursors and products. Molecular dynamics "on the fly" reveal that AgH loss is favoured in the ground state, but H2 formation and loss is preferred in the first excited state S1 , in agreement with CID and LID experimental findings. This indicates favourable photo-induced formation of H2 and subsequent release from [Ag3 H2 L](+) , an important finding in context of metal hydrides as a hydrogen storage medium, which can subsequently be released by heating or irradiation with light. PMID:25324009

  19. Locking-to-unlocking system is an efficient strategy to design DNA/silver nanoclusters (AgNCs) probe for human miRNAs

    OpenAIRE

    Shah, Pratik; Choi, Suk Won; Kim, Ho-jin; Cho, Seok Keun; Bhang, Yong-Joo; Ryu, Moon Young; Thulstrup, Peter Waaben; Bjerrum, Morten Jannik; Yang, Seong Wook

    2016-01-01

    MicroRNAs (miRNAs), small non-coding RNA molecules, are important biomarkers for research and medical purposes. Here, we describe the development of a fast and simple method using highly fluorescent oligonucleotide-silver nanocluster probes (DNA/AgNCs) to efficiently detect specific miRNAs. Due to the great sequence diversity of miRNAs in humans and other organisms, a uniform strategy for miRNA detection is attractive. The concept presented is an oligonucleotide-based locking-to-unlocking sys...

  20. A label-free fluorescence assay for trypsin based on the electron transfer between oligonucleotide-stabilized Ag nanoclusters and cytochrome c.

    Science.gov (United States)

    Hong, Mei-Lan; Li, Li-Juan; Han, Hui-Xia; Chu, Xia

    2014-01-01

    A label-free fluorescent assay for the detection of trypsin by using oligonucleotide-templated silver nanoclusters (Ag NCs) and cytochrome c (Cyt c) has been demonstrated. When negatively charged Ag NCs and positively charged Cyt c are mixed, they tend to form a hybrid complex, and then lead the fluorescence of Ag NCs to be quenched significantly due to electron transfer between Ag NCs and the heme cofactor of Cyt c. In the presence of trypsin, it catalyzes the hydrolytic cleavage of Cyt c to small peptide fragments, and releases the heme moiety from the Ag NCs/Cyt c complex; the quenched fluorescence restores therewith. By virtue of this specific response, the fluorescent biosensor has a linear range of from 0.7 to 4 μg mL(-1) and from 9 to 120 μg mL(-1) with a detection limit of 58.7 ng mL(-1). Aside from the easy manufacture aspect, our method also possesses a high signal-to-background ratio (~11), excellent selectivity and good biocompatibility, which makes it a promising bioanalysis for a trypsin activity assay. PMID:25109643

  1. Locking-to-unlocking system is an efficient strategy to design DNA/silver nanoclusters (AgNCs) probe for human miRNAs

    DEFF Research Database (Denmark)

    Shah, Pratik; Choi, Suk Won; Kim, Ho-jin; Cho, Seok Keun; Bhang, Yong-Joo; Ryu, Moon Young; Thulstrup, Peter Waaben; Bjerrum, Morten Jannik; Yang, Seong Wook

    2016-01-01

    MicroRNAs (miRNAs), small non-coding RNA molecules, are important biomarkers for research and medical purposes. Here, we describe the development of a fast and simple method using highly fluorescent oligonucleotide-silver nanocluster probes (DNA/AgNCs) to efficiently detect specific miRNAs. Due to...... the great sequence diversity of miRNAs in humans and other organisms, a uniform strategy for miRNA detection is attractive. The concept presented is an oligonucleotide-based locking-to-unlocking system that can be endowed with miRNA complementarity while maintaining the same secondary structure. The...... strategy successfully can detect a number of cancer related miRNAs in RNA extracts from human cancer cell lines....

  2. Locking-to-unlocking system is an efficient strategy to design DNA/silver nanoclusters (AgNCs) probe for human miRNAs.

    Science.gov (United States)

    Shah, Pratik; Choi, Suk Won; Kim, Ho-Jin; Cho, Seok Keun; Bhang, Yong-Joo; Ryu, Moon Young; Thulstrup, Peter Waaben; Bjerrum, Morten Jannik; Yang, Seong Wook

    2016-04-01

    MicroRNAs (miRNAs), small non-coding RNA molecules, are important biomarkers for research and medical purposes. Here, we describe the development of a fast and simple method using highly fluorescent oligonucleotide-silver nanocluster probes (DNA/AgNCs) to efficiently detect specific miRNAs. Due to the great sequence diversity of miRNAs in humans and other organisms, a uniform strategy for miRNA detection is attractive. The concept presented is an oligonucleotide-based locking-to-unlocking system that can be endowed with miRNA complementarity while maintaining the same secondary structure. The locking-to-unlocking system is based on fold-back anchored DNA templates that consist of a cytosine-rich loop for AgNCs stabilization, an miRNA recognition site and an overlap region for hairpin stabilization. When an miRNA is recognized, fluorescence in the visible region is specifically extinguished in a concentration-dependent manner. Here, the exact composition of the fold-back anchor for the locking-to-unlocking system has been systematically optimized, balancing propensity for loop-structure formation, encapsulation of emissive AgNCs and target sensitivity. It is demonstrated that the applied strategy successfully can detect a number of cancer related miRNAs in RNA extracts from human cancer cell lines. PMID:26681688

  3. Synthesis of unidirectional structures of SiO{sub 2}-Ag using Au nanoparticles as nucleation centers; Sintesis de estructuras unidireccionales de SiO{sub 2}-Ag utilizando nanoparticulas de Au como centros de nucleacion

    Energy Technology Data Exchange (ETDEWEB)

    Villa S, G.; Mendoza A, D.; Gutierrez W, C.; Perez H, R. [ININ, Carretera Mexico-Toluca s/n, Ocoyoacac 52750, Estado de Mexico (Mexico)], e-mail: demetrio.mendoza@inin.gob.mx

    2008-07-01

    This paper reports a method to synthesize Ag unidirectional structures covered with SiO{sub 2} by sol-gel technique using Au nanoparticles as nucleation centers of the unidirectional structures. In the first phase unidirectional structures of SiO{sub 2}-Ag CI are obtained by sol-gel, using TEOS as a precursor of metallic structures (Ag) and the incorporation of Au nanoparticles as nucleation centers for growth of unidirectional structures. In the second stage, one-way systems are subjected to thermal treatment in H{sub 2} atmosphere for obtain AG{sup 0} particles through mechanisms that diffusion and coalescence of silver to form structures that have a thin cover of SiO{sub 2}. Analysis by scanning electron microscopy, transmission and atomic force microscopy allowed to determine the chemical composition and microstructural properties of unidirectional systems SiO{sub 2}-Ag. (Author)

  4. Quantum sized Ag nanocluster assisted fluorescence enhancement in Tm{sup 3+}-Yb{sup 3+} doped optical fiber beyond plasmonics

    Energy Technology Data Exchange (ETDEWEB)

    Chattopadhyay, Rik; Haldar, Arindam; Paul, Mukul C.; Das, Shyamal; Bhadra, Shyamal K., E-mail: skbhadra@cgcri.res.in [Fiber Optics and Photonics Division, CSIR-Central Glass and Ceramic Research Institute, 196, Raja S. C. Mullick Road, Kolkata 700032 (India)

    2015-12-07

    We report a process for enhancing fluorescence emission from conventional rare earth ions in optical fiber by metal nanocluster (MNC) in nonresonant indirect pumping. The process is completely different from formal metal enhanced fluorescence phenomenon as the MNCs are too small in size to support localized surface plasmon and the excitation wavelength is far from plasmon resonance frequency. We used an established theory of two coupled oscillators to explain the simultaneous enhancement of Ytterbium (Yb{sup 3+}) and Thulium (Tm{sup 3+}) emission by silver (Ag) NCs under nonresonant pumping in optical fiber. The fiber is pumped with a 980 nm fiber pigtailed laser diode with input power of 20–100 mW to excite the Yb{sup 3+}. Four times enhancement of Yb{sup 3+} emission of 900–1100 nm and Tm{sup 3+} upconversion emission around 474 nm, 650 nm, and 790 nm is observed in the fiber with Ag NCs.

  5. Nucleic-acid-programmed Ag-nanoclusters as a generic platform for visualization of latent fingerprints and exogenous substances.

    Science.gov (United States)

    Ran, Xiang; Wang, Zhenzhen; Zhang, Zhijun; Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2016-01-11

    We display a nucleic acid controlled AgNC platform for latent fingerprint visualization. The versatile emission of aptamer-modified AgNCs was regulated by the nearby DNA regions. Multi-color images for simultaneous visualization of fingerprints and exogenous components were successfully obtained. A quantitative detection strategy for exogenous substances in fingerprints was also established. PMID:26537157

  6. Nucleation, growth, and dissolution of Ag nanostructures formed in nanotubular J-aggregates of amphiphilic cyanine dyes

    CERN Document Server

    Polzer, Egon Steeg Frank; Qiao, Yan; Rabe, Jürgen P; Kirstein, Stefan

    2015-01-01

    The nucleation, growth, and dissolution of silver nanowires within tubular aggregates of the dye C8S3 are investigated. The tubular aggregates are formed in aqueous solution from amphiphilic dyes and the silver wires are grown from silver salt. Samples were investigated systematically and in detail using cryo-TEM and TEM at different time steps after addition of silver salt (AgNO3) and short illumination with blue light (420 nm) for production of nuclei. The enhanced concentration of silver ions in proximity of the aggregates surface leads to favoured growth of seeds at or within the aggregates. The early stage of the seed growth is observable by cryo-TEM and shows to be well separated and isolated. There are no indications that nuclei are formed at preferred defect sites at the aggregates which is interpreted as homogeneous nucleation. The spatial position of the majority of initially formed seeds discriminates between growth of particles at the outer surface of the aggregate or wires at the inner space. The...

  7. Ultrasensitive and universal fluorescent aptasensor for the detection of biomolecules (ATP, adenosine and thrombin) based on DNA/Ag nanoclusters fluorescence light-up system.

    Science.gov (United States)

    Zhu, Ying; Hu, Xiao-Chun; Shi, Shuo; Gao, Ru-Ru; Huang, Hai-Liang; Zhu, Yan-Yan; Lv, Xiao-Yan; Yao, Tian-Ming

    2016-05-15

    We report here an ultrasensitive strategy based on the recognition-induced conformational alteration of aptamer and fluorescence turn-on abilities of guanine-rich (G-rich) DNA sequence in proximity to silver nanoclusters for adenosine triphosphate (ATP), adenosine (A) and thrombin (TB) detection. Herein, we designed two tailored DNA sequences noted as complementary DNA (abbreviated as c-DNA) and signal probe DNA (abbreviated as s-DNA), respectively. c-DNA is designed as a special structure consisting of a sequence complementary to aptamer at the 3'-end and a guanine-rich DNA sequence at the 5'-end; s-DNA contains a cytosine-rich sequence responsible for Ag NCs templated synthesis at the 3'-end and a link sequence (part of aptamer) complementary to partial of the c-DNA at the 5'-end. In the presence of target, the aptamer associated with the target, resulting in the formation of duplex DNA (dsDNA), the DNA-Ag NCs thereafter could close to the guanine-rich sequence, leading to enhanced fluorescence signal readout. The widespread application of the sensing system is achieved success in the detection of three biomolecules. ATP, adenosine and thrombin in the range of 0.5-8.0 μM, 0.5-7.0 μM and 50-900 nM could be linearly detected with the detection limits of 91.6 nM, 103.4 nM and 8.4 nM, respectively. This label-free and turn-on fluorescent sensing system employing the mechanism proposed here turns out to be sensitive, selective, and convenient for the detection of biomolecules without washing and separation steps. PMID:26706942

  8. Gas-phase VUV photoionisation and photofragmentation of the silver deuteride nanocluster [Ag10D8L6](2+) (L = bis(diphenylphosphino)methane). A joint experimental and theoretical study.

    Science.gov (United States)

    Daly, Steven; Krstić, Marjan; Giuliani, Alexandre; Antoine, Rodolphe; Nahon, Laurent; Zavras, Athanasios; Khairallah, George N; Bonačić-Koutecký, Vlasta; Dugourd, Philippe; O'Hair, Richard A J

    2015-10-21

    The bis(diphenylphosphino)methane (L = Ph2PCH2PPh2) ligated silver deuteride nanocluster dication, [Ag10D8L6](2+), has been synthesised in the condensed phase via the reaction of bis(diphenylphosphino)methane, silver nitrate and sodium borodeuteride in the methanol : chloroform (1 : 1) mixed solvent system. The photoionisation and photofragmentation of this mass-selected cluster were studied using a linear ion trap coupled to the DESIRS VUV beamline of the SOLEIL Synchrotron. At 15.5 eV the main ionic products observed are [Ag10D8L5](2+), [Ag10D8L4](2+), [Ag10D8L6](3+)˙, [Ag9D8L4](2+)˙, and [AgL2](+). The later two products arise from fragmentation of [Ag10D8L6](3+)˙. An analysis of the yields of these product ions as a function of the photon energy reveals the onset for the formation of [AgL2](+) and [Ag9D8L4](2+)˙ is around 2 eV higher than that for ionisation to produce [Ag10D8L5](3+)˙. The onset of ionisation energy of [Ag10D8L6](2+) was determined to be 9.3 ± 0.3 eV from a fit of the yield of the product ion, [Ag10D8L6](3+)˙, as a function of the VUV photon energy. DFT calculations at the RI-PBE/RECP-def2-SVP level of theory were carried out to search for a possible structure of the cluster and to estimate its vertical and adiabatic ionisation energies. The calculated lowest energy structure of the [Ag10D8L6](2+) nanocluster contains a symmetrical bicapped square antiprism as a silver core in which hydrides are located as a mix of triangular faces and edges. Four of the bisphosphines bind to the edges of the cluster core as bidentate ligands, the remaining two bisphosphines bind via a single phosphorus donor atom to each of the apical silver atoms. The DFT calculated adiabatic ionisation energy for this structure is 8.54 eV, in satisfactory agreement with experiment. PMID:25827635

  9. A sensitive spectrofluorometric method for detection of berberine hydrochloride using Ag nanoclusters directed by natural fish sperm DNA.

    Science.gov (United States)

    Liang, Sheng; Kuang, Yangfang; Ma, Fangfang; Chen, Shu; Long, Yunfei

    2016-11-15

    A novel DNA-directed AgNCs (DNA-AgNCs) was synthesized with economical raw material (natural fish sperm DNA) through a simple and rapid approach, and it first showed high and stable fluorescence emission as a AgNCs stabilized by natural DNA at about 635nm. Moreover, its emission intensity could be enhanced tremendously in acetic acid (HAc) medium. Whereas, when berberine hydrochloride (BRH) entered the solution system, it would interact and combine efficiently with DNA on the surface of AgNCs, which could lead to subtle change of charge distribution on its surface, and make it more lyophobic, inducing aggregation of DNA-AgNCs. As a result, fluorescence of the system was quenched visually; the process represented a color variance from yellow to hot pink under HAc medium, then back to yellowish-brown when BRH worked. Based on above phenomenon, a selective and accurate spectrofluorometric method for BRH detection was established. It can be applied to detect trace amounts of BRH in aqueous solution in the linear range from 1.0nM to 2000.0nM; and the detection limit (3σ/k) was 0.3nM, which is pretty lower compared to most reported spectral methods. Simultaneously, a semi-quantitative determination by visual evaluation from 5.0nM to 2000.0nM was also achieved. This method provided excellent selectivity for the detection of BRH in the presence of ten kinds of common natural amino acids and nine kinds of common mental ions. Furthermore, the BRH content in compound berberine tablets from drugstore was successfully investigated by this method and the results showed high accuracy. PMID:27266661

  10. Synthesis, structural characterization, and gas-phase unimolecular reactivity of the silver hydride nanocluster [Ag3((PPh2)2CH2)3(μ3-H)](BF4)2.

    Science.gov (United States)

    Zavras, Athanasios; Khairallah, George N; Connell, Timothy U; White, Jonathan M; Edwards, Alison J; Mulder, Roger J; Donnelly, Paul S; O'Hair, Richard A J

    2014-07-21

    A bis(diphenylphosphino)methane-ligated trinuclear silver hydride nanocluster, [Ag3((Ph2P)2CH2)3(μ3-H)](BF4)2, featuring three silver(I) ions coordinated to a μ3-hydride, and its deuteride analogue, [Ag3((Ph2P)2CH2)3(μ3-D)](BF4)2, have been isolated and structurally characterized using electrospray ionization mass spectrometry (ESI-MS), X-ray crystallography, NMR and IR spectroscopy. The position of the deuteride in [Ag3((Ph2P)2CH2)3(μ3-D)](BF4)2 was determined by neutron diffraction. ESI-MS of [Ag3L3(μ3-H/D)](BF4)2 [L = ((Ph2P)2CH2)2] produces [Ag3L3(μ3-H/D)](2+) and [Ag3L3(μ3-H/D)(BF4)](+). A rich gas-phase ion chemistry of [Ag3L3(μ3-H/D)](2+) is observed under conditions of collision-induced dissociation (CID) and electron-capture dissociation (ECD). CID gives rise to the following complementary ion pairs: [Ag3L2](+) and [L+(H/D)](+); [Ag2(H/D)L2](+) and [AgL](+); [Ag2(H/D)L](+) and [AgL2](+). ECD gives rise to a number of dissociation channels including loss of the bis(phosphine) ligand, fragmentation of a coordinated bis(phosphine) ligand via C-P bond activation, and loss of a hydrogen (deuterium) atom with concomitant formation of [Ag3L3](+). Under CID conditions, [Ag3L3(μ3-H/D)(BF4)](+) fragments via ligand loss, the combined loss of a ligand and [H,B,F4], and cluster fragmentation to give [Ag2(BF4)L2](+) and [Ag2(L-H)L](+) [where (L-H) = (Ph2P)2CH(-)]. PMID:24991699

  11. Radiation-sustained nanocluster metastability in oxide dispersion strengthened materials

    Science.gov (United States)

    Ribis, J.; Bordas, E.; Trocellier, P.; Serruys, Y.; de Carlan, Y.; Legris, A.

    2015-12-01

    ODS materials constitute a new promising class of structural materials for advanced fission and fusion energy application. These Fe-Cr based ferritic steels contain ultra-high density of dispersion-strengthening nanoclusters conferring excellent mechanical properties to the alloy. Hence, guarantee the nanocluster stability under irradiation remain a critical issue. Nanoclusters are non-equilibrium multicomponent compounds (YTiCrO) forming through a complex nucleation pathway during the elaboration process. In this paper, it is proposed to observe the response of these nanoclusters when the system is placed far from equilibrium by means of ion beam. The results indicate that the Y, Ti, O and Cr atoms self-organized so that nanoclusters coarsened but maintain their non-equilibrium chemical composition. It is discussed that the radiation-sustained nanocluster metastability emerges from cooperative effects: radiation-induced Ostwald ripening, permanent creation of vacancies in the clusters, and fast Cr diffusion mediated by interstitials.

  12. Growth and melting of metallic nanoclusters in glass: A review of recent investigations

    Science.gov (United States)

    Kellermann, G.; Craievich, A. F.

    2008-12-01

    The mechanisms of nucleation and growth and the solid-to-liquid transition of metallic nanoclusters embedded in sodium borate glass were recently studied in situ via small-angle X-ray scattering (SAXS) and wide-angle X-ray scattering (WAXS). SAXS results indicate that, under isothermal annealing conditions, the formation and growth of Bi or Ag nanoclusters embedded in sodium borate glass occurs through two successive stages after a short incubation period. The first stage is characterized by the nucleation and growth of spherical metal clusters promoted by the diffusion of Bi or Ag atoms through the initially supersaturated glass phase. The second stage is named the coarsening stage and occurs when the (Bi-or Ag-) doping level of the vitreous matrix is close to the equilibrium value. The experimental results demonstrated that, at advanced stages of the growth process, the time dependence of the average radius and density number of the clusters is in agreement with the classical Lifshitz-Slyozov-Wagner (LSW) theory. However, the radius distribution function is better described by a lognormal function than by the function derived from the theoretical LSW model. From the results of SAXS measurements at different temperatures, the activation energies for the diffusion of Ag and Bi through sodium borate glass were determined. In addition, via combination of the results of simultaneous WAXS and SAXS measurements at different temperatures, the crystallographic structure and the dependence of melting temperature T m on crystal radius R of Bi nanocrystals were established. The experimental results indicate that T m is a linear and decreasing function of nanocrystal reciprocal radius 1/ R, in agreement with the Couchman and Jesser theoretical model. Finally, a weak contraction in the lattice parameters of Bi nanocrystals with respect to bulk crystals was established.

  13. Growth and melting of metallic nanoclusters in glass: A review of recent investigations

    International Nuclear Information System (INIS)

    The mechanisms of nucleation and growth and the solid-to-liquid transition of metallic nanoclusters embedded in sodium borate glass were recently studied in situ via small-angle X-ray scattering (SAXS) and wide-angle X-ray scattering (WAXS). SAXS results indicate that, under isothermal annealing conditions, the formation and growth of Bi or Ag nanoclusters embedded in sodium borate glass occurs through two successive stages after a short incubation period. The first stage is characterized by the nucleation and growth of spherical metal clusters promoted by the diffusion of Bi or Ag atoms through the initially supersaturated glass phase. The second stage is named the coarsening stage and occurs when the (Bi-or Ag-) doping level of the vitreous matrix is close to the equilibrium value. The experimental results demonstrated that, at advanced stages of the growth process, the time dependence of the average radius and density number of the clusters is in agreement with the classical Lifshitz-Slyozov-Wagner (LSW) theory. However, the radius distribution function is better described by a lognormal function than by the function derived from the theoretical LSW model. From the results of SAXS measurements at different temperatures, the activation energies for the diffusion of Ag and Bi through sodium borate glass were determined. In addition, via combination of the results of simultaneous WAXS and SAXS measurements at different temperatures, the crystallographic structure and the dependence of melting temperature Tm on crystal radius R of Bi nanocrystals were established. The experimental results indicate that Tm is a linear and decreasing function of nanocrystal reciprocal radius 1/R, in agreement with the Couchman and Jesser theoretical model. Finally, a weak contraction in the lattice parameters of Bi nanocrystals with respect to bulk crystals was established.

  14. Monodispersed bimetallic PdAg nanoparticles with twinned structures: Formation and enhancement for the methanol oxidation

    Science.gov (United States)

    Yin, Zhen; Zhang, Yining; Chen, Kai; Li, Jing; Li, Wenjing; Tang, Pei; Zhao, Huabo; Zhu, Qingjun; Bao, Xinhe; Ma, Ding

    2014-03-01

    Monodispersed bimetallic PdAg nanoparticles can be fabricated through the emulsion-assisted ethylene glycol (EG) ternary system. Different compositions of bimetallic PdAg nanoparticles, Pd80Ag20, Pd65Ag35 and Pd46Ag54 can be obtained via adjusting the reaction parameters. For the formation process of the bimetallic PdAg nanoparticles, there have two-stage growth processes: firstly, nucleation and growth of the primary nanoclusters; secondly, formation of the secondary nanoparticles with the size-selection and relax process via the coalescence or aggregation of the primary nanoclusters. The as-prepared PdAg can be supported on the carbon black without any post-treatment, which exhibited high electro-oxidation activity towards methanol oxidation under alkaline media. More importantly, carbon-supported Pd80Ag20 nanoparticles reveal distinctly superior activities for the methanol oxidation, even if compared with commercial Pt/C electro-catalyst. It is concluded that the enhanced activity is dependant on the unique twinning structure with heterogeneous phase due to the dominating coalescence growth in EG ternary system.

  15. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

    2015-08-05

    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

  16. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    International Nuclear Information System (INIS)

    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy

  17. Vacancy-controlled ultrastable nanoclusters in nanostructured ferritic alloys

    OpenAIRE

    Zhang, Z. W.; Yao, L.; Wang, X. -L.; Miller, M K

    2015-01-01

    A new class of advanced structural materials, based on the Fe-O-vacancy system, has exceptional resistance to high-temperature creep and excellent tolerance to extremely high-dose radiation. Although these remarkable improvements in properties compared to steels are known to be associated with the Y-Ti-O-enriched nanoclusters, the roles of vacancies in facilitating the nucleation of nanoclusters are a long-standing puzzle, due to the experimental difficulties in characterizing vacancies, part...

  18. Laboratory Study on Nucleating Properties and Microstructure of AgI Pyrotechnics%含 AgI 焰剂成冰性能与物化特征的实验研究

    Institute of Scientific and Technical Information of China (English)

    孔君; 王广河; 房文; 苏正军

    2016-01-01

    Two formulations (WMC-IN-001 and WMC-IN-002)of high efficient AgI pyrotechnics used in weather modification have been obtained after a number of screen tests were carried out in CAMS 1 m3 iso-thermal cloud chamber.The effectiveness can reach to 10 14 g-1 AgI at temperatures of -7℃ and colder for WMC-IN-001,and it can reach up to 10 15 g-1 AgI at -15℃.The foreign pyrotechnic was made according to the formulation of silver-spare (USSR).The ice nucleating properties of silver-spare and other five for-mulations of AgI pyrotechnics in the marketplace in 2011 was tested in the same chamber for comparison with the new pyrotechnics.The results show that the nucleating rates are very low for WMC-IN-001 and WMC-IN-002,and change less (in 40 -55 min)in the temperature range between -7 and -20℃.The aerosol particles produced by WMC-IN-001 are identified by environmental scanning electron microscope (ESEM)and energy disperse spectroscopy (EDS).The particle sizes are within 0.02-0.60 μm in diame-ter,and the mean cube-root diameter is 0.2472 μm.WMC-IN-001 aerosol has a pronounced bimodal size distribution with particles in the small diameter mode between 0.02 -0.10 μm and particles constituting the mode between 0.20-0.55 μm.The relatively large particle size may be one cause for the low nuclea-ting rates.%利用 CAMS 的1 m3等温云室系统筛选出新型高效 AgI 焰剂 WMC-IN-001和 WMC-IN-002。检测结果表明,它们具有较高的成核率,在-15℃时达到1015 g-1 AgI 量级,尤其在-7℃时 WMC-IN-001的成核率仍可达到1014 g-1 AgI 量级。同时给出对节银剂配方和2011年市场上主要的几种催化剂的检测结果进行对比。WMC-IN-001和 WMC-IN-002的成冰速率较慢,在各检测温度的成冰速率差异较小,均在40~55 min。利用冷场发射扫描电镜和能谱仪对 WMC-IN-001燃烧产生的气溶胶粒子作了物化特征分析,粒子分布在0.02~0.60μm,具有两个典型的模态:0.02

  19. A thermochromic silver nanocluster exhibiting dual emission character

    Science.gov (United States)

    Xu, Qing-Qing; Dong, Xi-Yan; Huang, Ren-Wu; Li, Bo; Zang, Shuang-Quan; Mak, Thomas C. W.

    2015-01-01

    A Ag12(SCH2C10H7)6(CF3CO2)6(CH3CN)6 (1) nanocluster modified using naphthalen-2-yl-methanethiol was synthesized and structurally characterized by single crystal X-ray analysis. The targeted luminescent nanocluster displays dual emission with the property of reversible thermochromism spanning from red to bright yellow.A Ag12(SCH2C10H7)6(CF3CO2)6(CH3CN)6 (1) nanocluster modified using naphthalen-2-yl-methanethiol was synthesized and structurally characterized by single crystal X-ray analysis. The targeted luminescent nanocluster displays dual emission with the property of reversible thermochromism spanning from red to bright yellow. Electronic supplementary information (ESI) available: Experimental section and supporting Fig. S1-S6. CCDC 1004246. For ESI and crystallographic data in CIF or other electronic format see DOI: 10.1039/c4nr05122j

  20. DNA-templated silver nanoclusters for multiplexed fluorescent DNA detection.

    Science.gov (United States)

    Zhang, Ying; Zhu, Changfeng; Zhang, Lei; Tan, Chaoliang; Yang, Jian; Chen, Bo; Wang, Lianhui; Zhang, Hua

    2015-03-25

    Novel label-free/conjugation-free molecular beacons are designed based on DNA templated-silver nanoclusters for multiplexed DNA detection. The assay is implemented in solution, which makes it easy for the in-situ and real-time analysis. This study demonstrates a new method for multiplexd detection of biological molecules by using fluorescent Ag nanocluster-based molecular beacon probes. PMID:25491417

  1. Nucleation and temperature-driven phase transitions of silicene superstructures on Ag(1 1 1)

    International Nuclear Information System (INIS)

    Silicene grown on Ag(1 1 1) is characterized by several critical parameters. Among them, the substrate temperature plays a key role in determining the morphology during growth. However, an unexpected important role is also equally played by the post-deposition annealing temperature which determines the self-organization of silicene domains even in the submonolayer coverage regime and consecutive transitions between silicene with different periodicity. These temperature-driven phase transitions can be exploited to select the desired majority silicene phase, thus allowing for the manipulation of silicene properties. (paper)

  2. RHEED studies of the nucleation, growth, and mobility of Ag atoms on the Si(111)7 x 7 surface

    Energy Technology Data Exchange (ETDEWEB)

    Roos, K.R.

    1993-07-01

    The low temperature and flux dependent growth of ultrathin Ag films on the Si(111)7x7 surface is studied with Reflection High-Energy Electron Diffraction (RHEED). The grazing incidence geometry of RHEED allows for an incident molecular beam normal to the surface, and makes it an ideal surface probe for studying ultrathin film growth in real time. Short-lived oscillations in the diffracted intensity are observed during Ag deposition at 150 K, indicating quasi-layer-by-layer growth mediated by adatom mobility. When the 150 K growth is performed over a wide range of deposition rates F, the peak intensity is observed to scale, i.e. I(Ft) depends only on the total amount deposited, which implies thermally activated diffusion is absent at 150 K. Scaling is not obeyed at higher temperatures (T{ge}473 K) for the growth of the {radical}3{times}{radical}3 R30{degrees} ({radical}3) superstructure. Testing for scaling of the diffracted intensity constitutes a new experimental method which can be applied generally to determine if thermal diffusion is active at a particular temperature. Scaling is consistent with a constant diffusion length R{sub 0}, independent of substrate temperature and deposition rate. The presence of a non-thermal diffusion mechanism (responsible for the constant diffusion length R{sub 0}) is confirmed by monitoring the flux dependence of the {radical}3 superstructure growth during deposition at T{ge}473 K. At these temperatures the total diffusion length R is given by R=R{sub 0}+(4Dt){sup 1/2}, where (4Dt){sup 1/2} is the thermal component. A non-zero intercept R{sub 0} is found by plotting the peak intensity I{sub p}{sup 1/2} (a measure of the average domain size) vs. deposition rate F{sup {minus}1/2} (F{sup {minus}1} is proportional to the available diffusion time.) From the FWHM of a low coverage (0.2 ML) {radical}3 spot, an estimation of 50 {angstrom} is made for a lower bound of the magnitude of R{sub 0}.

  3. RHEED studies of the nucleation, growth, and mobility of Ag atoms on the Si(111)7 x 7 surface

    International Nuclear Information System (INIS)

    The low temperature and flux dependent growth of ultrathin Ag films on the Si(111)7x7 surface is studied with Reflection High-Energy Electron Diffraction (RHEED). The grazing incidence geometry of RHEED allows for an incident molecular beam normal to the surface, and makes it an ideal surface probe for studying ultrathin film growth in real time. Short-lived oscillations in the diffracted intensity are observed during Ag deposition at 150 K, indicating quasi-layer-by-layer growth mediated by adatom mobility. When the 150 K growth is performed over a wide range of deposition rates F, the peak intensity is observed to scale, i.e. I(Ft) depends only on the total amount deposited, which implies thermally activated diffusion is absent at 150 K. Scaling is not obeyed at higher temperatures (T≥473 K) for the growth of the √3x√3 R30 degrees (√3) superstructure. Testing for scaling of the diffracted intensity constitutes a new experimental method which can be applied generally to determine if thermal diffusion is active at a particular temperature. Scaling is consistent with a constant diffusion length R0, independent of substrate temperature and deposition rate. The presence of a non-thermal diffusion mechanism (responsible for the constant diffusion length R0) is confirmed by monitoring the flux dependence of the √3 superstructure growth during deposition at T≥473 K. At these temperatures the total diffusion length R is given by R=R0+(4Dt)1/2, where (4Dt)1/2 is the thermal component. A non-zero intercept R0 is found by plotting the peak intensity Ip1/2 (a measure of the average domain size) vs. deposition rate F-1/2 (F-1 is proportional to the available diffusion time.) From the FWHM of a low coverage (0.2 ML) √3 spot, an estimation of 50 angstrom is made for a lower bound of the magnitude of R0

  4. Surface-enhanced Raman scattering (SERS) activity of Ag, Au and Cu nanoclusters on TiO2-nanotubes/Ti substrate

    International Nuclear Information System (INIS)

    Tubular arrays of TiO2 nanotubes (ranging in diameter from 40 to 110 nm) on a Ti substrate were used as a support for Ag, Au or Cu deposits obtained by the sputter deposition technique, where the amount of metal varied from 0.01 to 0.2 mg/cm2. Those composite supports were intended for surface-enhanced Raman scattering (SERS) investigations. Composite samples were studied with the aid of scanning electron microscopy (SEM) and Auger electron spectroscopy (AES) to reveal their characteristic morphological and chemical features. Raman spectra of pyridine (as a probe molecule) were measured at different cathodic potentials ranging from -0.2 down to -1.2 V after the pyridine had been adsorbed on the metal-covered TiO2 nanotube/Ti substrates. In addition, SERS spectra on a bulk standard activated Ag, Au and Cu substrates were also measured. The SERS activity of the composite samples was strongly dependent on the amount of metal deposit, e.g. at and above 0.06 mg Ag/cm2, the intensity of SERS signal was even higher than that for the Ag reference substrate. The high activity of these composites is mainly a result of their specific morphology. The high SERS sensitivity on the surface morphology of the substrate made it possible to monitor very small temporal changes in the Ag metal clusters. This rearrangement was not detectable with microscopic (SEM) or microanalytical (AES) methods. The SERS activity of Au or Cu clusters was distinctly lower than those of Ag. The spectral differences exhibited by the three kinds of composites as compared to the reference metal samples are discussed.

  5. Optical properties of multicomponent antimony-silver nanoclusters formed in silica by sequential ion implantation

    International Nuclear Information System (INIS)

    The linear and nonlinear optical properties of nanometer dimension metal colloids embedded in a dielectric depend explicitly on the electronic structure of the metal nanoclusters. The ability to control the electronic structure of the nanoclusters may make it possible to tailor the optical properties for enhanced performance. By sequential implantation of different metal ion species multi-component nanoclusters can be formed with significantly different optical properties than single element metal nanoclusters. The authors report the formation of multi-component Sb/Ag nanoclusters in silica by sequential implantation of Sb and Ag. Samples were implanted with relative ratios of Sb to Ag of 1:1 and 3:1. A second set of samples was made by single element implantations of Ag and Sb at the same energies and doses used to make the sequentially implanted samples. All samples were characterized using RBS and both linear and nonlinear optical measurements. The presence of both ions significantly modifies the optical properties of the composites compared to the single element nanocluster glass composites. In the sequentially implanted samples the optical density is lower, and the strong surface plasmon resonance absorption observed in the Ag implanted samples is not present. At the same time the nonlinear response of the these samples is larger than for the samples implanted with Sb alone, suggesting that the addition of Ag can increase the nonlinear response of the Sb particles formed. The results are consistent with the formation of multi-component Sb/Ag colloids

  6. DNA-regulated silver nanoclusters for label-free ratiometric fluorescence detection of DNA.

    Science.gov (United States)

    Liu, Lin; Yang, Qianhui; Lei, Jianping; Xu, Nan; Ju, Huangxian

    2014-11-18

    Two kinds of DNA-regulated Ag nanoclusters were one-pot synthesized on an oligonucleotide, and delicately utilized in the design of a label-free ratiometric fluorescence strategy for DNA detection with simplicity and high sensitivity. PMID:25247781

  7. Thin films composed of Ag nanoclusters dispersed in TiO2: Influence of composition and thermal annealing on the microstructure and physical responses

    Science.gov (United States)

    Borges, J.; Rodrigues, M. S.; Lopes, C.; Costa, D.; Couto, F. M.; Kubart, T.; Martins, B.; Duarte, N.; Dias, J. P.; Cavaleiro, A.; Polcar, T.; Macedo, F.; Vaz, F.

    2015-12-01

    Noble metal powders containing gold and silver have been used for many centuries, providing different colours in the windows of the medieval cathedrals and in ancient Roman glasses. Nowadays, the interest in nanocomposite materials containing noble nanoparticles embedded in dielectric matrices is related with their potential use for a wide range of advanced technological applications. They have been proposed for environmental and biological sensing, tailoring colour of functional coatings, or for surface enhanced Raman spectroscopy. Most of these applications rely on the so-called localised surface plasmon resonance absorption, which is governed by the type of the noble metal nanoparticles, their distribution, size and shape and as well as of the dielectric characteristics of the host matrix. The aim of this work is to study the influence of the composition and thermal annealing on the morphological and structural changes of thin films composed of Ag metal clusters embedded in a dielectric TiO2 matrix. Since changes in size, shape and distribution of the clusters are fundamental parameters for tailoring the properties of plasmonic materials, a set of films with different Ag concentrations was prepared. The optical properties and the thermal behaviour of the films were correlated with the structural and morphological changes promoted by annealing. The films were deposited by DC magnetron sputtering and in order to promote the clustering of the Ag nanoparticles the as-deposited samples were subjected to an in-air annealing protocol. It was demonstrated that the clustering of metallic Ag affects the optical response spectrum and the thermal behaviour of the films.

  8. Nanoclusters and Microparticles in Gases and Vapors

    CERN Document Server

    Smirnov, Boris M

    2012-01-01

    Research of processes involving Nanoclusters and Microparticleshas been developing fastin many fields of rescent research, in particular in materials science. To stay at the cutting edge of this development, a sound understanding of the processes is needed. In this work, several processes involving small particles are described, such as transport processes in gases, charging of small particles in gases, chemical processes, atom attachment and quenching of excited atomic particles on surfaces, nucleation, coagulation, coalescence and growth processes for particles and aggregates. This work pres

  9. Luminescent silver nanoclusters acting as a label-free photoswitch in metal ion sensing.

    Science.gov (United States)

    Ghosh, Subhadip; Anand, Uttam; Mukherjee, Saptarshi

    2014-03-18

    In this work, we report the application of protein-templated Ag nanoclusters as a luminescent photoswitch for the detection of metal ions. Ag nanoclusters were synthesized using the circulatory protein human serum albumin (HSA) as a template, whose synthetic procedure can be tuned to make them toggle between blue-emitting (Ag9:HSA) and red-emitting (Ag14:HSA) nanoclusters. The photoluminescence (PL) intensity of Ag9:HSA was quenched significantly in the presence of 1 mM Co(II) ions. However, the PL of these quenched nanoclusters was completely restored in the presence of 3 mM Zn(II) ions. This enables them to be used as dual sensors and can serve as luminescent turn "on" and "off" metal switches. In contrast, the Ag14:HSA did not exhibit any photoswitchable properties but was able to detect Hg(II) selectively and to a high detection limit (10 nM). The luminescent-based sensing properties of these Ag:NCs were further supported by our time-resolved studies. The present study exhibits a promising step toward the application of luminescent metal nanoclusters as potential metal sensors since by tuning their luminescent properties we were able to detect and quantify metal ions selectively and simultaneously switch their sensing behaviors. PMID:24528116

  10. Triplex molecular beacons for sensitive recognition of melamine based on abasic-site-containing DNA and fluorescent silver nanoclusters.

    Science.gov (United States)

    Wang, Ya; Sun, Qianqian; Zhu, Linling; Zhang, Junying; Wang, Fengyang; Lu, Linlin; Yu, Haijun; Xu, Zhiai; Zhang, Wen

    2015-05-01

    A melamine aptamer derived from an abasic-site-containing triplex molecular beacon (tMB) was designed and developed for sensitive recognition of melamine by integrating tMBs and fluorescent silver nanoclusters (Ag NCs). PMID:25865656

  11. Synthesis and Doping of Ligand-Protected Atomically-Precise Metal Nanoclusters

    KAUST Repository

    Aljuhani, Maha A.

    2016-05-01

    Rapidly expanding research in nanotechnology has led to exciting progress in a versatile array of applications from medical diagnostics to catalysis. This success resulted from the manipulation of the desired properties of nanomaterials by controlling their size, shape, and composition. Among the most thriving areas of research about nanoparticle is the synthesis and doping of the ligand-protected atomically-precise metal nanoclusters. In this thesis, we developed three different novel metal nanoclusters, such as doped Ag29 with five gold (Au) atoms leading to enhance its quantum yield with remarkable stability. We also developed half-doped (alloyed) cluster of Ni6 nanocluster with molybdenum (Mo). This enabled enhanced stability and better catalytic activity. The third metal nanocluster that we synthesized was Au28 nanocluster by using di-thiolate as the ligand stabilizer instead of mono-thiolate. The new metal clusters obtained have been characterized by spectroscopic, electrochemical and crystallographic methods.

  12. Effect of thermal treatment condition on the Ag precipitates in Al–Ag alloy studied by positron annihilation

    International Nuclear Information System (INIS)

    Formation of Ag precipitates in an Al–1 wt%Ag alloy after aging at different temperatures was studied by positron annihilation spectroscopy. It is found that the aggregation of Ag atoms takes place during natural aging process after the Al–Ag alloy was homogenized at 550 °C and quenched to room temperature water. The Ag nanoclusters could trap positrons and thus positron annihilation measurements give information on the precipitation of Ag atoms. After artificial aging at 120 °C, the Ag signal is enhanced, which indicates further aggregation of Ag atoms. However, after artificial aging of the sample at 200 °C, no Ag nanoclusters are observed. Instead, the quenched-in vacancies show gradual recovery during this aging process. This is probably due to the dissolving of Ag clusters into Al matrix at 200 °C. Furthermore, after the sample was first heat treated at 200 °C and then aged at 120 °C, Ag nanoclusters appear again. This implies that the formation of Ag precipitates during natural aging process is assisted by the quenched-in vacancies. Temperature dependence of the positron annihilation measurements indicates that Ag nanoclusters are shallow positron traps, which makes it difficult to observe the real-time Ag precipitation formation by positrons during artificial aging of Al–Ag alloy

  13. Luminescent composite polymer fibers: In situ synthesis of silver nanoclusters in electrospun polymer fibers and application

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Wenran, E-mail: gaoshang5566@126.com [State Key Laboratory of Supramolecular Structure and Materials, Institute of Theoretical Chemistry, Jilin University, Changchun 130012 (China); Wang, Xumei, E-mail: wxmddp@163.com [Chinese National Petroleum Corporation Bohai Drilling Engineering Company Limited, Tianjin 300457 (China); Xu, Weiqing, E-mail: xuwq@jlu.edu.cn [State Key Laboratory of Supramolecular Structure and Materials, Institute of Theoretical Chemistry, Jilin University, Changchun 130012 (China); Xu, Shuping, E-mail: xusp@jlu.edu.cn [State Key Laboratory of Supramolecular Structure and Materials, Institute of Theoretical Chemistry, Jilin University, Changchun 130012 (China)

    2014-09-01

    The purpose of this study is to prepare multifunctional polymer fibers. We report a simple and controllable method for in situ synthesis of Ag nanoclusters (NCs) in electrospun polymer fibers via a photochemical reaction. The prepared composite polymer fibers emit pink luminescence and the luminescence property can be optimized by pH and Ag(I) precursor concentration. The as-prepared Ag NCs in electrospun polymer fibers were mainly Ag{sub 2–5} with a quantum yield of 6.81% and a lifetime of 2.29 ns. The in situ growth of Ag NCs avoids excessive surface modifications which may cause the aggregation of Ag NCs in many ex situ assembly methods. The combination of Ag NCs with polymer fibers greatly improves the stability of Ag NCs and broadens their applications. The storage of Ag NCs becomes facilitative due to the formation of bulky mat. Furthermore, these luminescence composite polymer fibers show strong antibacterial activity against Staphylococcus aureus (S. aureus). - Highlights: • Luminescent composite polymer nanofibers were fabricated. • Ag nanoclusters were in situ growth in the electrospun nanofiber membrane. • The prepared Ag nanoclusters have high chemical stability and antibacterial ability.

  14. Linear and Nonlinear Optical Response in Silver Nanoclusters: Insight from a Computational Investigation.

    Science.gov (United States)

    Day, Paul N; Pachter, Ruth; Nguyen, Kiet A; Bigioni, Terry P

    2016-02-01

    We report a density functional theory (DFT) and time-dependent DFT (TDDFT) investigation of the thiolated silver nanoclusters [Ag44(SR)30](4-), Ag14(SR)12(PR'3)8, Ag31(SG)19, Ag32(SG)19, and Ag15(SG)11, which were synthesized and for which one-photon absorption (OPA) characterization is available. Our computational investigation based on careful examination of the exchange-correlation functional used in DFT geometry optimization and for the linear optical properties predictions by TDDFT, demonstrated good agreement with the measured linear absorption spectra, however dependent on the applied functional. Following the benchmarking, we evaluated the two-photon absorption (TPA) response using TDDFT, noting that accurate prediction of OPA is important for suppositions on the spectral range for TPA enhancement because of the sensitivity to the excitation energies. Although the TPA cross-section results are complicated by resonance effects and quantifying TPA cross sections for these systems is difficult, our results indicate that the nanoclusters Ag15 and Ag31/32 are likely to have large TPA cross sections. The spherical symmetry of the Ag44 and Ag14 nanoclusters leads to applicability of superatom theory, while it is not as useful for the more oblate geometries of the Ag15 and Ag31/32 systems. PMID:26730764

  15. Fluorescent silver nanoclusters for ultrasensitive determination of chromium(VI) in aqueous solution.

    Science.gov (United States)

    Zhang, Jian Rong; Zeng, Ai Lian; Luo, Hong Qun; Li, Nian Bing

    2016-03-01

    In this work, a simple and sensitive Cr(VI) sensor is proposed based on fluorescent polyethyleneimine-stabilized Ag nanoclusters, which allows the determination over a wide concentration range of 0.1 nM-3.0 μM and with a detection limit as low as 0.04 nΜ and a good selectivity. The quenching mechanism was discussed in terms of the absorption and fluorescence spectra, suggesting that Cr(VI) is connected to Ag nanoclusters by hydrogen bond between the oxygen atom at the vertex of tetrahedron structure of Cr(VI) and the amino nitrogen of polyethyleneimine that surrounded Ag nanoclusters and electron transfer from Ag nanoclusters to highly electron-deficient Cr(VI) results in fluorescence quenching. Despite the failure to quench the fluorescence efficiently, Cr(III) can also be measured using the proposed Ag nanoclusters by being oxidized to Cr(VI) in alkaline solution (pH ∼ 9) containing H2O2. Therefore, our approach could be used to detect Cr(VI), Cr(III) and the total chromium level in aqueous solution. In addition, Cr(VI) analysis in real water samples were satisfactory, indicating this method could be practically promising for chromium measurements. PMID:26546705

  16. Enhancing NIR emission of Yb{sup 3+} by silver nanoclusters in oxyfluoride glass

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Ronghua; Qian, Jiangyun; Cui, Shuo [State Key Laboratory of Silicon Materials, Department of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Qiao, Xvsheng, E-mail: qiaoxus@zju.edu.cn [State Key Laboratory of Silicon Materials, Department of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Wang, Feng [Department of Physics and Materials Science, City University of Hong Kong, 83 Tat Chee Avenue, Hong Kong SAR (China); City University of Hong Kong Shenzhen Research Institute, Shenzhen 518057 (China); Fan, Xianping [State Key Laboratory of Silicon Materials, Department of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China)

    2014-08-01

    Oxyfluoride glass comprising Yb{sup 3+} ions and Ag nanoclusters was prepared via a melt-quenching method. The molecule-like Ag clusters (ML-Ag) in the glass displayed broad absorption and emission bands in the ultraviolet (UV) and visible spectral regions, respectively. The luminescence quantum yield (QY) was determined to be higher than 90%. We observed energy transfer from ML-Ag nanoclusters to Yb{sup 3+} ions as evidenced by time resolved luminescence spectra, which resulted in a four-fold enhancement in NIR emission of Yb{sup 3+}. The luminescence enhancement effect described here would be applied to boost the efficiency of solar cells by converting high energy UV photons into NIR photons that better match the absorption of photovoltaic devices. - Highlights: • Molecule-like Ag nanoclusters were precipitated in the oxyfluoride glass hosts. • The glass had broadband white PL with quantum yield higher than 90%. • The Ag/Yb{sup 3+} codoped glass obtained 4-fold enhancement in NIR emission. • The PL enhancement was due to energy transfer from Ag nanoclusters to Yb{sup 3+}.

  17. Enhancing NIR emission of Yb3+ by silver nanoclusters in oxyfluoride glass

    International Nuclear Information System (INIS)

    Oxyfluoride glass comprising Yb3+ ions and Ag nanoclusters was prepared via a melt-quenching method. The molecule-like Ag clusters (ML-Ag) in the glass displayed broad absorption and emission bands in the ultraviolet (UV) and visible spectral regions, respectively. The luminescence quantum yield (QY) was determined to be higher than 90%. We observed energy transfer from ML-Ag nanoclusters to Yb3+ ions as evidenced by time resolved luminescence spectra, which resulted in a four-fold enhancement in NIR emission of Yb3+. The luminescence enhancement effect described here would be applied to boost the efficiency of solar cells by converting high energy UV photons into NIR photons that better match the absorption of photovoltaic devices. - Highlights: • Molecule-like Ag nanoclusters were precipitated in the oxyfluoride glass hosts. • The glass had broadband white PL with quantum yield higher than 90%. • The Ag/Yb3+ codoped glass obtained 4-fold enhancement in NIR emission. • The PL enhancement was due to energy transfer from Ag nanoclusters to Yb3+

  18. Tunable surface plasmon resonance of silver nanoclusters in ion exchanged soda lime glass

    International Nuclear Information System (INIS)

    Highlights: • Ag-glass nanocomposites were synthesized by silver ion exchange and annealing. • SPR of Ag-glass nanocomposites was tuned from 420 to 596 nm by annealing in air. • Subsequent annealing of nanocomposites in Ar + H2 reversed back SPR to 398 nm. • Formation/dissolution of Ag2O nanoshells around Ag nanoclusters lead to tunable SPR. - Abstract: Silver (Ag) nanoclusters embedded in soda lime glass were synthesized by Ag ion exchange followed by thermal annealing. The effects of annealing temperature, time and atmosphere on the plasmonic response, structural and optical properties of silver-glass nanocomposites have been investigated using UV–visible absorption spectroscopy and X-ray photoelectron spectroscopy (XPS). As exchanged sample exhibits surface plasmon resonance (SPR) band around 420 nm which showed regular red shift with increase in annealing temperature. A significant red shift of 176 nm (from 420 to 596 nm) and broadening of the SPR peak was observed for annealing in air at 450 °C. XPS studies on air annealed samples confirmed the presence of Ag2O in addition to Ag. Subsequent annealing at 250 °C in reducing atmosphere resulted in increase in intensity, narrowing and blue shift of the SPR peak to 398 nm. Our observations suggest that SPR tunability is mainly due to the formation and dissolution of Ag2O nanoshells around Ag nanoclusters in the near-surface region of glass during annealing in oxidizing and reducing atmosphere, respectively

  19. Influence of dose and ion concentration on formation of binary Al-Ni alloy nanoclusters

    Science.gov (United States)

    Abedini, Alam; Larki, Farhad; Saion, Elias; Zakaria, Azmi; Zobir Hussein, M.

    2012-10-01

    Colloidal Al-Ni nanoclusters were prepared in an aqueous polyvinyl alcohol solution containing aluminum chloride and nickel chloride as metal precursors, polyvinyl alcohol as a capping agent, isopropanol as a scavenger of hydroxyl radicals, and distilled water as a solvent. Gamma irradiations were carried out in a 60Co gamma source chamber at doses up to 100 kGy. The nanocluster properties were characterized by transmission electron microscopy (TEM), UV-visible spectrophotometry, and X-ray diffraction (XRD). By controlling the dose and precursor concentration, nanoclusters with different particle sizes were obtained. The average particle diameter increased with increase of precursor concentration and decreased with increase of dose. This is owing to the competition between nucleation, growth, and aggregation processes in the formation of nanoclusters during irradiation.

  20. A label-free DNA-templated silver nanocluster probe for fluorescence on-off detection of endonuclease activity and inhibition.

    Science.gov (United States)

    Qian, Yunxia; Zhang, Yaodong; Lu, Lu; Cai, Yanan

    2014-01-15

    Endonuclease cleavage of DNA plays an important role in biological and medicinal chemistry. This study aimed to develop a reliable and sensitive method for nuclease activity assay by combining the high specificity of DNA cleavage reactions with ultrahigh fluorescence turn-on abilities of guanine-rich (G-rich) DNA sequences in proximity to silver nanoclusters (Ag NCs). The DNA-templated Ag NC (DNA-Ag NC) probe with endonuclease recognition sequence consists of NC and a G-rich probe. The NC probe was designed by adding Ag NC nucleation sequence at the 5'-end. The G-rich probe is the complementary DNA sequence modified by adding a G-rich overhang sequence at the 3'-end. Thus, the fluorescence of DNA-Ag NC probe was activated because of DNA hybridization. When these DNA-Ag NC probes were exposed to the targeted endonucleases, specific DNA cleavages occurred, and pieces of G-rich DNA fragments separated from Ag NCs, resulting in fluorescence turn-off. The endonuclease activity was quantified by monitoring the change in the fluorescence intensity. Detection was demonstrated by assaying EcoRI activity. Under optimized conditions, the fluorescence reduction efficiency was linear with the EcoRI concentration in the range of 5.0×10(-4) U μL(-1) to 3.0×10(-3) U μL(-1), with a detection limit of 3.5×10(-4) U μL(-1), which is much better than or at least comparable with that in previous reports. The potential application of the proposed method for screening endonuclease inhibitors was also demonstrated. The presented assay protocol proved to be convenient, effective, sensitive, and easy in preparing the fluorescent probe. PMID:24001584

  1. Pressurized polyol synthesis of Al-doped ZnO nanoclusters with high electrical conductivity and low near-infrared transmittance

    International Nuclear Information System (INIS)

    Highlights: • Low-temperature pressurized polyol method synthesized Al-doped ZnO nanoclusters. • Reaction time affected the doping efficiency, resistivity, and NIR transmittance. • The near-IR blocking efficiency of Al-doped ZnO (AZO) nanoclusters reached 85%. • AZO nanocluster coatings could be used for heat reflectors or artificial glasses. - Abstract: In this study, a novel pressurized polyol method is proposed to synthesize aluminum-doped ZnO (AZO) nanoclusters without utilizing additional thermal treatment to avoid the merging of nanoclusters. The size of the AZO nanoclusters range from 100 to 150 nm with a resistivity of 204 Ω cm. The AZO nanoclusters primarily consist of approximately 10-nm nanocrystals that form a spherically clustered morphology. A two-stage growth model has been proposed based on the results of scanning electron microscopy and transmission electron microscopy images, nanocluster sizes, and X-ray diffraction patterns. The primary AZO nanocrystals first nucleate under pressurized conditions and then spontaneously aggregate into larger nanoclusters. Optically, the AZO nanoclusters exhibit a significant decrease in the near-infrared (NIR) transmittance compared to pure ZnO nanoparticles. The NIR blocking efficiency of AZO nanoclusters reached 85%. Moreover, the doping efficiency, resistivity, and NIR transmittance of AZO nanoclusters are influenced by the reaction time in the pressurized polyol solution. On the other hand, the reaction time has no effect on the particle size and crystallinity. An optically transparent coating for the AZO nanoclusters, which consisted of iso-propanol solvent and ultraviolet-curable acrylic binder, was also demonstrated

  2. Pressurized polyol synthesis of Al-doped ZnO nanoclusters with high electrical conductivity and low near-infrared transmittance

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ho-Nyun; Shin, Chi-Ho [Surface Technology R& BD Group, Korea Institute of Industrial Technology (KITECH), Incheon 406-840 (Korea, Republic of); Hwang, Duck Kun [Department of Corporate Diagnosis, Small and Medium Business Corporation, Seoul 150-718 (Korea, Republic of); Kim, Haekyoung [School of Materials Science and Engineering, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Oh, Kyeongseok [Department of Chemical and Environmental Technology, Inha Technical College, Incheon 402-752 (Korea, Republic of); Kim, Hyun-Jong, E-mail: hjkim23@kitech.re.kr [Surface Technology R& BD Group, Korea Institute of Industrial Technology (KITECH), Incheon 406-840 (Korea, Republic of)

    2015-09-25

    Highlights: • Low-temperature pressurized polyol method synthesized Al-doped ZnO nanoclusters. • Reaction time affected the doping efficiency, resistivity, and NIR transmittance. • The near-IR blocking efficiency of Al-doped ZnO (AZO) nanoclusters reached 85%. • AZO nanocluster coatings could be used for heat reflectors or artificial glasses. - Abstract: In this study, a novel pressurized polyol method is proposed to synthesize aluminum-doped ZnO (AZO) nanoclusters without utilizing additional thermal treatment to avoid the merging of nanoclusters. The size of the AZO nanoclusters range from 100 to 150 nm with a resistivity of 204 Ω cm. The AZO nanoclusters primarily consist of approximately 10-nm nanocrystals that form a spherically clustered morphology. A two-stage growth model has been proposed based on the results of scanning electron microscopy and transmission electron microscopy images, nanocluster sizes, and X-ray diffraction patterns. The primary AZO nanocrystals first nucleate under pressurized conditions and then spontaneously aggregate into larger nanoclusters. Optically, the AZO nanoclusters exhibit a significant decrease in the near-infrared (NIR) transmittance compared to pure ZnO nanoparticles. The NIR blocking efficiency of AZO nanoclusters reached 85%. Moreover, the doping efficiency, resistivity, and NIR transmittance of AZO nanoclusters are influenced by the reaction time in the pressurized polyol solution. On the other hand, the reaction time has no effect on the particle size and crystallinity. An optically transparent coating for the AZO nanoclusters, which consisted of iso-propanol solvent and ultraviolet-curable acrylic binder, was also demonstrated.

  3. Fully Hydrogenated Beryllium Nanoclusters.

    Science.gov (United States)

    Koukaras, Emmanuel N; Sgouros, Aris P; Sigalas, Michael M

    2016-03-01

    We present the ground state and energetically low structures of BenH2n nanoclusters as predicted using density functional theory (DFT) and employing the M06 meta-hybrid exchange-correlation functional. Results using the M06 functional are benchmarked against high accuracy coupled-cluster CCSD(T) and found to be in excellent agreement. For small values of n, the linear or polymeric form is the lowest energy geometry, while for sizes larger, n > 9 ring type and link type structures are the energetically lowest configurations. This trend has also been observed through ab initio molecular dynamics (AIMD) simulations at finite temperatures. In addition to the binding energies of the structures we report on polymerization energies, Be-H bond energies with respect to coordination details, hydrogen desorption energies of saturated and oversaturated species, as well as computed infrared spectra of all the ground state and energetically low lying structures presented. Furthermore, we find that the saturated polymeric forms of the nanoclusters cannot retain molecular hydrogen, in contrast to what is expected when zero point energy corrections are not taken into account. PMID:26906563

  4. DNA/RNA Detection Using DNA-Templated Few-Atom Silver Nanoclusters

    OpenAIRE

    Hsin-Chih Yeh; Werner, James H.; Babin, Mark C.; Cong Liu; Robert Austin Batson; Obliosca, Judy M.

    2013-01-01

    DNA-templated few-atom silver nanoclusters (DNA/Ag NCs) are a new class of organic/inorganic composite nanomaterials whose fluorescence emission can be tuned throughout the visible and near-IR range by simply programming the template sequences. Compared to organic dyes, DNA/Ag NCs can be brighter and more photostable. Compared to quantum dots, DNA/Ag NCs are smaller, less prone to blinking on long timescales, and do not have a toxic core. The preparation of DNA/Ag NCs is simple and there is n...

  5. Probing DNA-stabilized fluorescent silver nanocluster spectral heterogeneity by time-correlated single photon counting

    DEFF Research Database (Denmark)

    Carro, Miguel; Paolucci, Valentina; Hooley, Emma Nicole; Latterini, Loredana; Vosch, Tom André Jos

    2016-01-01

    DNA-stabilized silver nanoclusters (DNA-AgNCs) are promising fluorophores whose photophysical properties and synthesis procedures have received increased attention in the literature. However, depending on the preparation conditions and the DNA sequence, the DNA-AgNC samples can host a range of...... spectral heterogeneity of other fluorophores, such as luminescent colloidal nanoparticles, and to assess the reproducibility of a synthetic procedure containing an unknown distribution of emissive species....

  6. Fluorescence enhancement of DNA-silver nanoclusters from guanine proximity

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, Hsin-chih [Los Alamos National Laboratory; Sharma, Jaswinder [Los Alamos National Laboratory; Yoo, Hyojong [Los Alamos National Laboratory; Martinez, Jennifer S [Los Alamos National Laboratory

    2010-01-01

    Oligonucleotide-templated, silver nanoclusters (DNA/Ag NCs) are a versatile set of fluorophores and have already been used for live cell imaging, detection of specific metal ions, and single-nucleotide variation identification. Compared to commonly used organic dyes, these fluorescent nanoclusters have much better photostability and are often a few times brighter. Owing to their small size, simple preparation, and biocompatibility (i.e. made of nontoxic metals), DNA/Ag NCs should find more applications in biological imaging and chemical detection in the years to come. While clearly promising as new fluorophores, DNA/Ag NCs possess a unique and poorly understood dynamic process not shared by organic dyes or photoluminescent nanocrystals - the conversion among different NC species due to silver oxidation/reduction or NC regrouping. While this environmental sensitivity can be viewed as a drawback, in the appropriate context, it can be used as a sensor or reporter. Often reversible, conversions among different NC species have been found to depend upon a number of factors, including time, temperature, oxygen and salt content. In this communication, we report significant fluorescence enhancement of DNA/Ag NCs via interactions with guanine-rich DNA sequences. Moreover, we demonstrated this property can be used for sensitive detection of specific target DNA from a human oncogene (i.e. Braf gene).

  7. Fluorescent silver nanoclusters stabilized by DNA scaffolds.

    Science.gov (United States)

    Yuan, Zhiqin; Chen, Ying-Chieh; Li, Hung-Wen; Chang, Huan-Tsung

    2014-09-01

    Fluorescent silver nanoclusters, in particular DNA stabilized (templated) silver nanoclusters, have attracted much attention because of their molecule-like optical properties, strong fluorescence and good biocompatibility. In this feature article, we summarize the DNA stabilized silver nanoclusters from the viewpoints of synthesis, optical properties, as well as recent applications in biological detection and imaging. PMID:24901353

  8. Silver nanocluster films as novel SERS substrates for ultrasensitive detection of molecules

    Science.gov (United States)

    Upender, G.; Satyavathi, R.; Raju, B.; Shadak Alee, K.; Narayana Rao, D.; Bansal, C.

    2011-08-01

    Highly reproducible, active and stable SERS substrates were prepared by a nanocluster deposition system. SERS studies were carried out on these substrates with R6G as a test molecule using near Raman resonant and off resonant laser excitation wavelengths. Our results show that Ag nanoclusters of average particle size of (157 ± 119) nm act as very good SERS substrates for the ultra trace detection of R6G with an AEF of 2 × 10 12 corresponding to a detection limit of 10 -16 M. The present substrates could improve the detection limit of R6G by two orders of magnitude as compared to the previous reports.

  9. Influence of dose and ion concentration on formation of binary Al–Ni alloy nanoclusters

    International Nuclear Information System (INIS)

    Colloidal Al–Ni nanoclusters were prepared in an aqueous polyvinyl alcohol solution containing aluminum chloride and nickel chloride as metal precursors, polyvinyl alcohol as a capping agent, isopropanol as a scavenger of hydroxyl radicals, and distilled water as a solvent. Gamma irradiations were carried out in a 60Co gamma source chamber at doses up to 100 kGy. The nanocluster properties were characterized by transmission electron microscopy (TEM), UV–visible spectrophotometry, and X-ray diffraction (XRD). By controlling the dose and precursor concentration, nanoclusters with different particle sizes were obtained. The average particle diameter increased with increase of precursor concentration and decreased with increase of dose. This is owing to the competition between nucleation, growth, and aggregation processes in the formation of nanoclusters during irradiation. - Highlights: ► Synthesized Al–Ni bimetallic nanoparticles by the gamma-ray induced method. ► Examined how changes in ion concentration affect particle size. ► Increasing dose can decrease the size of bimetallic nanoparticles. ► Nanoparticles in uniform size distribution are obtained at higher dose. ► Nucleation and aggregation rates can change the size of nanoparticles.

  10. Ligand-free Ni nanocluster formation at atmospheric pressure via rapid quenching in a microplasma process

    Science.gov (United States)

    Kumar, Ajay; Kang, Seungkoo; Larriba-Andaluz, Carlos; Ouyang, Hui; Hogan, Christopher J.; Mohan Sankaran, R.

    2014-09-01

    The production of metal nanoclusters composed of less than 103 atoms is important for applications in energy conversion and medicine, and for fundamental studies of nanomaterial nucleation and growth. Unfortunately, existing synthesis methods do not enable adequate control of cluster formation, particularly at atmospheric pressure wherein formation typically occurs on sub-millisecond timescales. Here, we demonstrate that ligand-free, unagglomerated nickel nanoclusters can be continuously synthesized at atmospheric pressure via the decomposition of bis(cyclopentadienyl)nickel(II) (nickelocene) in a spatially-confined microplasma process that rapidly quenches particle growth and agglomeration. The clusters were measured on line by ion mobility spectrometry (IMS) and further analyzed by atomic force microscopy (AFM). Our results reveal that stable clusters with spherical equivalent mean diameters below 10 \\dot{A} are produced, and by controlling the nickelocene concentration, the mean diameter can be tuned up to ˜50 \\dot{A}. Although diameter is often the sole metric used in nanocluster and nanoparticle characterization, to infer the number of atoms in AFM and IMS detected clusters, we compare measured AFM heights and IMS inferred collision cross sections to theoretical predictions based on both bulk matter approximations and density functional theory and Hartree-Fock calculated Ni nanocluster structures (composed of 2-15 atoms for the latter). The calculations suggest that Ni nanoclusters composed of less than 102 atoms can be produced repeatably with simple microplasma reactors.

  11. Resonant Nucleation

    CERN Document Server

    Gleiser, M; Gleiser, Marcelo; Howell, Rafael

    2004-01-01

    We investigate the role played by fast quenching on the decay of metastable (or false vacuum) states. Instead of the exponentially-slow decay rate per unit volume, $\\Gamma_{\\rm HN} \\sim \\exp[-E_b/k_BT]$ ($E_b$ is the free energy of the critical bubble), predicted by Homogeneous Nucleation theory, we show that under fast enough quenching the decay rate is, in fact, a power law $\\Gamma_{\\rm RN} \\sim [E_b/k_BT]^{-B}$, where $B$ is weakly sensitive to the temperature. We argue that the fast quench generates large-amplitude fluctuations about the metastable state which promote its rapid decay via parametric resonance. Possible decay mechanisms and their dependence on $E_b$ are proposed and illustrated in a (2+1)-dimensional scalar field model with an asymmetric double-well potential.

  12. Target-induced quenching for highly sensitive detection of nucleic acids based on label-free luminescent supersandwich DNA/silver nanoclusters.

    Science.gov (United States)

    Wang, Guangfeng; Zhu, Yanhong; Chen, Ling; Wang, Lun; Zhang, Xiaojun

    2014-01-01

    Luminescent silver nanoclusters (AgNCs) were anchored by designed oligonucleotides, acting as fluorescent labels. They hybridized with specific nucleic acid targets to form a supersandwich structure resulting in the fluorescence intensity of the DNA/AgNCs decreasing linearly with respect to the concentration of the target DNA. PMID:24244937

  13. Carbon nanocluster growth inside micropipes during the SiC bulk growth process

    International Nuclear Information System (INIS)

    Carbon nanocluster growth inside micropipes has been discovered during the SiC bulk growth process under near-equilibrium conditions. Measurements have been made of the morphology and structure of the carbon crystallites. An isobaric cross-section of the Si–C phase diagram and an isothermal cross-section of the triple Si–C–Ar system have been built. The C-cluster nucleation and growth conditions have been analyzed using a phase diagram. (papers)

  14. Copper ion detection using novel silver nanoclusters stabilized with amido black 10B.

    Science.gov (United States)

    Ma, Fangfang; Liang, Sheng; Peng, Yibo; Kuang, Yangfang; Zhang, Xing; Chen, Shu; Long, Yunfei; Zeng, Rongjin

    2016-05-01

    Novel fluorescent silver nanoclusters (AgNCs) were synthesized using amido black 10B (AB) as a stabilizing agent and then employed for the detection of copper ions (Cu(2+)). The AB-stabilized AgNCs (AB-AgNCs) were well dispersed in aqueous solution with an average diameter of around 1.3 nm and exhibited illustrious blue fluorescence emission. Moreover, the fluorescence of AB-AgNCs could be quenched efficiently by Cu(2+), which might be a result of the coordination between Cu(2+) and the free recognition group of AB on surfaces of AB-AgNCs, inducing the aggregation of AB-AgNCs. Based on the linear decrease of fluorescence intensity, the Cu(2+) concentration was determined in the range of 0.01-1.1 μmol L(-1) and the limit of detection (LOD) was 4.0 nΜ. In addition, the detection of Cu(2+) could be performed with AB-AgNCs in the presence of other ions, including 13 kinds of conventional metal ions and 11 kinds of anions. Based on the above experiment, the developed AB-AgNC probe was successfully further applied to detect Cu(2+) in three electroplating effluents, which showed high accuracy. Graphical abstract The process of synthesised silver nanoclusters and the application for Cu(2+) detection. PMID:26873219

  15. Toward site-specific, homogeneous and highly stable fluorescent silver nanoclusters fabrication on triplex DNA scaffolds

    OpenAIRE

    Feng, Lingyan; Huang, Zhenzhen; Ren, Jinsong; Qu, Xiaogang

    2012-01-01

    A new strategy to create site-specific, homogeneous, and bright silver nanoclusters (AgNCs) with high-stability was demonstrated by triplex DNA as template. By reasonable design of DNA sequence, homogeneous Ag2 cluster was obtained in the predefined position of CG.C+ site of triplex DNA. This strategy was also explored for controlled alignment of AgNCs on the DNA nanoscaffold. To the best of our knowledge, this was the first example to simultaneously answer the challenges of excellent site-sp...

  16. Silver Nanoclusters for High-Efficiency Quenching of CdS Nanocrystal Electrochemiluminescence and Sensitive Detection of microRNA.

    Science.gov (United States)

    Zhang, Yan-Yan; Feng, Qiu-Mei; Xu, Jing-Juan; Chen, Hong-Yuan

    2015-12-01

    In this work, oligonucleotide-encapusulated silver nanoclusters were applied in the electrochemiluminescence (ECL) system of CdS nanocrystals (NCs)/ K2S2O8 based on dual ECL quenching effects. We found that the ECL emission of CdS NCs matched well with the absorption band of oligonucleotide encapsulated Ag nanoclusters, which could act as the energy acceptor of CdS NCs ECL so as to lead to an effective ECL resonance energy transfer (RET). On the other hand, the Ag nanoclusters could also catalyze electrochemical reduction of K2S2O8, resulting in increased consumption of ECL coreactant near the working electrode and decreased ECL intensity from CdS NCs. On the basis of the dual ECL quenching effects, a sensitive ECL biosensor for detection of microRNA was successfully achieved with a wide linear range from 10 fM to 100 pM. PMID:26561442

  17. Synthesis of silver nanoclusters, characterization and application to trace level sensing of nitrate in aqueous media

    International Nuclear Information System (INIS)

    Highlights: • Simple and elegant potentiostatic method is described for synthesis of silver nanoclusters. • Micellar stabilized silver nanoclusters have been extensively characterized. • Designed square wave voltammetry based nitrate sensor. • The sensitivity and limit of detection are several orders lower compared to hitherto reported sensors. -- Abstract: We report here the synthesis of surfactant stabilized silver nanoclusters onto a silver disc electrode by simple potentiostatic method. Characterization of silver nanoclusters by spectral (UV–vis, fluorescence, matrix-assisted laser desorption ionization time-of-flight mass spectroscopy (MALDI-TOF-MS), energy dispersive X-ray spectroscopy (EDX)), morphological (transmission electron microscopy (TEM)) and electrochemical techniques is described. The silver nanocluster modified electrode is used for square wave voltammetric sensing of traces of nitrate. The results of electroanalytical experiments reveal that the designed sensor has a very low detection limit of 1.5 × 10−15 mol dm−3 and wide linear response range from 1 × 10−14 to 1 × 10−7 mol dm−3 with R2 value of 0.9936 for nitrate. The sensor shows a good precision of 1.2% (n = 3) at 10−12 mol dm−3 of nitrate. Electrocatalytic studies undertaken with AgNC modified electrode in 0.1 mol dm−3 NaH2PO4 buffer solution (pH 4.5) containing 10−8 mol dm−3 NO3− by scan rate variation and single step chronoamperometric studies

  18. Silver-gold alloy nanoclusters as a fluorescence-enhanced probe for aluminum ion sensing.

    Science.gov (United States)

    Zhou, Ting-yao; Lin, Li-ping; Rong, Ming-cong; Jiang, Ya-qi; Chen, Xi

    2013-10-15

    In this paper, the development of a simple method is described for preparing highly red fluorescent mercaptosuccinic acid stabilized AgAu alloy nanoclusters (MSA-AgAu NCs) through the core etching of Ag nanoparticles (NPs) and a galvanic exchange reaction using nonorganic solvent and no multistep centrifuge washing. The as-prepared MSA-AgAu NCs were characterized using spectroscopic and microscopic techniques. After covalently attaching methoxy-poly(ethylene glycol)-NH2 (m-PEG-NH2), PEGylated MSA-AgAu NCs were still stable even in 1 M NaCl. Probably based on the deposition of Al(3+)-enhanced fluorescence, the PEGylated MSA-AgAu NCs offered highly selective and sensitive sensing of Al(3+) in aqueous solution with a detection limit of 0.8 μM. PMID:24016136

  19. DNA/RNA Detection Using DNA-Templated Few-Atom Silver Nanoclusters.

    Science.gov (United States)

    Obliosca, Judy M; Liu, Cong; Batson, Robert Austin; Babin, Mark C; Werner, James H; Yeh, Hsin-Chih

    2013-01-01

    DNA-templated few-atom silver nanoclusters (DNA/Ag NCs) are a new class of organic/inorganic composite nanomaterials whose fluorescence emission can be tuned throughout the visible and near-IR range by simply programming the template sequences. Compared to organic dyes, DNA/Ag NCs can be brighter and more photostable. Compared to quantum dots, DNA/Ag NCs are smaller, less prone to blinking on long timescales, and do not have a toxic core. The preparation of DNA/Ag NCs is simple and there is no need to remove excess precursors as these precursors are non-fluorescent. Our recent discovery of the fluorogenic and color switching properties of DNA/Ag NCs have led to the invention of new molecular probes, termed NanoCluster Beacons (NCBs), for DNA detection, with the capability to differentiate single-nucleotide polymorphisms by emission colors. NCBs are inexpensive, easy to prepare, and compatible with commercial DNA synthesizers. Many other groups have also explored and taken advantage of the environment sensitivities of DNA/Ag NCs in creating new tools for DNA/RNA detection and single-nucleotide polymorphism identification. In this review, we summarize the recent trends in the use of DNA/Ag NCs for developing DNA/RNA sensors. PMID:25586126

  20. DNA/RNA Detection Using DNA-Templated Few-Atom Silver Nanoclusters

    Directory of Open Access Journals (Sweden)

    Hsin-Chih Yeh

    2013-04-01

    Full Text Available DNA-templated few-atom silver nanoclusters (DNA/Ag NCs are a new class of organic/inorganic composite nanomaterials whose fluorescence emission can be tuned throughout the visible and near-IR range by simply programming the template sequences. Compared to organic dyes, DNA/Ag NCs can be brighter and more photostable. Compared to quantum dots, DNA/Ag NCs are smaller, less prone to blinking on long timescales, and do not have a toxic core. The preparation of DNA/Ag NCs is simple and there is no need to remove excess precursors as these precursors are non-fluorescent. Our recent discovery of the fluorogenic and color switching properties of DNA/Ag NCs have led to the invention of new molecular probes, termed NanoCluster Beacons (NCBs, for DNA detection, with the capability to differentiate single-nucleotide polymorphisms by emission colors. NCBs are inexpensive, easy to prepare, and compatible with commercial DNA synthesizers. Many other groups have also explored and taken advantage of the environment sensitivities of DNA/Ag NCs in creating new tools for DNA/RNA detection and single-nucleotide polymorphism identification. In this review, we summarize the recent trends in the use of DNA/Ag NCs for developing DNA/RNA sensors.

  1. A "turn-on" silver nanocluster based fluorescent sensor for folate receptor detection and cancer cell imaging under visual analysis.

    Science.gov (United States)

    Jiang, Hong; Xu, Gang; Sun, Yimin; Zheng, Weiwei; Zhu, Xiangxiang; Wang, Baojuan; Zhang, Xiaojun; Wang, Guangfeng

    2015-07-28

    A novel terminal protection based label-free and "turn-on" fluorescent sensor for detection of folate receptors (FRs) and HeLa cells is developed by fluorescence resonance energy transfer (FRET) between single-walled carbon nanotubes (SWCNTs) and silver nanoclusters (AgNCs). Multilevel visual analysis (m(2)VA) was firstly proposed and applied in optimizing the experimental parameters. PMID:26108636

  2. A universal design for a DNA probe providing ratiometric fluorescence detection by generation of silver nanoclusters.

    Science.gov (United States)

    Del Bonis-O'Donnell, Jackson Travis; Vong, Daniel; Pennathur, Sumita; Fygenson, Deborah Kuchnir

    2016-08-14

    DNA-stabilized silver nanoclusters (AgNCs), the fluorescence emission of which can rival that of typical organic fluorophores, have made possible a new class of label-free molecular beacons for the detection of single-stranded DNA. Like fluorophore-quencher molecular beacons (FQ-MBs) AgNC-based molecular beacons (AgNC-MBs) are based on a single-stranded DNA that undergoes a conformational change upon binding a target sequence. The new conformation exposes a stretch of single-stranded DNA capable of hosting a fluorescent AgNC upon reduction in the presence of Ag(+) ions. The utility of AgNC-MBs has been limited, however, because changing the target binding sequence unpredictably alters cluster fluorescence. Here we show that the original AgNC-MB design depends on bases in the target-binding (loop) domain to stabilize its AgNC. We then rationally alter the design to overcome this limitation. By separating and lengthening the AgNC-stabilizing domain, we create an AgNC-hairpin probe with consistent performance for arbitrary target sequence. This new design supports ratiometric fluorescence measurements of DNA target concentration, thereby providing a more sensitive, responsive and stable signal compared to turn-on AgNC probes. Using the new design, we demonstrate AgNC-MBs with nanomolar sensitivity and singe-nucleotide specificity, expanding the breadth of applicability of these cost-effective probes for biomolecular detection. PMID:27406901

  3. Fluorescent silver nanoclusters as DNA probes

    Science.gov (United States)

    Obliosca, Judy M.; Liu, Cong; Yeh, Hsin-Chih

    2013-08-01

    Fluorescent silver nanoclusters (few atoms, quantum sized) have attracted much attention as promising substitutes for conventional fluorophores. Due to their unique environmental sensitivities, new fluorescent probes have been developed based on silver nanoclusters for the sensitive and specific detection of DNA. In this review we present the recent discoveries of activatable and color-switchable properties of DNA-templated silver nanoclusters and discuss the strategies to use these new properties in DNA sensing.

  4. Equilibrium Gold Nanoclusters Quenched with Biodegradable Polymers

    OpenAIRE

    Murthy, Avinash K.; Stover, Robert J.; Borwankar, Ameya U.; Nie, Golay D.; Gourisankar, Sai; Truskett, Thomas M.; Konstantin V. Sokolov; Johnston, Keith P.

    2012-01-01

    Although sub-100 nm nanoclusters of metal nanoparticles are of interest in many fields including biomedical imaging, sensors and catalysis, it has been challenging to control their morphologies and chemical properties. Herein, a new concept is presented to assemble equilibrium Au nanoclusters of controlled size by tuning the colloidal interactions with a polymeric stabilizer, PLA(1k)-b-PEG(10k)-b-PLA(1k). The nanoclusters form upon mixing a dispersion of ~5 nm Au nanospheres with a polymer so...

  5. Fast magnetization reversal of nanoclusters in resonator

    OpenAIRE

    Yukalov, V. I.; Yukalova, E. P.

    2012-01-01

    An effective method for ultrafast magnetization reversal of nanoclusters is suggested. The method is based on coupling a nanocluster to a resonant electric circuit. This coupling causes the appearance of a magnetic feedback field acting on the cluster, which drastically shortens the magnetization reversal time. The influence of the resonator properties, nanocluster parameters, and external fields on the magnetization dynamics and reversal time is analyzed. The magnetization reversal time can ...

  6. Silver Nanoclusters: From Design Principles to Practical Applications

    KAUST Repository

    Abdulhalim, Lina G.

    2015-12-08

    A strategy based on reticulating metal ions and organic ligands into atomically precise gold and silver nanoclusters (NCs) with high monodispersity has been advanced to a point that allows the design of NCs with strict stoichiometries, functionalities and valence. Of the Ag NCs discovered, Ag44 is the most studied, not only due to its high absorption that transcends the visible spectrum suitable for photovoltaics but also because of its long excited state lifetime, as revealed by nanosecond transient absorption spectroscopy. A major principle discovered in this dissertation is the ability to produce Ag44 in scalable amounts and with high stability in addition to modulation of the functional groups of the organic ligands via a fast and complete ligand exchange process. This new discovery has led to the development of synthetic designs in which new sizes were obtained by varying the reaction parameters (e.g., ligands functionality, reaction temperature and time), namely, Ag29 using dithiols and phosphines. The synthesized NCs possess tetravalent functionalities that facilitate their crystallization and characterization. Furthermore, Ag29 glows red and is therefore a possible candidate for sensing and imaging applications.

  7. Switching a Nanocluster Core from Hollow to Non-hollow

    KAUST Repository

    Bootharaju, Megalamane Siddaramappa

    2016-03-24

    Modulating the structure-property relationship in atomically precise nanoclusters (NCs) is vital for developing novel NC materials and advancing their applications. While promising biphasic ligand-exchange (LE) strategies have been developed primarily to attain novel NCs, understanding the mechanistic aspects involved in tuning the core and the ligand-shell of NCs in such biphasic processes is challenging. Here, we design a single phase LE process that enabled us to elucidate the mechanism of how a hollow NC (e.g., [Ag44(SR)30]4-, -SR: thiolate) converts into a non-hollow NC (e.g., [Ag25(SR)18]-), and vice versa. Our study reveals that the complete LE of the hollow [Ag44(SPhF)30]4- NCs (–SPhF: 4-fluorobenzenethiolate) with incoming 2,4-dimethylbenzenethiol (HSPhMe2) induced distortions in the Ag44 structure forming the non-hollow [Ag25(SPhMe2)18]- by a disproportionation mechanism. While the reverse reaction of [Ag25(SPhMe2)18]- with HSPhF prompted an unusual dimerization of Ag25, followed by a rearrangement step that reproduces the original [Ag44(SPhF)30]4-. Remarkably, both the forward and the backward reactions proceed through similar size intermediates that seem to be governed by the boundary conditions set by the thermodynamic and electronic stability of the hollow and non-hollow metal cores. Furthermore, the resizing of NCs highlights the surprisingly long-range effect of the ligands which are felt by atoms far deep in the metal core, thus opening a new path for controlling the structural evolution of nanoparticles.

  8. High photostability and enhanced fluorescence of gold nanoclusters by silver doping

    Science.gov (United States)

    Le Guével, Xavier; Trouillet, Vanessa; Spies, Christian; Li, Ke; Laaksonen, Timo; Auerbach, Dagmar; Jung, Gregor; Schneider, Marc

    2012-11-01

    Gold nanoclusters prepared with a controlled amount of Ag exhibit intense fluorescence with a quantum yield of ~16% and a ``quasi-monoexponential'' long lifetime of >200 ns. Characterization of the luminescent probes indicates high photostability and easy detection in cells. Additionally, fluorescence enhancement in the presence of proteins was found.Gold nanoclusters prepared with a controlled amount of Ag exhibit intense fluorescence with a quantum yield of ~16% and a ``quasi-monoexponential'' long lifetime of >200 ns. Characterization of the luminescent probes indicates high photostability and easy detection in cells. Additionally, fluorescence enhancement in the presence of proteins was found. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr30653k

  9. Synthesis, purification and mass spectrometric characterisation of a fluorescent Au9@BSA nanocluster and its enzymatic digestion by trypsin

    Science.gov (United States)

    Fernández-Iglesias, Nerea; Bettmer, Jörg

    2013-12-01

    Nanoclusters of noble metals like Ag and Au have attracted great attention as they form a missing link between isolated metal atoms and nanoparticles. Their particular properties like luminescence in the visible range and nontoxicity make them attractive for bioimaging and biolabelling purposes, especially with use of proteins as stabilising agents. In this context, this study intends the synthesis of a specific Au nanocluster covered by bovine serum albumin (BSA). It is shown that size-exclusion chromatography is feasible for the purification and isolation of the nanocluster. A mass spectrometric characterisation, preferably by ESI-MS, indicates the presence of an Au9@BSA nanocluster. Enzymatic digestion of the nanocluster with trypsin results in a significant increase of the fluorescence intensity at 650 and 710 nm, whereas complementary MALDI-MS studies are presented for the identification of generated peptides and show a distinctive pattern in comparison to the pure protein. It can be concluded that Au9@BSA might be, in future, an interesting candidate for in vitro studies of protease activities.Nanoclusters of noble metals like Ag and Au have attracted great attention as they form a missing link between isolated metal atoms and nanoparticles. Their particular properties like luminescence in the visible range and nontoxicity make them attractive for bioimaging and biolabelling purposes, especially with use of proteins as stabilising agents. In this context, this study intends the synthesis of a specific Au nanocluster covered by bovine serum albumin (BSA). It is shown that size-exclusion chromatography is feasible for the purification and isolation of the nanocluster. A mass spectrometric characterisation, preferably by ESI-MS, indicates the presence of an Au9@BSA nanocluster. Enzymatic digestion of the nanocluster with trypsin results in a significant increase of the fluorescence intensity at 650 and 710 nm, whereas complementary MALDI-MS studies are presented

  10. Dynamics of homogeneous nucleation

    DEFF Research Database (Denmark)

    Toxværd, Søren

    2015-01-01

    clusters fluctuates, but the mean temperature remains below the temperature in the supersaturated gas until they reach the critical nucleation size. The critical nuclei have, however, a temperature equal to the supersaturated gas. The kinetics of homogeneous nucleation is not only caused by a grow or......The classical nucleation theory for homogeneous nucleation is formulated as a theory for a density fluctuation in a supersaturated gas at a given temperature. But molecular dynamics simulations reveal that it is small cold clusters which initiates the nucleation. The temperature in the nucleating...

  11. Bright two-photon emission and ultra-fast relaxation dynamics in a DNA-templated nanocluster investigated by ultra-fast spectroscopy

    Science.gov (United States)

    Yau, Sung Hei; Abeyasinghe, Neranga; Orr, Meghan; Upton, Leslie; Varnavski, Oleg; Werner, James H.; Yeh, Hsin-Chih; Sharma, Jaswinder; Shreve, Andrew P.; Martinez, Jennifer S.; Goodson, Theodore, III

    2012-06-01

    Metal nanoclusters have interesting steady state fluorescence emission, two-photon excited emission and ultrafast dynamics. A new subclass of fluorescent silver nanoclusters (Ag NCs) are NanoCluster Beacons. NanoCluster Beacons consist of a weakly emissive Ag NC templated on a single stranded DNA (``Ag NC on ssDNA'') that becomes highly fluorescent when a DNA enhancer sequence is brought in proximity to the Ag NC by DNA base pairing (``Ag NC on dsDNA''). Steady state fluorescence was observed at 540 nm for both Ag NC on ssDNA and dsDNA; emission at 650 nm is observed for Ag NC on dsDNA. The emission at 550 nm is eight times weaker than that at 650 nm. Fluorescence up-conversion was used to study the dynamics of the emission. Bi-exponential fluorescence decay was recorded at 550 nm with lifetimes of 1 ps and 17 ps. The emission at 650 nm was not observed at the time scale investigated but has been reported to have a lifetime of 3.48 ns. Two-photon excited fluorescence was detected for Ag NC on dsDNA at 630 nm when excited at 800 nm. The two-photon absorption cross-section was calculated to be ~3000 GM. Femtosecond transient absorption experiments were performed to investigate the excited state dynamics of DNA-Ag NC. An excited state unique to Ag NC on dsDNA was identified at ~580 nm as an excited state bleach that related directly to the emission at 650 nm based on the excitation spectrum. Based on the optical results, a simple four level system is used to describe the emission mechanism for Ag NC on dsDNA.

  12. Bright two-photon emission and ultra-fast relaxation dynamics in a DNA-templated nanocluster investigated by ultra-fast spectroscopy.

    Science.gov (United States)

    Yau, Sung Hei; Abeyasinghe, Neranga; Orr, Meghan; Upton, Leslie; Varnavski, Oleg; Werner, James H; Yeh, Hsin-Chih; Sharma, Jaswinder; Shreve, Andrew P; Martinez, Jennifer S; Goodson, Theodore

    2012-07-21

    Metal nanoclusters have interesting steady state fluorescence emission, two-photon excited emission and ultrafast dynamics. A new subclass of fluorescent silver nanoclusters (Ag NCs) are NanoCluster Beacons. NanoCluster Beacons consist of a weakly emissive Ag NC templated on a single stranded DNA ("Ag NC on ssDNA") that becomes highly fluorescent when a DNA enhancer sequence is brought in proximity to the Ag NC by DNA base pairing ("Ag NC on dsDNA"). Steady state fluorescence was observed at 540 nm for both Ag NC on ssDNA and dsDNA; emission at 650 nm is observed for Ag NC on dsDNA. The emission at 550 nm is eight times weaker than that at 650 nm. Fluorescence up-conversion was used to study the dynamics of the emission. Bi-exponential fluorescence decay was recorded at 550 nm with lifetimes of 1 ps and 17 ps. The emission at 650 nm was not observed at the time scale investigated but has been reported to have a lifetime of 3.48 ns. Two-photon excited fluorescence was detected for Ag NC on dsDNA at 630 nm when excited at 800 nm. The two-photon absorption cross-section was calculated to be ∼3000 GM. Femtosecond transient absorption experiments were performed to investigate the excited state dynamics of DNA-Ag NC. An excited state unique to Ag NC on dsDNA was identified at ∼580 nm as an excited state bleach that related directly to the emission at 650 nm based on the excitation spectrum. Based on the optical results, a simple four level system is used to describe the emission mechanism for Ag NC on dsDNA. PMID:22692295

  13. Characterizing protein crystal nucleation

    Science.gov (United States)

    Akella, Sathish V.

    We developed an experimental microfluidic based technique to measure the nucleation rates and successfully applied the technique to measure nucleation rates of lysozyme crystals. The technique involves counting the number of samples which do not have crystals as a function of time. Under the assumption that nucleation is a Poisson process, the fraction of samples with no crystals decays exponentially with the decay constant proportional to nucleation rate and volume of the sample. Since nucleation is a random and rare event, one needs to perform measurements on large number of samples to obtain good statistics. Microfluidics offers the solution of producing large number of samples at minimal material consumption. Hence, we developed a microfluidic method and measured nucleation rates of lysozyme crystals in supersaturated protein drops, each with volume of ˜ 1 nL. Classical Nucleation Theory (CNT) describes the kinetics of nucleation and predicts the functional form of nucleation rate in terms of the thermodynamic quantities involved, such as supersaturation, temperature, etc. We analyzed the measured nucleation rates in the context of CNT and obtained the activation energy and the kinetic pre-factor characterizing the nucleation process. One conclusion is that heterogeneous nucleation dominates crystallization. We report preliminary studies on selective enhancement of nucleation in one of the crystal polymorprhs of lysozyme (spherulite) using amorphous mesoporous bioactive gel-glass te{naomi06, naomi08}, CaO.P 2O5.SiO2 (known as bio-glass) with 2-10 nm pore-size diameter distribution. The pores act as heterogeneous nucleation centers and claimed to enhance the nucleation rates by molecular confinement. The measured kinetic profiles of crystal fraction of spherulites indicate that the crystallization of spherulites may be proceeding via secondary nucleation pathways.

  14. Quantum sized gold nanoclusters with atomic precision.

    Science.gov (United States)

    Qian, Huifeng; Zhu, Manzhou; Wu, Zhikun; Jin, Rongchao

    2012-09-18

    Gold nanoparticles typically have a metallic core, and the electronic conduction band consists of quasicontinuous energy levels (i.e. spacing δ ≪ k(B)T, where k(B)T is the thermal energy at temperature T (typically room temperature) and k(B) is the Boltzmann constant). Electrons in the conduction band roam throughout the metal core, and light can collectively excite these electrons to give rise to plasmonic responses. This plasmon resonance accounts for the beautiful ruby-red color of colloidal gold first observed by Faraday back in 1857. On the other hand, when gold nanoparticles become extremely small (plasmonic gold nanoparticles, researchers often refer to the ultrasmall nanoparticles as nanoclusters. In this Account, we chose several typical sizes of gold nanoclusters, including Au(25)(SR)(18), Au(38)(SR)(24), Au(102)(SR)(44), and Au(144)(SR)(60), to illustrate the novel properties of metal nanoclusters imparted by quantum size effects. In the nanocluster size regime, many of the physical and chemical properties of gold nanoparticles are fundamentally altered. Gold nanoclusters have discrete electronic energy levels as opposed to the continuous band in plasmonic nanoparticles. Quantum-sized nanoparticles also show multiple optical absorption peaks in the optical spectrum versus a single surface plasmon resonance (SPR) peak at 520 nm for spherical gold nanocrystals. Although larger nanocrystals show an fcc structure, nanoclusters often have non-fcc atomic packing structures. Nanoclusters also have unique fluorescent, chiral, and magnetic properties. Due to the strong quantum confinement effect, adding or removing one gold atom significantly changes the structure and the electronic and optical properties of the nanocluster. Therefore, precise atomic control of nanoclusters is critically important: the nanometer precision typical of conventional nanoparticles is not sufficient. Atomically precise nanoclusters are represented by molecular formulas (e.g. Au

  15. Carbon surface diffusion and SiC nanocluster self-ordering

    International Nuclear Information System (INIS)

    The process of the spatial ordering of SiC nanoclusters on the step edges on Si surfaces was studied by means of multi-scale computer simulation. The evolution of cluster arrays on an ideal flat surface and surfaces with terraces of various widths was performed by kinetic Monte Carlo (KMC) simulations based on quantitative studies of potential energy surfaces (PES) by molecular dynamics (MD). PES analysis revealed that certain types of steps act as strong trapping centres for both Si and C adatoms stimulating clusters nucleation. Spatial ordering of the SiC nanoclusters at the terrace edges can be achieved if the parameters of the growth process (substrate temperature, carbon flux) and substrate (steps direction and terrace widths) are adjusted to the surface morphology. Temperature ranges for growth regimes with and without formation of cluster chains were determined. Cluster size distributions and the dependence of optimal terrace width for self ordering on the deposition parameters were obtained

  16. Atomistic Modeliing of the Interactions of He with Nanoclusters in Fe

    Energy Technology Data Exchange (ETDEWEB)

    Kurtz, Richard J.; Gao, Fei; Heinisch, Howard L.; Wirth, B. D.; Odette, George R.; Yamamoto, Takuya

    2006-06-29

    Structural materials of a fusion power system will be exposed to high concentrations of He produced from nuclear transmutation reactions. Helium is essentially insoluble in metals so there is a strong tendency for it to form bubbles that can significantly degrade mechanical properties. A strategy to effectively manage He is to provide a high-density of internal interfaces to serve as He bubble nucleation sites and vacancy-interstitial recombination centers. Nanostructured ferritic alloys are being developed to provide improved creep strength and He management capability compared to conventional steels. A key characteristic of these materials is the high-density (~1024 m-3) of nanometer-scale (~3 nm diameter) Y-Ti-O clusters. We describe molecular dynamics simulations to assess the interaction of He atoms, vacancies and He-vacancy complexes with coherent Cu nanoclusters in Fe. The potentials employed here were adjusted to explore the effect of nanocluster elastic properties on He trapping efficiency.

  17. The formation of Er-oxide nanoclusters in SiO$_2$ thin films with excess Si

    OpenAIRE

    Thøgersen, Annett; Mayandi, Jeyanthinath; Finstad, Terje; Olsen, Arne; Diplas, Spyros; Mitome, Masanori; Bando, Yoshio

    2012-01-01

    The nucleation, distribution and composition of erbium embedded in a SiO$_2$-Si layer were studied with High Resolution Transmission Electron Microscopy (HRTEM), Electron Energy Loss Spectroscopy (EELS), Energy Filtered TEM (EFTEM), Scanning Transmission Electron Microscopy (STEM) and X-ray Photoelectron Spectroscopy (XPS). When the SiO$_2$ layer contains small amounts of Si and Er, nanoclusters of Er-oxide are formed throughout the whole layer. Exposure of the oxide to an electron beam with ...

  18. The determination of copper ions based on sensitized chemiluminescence of silver nanoclusters

    International Nuclear Information System (INIS)

    We report on the first application of novel, water-soluble and fluorescent silver nanoclusters (Ag NCs) in a chemiluminescent (CL) detection system. A method has been developed for the determination of copper(II) ion that is based on the fact that the weak CL resulting from the redox reaction between Ce(IV) ion and sulfite ion is strongly enhanced by the Ag NCs and that the main CL signals now originate from Ag NCs. UV-visible spectra, CL spectra and fluorescent (FL) spectra were acquired to investigate the enhanced CL mechanism. It is proposed that the electronic energy of the excited state intermediate SO2* that originates from the CL reaction is transferred to Ag NCs to form an electronically excited NC whose emission is observed. In addition, it is found that copper(II) is capable of inhibiting the CL of the nanoclusters system, but not if other common metal ions are present. The detection of copper(II) is achieved indirectly by measuring the CL intensity of Ag NCs. Under the optimized experimental conditions, a linear relationship does exist between the intensity of CL and the concentrations of copper(II) in the range of 0.2 nM to 0.1 mM. The detection limit is 0.12 nM. The method is applied to the determination of copper(II) ion in tap water with satisfactory results. (author)

  19. A universal design for a DNA probe providing ratiometric fluorescence detection by generation of silver nanoclusters

    Science.gov (United States)

    Del Bonis-O'Donnell, Jackson Travis; Vong, Daniel; Pennathur, Sumita; Fygenson, Deborah Kuchnir

    2016-07-01

    DNA-stabilized silver nanoclusters (AgNCs), the fluorescence emission of which can rival that of typical organic fluorophores, have made possible a new class of label-free molecular beacons for the detection of single-stranded DNA. Like fluorophore-quencher molecular beacons (FQ-MBs) AgNC-based molecular beacons (AgNC-MBs) are based on a single-stranded DNA that undergoes a conformational change upon binding a target sequence. The new conformation exposes a stretch of single-stranded DNA capable of hosting a fluorescent AgNC upon reduction in the presence of Ag+ ions. The utility of AgNC-MBs has been limited, however, because changing the target binding sequence unpredictably alters cluster fluorescence. Here we show that the original AgNC-MB design depends on bases in the target-binding (loop) domain to stabilize its AgNC. We then rationally alter the design to overcome this limitation. By separating and lengthening the AgNC-stabilizing domain, we create an AgNC-hairpin probe with consistent performance for arbitrary target sequence. This new design supports ratiometric fluorescence measurements of DNA target concentration, thereby providing a more sensitive, responsive and stable signal compared to turn-on AgNC probes. Using the new design, we demonstrate AgNC-MBs with nanomolar sensitivity and singe-nucleotide specificity, expanding the breadth of applicability of these cost-effective probes for biomolecular detection.DNA-stabilized silver nanoclusters (AgNCs), the fluorescence emission of which can rival that of typical organic fluorophores, have made possible a new class of label-free molecular beacons for the detection of single-stranded DNA. Like fluorophore-quencher molecular beacons (FQ-MBs) AgNC-based molecular beacons (AgNC-MBs) are based on a single-stranded DNA that undergoes a conformational change upon binding a target sequence. The new conformation exposes a stretch of single-stranded DNA capable of hosting a fluorescent AgNC upon reduction in the

  20. Water-soluble homo-oligonucleotide stabilized fluorescent silver nanoclusters as fluorescent probes for mercury ion

    International Nuclear Information System (INIS)

    Water–soluble fluorescent silver nanoclusters (Ag NCs) were prepared with the assistance of commercially available polyinosinic acid (PI) or polycytidylic acid (PC). The fluorescence of the Ag NCs is effectively quenched by trace mercury(II) ions, which can be applied for their detection. The response of the Ag NCs prepared with PI to Hg(II) ion is linear in the Hg(II) concentration range from 0.05 to 1.0 μM (R2 = 0.9873), and from 0.5 to 10 μM of Hg(II) (R2 = 0.9971) for Ag NCs prepared with PC. The detection limits are 3.0 nM and 9.0 nM (at an S/N of 3), respectively. The method is simple, sensitive and fairly selective. (author)

  1. Uptake and effect of highly fluorescent silver nanoclusters on Scenedesmus obliquus.

    Science.gov (United States)

    Zhang, Li; He, Yiliang; Goswami, Nirmal; Xie, Jianping; Zhang, Bo; Tao, Xianji

    2016-06-01

    The release of silver nanoparticles (Ag NPs) in aquatic environment has caused wide public concern about their effects on living organisms (e.g., algae). However, how these small NPs exert cytotoxicity in the living organisms has always been under heated debate. In this study, the uptake and toxicity effects of strongly red-emitting fluorescent silver nanoclusters (r-Ag NCs) exposed to the green algae Scenedesmus obliquus was investigated. Upon exposure to pure r-Ag NCs and r-Ag NCs containing l-cysteine, the algae growth inhibition test showed that Ag(+) ions released from r-Ag NCs played an important role in the toxicity of r-Ag NCs along with the toxicity of intact r-Ag NCs. Furthermore, no signals of intracellular reactive oxygen species (ROS) were observed indicating that r-Ag NCs or released Ag(+) ions - mediated growth inhibition of algae cells was independent of ROS production. Transmission electron microscopy (TEM) and laser scanning confocal microscopy (LSCM) were employed to study cellular uptake and cytotoxicity. Furthermore, analysis of differential expressed gene demonstrated that r-Ag NCs as well as the released Ag(+) ions can simultaneously exist inside the algae cells, and inhibit the transcriptomic process of genes by their "joint-toxicity" mechanism. Taken together, our study provides a new insight into the molecular mechanisms of r-Ag NCs and Ag(+) ions exposure to the aquatic organism and can be applied to early diagnosis of ecologic risk mediated by others metal-based NPs. PMID:27023120

  2. Nanoclusters a bridge across disciplines

    CERN Document Server

    Jena, Purusottam

    2010-01-01

    This comprehensive book on Nanoclusters comprises sixteen authoritative chapters written by leading researchers in the field. It provides insight into topics that are currently at the cutting edge of cluster science, with the main focus on metal and metal compound systems that are of particular interest in materials science, and also on aspects related to biology and medicine. While there are numerous books on clusters, the focus on clusters as a bridge across disciplines sets this book apart from others. Delivers cutting edge coverage of cluster science Covers a broad range of topics in

  3. Role of anion polarizability in fluorescence sensitization of DNA-templated silver nanoclusters

    Science.gov (United States)

    Peng, Jian; Shao, Yong; Liu, Lingling; Zhang, Lihua; Fu, Wensheng; Liu, Hua

    2014-06-01

    Fluorescent silver nanoclusters (Ag NCs) as novel fluorophores have received much attention because of their high brightness, good photostability and widely tunable emissions from the visible to the near-infrared range as a result of their size and existing environment. However, efforts are still needed to find the factors that tune the emission of Ag NCs. In this work, Ag NCs that were size-selectively grown on DNA were used to investigate the effect of the electronic properties of coordinating ligands. Halogen anions were used as the paradigm because of their periodicity in element properties. We found that addition of halogen anions did not alter the emission wavelength of Ag NCs, but the fluorescence intensity showed an initial increase at low concentrations of Cl-, Br- and I- followed by a gradual decrease at high concentrations. No increase in fluorescence was observed for F- at either low or high concentration. Such specific halogen-anion sensitization of the fluorescence of Ag NCs suggests that the binding strength/manner and dipole polarizability of these anions synergistically tune the emission behavior of Ag NCs. Less fluorescence sensitization occurred for the anion having high enough polarizability to form a covalent bond with Ag NCs. The anion polarizability-sensitized fluorescence indicates the role of anion electronic properties in tuning the emission behavior of Ag NCs, which should be seriously considered in designing Ag NC-based sensors and devices.

  4. Interface controlled growth of nanostructures in discontinuous Ag and Au thin films fabricated by ion beam sputter deposition for plasmonic applications

    Indian Academy of Sciences (India)

    R Brahma; M Ghanashyam Krishna

    2012-08-01

    The growth of discontinuous thin films of Ag and Au by low energy ion beam sputter deposition is reported. The study focuses on the role of the film–substrate in determining the shape and size of nanostructures achieved in such films. Ag films were deposited using Ar ion energy of 150 eV while the Au films were deposited with Ar ion energies of 250–450 eV. Three types of interfaces were investigated in this study. The first set of film–substrate interfaces consisted of Ag and Au films grown on borosilicate glass and carbon coated Cu grids used as substrates. The second set of films was metallic bilayers in which one of the metals (Ag or Au) was grown on a continuous film of the other metal (Au or Ag). The third set of interfaces comprised of discontinuous Ag and Au films deposited on different dielectrics such as SiO2, TiO2 and ZrO2. In each case, a rich variety of nanostructures including self organized arrays of nanoparticles, nanoclusters and nanoneedles have been achieved. The role of the film–substrate interface is discussed within the framework of existing theories of thin film nucleation and growth. Interfacial nanostructuring of thin films is demonstrated to be a viable technique to realize a variety of nanostructures. The use of interfacial nanostructuring for plasmonic applications is demonstrated. It is shown that the surface Plasmon resonance of the metal nanostructures can be tuned over a wide range of wavelengths from 400 to 700 nm by controlling the film–substrate interface.

  5. Principles of nucleation theory

    International Nuclear Information System (INIS)

    The nucleation of small stable species is described in the problem of void growth by discrete rate equations. When gas is being produced the problem reduces to one of calculating the incubation dose for the gas bubble to void transition. A general expression for the steady state nucleation rate is derived for the case when voids are formed by vacancy fluctuations which enable an effective nucleation barrier to be crossed. (author)

  6. G-quadruplex enhanced fluorescence of DNA-silver nanoclusters and their application in bioimaging

    Science.gov (United States)

    Zhu, Jinbo; Zhang, Libing; Teng, Ye; Lou, Baohua; Jia, Xiaofang; Gu, Xiaoxiao; Wang, Erkang

    2015-07-01

    Guanine proximity based fluorescence enhanced DNA-templated silver nanoclusters (AgNCs) have been reported and applied for bioanalysis. Herein, we studied the G-quadruplex enhanced fluorescence of DNA-AgNCs and gained several significant conclusions, which will be helpful for the design of future probes. Our results demonstrate that a G-quadruplex can also effectively stimulate the fluorescence potential of AgNCs. The major contribution of the G-quadruplex is to provide guanine bases, and its special structure has no measurable impact. The DNA-templated AgNCs were further analysed by native polyacrylamide gel electrophoresis and the guanine proximity enhancement mechanism could be visually verified by this method. Moreover, the fluorescence emission of C3A (CCCA)4 stabilized AgNCs was found to be easily and effectively enhanced by G-quadruplexes, such as T30695, AS1411 and TBA, especially AS1411. Benefiting from the high brightness of AS1411 enhanced DNA-AgNCs and the specific binding affinity of AS1411 for nucleolin, the AS1411 enhanced AgNCs can stain cancer cells for bioimaging.Guanine proximity based fluorescence enhanced DNA-templated silver nanoclusters (AgNCs) have been reported and applied for bioanalysis. Herein, we studied the G-quadruplex enhanced fluorescence of DNA-AgNCs and gained several significant conclusions, which will be helpful for the design of future probes. Our results demonstrate that a G-quadruplex can also effectively stimulate the fluorescence potential of AgNCs. The major contribution of the G-quadruplex is to provide guanine bases, and its special structure has no measurable impact. The DNA-templated AgNCs were further analysed by native polyacrylamide gel electrophoresis and the guanine proximity enhancement mechanism could be visually verified by this method. Moreover, the fluorescence emission of C3A (CCCA)4 stabilized AgNCs was found to be easily and effectively enhanced by G-quadruplexes, such as T30695, AS1411 and TBA, especially

  7. Effect of strain on surface diffusion and nucleation

    DEFF Research Database (Denmark)

    Brune, Harald; Bromann, Karsten; Röder, Holger;

    1995-01-01

    The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

  8. Multiplexed analysis of genes using nucleic acid-stabilized silver-nanocluster quantum dots.

    Science.gov (United States)

    Enkin, Natalie; Wang, Fuan; Sharon, Etery; Albada, H Bauke; Willner, Itamar

    2014-11-25

    Luminescent nucleic acid-stabilized Ag nanoclusters (Ag NCs) are applied for the optical detection of DNA and for the multiplexed analysis of genes. Two different sensing modules including Ag NCs as luminescence labels are described. One sensing module involves the assembly of a three-component sensing module composed of a nucleic acid-stabilized Ag NC and a quencher-modified nucleic acid hybridized with a nucleic acid scaffold that is complementary to the target DNA. The luminescence of the Ag NCs is quenched in the sensing module nanostructure. The strand displacement of the scaffold by the target DNA separates the nucleic acid-functionalized Ag NCs, leading to the turned-on luminescence of the NCs and to the optical readout of the sensing process. By implementing two different-sized Ag NC-modified sensing modules, the parallel multiplexed analysis of two genes (the Werner Syndrome gene and the HIV, human immunodeficiency, gene), using 615 and 560 nm luminescent Ag NCs, is demonstrated. The second sensing module includes the nucleic acid functionalized Ag NCs and the quencher-modified nucleic acid hybridized with a hairpin DNA scaffold. The luminescence of the Ag NCs is quenched in the sensing module. Opening of the hairpin by the target DNA triggers the luminescence of the Ag NCs, due to the spatial separation of the Ag NCs/quencher units. The system is applied for the optical detection of the BRAC1 gene. In addition, by implementing two-sized Ag NCs, the multiplexed analysis of two genes by the hairpin sensing module approach is demonstrated. PMID:25327411

  9. Silver nanocluster catalytic microreactors for water purification

    Science.gov (United States)

    Da Silva, B.; Habibi, M.; Ognier, S.; Schelcher, G.; Mostafavi-Amjad, J.; Khalesifard, H. R. M.; Tatoulian, M.; Bonn, D.

    2016-07-01

    A new method for the elaboration of a novel type of catalytic microsystem with a high specific area catalyst is developed. A silver nanocluster catalytic microreactor was elaborated by doping a soda-lime glass with a silver salt. By applying a high power laser beam to the glass, silver nanoclusters are obtained at one of the surfaces which were characterized by BET measurements and AFM. A microfluidic chip was obtained by sealing the silver coated glass with a NOA 81 microchannel. The catalytic activity of the silver nanoclusters was then tested for the efficiency of water purification by using catalytic ozonation to oxidize an organic pollutant. The silver nanoclusters were found to be very stable in the microreactor and efficiently oxidized the pollutant, in spite of the very short residence times in the microchannel. This opens the way to study catalytic reactions in microchannels without the need of introducing the catalyst as a powder or manufacturing complex packed bed microreactors.

  10. Detection of adenosine 5'-triphosphate by fluorescence variation of oligonucleotide-templated silver nanoclusters.

    Science.gov (United States)

    Lee, Jennifer Daneen; Cang, Jinshun; Chen, Ying-Chieh; Chen, Wei-Yu; Ou, Chung-Mao; Chang, Huan-Tsung

    2014-08-15

    Oligonucleotide-templated Ag nanoclusters (DNA-Ag NCs) prepared from AgNO3 using an oligonucleotide (5'-TAACCCCTAACCCCT-3') as a template and NaBH4 as a reducing agent have been used for sensing of adenosine 5'-triphosphate (ATP). The fluorescence intensity and emission wavelength of DNA-Ag NCs are dependent on the pH value and ATP concentration. At pH 3.0 and 11.0, ATP shows greater effects on fluorescence of the DNA-Ag NCs. Upon increasing ATP concentration from 10 to 50μM, their emission wavelength at pH 3.0 shifts from 525 to 585nm. At pH 11.0, their fluorescence intensity (510nm) increases upon increasing ATP concentration. The circular dichroism (CD), electrospray ionization-mass spectrometry (ESI-MS), absorption, and fluorescence results indicate that ATP and pH affect the interactions between DNAs and Ag atoms, resulting in changes in their fluorescence. The DNA-Ag NCs allow detection of ATP over a concentration range of 0.1-10μM, with a limit of detection 33nM. Practicality of the DNA-Ag NCs probe has been validated with the determination of ATP concentrations in the lysate of MDA-MB-231 breast carcinoma cells. PMID:24657647

  11. Equilibrium gold nanoclusters quenched with biodegradable polymers.

    Science.gov (United States)

    Murthy, Avinash K; Stover, Robert J; Borwankar, Ameya U; Nie, Golay D; Gourisankar, Sai; Truskett, Thomas M; Sokolov, Konstantin V; Johnston, Keith P

    2013-01-22

    Although sub-100 nm nanoclusters of metal nanoparticles are of interest in many fields including biomedical imaging, sensors, and catalysis, it has been challenging to control their morphologies and chemical properties. Herein, a new concept is presented to assemble equilibrium Au nanoclusters of controlled size by tuning the colloidal interactions with a polymeric stabilizer, PLA(1k)-b-PEG(10k)-b-PLA(1k). The nanoclusters form upon mixing a dispersion of ~5 nm Au nanospheres with a polymer solution followed by partial solvent evaporation. A weakly adsorbed polymer quenches the equilibrium nanocluster size and provides steric stabilization. Nanocluster size is tuned from ~20 to ~40 nm by experimentally varying the final Au nanoparticle concentration and the polymer/Au ratio, along with the charge on the initial Au nanoparticle surface. Upon biodegradation of the quencher, the nanoclusters reversibly and fully dissociate to individual ~5 nm primary particles. Equilibrium cluster size is predicted semiquantitatively with a free energy model that balances short-ranged depletion and van der Waals attractions with longer-ranged electrostatic repulsion, as a function of the Au and polymer concentrations. The close spacings of the Au nanoparticles in the clusters produce strong NIR extinction over a broad range of wavelengths from 650 to 900 nm, which is of practical interest in biomedical imaging. PMID:23230905

  12. A nanocluster beacon based on the template transformation of DNA-templated silver nanoclusters.

    Science.gov (United States)

    Teng, Ye; Jia, Xiaofang; Zhang, Shan; Zhu, Jinbo; Wang, Erkang

    2016-01-28

    In this work, we developed a novel light-up nanocluster beacon (NCB) based on shuttling dark silver nanoclusters (NCs) to a bright scaffold through hybridization. The fluorescence enhancement was as high as 70-fold when the two templates were on the opposite sides of the duplexes, enabling sensitive and selective detection of DNA. PMID:26666564

  13. Bovine serum albumin-confined silver nanoclusters as fluorometric probe for detection of biothiols.

    Science.gov (United States)

    Chen, Zhen; Lu, Dongtao; Cai, Zongwei; Dong, Chuan; Shuang, Shaomin

    2014-11-01

    Fluorescent bovine serum albumin-confined silver nanoclusters (BSA-AgNCs) were demonstrated to be a novel and environmentally friendly probe for the rapid detection of biothiols such as cysteine (Cys), homocysteine (Hcy) and glutathione (GSH). The sensing was ascribed to the strong affinity between the mercapto group of the biothiols and the silver nanoclusters. The fluorescence intensity of BSA-AgNCs was quenched efficiently on increasing the concentration of biothiol, corresponding with a red-shift in emission wavelength. However, the fluorescence of the silver nanoclusters was almost unchanged in the presence of other α-amino acids at 10-fold higher concentrations. By virtue of this specific response, a new, simple and rapid fluorescent method for detecting biothiols has been developed. The linear ranges for Cys, Hcy and GSH were 2.0 × 10(-6) to 9.0 × 10(-5) M (R(2) = 0.994), 2.0 × 10(-6) to 1.2 × 10(-4) M (R(2) = 0.996) and 1.0 × 10(-5) to 8.0 × 10(-5) M (R(2) = 0.980), respectively. The detection limits were 8.1 × 10(-7) M for Cys, 1.0 × 10(-6) M for Hcy and 1.1 × 10(-6) M for GSH. Our proposed method was successfully applied to the determination of thiols in human plasma and the recovery was 94.83-105.24%. It is potentially applicable to protein-stabilized silver nanoclusters in a chemical or biochemical sensing system. PMID:24403131

  14. Synthesis of Au13(glutathionato)8-β-cyclodextrin nanoclusters and their use as a fluorescent probe for silver ions

    International Nuclear Information System (INIS)

    Heating and drying of the mixture of glutathione-etched gold nanoparticles (Au-SG) and β-cyclodextrin (β-CD) results in the formation of β-CD-capped and glutathionate-protected Au13 nanoclusters (Au13(SG)8-β-CD). Their particle size, composition, and number of gold atoms and the capping molecules were characterized by scanning electron microscopy, fluorescence, UV–vis absorption, FT-IR spectroscopy and mass spectrometry. The fluorescence of these nanoclusters is specifically enhanced by the addition of Ag(I) ions to the aqueous solution. This effect was exploited to develop a selective and sensitive method for the fluorometric determination of Ag(I) in water in the concentration range between 0.5 nM and 0.1 μM, with a detection limit at 0.3 nM (at a signal-to-noise ratio of 3). (author)

  15. Nonequilibrium thermodynamics of nucleation

    International Nuclear Information System (INIS)

    We present a novel approach to nucleation processes based on the GENERIC framework (general equation for the nonequilibrium reversible-irreversible coupling). Solely based on the GENERIC structure of time-evolution equations and thermodynamic consistency arguments of exchange processes between a metastable phase and a nucleating phase, we derive the fundamental dynamics for this phenomenon, based on continuous Fokker-Planck equations. We are readily able to treat non-isothermal nucleation even when the nucleating cores cannot be attributed intensive thermodynamic properties. In addition, we capture the dynamics of the time-dependent metastable phase being continuously expelled from the nucleating phase, and keep rigorous track of the volume corrections to the dynamics. Within our framework the definition of a thermodynamic nuclei temperature is manifest. For the special case of nucleation of a gas phase towards its vapor-liquid coexistence, we illustrate that our approach is capable of reproducing recent literature results obtained by more microscopic considerations for the suppression of the nucleation rate due to nonisothermal effects

  16. Nonequilibrium thermodynamics of nucleation.

    Science.gov (United States)

    Schweizer, M; Sagis, L M C

    2014-12-14

    We present a novel approach to nucleation processes based on the GENERIC framework (general equation for the nonequilibrium reversible-irreversible coupling). Solely based on the GENERIC structure of time-evolution equations and thermodynamic consistency arguments of exchange processes between a metastable phase and a nucleating phase, we derive the fundamental dynamics for this phenomenon, based on continuous Fokker-Planck equations. We are readily able to treat non-isothermal nucleation even when the nucleating cores cannot be attributed intensive thermodynamic properties. In addition, we capture the dynamics of the time-dependent metastable phase being continuously expelled from the nucleating phase, and keep rigorous track of the volume corrections to the dynamics. Within our framework the definition of a thermodynamic nuclei temperature is manifest. For the special case of nucleation of a gas phase towards its vapor-liquid coexistence, we illustrate that our approach is capable of reproducing recent literature results obtained by more microscopic considerations for the suppression of the nucleation rate due to nonisothermal effects. PMID:25494727

  17. Highly fluorescent silver nanoclusters in alumina-silica composite optical fiber

    International Nuclear Information System (INIS)

    An efficient visible fluorescent optical fiber embedded with silver nanoclusters (Ag-NCs) having size ∼1 nm, uniformly distributed in alumina-silica composite core glass, is reported. Fibers are fabricated in a repetitive controlled way through modified chemical vapour deposition process associated with solution doping technique. Fibers are drawn from the transparent preforms by conventional fiber drawing process. Structural characteristics of the doped fibers are studied using transmission electron microscopy and electron probe micro analysis. The oxidation state of Ag within Ag-NCs is investigated by X-ray photo electron spectroscopy. The observed significant fluorescence of the metal clusters in fabricated fibers is correlated with electronic model. The experimentally observed size dependent absorption of the metal clusters in fabricated fibers is explained with the help of reported results calculated by ab-initio density functional theory. These optical fibers may open up an opportunity of realizing tunable wavelength fiber laser without the help of rare earth elements

  18. Silver nanoclusters-based fluorescence assay of protein kinase activity and inhibition.

    Science.gov (United States)

    Shen, Congcong; Xia, Xiaodong; Hu, Shengqiang; Yang, Minghui; Wang, Jianxiu

    2015-01-01

    A simple and sensitive fluorescence method for monitoring the activity and inhibition of protein kinase (PKA) has been developed using polycytosine oligonucleotide (dC12)-templated silver nanoclusters (Ag NCs). Adenosine-5'-triphosphate (ATP) was found to enhance the fluorescence of Ag NCs, while the hydrolysis of ATP to adenosine diphosphate (ADP) by PKA decreased the fluorescence of Ag NCs. Compared to the existing methods for kinase activity assay, the developed method does not involve phosphorylation of the substrate peptides, which significantly simplifies the detection procedures. The method exhibits high sensitivity, good selectivity, and wide linear range toward PKA detection. The inhibition effect of kinase inhibitor H-89 on the activity of PKA was also studied. The sensing protocol was also applied to the assay of drug-stimulated activation of PKA in HeLa cell lysates. PMID:25517425

  19. Sensitive and selective detection of copper ions with highly stable polyethyleneimine-protected silver nanoclusters.

    Science.gov (United States)

    Yuan, Zhiqin; Cai, Na; Du, Yi; He, Yan; Yeung, Edward S

    2014-01-01

    Copper is a highly toxic environmental pollutant with bioaccumulative properties. Therefore, sensitive Cu(2+) detection is very important to prevent over-ingestion, and visual detection using unaugmented vision is preferred for practical applications. In this study, hyperbranched polyethyleneimine-protected silver nanoclusters (hPEI-AgNCs) were successfully synthesized using a facile, one-pot reaction under mild conditions. The hPEI-AgNCs were very stable against extreme pH, ionic strength, temperature, and photoillumination and could act as sensitive and selective Cu(2+) sensing nanoprobes in aqueous solutions with a 10 nM limit of detection. In addition, hPEI-AgNCs-doped agarose hydrogels were developed as an instrument-free and regenerable platform for visual Cu(2+) and water quality monitoring. PMID:24274096

  20. Ice nucleation terminology

    Science.gov (United States)

    Vali, G.; DeMott, P.; Möhler, O.; Whale, T. F.

    2014-08-01

    Progress in the understanding of ice nucleation is being hampered by the lack of uniformity in how some terms are used in the literature. This even extends to some ambiguity of meanings attached to some terms. Suggestions are put forward here for common use of terms. Some are already well established and clear of ambiguities. Others are less engrained and will need a conscious effort in adoption. Evolution in the range of systems where ice nucleation is being studied enhances the need for a clear nomenclature. The ultimate limit in the clarity of definitions is, of course, the limited degree to which ice nucleation processes are understood.

  1. Reversible Size Control of Silver Nanoclusters via Ligand-exchange

    KAUST Repository

    Bootharaju, Megalamane Siddaramappa

    2015-05-21

    The properties of atomically monodisperse noble metal nanoclusters (NCs) are intricately intertwined with their precise molecular formula. The vast majority of size-specific NC syntheses start from the reduction of the metal salt and thiol ligand mixture. Only in gold was it recently shown that ligand-exchange could induce the growth of NCs from one atomically precise species to another; a process of yet unknown reversibility. Here, we present a process for the ligand-exchange-induced growth of atomically precise silver NCs, in a biphasic liquid-liquid system, which is particularly of interest because of its complete reversibility and ability to occur at room temperature. We explore this phenomenon in-depth using Ag35(SG)18 [SG= glutathionate] and Ag44(4-FTP)30 [4-FTP= 4-fluorothiophenol] as model systems. We show that the ligand-exchange conversion of Ag35(SG)18 into Ag44(4-FTP)30 is rapid (< 5 min) and direct, while the reverse process proceeds slowly through intermediate cluster sizes. We adapt a recently developed theory of reverse Ostwald ripening to model the NCs’ interconvertibility. The model’s predictions are in good agreement with the experimental observations, and they highlight the importance of small changes in the ligand-metal binding energy in determining the final equilibrium NC size. Based on the insight provided by this model, we demonstrated experimentally that by varying the choice of ligands, ligand-exchange can be used to obtain different sized NCs. The findings in this work establish ligand-exchange as a versatile tool for tuning cluster sizes.

  2. One-pot hydrothermal synthesis of orange fluorescent silver nanoclusters as a general probe for sulfides.

    Science.gov (United States)

    Lan, Jing; Zhang, Pu; Wang, Ting Ting; Chang, Yong; Lie, Shao Qing; Wu, Zhu Lian; Liu, Zhong De; Li, Yuan Fang; Huang, Cheng Zhi

    2014-07-01

    Water-soluble fluorescent silver nanoclusters (AgNCs) with almost seven and nine silver atoms and a quantum yield (QY) of 5.38 ± 0.25% were successfully prepared via one-pot hydrothermal synthesis using polymethacrylic acid sodium salt (PMAA-Na) as a template. The as-prepared PMAA-AgNCs displayed a mono-distribution, they were uniform in size and the color of the fluorescence, emitting at 579 nm, was orange when excited at 502 nm. What is more, we found that the as-prepared PMAA-AgNCs could be quenched by sulfides based on the formation of a metal-ligand bond Ag-S, and thus sulfides could be sensitively detected by spectrofluorometry. As proof of concept, thiourea (TU) and other sulfides including cysteine (Cys), glutathione (GSH) and dl-methionine could be detected. For example, the color of the orange fluorescent AgNCs solutions darkened upon the addition of TU and the fluorescence of PMAA-AgNCs was quenched. The detection limit for TU was 6.10 μM in the linear range from 8.57 μM to 2.29 mM. PMID:24834451

  3. Nanostructural transformations of silver nanoclusters occurring during their synthesis and after interaction with UV-light

    Science.gov (United States)

    Trapiella-Alfonso, Laura; Menéndez-Miranda, Mario; Costa-Fernández, José M.; Pereiro, Rosario; Sanz-Medel, Alfredo

    2014-03-01

    Metal nanoclusters (NCs), composed of several to tens of atoms, are a new class of fluorescent nanoprobes. NCs present distinct and favourable optical, electrical, and chemical properties as compared to other large-scale nanomaterials or bulk materials with the same chemical composition, being attractive for bio-imaging and bio-labelling applications. As this is a new nanomaterial class, fundamental questions regarding cluster growth mechanisms, stability, and functionality remain. Thus, new analytical tools for the analysis and characterization of such NCs are urgently needed to help in their synthesis optimization and final quality control. Information obtained from the use of a gentle separation technique, asymmetric flow field-flow fractionation, coupled on-line to molecular and elemental spectroscopic detection (spectrophotometry, fluorimetry and inductively coupled plasma mass spectrometry) along with transmission electron microscopy provide new insights into the structural transformations occurring during the growth of highly fluorescent silver nanoclusters (AgNCs) and also after their continuous irradiation with UV-light. These studies reveal that the mechanism of AgNCs growth goes through the previous formation of the corresponding unstable plasmonic metal nanoparticle. Moreover, photo-stability of the synthesized fluorescent NCs was investigated, in order to establish its manipulation and possible applications. Obtained results prove that the continuous exposure of AgNCs to UV-light provokes the loss of their optical properties driven by a photo-oxidation reaction.

  4. Nanostructural transformations of silver nanoclusters occurring during their synthesis and after interaction with UV-light

    International Nuclear Information System (INIS)

    Metal nanoclusters (NCs), composed of several to tens of atoms, are a new class of fluorescent nanoprobes. NCs present distinct and favourable optical, electrical, and chemical properties as compared to other large-scale nanomaterials or bulk materials with the same chemical composition, being attractive for bio-imaging and bio-labelling applications. As this is a new nanomaterial class, fundamental questions regarding cluster growth mechanisms, stability, and functionality remain. Thus, new analytical tools for the analysis and characterization of such NCs are urgently needed to help in their synthesis optimization and final quality control. Information obtained from the use of a gentle separation technique, asymmetric flow field-flow fractionation, coupled on-line to molecular and elemental spectroscopic detection (spectrophotometry, fluorimetry and inductively coupled plasma mass spectrometry) along with transmission electron microscopy provide new insights into the structural transformations occurring during the growth of highly fluorescent silver nanoclusters (AgNCs) and also after their continuous irradiation with UV-light. These studies reveal that the mechanism of AgNCs growth goes through the previous formation of the corresponding unstable plasmonic metal nanoparticle. Moreover, photo-stability of the synthesized fluorescent NCs was investigated, in order to establish its manipulation and possible applications. Obtained results prove that the continuous exposure of AgNCs to UV-light provokes the loss of their optical properties driven by a photo-oxidation reaction. (papers)

  5. Surface-Induced Melting of Metal Nanoclusters

    Institute of Scientific and Technical Information of China (English)

    YANG Quan-Wen; ZHU Ru-Zeng; WEI Jiu-An; WEN Yu-Hua

    2004-01-01

    @@ We investigate the size effect on melting of metal nanoclusters by molecular dynamics simulation and thermodynamic theory based on Kofman's melt model. By the minimization of the free energy of metal nanoclusters with respect to the thickness of the surface liquid layer, it has been found that the nanoclusters of the same metal have the same premelting temperature Tpre = T0 - T0(γsv -γlv -γst)/(ρLξ) (T0 is the melting point of bulk metal, γsv the solid-vapour interfacial free energy, γlv the liquid-vapour interfacial free energy, γsl the solid-liquid interfacial free energy, ρ the density of metal, L the latent heat of bulk metal, and ξ the characteristic length of surface-interface interaction) to be independent of the size of nanoclusters, so that the characteristic length ξ ofa metal can be obtained easily by Tpre, which can be obtained by experiments or molecular dynamics (MD) simulations. The premelting temperature Tpre of Cu is obtained by MD simulations, then ξ is obtained.The melting point Tcm is further predicted by free energy analysis and is in good agreement with the result of our MD simulations. We also predict the maximum premelting-liquid width of Cu nanoclusters with various sizes and the critical size, below which there is no premelting.

  6. Non-covalent attachment of silver nanoclusters onto single-walled carbon nanotubes with human serum albumin as linking molecule

    Energy Technology Data Exchange (ETDEWEB)

    Rodríguez-Galván, Andrés, E-mail: andres.rodriguez@nucleares.unam.mx [Instituto de Ciencias Nucleares, Universidad Nacional Autónoma de México, Circuito Exterior C.U., 04510 México D.F. (Mexico); Instituto de Física, Dpto. Física Experimental, Universidad Nacional Autónoma de México, Coyoacán, México, DF 04510 (Mexico); Unidad de Investigación Biomédica en Cáncer INCan-UNAM, Instituto Nacional de Cancerología, México, DF 14080 (Mexico); Heredia, Alejandro [Instituto de Ciencias Nucleares, Universidad Nacional Autónoma de México, Circuito Exterior C.U., 04510 México D.F. (Mexico); Amelines-Sarria, Oscar; Rivera, Margarita [Instituto de Física, Dpto. Materia Condensada, Universidad Nacional Autónoma de México, Coyoacán, 04510 México D.F. (Mexico); and others

    2015-03-15

    The attachment of silver nanoclusters (AgNCs) onto single-walled carbon nanotubes (SWNTs) for the formation of integrated fluorescence sites has attracted much attention due their potential applications as biological probes and nanovectors in theragnosis. Here, we report the preparation through assembly of fluorescent quasi 1-D nanomaterial based on SWNTs and silver nanoclusters (AgNCs) non-covalently attached to human serum albumin as biological linker. The fluorescent SWNT–AgNCs–HSA conjugates were characterized by atomic force microscopy, high-resolution transmission electron microscopy (HRTEM), high angle annular dark field scanning TEM (HAADF-STEM), fluorescent and UV–vis spectroscopy. The above techniques confirmed that AgNCs were non-covalently attached onto the external surface of SWNTs. In addition, it was observed that the modification did not affect the optical properties of the synthesized AgNCs since the absorption spectra and fluorescence under UV irradiation (λ = 365 nm) remain the same. The effect of the functionalized systems was tested on mammal red blood cells (RBCs) and it was found that their structural integrity was compromised by the conjugates, limiting their biological and medical applications.

  7. Non-covalent attachment of silver nanoclusters onto single-walled carbon nanotubes with human serum albumin as linking molecule

    International Nuclear Information System (INIS)

    The attachment of silver nanoclusters (AgNCs) onto single-walled carbon nanotubes (SWNTs) for the formation of integrated fluorescence sites has attracted much attention due their potential applications as biological probes and nanovectors in theragnosis. Here, we report the preparation through assembly of fluorescent quasi 1-D nanomaterial based on SWNTs and silver nanoclusters (AgNCs) non-covalently attached to human serum albumin as biological linker. The fluorescent SWNT–AgNCs–HSA conjugates were characterized by atomic force microscopy, high-resolution transmission electron microscopy (HRTEM), high angle annular dark field scanning TEM (HAADF-STEM), fluorescent and UV–vis spectroscopy. The above techniques confirmed that AgNCs were non-covalently attached onto the external surface of SWNTs. In addition, it was observed that the modification did not affect the optical properties of the synthesized AgNCs since the absorption spectra and fluorescence under UV irradiation (λ = 365 nm) remain the same. The effect of the functionalized systems was tested on mammal red blood cells (RBCs) and it was found that their structural integrity was compromised by the conjugates, limiting their biological and medical applications

  8. Non-covalent attachment of silver nanoclusters onto single-walled carbon nanotubes with human serum albumin as linking molecule

    Science.gov (United States)

    Rodríguez-Galván, Andrés; Heredia, Alejandro; Amelines-Sarria, Oscar; Rivera, Margarita; Medina, Luis A.; Basiuk, Vladimir A.

    2015-03-01

    The attachment of silver nanoclusters (AgNCs) onto single-walled carbon nanotubes (SWNTs) for the formation of integrated fluorescence sites has attracted much attention due their potential applications as biological probes and nanovectors in theragnosis. Here, we report the preparation through assembly of fluorescent quasi 1-D nanomaterial based on SWNTs and silver nanoclusters (AgNCs) non-covalently attached to human serum albumin as biological linker. The fluorescent SWNT-AgNCs-HSA conjugates were characterized by atomic force microscopy, high-resolution transmission electron microscopy (HRTEM), high angle annular dark field scanning TEM (HAADF-STEM), fluorescent and UV-vis spectroscopy. The above techniques confirmed that AgNCs were non-covalently attached onto the external surface of SWNTs. In addition, it was observed that the modification did not affect the optical properties of the synthesized AgNCs since the absorption spectra and fluorescence under UV irradiation (λ = 365 nm) remain the same. The effect of the functionalized systems was tested on mammal red blood cells (RBCs) and it was found that their structural integrity was compromised by the conjugates, limiting their biological and medical applications.

  9. Octahedral Ni-nanocluster (Ni85) for Efficient and Selective Reduction of Nitric Oxide (NO) to Nitrogen (N2).

    Science.gov (United States)

    Mahata, Arup; Rawat, Kuber Singh; Choudhuri, Indrani; Pathak, Biswarup

    2016-01-01

    Nitric oxide (NO) reduction pathways are systematically studied on a (111) facet of the octahedral nickel (Ni85) nanocluster in the presence/absence of hydrogen. Thermodynamic (reaction free energies) and kinetic (free energy barriers, and temperature dependent reaction rates) parameters are investigated to find out the most favoured reduction pathway for NO reduction. The catalytic activity of the Ni-nanocluster is investigated in greater detail toward the product selectivity (N2 vs. N2O vs. NH3). The previous theoretical (catalyzed by Pt, Pd, Rh and Ir) and experimental reports (catalyzed by Pt, Ag, Pd) show that direct N-O bond dissociation is very much unlikely due to the high-energy barrier but our study shows that the reaction is thermodynamically and kinetically favourable when catalysed by the octahedral Ni-nanocluster. The catalytic activity of the Ni-nanocluster toward NO reduction reaction is very much efficient and selective toward N2 formation even in the presence of hydrogen. However, N2O (one of the major by-products) formation is very much unlikely due to the high activation barrier. Our microkinetic analysis shows that even at high hydrogen partial pressures, the catalyst is very much selective toward N2 formation over NH3. PMID:27157072

  10. Fluorescent DNA-templated silver nanoclusters

    Science.gov (United States)

    Lin, Ruoqian

    Because of the ultra-small size and biocompatibility of silver nanoclusters, they have attracted much research interest for their applications in biolabeling. Among the many ways of synthesizing silver nanoclusters, DNA templated method is particularly attractive---the high tunability of DNA sequences provides another degree of freedom for controlling the chemical and photophysical properties. However, systematic studies about how DNA sequences and concentrations are controlling the photophysical properties are still lacking. The aim of this thesis is to investigate the binding mechanisms of silver clusters binding and single stranded DNAs. Here in this thesis, we report synthesis and characterization of DNA-templated silver nanoclusters and provide a systematic interrogation of the effects of DNA concentrations and sequences, including lengths and secondary structures. We performed a series of syntheses utilizing five different sequences to explore the optimal synthesis condition. By characterizing samples with UV-vis and fluorescence spectroscopy, we achieved the most proper reactants ratio and synthesis conditions. Two of them were chosen for further concentration dependence studies and sequence dependence studies. We found that cytosine-rich sequences are more likely to produce silver nanoclusters with stronger fluorescence signals; however, sequences with hairpin secondary structures are more capable in stabilizing silver nanoclusters. In addition, the fluorescence peak emission intensities and wavelengths of the DNA templated silver clusters have sequence dependent fingerprints. This potentially can be applied to sequence sensing in the future. However all the current conclusions are not warranted; there is still difficulty in formulating general rules in DNA strand design and silver nanocluster production. Further investigation of more sequences could solve these questions in the future.

  11. Embedded of neodymium oxide nanoclusters in silica

    Science.gov (United States)

    Duhan, S.; Aghamkar, P.; Singh, M.; Kishore, N.

    2007-06-01

    The solgel process successfully prepared Nd IIO 3 / SiO II nanocomposites. After drying in air at 85°C for three days, samples were heat treated, in air, at 750, 950, 1150 and 1250°C. Characterizations were made by, Infrared spectroscopy, X-ray diffraction, and scanning electron microscopy. Mechanisms of neodymium oxide nano clusters formation in the densified silica matrix with respect to thermal treatment are discussed. XRD profiles confirm the crystallinity of the nanoclusters. The size of the nanoclusters was found in the range 15-30nm.

  12. Fluorescent DNA Stabilized Silver Nanoclusters as Biosensors

    Directory of Open Access Journals (Sweden)

    Alfonso Latorre

    2013-01-01

    Full Text Available DNA stabilized fluorescent silver nanoclusters are promising materials, of which fluorescent properties can be exploited to develop sensors. Particularly, the presence of a DNA strand in the structure has promoted the development of gene sensors where one part of the sensor is able to recognize the target gene sequence. Moreover, since oligonucleotides can be designed to have binding properties (aptamers a variety of sensors for proteins and cells have been developed using silver nanoclusters. In this review the applications of this material as sensors of different biomolecules are summarized.

  13. New insight into the structure of saturated chlorine layer on Ag(1 1 1): LT-STM and DFT study

    International Nuclear Information System (INIS)

    Atomic structures formed on the Ag(1 1 1) surface as a result of molecular chlorine adsorption have been studied with a low-temperature scanning tunneling microscopy (LT-STM) in a combination with DFT calculations. We have found that saturated chlorine coverage on Ag(1 1 1) is a complex system consisting of two different structural phases: small anti-phase domains of a (3 × 3) reconstruction and nanoclusters Ag3Cl7.

  14. New insight into the structure of saturated chlorine layer on Ag(1 1 1): LT-STM and DFT study

    Science.gov (United States)

    Andryushechkin, B. V.; Cherkez, V. V.; Gladchenko, E. V.; Zhidomirov, G. M.; Kierren, B.; Fagot-Revurat, Y.; Malterre, D.; Eltsov, K. N.

    2013-02-01

    Atomic structures formed on the Ag(1 1 1) surface as a result of molecular chlorine adsorption have been studied with a low-temperature scanning tunneling microscopy (LT-STM) in a combination with DFT calculations. We have found that saturated chlorine coverage on Ag(1 1 1) is a complex system consisting of two different structural phases: small anti-phase domains of a (3 × 3) reconstruction and nanoclusters Ag3Cl7.

  15. New insight into the structure of saturated chlorine layer on Ag(1 1 1): LT-STM and DFT study

    Energy Technology Data Exchange (ETDEWEB)

    Andryushechkin, B.V., E-mail: andrush@kapella.gpi.ru [International Joint Laboratory IMTAS, A.M. Prokhorov General Physics Institute, Russian Academy of Sciences, Vavilov str. 38, 119991 Moscow (Russian Federation); Cherkez, V.V. [International Joint Laboratory IMTAS, A.M. Prokhorov General Physics Institute, Russian Academy of Sciences, Vavilov str. 38, 119991 Moscow (Russian Federation); International Joint Laboratory IMTAS, Institut Jean Lamour, UMR CNRS 7198, équipe 102, Departement Physique de la Matière et des Matériaux, B.P. 239, Université H. Poincaré, Nancy, 54506 Vandoeuvre les Nancy (France); Gladchenko, E.V. [International Joint Laboratory IMTAS, A.M. Prokhorov General Physics Institute, Russian Academy of Sciences, Vavilov str. 38, 119991 Moscow (Russian Federation); Moscow Institute of Physics and Technology, Institutskii per. 9, 141700 Dolgoprudny, Moscow Region (Russian Federation); Zhidomirov, G.M. [International Joint Laboratory IMTAS, A.M. Prokhorov General Physics Institute, Russian Academy of Sciences, Vavilov str. 38, 119991 Moscow (Russian Federation); Kierren, B.; Fagot-Revurat, Y.; Malterre, D. [International Joint Laboratory IMTAS, Institut Jean Lamour, UMR CNRS 7198, équipe 102, Departement Physique de la Matière et des Matériaux, B.P. 239, Université H. Poincaré, Nancy, 54506 Vandoeuvre les Nancy (France); Eltsov, K.N. [International Joint Laboratory IMTAS, A.M. Prokhorov General Physics Institute, Russian Academy of Sciences, Vavilov str. 38, 119991 Moscow (Russian Federation); Moscow Institute of Physics and Technology, Institutskii per. 9, 141700 Dolgoprudny, Moscow Region (Russian Federation)

    2013-02-15

    Atomic structures formed on the Ag(1 1 1) surface as a result of molecular chlorine adsorption have been studied with a low-temperature scanning tunneling microscopy (LT-STM) in a combination with DFT calculations. We have found that saturated chlorine coverage on Ag(1 1 1) is a complex system consisting of two different structural phases: small anti-phase domains of a (3 × 3) reconstruction and nanoclusters Ag{sub 3}Cl{sub 7}.

  16. Oligonucleotide-stabilized fluorescent silver nanoclusters for the specific and sensitive detection of biotin.

    Science.gov (United States)

    Xiong, Xiaoli; Tang, Yan; Zhao, Jingjin; Zhao, Shulin

    2016-02-01

    A novel biotin fluorescent probe based on oligonucleotide-stabilized silver nanoclusters (DNA-AgNCs) was synthesized by employing a biotinylated cytosine-rich sequence as a synthesized template. The fluorescence properties of the DNA-AgNCs are related to the modified position of the DNA. When biotin is linked to the middle thymine base of the DNA sequence, the DNA-AgNCs emit the strongest fluorescence. Moreover, the stability of the DNA-AgNCs was affected by avidin through biotin-avidin binding, quenching the fluorescence of the DNA-AgNCs. In contrast, if free biotin is further introduced into this system, the quenching is apparently weakened by competition, leading to the restoration of fluorescence. This phenomenon can be utilized for the detection of biotin. Under the optimal conditions, the fluorescence recovery is linearly proportional to the concentration of biotin in the range of 10 nM-1.0 μM with a detection limit of 6.0 nM. This DNA-AgNCs probe with excellent fluorescent properties is sensitive and selective for the detection of biotin and has been applied for the determination of biotin in wheat flour. PMID:26750716

  17. In-solution multiplex miRNA detection using DNA-templated silver nanocluster probes.

    Science.gov (United States)

    Shah, Pratik; Thulstrup, Peter Waaben; Cho, Seok Keun; Bhang, Yong-Joo; Ahn, Jong Cheol; Choi, Suk Won; Bjerrum, Morten Jannik; Yang, Seong Wook

    2014-05-01

    MicroRNAs (miRNAs) are small regulatory RNAs (size ∼21nt to ∼25nt) that can be used as biomarkers of disease diagnosis, and efforts have been directed towards the invention of a rapid, simple and sequence-selective detection method for miRNAs. We recently developed a DNA/silver nanoclusters (AgNCs)-based turn-off fluorescence method in the presence of target miRNA. To further advance our method toward multiplex miRNA detection in solution, the design of various fluorescent DNA/AgNCs probes was essential. Therefore, tethering of DNA-12nt scaffolds with 9 different AgNCs emitters to target-sensing DNA sequences was investigated. Interestingly, for the creation of spectrally different DNA/AgNCs probes, not only were the emitters encapsulated in 9 different DNA-12nt scaffolds necessary but the tethered target-sensing DNA sequences are also crucial to tune the fluorescence across the visible to infra-red region. In this study, we obtained three spectrally distinctive emitters of each DNA/AgNCs probes such as green, red, and near-infrared (NIR) fluorescence. Using these DNA/AgNCs probes, we here show a proof of concept for a rapid, one-step, in-solution multiplex miRNA detection method. PMID:24616905

  18. Fabrication of highly catalytic silver nanoclusters/graphene oxide nanocomposite as nanotag for sensitive electrochemical immunoassay.

    Science.gov (United States)

    Wang, Jiamian; Wang, Xiuyun; Wu, Shuo; Song, Jie; Zhao, Yanqiu; Ge, Yanqiu; Meng, Changgong

    2016-02-01

    Silver nanoclusters and graphene oxide nanocomposite (AgNCs/GRO) is synthesized and functionalized with detection antibody for highly sensitive electrochemical sensing of carcinoembryonic antigen (CEA), a model tumor marker involved in many cancers. AgNCs with large surface area and abundant amount of low-coordinated sites are synthesized with DNA as template and exhibit high catalytic activity towards the electrochemical reduction of H2O2. GRO is employed to assemble with AgNCs because it has large specific surface area, super electronic conductivity and strong π-π stacking interaction with the hydrophobic bases of DNA, which can further improve the catalytic ability of the AgNCs. Using AgNCs/GRO as signal amplification tag, an enzyme-free electrochemical immunosensing protocol is designed for the highly sensitive detection of CEA on the capture antibody functionalized immunosensing interface. Under optimal conditions, the designed immunosensor exhibits a wide linear range from 0.1 pg mL(-1) to 100 ng mL(-1) and a low limit of detection of 0.037 pg mL(-1). Practical sample analysis reveals the sensor has good accuracy and reproducibility, indicating the great application prospective of the AgNCs/GRO in fabricating highly sensitive immunosensors, which can be extended to the detection of various kinds of low abundance disease related proteins. PMID:26772127

  19. A Novel Label-Free microRNA-155 Detection on the Basis of Fluorescent Silver Nanoclusters.

    Science.gov (United States)

    Hosseini, Morteza; Akbari, Azam; Ganjali, Mohammad Reza; Dadmehr, Mehdi; Rezayan, Ali Hossein

    2015-07-01

    In this paper, a new approach for microRNA-155 (miRNA-155) detection was described based on the fluorescence quenching of oligonucleotide-templated silver nanoclusters (DNA-AgNCs). The specific DNA scaffold with two different nucleotides fragments were used: one was enriched with a cytosine sequence fragment (C12) that could result in DNA-AgNCs with a high quantum yield via a chemical reduction method, and the other was the probe fragment (5- CUGUUAAUGCUAAUCGUG-3) which could selectively bind to the miRNA-155. Thus, the as-prepared AgNCs could exhibit quenched fluorescence when binding to the target miRNA-155. The fluorescence ratio of the DNA-AgNCs was quenched in a linearly proportional manner to the concentration of the target in the range of 0.2 nM to 30 nM with a detection limit of 0.1 nM. PMID:25953605

  20. Nonperturbative effects on nucleation

    CERN Document Server

    Gleiser, Marcello; Gleiser, Marcelo; Heckler, Andrew F

    1996-01-01

    A nonperturbative correction to the thermal nucleation rate of critical bubbles in a first order phase transition is estimated. The correction originates from large-amplitude fluctuations which may be present before the transition occurs. Using a simple model of a scalar field in a double-well potential, we present a method to obtain a corrected potential which incorporates the free-energy density available from large-amplitude fluctuations, which is not included in the usual perturbative calculation. For weaker phase transitions, the nucleation rate can be much larger than the rate calculated via perturbation theory. As an application of our method, we show how nonperturbative corrections can both qualitatively and quantitatively explain anomalously high nucleation rates observed in 2-d numerical simulations.

  1. Silver nanoclusters emitting weak NIR fluorescence biomineralized by BSA

    Science.gov (United States)

    Li, Baoshun; Li, Jianjun; Zhao, Junwu

    2015-01-01

    Noble metal (e.g., gold and silver) nanomaterials possess unique physical and chemical properties. In present work, silver nanoclusters (also known as silver quantum clusters or silver quantum dots) were synthesized by bovine serum albumin (BSA) biomineralization. The synthesized silver nanoclusters were characterized by UV-VIS absorption spectroscopy, fluorescence spectroscopy, upconversion emission spectroscopy, TEM, HRTEM and FTIR spectroscopy. TEM results showed that the average size of the silver nanoclusters was 2.23 nm. Fluorescence results showed that these silver nanoclusters could emit weak near-infrared (NIR) fluorescence (the central emission wavelength being about 765 nm). And the central excitation wavelength was about 395 nm, in the UV spectral region. These silver nanoclusters showed an extraordinarily large gap (about 370 nm) between the central excitation wavelength and central emission wavelength. In addition, it was found that these silver nanoclusters possess upconversion emission property. Upconversion emission results showed that the upconversion emission spectrum of the silver nanoclusters agreed well with their normal fluorescence emission spectrum. The synthesized silver nanoclusters showed high stability in aqueous solution and it was considered that they might be confined in BSA molecules. It was found that silver nanoclusters might enhance and broaden the absorption of proteins, and the protein absorption peak showed an obvious red shift (being 7 nm) after the formation of silver nanoclusters.

  2. Nucleation of Gold in the Electric Field on the Surface of Template

    Directory of Open Access Journals (Sweden)

    M.Yu. Barabash

    2014-04-01

    Full Text Available The comparative study of gold nanoclusters phase formation processes in the matrix of poly-N-vinil-carbazole ( PVCa at co-condensation from the gas phase in local electric field near the surface of the template and on the surface of neutral substrates is investigated. TEM studies have directly observed the golden critical nuclei in the PVCa matrix and determine their size. Experimentally proved that the size of the gold critical nuclei is 1.9 nm, whereas in the non-uniform electric field of the template is reduced it to 1.2 nm. Modelling the influence of polarization component on Au nucleation within the thermodynamic approach to electrically charged and neutral gold nanoclusters showed the possibility of the existence of the measured changes in the critical nucleus size in the field 108-1010 V/m.

  3. Vapor Condensed and Supercooled Glassy Nanoclusters.

    Science.gov (United States)

    Qi, Weikai; Bowles, Richard K

    2016-03-22

    We use molecular simulation to study the structural and dynamic properties of glassy nanoclusters formed both through the direct condensation of the vapor below the glass transition temperature, without the presence of a substrate, and via the slow supercooling of unsupported liquid nanodroplets. An analysis of local structure using Voronoi polyhedra shows that the energetic stability of the clusters is characterized by a large, increasing fraction of bicapped square antiprism motifs. We also show that nanoclusters with similar inherent structure energies are structurally similar, independent of their history, which suggests the supercooled clusters access the same low energy regions of the potential energy landscape as the vapor condensed clusters despite their different methods of formation. By measuring the intermediate scattering function at different radii from the cluster center, we find that the relaxation dynamics of the clusters are inhomogeneous, with the core becoming glassy above the glass transition temperature while the surface remains mobile at low temperatures. This helps the clusters sample the highly stable, low energy structures on the potential energy surface. Our work suggests the nanocluster systems are structurally more stable than the ultrastable glassy thin films, formed through vapor deposition onto a cold substrate, but the nanoclusters do not exhibit the superheating effects characteristic of the ultrastable glass states. PMID:26866858

  4. Surface morphology and electronic structure of Ni/Ag(100)

    International Nuclear Information System (INIS)

    The growth morphology and electronic structure of Ni on Ag(100) has been studied with scanning tunneling microscopy (STM) and synchrotron based angle resolved photoemission spectroscopy. At deposition temperatures at or below 300 K, STM reveals Ni cluster growth on the surface along with some subsurface growth. Upon annealing to 420 K, virtually all Ni segregates into the subsurface region forming embedded nanoclusters. The electronic structure of Ni d bands in the unannealed surface shows dispersion only perpendicular to the surface whereas the annealed surface has Ni d bands that exhibit a three-dimensional-like structure. This is a result of the increased Ni d-Ag sp hybridization bonding and increased coordination of the embedded Ni nanoclusters. (c) 2000 American Vacuum Society

  5. Nonequilibrium thermodynamics of nucleation

    NARCIS (Netherlands)

    Schweizer, M.; Sagis, L.M.C.

    2014-01-01

    We present a novel approach to nucleation processes based on the GENERIC framework (general equation for the nonequilibrium reversible-irreversible coupling). Solely based on the GENERIC structure of time-evolution equations and thermodynamic consistency arguments of exchange processes between a met

  6. Structural Characterization of Crystalline Ice Nanoclusters

    Science.gov (United States)

    Blake, David

    2000-01-01

    Water ice nanoclusters are useful analogs for studying a variety of processes that occur within icy grains in the extraterrestrial environment. The surface of ice nanoclusters prepared in the laboratory is similar to the surface of interstellar ice grains. In cold molecular clouds, the silicate cores of interstellar grains are typically approx. 100 nm in diameter and have a coating of impure amorphous water ice. Depositional, thermal and radiolytic processes leave the surface and subsurface molecules in a disordered state. In this state, structural defects become mobile and reactions of trapped gases and small molecules can occur. The large surface area of nanocluster deposits relative to their bulk allows for routine observation of such surface-mediated processes. Furthermore, the disordered surface and subsurface layers in nanocluster deposits mimic the structure of amorphous ice rinds found on interstellar dust grains. Transmission Electron Microscopy (TEM has been used tn characterize the crystallinity, growth mechanism, and size distribution of nanoclusters formed from a mixture of water vapor with an inert carrier gas that has been rapidly cooled to 77K. E M imaging reveals a Gaussian size distribution around a modal diameter that increases from approx. 15 to 30 nm as the percentage of water vapor within the mixture increases from 0.5 to 2.007, respectively . TEM bright and dark field imaging also reveals the crystalline nature of the clusters. h4any of the clusters show a mosaic structure in which crystalline domains originate at the center Other images show mirror planes that are separated by approx. 10 nm. Electron diffraction patterns of these clusters show that the clusters are composed of cubic ice with only a small hexagonal component. Further, the crystalline domain size is approximately the same as the modal diameter suggesting that the clusters are single crystals.

  7. THERMODYNAMIC STUDY OF NUCLEATION PROPERTY OF NUCLEATING AGENT

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    It is deduced from thermodynamic relations and confirm ed by experiment results that the nucleation rate and nucleation temperature o f nucleating agents in the glass are dependent upon their melting entropy ΔSm melting temperature Tm and crystal-type transition in terms of some mathemati cal expressions.

  8. Gold Doping of Silver Nanoclusters: A 26-Fold Enhancement in the Luminescence Quantum Yield.

    Science.gov (United States)

    Soldan, Giada; Aljuhani, Maha A; Bootharaju, Megalamane S; AbdulHalim, Lina G; Parida, Manas R; Emwas, Abdul-Hamid; Mohammed, Omar F; Bakr, Osman M

    2016-05-01

    A high quantum yield (QY) of photoluminescence (PL) in nanomaterials is necessary for a wide range of applications. Unfortunately, the weak PL and moderate stability of atomically precise silver nanoclusters (NCs) suppress their utility. Herein, we accomplished a ≥26-fold PL QY enhancement of the Ag29 (BDT)12 (TPP)4 cluster (BDT: 1,3-benzenedithiol; TPP: triphenylphosphine) by doping with a discrete number of Au atoms, producing Ag29-x Aux (BDT)12 (TPP)4 , x=1-5. The Au-doped clusters exhibit an enhanced stability and an intense red emission around 660 nm. Single-crystal XRD, mass spectrometry, optical, and NMR spectroscopy shed light on the PL enhancement mechanism and the probable locations of the Au dopants within the cluster. PMID:27060602

  9. Dual emission fluorescent silver nanoclusters for sensitive detection of the biological coenzyme NAD+/NADH.

    Science.gov (United States)

    Yuan, Yufeng; Huang, Kehan; Chang, Mengfang; Qin, Cuifang; Zhang, Sanjun; Pan, Haifeng; Chen, Yan; Xu, Jianhua

    2016-02-01

    Fluorescent silver nanoclusters (Ag NCs) displaying dual-excitation and dual-emission properties have been developed for the specific detection of NAD(+) (nicotinamide adenine dinucleotide, oxidized form). With the increase of NAD(+) concentrations, the longer wavelength emission (with the peak at 550 nm) was gradually quenched due to the strong interactions between the NAD(+) and Ag NCs, whereas the shorter wavelength emission (peaking at 395 nm) was linearly enhanced. More important, the dual-emission intensity ratio (I395/I550), fitting by a single-exponential decay function, can efficiently detect various NAD(+) levels from 100 to 4000 μM, as well as label NAD(+)/NADH (reduced form of NAD) ratios in the range of 1-50. PMID:26452612

  10. Ligation-triggered fluorescent silver nanoclusters system for the detection of nicotinamide adenine dinucleotide.

    Science.gov (United States)

    Cao, Zhijuan; Wang, Pei; Qiu, Xue; Lau, Choiwan; Lu, Jianzhong

    2014-03-01

    Herein, we demonstrate a novel silver nanocluster-based fluorescent system for the detection of nicotinamide adenine dinucleotide (NAD(+)), an important biological small molecule involved in a wide range of biological processes. A single-stranded dumbbell DNA probe was designed and used for the assay, which contained a nick in the stem, a poly-cytosine nucleotide loop close to 5' end as the template for the formation of highly fluorescent silver nanoclusters (Ag NCs) and another loop close to 3' end. Only in the presence of NAD(+), the probe was linked at 5' and 3' ends by Escherichia coli DNA ligase, which blocked the DNA polymerase-based extension reaction, ensuring the formation of fluorescent Ag NCs. This technique provided a logarithmic linear relationship in the range of 1 pM-500 nM with a detection limit of as low as 1 pM NAD(+), and exhibited high selectivity against its analogues, and was then successfully used for the detection of NAD(+) level in four kinds of cell homogenates. In addition, this new approach was conducted in an isothermal and homogeneous condition without the need of any thermal cycling, washing, and separation steps, making it very simple. Overall, this label-free protocol offers a promising alternative for the detection of NAD(+), taking advantage of specificity, sensitivity, cost-efficiency, and simplicity. PMID:24442015

  11. Fluorescent silver nanocluster DNA probes for multiplexed detection using microfluidic capillary electrophoresis.

    Science.gov (United States)

    Del Bonis-O'Donnell, Jackson Travis; Fygenson, Deborah K; Pennathur, Sumita

    2015-03-01

    DNA-stabilized fluorescent silver nanoclusters (AgNC DNA) are a new class of fluorophore that are formed by sequence specific interactions between silver and single-stranded DNA. By incorporating both target-binding and fluorescent-reporting sequences into a single synthetic DNA oligomer, AgNC DNA probes eliminate the need to conjugate dye or quencher molecules. In this study, we modify a AgNC DNA probe to demonstrate single-color multiplexed detection of DNA targets. We show that appending different lengths of poly-dT to the probe sequences tunes the electrophoretic mobility of AgNC DNA probes without affecting their fluorescence spectra. We use this to introduce a set of AgNC DNA probes selective for Hepatitis A, B and C target sequences that can be processed together in a simple, single-step protocol and distinguished with a resolution of 3.47 and signal to noise ratio of 17.23 in under 10 seconds by microfluidic capillary electrophoresis. PMID:25601044

  12. Statistics of heterogeneous nucleation

    Czech Academy of Sciences Publication Activity Database

    Sveshnikov, Alexey; Demo, Pavel; Kožíšek, Zdeněk

    Valencia : American Scientific Publishers, 2015 - (Kožíšek, Z.; Nitsch, K.; Koman, M.; Behúlová, M.), s. 313-315 ISSN 2164-6627. [Development of Materials Science and Education 2013 (DMSRE23). Kežmarské Žľaby (SK), 09.09.2013-13.09.2013] R&D Projects: GA ČR GAP108/12/0891 Institutional support: RVO:68378271 Keywords : heterogeneous nucleation Subject RIV: BM - Solid Matter Physics ; Magnetism

  13. Application of ionizing radiation for metal nanoclusters synthesis

    International Nuclear Information System (INIS)

    Complete text of publication follows. Possibility of ionizing radiation application in nanotechnology has been observed from very beginning when this field of science and technology was named. The lithography is based on electron and ion beam applications, and metal clusters synthesis by radiation induced radicals was reported many years ago. International Atomic Energy Agency was the first organization which has started coordinated programs on radiation applications in nanotechnology which are being continued in the frame of regional cooperation project RER8014. Some of applications led to patented technical solutions. Then review papers and chapters in the books have been published. The main applications beside of lithography deal with metal nanoclusters and nano-composites synthesis. Polymer composites containing metal nanoparticles have attracted a great interest due to their unique chemical and physical properties. 'Green' chemistry promotes application of natural fibers in such structures, among them cellulose is one of the most frequently used. However, cellulose fabric have ability to absorb moisture, so under certain conditions of humidity and temperature they can be subjected to microbial attack. One of the most popular and best known antibacterial agents is silver, which serves as a potential antibacterial material acting against an exceptionally broad spectrum of bacteria including activity against antibiotic-resistant bacteria. Silver nanoparticles (Ag NPs) were grown at the cellulose fibers surface by direct reduction of AgNO3 with electron beam (EB) application. The big field of development concerns nano composites, possibility of e/X units application enlarge this possibility to industrial scale product manufacturing. Acknowledgement: This work was supported by the IAEA, regional project RER/8/014 and by the Ministry of Science and Higher Education, project DPN/W14/IAEA/2009.

  14. Aggregation-induced emission from gold nanoclusters for use as a luminescence-enhanced nanosensor to detect trace amounts of silver ions.

    Science.gov (United States)

    Li, Bingzhi; Wang, Xi; Shen, Xin; Zhu, Wanying; Xu, Lei; Zhou, Xuemin

    2016-04-01

    Several research have reported that silver ions (Ag(+)) could enhance the photoluminescence of some kinds of gold nanoclusters (AuNCs), and redox reaction involved mechanisms were recognized as the main reason to cause such phenomenon. However, in this work, we found that Ag(+) could enhance the luminescence of aggregation-induced emission gold nanoclusters (AIE-AuNCs) without valence state change. Upon addition of Ag(+), the luminescence of AIE-AuNCs enhanced instantly by 7.2 times with a red-shift of emission peak and a complete restoration of luminescence features was observed when Ag(+) was removed. A cost-effective, rapid-response, highly sensitive and selective method to detect trace amount of Ag(+) has thereby been established using AIE-AuNCs as a nanosensor. This analytical method exhibited a linear range of 0.5nM-20μM with a limit of detection of 0.2nM and it showed great promise for Ag(+) monitoring in environmental water. PMID:26773614

  15. Bleb Nucleation through Membrane Peeling

    CERN Document Server

    Alert, Ricard

    2016-01-01

    We study the nucleation of blebs, i.e., protrusions arising from a local detachment of the membrane from the cortex of a cell. Based on a simple model of elastic linkers with force-dependent kinetics, we show that bleb nucleation is governed by membrane peeling. By this mechanism, the growth or shrinkage of a detached membrane patch is completely determined by the linker kinetics, regardless of the energetic cost of the detachment. We predict the critical nucleation radius for membrane peeling and the corresponding effective energy barrier. These may be typically smaller than those predicted by classical nucleation theory, implying a much faster nucleation. We also perform simulations of a continuum stochastic model of membrane-cortex adhesion to obtain the statistics of bleb nucleation times as a function of the stress on the membrane. The determinant role of membrane peeling changes our understanding of bleb nucleation and opens new directions in the study of blebs.

  16. Bleb Nucleation through Membrane Peeling

    Science.gov (United States)

    Alert, Ricard; Casademunt, Jaume

    2016-02-01

    We study the nucleation of blebs, i.e., protrusions arising from a local detachment of the membrane from the cortex of a cell. Based on a simple model of elastic linkers with force-dependent kinetics, we show that bleb nucleation is governed by membrane peeling. By this mechanism, the growth or shrinkage of a detached membrane patch is completely determined by the linker kinetics, regardless of the energetic cost of the detachment. We predict the critical nucleation radius for membrane peeling and the corresponding effective energy barrier. These may be typically smaller than those predicted by classical nucleation theory, implying a much faster nucleation. We also perform simulations of a continuum stochastic model of membrane-cortex adhesion to obtain the statistics of bleb nucleation times as a function of the stress on the membrane. The determinant role of membrane peeling changes our understanding of bleb nucleation and opens new directions in the study of blebs.

  17. Surface-supported Ag islands stabilized by a quantum size effect: Their interaction with small molecules relevant to ethylene epoxidation

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Dahai [Iowa State Univ., Ames, IA (United States)

    2013-05-15

    This dissertation focuses on how QSE-stabilized, surface-supported Ag nanoclusters will interact with ethylene or oxygen. Experiments are performed to determine whether the QSE-mediated Ag islands react differently toward adsorption of ethylene or oxygen, or whether the adsorption of these small molecules will affect the QSE-mediated stability of Ag islands. Studies of the interaction of oxygen with Ag/Si(111)-7×7 were previously reported, but these studies were performed at a low Ag coverage where 3D Ag islands were not formed. So the study of such a system at a higher Ag coverage will be a subject of this work. The interaction of ethylene with Ag/Si(111)-7×7, as well as the interaction of oxygen with Ag/NiAl(110) are also important parts of this study.

  18. Flourescent Peptide-Stabilized Silver-Nanoclusters

    DEFF Research Database (Denmark)

    Gregersen, Simon

    Fluorescent probes are widely used in the fields of imaging, detection, and diagnostics, and in order to achieve methodical progress, the search for new tools is an on-going quest. Within the last few decades, few-atom noble metal nanoclusters (NCs) have gathered increasing attention due to their...... of MALDI-TOF mass spectrometry for the determination of solution-phase composition of organic-silver complexes.......Fluorescent probes are widely used in the fields of imaging, detection, and diagnostics, and in order to achieve methodical progress, the search for new tools is an on-going quest. Within the last few decades, few-atom noble metal nanoclusters (NCs) have gathered increasing attention due to their...

  19. Surface modification of gold nanoparticles and nanoclusters

    OpenAIRE

    Sokolowska, Karolina

    2016-01-01

    Gold nanoparticles are used in many beneficial technological applications in biochemistry, medicine and electronics. Among them, monolayer protected gold nanoclusters (MPCs) have received a significant attention in the scientific community due to their well-defined atomic structure, which is important for fundamental studies of nanoparticles properties and their functionalization. These particles, with a precise number of atoms, exhibit size-dependent optical, chemical and electronic properti...

  20. RF heating of nanoclusters for cancer therapy

    Science.gov (United States)

    Letfullin, Renat R.; Letfullin, Alla R.; George, Thomas F.

    2015-03-01

    Nanodrugs selectively delivered to a tumor site can be activated by radiation for drug release, or nanoparticles (NPs) can be used as a drug themselves by producing biological damage in cancer cells through thermal, mechanical ablations or charged particle emission. Radio-frequency (RF) waves have an excellent ability to penetrate into the human body without causing healthy tissue damage, which provides a great opportunity to activate/heat NPs delivered inside the body as a contrast agent for diagnosis and treatment purposes. However the heating of NPs in the RF range of the spectrum is controversial in the research community because of the low power load of RF waves and low absorption of NPs in the RF range. To resolve these weaknesses in the RF activation of NPs and dramatically increase absorption of contrast agents in tumor, we suggest aggregating the nanoclusters inside or on the surface of the cancer cells. We simulate space distribution of temperature changes inside and outside metal and dielectric nanopraticles/nanoclusters, determine the number of nanoparticles needed to form a cluster, and estimate the thermal damage area produced in surrounding medium by nanopraticles/nanoclusters heated in the RF field.

  1. Synthesis and characterization of mixed ligand chiral nanoclusters

    OpenAIRE

    Güven, Zekiye Pelin; Guven, Zekiye Pelin; Üstbaş, Burçin; Ustbas, Burcin; Harkness, Kellen M.; Coşkun, Hikmet; Coskun, Hikmet; Joshi, Chakra P.; Besong, Tabot M. D.; Stellacci, Francesco; Bakr, Osman M.; Akbulut, Özge; Akbulut, Ozge

    2015-01-01

    Chiral mixed ligand silver nanoclusters were synthesized in the presence of a chiral and an achiral ligand. The ratio of the ligands was changed to track the formation of these clusters. While the chiral ligand lead to nanoparticles, Presence of the achiral ligand induced the formation of nanoclusters with chiral properties.

  2. A facile synthesis of fluorescent silver nanoclusters with human ferritin as a synthetic and interfacing ligand.

    Science.gov (United States)

    Lee, In Hwan; Ahn, Byungjun; Lee, Jeong Min; Lee, Chang Soo; Jung, Yongwon

    2015-05-21

    Water-soluble fluorescent silver nanoclusters (NCs) formed on biomolecule ligands have been extensively studied due to their great potential as new biocompatible fluorescent materials for biosensors. As synthetic ligands, proteins in particular can provide unique structures and functions to the assembled fluorescent silver clusters. A key challenge, however, is to develop appropriate protein ligands and synthetic approaches for cluster formation, especially using native aqueous solutions, to fully preserve the valuable properties of the protein templates. Here we report a human ferritin-templated synthesis of fluorescent silver NCs under neutral aqueous buffer conditions. The unique metal binding property of ferritin and an optimized silver ion reduction allowed us to produce highly stable fluorescent silver NCs that are steadily assembled in the cage-like ferritin proteins. The fluorescent clusters were also successfully assembled on genetically engineered ferritin with antibody-binding protein G. The resulting protein G-ferritin-silver NC complex fully retained the ferritin structure as well as the antibody binding ability. The present silver nanoclusters on ferritin (Ft-Ag NCs) also showed highly specific Cu(2+)-induced fluorescence quenching. By exploiting the large but stable nature of ferritin, we fabricated a highly robust and porous hydrogel sensor system for rapid Cu(2+) detection, where the Ft-Ag NCs were stably encapsulated in surface-bound hydrogels with large pore sizes. Our Ft-Ag NCs that are formed under native aqueous conditions will have great potential as a new fluorescent material with the high structural and functional diversities of ferritin. PMID:25848642

  3. Hexaphenylbenzene-Stabilized Luminescent Silver Nanoclusters: A Potential Catalytic System for the Cycloaddition of Terminal Alkynes with Isocyanides.

    Science.gov (United States)

    Pramanik, Subhamay; Bhalla, Vandana; Kumar, Manoj

    2015-10-21

    A hexaphenylbenzene (HPB)-based derivative bearing thiol groups has been designed and synthesized that undergoes aggregation-induced emission enhancement in mixed aqueous media to form rodlike fluorescent aggregates. These rodlike aggregates behave as a "not quenched" probe for the detection of silver ions and further act as reactors and stabilizers for reducing-agent-free preparation of blue luminescent silver nanoclusters at room temperature. The utilization of fluorescent supramolecular aggregates for the preparation of Ag NCs in mixed aqueous media is unprecedented in the literature. Moreover, the wet chemical method that we are reporting in the present paper for the preparation of luminescent silver nanoclusters is better than the other methods reported in the literature. Further, these in situ generated Ag NCs showed exceptional catalytic activity in the preparation of pyrroles involving cocyclization of isocyanides and terminal alkynes. Interestingly, the catalytic efficiency of in situ generated Ag NCs was found to be better than the other catalytic systems reported in the literature. PMID:26420310

  4. DNA abasic site-directed formation of fluorescent silver nanoclusters for selective nucleobase recognition

    Energy Technology Data Exchange (ETDEWEB)

    Ma Kun; Cui Qinghua; Liu Guiying; Wu Fei; Xu Shujuan; Shao Yong, E-mail: yshao@zjnu.cn [Institute of Physical Chemistry, Zhejiang Normal University, Jinhua 321004, Zhejiang (China)

    2011-07-29

    DNA single-nucleotide polymorphism (SNP) detection has attracted much attention due to mutation related diseases. Various methods for SNP detection have been proposed and many are already in use. Here, we find that the abasic site (AP site) in the DNA duplex can be developed as a capping scaffold for the generation of fluorescent silver nanoclusters (Ag NCs). As a proof of concept, the DNA sequences from fragments near codon 177 of cancer supression gene p53 were used as a model for SNP detection by in situ formed Ag NCs. The formation of fluorescent Ag NCs in the AP site-containing DNA duplex is highly selective for cytosine facing the AP site and guanines flanking the site and can be employed in situ as readout for SNP detection. The fluorescent signal-on sensing for SNP based on this inorganic fluorophore is substantially advantageous over the previously reported signal-off responses using low-molecular-weight organic ligands. The strong dependence of fluorescent Ag NC formation on the sequences surrounding the AP site was successfully used to identify mutations in codon 177 of cancer supression gene p53. We anticipate that this approach will be employed to develop a practical SNP detection method by locating an AP site toward the midway cytosine in a target strand containing more than three consecutive cytosines.

  5. DNA abasic site-directed formation of fluorescent silver nanoclusters for selective nucleobase recognition

    International Nuclear Information System (INIS)

    DNA single-nucleotide polymorphism (SNP) detection has attracted much attention due to mutation related diseases. Various methods for SNP detection have been proposed and many are already in use. Here, we find that the abasic site (AP site) in the DNA duplex can be developed as a capping scaffold for the generation of fluorescent silver nanoclusters (Ag NCs). As a proof of concept, the DNA sequences from fragments near codon 177 of cancer supression gene p53 were used as a model for SNP detection by in situ formed Ag NCs. The formation of fluorescent Ag NCs in the AP site-containing DNA duplex is highly selective for cytosine facing the AP site and guanines flanking the site and can be employed in situ as readout for SNP detection. The fluorescent signal-on sensing for SNP based on this inorganic fluorophore is substantially advantageous over the previously reported signal-off responses using low-molecular-weight organic ligands. The strong dependence of fluorescent Ag NC formation on the sequences surrounding the AP site was successfully used to identify mutations in codon 177 of cancer supression gene p53. We anticipate that this approach will be employed to develop a practical SNP detection method by locating an AP site toward the midway cytosine in a target strand containing more than three consecutive cytosines.

  6. DNA abasic site-directed formation of fluorescent silver nanoclusters for selective nucleobase recognition

    Science.gov (United States)

    Ma, Kun; Cui, Qinghua; Liu, Guiying; Wu, Fei; Xu, Shujuan; Shao, Yong

    2011-07-01

    DNA single-nucleotide polymorphism (SNP) detection has attracted much attention due to mutation related diseases. Various methods for SNP detection have been proposed and many are already in use. Here, we find that the abasic site (AP site) in the DNA duplex can be developed as a capping scaffold for the generation of fluorescent silver nanoclusters (Ag NCs). As a proof of concept, the DNA sequences from fragments near codon 177 of cancer supression gene p53 were used as a model for SNP detection by in situ formed Ag NCs. The formation of fluorescent Ag NCs in the AP site-containing DNA duplex is highly selective for cytosine facing the AP site and guanines flanking the site and can be employed in situ as readout for SNP detection. The fluorescent signal-on sensing for SNP based on this inorganic fluorophore is substantially advantageous over the previously reported signal-off responses using low-molecular-weight organic ligands. The strong dependence of fluorescent Ag NC formation on the sequences surrounding the AP site was successfully used to identify mutations in codon 177 of cancer supression gene p53. We anticipate that this approach will be employed to develop a practical SNP detection method by locating an AP site toward the midway cytosine in a target strand containing more than three consecutive cytosines.

  7. Self-organized one-atom thick fractal nanoclusters via field-induced atomic transport

    Science.gov (United States)

    Batabyal, R.; Mahato, J. C.; Das, Debolina; Roy, Anupam; Dev, B. N.

    2013-08-01

    We report on the growth of a monolayer thick fractal nanostructures of Ag on flat-top Ag islands, grown on Si(111). Upon application of a voltage pulse at an edge of the flat-top Ag island from a scanning tunneling microscope tip, Ag atoms climb from the edge onto the top of the island. These atoms aggregate to form precisely one-atom thick nanostructures of fractal nature. The fractal (Hausdorff) dimension, DH = 1.75 ± 0.05, of this nanostructure has been determined by analyzing the morphology of the growing nanocluster, imaged by scanning tunneling microscopy, following the application of the voltage pulse. This value of the fractal dimension is consistent with the diffusion limited aggregation (DLA) model. We also determined two other fractal dimensions based on perimeter-radius-of-gyration (DP) and perimeter-area (D'P) relationship. Simulations of the DLA process, with varying sticking probability, lead to different cluster morphologies [P. Meakin, Phys. Rev. A 27, 1495 (1983)]; however, the value of DH is insensitive to this difference in morphology. We suggest that the morphology can be characterized by additional fractal dimension(s) DP and/or D'P, besides DH. We also show that within the DLA process DP = DH [C. Amitrano et al., Phys. Rev. A 40, 1713 (1989)] is only a special case; in general, DP and DH can be unequal. Characterization of fractal morphology is important for fractals in nanoelectronics, as fractal morphology would determine the electron transport behavior.

  8. A complementary palette of NanoCluster Beacons.

    Science.gov (United States)

    Obliosca, Judy M; Babin, Mark C; Liu, Cong; Liu, Yen-Liang; Chen, Yu-An; Batson, Robert A; Ganguly, Mainak; Petty, Jeffrey T; Yeh, Hsin-Chih

    2014-10-28

    NanoCluster Beacons (NCBs), which use few-atom DNA-templated silver clusters as reporters, are a type of activatable molecular probes that are low-cost and easy to prepare. While NCBs provide a high fluorescence enhancement ratio upon activation, their activation colors are currently limited. Here we report a simple method to design NCBs with complementary emission colors, creating a set of multicolor probes for homogeneous, separation-free detection. By systematically altering the position and the number of cytosines in the cluster-nucleation sequence, we have tuned the activation colors of NCBs to green (C8-8, 460 nm/555 nm); yellow (C5-5, 525 nm/585 nm); red (C3-4, 580 nm/635 nm); and near-infrared (C3-3, 645 nm/695 nm). At the same NCB concentration, the activated yellow NCB (C5-5) was found to be 1.3 times brighter than the traditional red NCB (C3-4). Three of the four colors (green, yellow, and red) were relatively spectrally pure. We also found that subtle changes in the linker sequence (down to the single-nucleotide level) could significantly alter the emission spectrum pattern of an NCB. When the length of linker sequences was increased, the emission peaks were found to migrate in a periodic fashion, suggesting short-range interactions between silver clusters and nucleobases. Size exclusion chromatography results indicated that the activated NCBs are more compact than their native duplex forms. Our findings demonstrate the unique photophysical properties and environmental sensitivities of few-atom DNA-templated silver clusters, which are not seen before in common organic dyes or luminescent crystals. PMID:25299363

  9. An amplified electrochemical aptasensor based on hybridization chain reactions and catalysis of silver nanoclusters

    Science.gov (United States)

    Chen, Ling; Sha, Liang; Qiu, Yuwei; Wang, Guangfeng; Jiang, Hong; Zhang, Xiaojun

    2015-02-01

    In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear range of 10-10 M to 10-5 M.In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear

  10. Nucleate boiling heat transfer

    Energy Technology Data Exchange (ETDEWEB)

    Saiz Jabardo, J.M. [Universidade da Coruna (Spain). Escola Politecnica Superior], e-mail: mjabardo@cdf.udc.es

    2009-07-01

    Nucleate boiling heat transfer has been intensely studied during the last 70 years. However boiling remains a science to be understood and equated. In other words, using the definition given by Boulding, it is an 'insecure science'. It would be pretentious of the part of the author to explore all the nuances that the title of the paper suggests in a single conference paper. Instead the paper will focus on one interesting aspect such as the effect of the surface microstructure on nucleate boiling heat transfer. A summary of a chronological literature survey is done followed by an analysis of the results of an experimental investigation of boiling on tubes of different materials and surface roughness. The effect of the surface roughness is performed through data from the boiling of refrigerants R-134a and R-123, medium and low pressure refrigerants, respectively. In order to investigate the extent to which the surface roughness affects boiling heat transfer, very rough surfaces (4.6 {mu}m and 10.5 {mu}m ) have been tested. Though most of the data confirm previous literature trends, the very rough surfaces present a peculiar behaviour with respect to that of the smoother surfaces (Ra<3.0 {mu}m). (author)

  11. Preparation of AgBr Nanoparticles in Microemulsions Via Reaction of AgNO{sub 3} with CTAB Counterion

    Energy Technology Data Exchange (ETDEWEB)

    Husein, Maen M. [University of Calgary, Department of Chemical and Petroleum Engineering (Canada)], E-mail: mhusein@ucalgary.ca; Rodil, Eva; Vera, Juan H. [McGill University, Department of Chemical Engineering (Canada)

    2007-10-15

    Nanoparticles of AgBr were prepared by precipitating AgBr in the water pools of microemulsions consisting of CTAB, n-butanol, isooctane and water. An aqueous solution of AgNO{sub 3} added to the microemulsion was the source of Ag{sup +} ions. The formation of AgBr nanoparticles in microemulsions through direct reaction with the surfactant counterion is a novel approach aimed at decreasing the role of intermicellar nucleation on nanoparticle formation for rapid reactions. The availability of the surfactant counterion in every reverse micelle and the rapidity of the reaction with the counterion trigger nucleation within individual reverse micelles. The effect of the following variables on the particle size and size distribution was investigated: the surfactant and cosurfactant concentrations, moles of AgNO{sub 3} added, and water to surfactant mole ratio, R. High concentration of the surfactant or cosurfactant, or high water content of the microemulsion favored intermicellar nucleation and resulted in the formation of large particles with broad size distribution, while high amounts of AgNO{sub 3} favored nucleation within individual micelles and resulted in small nanoparticles with narrow size distribution. A blue shift in the UV absorption threshold corresponding to a decrease in the particle size was generally observed. Notably, the variation of the absorption peak size with the nanoparticle size was opposite to those reported by us in previous studies using different surfactants.

  12. Modeling of metal nanocluster growth on patterned substrates and surface pattern formation under ion bombardment

    Energy Technology Data Exchange (ETDEWEB)

    Numazawa, Satoshi

    2012-11-01

    This work addresses the metal nanocluster growth process on prepatterned substrates, the development of atomistic simulation method with respect to an acceleration of the atomistic transition states, and the continuum model of the ion-beam inducing semiconductor surface pattern formation mechanism. Experimentally, highly ordered Ag nanocluster structures have been grown on pre-patterned amorphous SiO{sub 2} surfaces by oblique angle physical vapor deposition at room temperature. Despite the small undulation of the rippled surface, the stripe-like Ag nanoclusters are very pronounced, reproducible and well-separated. The first topic is the investigation of this growth process with a continuum theoretical approach to the surface gas condensation as well as an atomistic cluster growth model. The atomistic simulation model is a lattice-based kinetic Monte-Carlo (KMC) method using a combination of a simplified inter-atomic potential and experimental transition barriers taken from the literature. An effective transition event classification method is introduced which allows a boost factor of several thousand compared to a traditional KMC approach, thus allowing experimental time scales to be modeled. The simulation predicts a low sticking probability for the arriving atoms, millisecond order lifetimes for single Ag monomers and {approx}1 nm square surface migration ranges of Ag monomers. The simulations give excellent reproduction of the experimentally observed nanocluster growth patterns. The second topic specifies the acceleration scheme utilized in the metallic cluster growth model. Concerning the atomistic movements, a classical harmonic transition state theory is considered and applied in discrete lattice cells with hierarchical transition levels. The model results in an effective reduction of KMC simulation steps by utilizing a classification scheme of transition levels for thermally activated atomistic diffusion processes. Thermally activated atomistic movements

  13. Scaled nucleation theory for bubble nucleation of lower alkanes

    Czech Academy of Sciences Publication Activity Database

    Němec, Tomáš

    2014-01-01

    Roč. 37, č. 111 (2014), s. 69-75. ISSN 1292-8941 R&D Projects: GA ČR GAP101/10/1819; GA ČR GAP101/10/1428 Institutional support: RVO:61388998 Keywords : bubble nucleation * corresponding states * scaled nucleation rate Subject RIV: BJ - Thermodynamics Impact factor: 1.757, year: 2014

  14. Enhanced resistive switching effect in Ag nanoparticle embedded BaTiO3 thin films

    International Nuclear Information System (INIS)

    Ag nanoparticle (NP) embedded BaTiO3 (BTO) thin films on SrRuO3-coated SrTiO3 (STO) substrates are prepared by the integrated nanocluster beam deposition and laser-molecular beam epitaxy. Enhanced resistive switching, up to an ON/OFF ration of 104, has been achieved at low switching voltage (less than 1 V) without a forming voltage. These characteristics make such nanocomposite film very promising for application of low voltage non-volatile random access memory. The enhanced resistive switching effect may be attributed to the charge storage effect of the Ag nanoparticles and easy formation of Ag filament inside the BTO film

  15. Dumbbell-shaped metallothionein-templated silver nanoclusters with applications in cell imaging and Hg(2+) sensing.

    Science.gov (United States)

    Hu, Shengqiang; Ye, Baoyu; Yi, Xinyao; Cao, Zhize; Wu, Daohong; Shen, Congcong; Wang, Jianxiu

    2016-08-01

    Metallothionein (MT) is a cysteine-rich, low-molecular-weight protein, which adopts a unique dumbbell-shaped structure with a stable C-terminal α-domain and a reactive N-terminal β-domain. The specific configuration serves as a unique scaffold for the synthesis of ultra-small fluorescent metal nanoclusters (NCs). For the first time, MT-templated Ag NCs (MT-Ag NCs) with excellent antioxidant capacity and superior biocompatibility were facilely synthesized. The NCs were thoroughly characterized by various techniques. Zn(2+) in the β-domain was preferentially replaced by Ag(+), which was then reduced by NaBH4 to yield Ag NCs, while Zn(2+) in the α-domain was intactly tetrahedrally-coordinated through thiolate ligands in MT. Fluorescent imaging of HeLa cells was achieved by attaching folic acid (FA) to MT-Ag NCs. Due to the strong binding capacity toward the thiolate ligands in the α-domain, Hg(2+) was assayed via quenching the fluorescence of Ag NCs by an energy transfer process. The methodology described herein may be extended to the synthesis of other metal NCs with potential applications in biosensing and cell imaging. PMID:27216684

  16. In Vivo Renal Clearance, Biodistribution, Toxicity of Gold nanoclusters

    CERN Document Server

    Zhang, Xiao-Dong; Shen, Xiu; Liu, Pei-Xun; Fan, Fei-Yue; Fan, Sai-Jun; 10.1016/j.biomaterials.2012.03.020

    2012-01-01

    Gold nanoparticles have shown great prospective in cancer diagnosis and therapy, but they can not be metabolized and prefer to accumulate in liver and spleen due to their large size. The gold nanoclusters with small size can penetrate kidney tissue and have promise to decrease in vivo toxicity by renal clearance. In this work, we explore the in vivo renal clearance, biodistribution, and toxicity responses of the BSA- and GSH-protected gold nanoclusters for 24 hours and 28 days. The BSA-protected gold nanoclusters have low-efficient renal clearance and only 1% of gold can be cleared, but the GSH-protected gold nanoclusters have high-efficient renal clearance and 36 % of gold can be cleared after 24 hours. The biodistribution further reveals that 94% of gold can be metabolized for the GSH-protected nanoclusters, but only less than 5% of gold can be metabolized for the BSA-protected nanoclusters after 28 days. Both of the GSH- and BSA-protected gold nanoclusters cause acute infection, inflammation, and kidney fu...

  17. Highly selective detection of bacterial alarmone ppGpp with an off-on fluorescent probe of copper-mediated silver nanoclusters.

    Science.gov (United States)

    Zhang, Pu; Wang, Yi; Chang, Yong; Xiong, Zu Hong; Huang, Cheng Zhi

    2013-11-15

    In this study, a facile strategy for highly selective and sensitive detection of bacterial alarmone, ppGpp, which is generated when bacteria face stress circumstances such as nutritional deprivation, has been established by developing an off-on fluorescent probe of Cu(2+)-mediated silver nanoclusters (Ag NCs). This work not only achieves highly selective detection of ppGpp in a broad range concentration of 2-200 μM, but also improves our understanding of the specific recognitions among DNA-Ag NCs, Cu(2+), and ppGpp. The present strategy, together with other reports on the Ag NCs-related analytical methods, has also identified that Ag NCs functionalized with different molecules on their surfaces can be engineered fluorescent probes for a wide range of applications such as biosensing and bioimaging. PMID:23810912

  18. Catalytic formation of silver nanoparticles by bovine serum albumin protected-silver nanoclusters and its application for colorimetric detection of ascorbic acid

    Science.gov (United States)

    Yang, Xiu-Hua; Ling, Jian; Peng, Jun; Cao, Qiu-E.; Wang, Lei; Ding, Zhong-Tao; Xiong, Jie

    2013-04-01

    We established a simple spectrophotometric and colorimetric method for detection of ascorbic acid based on the growth of silver nanoparticles in bovine serum albumin protected-silver nanoclusters (BSA-AgNCs) and Ag+ mixture. Due to the catalysis of BSA-AgNCs, ascorbic acid could reduce Ag+ to silver nanoparticles (NPs) at room temperature. The color of the mixture changed from colorless to yellow and a strong absorption band near 420 nm could be found in their absorption spectra owing to localized surface plasmon resonance (LSPR) of produced silver NPs. The absorbance changes at 420 nm had a good relationship with ascorbic acid concentration. Thus, we proposed a spectrophotometric and colorimetric method to determine ascorbic acid in concentration range from 2.0 to 50.0 μM, with the corresponding limits of determination (3σ) of 0.16 μM.

  19. On the geometry and thermodynamics of nanoclusters

    Science.gov (United States)

    Belashchenko, D. K.

    2015-03-01

    It is proposed that the volume, surface, and radii of nanoclusters be determined by Delaunay tesselation. Argon, silver, zinc, and iron clusters with total numbers of atoms ranging from 13 to 1415 are investigated by means of molecular dynamics (MD) along with the different potentials of interparticle interactions using the embedded atom model (EAM). The cluster surface area is defined as the sum of the surface areas of Delaunay simplexes. A formula that accurately describes the atomic volumes of clusters is proposed. The geometric characteristics, numbers of surface atoms, sphericity, energy, and entropy of specific clusters are calculated via MD. It is shown that the number of surface atoms for a given cluster size depends substantially on the material due to variations in the looseness of surface layers. The distribution of kinetic energy over atoms and parts of clusters is not uniform and deviates by ˜1/ N. It is found that the dependence of energy U on the cluster size is linear in the ( U/ N, N -1/3) coordinate system (where N is the number of atoms) for all investigated cases. The behaviors of entropy and the effective Gibbs energy are similar, so specific surface characteristics need not be determined when calculating excess characteristics. The specific excess surface energy per unit area, determined from the MD data on clusters, grows by several tens of percent when their size falls from N = 1415 to 13. In all of the investigated cases, nanoclusters are stable at any size. The melting point depression of nanoclusters is proportional to N -1/3 and can be calculated from the MD data.

  20. Theory and Simulation of Nucleation

    NARCIS (Netherlands)

    Kuipers, J.

    2009-01-01

    Nucleation is the process where a stable nucleus spontaneously emerges in a metastable environment. Examples of nucleation abound, for instance the formation of droplets in undercooled gasses and of crystals in undercooled liquids. The process is thermally activated and is key to understanding vario

  1. Effect of compartmentalization of donor and acceptor on the ultrafast resonance energy transfer from DAPI to silver nanoclusters

    Science.gov (United States)

    Prajapati, Roopali; Chatterjee, Surajit; Kannaujiya, Krishna K.; Mukherjee, Tushar Kanti

    2016-06-01

    The mechanism and dynamics of excitation energy transfer (EET) from photo-excited 4',6-diamidino-2-phenylindole (DAPI) to silver nanoclusters (Ag NCs) and its subsequent modulation in the presence of cationic polymer poly(diallyldimethylammonium chloride) (PDADMAC) and Calf Thymus DNA (CT-DNA) have been demonstrated using steady-state fluorescence and femtosecond fluorescence upconversion techniques. The synthesized Ag NCs were characterized using FTIR, mass spectrometry, XPS, HRTEM, DLS, UV-Vis and PL spectroscopy. Mass spectrometric analysis reveals the formation of ultrasmall Ag4 NCs with a small amount of Ag5 NCs. UV-Vis and PL spectra reveal distinct molecular-like optoelectronic behaviour of these ultrasmall Ag NCs. The dihydrolipoic acid-capped Ag NCs strongly quench the fluorescence of DAPI with concomitant increase in its photoluminescence (PL) intensity at 675 nm. This steady-state fluorescence quenching proceeds with a significant shortening of the fluorescence lifetime of DAPI in the presence of Ag NCs, signifying the nonradiative Förster resonance energy transfer (FRET) from DAPI to Ag NCs. Various energy transfer parameters have been estimated from FRET theory. The present FRET pair shows a characteristic Förster distance of 2.45 nm and can be utilized as a reporter of short-range distances in various FRET based applications. Moreover, this nonradiative FRET is completely suppressed in the presence of both 0.2 wt% PDADMAC and CT-DNA. Our results reveal selective compartmentalization of Ag NCs and DAPI in the presence of 0.2 wt% PDADMAC and CT-DNA, respectively. This selective compartmentalization of donor and acceptor and the subsequent modification of the FRET process may find application in various sensing, photovoltaic, and light harvesting applications.The mechanism and dynamics of excitation energy transfer (EET) from photo-excited 4',6-diamidino-2-phenylindole (DAPI) to silver nanoclusters (Ag NCs) and its subsequent modulation in the presence

  2. Nonlinear analysis of nano-cluster doped fiber

    Institute of Scientific and Technical Information of China (English)

    LIU Gang; ZHANG Ru

    2007-01-01

    There are prominent nonlinear characteristics that we hope for the semiconductor nano-clusters doped fiber. Refractive index of fiber core can be effectively changed by adulteration. This technology can provide a new method for developing photons components. Because the semiconductor nano-cluster has quantum characteristics,Based on first-order perturbation theory and classical theory of fiber,we deduced refractive index expressions of fiber core,which was semiconductor nano-cluster doped fiber. Finally,third-order nonlinear coefficient equation was gained. Using this equation,we calculated SMF-28 fiber nonlinear coefficient. The equation shows that new third-order coefficient was greater.

  3. Effect of compartmentalization of donor and acceptor on the ultrafast resonance energy transfer from DAPI to silver nanoclusters.

    Science.gov (United States)

    Prajapati, Roopali; Chatterjee, Surajit; Kannaujiya, Krishna K; Mukherjee, Tushar Kanti

    2016-07-14

    The mechanism and dynamics of excitation energy transfer (EET) from photo-excited 4',6-diamidino-2-phenylindole (DAPI) to silver nanoclusters (Ag NCs) and its subsequent modulation in the presence of cationic polymer poly(diallyldimethylammonium chloride) (PDADMAC) and Calf Thymus DNA (CT-DNA) have been demonstrated using steady-state fluorescence and femtosecond fluorescence upconversion techniques. The synthesized Ag NCs were characterized using FTIR, mass spectrometry, XPS, HRTEM, DLS, UV-Vis and PL spectroscopy. Mass spectrometric analysis reveals the formation of ultrasmall Ag4 NCs with a small amount of Ag5 NCs. UV-Vis and PL spectra reveal distinct molecular-like optoelectronic behaviour of these ultrasmall Ag NCs. The dihydrolipoic acid-capped Ag NCs strongly quench the fluorescence of DAPI with concomitant increase in its photoluminescence (PL) intensity at 675 nm. This steady-state fluorescence quenching proceeds with a significant shortening of the fluorescence lifetime of DAPI in the presence of Ag NCs, signifying the nonradiative Förster resonance energy transfer (FRET) from DAPI to Ag NCs. Various energy transfer parameters have been estimated from FRET theory. The present FRET pair shows a characteristic Förster distance of 2.45 nm and can be utilized as a reporter of short-range distances in various FRET based applications. Moreover, this nonradiative FRET is completely suppressed in the presence of both 0.2 wt% PDADMAC and CT-DNA. Our results reveal selective compartmentalization of Ag NCs and DAPI in the presence of 0.2 wt% PDADMAC and CT-DNA, respectively. This selective compartmentalization of donor and acceptor and the subsequent modification of the FRET process may find application in various sensing, photovoltaic, and light harvesting applications. PMID:27304093

  4. Silver nanocluster films on ITO coated glass as novel substrates for the detection of molecules using Surface Enhanced Raman Scattering (SERS)

    Science.gov (United States)

    Botta, Raju; Upender, G.; Bansal, C.

    2015-02-01

    A novel surface enhanced Raman scattering (SERS) substrates were prepared by a nanocluster deposition system. Silver nanoclusters were deposited on the indium tin oxide (ITO) coated glass slides. These films were annealed at 300°C for two hours to obtain the required size distribution for the desirable optical properties. The surface morphology of the films was examined using filed emission scanning electron microscope (FESEM) and atomic force microscope (AFM). The surface plasmon resonance (SPR) of the pre annealed and the annealed Ag deposited ITO coated glass substrates were measured using UV-Vis spectrophotometer. The SERS studies were carried out on these substrates with Methylene Blue (MB) as a test molecule with 10-4 to 10-8 M concentrations using 514.5 nm and 632.81 nm laser excitation wavelengths. The results show that Ag nanoclusters of average particle size of ~ 150 nm act as very good SERS substrates for the detection 10-6 M of MB. Both the electromagnetic (EM) and chemical enhancement could be contributed to the SERS signal enhancement of MB molecule.

  5. Mitochondrial dysfunction induced by ultra-small silver nanoclusters with a distinct toxic mechanism.

    Science.gov (United States)

    Dong, Ping; Li, Jia-Han; Xu, Shi-Ping; Wu, Xiao-Juan; Xiang, Xun; Yang, Qi-Qi; Jin, Jian-Cheng; Liu, Yi; Jiang, Feng-Lei

    2016-05-01

    As noble metal nanoclusters (NCs) are widely employed in nanotechnology, their potential threats to human and environment are relatively less understood. Herein, the biological effects of ultra-small silver NCs coated by bovine serum albumin (BSA) (Ag-BSA NCs) on isolated rat liver mitochondria were investigated by testing mitochondrial swelling, membrane permeability, ROS generation, lipid peroxidation and respiration. It was found that Ag-BSA NCs induced mitochondrial dysfunction via synergistic effects of two different ways: (1) inducing mitochondrial membrane permeability transition (MPT) by interacting with the phospholipid bilayer of the mitochondrial membrane (not with specific MPT pore proteins); (2) damaging mitochondrial respiration by the generation of reactive oxygen species (ROS). As far as we know, this is the first report on the biological effects of ultra-small size nanoparticles (∼2nm) at the sub-cellular level, which provides significant insights into the potential risks brought by the applications of NCs. It would inspire us to evaluate the potential threats of nanomaterials more comprehensively, even though they showed no obvious toxicity to cells or in vivo animal models. Noteworthy, a distinct toxic mechanism to mitochondria caused by Ag-BSA NCs was proposed and elucidated. PMID:26808252

  6. Rapid restriction enzyme free detection of DNA methyltransferase activity based on DNA-templated silver nanoclusters.

    Science.gov (United States)

    Kermani, Hanie Ahmadzade; Hosseini, Morteza; Dadmehr, Mehdi; Ganjali, Mohammad Reza

    2016-06-01

    DNA methylation has significant roles in gene regulation. DNA methyltransferase (MTase) enzyme characterizes DNA methylation and also induces an aberrant methylation pattern that is related to many diseases, especially cancers. Thus, it is required to develop a method to detect the DNA MTase activity. In this study, we developed a new sensitive and reliable method for methyltransferase activity assay by employing DNA-templated silver nanoclusters (DNA/Ag NCs) without using restriction enzymes. The Ag NCs have been utilized for the determination of M.SssI MTase activity and its inhibition. We designed an oligonucleotide probe which contained an inserted six-cytosine loop as Ag NCs formation template. The changes in fluorescence intensity were monitored to quantify the M.SssI activity. The fluorescence spectra showed a linear decrease in the range of 0.4 to 20 U/ml with a detection limit of 0.1 U/ml, which was significant compared with previous reports. The proposed method was applied successfully for demonstrating the Gentamicin effect as MTase inhibitor. The proposed method showed convenient reproducibility and sensitivity indicating its potential for the determination of methyltransferase activity. PMID:27052776

  7. DNA fluorescence shift sensor: a rapid method for the detection of DNA hybridization using silver nanoclusters.

    Science.gov (United States)

    Lee, Shin Yong; Hairul Bahara, Nur Hidayah; Choong, Yee Siew; Lim, Theam Soon; Tye, Gee Jun

    2014-11-01

    DNA-templated silver nanoclusters (AgNC) are a class of subnanometer sized fluorophores with good photostability and brightness. It has been applied as a diagnostic tool mainly for deoxyribonucleic acid (DNA) detection. Integration of DNA oligomers to generate AgNCs is interesting as varying DNA sequences can result in different fluorescence spectra. This allows a simple fluorescence shifting effect to occur upon DNA hybridization with the hybridization efficiency being a pronominal factor for successful shifting. The ability to shift the fluorescence spectra as a result of hybridization overcomes the issue of background intensities in most fluorescent based assays. Here we describe an optimized method for the detection of single-stranded and double-stranded synthetic forkhead box P3 (FOXP3) target by hybridization with the DNA fluorescence shift sensor. The system forms a three-way junction by successful hybridization of AgNC, G-rich strand (G-rich) to the target DNA, which generated a shift in fluorescence spectra with a marked increase in fluorescence intensity. The DNA fluorescence shift sensor presents a rapid and specific alternative to conventional DNA detection. PMID:25129336

  8. Nucleation theory beyond the deterministic limit. I. The nucleation stage.

    Science.gov (United States)

    Dubrovskii, V G; Nazarenko, M V

    2010-03-21

    This work addresses theory of nucleation and condensation based on the continuous Fokker-Plank type kinetic equation for the distribution of supercritical embryos over sizes beyond the deterministic limit, i.e., keeping the second derivative with respect to size. The first part of the work treats the nucleation stage. It is shown that the size spectrum should be generally obtained by the convolution of the initial distribution with the Gaussian-like Green function with spreading dispersion. It is then demonstrated that the fluctuation-induced effects can be safely neglected at the nucleation stage, where the spectrum broadening due to the nonlinear boundary condition is much larger than the fluctuational one. The crossover between the known triangular and double exponential distributions under different conditions of material influx into the system is demonstrated. Some examples of size distributions at the nucleation stage in different regimes of material influx are also presented. PMID:20331305

  9. Generation of fluorescent silver nanoclusters in reverse micelles using gamma irradiation: low vs. high dosages and spectral evolution with time

    Science.gov (United States)

    Martin, Brett D.; Fontana, Jake; Wang, Zheng; Trammell, Scott A.

    2015-04-01

    Reverse micelles (RMs) containing aqueous solutions of Ag+ ions in their core produce fluorescent Ag nanoclusters (NCs), upon exposure to gamma irradiation. The fluorescence spectra of the NCs evolve over days to weeks after the exposure, and usually show large increases in intensity. Responses of as high as 2.8 × 104 CPS/Gy were reached. A dosage as low as 0.5 Gy (10 % of the lethal dosage for humans) produces NCs having fluorescence intensities higher than background. The RMs can be employed in novel gamma radiation detectors with appearance of fluorescence indicating that radiation was once present. In applications involving detection and tracking of fissile materials, the evolution of the fluorescence spectra over time may provide additional information about the radiation source. A two-phase liquid system is used for RM formation in a simple procedure. It is likely that this synthesis method may be adapted to produce NCs from other metal ions.

  10. Undercoordinated atoms at Rh nanoclusters supported by epitaxial graphene

    International Nuclear Information System (INIS)

    Full text: Local atomic coordination in nanoclusters varies widely between edge, kink, facet and bulk atoms causing relevant modifications of their physical and chemical properties. We show that, by using epitaxial graphene grown on Ir(111) as a template, it is possible to produce a homogeneous distribution of regular and ordered self-assembled Rh nanoclusters which not only allow clear identification of edge, facets and bulk atoms but also unveil size-dependent structural modifications. Combining high-energy resolution core level Photoelectron Spectroscopy, Scanning Tunneling Microscopy and Density Functional Theory we highlight the deep connection existing between nanoparticle morphological structure, local atomic coordination, interatomic distance relaxation, and electronic structure. Measured and calculated atomic core levels shifts quantitatively describe how nanoclusters minimize total energy by increasing effective atomic coordination. We present a pathway to obtain the desired nanocluster morphology by measuring the fraction of edge, facet and bulk atoms, providing therefore a knob to also tune magnetic and catalytic properties. (author)

  11. A versatile proximity-dependent probe based on light-up DNA-scaffolded silver nanoclusters.

    Science.gov (United States)

    Ma, Jin-Liang; Yin, Bin-Cheng; Ye, Bang-Ce

    2016-02-01

    It is well-known that proximity-dependent probes containing an analyte recognization site and a signal formation domain could be assembled specifically into a sandwich-like structure (probe-analyte-probe) via introducing an analyte. In this work, using the design for zirconium ion (Zr(4+)) detection as the model, we develop a novel and reliable proximity-dependent DNA-scaffolded silver nanocluster (DNA/AgNC) probe for Zr(4+) detection via target-induced emitter proximity. The proposed strategy undergoes the two following processes: target-mediated emitter pair proximity as target recognition implement and the synthesis of DNA/AgNCs with fluorescence as a signal reporter. Upon combination of the rationally designed probe with Zr(4+), the intact templates were obtained according to the -PO3(2-)-Zr(4+)-PO3(2-)- pattern. The resultant structure with an emitter pair serves as a potent template to achieve highly fluorescent DNA/AgNCs. To verify the universality of the proposed proximity-dependent DNA/AgNC probe, we extend the application of the proximity-dependent probe to DNA and adenosine triphosphate (ATP) detection by virtue of a specific DNA complementary sequence and ATP aptamer as a recognition unit, respectively. The produced fluorescence enhancement of the DNA/AgNCs in response to the analyte concentration allows a quantitative evaluation of the target, including Zr(4+), DNA, and ATP with detection limits of ∼3.00 μM, ∼9.83 nM, and ∼0.81 mM, respectively. The proposed probe possesses good performance with simple operation, cost-effectiveness, good selectivity, and without separation procedures. PMID:26814697

  12. Compositional changes of Pd-Au bimetallic nanoclusters upon hydrogenation

    OpenAIRE

    Di Vece, M; Bals, S.; Verbeeck, J.; Lievens, P.; van Tendeloo, G.

    2009-01-01

    Changes in the size distribution and composition of bimetallic Pd-Au nanoclusters have been observed after hydrogen exposure. This effect is caused by hydrogen-induced Ostwald ripening whereby the hydrogen reduces the binding energy of the cluster atoms leading to their detachment from the cluster. The composition changes due to a difference in mobility of the detached palladium and gold atoms on the surface. Fast palladium atoms contribute to the formation of larger nanoclusters, while the s...

  13. Detection of Early Stage Apoptotic Cells Based on Label-Free Cytochrome c Assay Using Bioconjugated Metal Nanoclusters as Fluorescent Probes.

    Science.gov (United States)

    Shamsipur, Mojtaba; Molaabasi, Fatemeh; Hosseinkhani, Saman; Rahmati, Fereshteh

    2016-02-16

    Cytochrome c (Cyt c) is an important biomarker in cell lysates for the early stage of apoptosis or anticancer agents. Here, two novel label-free fluorescence assays based on hemoglobin-stabilized gold nanoclusters (Hb/AuNCs) and aptamer-stabilized silver nanoclusters (DNA/AgNCs) for analysis of Cyt c are presented. The heme group of the protein induces sensitive sensing platforms accompanied by the decreased fluorescence of both metal nanoclusters. The quenching processes observed found to be based on the fluorescence resonance energy transfer mechanism from Hb/AuNCs to Cyt c and photoinduced electron transfer from DNA/AgNCs to the aptamer-Cyt c complex. The linear range for Cyt c was found to be 0-10 μM for Hb/AuNCs and from 0 to 1 μM for DNA/AgNCs, with limits of detection of ∼15 nM. On the basis of strong binding affinity of DNA aptamers for their target proteins, the DNA/AgNCs probe was successfully applied to the quantitative determination of Cyt c in cell lysates, which opens a new avenue to early diagnostics and drug screening with high sensitivity. Compared to the conventional Western blot method, the presented assays are low cost, easy to prepare the fluorescent probes, and sensitive, while overall time for the detection and quantitation of Cyt c from isolated mitochondria is only 20 min. The proposed method for Cyt c detection may also be useful for the study of those materials that cause mitochondrial dysfunction and apoptotic cell death. PMID:26812937

  14. DNA stabilized silver nanoclusters for ratiometric and visual detection of Hg²⁺ and its immobilization in hydrogels.

    Science.gov (United States)

    MacLean, James L; Morishita, Kiyoshi; Liu, Juewen

    2013-10-15

    DNA oligomers are particularly interesting templates for making silver nanoclusters (AgNCs) as different emission colors can be obtained by varying the DNA sequence. Many AgNCs have been used as Hg²⁺ sensors since Hg²⁺ induces fluorescence quenching. From an analytical chemistry standpoint, however, these 'light off' sensors are undesirable. In this work, taking advantage of the fact that some AgNCs are not as effectively quenched by Hg²⁺, we design a sensor with AgNCs containing two emission peaks. The red peak is strongly quenched by Hg²⁺ while the green peak shows a concomitant increase, producing an orange-to-green visual fluorescence transformation. Using this AgNC, we demonstrate ratiometric detection with a detection limit of 4 nM Hg²⁺. This sensor is further immobilized in a hydrogel matrix and this gel is also capable of detecting Hg²⁺ with a visual response. PMID:23651572

  15. Tailoring the magnetic properties of cobalt-ferrite nanoclusters

    International Nuclear Information System (INIS)

    In this contribution, we report on the tuning of magnetic properties of cobalt-ferrite nanoclusters. The cobalt-ferrite nanoclusters were synthesized from a two-step approach that consists of the synthesis of cobalt-ferrite nanoparticles in organic media, followed by their dispersion into aqueous dissolution to form an oil-in-water emulsion. These emulsions were prepared at three different concentrations of the cationic surfactant cetyltrimethylammonium bromide (CTAB), in order to control the size and clustering density of the nanoparticles in the nanoclusters. The synthesized samples were characterized by transmission electron microscopy and their related techniques, such as bright-field and Z-contrast imaging, electron diffraction and energy-dispersive X-ray spectrometry; as well as static magnetic measures. The experimental evidence indicates that the size, morphology, and nanoparticles clustering density in the nanoclusters is highly dependent of the cobalt-ferrite:CTAB molar ratio that is used in their synthesis. In addition, due to the clustering of the nanoparticles into the nanoclusters, their magnetic moments are blocked to relax cooperatively. Hence, the magnetic response of the nanoclusters can be tailored by controlling the size and nanoparticles clustering density

  16. Tailoring the magnetic properties of cobalt-ferrite nanoclusters

    Energy Technology Data Exchange (ETDEWEB)

    Vega, A. Estrada de la; Garza-Navarro, M. A., E-mail: marco.garzanr@uanl.edu.mx; Durán-Guerrero, J. G.; Moreno Cortez, I. E.; Lucio-Porto, R.; González-González, V. [Universidad Autónoma de Nuevo León, Facultad de Ingeniería Mecánica y Eléctrica (Mexico)

    2016-01-15

    In this contribution, we report on the tuning of magnetic properties of cobalt-ferrite nanoclusters. The cobalt-ferrite nanoclusters were synthesized from a two-step approach that consists of the synthesis of cobalt-ferrite nanoparticles in organic media, followed by their dispersion into aqueous dissolution to form an oil-in-water emulsion. These emulsions were prepared at three different concentrations of the cationic surfactant cetyltrimethylammonium bromide (CTAB), in order to control the size and clustering density of the nanoparticles in the nanoclusters. The synthesized samples were characterized by transmission electron microscopy and their related techniques, such as bright-field and Z-contrast imaging, electron diffraction and energy-dispersive X-ray spectrometry; as well as static magnetic measures. The experimental evidence indicates that the size, morphology, and nanoparticles clustering density in the nanoclusters is highly dependent of the cobalt-ferrite:CTAB molar ratio that is used in their synthesis. In addition, due to the clustering of the nanoparticles into the nanoclusters, their magnetic moments are blocked to relax cooperatively. Hence, the magnetic response of the nanoclusters can be tailored by controlling the size and nanoparticles clustering density.

  17. Ab initio Investigation of Helium in Vanadium Oxide Nanoclusters

    Science.gov (United States)

    Danielson, Thomas; Tea, Eric; Hin, Celine

    Nanostructured ferritic alloys (NFAs) are strong candidate materials for the next generation of fission reactors and future fusion reactors. They are characterized by a large number density of oxide nanoclusters dispersed throughout a BCC iron matrix, where current oxide nanoclusters are primarily comprised of Y-Ti-O compounds. The oxide nanoclusters provide the alloy with high resistance to neutron irradiation, high yield strength and high creep strength at the elevated temperatures of a reactor environment. In addition, the oxide nanoclusters serve as trapping sites for transmutation product helium providing substantially increased resistance to catastrophic cracking and embrittlement. Although the mechanical properties and radiation resistance of the existing NFAs is promising, the problem of forming large scale reactor components continues to present a formidable challenge due to the high hardness and unpredictable fracture behavior of the alloys. An alternative alloy has been previously proposed and fabricated where vanadium is added in order to form vanadium oxide nanoclusters that serve as deflection sites for crack propagation. Although experiments have shown evidence that the fracture behavior of the alloys is improved, it is unknown whether or not the vanadium oxide nanoclusters are effective trapping sites for helium. We present results obtained using density functional theory investigating the thermodynamic stability of helium with the vanadium oxide matrix to make a comparison of trapping effectiveness to traditional Y-Ti-O compounds.

  18. Biomineralization: Ion binding and nucleation

    Science.gov (United States)

    Kröger, Roland

    2015-04-01

    The visualization of organic-acid-induced crystal growth by means of liquid-cell transmission electron microscopy can provide key insights into the nucleation of calcium carbonate in an organic matrix.

  19. Improvement in the photocurrent collection due to enhanced absorption of light by synthesizing staggered layers of silver nanoclusters in silicon

    Energy Technology Data Exchange (ETDEWEB)

    Dhoubhadel, Mangal S.; Lakshantha, Wickramaarachchige J.; Rout, Bibhudutta; McDaniel, Floyd D., E-mail: mcdaniel@unt.edu [Ion Beam Modification and Analysis Laboratory, Department of Physics, University of North Texas, Denton, Texas 76203 (United States); Lightbourne, Sherard; D’Souza, Francis [Department of Chemistry, University of North Texas, Denton, Texas 76203 (United States)

    2015-07-23

    The quest for increased efficiency of solar cells has driven the research in synthesizing photovoltaic cells involving Si based materials. The efficiency of solar cells involving crystalline Si is stalled around 25% for the last decade. Recently Shi et al. had shown that light trapping can be enhanced by fabricating double layers of Ag nanoparticles in silicon based materials. The light trapping is critically important in a photo devices such as solar cells in order to increase light absorption and efficiency. In the present work, we report enhancement in the absorption of light in Ag ion implanted Si substrates. Multiple low energies Ag ions, ranging from ∼80 keV to ∼30 keV, with different fluences ranging from ∼1 × 10{sup 16} to ∼1 × 10{sup 17} atoms/cm{sup 2} were sequentially implanted into commercially available Si (100) substrates followed by post-thermal annealing to create different sizes of Ag nanoclusters (NC) at different depths in the top 100 nm of the Si. The absorbance of light is increased in Ag implanted Si with a significant increase in the current collection in I-V (current-voltage) photo switching measurements. The experimental photovoltaic cells fabricated with the Ag-implanted Si samples were optically characterized under AM (air mass) 1.5 solar radiation conditions (∼1.0 kW/m{sup 2}). An enhancement in the charge collection were measured in the annealed samples, where prominent Ag NCs were formed in the Si matrix compared to the as-implanted samples with amorphous layers. We believe the enhancement of the photo-current density from the samples with Ag NC is due to the improvement of efficiency of charge collection of e{sup −}-h{sup +} pairs produced by the incident light.

  20. Improvement in the photocurrent collection due to enhanced absorption of light by synthesizing staggered layers of silver nanoclusters in silicon

    International Nuclear Information System (INIS)

    The quest for increased efficiency of solar cells has driven the research in synthesizing photovoltaic cells involving Si based materials. The efficiency of solar cells involving crystalline Si is stalled around 25% for the last decade. Recently Shi et al. had shown that light trapping can be enhanced by fabricating double layers of Ag nanoparticles in silicon based materials. The light trapping is critically important in a photo devices such as solar cells in order to increase light absorption and efficiency. In the present work, we report enhancement in the absorption of light in Ag ion implanted Si substrates. Multiple low energies Ag ions, ranging from ∼80 keV to ∼30 keV, with different fluences ranging from ∼1 × 1016 to ∼1 × 1017 atoms/cm2 were sequentially implanted into commercially available Si (100) substrates followed by post-thermal annealing to create different sizes of Ag nanoclusters (NC) at different depths in the top 100 nm of the Si. The absorbance of light is increased in Ag implanted Si with a significant increase in the current collection in I-V (current-voltage) photo switching measurements. The experimental photovoltaic cells fabricated with the Ag-implanted Si samples were optically characterized under AM (air mass) 1.5 solar radiation conditions (∼1.0 kW/m2). An enhancement in the charge collection were measured in the annealed samples, where prominent Ag NCs were formed in the Si matrix compared to the as-implanted samples with amorphous layers. We believe the enhancement of the photo-current density from the samples with Ag NC is due to the improvement of efficiency of charge collection of e−-h+ pairs produced by the incident light

  1. Gas hydrate nucleation

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-12-31

    The overall aim of the project was to gain more knowledge about the kinetics of gas hydrate formation especially the early growth phase. Knowledge of kinetics of gas hydrate formation is important and measurements of gas hydrate particle size and concentration can contribute to improve this knowledge. An experimental setup for carrying out experimental studies of the nucleation and growth of gas hydrates has been constructed and tested. Multi wavelength extinction (MWE) was the experimental technique selected for obtaining particle diameter and concentration. The principle behind MWE is described as well as turbidity spectrum analysis that in an initial stage of the project was considered as an alternative experimental technique. Details of the experimental setup and its operation are outlined. The measuring cell consists of a 1 litre horizontal tube sustaining pressures up to 200 bar. Laser light for particle size determination can be applied through sapphire windows. A description of the various auxiliary equipment and of another gas hydrate cell used in the study are given. A computer program for simulation and analysis of gas hydrate experiments is based on the gas hydrate kinetics model proposed by Skovborg and Rasmussen (1993). Initial measurements showed that knowledge of the refractive index of gas hydrates was important in order to use MWE. An experimental determination of the refractive index of methane and natural gas hydrate is described. The test experiments performed with MWE on collectives of gas hydrate particles and experiments with ethane, methane and natural gas hydrate are discussed. Gas hydrate particles initially seem to grow mainly in size and at latter stages in number. (EG) EFP-94; 41 refs.

  2. Short review on Controlled Nucleation

    Directory of Open Access Journals (Sweden)

    Gupta Anuj

    2012-09-01

    Full Text Available Freeze-drying (also known as lyophilization or cryodesiccation is a dehydration process mainly used to preserve for perishable material and this method make the material more convenient for transport. Freezedrying works by freezing the material and then reducing the surrounding pressure and giving sufficient heat to allow the frozen water into the material to sublime directly from the solid phase to gas phase. Sublimation is the transition of a substance from the solid to the vapor state, without first passing through an intermediate liquid phase. A method to achieve controlled ice nucleation during the freeze-drying process using an ice fog, vial treatment, ultrasound, additives and electro freezing technique was demonstrated in an earlier report. And by the potential of a high electric field was utilized to induce ice nucleus formation in aqueous solutions. Using this technique it was possible to reduce the primary drying time during lyophilization. [1] Many technical issues surrounding the freeze-drying process have been addressed over the past several decades. Better understanding of critical formulation characteristics and cycle conditions. There are two types of technique for nucleation 1 Uncontrolled Nucleation, 2 Controlled Nucleation. The objectives of the present study simply introduce controlled Nucleation is the rapid ice nucleation in freeze drying technique. [2

  3. Structural and electronic properties of sodium nanoclusters

    Science.gov (United States)

    Perez, Luis A.; Reyes-Nava, Juan A.; Garzon, Ignacio L.

    2006-03-01

    Recent advances on mass selection of sodium nanoclusters and their characterization by photoemission electron spectroscopy [1] have given useful data for a variety of clusters sizes. These data may lead to assignments of the relevant structures by comparing the measured photoelectron spectra (PES) with the electronic density of states (DOS) obtained from DFT calculations. In this work, the lowest energy structures modeled by the many-body Gupta potential, are obtained by using molecular dynamics simulations for Nan (n= 178, 204, 271, 298-300, 309). DFT calculations were then performed for neutral, positively- and negatively-charged Nan clusters. A comparison between the DOS of clusters of the same size but different charge will be presented, as well as between the available experimental PES and the theoretical obtained DOS.[1] H. Haberland, T. Hippler, J. Donges, O. Kostko, M. Schmidt, B. von Issendorff, Phys. Rev. Lett. 94, 035701 (2005).

  4. New Adsorption Active Nanoclusters for Ecological Monitoring

    Science.gov (United States)

    Litovchenko, V. G.; Gorbanyuk, T. I.; Solntsev, V. S.

    Gas sensitive metal-insulator-semiconductor (MIS)-structures based on nanoporous silicon (PS) with clusters of transition metals (Pd, Cu, W) and their oxides embedded into the pores have been investigated by means of current-voltage (I-V) and capacitance-voltage (C-V) characteristics. It has been shown that the most sensitive structures to hydrogen sulfide are MIS-structures with top electrodes from W and Cu oxide composite. Our experiments have also demonstrated that thermal annealing of layered semiconductor structures based on nanoporous silicon and copper ultra-thin films (nanoclustered) leads to the formation of nanosize p-n junction (Cu2O-CuO). The use of the porous semiconductor matrix with the embedded nanosize p-n junctions enable to create highly sensitive sensors for toxic gas molecules in the ambient surrounding.

  5. Role of nucleation in nanodiamond film growth

    International Nuclear Information System (INIS)

    Nanodiamond films were deposited using different microwave plasma chemical vapor deposition schemes following several nucleation pretreatment methods. The nucleation efficiency and the films structure were investigated using scanning and transmission electron microscopy and Raman spectroscopy. C2 dimer growth (CH4 and H2 in 90% Ar) cannot nucleate diamond and works only on existing diamond surfaces. The methyl radical process (up to 20% CH4 in H2) allows some nucleation probability on appropriate substrates. Prolonged bias enhanced nucleation initiates both diamond nucleation and growth. C2 dimer growth results in pure nanodiamond free of amorphous carbon, while prolonged bias enhanced nucleation forms an amorphous carbon/nanodiamond composite

  6. Synthesis of crystalline Ge nanoclusters in PE-CVD-deposited SiO2 films

    DEFF Research Database (Denmark)

    Leervad Pedersen, T.P.; Skov Jensen, J.; Chevallier, J.;

    2005-01-01

    The synthesis of evenly distributed Ge nanoclusters in plasma-enhanced chemical-vapour-deposited (PE-CVD) SiO2 thin films containing 8 at. % Ge is reported. This is of importance for the application of nanoclusters in semiconductor technology. The average diameter of the Ge nanoclusters can be...

  7. Sub-micron scale patterning of fluorescent silver nanoclusters using low-power laser

    OpenAIRE

    Puskal Kunwar; Jukka Hassinen; Godofredo Bautista; Ras, Robin H. A.; Juha Toivonen

    2016-01-01

    Noble metal nanoclusters are ultrasmall nanomaterials with tunable properties and huge application potential; however, retaining their enhanced functionality is difficult as they readily lose their properties without stabilization. Here, we demonstrate a facile synthesis of highly photostable silver nanoclusters in a polymer thin film using visible light photoreduction. Furthermore, the different stages of the nanocluster formation are investigated in detail using absorption and fluorescence ...

  8. Colloidal Au nanoclusters formed in fused silica by MeV ion implantation and annealing

    International Nuclear Information System (INIS)

    MeV implantation of Au has been used to create a high density of Au nanoclusters in the near surface of fused silica. Measurements of the nanocluster size and size distribution under various implantation/annealing conditions are presented and correlated with measurements of optical absorption by the Au nanoclusters in fused silica. Preliminary measurements of the nonlinear refractive index are included

  9. Rest frame of bubble nucleation

    Energy Technology Data Exchange (ETDEWEB)

    Garriga, Jaume [Departament de Física Fondamental i Institut de Ciencies del Cosmos, Universitat de Barcelona, Martí i Franquès 1, 08028 Barcelona (Spain); Kanno, Sugumi [Institute of Cosmology, Department of Physics and Astronomy, Tufts University, Medford, Massachusetts 02155 (United States); Tanaka, Takahiro, E-mail: jaume.garriga@ub.edu, E-mail: sugumi@cosmos.phy.tufts.edu, E-mail: tanaka@yukawa.kyoto-u.ac.jp [Yukawa Institute for Theoretical Physics, Kyoto University, Kyoto 606-8502 (Japan)

    2013-06-01

    Vacuum bubbles nucleate at rest with a certain critical size and subsequently expand. But what selects the rest frame of nucleation? This question has been recently addressed in [1] in the context of Schwinger pair production in 1+1 dimensions, by using a model detector in order to probe the nucleated pairs. The analysis in [1] showed that, for a constant external electric field, the adiabatic ''in'' vacuum of charged particles is Lorentz invariant, (and in this) case pairs tend to nucleate preferentially at rest with respect to the detector. Here, we sharpen this picture by showing that the typical relative velocity between the frame of nucleation and that of the detector is at most of order Δv ∼ S{sub E}{sup −1/3} << 1. Here, S{sub E} >> 1 is the action of the instanton describing pair creation. The bound Δv coincides with the minimum uncertainty in the velocity of a non-relativistic charged particle embedded in a constant electric field. A velocity of order Δv is reached after a time interval of order Δt ∼ S{sub E}{sup −1/3}r{sub 0} << r{sub 0} past the turning point in the semiclassical trajectory, where r{sub 0} is the size of the instanton. If the interaction takes place in the vicinity of the turning point, the semiclassical description of collision does not apply. Nonetheless, we find that even in this case there is still a strong asymmetry in the momentum transferred from the nucleated particles to the detector, in the direction of expansion after the turning point. We conclude that the correlation between the rest frame of nucleation and that of the detector is exceedingly sharp.

  10. A DNA-templated silver nanocluster probe for label-free, turn-on fluorescence-based screening of homo-adenine binding molecules.

    Science.gov (United States)

    Park, Ki Soo; Park, Hyun Gyu

    2015-02-15

    A novel, label-free, turn-on fluorescence strategy to detect molecules that bind to adenine-rich DNA sequences has been developed. The probe employs DNA-templated silver nanoclusters (DNA-AgNCs) as the key detection component. The new strategy relies on the formation of non-Watson-Crick homo-adenine DNA duplex, triggered by strong interactions with homo-adenine binding molecules, which brings a guanine-rich sequence in one strand close to DNA-AgNCs located on the opposite strand. This phenomenon transforms weakly fluorescent AgNCs into highly emissive species that display bright red fluorescence. Finally, we have shown that the new fluorescence turn-on strategy can be employed to detect coralyne, the most representative homo-adenine binding molecule that triggers formation of a non-Watson-Crick homo-adenine DNA duplex. PMID:25441410

  11. ASPP2 Is a Novel Pan-Ras Nanocluster Scaffold

    Science.gov (United States)

    Posada, Itziar M. D.; Serulla, Marc; Zhou, Yong; Oetken-Lindholm, Christina

    2016-01-01

    Ras-induced senescence mediated through ASPP2 represents a barrier to tumour formation. It is initiated by ASPP2’s interaction with Ras at the plasma membrane, which stimulates the Raf/MEK/ERK signaling cascade. Ras to Raf signalling requires Ras to be organized in nanoscale signalling complexes, called nanocluster. We therefore wanted to investigate whether ASPP2 affects Ras nanoclustering. Here we show that ASPP2 increases the nanoscale clustering of all oncogenic Ras isoforms, H-ras, K-ras and N-ras. Structure-function analysis with ASPP2 truncation mutants suggests that the nanocluster scaffolding activity of ASPP2 converges on its α-helical domain. While ASPP2 increased effector recruitment and stimulated ERK and AKT phosphorylation, it did not increase colony formation of RasG12V transformed NIH/3T3 cells. By contrast, ASPP2 was able to suppress the transformation enhancing ability of the nanocluster scaffold Gal-1, by competing with the specific effect of Gal-1 on H-rasG12V- and K-rasG12V-nanoclustering, thus imposing ASPP2’s ERK and AKT signalling signature. Similarly, ASPP2 robustly induced senescence and strongly abrogated mammosphere formation irrespective of whether it was expressed alone or together with Gal-1, which by itself showed the opposite effect in Ras wt or H-ras mutant breast cancer cells. Our results suggest that Gal-1 and ASPP2 functionally compete in nanocluster for active Ras on the plasma membrane. ASPP2 dominates the biological outcome, thus switching from a Gal-1 supported growth-promoting setting to a senescence inducing and stemness suppressive program in cancer cells. Our results support Ras nanocluster as major integrators of tumour fate decision events. PMID:27437940

  12. High-Level Incorporation of Silver in Gold Nanoclusters: Fluorescence Redshift upon Interaction with Hydrogen Peroxide and Fluorescence Enhancement with Herbicide.

    Science.gov (United States)

    Guan, Guijian; Cai, Yongqing; Liu, Shuhua; Yu, Haidong; Bai, Shiqiang; Cheng, Yuan; Tang, Tao; Bharathi, M S; Zhang, Yong-Wei; Han, Ming-Yong

    2016-01-26

    High-level incorporation of Ag in Au nanoclusters (NCs) is conveniently achieved by controlling the concentration of Ag(+) in the synthesis of bovine serum albumin (BSA)-protected Au NCs, and the resulting structure is determined to be bimetallic Ag28 Au10-BSA NCs through a series of characterizations including energy-dispersive X-ray spectroscopy, mass spectroscopy, and X-ray photoelectron spectroscopy, together with density functional theory simulations. Interestingly, the Ag28 Au10 NCs exhibit a significant fluorescence redshift rather than quenching upon interaction with hydrogen peroxide, providing a new approach to the detection of hydrogen peroxide through direct comparison of their fluorescence peaks. Furthermore, the Ag28 Au10 NCs are also used for the sensitive and selective detection of herbicide through fluorescence enhancement. The detection limit for herbicide (0.1 nm) is far below the health value established by the U.S. Environmental Protection Agency; such sensitive detection was not achieved by using AuAg NCs with low-level incorporation of Ag or by using the individual metal NCs. PMID:26692116

  13. A new label-free and turn-on strategy for endonuclease detection using a DNA-silver nanocluster probe.

    Science.gov (United States)

    Tian, Xue; Kong, Xiang-Juan; Zhu, Zi-Mao; Chen, Ting-Ting; Chu, Xia

    2015-01-01

    Endonuclease plays a vital role in a variety of biological processes and the assay of endonuclease activity and inhibitors is of high importance in the fields ranging from biotechnology to pharmacology. Howerer, traditional techniques usually suffer from time intensive, laborious, and cost-expensive. This work aims to develop a facile and sensitive method for endonuclease activity assay by making use of the fluorescence enhancement effect when DNA-silver nanoclusters (DNA-Ag NCs) are in proximity to guanine-rich DNA sequences. The system mainly consists of block DNA (B-DNA), G-DNA and Ag-DNA. B-DNA serves as the substrate of the endonuclease (S1 nuclease as the model enzyme). G-DNA, which is predesigned entirely complementary to B strand, contains a guanine-rich overhang sequence and hybridization part at the 5'-end. Ag-DNA involves a sequence for Ag NCs synthesis and a sequence complementary to the hybridization part of the G-DNA. In the "off" state, B-DNA plays the role as a blocker that inhibit the proximity between Ag NCs and guanine-rich DNA sequences, resulting in a low fluorescence readout. However, if S1 nuclease is introduced into the system, B-DNA was cleaved into mono- or short-oligonucleotides fragments, which could not hybridize with G-DNA. As a result, the subsequent addition of DNA-Ag NCs could bring guanine-rich DNA sequences close to the Ag NCs, accompanied by a significant fluorescence enhancement. Therefore, endonuclease activity could be successfully quantified by monitoring the variation in fluorescence intensity. In addition, this approach can also be applied for inhibitor screening of endonuclease. This label-free and turn-on fluorescent assays employing the mechanism proposed here for the detection of nuclease and inhibitors turn out to be sensitive, selective, and convenient. PMID:25281081

  14. NanoClusters Enhance Drug Delivery in Mechanical Ventilation

    Science.gov (United States)

    Pornputtapitak, Warangkana

    The overall goal of this thesis was to develop a dry powder delivery system for patients on mechanical ventilation. The studies were divided into two parts: the formulation development and the device design. The pulmonary system is an attractive route for drug delivery since the lungs have a large accessible surface area for treatment or drug absorption. For ventilated patients, inhaled drugs have to successfully navigate ventilator tubing and an endotracheal tube. Agglomerates of drug nanoparticles (also known as 'NanoClusters') are fine dry powder aerosols that were hypothesized to enable drug delivery through ventilator circuits. This Thesis systematically investigated formulations of NanoClusters and their aerosol performance in a conventional inhaler and a device designed for use during mechanical ventilation. These engineered powders of budesonide (NC-Bud) were delivered via a MonodoseRTM inhaler or a novel device through commercial endotracheal tubes, and analyzed by cascade impaction. NC-Bud had a higher efficiency of aerosol delivery compared to micronized stock budesonide. The delivery efficiency was independent of ventilator parameters such as inspiration patterns, inspiration volumes, and inspiration flow rates. A novel device designed to fit directly to the ventilator and endotracheal tubing connections and the MonodoseRTM inhaler showed the same efficiency of drug delivery. The new device combined with NanoCluster formulation technology, therefore, allowed convenient and efficient drug delivery through endotracheal tubes. Furthermore, itraconazole (ITZ), a triazole antifungal agent, was formulated as a NanoCluster powder via milling (top-down process) or precipitation (bottom-up process) without using any excipients. ITZ NanoClusters prepared by wet milling showed better aerosol performance compared to micronized stock ITZ and ITZ NanoClusters prepared by precipitation. ITZ NanoClusters prepared by precipitation methods also showed an amorphous state

  15. Nucleation and condensation model development

    Energy Technology Data Exchange (ETDEWEB)

    Fry, H.; Lyman, J.; Breshears, D.; Zerkle, D.; Wilson, C.; Hewitt, C.; Gallegos, D.

    1996-09-01

    This is a final report of a one-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The purpose of this project was to bring to maturity a theoretical and experimental capability of the Laboratory to perform basic research in nucleation and condensation of water vapor. This report provides a general description of this capability and summarizes specific work in two areas: development and use of a combustive flow facility (CFF) to measure water monomer depletion in a supersonic nozzle and nucleation pulse experiments for investigation of transport effects on water droplet growth dynamics. The later work was performed in collaboration with Dr. Wehrner Strey in Goettingen, Germany. Preliminary water absorption data from the CFF experiment are presented. The nucleation pulse data is described along with an analysis that shows under the condition of the experiment the growth rate of water droplets is limited by monomer diffusion.

  16. A sensitive chemiluminescence method for the determination of cysteine based on silver nanoclusters

    International Nuclear Information System (INIS)

    We have developed a sensitive chemiluminescent (CL) assay for cysteine. It is based on the use of water-soluble and fluorescent silver nanoclusters (Ag NCs) which are found to be able to strongly enhance the weak CL signal resulting from the redox reaction between Ce(IV) ion and sulfite ion. This enhancement is inhibited by cysteine under appropriate conditions. Taking advantage of this specific CL inhibition, a novel CL method for the sensitive and selective detection of cysteine was developed. This effect is interpreted in terms of an electronic energy transfer from excited state intermediate sulfur dioxide (originating from the CL reaction between Ce(IV) and sulfite ions) to the Ag-NCs. The latter become electronically excited and thus can act as a new source of emission. The method was applied to the determination of cysteine in the range from 5.0 nM to 1.0 μM, with a detection limit at 2.5 nM (S/N=3). (author)

  17. N-acetylcysteine induced quenching of red fluorescent oligonucleotide-stabilized silver nanoclusters and the application in pharmaceutical detection

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •A new method for nanomolar NAC determination with LOD of 50 nM was reported. •The combined mechanism for NAC quenching with static dominating was suggested. •DNA-Ag NC structure changed with addition of NAC, proved by spectroscopic studies. -- Abstract: In this work, we reported a new, simple and sensitive method for determination of N-acetylcysteine (NAC) based on quenching of the red fluorescence of oligonuleotide-protected silver nanoculsters (Ag NCs) with the quantum yield of 68.3 ± 0.3%. This method was successfully used for the assay of NAC granules presenting a linear range from 100 nM to 1200 nM (LOD of 50 nM) with minimal interferences from potential coexisting substances. It is for the first time that quenching performance of the thiol-containing compound was found to follow a non-linear Stern–Volmer profile, indicative of a complicated quenching mechanism with static quenching dominating, in which DNA-template of Ag NCs was partly replaced by NAC, as elucidated by spectral investigations. This study extended the analytical application of silver nanoclusters as well as provided a more insightful understanding of the quenching mechanism of thiol-compounds on the fluorescence of Ag NCs

  18. N-acetylcysteine induced quenching of red fluorescent oligonucleotide-stabilized silver nanoclusters and the application in pharmaceutical detection

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Xinyi [Department of Chemical Biology, School of Pharmaceutical Sciences, Peking University, Beijing 100083 (China); Beijing National Laboratory for Molecular Sciences (BNLMS), The Key Laboratory of Bioorganic Chemistry and Molecular Engineering, Ministry of Education, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871 (China); College of Sciences, Shenyang Agricultural University, Shenyang 110161 (China); Lin, Ruoyun [Beijing National Laboratory for Molecular Sciences (BNLMS), The Key Laboratory of Bioorganic Chemistry and Molecular Engineering, Ministry of Education, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871 (China); Xu, Zhihan [Department of Chemical Biology, School of Pharmaceutical Sciences, Peking University, Beijing 100083 (China); Huang, Hongduan [Beijing National Laboratory for Molecular Sciences (BNLMS), The Key Laboratory of Bioorganic Chemistry and Molecular Engineering, Ministry of Education, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871 (China); Li, Limei [College of Sciences, Shenyang Agricultural University, Shenyang 110161 (China); Liu, Feng [Beijing National Laboratory for Molecular Sciences (BNLMS), The Key Laboratory of Bioorganic Chemistry and Molecular Engineering, Ministry of Education, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871 (China); Li, Na, E-mail: lina@pku.edu.cn [Beijing National Laboratory for Molecular Sciences (BNLMS), The Key Laboratory of Bioorganic Chemistry and Molecular Engineering, Ministry of Education, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871 (China); Yang, Xiaoda, E-mail: xyang@bjmu.edu.cn [Department of Chemical Biology, School of Pharmaceutical Sciences, Peking University, Beijing 100083 (China)

    2013-09-02

    Graphical abstract: -- Highlights: •A new method for nanomolar NAC determination with LOD of 50 nM was reported. •The combined mechanism for NAC quenching with static dominating was suggested. •DNA-Ag NC structure changed with addition of NAC, proved by spectroscopic studies. -- Abstract: In this work, we reported a new, simple and sensitive method for determination of N-acetylcysteine (NAC) based on quenching of the red fluorescence of oligonuleotide-protected silver nanoculsters (Ag NCs) with the quantum yield of 68.3 ± 0.3%. This method was successfully used for the assay of NAC granules presenting a linear range from 100 nM to 1200 nM (LOD of 50 nM) with minimal interferences from potential coexisting substances. It is for the first time that quenching performance of the thiol-containing compound was found to follow a non-linear Stern–Volmer profile, indicative of a complicated quenching mechanism with static quenching dominating, in which DNA-template of Ag NCs was partly replaced by NAC, as elucidated by spectral investigations. This study extended the analytical application of silver nanoclusters as well as provided a more insightful understanding of the quenching mechanism of thiol-compounds on the fluorescence of Ag NCs.

  19. Resonance energy transfer between fluorescent BSA protected Au nanoclusters and organic fluorophores

    Science.gov (United States)

    Raut, Sangram; Rich, Ryan; Fudala, Rafal; Butler, Susan; Kokate, Rutika; Gryczynski, Zygmunt; Luchowski, Rafal; Gryczynski, Ignacy

    2013-12-01

    Bovine serum albumin (BSA) protected nanoclusters (Au and Ag) represent a group of nanomaterials that holds great promise in biophysical applications due to their unique fluorescence properties and lack of toxicity. These metal nanoclusters have utility in a variety of disciplines including catalysis, biosensing, photonics, imaging and molecular electronics. However, they suffer from several disadvantages such as low fluorescence quantum efficiency (typically near 6%) and broad emission spectrum (540 nm to 800 nm). We describe an approach to enhance the apparent brightness of BSA Au clusters by linking them with a high extinction donor organic dye pacific blue (PB). In this conjugate PB acts as a donor to BSA Au clusters and enhances its brightness by resonance energy transfer (RET). We found that the emission of BSA Au clusters can be enhanced by a magnitude of two-fold by resonance energy transfer (RET) from the high extinction donor PB, and BSA Au clusters can act as an acceptor to nanosecond lifetime organic dyes. By pumping the BSA Au clusters using a high extinction donor, one can increase the effective brightness of less bright fluorophores like BSA Au clusters. Moreover, we prepared another conjugate of BSA Au clusters with the near infrared (NIR) dye Dylight 750 (Dy750), where BSA Au clusters act as a donor to Dy750. We observed that BSA Au clusters can function as a donor, showing 46% transfer efficiency to the NIR dye Dy750 with a long lifetime component in the acceptor decay through RET. Such RET-based probes can be used to prevent the problems of a broad emission spectrum associated with the BSA Au clusters. Moreover, transferring energy from BSA Au clusters to Dy750 will result in a RET probe with a narrow emission spectrum and long lifetime component which can be utilized in imaging applications.Bovine serum albumin (BSA) protected nanoclusters (Au and Ag) represent a group of nanomaterials that holds great promise in biophysical applications due to

  20. AGS II

    International Nuclear Information System (INIS)

    Interest in rare K decays, neutrino oscillations and other fields have generated an increasing demand for running, and improved intensity and duty cycle, at the AGS. Current projects include acceleration of polarized protons and light ions (up to mass 32). Future plans are for a booster to increase intensity and allow heavy ions (up to mass 200), and a stretcher to give 100% duty cycle. A later upgrade could yield an average current of 32 μ amps. 6 figures, 2 tables

  1. Dynamic features of rod-shaped Au nanoclusters

    Science.gov (United States)

    So, Woong Young; Das, Anindita; Wang, Shuxin; Zhao, Shuo; Byun, Hee Young; Lee, Dana; Kumar, Santosh; Jin, Rongchao; Peteanu, Linda A.

    2015-08-01

    Gold nanoclusters hold many potential applications such as biosensing and optics due to their emission characteristics, small size, and non-toxicity. However, their low quantum yields remain problematic for further applications, and their fluorescence mechanism is still unclear. To increase the low quantum yields, various methods have been performed: doping, tuning structures, and changing number of gold atoms. In the past, most characterizations have been performed on spherical shaped nanoclusters; in this paper, several characterizations of various rod-shaped Au nanoclusters specifically on Au25 are shown. It has been determined that the central gold atom in Au25 nano-rod is crucial in fluorescence. Furthermore, single molecule analysis of silver doped Au25 nano-rod revealed that it has more photo-stability than conjugated polymers and quantum dots.

  2. Nanoclustering in Silicon Induced by Oxygen Ions Implanted

    Directory of Open Access Journals (Sweden)

    D. Manno

    2011-11-01

    Full Text Available We report about the nanoclustering induced by oxygen‐implantation in silicon. A tandem‐type accelerator, with a maximum acceleration voltage of 3 MV, equipped with a sputtering ion source suitable for the production of high current ion beams by sputtering of solid cathodes has been used. The surface modifications and the structure of nanoclusters are investigated. The topographic images, obtained by scanning tunnelling microscope showed that the surface is covered with a dense array of tetragonal nanostructures oriented with respect to the substrate. Raman spectroscopy data allowed us to estimate an average cluster size of about 50 nm. Resistivity and Hall effect measurements evidenced that the electron transport in the implanted silicon samples is affected by the nanoclusters array and it could be explained by thermally activated hopping between localized states.

  3. Rapid, selective, and ultrasensitive fluorimetric analysis of mercury and copper levels in blood using bimetallic gold-silver nanoclusters with "silver effect"-enhanced red fluorescence.

    Science.gov (United States)

    Zhang, Ning; Si, Yanmei; Sun, Zongzhao; Chen, Lijun; Li, Rui; Qiao, Yuchun; Wang, Hua

    2014-12-01

    Bimetallic alloying gold-silver nanoclusters (Au-AgNCs) have been synthesized by a one-pot biomineralization synthesis route at a vital molar ratio of Au/Ag precursors in the protein matrix. Unexpectedly, the prepared Au-AgNCs could exhibit dramatically enhanced red fluorescence, which is about 6.5-fold and 4.7-fold higher than that of common AuNCs and core-shell Au@AgNCs, respectively. A rapid, selective, and ultrasensitive fluorimetric method has thereby been developed using Au-AgNCs as fluorescent probes toward the separate detections of Hg(2+) and Cu(2+) ions in blood. The interactions of Au-AgNCs with Hg(2+) and Cu(2+) ions were systematically characterized by microscopy imaging, UV-vis, and fluorescence measurements. It is demonstrated that the "silver effect" gives the Au-AgNCs probes not only greatly enhanced red fluorescence but also the strong capacity to specifically sense Cu(2+) ions in addition to improved response to Hg(2+) ions. Moreover, aided by a Cu(2+) chelating agent, exclusive detection of Hg(2+) ions could also be expected with the coexistence of a high level of Cu(2+) ions, as well as reversible Cu(2+) analysis by restoring the fluorescence of Au-AgNCs. Additionally, Au-AgNCs with strong red fluorescence could facilitate fluorimetric analysis with minimal interference from blood backgrounds. Such an Au-AgNCs-based fluorimetric method can allow for the selective analysis of Hg(2+) and Cu(2+) ions down to 0.30 nM and 0.60 nM in blood, respectively, promising a novel detection method to be applied in the clinical laboratory. PMID:25350497

  4. Nucleation kinetics in closed systems

    Czech Academy of Sciences Publication Activity Database

    Kožíšek, Zdeněk

    Praha, 2015. 1-44 R&D Projects: GA MŠk LD15004 Institutional support: RVO:68378271 Keywords : nucleation * encapsulated systems Subject RIV: BM - Solid Matter Physics ; Magnetism http://www.fzu.cz/~kozisek/lectures/Lyon_Nov_2015.pdf

  5. CFD Simulations of Binary Nucleation

    Czech Academy of Sciences Publication Activity Database

    Herrmann, E.; Brus, David; Hyvärinen, A-P.; Kulmala, M.

    Helsinki : -, 2010, P3U16. ISBN N. [International Aerosol Conference IAC 2010. Helsinki (FI), 29.08.2010-03.09.2010] Grant ostatní: FCR(FI) 1118615 Institutional research plan: CEZ:AV0Z40720504 Keywords : nucleation * binary * parameterization Subject RIV: CF - Physical ; Theoretical Chemistry www.iac2010.fi

  6. Adsorption of Ag on Ge(100)-(2 x 1)

    Energy Technology Data Exchange (ETDEWEB)

    Miller, T.; Rosenwinkel, E.; Chiang, T.C.

    1984-01-01

    The initial stages of interface formation of Ag deposited onto Ge(100)-(2 x 1) were studied with high-energy electron diffraction and high-resolution photoemission. The surface core-level energies for clean Ge(100)-(2 x 1) were not changed with the deposition of about one monolayer of Ag, indicating that there was no chemical reaction or atomic intermixing. The Ag nucleated at a coverage of about 1/3 monolayer and showed three-dimensional growth for higher coverages. 13 references, 3 figures.

  7. Quantum confinement in GaP nanoclusters

    Energy Technology Data Exchange (ETDEWEB)

    Laurich, B.K.; Smith, D.C.; Healy, M.D.

    1994-06-01

    We have prepared GaP and GaAs nanoclusters from organometallic condensation reactions of E[Si(ChH{sub 3})3]3 (E = P, As) and GaCl{sub 3}. The size of the as synthesized clusters is 10 {Angstrom} to 15 {Angstrom}. Larger clusters of 20 {Angstrom} to 30 {Angstrom} size were obtained by thermal annealing of the as grown material. X-ray diffraction and transmission electron microscopy confirm the high crystalline quality. A lattice contraction of 6.7% could be seen for 10 {Angstrom} sized GaAs clusters. The clusters are nearly spherical in shape. Optical absorption spectra show a distinct line which can be assigned to the fundamental transition of the quantum confined electronic state. The measured blue shift, with respect to the GaP bulk absorption edge is 0.53 eV. As the cluster is smaller than the exciton radius, we can calculate the cluster size from this blue shift and obtain 20.2 {Angstrom}, consistent with the results from X-ray diffraction of 19.5 {Angstrom} for the same sample.

  8. Photoinduced spectral changes of photoluminescent gold nanoclusters

    Science.gov (United States)

    Matulionytė, Marija; Marcinonytė, Raminta; Rotomskis, Ričardas

    2015-05-01

    Ultrasmall photoluminescent gold nanoclusters (Au NCs), composed of several atoms with sizes up to a few nanometers, have recently stimulated extensive interest. Unique molecule-like behaviors, low toxicity, and facile synthesis make photoluminescent Au NCs a very promising alternative to organic fluorophores and semiconductor quantum dots (QDs) in broad ranges of biomedical applications. However, using gold nanoparticles (Au NPs) for bioimaging might cause their degradation under continuous excitation with UV light, which might result in toxicity. We report spectral changes of photoluminescent 2-(N-morpholino) ethanesulfonic acid (MES)-coated (Au-MES) NCs under irradiation with UV/blue light. Photoluminescent water soluble Au-MES NCs with a photoluminescence (PL) band maximum at 476 nm (λex=420 nm) were synthesized. Under irradiation with 402 nm wavelength light the size of photoluminescent Au-MES NCs decreased (λem=430 nm). Irradiating the sample solution with 330 nm wavelength light, nonluminescent Au NPs were disrupted, and photoluminescent Au NCs (λem=476 nm) were formed. Irradiation with 330 nm wavelength light did not directly affect photoluminescent Au-MES NCs, however, increase in PL intensity indicated the formation of photoluminescent Au NCs from the disrupted nonluminescent Au NPs. This study gives a good insight into the photostability of MES-coated Au NPs under continuous excitation with UV/blue light.

  9. Fractal Electronic Circuits Assembled From Nanoclusters

    Science.gov (United States)

    Fairbanks, M. S.; McCarthy, D.; Taylor, R. P.; Brown, S. A.

    2009-07-01

    Many patterns in nature can be described using fractal geometry. The effect of this fractal character is an array of properties that can include high internal connectivity, high dispersivity, and enhanced surface area to volume ratios. These properties are often desirable in applications and, consequently, fractal geometry is increasingly employed in technologies ranging from antenna to storm barriers. In this paper, we explore the application of fractal geometry to electrical circuits, inspired by the pervasive fractal structure of neurons in the brain. We show that, under appropriate growth conditions, nanoclusters of Sb form into islands on atomically flat substrates via a process close to diffusion-limited aggregation (DLA), establishing fractal islands that will form the basis of our fractal circuits. We perform fractal analysis of the islands to determine the spatial scaling properties (characterized by the fractal dimension, D) of the proposed circuits and demonstrate how varying growth conditions can affect D. We discuss fabrication approaches for establishing electrical contact to the fractal islands. Finally, we present fractal circuit simulations, which show that the fractal character of the circuit translates into novel, non-linear conduction properties determined by the circuit's D value.

  10. Microwave-assisted green synthesis of ultrasmall fluorescent water-soluble silver nanoclusters and its application in chiral recognition of amino acids.

    Science.gov (United States)

    Liu, Tao; Su, Yingying; Song, Hongjie; Lv, Yi

    2013-11-01

    In this article, we established a fluorescent chiral recognition and detection method for cysteine based on the L-glutathione (L-GSH)-stabilized Ag nanoclusters (AgNCs) with high selectivity and sensitivity. A fast and green microwave (MW)-assisted strategy has been employed for synthesizing water-soluble fluorescent L-GSH-AgNCs. The reaction time was shortened from hours to several minutes. The synthetic process utilized L-glutathione as a stabilizing agent and a reducing agent without any other toxic reducing agent, such as NaBH4 or N2H4. The method is environmental friendly. Due to the different responses to AgNCs from chiral cysteine, we found d-cysteine hardly affects the fluorescence intensity of the AgNCs, whereas L-cysteine distinctly weakened its fluorescence intensity. This experiment indicated that fluorescence quenching efficiency of AgNCs was proportional to the concentration of L-cysteine in the range from 0.025 to 50 μmol L(-1). PMID:24029964

  11. Ice nucleation properties of mineral dusts

    OpenAIRE

    Steinke, Isabelle

    2013-01-01

    Ice nucleation in clouds has a significant impact on the global hydrological cycle as well as on the radiative budget of the Earth. The AIDA cloud chamber was used to investigate the ice nucleation efficiency of various atmospherically relevant mineral dusts. From experiments with Arizona Test Dust (ATD) a humidity and temperature dependent ice nucleation active surface site density parameterization was developed to describe deposition nucleation at temperatures above 220 K. Based...

  12. Multicomponent nonisothermal nucleation. 1. Kinetic equation

    OpenAIRE

    Kurasov, Victor

    1999-01-01

    The first part of the theory for the multicomponent nonisothermal nucleation is presented. On the base of analysis of the elementary acts of interation between an embryo and environment the kinetic equation is derived. This equation will be solved later and gives the nucleation rate for nonisothermal nucleation in the system with many condensating components. The orders of operators in this equation are estimated.

  13. Deposition and characterization of Pt nanocluster films by means of gas aggregation cluster source

    International Nuclear Information System (INIS)

    In this study we report on the deposition of Pt nanocluster films prepared by gas aggregation source that was operated with argon as working gas. The aim of this study was optimization of deposition process as well as determination of properties of deposited nanocluster films and their temporal stability. It was found that the production of Pt nanoclusters reached maximum value for pressure of 100 Pa and increases monotonously with magnetron current. The deposition rate at optimized deposition conditions was 0.7 nm of the Pt nanocluster film per second. Deposited films were porous and composed of 4 nm Pt nanoclusters. The nanoclusters were metallic and no sights of their oxidation were observed after 1 year on open air as witnessed by X-ray photoelectron spectroscopy. Regarding the electrical properties, a dramatic decrease of the resistivity was observed with increasing amount of deposited nanoclusters. This decrease saturated for the films approximately 50 nm thick. Such behavior indicates transition between different mechanisms of electrical conductivity: charge hopping for thin discontinuous films and current conduction through conducting path formed when higher amount of nanoclusters is deposited. Different mechanisms of electrical conduction for thin and thick layers of Pt were confirmed by subsequent investigation of temperature dependence of resistivity. In addition, no changes in resistivity were observed after one year on open air that confirms stability of produced Pt nanocluster films. - Highlights: • Pt nanocluster films were deposited by gas aggregation nanocluster source. • Conditions leading to effective deposition of Pt nanocluster films were found. • Deposited nanocluster films have good temporal stability. • Electrical properties of Pt films were found to depend on their thickness

  14. Binary nucleation beyond capillarity approximation

    OpenAIRE

    Kalikmanov, V.I.

    2010-01-01

    Large discrepancies between binary classical nucleation theory (BCNT) and experiments result from adsorption effects and inability of BCNT, based on the phenomenological capillarity approximation, to treat small clusters. We propose a model aimed at eliminating both of these deficiencies. Adsorption is taken into account within Gibbsian approximation. Binary clusters are treated by means of statistical-mechanical considerations: tracing out the molecular degrees of freedom of the more volatil...

  15. Nucleation barrier in small volumes

    Czech Academy of Sciences Publication Activity Database

    Kožíšek, Zdeněk; Demo, Pavel; Sveshnikov, Alexey; Tichá, Petra

    Bratislava: N, 2009 - (Koman, M.; Mikloš, D.), s. 36-37 ISBN 978-80-89088-81-2. [Development of Materials Science in Research and Education - DMS -RE 2009 /19./. Závažná Poruba (SK), 31.08.2009-04.09.2009] R&D Projects: GA AV ČR IAA100100806 Institutional research plan: CEZ:AV0Z10100521 Keywords : nucleation * phase transition in small volumes Subject RIV: BM - Solid Matter Physics ; Magnetism

  16. Stimulated nucleation on polymer nanofibres

    Czech Academy of Sciences Publication Activity Database

    Demo, Pavel; Kožíšek, Zdeněk; Sveshnikov, Alexey; Tichá, Petra; Krňanský, J.

    Bratislava: N, 2009 - (Koman, M.; Mikloš, D.), s. 20-21 ISBN 978-80-89088-81-2. [Development of Materials Science in Research and Education - DMS -RE 2009 /19./. Závažná Poruba (SK), 31.08.2009-04.09.2009] R&D Projects: GA AV ČR IAA100100806 Institutional research plan: CEZ:AV0Z10100521 Keywords : nanofibres * heterogeneous nucleation Subject RIV: BM - Solid Matter Physics ; Magnetism

  17. Revision of nucleated boiling mechanisms

    International Nuclear Information System (INIS)

    The boiling occurrence plays an important role in the power reactors energy transfer. But still, there is not a final theory on the boiling mechanisms. This paper presents a critical analysis of the most important nucleated boiling models that appear in literature. The conflicting points are identified and experiments are proposed to clear them up. Some of these experiments have been performed at the Thermohydraulics laboratory (Bariloche Atomic Center). (Author)

  18. Label-free fluorometric detection of S1 nuclease activity by using polycytosine oligonucleotide-templated silver nanoclusters.

    Science.gov (United States)

    Wang, Lihui; Ma, Keke; Zhang, Yaodong

    2014-09-28

    S1 nuclease has an important function in DNA transcription, replication, recombination, and repair. A label-free fluorescent method for the detection of S1 nuclease activity has been developed using polycytosine oligonucleotide-templated silver nanoclusters (dC12-Ag NCs). In this assay, dC12 can function as both the template for the stabilization of Ag NCs and the substrate of the S1 nuclease. Fluorescent Ag NCs could be effectively formed using dC12 as the template without S1 nuclease. In the presence of S1 nuclease, dC12 is degraded to mono- or oligonucleotide fragments, thereby resulting in a reduction in fluorescence. S1 nuclease with an activity as low as 5×10(-8)Uμl(-1) (signal/noise=3) can be determined with a linear range of 5×10(-7) to 1×10(-3)Uμl(-1). The promising application of the proposed method in S1 nuclease inhibitor screening has been demonstrated using pyrophosphate as the model inhibitor. Furthermore, the S1 nuclease concentrations in RPMI 1640 cell medium were validated. The developed method for S1 nuclease is sensitive and facile because its operation does not require any complicated DNA labeling or laborious fluorescent dye synthesis. PMID:25263815

  19. Hairpin DNA-Templated Silver Nanoclusters as Novel Beacons in Strand Displacement Amplification for MicroRNA Detection.

    Science.gov (United States)

    Zhang, Jingpu; Li, Chao; Zhi, Xiao; Ramón, Gabriel Alfranca; Liu, Yanlei; Zhang, Chunlei; Pan, Fei; Cui, Daxiang

    2016-01-19

    MicroRNA (miRNA) biomarkers display great potential for cancer diagnosis and prognosis. The development of rapid and specific methods for miRNA detection has become a hotspot. Herein, hairpin DNA-templated silver nanoclusters (AgNCs/HpDNA) were prepared and integrated into strand-displacement amplification (SDA) as a novel beacon for miRNA detection. The light-up platform was established based on guanine (G)-rich fluorescence enhancement that essentially converted the excitation/emission pair of AgNCs/HpDNAs from a shorter wavelength to a longer wavelength, and then achieved fluorescent enhancement at longer wavelength. On the basis of the validation of the method, the single and duplex detection were conducted in two plasma biomarkers (miR-16-5p and miR-19b-3p) for the diagnosis of gastric cancer. The probe (AgNCs/RED 16(7s)C) utilized for miR-16-5p detection adopted a better conformation with high specificity to recognize single-base mismatches by producing dramatically opposite signals (increase or decrease at 580 nm ex/640 nm em) while the probe (AgNCs/GRE 19b(5s)C) for miR-19b-3p generated dual signals (increase at 490 nm ex/570 nm em and decrease at 430 nm ex/530 nm em) with bright fluorescence in one reaction during the amplification, but unexpectedly was partially digested. This is for the first time to allow the generation of enhanced fluorescent AgNCs and the target recognition integrated into a single process, which offers great opportunity for specific miRNA detection in an easy and rapid way. PMID:26675240

  20. Hybridization chain reaction modulated DNA-hosted silver nanoclusters for fluorescent identification of single nucleotide polymorphisms in the let-7 miRNA family.

    Science.gov (United States)

    Qiu, Xue; Wang, Pei; Cao, Zhijuan

    2014-10-15

    A simple microRNA (miRNA) detection system based on hybridization chain reaction (HCR) has been developed using highly fluorescent DNA-hosted silver (Ag) nanoclusters. In this assay, a new type of hairpin DNA probe (MB1) containing a poly-cytosine nucleotide loop is designed and used as one of the HCR monomers, which is also demonstrated to be an ideal template for in situ synthesis of highly fluorescent Ag nanoclusters. Correspondingly, another HCR monomer (MB2) contains a poly-guanine nucleotide sticky end. Two monomers are stable to coexist in solution until the introduction of the initiator strand (let-7a) triggers a cascade of hybridization events that yields nicked double helices analogous. By taking advantage of HCR, a small amount of let-7a leads to the conformational change of a large amount of MB1, which results in the decrease of fluorescent signal greatly. Overall, this label-free, enzyme-free method allows the sensitive detection of let-7a with high specificity towards single nucleotide polymorphisms in the let-7 miRNA family. In addition, the simple "mix and measure" assay can be extended to detect other types of targets upon slight modification, and thus provides a tool for the early diagnosis and risk assessment of malignancy. PMID:24836018

  1. Label-free hairpin DNA-scaffolded silver nanoclusters for fluorescent detection of Hg²⁺ using exonuclease III-assisted target recycling amplification.

    Science.gov (United States)

    Xu, Mingdi; Gao, Zhuangqiang; Wei, Qiaohua; Chen, Guonan; Tang, Dianping

    2016-05-15

    A new label-free DNA sensing protocol was designed for fluorescent detection of mercury(II) (Hg(2+)), coupling hairpin DNA-scaffolded silver nanocluster (DNA-AgNC) with exonuclease III-assisted target recycling amplification. The assay was carried out through target-induced conformational change of hairpin DNA, while the signal derived from the formed silver nanoclusters on hairpin DNA probes. Initially, target Hg(2+) was specifically coordinated with thymine-thymine (T-T) mismatches to form an intact hairpin DNA. Then, the newly formed hairpin DNA was digested through exonuclease III from blunt 3' termini and restrained at 3' protruding terminus, thus resulting in the release of target Hg(2+) from hairpin DNA. The liberated target Hg(2+) initiated the next cycling, thereby causing the conformational change of numerous hairpin probes from the stem-loop DNA structure to single-stranded DNA. Under the optimal conditions, the fluorescent intensity of the as-produced DNA-AgNCs decreased with the increasing Hg(2+) concentration within a dynamic range from 0.1 nM to 10nM with a detection limit (LOD) of 24 pM. Moreover, the low-cost fluorescent sensing system exhibited high reproducibility and good specificity, thus representing an optional sensing platform for rapid screening of Hg(2+) in environmental water samples. PMID:26741529

  2. Communication: Kinetics of scavenging of small, nucleating clusters: First nucleation theorem and sum rules

    International Nuclear Information System (INIS)

    Despite recent advances in monitoring nucleation from a vapor at close-to-molecular resolution, the identity of the critical cluster, forming the bottleneck for the nucleation process, remains elusive. During past twenty years, the first nucleation theorem has been often used to extract the size of the critical cluster from nucleation rate measurements. However, derivations of the first nucleation theorem invoke certain questionable assumptions that may fail, e.g., in the case of atmospheric new particle formation, including absence of subcritical cluster losses and heterogeneous nucleation on pre-existing nanoparticles. Here we extend the kinetic derivation of the first nucleation theorem to give a general framework to include such processes, yielding sum rules connecting the size dependent particle formation and loss rates to the corresponding loss-free nucleation rate and the apparent critical size from a naïve application of the first nucleation theorem that neglects them

  3. One-step facile synthesis of Pd nanoclusters supported on carbon and their electrochemical property

    OpenAIRE

    Junjun Shi; Xiulan Hu; Jianbo Zhang; Weiping Tang; Hongtao Li; Xiaodong Shen; Nagahiro Saito

    2014-01-01

    Well-crystallized Pd nanoclusters supported on Ketjen Black (KB) were successfully fabricated when Pd wires were served as an electrode pair by a solution plasma technique at atmospheric pressure. The synthesis of Pd nanoclusters was almost simultaneous with their dispersion on KB. Pd nanoclusters with the average diameter of about 2 nm were equably distributed on KB, and showed good electrochemical property corresponding to their obvious characteristic peaks. Multi-scan cyclic voltammetry an...

  4. Hydrophilic magnetic nanoclusters with thermo-responsive properties and their drug controlled release

    Energy Technology Data Exchange (ETDEWEB)

    Meerod, Siraprapa [Department of Chemistry and Center of Excellence for Innovation in Chemistry, Faculty of Science, Naresuan University, Phitsanulok 65000 (Thailand); Rutnakornpituk, Boonjira; Wichai, Uthai [Department of Chemistry and Center of Excellence for Innovation in Chemistry, Faculty of Science, Naresuan University, Phitsanulok 65000 (Thailand); Center of Excellence in Biomaterials, Faculty of Science, Naresuan University, Phitsanulok 65000 Thailand (Thailand); Rutnakornpituk, Metha, E-mail: methar@nu.ac.th [Department of Chemistry and Center of Excellence for Innovation in Chemistry, Faculty of Science, Naresuan University, Phitsanulok 65000 (Thailand); Center of Excellence in Biomaterials, Faculty of Science, Naresuan University, Phitsanulok 65000 Thailand (Thailand)

    2015-10-15

    Synthesis and drug controlled release properties of thermo-responsive magnetic nanoclusters grafted with poly(N-isopropylacrylamide) (poly(NIPAAm)) and poly(NIPAAm-co-poly(ethylene glycol) methyl ether methacrylate) (PEGMA) copolymers were described. These magnetic nanoclusters were synthesized via an in situ radical polymerization in the presence of acrylamide-grafted magnetic nanoparticles (MNPs). Poly(NIPAAm) provided thermo-responsive properties, while PEGMA played a role in good water dispersibility to the nanoclusters. The ratios of PEGMA to NIPAAm in the (co)polymerization in the presence of the MNPs were fine-tuned such that the nanoclusters with good water dispersibility, good magnetic sensitivity and thermo responsiveness were obtained. The size of the nanoclusters was in the range of 50–100 nm in diameter with about 100–200 particles/cluster. The nanoclusters were well dispersible in water at room temperature and can be suddenly agglomerated when temperature was increased beyond the lower critical solution temperature (LCST) (32 °C). The release behavior of an indomethacin model drug from the nanoclusters was also investigated. These novel magnetic nanoclusters with good dispersibility in water and reversible thermo-responsive properties might be good candidates for the targeting drug controlled release applications. - Highlights: • Nanoclusters with good water dispersibility and magnetic response were prepared. • They were grafted with thermo-responsive poly(NIPAAm) and/or poly(PEGMA). • Poly(NIPAAm) provided thermo-responsive properties to the nanoclusters. • Poly(PEGMA) provided good water dispersibilityto the nanoclusters. • Accelerated and controllable releases of a drug from the nanoclusters were shown.

  5. Hydrophilic magnetic nanoclusters with thermo-responsive properties and their drug controlled release

    International Nuclear Information System (INIS)

    Synthesis and drug controlled release properties of thermo-responsive magnetic nanoclusters grafted with poly(N-isopropylacrylamide) (poly(NIPAAm)) and poly(NIPAAm-co-poly(ethylene glycol) methyl ether methacrylate) (PEGMA) copolymers were described. These magnetic nanoclusters were synthesized via an in situ radical polymerization in the presence of acrylamide-grafted magnetic nanoparticles (MNPs). Poly(NIPAAm) provided thermo-responsive properties, while PEGMA played a role in good water dispersibility to the nanoclusters. The ratios of PEGMA to NIPAAm in the (co)polymerization in the presence of the MNPs were fine-tuned such that the nanoclusters with good water dispersibility, good magnetic sensitivity and thermo responsiveness were obtained. The size of the nanoclusters was in the range of 50–100 nm in diameter with about 100–200 particles/cluster. The nanoclusters were well dispersible in water at room temperature and can be suddenly agglomerated when temperature was increased beyond the lower critical solution temperature (LCST) (32 °C). The release behavior of an indomethacin model drug from the nanoclusters was also investigated. These novel magnetic nanoclusters with good dispersibility in water and reversible thermo-responsive properties might be good candidates for the targeting drug controlled release applications. - Highlights: • Nanoclusters with good water dispersibility and magnetic response were prepared. • They were grafted with thermo-responsive poly(NIPAAm) and/or poly(PEGMA). • Poly(NIPAAm) provided thermo-responsive properties to the nanoclusters. • Poly(PEGMA) provided good water dispersibilityto the nanoclusters. • Accelerated and controllable releases of a drug from the nanoclusters were shown

  6. Application of Mass Spectrometry in the Synthesis and Characterization of Metal Nanoclusters.

    Science.gov (United States)

    Lu, Yizhong; Chen, Wei

    2015-11-01

    In recent years, mass spectrometry has been widely used in the characterization of metal nanoclusters. In this Feature, we first give an introductory tutorial on mass spectrometry and then highlight the versatile applications of mass spectrometry in accurately analyzing core size, atom-level composition, charge states, etc. of metal nanoclusters and size evolution during synthesis. Finally, some perspectives on the future applications of mass spectrometry in nanocluster research are given. PMID:26086315

  7. Human serum albumin-stabilized gold nanoclusters act as an electron transfer bridge supporting specific electrocatalysis of bilirubin useful for biosensing applications.

    Science.gov (United States)

    Santhosh, Mallesh; Chinnadayyala, Somasekhar R; Singh, Naveen K; Goswami, Pranab

    2016-10-01

    Human serum albumin (HSA)-stabilized Au18 nanoclusters (AuNCs) were synthesized and chemically immobilized on an Indium tin oxide (ITO) plate. The assembly process was characterized by advanced electrochemical and spectroscopic techniques. The bare ITO electrode generated three irreversible oxidation peaks, whereas the HSA-AuNC-modified electrode produced a pair of redox peaks for bilirubin at a formal potential of 0.27V (vs. Ag/AgCl). However, the native HSA protein immobilized on the ITO electrode failed to produce any redox peak for bilirubin. The results indicate that the AuNCs present in HSA act as electron transfer bridge between bilirubin and the ITO plate. Docking studies of AuNC with HSA revealed that the best docked structure of the nanocluster is located around the vicinity of the bilirubin binding site, with an orientation that allows specific oxidation. When the HSA-AuNC-modified electrode was employed for the detection of bilirubin using chronoamperometry at 0.3V (vs. Ag/AgCl), a steady-state current response against bilirubin in the range of 0.2μM to 7μM, with a sensitivity of 0.34μAμM(-1) and limit of detection of 86.32nM at S/N 3, was obtained. The bioelectrode was successfully applied to measure the bilirubin content in spiked serum samples. The results indicate the feasibility of using HSA-AuNC as a biorecognition element for the detection of serum bilirubin levels using an electrochemical technique. PMID:27126550

  8. Nucleation and growth of noble metals on transition-metal di-tellurides

    Science.gov (United States)

    Hla, S. W.; Marinković, V.; Prodan, A.

    1997-04-01

    Transition-metal di-tellurides (α- and β-MoTe 2 and WTe 2) were used as substrates for nucleation and growth studies of noble metals. They represent a group of chemically closely related compounds with different surface topographies. Nucleation and growth of Ag and Au at room temperature were studied by means of UHV-STM, AFM and TEM. The results revealed that the growth and orientation of these metals are influenced by the topography of the substrate surfaces. Contrary to the growth on atomically flat α-MoTe 2, there is an enhanced diffusion and nucleation along the periodic surface troughs on β-MoTe 2 and WTe 2. The topography of their (001) surfaces is responsible for the orientation of metal (112) planes being parallel to the substrate surface.)

  9. Polyethylenimine-capped silver nanoclusters as a fluorescence probe for highly sensitive detection of folic acid through a two-step electron-transfer process.

    Science.gov (United States)

    Zhang, Jian Rong; Wang, Zhong Ling; Qu, Fei; Luo, Hong Qun; Li, Nian Bing

    2014-07-16

    A highly sensitive folic acid (FA) detection method based on the fluorescence quenching of polyethylenimine-capped silver nanoclusters (PEI-AgNCs) was put forward. In the sensing system, FA and PEI-AgNCs were brought into close proximity to each other by electrostatic interaction, and a two-step electron-transfer process, in which the electron was transferred from FA to AgNCs through PEI molecule, led to fluorescence quenching. The fluorescence quenching efficiency of PEI-AgNCs was linearly related to the concentration of FA over the range from 0.1 nM to 2.75 μM. Good linear correlation (R(2) = 0.9981) and a detection limit of 0.032 nM were obtained under optimum conditions. Moreover, the proposed method was used for the determination of FA in real samples with satisfactory results, and those coexistent substances could not cause any significant decrease in the fluorescence intensity of AgNCs. Therefore, the proposed research system is of practical significance and application prospects. PMID:24972143

  10. Electrochemical immunoassay for the protein biomarker mucin 1 and for MCF-7 cancer cells based on signal enhancement by silver nanoclusters

    International Nuclear Information System (INIS)

    An electrochemical immunoassay is described for the detection of the protein biomarker mucin 1 (MUC-1) and of breast cancer cells of type MCF-7 where MUC-1 is over expressed. The method is based on the use of silver nanoclusters (Ag-NCs) acting as a signalling probe. The Ag-NCs were synthesized via chemical reduction in the presence of a DNA strand with the sequence of 5′-GCAGTTGATCCTTTGGATACCCTGG-C12-3′. The strand contains mucin 1 aptamer (GCAGTTGATCCTTTGGATACCCTGG) that can specifically bind to MUC1 and the template (C12) for synthesis of Ag-NCs. The assay involves the following steps: (1) Construction of an immunosensor by immobilizing the antibody against MUC-1 on a glassy carbon electrode; (2) addition of sample containing MUC-1; (3) addition of Ag-NCs; (4) signal amplification via silver enhancement process (deposition of metal silver on Ag-NCs); (5) measurement via square wave voltammetry. The current measured at a potential of 0.11 V (vs. SCE) is logarithmically related to the concentration of MUC-1 in the 1 to 500 nM range, with a detection limit of 0.5 nM. We also demonstrate that MCF-7 cancer cells can be detected by this method with high sensitivity (50 cells per mL) due to the presence of MUC-1 proteins on the cell surface. (author)

  11. Ge nanoclusters in PECVD-deposited glass after heat treating and electron irradiation

    DEFF Research Database (Denmark)

    Ou, Haiyan; Rørdam, Troels Peter; Rottwitt, Karsten;

    2007-01-01

    This paper reports the formation of Ge nanoclusters in silica glass thin films deposited by plasma-enhanced chemical vapor deposition (PECVD). We studied the samples by transmission electron microscopy (TEM) and Raman spectroscopy after annealing. TEM investigation shows that the Ge nanoclusters at...... two areaswere formed by different mechanisms. The Ge nanoclusters formed in a single row along the interface of a silicon substrate and the silica glass film by annealing during high-temperature heat treatment. Ge nanoclusters did not initially form in the bulk of the film but could be subsequently...

  12. Nano-clustered Pd catalysts formed on GaN surface for green chemistry

    Science.gov (United States)

    Hirayama, Motoi; Ueta, Yukiko; Konishi, Tomoya; Tsukamoto, Shiro

    2011-05-01

    We have succeeded in observing Pd nano-clusters, catalytic prime elements, on a GaN(0 0 0 1) surface by a scanning tunneling microscope for the first time. After the sample was reused, we found that nano-clusters (width: 11 nm, height: 2.2 nm) existed on the surface which still kept the catalytic activity, resulting that the neutral Pd atoms formed the nano-cluster. Moreover, the S-termination contributed to the formation of the dense and flat structure consisting of the Pd nano-clusters.

  13. Optimum processing conditions for the fabrication of large, single grain Ag-doped YBCO bulk superconductors

    International Nuclear Information System (INIS)

    A pseudo Time-Temperature-Transformation (TTT) diagram has been constructed for the optimum melt processing conditions for the fabrication of large, single grain Ag-doped Y-Ba-Cu-O (YBCO/Ag) bulk superconductors. The thermal conditions for the formation of homogeneous nuclei have been investigated and the boundary between this region and that for no grain nucleation has been mapped as a function of holding time. YBCO/Ag bulk samples grow typically in the form of single grains when the processing temperature profile lies within the 'no nucleation' region of the pseudo TTT diagram. However, by studying the YBCO/Ag growth process, some samples have been grown in the form of single grains by employing a temperature profile within the homogeneous grain nucleation region of the phase diagram. Such growth may be achieved when the YBCO/Ag phase constitutes the majority of the volume of the pellet before the growth temperature reaches that at the nucleation boundary. A large, single YBCO/Ag grain of diameter 30 mm has been fabricated successfully based on these studies by both cold-seeding and seeded infiltration growth techniques

  14. Size-confined growth of atom-precise nanoclusters in metal-organic frameworks and their catalytic applications

    Science.gov (United States)

    Liu, Lingli; Song, Yongbo; Chong, Hanbao; Yang, Sha; Xiang, Ji; Jin, Shan; Kang, Xi; Zhang, Jun; Yu, Haizhu; Zhu, Manzhou

    2016-01-01

    Using MOFs as size-selection templates, we have for the first time synthesized atom-precise Au11:PPh3 nanoclusters (NCs) and Au13Ag12:PPh3 NCs with high purity by a one-step, in situ reduction method. Specifically, we found that the product released from the frameworks of ZIF-8 is exclusively the Au11:PPh3 NCs rather than polydispersed NCs, and inside MIL-101(Cr) the Au13Ag12:PPh3 NCs constitute the exclusive product. The metal NC@MOF composites are also demonstrated for catalytic application. The high catalytic efficiency for the oxidation of benzyl alcohol indicates that atom-precise noble metal NCs@MOFs may act as a promising class of heterogeneous catalysts. The atom-precise NCs obtained in the MOF templated synthesis imply the future possibility of using MOFs of various pore sizes for the size-selective synthesis of atomically precise NCs. Meanwhile, metal NCs@MOFs will contribute to the understanding of the mechanism of nanocatalyst surface reactions and hence opens up enormous opportunities in heterogeneous catalysis.Using MOFs as size-selection templates, we have for the first time synthesized atom-precise Au11:PPh3 nanoclusters (NCs) and Au13Ag12:PPh3 NCs with high purity by a one-step, in situ reduction method. Specifically, we found that the product released from the frameworks of ZIF-8 is exclusively the Au11:PPh3 NCs rather than polydispersed NCs, and inside MIL-101(Cr) the Au13Ag12:PPh3 NCs constitute the exclusive product. The metal NC@MOF composites are also demonstrated for catalytic application. The high catalytic efficiency for the oxidation of benzyl alcohol indicates that atom-precise noble metal NCs@MOFs may act as a promising class of heterogeneous catalysts. The atom-precise NCs obtained in the MOF templated synthesis imply the future possibility of using MOFs of various pore sizes for the size-selective synthesis of atomically precise NCs. Meanwhile, metal NCs@MOFs will contribute to the understanding of the mechanism of nanocatalyst

  15. SERS monitoring of Pd-catalysed reduction processes of nitroarenes adsorbed on Ag/Pd colloidal nanoparticles

    Science.gov (United States)

    Muniz-Miranda, Maurizio; Pergolese, Barbara; Bigotto, Adriano

    2006-05-01

    The catalytic activity of palladium has been verified in Ag/Pd colloids for two different nitroarenes, 2-amino,5-nitropyridine (ANP) and 4-nitrobenzoic acid (PNBA). Palladium, deposited as nanoclusters onto the silver core, can act as catalyst for the ligands, while silver ensures the SERS enhancement, which is necessary to detect the Raman spectra of the adsorbates. The SERS measurements show that the nitrogroup of ANP is reduced to aminogroup in Ag/Pd colloids, whereas, in the case of PNBA, the azo-derivative is obtained as stable product.

  16. Ice Nucleation Activity in Lichens

    OpenAIRE

    Kieft, Thomas L.

    1988-01-01

    A newly discovered form of biological ice nucleus associated with lichens is described. Ice nucleation spectra of a variety of lichens from the southwestern United States were measured by the drop-freezing method. Several epilithic lichen samples of the genera Rhizoplaca, Xanthoparmelia, and Xanthoria had nuclei active at temperatures as warm as −2.3°C and had densities of 2.3 × 106 to more than 1 × 108 nuclei g−1 at −5°C (2 to 4 orders of magnitude higher than any plants infected with ice nu...

  17. Stochastic analysis of nucleation rates

    Science.gov (United States)

    Johansson, Jonas

    2016-02-01

    We show that approximating the Becker-Döring equations with a Langevin equation results in multiplicative noise, which in turn leads to a family of possible Fokker-Planck equations according to the Ito-Stratonovich dilemma. Using a simple and general model for the attachment and detachment rates, we find that the Ito choice approximates the nucleation rate best and also coincides with the Fokker-Planck equation resulting from the common way to Taylor expand the original set of rate equations.

  18. Classical Nucleation Theory- Power Remarks

    Czech Academy of Sciences Publication Activity Database

    Němec, T.; Maršík, František

    Kyoto : Maruzen Co., Ltd, 2005 - (Nakahara, M.; Matubayasi, N.; Ueno, M.; Yasuoka, K.; Watanabe, K.), s. 220-225 ISBN 4-621-07596-9. [International Conference on the Properties of Water and Steam /14./. Kyoto (JP), 29.08.2004-03.09.2004] R&D Projects: GA AV ČR(CZ) IBS2076003; GA ČR(CZ) GA101/02/0364 Institutional research plan: CEZ:AV0Z20760514 Keywords : binary * nucleation * power cycle chemistry Subject RIV: BJ - Thermodynamic s

  19. Stochastic analysis of nucleation rates.

    Science.gov (United States)

    Johansson, Jonas

    2016-02-01

    We show that approximating the Becker-Döring equations with a Langevin equation results in multiplicative noise, which in turn leads to a family of possible Fokker-Planck equations according to the Ito-Stratonovich dilemma. Using a simple and general model for the attachment and detachment rates, we find that the Ito choice approximates the nucleation rate best and also coincides with the Fokker-Planck equation resulting from the common way to Taylor expand the original set of rate equations. PMID:26986388

  20. Preparation, characterization, and photocatalytic activity of porous AgBr@Ag and AgBrI@Ag plasmonic photocatalysts

    Science.gov (United States)

    Yang, Fan; Tian, Baozhu; Zhang, Jinlong; Xiong, Tianqing; Wang, Tingting

    2014-02-01

    Porous AgBr@Ag and AgBrI@Ag plasmonic photocatalysts were synthesized by a multistep route, including a dealloying method to prepare porous Ag, a transformation from Ag to AgBr and AgBrI, and a photo-reduction process to form Ag nanoparticles on the surface of AgBr and AgBrI. It was found that the porous structure kept unchanged during Ag was transferred into AgBr, AgBrI, AgBr@Ag, and AgBrI@Ag. Both porous AgBr@Ag and porous AgBrI@Ag showed much higher visible-light photocatalytic activity than cubic AgBr@Ag for the degradation of methyl orange, which is because the interconnected pore channels not only provide more reactive sites but also favor the transportation of photo-generated electrons and holes. For AgBrI@Ag, AgBrI solid solution formed at the interface of AgBr and AgI, and the phase junction can effectively separate the photo-generated electrons and holes, favorable to the improvement of photocatalytic activity. The optimal I content for obtaining the highest activity is ∼10 at.%.

  1. Oxygen reduction catalyzed by gold nanoclusters supported on carbon nanosheets

    Science.gov (United States)

    Wang, Qiannan; Wang, Likai; Tang, Zhenghua; Wang, Fucai; Yan, Wei; Yang, Hongyu; Zhou, Weijia; Li, Ligui; Kang, Xiongwu; Chen, Shaowei

    2016-03-01

    Nanocomposites based on p-mercaptobenzoic acid-functionalized gold nanoclusters, Au102(p-MBA)44, and porous carbon nanosheets have been fabricated and employed as highly efficient electrocatalysts for oxygen reduction reaction (ORR). Au102(p-MBA)44 clusters were synthesized via a wet chemical approach, and loaded onto carbon nanosheets. Pyrolysis at elevated temperatures led to effective removal of the thiolate ligands and the formation of uniform nanoparticles supported on the carbon scaffolds. The nanocomposite structures were characterized by using a wide range of experimental techniques such as transmission electron microscopy, scanning electron microscopy, X-ray photoelectron spectroscopy, X-ray diffraction, UV-visible absorption spectroscopy, thermogravimetric analysis and BET nitrogen adsorption/desorption. Electrochemical studies showed that the composites demonstrated apparent ORR activity in alkaline media, and the sample with a 30% Au mass loading was identified as the best catalyst among the series, with a performance comparable to that of commercial Pt/C, but superior to those of Au102 nanoclusters and carbon nanosheets alone, within the context of onset potential, kinetic current density, and durability. The results suggest an effective approach to the preparation of high-performance ORR catalysts based on gold nanoclusters supported on carbon nanosheets.Nanocomposites based on p-mercaptobenzoic acid-functionalized gold nanoclusters, Au102(p-MBA)44, and porous carbon nanosheets have been fabricated and employed as highly efficient electrocatalysts for oxygen reduction reaction (ORR). Au102(p-MBA)44 clusters were synthesized via a wet chemical approach, and loaded onto carbon nanosheets. Pyrolysis at elevated temperatures led to effective removal of the thiolate ligands and the formation of uniform nanoparticles supported on the carbon scaffolds. The nanocomposite structures were characterized by using a wide range of experimental techniques such as

  2. Grain boundary diffusion of Fe in ultrafine-grained nanocluster-strengthened ferritic steel

    International Nuclear Information System (INIS)

    Grain boundary diffusion of Fe in nanocluster-strengthened ferritic steel (Fe-14Cr-3W-0.4Ti-0.25Y2O3 in wt.%) has been investigated. The steel was produced by mechanical alloying followed by hot extrusion. The final grain size was ∼200 nm. The diffusivity of Fe was measured within the temperature range 423-820 K. The grain boundary penetration at lower temperatures revealed a specific time dependence, which indicates a residual interconnected porosity in the ferritic steel. In order to quantify the percolating porosity, conventional radiotracer (59Fe) diffusion measurements were combined with a study of room temperature penetration of liquid 110mAg solution to distinguish between solid-state diffusion along boundaries and penetration along the surface of interconnected cavities. The presence of porosity affected the diffusion process, introducing a hierarchy of internal interfaces. The grain boundary diffusion coefficient and the diffusivity along internal surfaces were determined in the so-called type C-C, C-B and B-B kinetic regimes of interface diffusion in a hierarchical microstructure. Using the residual activity method and a 65Zn tracer, the volume fraction of the percolating porosity was estimated to be 0.6%.

  3. Systematic Coarse-Graining in Nucleation Theory

    CERN Document Server

    Schweizer, Marco

    2015-01-01

    We present a novel approach to nucleation processes based one the GENERIC framework (general equation for the nonequilibrium reversible-irreversible coupling). Solely based on the GENERIC structure of time-evolution equations and thermodynamic consistency arguments of exchange processes between a metastable phase and a nucleating phase, we derive the fundamental dynamics for this phenomenon, based on continuous Fokker-Planck equations. We are readily able to treat non-isothermal nucleation even when the nucleating cores cannot be attributed intensive thermodynamic properties. In addition, we capture the dynamics of the time-dependent metastable phase being continuously expelled from the nucleating phase, and keep rigorous track of the volume corrections to the dynamics. Within our framework the definition of a thermodynamic nuclei temperature is manifest. For the special case of nucleation of a gas phase towards its vapor-liquid coexistence, we illustrate that our approach is capable of reproducing recent lit...

  4. UV-Light-Induced Improvement of Fluorescence Quantum Yield of DNA-Templated Gold Nanoclusters: Application to Ratiometric Fluorescent Sensing of Nucleic Acids.

    Science.gov (United States)

    Li, Zong-Yu; Wu, Yun-Tse; Tseng, Wei-Lung

    2015-10-28

    The use of DNA as a template has been demonstrated as an effective method for synthesizing different-sized silver nanoclusters. Although DNA-templated silver nanoclusters show outstanding performance as fluorescent probes for chemical sensing and cellular imaging, the synthesis of DNA-stabilized gold nanoclusters (AuNCs) with high fluorescence intensity remains a challenge. Here a facile, reproducible, scalable, NaBH4-free, UV-light-assisted method was developed to prepare AuNCs using repeats of 30 adenosine nucleotides (A30). The maximal fluorescence of A30-stabilized AuNCs appeared at 475 nm with moderate quantum yield, two fluorescence lifetimes, and a small amount of Au(+) on the surface of the Au core. Results of size-exclusion chromatography revealed that A30-stabilized AuNCs were more compact than A30. A series of control experiments showed that UV light played a dual role in the reduction of gold-ion precursors and the decomposition of citrate ions. A30 also acted as a stabilizer to prevent the aggregation of AuNCs. In addition, single-stranded DNA (ssDNA) consisting of an AuNC-nucleation sequence and a hybridization sequence was utilized to develop a AuNC-based ratiometric fluorescent probe in the presence of the double-strand-chelating dye SYBR Green I (SG). Under conditions of single-wavelength excitation, the combination of AuNC/SG-bearing ssDNA and perfectly matched DNA emitted fluorescence at 475 and 525 nm, respectively. The formed AuNC/SG-bearing ssDNA enabled the sensitive, selective, and ratiometric detection of specific nucleic acid targets. Finally, the AuNC-based ratiometric probes were successfully applied to determine specific nucleic acid targets in human serum. PMID:26443919

  5. Nucleation on active centers in confined volumes

    OpenAIRE

    Kožíšek, Zdeněk; Hikosaka, Masamichi; Okada, Kiyoka; Demo, Pavel

    2012-01-01

    Kinetic equations describing nucleation on active centers are solved numerically to determine the number of supercritical nuclei, nucleation rate, and the number density of nuclei for formation both of droplets from vapor and also crystalline phase from vapor, solution, and melt. Our approach follows standard nucleation model, when the exhaustion of active centers is taken into account via the boundary condition, and thus no additional equation (expressing exhaustion of active centers) is nee...

  6. Silicon nanowire arrays coated with electroless Ag for increased surface-enhanced Raman scattering

    Science.gov (United States)

    Bai, Fan; Li, Meicheng; Fu, Pengfei; Li, Ruike; Gu, Tiansheng; Huang, Rui; Chen, Zhao; Jiang, Bing; Li, Yingfeng

    2015-05-01

    The ordered Ag nanorod (AgNR) arrays are fabricated through a simple electroless deposition technique using the isolated Si nanowire (SiNW) arrays as the Ag-grown scaffold. The AgNR arrays have the single-crystallized structure and the plasmonic crystal feature. It is found that the formation of the AgNR arrays is strongly dependent on the filling ratio of SiNWs. A mechanism is proposed based on the selective nucleation and the synergistic growth of Ag nanoparticles on the top of the SiNWs. Moreover, the special AgNR arrays grown on the substrate of SiNWs exhibit a detection sensitivity of 10-15M for rhodamine 6G molecules, which have the potential application to the highly sensitive surface-enhanced Raman scattering sensors.

  7. Silicon nanowire arrays coated with electroless Ag for increased surface-enhanced Raman scattering

    Directory of Open Access Journals (Sweden)

    Fan Bai

    2015-05-01

    Full Text Available The ordered Ag nanorod (AgNR arrays are fabricated through a simple electroless deposition technique using the isolated Si nanowire (SiNW arrays as the Ag-grown scaffold. The AgNR arrays have the single-crystallized structure and the plasmonic crystal feature. It is found that the formation of the AgNR arrays is strongly dependent on the filling ratio of SiNWs. A mechanism is proposed based on the selective nucleation and the synergistic growth of Ag nanoparticles on the top of the SiNWs. Moreover, the special AgNR arrays grown on the substrate of SiNWs exhibit a detection sensitivity of 10−15M for rhodamine 6G molecules, which have the potential application to the highly sensitive surface-enhanced Raman scattering sensors.

  8. Binary Nucleation of Water and Sodium Chloride

    Energy Technology Data Exchange (ETDEWEB)

    Nemec, Thomas [Institute of Thermomechanics ASCR, Prague, Czech Republic; Marsik, Frantisek [Institute of Thermomechanics ASCR, Prague, Czech Republic; Palmer, Donald [ORNL

    2005-01-01

    Nucleation processes in the binary water-sodium chloride system are investigated in the sense of the classical nucleation theory (CNT). The CNT is modified to be able to handle the electrolytic nature of the system and is employed to investigate the acceleration of the nucleation process due to the presence of sodium chloride in the steam. This phenomenon, frequently observed in the Wilson zone of steam turbines, is called early condensation. Therefore, the nucleation rates of the water-sodium chloride mixture are of key importance in the power cycle industry.

  9. Ice Nucleation on Carbon Surface Supports the Classical Theory for Heterogeneous Nucleation

    CERN Document Server

    Cabriolu, Raffaela

    2015-01-01

    The prevalence of heterogeneous nucleation in nature was explained qualitatively by the classical theory for heterogeneous nucleation established over more than 60 years ago, but the quantitative validity and the key conclusions of the theory have remained unconfirmed. Employing the forward flux sampling method and the coarse-grained water model mW, we explicitly computed the heterogeneous ice nucleation rates in the supercooled water on a graphitic surface at various temperatures. The independently calculated ice nucleation rates were found to fit well according to the classical theory for heterogeneous nucleation. The fitting procedure further yields the estimate of the potency factor which measures the ratio of the heterogeneous nucleation barrier to the homogeneous nucleation barrier. Remarkably, the estimated potency factor agrees quantitatively with the volumetric ratio of the critical nuclei between the heterogeneous and homogeneous nucleation. Our numerical study thus provides a strong support to the ...

  10. Size-dependent structure of CdSe nanoclusters formed after ion implantation in MgO

    NARCIS (Netherlands)

    van Huis, MA; van Veen, A; Schut, H; Eijt, SWH; Kooi, BJ; De Hosson, JTM

    2005-01-01

    The band gap as well as the optical and structural properties of semiconductor CdSe nanoclusters change as a function of the nanocluster size. Embedded CdSe nanoclusters in MgO were created by means of sequential Cd and Se ion implantation followed by thermal annealing. Changes during annealing were

  11. Luminescent metal nanoclusters: controlled synthesis and functional applications

    International Nuclear Information System (INIS)

    Luminescent metal nanoclusters that consist of only several, to tens of, metal atoms and which possess sizes comparable to the Fermi wavelength of electrons have recently attracted significant attention. This new class of luminescent materials not only provides the missing link between atomic and nanoparticle behaviors in metals but also they present abundant novel information for the development of new applicable material systems to meet urgent needs in many areas (such as ultrasensitive sensors for heavy metals, bioimaging, as well as information technology) mainly because of their attractive characteristics, including ultra-small size, good dispersibility, excellent biocompatibility and photostability. In this review, we summarize recent advances in the controlled synthesis and application of luminescent metal nanoclusters, with a particular emphasis on Pt, Mo, Bi and alloy clusters. We also speculate on their future and discuss potential developments for their use in sensors, bioimaging and energy harvesting and conversion. (review)

  12. Growth Mechanism of Vertically Aligned Ag(TCNQ) Nanowires

    Institute of Scientific and Technical Information of China (English)

    叶春暖; 曹冠英; 莫晓亮; 方方; 邢晓艳; 陈国荣; 孙大林

    2004-01-01

    Highly oriented Ag(TCNQ) nanowires have been prepared on Si(111) wafer at 100 ℃ by the vapour-transport reaction between silver and TCNQ without any other catalyst. X-ray diffraction analysis shows that the composition and crystal structure of the obtained nanostructure were Ag(TCNQ) crystalline. Most Ag(TCNQ) nanowires were grown uniformly and vertically on the substrate with diameters ranging from 50 to 300nm and the lengths measuring from 2 to 50 μm by scanning electron microscopy. Ag particles were observed on the substrate from pure thin Ag film heated under the same conditions as used in synthesizing the nanowires. Nucleation and short Ag(TCNQ) nanowires were prepared by controlling the reaction time, providing direct evidence of the growth mechanism in a nanometre scale. The growth process was explained according to the vapour-liquid-solid model.The gradient of temperature and the densely distributed Ag particles may contribute to the vertically aligned growth. These results will be helpful for the controllable synthesis of Ag(TCNQ) nanowires.

  13. Mass Spectrometric Analysis of Water-soluble Gold Nanoclusters

    International Nuclear Information System (INIS)

    Batches of water-soluble gold nanoclusters of nominal 2.0 or 3.5-nm diameter were prepared to evaluate particle size determinations by a number of techniques such as transmission electron microscopy or atomic force microscopy and to validate estimates derived by mass spectrometric analysis using matrix-assisted laser desorption ionization (MALDI). Good agreement was found and MALDI lends itself to analyses even in the presence of aggregates

  14. On the formation of copper nanoparticles in nanocluster aggregation source

    Energy Technology Data Exchange (ETDEWEB)

    Dutka, Mikhail V.; Vainchtein, David I.; De Hosson, Jeff Th. M., E-mail: j.t.m.de.hosson@rug.nl [Department of Applied Physics, Zernike Institute for Advances Materials, University of Groningen, Nijenborgh 4, 9747 AG Groningen (Netherlands); Turkin, Anatoliy A. [National Science Center, “Kharkiv Institute of Physics and Technology,” Akademichna str. 1, UA-61108 Kharkiv (Ukraine)

    2015-05-15

    The influence of pressure and type of inert gas (Ar and Kr) on the morphology and size distribution of nanoparticles produced in a nanocluster source is studied experimentally. The experimental data are used to validate the model of cluster formation from a supersaturated atomic vapor in an inert buffer gas, which has been developed in our previous paper. The model predictions are in accordance with the experimental findings.

  15. On the formation of copper nanoparticles in nanocluster aggregation source

    International Nuclear Information System (INIS)

    The influence of pressure and type of inert gas (Ar and Kr) on the morphology and size distribution of nanoparticles produced in a nanocluster source is studied experimentally. The experimental data are used to validate the model of cluster formation from a supersaturated atomic vapor in an inert buffer gas, which has been developed in our previous paper. The model predictions are in accordance with the experimental findings

  16. Optical properties of core-shell structured Ag/SiO{sub 2} nanocomposites

    Energy Technology Data Exchange (ETDEWEB)

    Wang Jun, E-mail: jun.wang@saint-gobain.co [Materials Research Institute and Department of Materials Science and Engineering, Pennsylvania State University, University Park, PA 16802 (United States); White, William B.; Adair, James H. [Materials Research Institute and Department of Materials Science and Engineering, Pennsylvania State University, University Park, PA 16802 (United States)

    2010-02-15

    Silver nanoclusters coated by SiO{sub 2} were synthesized by a reverse micelle technique to obtain a core-shell microstructure with tunable particle size less than 50 nm. The refractive indices of the Ag/SiO{sub 2} nanocomposites were calculated based on a theoretical model for binary composite materials which illustrated a strong correlation to the size of the metallic core and the dielectric shell. Dynamic light scattering analysis of the Ag/SiO{sub 2} nanocomposites revealed that the refractive index of the nanocomposites was about 2.40, which was well in the range predicted by theoretical modeling. Optical absorption spectra and silver quantum dot size induced color change of the Ag/SiO{sub 2} nanocomposites suspension were also investigated.

  17. Hydrophilic magnetic nanoclusters with thermo-responsive properties and their drug controlled release

    Science.gov (United States)

    Meerod, Siraprapa; Rutnakornpituk, Boonjira; Wichai, Uthai; Rutnakornpituk, Metha

    2015-10-01

    Synthesis and drug controlled release properties of thermo-responsive magnetic nanoclusters grafted with poly(N-isopropylacrylamide) (poly(NIPAAm)) and poly(NIPAAm-co-poly(ethylene glycol) methyl ether methacrylate) (PEGMA) copolymers were described. These magnetic nanoclusters were synthesized via an in situ radical polymerization in the presence of acrylamide-grafted magnetic nanoparticles (MNPs). Poly(NIPAAm) provided thermo-responsive properties, while PEGMA played a role in good water dispersibility to the nanoclusters. The ratios of PEGMA to NIPAAm in the (co)polymerization in the presence of the MNPs were fine-tuned such that the nanoclusters with good water dispersibility, good magnetic sensitivity and thermo responsiveness were obtained. The size of the nanoclusters was in the range of 50-100 nm in diameter with about 100-200 particles/cluster. The nanoclusters were well dispersible in water at room temperature and can be suddenly agglomerated when temperature was increased beyond the lower critical solution temperature (LCST) (32 °C). The release behavior of an indomethacin model drug from the nanoclusters was also investigated. These novel magnetic nanoclusters with good dispersibility in water and reversible thermo-responsive properties might be good candidates for the targeting drug controlled release applications.

  18. Evidence of energy transfer from tryptophan to BSA/HSA protected gold nanoclusters

    International Nuclear Information System (INIS)

    This work reports on the chromophores interactions within protein-protected gold nanoclusters. We conducted spectroscopic studies of fluorescence emissions originated from gold nanoclusters and intrinsic tryptophan (Trp) in BSA or HSA proteins. Both steady state fluorescence and lifetime measurements showed a significant Forster Resonance Energy Transfer (FRET) from Trp to the gold nanocluster. Tryptophan lifetimes in the case of protein-protected gold nanoclusters are 2.6 ns and 2.3 ns for BSA and HSA Au clusters while 5.8 ns for native BSA and 5.6 for native HSA. The apparent distances from Trp to gold nanocluster emission center, we estimated as 24.75 Å for BSA and 23.80 Å for HSA. We also studied a potassium iodide (KI) quenching of protein-protected gold nanoclusters and compared with the quenching of BSA and HSA alone. The rates of Trp quenching were smaller in BSA-Au and HSA-Au nanoclusters than in the case of free proteins, which is consistent with shorter lifetime of quenched Trp(s) and lower accessibility for KI. While Trp residues were quenched by KI, the emissions originated from nanoclusters were practically unquenched. In summary, for BSA and HSA Au clusters, we found 55% and 59% energy transfer efficiency respectively from tryoptophan to gold clusters. We believe this interaction can be used to our advantage in terms of developing resonance energy transfer based sensing applications. (paper)

  19. Synthesis and characterization of ZnO-Ag core-shell nanocomposites with uniform thin silver layers

    International Nuclear Information System (INIS)

    This paper presents an investigation on the synthesis and characterization of ZnO-Ag core-shell nanocomposites. ZnO nanorods were employed as core material for Ag seeds, and subsequent nucleation and growth of reduced Ag by formaldehyde formed the ZnO-Ag core-shell nanocomposites. The ZnO-Ag nanocomposites were annealed at different temperature to improve the crystallinity and binding strength of Ag nanoparticles. The morphology, microstructure and optical properties of the ZnO-Ag core-shell nanocomposites were characterized by X-ray diffraction, field emission scanning electron microscopy, transmission electron microscopy, energy-dispersive X-ray spectroscopy, ultraviolet-visible (UV-vis) absorption and photoluminescence measurement. It was demonstrated that very small face-center-cubic Ag nanoparticles were coated on the surface of ZnO nanorods. The ultraviolet absorption and surface plasmon absorption band of ZnO-Ag core-shell nanocomposites exhibited some redshifts relative to pure ZnO nanorods and monometallic Ag nanoparticles. The coating of Ag nanocrystals onto the ZnO nanorods completely quenched the photoluminescence. These observations reflected the strong interfacial interaction between ZnO nanorods and Ag nanoparticles. The effect of Ag coating thickness on the morphology and optical properties of ZnO-Ag core-shell nanocomposites was also investigated. Moreover, the growth mechanism of ZnO-Ag core-shell nanocomposites was also proposed and discussed in detail.

  20. Blue shift of plasmon resonance in Cu and Ag ion-exchanged and annealed soda-lime glass: an optical absorption study

    International Nuclear Information System (INIS)

    Metal nanocluster composite glasses are formed by the ion-exchange technique of dipping the host matrix in the respective metal salt bath of interest. These ion-exchanged glasses are then annealed in air for 1 h at different temperatures. The optical absorption spectra of the ion-exchanged and annealed samples confirmed the presence of nano sized metal clusters embedded inside the glass matrix. With increase of the annealing temperature, the absorption peak of the Cu and Ag nanoparticles showed a blue shift which can be attributed to the change in particle size and volume fraction. Annealing of the sequential Cu and Ag ion-exchanged soda-lime glass resulted in the formation of complex metal nanocluster composite glass, with the optical spectra exhibiting two peaks corresponding to the surface plasmon resonance of both metals

  1. Nucleation in suspensions of anisotropic colloids

    NARCIS (Netherlands)

    Schilling, T.; Frenkel, D.

    2005-01-01

    We report Monte Carlo studies of liquid crystal nucleation in two types of anisotropic colloidal systems: hard rods and hard ellipsoids. In both cases we find that nucleation pathways differ strongly from the pathways in systems of spherical particles. Short hard rods show an effect of self-poisonin

  2. Clustomesogens: Liquid Crystalline Hybrid Nanomaterials Containing Functional Metal Nanoclusters.

    Science.gov (United States)

    Molard, Yann

    2016-08-16

    Inorganic phosphorescent octahedral metal nanoclusters fill the gap between metal complexes and nanoparticles. They are finite groups of metal atoms linked by metal-metal bonds, with an exact composition and structure at the nanometer scale. As their phosphorescence internal quantum efficiency can approach 100%, they represent a very attractive class of molecular building blocks to design hybrid nanomaterials dedicated to light energy conversion, optoelectronic, display, lighting, or theragnostic applications. They are obtained as AnM6X(i)8X(a)6 ternary salt powders (A = alkali cation, M = Mo, Re, W, X(i): halogen inner ligand, X(a) = halogen apical ligand) by high temperature solid state synthesis (750-1200 °C). However, their ceramic-like behavior has largely restricted their use as functional components in the past. Since these last two decades, several groups, including ours, started to tackle the challenge of integrating them in easy-to-process materials. Within this context, we have extensively explored the nanocluster ternary salt specificities to develop a new class of self-organized hybrid organic-inorganic nanomaterials known as clustomesogens. These materials, combine the specific properties of nanoclusters (magnetic, electronic, luminescence) with the anisotropy-related properties of liquid crystals (LCs). This Account covers the research and development of clustomesogens starting from the design concepts and synthesis to their introduction in functional devices. We developed three strategies to build such hybrid super- or supramolecules. In the covalent approach, we capitalized on the apical ligand-metal bond iono-covalent character to graft tailor-made organic LC promoters on the {M6X(i)8}(n+) nanocluster cores. The supramolecular approach relies on the host-guest complexation of the ternary cluster salt alkali cations with functional crown ether macrocycles. We showed that the hybrid LC behavior depends on the macrocycles structural features

  3. One-step facile synthesis of Pd nanoclusters supported on carbon and their electrochemical property

    Directory of Open Access Journals (Sweden)

    Junjun Shi

    2014-12-01

    Full Text Available Well-crystallized Pd nanoclusters supported on Ketjen Black (KB were successfully fabricated when Pd wires were served as an electrode pair by a solution plasma technique at atmospheric pressure. The synthesis of Pd nanoclusters was almost simultaneous with their dispersion on KB. Pd nanoclusters with the average diameter of about 2 nm were equably distributed on KB, and showed good electrochemical property corresponding to their obvious characteristic peaks. Multi-scan cyclic voltammetry and chronoamperometry clarified that as-prepared Pd nanoclusters have better electrochemical stability in alkaline solution than that of in acidic solution. Thus as-obtained Pd nanoclusters would become a promising electrocatalyst for fuel cells or Li-air batteries.

  4. Sub-micron scale patterning of fluorescent silver nanoclusters using low-power laser.

    Science.gov (United States)

    Kunwar, Puskal; Hassinen, Jukka; Bautista, Godofredo; Ras, Robin H A; Toivonen, Juha

    2016-01-01

    Noble metal nanoclusters are ultrasmall nanomaterials with tunable properties and huge application potential; however, retaining their enhanced functionality is difficult as they readily lose their properties without stabilization. Here, we demonstrate a facile synthesis of highly photostable silver nanoclusters in a polymer thin film using visible light photoreduction. Furthermore, the different stages of the nanocluster formation are investigated in detail using absorption and fluorescence spectroscopy, fluorescence microscopy, and atomic force microscopy. A cost-effective fabrication of photostable micron-sized fluorescent silver nanocluster barcode is demonstrated in silver-impregnated polymer films using a low-power continuous-wave laser diode. It is shown that a laser power of as low as 0.75 mW is enough to write fluorescent structures, corresponding to the specifications of a commercially available laser pointer. The as-formed nanocluster-containing microstructures can be useful in direct labeling applications such as authenticity marking and fluorescent labeling. PMID:27045598

  5. Controlling the Atomic Structure of Au30 Nanoclusters by a Ligand-Based Strategy.

    Science.gov (United States)

    Higaki, Tatsuya; Liu, Chong; Zeng, Chenjie; Jin, Renxi; Chen, Yuxiang; Rosi, Nathaniel L; Jin, Rongchao

    2016-06-01

    We report the X-ray structure of a gold nanocluster with 30 gold atoms protected by 18 1-adamantanethiolate ligands (formulated as Au30 (S-Adm)18 ). This nanocluster exhibits a threefold rotationally symmetrical, hexagonal-close-packed (HCP) Au18 kernel protected by six dimeric Au2 (SR)3 staple motifs. This new structure is distinctly different from the previously reported Au30 S(S-(t) Bu)18 nanocluster protected by 18 tert-butylthiolate ligands and one sulfido ligand with a face-centered cubic (FCC) Au22 kernel. The Au30 (S-Adm)18 nanocluster has an anomalous solubility (it is only soluble in benzene but not in other common solvents). This work demonstrates a ligand-based strategy for controlling nanocluster structure and also provides a method for the discovery of possibly overlooked clusters because of their anomalous solubility. PMID:27099989

  6. Pt, Co-Pt and Fe-Pt alloy nanoclusters encapsulated in virus capsids

    Science.gov (United States)

    Okuda, M.; Eloi, J.-C.; Jones, S. E. Ward; Verwegen, M.; Cornelissen, J. J. L. M.; Schwarzacher, W.

    2016-03-01

    Nanostructured Pt-based alloys show great promise, not only for catalysis but also in medical and magnetic applications. To extend the properties of this class of materials, we have developed a means of synthesizing Pt and Pt-based alloy nanoclusters in the capsid of a virus. Pure Pt and Pt-alloy nanoclusters are formed through the chemical reduction of [PtCl4]- by NaBH4 with/without additional metal ions (Co or Fe). The opening and closing of the ion channels in the virus capsid were controlled by changing the pH and ionic strength of the solution. The size of the nanoclusters is limited to 18 nm by the internal diameter of the capsid. Their magnetic properties suggest potential applications in hyperthermia for the Co-Pt and Fe-Pt magnetic alloy nanoclusters. This study introduces a new way to fabricate size-restricted nanoclusters using virus capsid.

  7. Sub-micron scale patterning of fluorescent silver nanoclusters using low-power laser

    Science.gov (United States)

    Kunwar, Puskal; Hassinen, Jukka; Bautista, Godofredo; Ras, Robin H. A.; Toivonen, Juha

    2016-04-01

    Noble metal nanoclusters are ultrasmall nanomaterials with tunable properties and huge application potential; however, retaining their enhanced functionality is difficult as they readily lose their properties without stabilization. Here, we demonstrate a facile synthesis of highly photostable silver nanoclusters in a polymer thin film using visible light photoreduction. Furthermore, the different stages of the nanocluster formation are investigated in detail using absorption and fluorescence spectroscopy, fluorescence microscopy, and atomic force microscopy. A cost-effective fabrication of photostable micron-sized fluorescent silver nanocluster barcode is demonstrated in silver-impregnated polymer films using a low-power continuous-wave laser diode. It is shown that a laser power of as low as 0.75 mW is enough to write fluorescent structures, corresponding to the specifications of a commercially available laser pointer. The as-formed nanocluster-containing microstructures can be useful in direct labeling applications such as authenticity marking and fluorescent labeling.

  8. DNA-templated silver nanoclusters based label-free fluorescent molecular beacon for the detection of adenosine deaminase.

    Science.gov (United States)

    Zhang, Kai; Wang, Ke; Xie, Minhao; Zhu, Xue; Xu, Lan; Yang, Runlin; Huang, Biao; Zhu, Xiaoli

    2014-02-15

    A general and reliable fluorescent molecular beacon is proposed in this work utilizing DNA-templated silver nanoclusters (AgNCs). The fluorescent molecular beacon has been employed for sensitive determination of the concentration of adenosine deaminase (ADA) and its inhibition. A well-designed oligonucleotide containing three functional regions (an aptamer region for adenosine assembly, a sequence complementary to the region of the adenosine aptamer, and an inserted six bases cytosine-loop) is adopted as the core element in the strategy. The enzymatic reaction of adenosine catalyzed by ADA plays a key role as well in the regulation of the synthesis of the DNA-templated AgNCs, i.e. the signal indicator. The intensity of the fluorescence signal may thereby determine the concentration of the enzyme and its inhibitor. The detection limit of the ADA can be lowered to 0.05 UL(-1). Also, 100 fM of a known inhibitor erythro-9-(2-hydroxy-3-nonyl) adenine hydrochloride (EHNA) is enough to present distinguishable fluorescence emission. Moreover, since the fluorescent signal indicator is not required to be bound with the oligonucleotide, this fluorescent molecular beacon may integrate the advantages of both the label-free and signal-on strategies. PMID:24035856

  9. Cu(2+) modulated silver nanoclusters as an on-off-on fluorescence probe for the selective detection of L-histidine.

    Science.gov (United States)

    Zheng, Xuyue; Yao, Tianming; Zhu, Ying; Shi, Shuo

    2015-04-15

    In the present study, a new strategy based on Cu(2+) mediated DNA-templated silver nanoclusters (DNA-Ag NCs) was developed, as a label-free, on-off-on fluorescent probe for the detection of l-histidine. Eight synthesized DNA oligonucleotides (D1-D8) were experimentally tested, and D5-Ag NCs was finally selected for l-histidine detection due to its best fluorescent properties. The fluorescence emission of D5-Ag NCs could be quenched by Cu(2+) via electron or energy transfer. Upon addition of l-histidine, the chelation between Cu(2+) and the imidazole group of l-histidine leads to Cu(2+) liberation from D5-Ag NCs, and subsequently results in a dramatic fluorescence enhancement of the probe. The method displayed a good selectivity toward l-histidine over all the other amino acids, with a linear relationship in the range of 0.20-80μM, and a limit of detection (LOD) of 4.3nM. The strategy was also successfully applied to detect l-histidine in diluted human urine, exhibiting great opportunities for practical application in biological system. PMID:25460889

  10. DNA/RNA chimera templates improve the emission intensity and target the accessibility of silver nanocluster-based sensors for human microRNA detection.

    Science.gov (United States)

    Shah, Pratik; Choi, Suk Won; Kim, Ho-jin; Cho, Seok Keun; Thulstrup, Peter Waaben; Bjerrum, Morten Jannik; Bhang, Yong-Joo; Ahn, Jong Cheol; Yang, Seong Wook

    2015-05-21

    In recent years microRNAs (miRNAs) have been established as important biomarkers in a variety of diseases including cancer, diabetes, cardiovascular disease, aging, Alzheimer's disease, asthma, autoimmune disease and liver diseases. As a consequence, a variety of monitoring methods for miRNAs have been developed, including a fast and simple method for miRNA detection by exploitation of the unique photoluminescence of DNA-templated silver nanoclusters (DNA/AgNCs). To increase the versatility of the AgNC-based method, we have adopted DNA/RNA chimera templates for AgNC-based probes, allowing response from several human miRNAs which are hardly detectable with DNA-based probes. Here, we demonstrate in detail the power of DNA/RNA chimera/AgNC probes in detecting two human miRNAs, let-7a and miR-200c. The DNA/RNA chimera-based probes are highly efficient to determine the level of miRNAs in several human cell lines. PMID:25759134

  11. Sensitivity of Ag:DNA fluorescence to single base mutations of hairpin strands

    Science.gov (United States)

    Gwinn, Elisabeth; Hassanzadeh, Rameen; O'Neill, Patrick; Fygenson, Deborah

    2010-03-01

    DNA strands can stabilize fluorescent silver clusters composed of just a few atoms [1]. The small size of these photon emitters and their formation in single-stranded DNA [2] give Ag:DNA emitters promise for use in optically-active, self-assembled DNA nanostructures. Exploiting this promise requires an understanding of how fluorophore color relates to the sequence and conformation of the host DNA strand. Here we examine the optical properties of Ag:DNA solutions for a family of DNA hairpins that differ by single base mutations in the hairpin loop. Specific mutations result in spectral redistribution of the fluorescence and large changes in brightness, pointing to geometric control as a means to select specific emitter species.[4pt] [1] J.T. Petty, J. Zheng, N.V. Hud and R.M. Dickson, ``DNA-templated Ag nanocluster formation,'' J. Am. Chem. Soc, 126, 5207 (2004).[0pt] [2] E.G. Gwinn, P. O'Neill, A. Guerrero, D. Bouwmeester and D.K. Fygenson, ``Sequence-dependent fluorescence from DNA-hosted silver nanoclusters,'' Advanced Materials 20, 279 (2008).

  12. Experimental Studies in Ice Nucleation

    Science.gov (United States)

    Wright, Timothy Peter

    Ice nuclei play a critical role in the formation of precipitation in mixed phase clouds. Modification of IN concentrations can lead to changes in cloud lifetimes and precipitation size. Presented in this study are experimental investigations into ice nuclei in an ongoing effort to reduce the uncertainties that ice nuclei have on cloud processes and climate. This research presents a new version of the cold stage drop freezing assay to investigate the time-dependence of heterogeneous nucleation. The temperature range for the instrument spans from the melting point of water to the homogeneous freezing limit of ˜-38 deg C. Temperature stability for the instrument allowed for experimental operation for up to four days while interrogating the same sample. Up to a one hundred fold increase in the number of analyzed drops was accomplished through an in-house written automated drop freezing detection software package. Combined instrument design improvements allow for the analysis of IN concentrations down to ˜10-8 ice nuclei per picoliter of sample water. A new variant of the multiple-component stochastic model for heterogeneous ice nucleation was used to investigate the time dependence of heterogeneous freezing processes. This was accomplished by analyzing how the changes in the cooling rate can impact the observed nucleation rate. The model employed four material-dependent parameters to accurately capture the observed freezing of water drops containing Arizona Test Dust. The parameters were then used to accurately predict the freezing behavior of the drops in time dependent experiments. The time dependence freezing of a wide range of materials was then investigated. These materials included the minerals montmorillonite and kaolinite, the biological proxy ice nuclei contained within the product Icemax, and flame soot generated from the incomplete combustion of ethylene gas. The time dependence for ice nuclei collected from rainwater samples was also investigated. The

  13. Heterogeneous nucleation of calcium oxalate on native oxide surfaces

    International Nuclear Information System (INIS)

    The aqueous deposition of calcium oxalate onto colloidal oxides has been studied as a model system for understanding heterogeneous nucleation processes of importance in biomimetic synthesis of ceramic thin films. Calcium oxalate nucleation has been monitored by measuring induction times for nucleation using Constant Composition techniques and by measuring nucleation densities on extended oxide surfaces using an atomic force microscope. Results show that the dependence of calcium oxalate nucleation on solution supersaturation fits the functional form predicted by classical nucleation theories. Anionic surfaces appear to promote nucleation better than cationic surfaces, lowering the effective energy barrier to heterogeneous nucleation

  14. Nucleation of voids - the impurity effect

    International Nuclear Information System (INIS)

    Nucleation of voids under irradiation in multicomponent alloys remains an unsolved theoretical problem. Of particular interest are the effects of nonequilibrium solute segregation phenomena on the critical nucleus and the nucleation rate. The resolution of the multicomponent nucleation in a dissipative system also has broader implication to the field of irreversible thermodynamics. The present paper describes a recent study of solute segregation effects in void nucleation. We begin with a thermodynamic model for a nonequilibrium void with interfacial segregation. The thermodynamic model is coupled with kinetic considerations of solute/solvent diffusion under a bias, which is itself related to segregation by the coating effect, to assess the stability of void embryos. To determine nucleation rate, we develop a novel technique by extending the most probable path method in statistical mechanics for nonequilibrium steady state to simulate large fluctuation with nonlinear dissipation. The path of nucleation is determined by solving an analogous problem on particle trajectory in classical dynamics. The results of both the stability analysis and the fluctuation analysis establish the paramount significance of the impurity effect via the mechanism of nonequilibrium segregation. We conclude that over-segregation is probably the most general cause for the apparently low nucleation barriers that are responsible for nearly ubiquitous occurrence of void swelling in common metals

  15. Nanowires and nanoneedles nucleation on vicinal substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xu, E-mail: zhangxubetter@gmail.com [Henan Key Laboratory of Laser and Opto-electric Information Technology, School of Information Engineering, Zhengzhou University, Zhengzhou 450052 (China); Xie, Dan; Huang, Genling [Zhengzhou Railway Vocational and Technical College, Zhengzhou 450052 (China); Sun, Xiao-Hong [Henan Key Laboratory of Laser and Opto-electric Information Technology, School of Information Engineering, Zhengzhou University, Zhengzhou 450052 (China)

    2015-01-01

    An analytic stress-driven nucleation model of nanowires (NWs) and nanoneedles (NNs) growing on a mismatched vicinal substrate is proposed. It is demonstrated that the formation enthalpy of NWs and NNs is a function of three independent variables, the base radius, aspect ratio and miscut angle of the vicinal surface. Theoretical analysis shows that the minimum nucleation barrier of an island decreases with increment of substrate misorientation, which means the nucleation of islands on a vicinal substrate is more favorable than that on a flat substrate.

  16. Dynamical viscosity of nucleating bubbles

    CERN Document Server

    Alamoudi, S M; Boyanovsky, D; Aragão de Carvalho, C; Fraga, E S; Jorás, S E; Takakura, F I

    1999-01-01

    We study the viscosity corrections to the growth rate of nucleating bubbles in a first order phase transition in scalar field theory. We obtain the non-equilibrium equation of motion of the coordinate that describes small departures from the critical bubble and extract the growth rate consistently in weak coupling and in the thin wall limit. Viscosity effects arise from the interaction of this coordinate with the stable quantum and thermal fluctuations around a critical bubble. In the case of 1+1 dimensions we provide an estimate for the growth rate that depends on the details of the free energy functional. In 3+1 dimensions we recognize robust features that are a direct consequence of the thin wall approximation and give the leading viscosity corrections.These are long-wavelength hydrodynamic fluctuations that describe surface waves, quasi-Goldstone modes which are related to ripples on interfaces in phase ordered Ising-like systems. We discuss the applicability of our results to describe the growth rate of ...

  17. DNA-stabilized silver nanoclusters and carbon nanoparticles oxide: A sensitive platform for label-free fluorescence turn-on detection of HIV-DNA sequences.

    Science.gov (United States)

    Ye, Yu-Dan; Xia, Li; Xu, Dang-Dang; Xing, Xiao-Jing; Pang, Dai-Wen; Tang, Hong-Wu

    2016-11-15

    Based on the remarkable difference between the interactions of carbon nanoparticles (CNPs) oxide with single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), and the fact that fluorescence of DNA-stabilized silver nanoclusters (AgNCs) can be quenched by CNPs oxide, DNA-functionalized AgNCs were applied as label-free fluorescence probes and a novel fluorescence resonance energy transfer (FRET) sensor was successfully constructed for the detection of human immunodeficiency virus (HIV) DNA sequences. CNPs oxide were prepared with the oxidation of candle soot, hence it is simple, time-saving and low-cost. The strategy of dual AgNCs probes was applied to improve the detection sensitivity by using dual- probe capturing the same target DNA in a sandwich mode and as the fluorescence donor, and using CNPs oxide as the acceptor. In the presence of target DNA, a dsDNA hybrid forms, leading to the desorption of the ssDNA-AgNCs probes from CNPs oxide, and the recovering of fluorescence of the AgNCs in a HIV-DNA concentration-dependent manner. The results show that HIV-DNA can be detected in the range of 1-50nM with a detection limit of 0.40nM in aqueous buffer. The method is simple, rapid and sensitive with no need of labeled fluorescent probes, and moreover, the design of fluorescent dual-probe makes full use of the excellent fluorescence property of AgNCs and further improves the detection sensitivity. PMID:27295571

  18. Metal-containing amorphous carbon (a-C:Ag) and AlN (AlN:Ag) metallo-dielectric nanocomposites

    Energy Technology Data Exchange (ETDEWEB)

    Matenoglou, G.M.; Zoubos, H. [University of Ioannina, Department of Materials Science and Engineering, GR-45110 Ioannina (Greece); Lotsari, A. [Aristotle University of Thessaloniki, Department of Physics, GR-54124 Thessaloniki (Greece); Lekka, Ch.E. [University of Ioannina, Department of Materials Science and Engineering, GR-45110 Ioannina (Greece); Komninou, Ph.; Dimitrakopulos, G.P. [Aristotle University of Thessaloniki, Department of Physics, GR-54124 Thessaloniki (Greece); Kosmidis, C.; Evangelakis, G.A. [University of Ioannina, Department of Physics, GR-45110 Ioannina (Greece); Patsalas, P., E-mail: ppats@cc.uoi.g [University of Ioannina, Department of Materials Science and Engineering, GR-45110 Ioannina (Greece)

    2009-12-31

    In this work we study the structure of Pulsed Laser Deposited silver-containing amorphous carbon a-C:Ag and AlN:Ag composites. The films have the form of a dielectric matrix (a-C or AlN) incorporating metal nanoclusters of 3-10 nm diameters. The composition of the films and the crystal structure of the inclusions have been determined by in-situ Auger Electron Spectroscopy and transmission electron microscopy, respectively. We show that the incorporation of the metal nanoparticles may severely alter the structure and properties of the matrix and a simple rule of mixture does not apply. The interactions of the possible matrix-nanoparticle interfaces were investigated using ab-initio calculations.

  19. Metal-containing amorphous carbon (a-C:Ag) and AlN (AlN:Ag) metallo-dielectric nanocomposites

    International Nuclear Information System (INIS)

    In this work we study the structure of Pulsed Laser Deposited silver-containing amorphous carbon a-C:Ag and AlN:Ag composites. The films have the form of a dielectric matrix (a-C or AlN) incorporating metal nanoclusters of 3-10 nm diameters. The composition of the films and the crystal structure of the inclusions have been determined by in-situ Auger Electron Spectroscopy and transmission electron microscopy, respectively. We show that the incorporation of the metal nanoparticles may severely alter the structure and properties of the matrix and a simple rule of mixture does not apply. The interactions of the possible matrix-nanoparticle interfaces were investigated using ab-initio calculations.

  20. AGS experiments -- 1991, 1992, 1993

    International Nuclear Information System (INIS)

    This report contains: (1) FY 1993 AGS schedule as run; (2) FY 1994--95 AGS schedule; (3) AGS experiments ≥ FY 1993 (as of 30 March 1994); (4) AGS beams 1993; (5) AGS experimental area FY 1991 physics program; (6) AGS experimental area FY 1992 physics program; (7) AGS experimental area FY 1993 physics program; (8) AGS experimental area FY 1994 physics program (planned); (9) a listing of experiments by number; (10) two-page summaries of each experiment; (11) listing of publications of AGS experiments; and (12) listing of AGS experiments

  1. AGS experiments - 1994, 1995, 1996

    International Nuclear Information System (INIS)

    This report contains the following information on the Brookhaven AGS Accelerator complex: FY 1996 AGS schedule as run; FY 1997 AGS schedule (working copy); AGS beams 1997; AGS experimental area FY 1994 physics program; AGS experimental area FY 1995 physics program; AGS experimental area FY 1996 physics program; AGS experimental area FY 1997 physics program (in progress); a listing of experiments by number; two-phage summaries of each experiment begin here, also ordered by number; listing of publications of AGS experiments begins here; and listing of AGS experimenters begins here

  2. AGS experiments - 1994, 1995, 1996

    Energy Technology Data Exchange (ETDEWEB)

    Depken, J.C.

    1997-01-01

    This report contains the following information on the Brookhaven AGS Accelerator complex: FY 1996 AGS schedule as run; FY 1997 AGS schedule (working copy); AGS beams 1997; AGS experimental area FY 1994 physics program; AGS experimental area FY 1995 physics program; AGS experimental area FY 1996 physics program; AGS experimental area FY 1997 physics program (in progress); a listing of experiments by number; two-phage summaries of each experiment begin here, also ordered by number; listing of publications of AGS experiments begins here; and listing of AGS experimenters begins here.

  3. Importance of configurational contributions to the free energy of nanoclusters

    Directory of Open Access Journals (Sweden)

    M. Posselt

    2013-07-01

    Full Text Available An effective simulation method based on the Wang-Landau Monte Carlo algorithm is used in order to demonstrate the significance of the configurational contributions to the free energy of embedded nanoclusters. Starting from the most stable cluster configuration the simulation provides all geometrically different, but simply connected and sufficiently compact configurations of a nanocluster of a given size and the respective formation energies. The knowledge of these data allows the calculation of the free formation and free binding energy of the cluster at T ≠ 0. The method is applied to coherent Cu clusters in bcc-Fe. It is shown that even at moderate temperatures the configurational contributions to the free formation and binding energy must not be neglected. The dependence of the monomer free binding energy on clusters size is found to change significantly with increasing temperature which has a considerable effect on the pathway of cluster evolution. Therefore, present investigations provide an essential contribution to the improvement of the input parameters for object kinetic Monte Carlo simulations and rate theory used in multi-scale simulations of the nanostructure evolution. The calculation scheme developed in this work is rather general and applicable to many types of embedded nanoclusters. Compared to the method of overlapping distributions hitherto used in some cases to determine the configurational part of the free energy the new method has major advantages. Various tests are performed in order verify the presented approach and to compare with the results of the other calculation procedure. A roadmap is proposed to include the vibrational contributions to the free energy of the clusters within the framework of the method employed in this work.

  4. Electronic Structure and Bonding of Icosahedral Core-Shell Gold-Silver Nanoalloy Clusters Au_(144-x)Ag_x(SR)_60

    OpenAIRE

    Malola, Sami; Häkkinen, Hannu

    2011-01-01

    Atomically precise thiolate-stabilized gold nanoclusters are currently of interest for many cross-disciplinary applications in chemistry, physics and molecular biology. Very recently, synthesis and electronic properties of "nanoalloy" clusters Au_(144-x)Ag_x(SR)_60 were reported. Here, density functional theory is used for electronic structure and bonding in Au_(144-x)Ag_x(SR)_60 based on a structural model of the icosahedral Au_144(SR)_60 that features a 114-atom metal core with 60 symmetry-...

  5. GE NANOCLUSTERS IN PLANAR GLASS WAVEGUIDES DEPOSITED BY PECVD

    DEFF Research Database (Denmark)

    Haiyan, Ou; Olsen, Johnny H.; Rottwitt, Karsten;

    2004-01-01

    Germanium (Ge) has been widely used as the dopant in the core layer of planar glass waveguides to increase the refractive index because it gives a small propagation loss. Plasma enhanced chemical vapour deposition (PECVD) and flame hydrolysis deposition (FHD) are two main material deposition...... this work we study the size and distribution of the nanoclusters by transmission electron microscopy (TEM) and Raman spectroscopy. The formation of the clusters is investigated by varying the Ge concentration in the glass and changing the annealing conditions such as temperature, atmosphere and time...

  6. Organization of copper nanoclusters in Langmuir–Blodgett films

    Indian Academy of Sciences (India)

    G Hemakanthi; Aruna Dhathathreyan; T Ramasami

    2002-02-01

    Stable nanoclusters of Cu were synthesized using Langmuir–Blodgett films of octadecylsuccinic acid (ODSA) as template. The Langmuir–Blodgett films of ODSA formed from subphase containing copper ions were first subjected to sulphidation (S) using sodium sulphide and then hydrogenated (H) using hydrogen gas. Diffuse reflectance UV-visible spectroscopy (DIR-UV-vis), X-ray photoelectron spectroscopy (XPS) and transmission electron microscopy (TEM) used to characterize these films indicated the formation of Cu(0) metallic clusters ranging in size from 3 ∼ 10 nm.

  7. Kinetical and thermodynamical parametars of crystallization of iPP nucleated with mixed α-nucleators

    OpenAIRE

    Janevski, Aco; Bogoeva-Gaceva, Gordana

    2013-01-01

    It is well known that the presence of a solid surface (substrate) in contact with thermoplastic polymers during the crystallization from the melt, generally favors the heterogeneous nucleation. Isothermal and nonisothermal crystallization of isotactic polypropylene (iPP) nucleated with 0.1 %wt. talc (average dimension of 20 µ) (assign. PPT), 0.1 %wt. calcite (average dimension of 5µ) (assign. PPC) and polymer nucleated with 0.1 %wt. talc plus 0.1 % wt. calcite (assign. PPTC), were studied...

  8. Impact of nucleation on global CCN

    OpenAIRE

    Merikanto, J.; Spracklen, D. V.; Mann, G.W.; Pickering, S. J.; Carslaw, K. S.

    2009-01-01

    Cloud condensation nuclei (CCN) are derived from particles emitted directly into the atmosphere (primary emissions) or from the growth of nanometer-sized particles nucleated in the atmosphere. It is important to separate these two sources because they respond in different ways to gas and particle emission control strategies and environmental changes. Here, we use a global aerosol microphysics model to quantify the contribution of primary and nucleated particles to global CCN. The model consid...

  9. Nucleate boiling of oxygen under reduced gravity

    Energy Technology Data Exchange (ETDEWEB)

    Kirichenko, Y.A.; Gladchenko, G.M.; Rusanov, K.V.

    1986-03-01

    Experimental results are presented on the coefficients of nucleate boiling heat transfer of oxygen under the conditions of low loading factors at elevated pressures. Based on the statistical distribution of the separation bubble radii and distances between the nucleation sites, a relation is obtained which provides a satisfactory description of the function ..cap alpha..(q) in case of deteriorated heat transfer at eta = g/g/sub n/ < 0.1.

  10. Nucleate boiling of oxygen under reduced gravity

    International Nuclear Information System (INIS)

    Experimental results are presented on the coefficients of nucleate boiling heat transfer of oxygen under the conditions of low loading factors at elevated pressures. Based on the statistical distribution of the separation bubble radii and distances between the nucleation sites, a relation is obtained which provides a satisfactory description of the function α(q) in case of deteriorated heat transfer at eta = g/g/sub n/ < 0.1

  11. Grain nucleation and growth during phase transformations

    DEFF Research Database (Denmark)

    Offerman, S.E.; Dijk, N.H. van; Sietsma, J.;

    2002-01-01

    of individual grains. Our measurements show that the activation energy for grain nucleation is at least two orders of magnitude smaller than that predicted by thermodynamic models. The observed growth curves of the newly formed grains confirm the parabolic growth model but also show three...... fundamentally different types of growth. Insight into the grain nucleation and growth mechanisms during phase transformations contributes to the development of materials with optimal mechanical properties....

  12. Homogeneous Nucleation of Water in Synthetic Air

    Czech Academy of Sciences Publication Activity Database

    Fransen, M. A. L. J.; Sachteleben, E.; Hrubý, Jan; Smeulders, D. M. J.

    Melville, New York: AIP Publishing, 2013 - (DeMott, P.; O'Dowd, C.), s. 124-127 ISBN 978-0-7354-1152-4. ISSN 0094-243X. [Nucleation and Atmospheric Aerosols /19./. Fort Collins (US), 23.06.2013-28.06.2013] R&D Projects: GA ČR(CZ) GAP101/11/1593 Institutional support: RVO:61388998 Keywords : molecular clusters * nucleation * supercooling Subject RIV: JE - Non-nuclear Energetics, Energy Consumption ; Use

  13. Size-dependent mobility of gold nano-clusters during growth on chemically modified graphene

    International Nuclear Information System (INIS)

    Gold nano-clusters were grown on chemically modified graphene by direct sputter deposition. Transmission electron microscopy of the nano-clusters on these electron-transparent substrates reveals an unusual bimodal island size distribution (ISD). A kinetic Monte Carlo model of growth incorporating a size-dependent cluster mobility rule uniquely reproduces the bimodal ISD, providing strong evidence for the mobility of large clusters during surface growth. The cluster mobility exponent of −5/3 is consistent with cluster motion via one-dimensional diffusion of gold atoms around the edges of the nano-clusters

  14. Size-dependent mobility of gold nano-clusters during growth on chemically modified graphene

    Directory of Open Access Journals (Sweden)

    Gavin R. Bell

    2014-01-01

    Full Text Available Gold nano-clusters were grown on chemically modified graphene by direct sputter deposition. Transmission electron microscopy of the nano-clusters on these electron-transparent substrates reveals an unusual bimodal island size distribution (ISD. A kinetic Monte Carlo model of growth incorporating a size-dependent cluster mobility rule uniquely reproduces the bimodal ISD, providing strong evidence for the mobility of large clusters during surface growth. The cluster mobility exponent of −5/3 is consistent with cluster motion via one-dimensional diffusion of gold atoms around the edges of the nano-clusters.

  15. Kinetically controlled synthesis of Au102(SPh)44 nanoclusters and catalytic application

    Science.gov (United States)

    Chen, Yongdong; Wang, Jin; Liu, Chao; Li, Zhimin; Li, Gao

    2016-05-01

    We here explore a kinetically controlled synthetic protocol for preparing solvent-solvable Au102(SPh)44 nanoclusters which are isolated from polydispersed gold nanoclusters by solvent extraction and size exclusion chromatography (SEC). The as-obtained Au102(SPh)44 nanoclusters are determined by matrix-assisted laser desorption ionization (MALDI) and electrospray ionization (ESI) mass spectrometry, in conjunction with UV-vis spectroscopy and thermogravimetric analysis (TGA). However, Au99(SPh)42, instead of Au102(SPh)44, is yielded when the polydispersed gold nanoclusters are etched in the presence of excess thiophenol under thermal conditions (e.g., 80 °C). Interestingly, the Au102(SPh)44 nanoclusters also can convert to Au99(SPh)42 with equivalent thiophenol ligands, evidenced by the analyses of UV-vis and MALDI mass spectrometry. Finally, the TiO2-supported Au102(SPh)44 nanocluster catalyst is investigated in the selective oxidation of sulfides into sulfoxides by the PhIO oxidant and gives rise to high catalytic activity (e.g., 80-99% conversion of R-S-R' sulfides with 96-99% selectivity for R-S(&z.dbd;O)-R' sulfoxides). The Au102(SPh)44/TiO2 catalyst also shows excellent recyclability in the sulfoxidation process.We here explore a kinetically controlled synthetic protocol for preparing solvent-solvable Au102(SPh)44 nanoclusters which are isolated from polydispersed gold nanoclusters by solvent extraction and size exclusion chromatography (SEC). The as-obtained Au102(SPh)44 nanoclusters are determined by matrix-assisted laser desorption ionization (MALDI) and electrospray ionization (ESI) mass spectrometry, in conjunction with UV-vis spectroscopy and thermogravimetric analysis (TGA). However, Au99(SPh)42, instead of Au102(SPh)44, is yielded when the polydispersed gold nanoclusters are etched in the presence of excess thiophenol under thermal conditions (e.g., 80 °C). Interestingly, the Au102(SPh)44 nanoclusters also can convert to Au99(SPh)42 with equivalent

  16. Modeling the crystallization of gold nanoclusters-the effect of the potential energy function

    International Nuclear Information System (INIS)

    The crystallization dynamics of 5083 atom gold nanoclusters, which were quenched from the melt, were studied by molecular dynamics (MD) using the EAM 'Glue' and 'Force-matched' potentials to compare and contrast how the crystallization dynamics is affected by these potential energy functions. MD simulations from each potential showed the formation of gold nanoclusters of icosahedral morphology during the quenching process, which is in good agreement with the experimental studies of gold nanoclusters formed under vacuum. The effect of the potential on the evolution of cluster (surface and interior) morphology during the crystallization process is discussed.

  17. Tailoring Interlayer Exchange Coupling of Ferromagnetic Films Across MgO with Fe Nanoclusters

    OpenAIRE

    Wong, Jared J. I.; Ramirez, Luciana; Swartz, A. G.; HOFF A.; Han, Wei; LI Yan; Kawakami, R. K.

    2010-01-01

    We investigate the interlayer exchange coupling in Fe/MgO/Fe and Fe/MgO/Co systems with magnetic Fe nanoclusters embedded in the MgO spacer. Samples are grown by molecular beam epitaxy (MBE) and utilize wedged MgO films to independently vary the film thickness and the position of the Fe nanoclusters. Depending on the position of the Fe nanoclusters, the bilinear coupling (J1) exhibits strong variations in magnitude and can even switch between antiferromagnetic and ferromagnetic. This effect i...

  18. Ge nanoclusters in PECVD-deposited glass caused only by heat treatment

    DEFF Research Database (Denmark)

    Ou, Haiyan; Rørdam, Troels Peter; Rottwitt, Karsten; Grumsen, Flemming Bjerg; Horsewell, Andy; Berg, Rolf W.; Shi, Peixiong

    2008-01-01

    This paper reports the formation of Ge nanoclusters in a multi-layer structure consisting of alternating thin films of Ge-doped silica glass and SiGe, deposited by plasma-enhanced chemical vapor deposition (PECVD) and post annealed at 1100 °C in N2 atmosphere. We studied the annealed samples by...... embedded with Ge nanoclusters after annealing. These nanoclusters are crystalline and varied in size. There were no clusters in the Ge-doped glass layer. Raman spectra verified the existence of crystalline Ge clusters. The positional shift of the Ge vibrational peak with the change of the focus depth...

  19. Biological ice nucleation initiates hailstone formation

    Science.gov (United States)

    Michaud, Alexander B.; Dore, John E.; Leslie, Deborah; Lyons, W. Berry; Sands, David C.; Priscu, John C.

    2014-11-01

    Cloud condensation and ice nuclei in the troposphere are required precursors to cloud and precipitation formation, both of which influence the radiative balance of Earth. The initial stage of hailstone formation (i.e., the embryo) and the subsequent layered growth allow hail to be used as a model for the study of nucleation processes in precipitation. By virtue of the preserved particle and isotopic record captured by hailstones, they represent a unique form of precipitation that allows direct characterization of the particles present during atmospheric ice nucleation. Despite the ecological and economic consequences of hail storms, the dynamics of hailstone nucleation, and thus their formation, are not well understood. Our experiments show that hailstone embryos from three Rocky Mountain storms contained biological ice nuclei capable of freezing water at warm, subzero (°C) temperatures, indicating that biological particles can act as nucleation sites for hailstone formation. These results are corroborated by analysis of δD and δ18O from melted hailstone embryos, which show that the hailstones formed at similarly warm temperatures in situ. Low densities of ice nucleation active abiotic particles were also present in hailstone embryos, but their low concentration indicates they were not likely to have catalyzed ice formation at the warm temperatures determined from water stable isotope analysis. Our study provides new data on ice nucleation occurring at the bottom of clouds, an atmospheric region whose processes are critical to global climate models but which has challenged instrument-based measurements.

  20. Continuous and rapid synthesis of nanoclusters and nanocrystals using scalable microstructured reactors

    Science.gov (United States)

    Jin, Hyung Dae

    Recent advances in nanocrystalline materials production are expected to impact the development of next generation low-cost and/or high efficiency solar cells. For example, semiconductor nanocrystal inks are used to lower the fabrication cost of the absorber layers of the solar cells. In addition, some quantum confined nanocrystals display electron-hole pair generation phenomena with greater than 100% quantum yield, called multiple exciton generation (MEG). These quantum dots could potentially be used to fabricate solar cells that exceed the Schockley-Queisser limit. At present, continuous syntheses of nanoparticles using microreactors have been reported by several groups. Microreactors have several advantages over conventional batch synthesis. One advantage is their efficient heat transfer and mass transport. Another advantage is the drastic reduction in the reaction time, in many cases, down to minutes from hours. Shorter reaction time not only provides higher throughput but also provide better particle size control by avoiding aggregation and by reducing probability of oxidizing precursors. In this work, room temperature synthesis of Au11 nanoclusters and high temperature synthesis of chalcogenide nanocrystals were demonstrated using continuous flow microreactors with high throughputs. A high rate production of phosphine-stabilized Au11 nanoclusters was achieved using a layer-up strategy which involves the use of microlamination architectures; the patterning and bonding of thin layers of material (laminae) to create a multilayered micromixer in the range of 25-250 mum thick was used to step up the production of phosphine-stabilized Au11 nanoclusters. Continuous production of highly monodispersed phosphine-stabilized Au 11 nanoclusters at a rate of about 11.8 [mg/s] was achieved using a microreactor with a size of 1.687cm3. This result is about 30,000 times over conventional batch synthesis according to production rate/per reactor volume. We have elucidated the

  1. Nucleation and Growth of Tin in Pb-Free Solder Joints

    Science.gov (United States)

    Gourlay, C. M.; Belyakov, S. A.; Ma, Z. L.; Xian, J. W.

    2015-08-01

    The solidification of Pb-free solder joints is overviewed with a focus on the formation of the βSn grain structure and grain orientations. Three solders commonly used in electronics manufacturing, Sn-3Ag-0.5Cu, Sn-3.5Ag, and Sn-0.7Cu-0.05Ni, are used as case studies to demonstrate that (I) growth competition between primary dendrites and eutectic fronts during growth in undercooled melts is important in Pb-free solders and (II) a metastable eutectic containing NiSn4 forms in Sn-3.5Ag/Ni joints. Additionally, it is shown that the substrate (metallization) has a strong influence on the nucleation and growth of tin. We identify Co, Pd, and Pt substrates as having the potential to control solidification and microstructure formation. In the case of Pd and Pt substrates, βSn is shown to nucleate on the PtSn4 or PdSn4 intermetallic compound (IMC) reaction layer at relatively low undercooling of ~4 K, even for small solder ball diameters down to <200 μm.

  2. Nanoclusters prepared from a silver/gold alloy as a fluorescent probe for selective and sensitive determination of lead(II)

    International Nuclear Information System (INIS)

    We report on the preparation of water-soluble and fluorescent silver/gold alloy nanoclusters (Ag/Au NCs) by a galvanic replacement reaction. The alloy NCs have an average diameter of 1.5 nm and are shown to be viable fluorescent probes for the determination of lead(II) due to aggregation-induced quenching of fluorescence. The alloy NCs are characterized in terms of photoluminescence spectrum, photoluminescence excitation spectrum, transmission electron microscopy and X-ray photoelectron spectroscopy which confirm the presence of alloy NCs. Bovine serum albumin, a well known stabilizing agent, has a high-affinity site for Pb2+ ion, and the resulting complex acts as a quencher of fluorescence. This finding has led to a method for selective determination of Pb2+ with a limit of detection of about 2 nM. (author)

  3. Method of examination of bubble nucleation in glass melts

    Czech Academy of Sciences Publication Activity Database

    Vernerová, Miroslava; Cincibusová, Petra; Kloužek, Jaroslav; Maehara, T.; Němec, Lubomír

    2015-01-01

    Roč. 411, 1 March (2015), s. 59-67. ISSN 0022-3093 R&D Projects: GA TA ČR TA01010844 Institutional support: RVO:67985891 Keywords : bubble nucleation * nucleation monitoring * nucleation temperature * nucleation intensity * glass fining Subject RIV: JH - Ceramics, Fire-Resistant Materials and Glass Impact factor: 1.766, year: 2014

  4. Synthesis of highly fluorescent gold nanoclusters using egg white proteins.

    Science.gov (United States)

    Joseph, Dickson; Geckeler, Kurt E

    2014-03-01

    Gold nanoclusters (AuNCs) have gained interest during the recent years because of their low toxicity and finer size for the bioimaging and biolabeling applications in comparison to the semiconductor quantum dot analogues. Diverse materials such as sulfur compounds, peptides, dendrimers, proteins, etc., are exploited for the preparation of AuNCs. Henceforth, highly fluorescent, water-soluble, and few atom-containing gold nanoclusters are created using a rapid, straightforward, and green method. In this regard for the first time chicken egg white (CEW), one of the most unique materials, is utilized in an aqueous solution under basic conditions at physiological temperature for the preparation of AuNCs. Tyrosine and tryptophan amino acid residues are responsible for the conversion of Au ions to Au(0) under alkaline condtions. CEW contains four major proteins of which the main constituent protein, ovalbumin also leads to the formation of the AuNCs with a higher fluorescence emission compared to the CEW. The ratios between the different reaction partners are very crucial, along with temperature and time for the preparation of AuNCs with high photoluminescence emission. The limited vibrational motion of the proteins under alkaline condition and the bulkiness of the proteins help in the formation of AuNCs. PMID:24321847

  5. Aqueous synthesis of near-infrared highly fluorescent platinum nanoclusters.

    Science.gov (United States)

    García Fernández, Jenifer; Trapiella-Alfonso, Laura; Costa-Fernández, José M; Pereiro, Rosario; Sanz-Medel, Alfredo

    2015-05-29

    A one-step synthesis of near infrared fluorescent platinum nanoclusters (PtNCs) in aqueous medium is described. The proposed optimized procedure for PtNC synthesis is rather simple, fast and it is based on the direct metal reduction with NaBH4. Bidentated thiol ligands (lipoic acid) were selected as nanoclusters stabilizers in water media. The structural characterization revealed attractive features of the PtNCs, including small size, high water solubility, near-infrared luminescence centered at 680 nm, long-term stability and the highest quantum yield in water reported so far (47%) for PtNCs. Moreover, their stability in different pH media and an ionic strength of 0.2 M NaCl was studied and no significant changes in fluorescence emission were detected. In brief, they offer a new type of fluorescent noble metal nanoprobe with a great potential to be applied in several fields, including biolabeling and imaging experiments. PMID:25944823

  6. DNA methyltransferase activity detection based on fluorescent silver nanocluster hairpin-shaped DNA probe with 5'-C-rich/G-rich-3' tails.

    Science.gov (United States)

    Liu, Wenting; Lai, Han; Huang, Rong; Zhao, Chuntao; Wang, Yimo; Weng, Xiaocheng; Zhou, Xiang

    2015-06-15

    DNA methylation has received a large amount of attention due to its close relationship to a wide range of biological phenomena, such as gene activation, gene imprinting, and chromatin stability. Herein, we have designed a hairpin-shaped DNA probe with 5'-C-rich/G-rich-3' tails and developed a simple and reliable fluorescence turn-off assay for DNA adenine methylation (Dam) methyltransferase (MTase) detection combining site recognition and the fluorescence enhancement of DNA-templated silver nanoclusters (DNA-AgNCs) by guanine-rich DNA sequences. A designed hairpin probe with 5' CCCTTACCCC and 3' GGGTGGGGTGGGGTGGGG displays a bright red emission after reacting with AgNO3 and NaBH4. In the presence of Dam MTase, the methylation-sensitive restriction endonuclease Dpn I which has the same recognition site with the Dam MTase can split the probe, freeing the G-rich sequence from the C-rich sequence, thus quenching the fluorescence of DNA-AgNCs. Compared to traditional fluorescent-based methods, this strategy is simple and inexpensive. A linear response to concentrations of Dam MTase which range from 1 U/mL to 100 U/mL and a detection limit of 1 U/mL are obtained without any amplification steps. In addition, we also demonstrate the method can be used for evaluation and screening of inhibitors for Dam MTase. PMID:25682501

  7. A label-free fluorescent probe based on DNA-templated silver nanoclusters and exonuclease III-assisted recycling amplification detection of nucleic acid.

    Science.gov (United States)

    Yang, Wen; Tian, Jianniao; Ma, Yefei; Wang, Lijun; Zhao, Yanchun; Zhao, Shulin

    2015-11-01

    A number of specific nucleic acids are closely related with many serious diseases, in the current research, a platform taking advantage of exonuclease III (Exo III) to realize double recycling amplification and label-free fluorescent DNA-templated silver nanoclusters (DNA-AgNCs) for detecting of nucleic acid had been developed. In this method, a molecular beacon (MB) with 3'-protruding termini and a single-stranded cytosine-rich (C-rich) probe were designed that coexist stably with Exo III. Once the target DNA appeared, portion of the MB could hybridize with target DNA and was digested by Exo III, which allowed the release of target DNA and a residual sequence. Subsequently, the residual sequence could trigger the Exo III to digest C-rich probe, and the DNA-AgNCs was not able to be synthesized because of the C-rich probe was destroyed; finally the fluorescent of solution was quenched. This assay enables to monitor human hemochromatosis gene (as a model) with high sensitivity, the detection limit is as low as 120 pM compared with other fluorescence DNA-AgNCs methods, this assay also exhibits superior specificity even against single base mismatch. The strategy is applied to detect human hemochromatosis gene in real human serum samples successfully. PMID:26572843

  8. Multifunctional Dumbbell-Shaped DNA-Templated Selective Formation of Fluorescent Silver Nanoclusters or Copper Nanoparticles for Sensitive Detection of Biomolecules.

    Science.gov (United States)

    Chen, Jinyang; Ji, Xinghu; Tinnefeld, Philip; He, Zhike

    2016-01-27

    In this work, a multifunctional template for selective formation of fluorescent silver nanoclusters (AgNCs) or copper nanoparticles (CuNPs) is put forward. This dumbbell-shaped (DS) DNA template is made up of two cytosine hairpin loops and an adenine-thymine-rich double-helical stem which is closed by the loops. The cytosine loops act as specific regions for the growth of AgNCs, and the double-helical stem serves as template for the CuNPs formation. By carefully investigating the sequence and length of DS DNA, we present the optimal design of the template. Benefiting from the smart design and facile synthesis, a simple, label-free, and ultrasensitive fluorescence strategy for adenosine triphosphate (ATP) detection is proposed. Through the systematic comparison, it is found that the strategy based on CuNPs formation is more sensitive for ATP assay than that based on AgNCs synthesis, and the detection limitation was found to be 81 pM. What's more, the CuNPs formation-based method is successfully applied in the detection of ATP in human serum as well as the determination of cellular ATP. In addition to small target molecule, the sensing strategy was also extended to the detection of biomacromolecule (DNA), which illustrates the generality of this biosensor. PMID:26719979

  9. Magnetic-plasmonic bifunctional CoO–Ag heterostructure nanoparticles

    International Nuclear Information System (INIS)

    We demonstrate the synthesis of CoO–Ag heterostructure nanoparticles by chemical reduction of AgNO3 in the presence of Co nanoparticles in oleylamine (OAm). OAm plays multiple roles as a surfactant, solvent, and reducing agent. The mechanism of surface-activated heterogeneous nucleation and growth on the preformed seeds has been proposed. At the same time, the Co nanoparticles are oxidized to form hollow CoO nanoparticles through the Kirkendall effect. The resulting CoO–Ag heterostructures display mushroom-like morphology, Ag nanoparticle as ‘cap’ attached on the ‘stem’ of hollow CoO nanoparticles. The size of Ag domains in the heterostructure nanoparticles can be tuned by controlling the volume of Co nanoparticles. The plasmonic absorption and the magnetization of the bifunctional nanoparticles were investigated. The combination of the hollow structure of the CoO and the surface plasmon resonances of the Ag domains may make them suitable for catalysis, drug delivery, therapy, and surface-enhanced Raman scattering. (papers)

  10. The growth of AgGaTe2 layers on glass substrates with Ag2Te buffer layer by closed space sublimation method

    International Nuclear Information System (INIS)

    The AgGaTe2 layer growth was performed by the closed space sublimation method on the Mo/glass substrate. The Ag2Te buffer layer was inserted between AgGaTe2 and Mo layers, to improve the quality of grown layers. Crystallographic properties were analyzed by x-ray diffraction (XRD), and the surface morphologies were analyzed by scanning electron microscopy (SEM). The Ag2Te layer grown on the Mo/glass exhibited a membrane filter structure from the SEM observation. XRD spectra of layers grown with and without the buffer layer were compared. The AgGaTe2 layer with the Ag2Te buffer layer exhibited peaks originating from AgGaTe2, and a very strong diffraction peak of 112 was observed. On the other hand, it was cleared that the layer grown without the buffer layer exhibited no strong peaks associated with AgGaTe2, but Ga-Te compounds. From this, crystallographic properties of the AgGaTe2 layer were drastically improved by the insertion of the Ag2Te buffer layer. Moreover, the surface morphology exhibited a smooth surface when the Ag2Te buffer layer was inserted. The nucleation site density of AgGaTe2 was probably increased since the membrane filter structure exhibited numbers of kinks at the edge. Chemical reaction between Ga and Mo was also eliminated. It was cleared that the insertion of the buffer layer and its surface morphology were an important parameter to grow high quality AgGaTe2 layers. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  11. The growth of AgGaTe{sub 2} layers on glass substrates with Ag{sub 2}Te buffer layer by closed space sublimation method

    Energy Technology Data Exchange (ETDEWEB)

    Uruno, Aya; Usui, Ayaka; Takeda, Yuji; Inoue, Tomohiro [Department of Electrical Engineering and Bioscience, Waseda University, 3-4-1 Okubo, Shinjuku, Tokyo 169-8555 (Japan); Kobayashi, Masakazu [Department of Electrical Engineering and Bioscience, Waseda University, 3-4-1 Okubo, Shinjuku, Tokyo 169-8555 (Japan); Kagami Memorial Research Institute for Materials Science and Technology, Waseda University, 2-8-26 Nishiwaseda, Shinjuku, Tokyo 169-0051 (Japan)

    2015-06-15

    The AgGaTe{sub 2} layer growth was performed by the closed space sublimation method on the Mo/glass substrate. The Ag{sub 2}Te buffer layer was inserted between AgGaTe{sub 2} and Mo layers, to improve the quality of grown layers. Crystallographic properties were analyzed by x-ray diffraction (XRD), and the surface morphologies were analyzed by scanning electron microscopy (SEM). The Ag{sub 2}Te layer grown on the Mo/glass exhibited a membrane filter structure from the SEM observation. XRD spectra of layers grown with and without the buffer layer were compared. The AgGaTe{sub 2} layer with the Ag{sub 2}Te buffer layer exhibited peaks originating from AgGaTe{sub 2}, and a very strong diffraction peak of 112 was observed. On the other hand, it was cleared that the layer grown without the buffer layer exhibited no strong peaks associated with AgGaTe{sub 2}, but Ga-Te compounds. From this, crystallographic properties of the AgGaTe{sub 2} layer were drastically improved by the insertion of the Ag{sub 2}Te buffer layer. Moreover, the surface morphology exhibited a smooth surface when the Ag{sub 2}Te buffer layer was inserted. The nucleation site density of AgGaTe{sub 2} was probably increased since the membrane filter structure exhibited numbers of kinks at the edge. Chemical reaction between Ga and Mo was also eliminated. It was cleared that the insertion of the buffer layer and its surface morphology were an important parameter to grow high quality AgGaTe{sub 2} layers. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  12. Electrochemical nucleation of palladium on graphene: A kinetic study with an emphasis on hydrogen co-reduction

    International Nuclear Information System (INIS)

    Highlights: ► Simultaneous reduction of Pd and H on graphene was kinetically investigated. ► There is no thermodynamic barrier against nucleation of Pd on graphene. ► Nucleation rate of Pd on graphene is 100 times higher than glassy carbon substrate. - Abstract: The nucleation mechanisms of palladium nanoparticles from 1 mM [PdCl4]2− + 1 M NH4Cl electrolyte (pH = 3.4) on graphene surface were studied using cyclic voltammetry, chronoamperometry and field emission scanning electron microscopy (FESEM). It was found that due to high catalytic properties of Pd nanoparticles/graphene surface, the hydrogen co-reduction during Pd electrodeposition occurs. The kinetics of electrochemical nucleation and growth of Pd nanoparticles was also evaluated using Mirkin–Nilov–Heerman–Tarallo (MNHT) model. Regarding the simultaneous reduction of hydrogen ion on the surface of the growing Pd nuclei, a modified model developed by Palomar-Pardavé et al. [M. Palomar-Pardavé, B.R. Scharifker, E.M. Arce, M. Romero-Romo, Electrochimica Acta 50 (2005) 4736] was employed to estimate the kinetic parameters of the process. It was shown that the steady state nucleation rate (Ist) and the rate constant of hydrogen reduction (kH) increase exponentially with a potential shift to more cathodic values. Using the relation between Gibbs free energy of formation for a critical nucleus (ΔGc) and Ist, it is concluded that there is no thermodynamic barrier against nucleation of Pd on graphene in the electrode potential range studied in this work (E = −0.3 to −0.5 V vs. Ag/AgCl).

  13. Hairpin DNA probes based on target-induced in situ generation of luminescent silver nanoclusters.

    Science.gov (United States)

    Xiao, Yan; Wu, Zhengjun; Wong, Kwok-Yin; Liu, Zhihong

    2014-05-14

    Novel hairpin DNA probes are designed and constructed based on target-induced in situ generation of luminescent silver nanoclusters. This design allows specific and versatile detection of diverse targets with easy operation and low cost. PMID:24686790

  14. Biosynthesis of fluorescent gold nanoclusters for in vitro and in vivo tumor imaging

    Science.gov (United States)

    Li, Linlin; Liu, Xi; Fu, Changhui; Tan, Longfei; Liu, Huiyu

    2015-11-01

    Recently, fluorescent metallic nanoclusters with sizes in the few-nanometer range have showed great potentials in biomedical applications for their stable and tailorable fluorescence. Although many studies have focused on fabricating these kinds of materials with chemical methods, there has been little focus on the biosynthesis of gold nanoclusters with green and facile methods. In this study, a facile, scalable, cost-effective and environmentally benign biosynthesis approach was developed to produce fluorescent gold nanoclusters (AuNCs). Biomasses including egg white, egg yolk and serums were used as both capping agents and reductants in the biosynthesis of AuNCs. As a new kind of fluorescent imaging agent, they were used for in vitro and in vivo tumor imaging that can efficiently track cancer cells with excellent biocompatibility. This work provides new insight into green biosynthesis and biomedical applications of fluorescent metallic nanoclusters.

  15. A colloidal assembly approach to synthesize magnetic porous composite nanoclusters for efficient protein adsorption

    Science.gov (United States)

    Yang, Qi; Lan, Fang; Yi, Qiangying; Wu, Yao; Gu, Zhongwei

    2015-10-01

    A combination strategy of the inverse emulsion crosslinking approach and the colloidal assembly technique is first proposed to synthesize Fe3O4/histidine composite nanoclusters as new-type magnetic porous nanomaterials. The nanoclusters possess uniform morphology, high magnetic content and excellent protein adsorption capacity, exhibiting their great potential for bio-separation.A combination strategy of the inverse emulsion crosslinking approach and the colloidal assembly technique is first proposed to synthesize Fe3O4/histidine composite nanoclusters as new-type magnetic porous nanomaterials. The nanoclusters possess uniform morphology, high magnetic content and excellent protein adsorption capacity, exhibiting their great potential for bio-separation. Electronic supplementary information (ESI) available: Experimental details. See DOI: 10.1039/c5nr05800g

  16. Mechanical stability of titanium and plasma polymer nanoclusters in nanocomposite coatings

    International Nuclear Information System (INIS)

    The mechanical stability of nanoclusters embedded in nanocomposite coatings was investigated by scratch and wear tests supported by atomic force microscopy using surface topography mode. Titanium and plasma polymer nanoclusters were deposited on planar substrates (glass, titanium) using a magnetron-based gas aggregation cluster source. The deposited clusters were overcoated with a thin titanium film of different thicknesses to stabilize the position of the clusters in the nanocomposite coating. Nanotribological measurements were carried out to optimize the thickness of the overcoating film for sufficient interfacial adhesion of the cluster/film system. - Highlights: ► Titanium and plasma polymer nanoclusters were overcoated with thin titanium film. ► The mechanical stability of nanoclusters was characterized by nanotribological tests. ► The film thickness was optimized to stabilize the position of the clusters in coating

  17. Growth of gold nanoclusters and nanocrystals induced by lysozyme protein in thin film conformation

    Science.gov (United States)

    Bhowal, Ashim Chandra; Kundu, Sarathi

    2016-08-01

    Structures and growth behavior of gold nanoclusters and nanocrystals have been explored on thin films of globular protein lysozyme by using UV-vis and photoluminescence spectroscopy, X-ray diffraction (XRD) and atomic force microscopy (AFM). A simple and one-step environment friendly method has been used to grow nanocrystals on protein surface from HAuCl4 solution. It has been found that if different interaction times are provided between lysozyme films and HAuCl4 solution, then initially formed tiny gold nanoclusters on protein surface transform into nanocrystals with the passage of time. XRD analysis shows the formation of faced-centered cubic lattice along (1 1 1) crystalline direction and AFM images confirm the presence of circular, rod-like, triangular and hexagonal crystal structures. Langmuir-like growth behavior has been identified for both the gold nanoclusters and nanocrystals formation induced by the lysozyme films, however, nanocrystal growth is relatively slower than nanocluster.

  18. Self-Assembled Superparamagnetic Iron Oxide Nanoclusters for Universal Cell Labeling and MRI

    Science.gov (United States)

    Chen, Shuzhen; Zhang, Jun; Jiang, Shengwei; Lin, Gan; Luo, Bing; Yao, Huan; Lin, Yuchun; He, Chengyong; Liu, Gang; Lin, Zhongning

    2016-05-01

    Superparamagnetic iron oxide (SPIO) nanoparticles have been widely used in a variety of biomedical applications, especially as contrast agents for magnetic resonance imaging (MRI) and cell labeling. In this study, SPIO nanoparticles were stabilized with amphiphilic low molecular weight polyethylenimine (PEI) in an aqueous phase to form monodispersed nanocomposites with a controlled clustering structure. The iron-based nanoclusters with a size of 115.3 ± 40.23 nm showed excellent performance on cellular uptake and cell labeling in different types of cells, moreover, which could be tracked by MRI with high sensitivity. The SPIO nanoclusters presented negligible cytotoxicity in various types of cells as detected using MTS, LDH, and flow cytometry assays. Significantly, we found that ferritin protein played an essential role in protecting stress from SPIO nanoclusters. Taken together, the self-assembly of SPIO nanoclusters with good magnetic properties provides a safe and efficient method for universal cell labeling with noninvasive MRI monitoring capability.

  19. [Ag25(SR)18]¯: The ‘Golden’ Silver Nanoparticle

    KAUST Repository

    Joshi, Chakra P

    2015-08-31

    Silver nanoparticles with an atomically precise molecular formula [Ag25(SR)18]¯ (‒SR: thiolate) are synthesized and their single-crystal structure is determined. This synthesized nanocluster is the only silver nanoparticle that has a virtually identical analogue in gold, i.e., [Au25(SR)18]¯, in terms of number of metal atoms, ligand count, super-atom electronic configuration, and atomic arrangement. Furthermore, both [Ag25(SR)18]¯ and its gold analogue share a number of features in their optical absorption spectra. This unprecedented molecular synthesis in silver to mimic gold offers the first model nanoparticle platform to investigate the centuries-old problem of understanding the fundamental differences between silver and gold in terms of nobility, catalytic activity, and optical property.

  20. Silver nanocluster/silica composite coatings obtained by sputtering for antibacterial applications

    OpenAIRE

    Miola, Marta; Perero, Sergio; Ferraris, Sara; Verne, Enrica; Ferraris, Monica; Baino, Francesco; Balagna, Cristina

    2012-01-01

    Silver nanocluster silica composite coatings were deposited by radio frequency co-sputtering technique on several substrates. This versatile method allows tailoring of silver content and antibacterial behaviour of coatings deposited on glasses, ceramics, metals and polymers for several applications. Coating morphology and composition as well as nanocluster size were analyzed by means of UV-Visible absorption, X-ray diffraction (XRD), Field Emission Scanning Electron Microscopy (FESEM), electr...

  1. Second-Row Transition-Metal Doping of (ZniSi), i = 12, 16 Nanoclusters: Structural and Magnetic Properties

    OpenAIRE

    Elisa Jimenez-Izal; Matxain, Jon M.; Mario Piris; Ugalde, Jesus M

    2013-01-01

    TM@ZniSi nanoclusters have been characterized by means of the Density Functional Theory, in which Transition Metal (TM) stands from Y to Cd, and i = 12 and 16. These two nanoclusters have been chosen owing to their highly spheroidal shape which allow for favored endohedral structures as compared to other nanoclusters. Doping with TM is chosen due to their magnetic properties. In similar cluster-assembled materials, these magnetic properties are related to the Transition Metal-Transition Metal...

  2. Microtubule nucleation and organization in dendrites.

    Science.gov (United States)

    Delandre, Caroline; Amikura, Reiko; Moore, Adrian W

    2016-07-01

    Dendrite branching is an essential process for building complex nervous systems. It determines the number, distribution and integration of inputs into a neuron, and is regulated to create the diverse dendrite arbor branching patterns characteristic of different neuron types. The microtubule cytoskeleton is critical to provide structure and exert force during dendrite branching. It also supports the functional requirements of dendrites, reflected by differential microtubule architectural organization between neuron types, illustrated here for sensory neurons. Both anterograde and retrograde microtubule polymerization occur within growing dendrites, and recent studies indicate that branching is enhanced by anterograde microtubule polymerization events in nascent branches. The polarities of microtubule polymerization events are regulated by the position and orientation of microtubule nucleation events in the dendrite arbor. Golgi outposts are a primary microtubule nucleation center in dendrites and share common nucleation machinery with the centrosome. In addition, pre-existing dendrite microtubules may act as nucleation sites. We discuss how balancing the activities of distinct nucleation machineries within the growing dendrite can alter microtubule polymerization polarity and dendrite branching, and how regulating this balance can generate neuron type-specific morphologies. PMID:27097122

  3. Synthesis of selenolate-protected Au18(SeC6H5)14 nanoclusters

    Science.gov (United States)

    Xu, Qian; Wang, Shuxin; Liu, Zhao; Xu, Guoyong; Meng, Xiangming; Zhu, Manzhou

    2013-01-01

    This work reports the first synthesis of selenophenolate-protected Au18(SePh)14 nanoclusters. This cluster exhibits distinct differences from its thiolate analogue in terms of optical absorption properties. The Au18(SePh)14 nanoclusters were obtained via a controlled reaction of Au25(SCH2CH2Ph)18 with selenophenol. Electrospray ionization time-of-flight mass spectrometry (ESI-TOF-MS) revealed the crude product to contain predominantly Au18(SePh)14 nanoclusters, and side products include Au15(SePh)13, Au19(SePh)15 and Au20(SePh)16. High-performance liquid chromatography (HPLC) was employed to isolate Au18(SePh)14 nanoclusters. The results of thermogravimetric analysis (TGA), elemental analysis (EA), and 1H/13C NMR spectroscopy confirmed the cluster composition. To the best of our knowledge, this is the first report of selenolate-protected Au18 nanoclusters. Future theoretical and X-ray crystallographic work will reveal the geometric structure and the nature of selenolate-gold bonding in the nanocluster.

  4. Laser-assisted atom probe tomography investigation of magnetic FePt nanoclusters: First experiments

    Energy Technology Data Exchange (ETDEWEB)

    Folcke, E.; Larde, R. [Groupe de Physique des Materiaux, UMR CNRS 6634, Universite de Rouen, 76801 Saint Etienne du Rouvray (France); Le Breton, J.M., E-mail: jean-marie.lebreton@univ-rouen.fr [Groupe de Physique des Materiaux, UMR CNRS 6634, Universite de Rouen, 76801 Saint Etienne du Rouvray (France); Gruber, M.; Vurpillot, F. [Groupe de Physique des Materiaux, UMR CNRS 6634, Universite de Rouen, 76801 Saint Etienne du Rouvray (France); Shield, J.E.; Rui, X. [Department of Mechanical and Materials Engineering, Nebraska Center for Materials and Nanoscience, University of Nebraska, N104 WSEC, Lincoln, NE 68588 (United States); Patterson, M.M. [Department of Physics, University of Wisconsin-Stout, Menomonie, WI 54751 (United States)

    2012-03-15

    Highlights: Black-Right-Pointing-Pointer FePt nanoclusters dispersed in a Cr matrix were studied by atom probe tomography. Black-Right-Pointing-Pointer Simulated experiments were conducted to study the artefacts of the analysis. Black-Right-Pointing-Pointer In FePt nanoclusters, Fe and Pt are present in equiatomic proportions. Black-Right-Pointing-Pointer FePt nanoclusters are homogeneous, no core-shell structure is observed. - Abstract: FePt nanoclusters dispersed in a Cr matrix have been investigated by laser-assisted atom probe tomography. The results were analysed according to simulated evaporation experiments. Three-dimensional (3D) reconstructions reveal the presence of nanoclusters roughly spherical in shape, with a size in good agreement with previous transmission electron microscopy observations. Some clusters appear to be broken up after the evaporation process due to the fact that the Cr matrix has a lower evaporation field than Fe and Pt. It is thus shown that the observed FePt nanoclusters are chemically homogeneous. They contain Fe and Pt in equiatomic proportions, with no core-shell structure observed.

  5. Kinetically controlled synthesis of Au102(SPh)44 nanoclusters and catalytic application.

    Science.gov (United States)

    Chen, Yongdong; Wang, Jin; Liu, Chao; Li, Zhimin; Li, Gao

    2016-05-21

    We here explore a kinetically controlled synthetic protocol for preparing solvent-solvable Au102(SPh)44 nanoclusters which are isolated from polydispersed gold nanoclusters by solvent extraction and size exclusion chromatography (SEC). The as-obtained Au102(SPh)44 nanoclusters are determined by matrix-assisted laser desorption ionization (MALDI) and electrospray ionization (ESI) mass spectrometry, in conjunction with UV-vis spectroscopy and thermogravimetric analysis (TGA). However, Au99(SPh)42, instead of Au102(SPh)44, is yielded when the polydispersed gold nanoclusters are etched in the presence of excess thiophenol under thermal conditions (e.g., 80 °C). Interestingly, the Au102(SPh)44 nanoclusters also can convert to Au99(SPh)42 with equivalent thiophenol ligands, evidenced by the analyses of UV-vis and MALDI mass spectrometry. Finally, the TiO2-supported Au102(SPh)44 nanocluster catalyst is investigated in the selective oxidation of sulfides into sulfoxides by the PhIO oxidant and gives rise to high catalytic activity (e.g., 80-99% conversion of R-S-R' sulfides with 96-99% selectivity for R-S([double bond, length as m-dash]O)-R' sulfoxides). The Au102(SPh)44/TiO2 catalyst also shows excellent recyclability in the sulfoxidation process. PMID:26758553

  6. Energetic Study of Helium Cluster Nucleation and Growth in 14YWT through First Principles

    Directory of Open Access Journals (Sweden)

    Yingye Gan

    2016-01-01

    Full Text Available First principles calculations have been performed to energetically investigate the helium cluster nucleation, formation and growth behavior in the nano-structured ferritic alloy 14YWT. The helium displays strong affinity to the oxygen:vacancy (O:Vac pair. By investigating various local environments of the vacancy, we find that the energy cost for He cluster growth increases with the appearance of solutes in the reference unit. He atom tends to join the He cluster in the directions away from the solute atoms. Meanwhile, the He cluster tends to expand in the directions away from the solute atoms. A growth criterion is proposed based on the elastic instability strain of the perfect iron lattice in order to determine the maximum number of He atoms at the vacancy site. We find that up to seven He atoms can be trapped at a single vacancy. However, it is reduced to five if the vacancy is pre-occupied by an oxygen atom. Furthermore, the solute atoms within nanoclusters, such as Ti and Y, will greatly limit the growth of the He cluster. A migration energy barrier study is performed to discuss the reduced mobility of the He atom/He cluster in 14YWT.

  7. Assembly, Structure and Properties of DNA Programmable Nanoclusters

    Science.gov (United States)

    Chi, Cheng

    Finite size nanoclusters can be viewed as a nanoscale analogue of molecules. Just as molecules, synthesized from atoms, give access to new properties, clusters composed of nanoparticles modulate of their functional properties of nanoparticles. In contrast to synthetic chemistry which is a mature field, the creation of nanoscale clusters with well-defined architectures is a new and challenging area of research. My work explores how to assemble model systems of nanoclusters using DNA-programmable interparticle linkages. The simplest clusters of two particles, dimers, allow one to investigate fundamental effects in these systems. Such clusters serve as a versatile platform to understand DNA-mediated interactions, especially in the non-trivial regime where the nanoparticle and DNA chains are comparable in size. I systematically studied a few fundamental questions as follows: Firstly, we examined the structure of nanoparticle dimers in detail by a combination of X-ray scattering experiments and molecular simulations. We found that, for a given DNA length, the interparticle separation within the dimer is controlled primarily by the number of linking DNA. We summarized our findings in a simple model that captures the interplay of the number of DNA bridges, their length, the particle's curvature and the excluded volume effects. We demonstrated the applicability of the model to our results, without any free parameters. As a consequence, the increase of dimer separation with increasing temperature can be understood as a result of changing the number of connecting DNA. Later, we investigated the self-assembly process of DNA-functionalized particles in the presence of various lengths of the DNA linkage strands using 3 different pathways. We observed a high yield of dimer formation when significantly long linkers were applied. Small Angle X-ray Scattering revealed two configurations of the small clusters by different pathways. In one case, the interparticle distance increases

  8. Si nanocluster growth using a digital gas-feeding method in the LPCVD system and its charge storage effect

    International Nuclear Information System (INIS)

    The density and size of Si nanoclusters were controlled by using a newly suggested digital gas-feeding method with Si2H6 source gas in a low pressure chemical vapor deposition system. The density of the Si nanoclusters increased and the size slightly changed based on the frequency of gas pulse feeding in the digital process. A new process was used in the fabrication of the Si nanocluster floating gate memory structures, which allowed the maximum program window of 6 V to be achieved. It was also found that the program window could be easily controlled through the frequency of gas pulse feeding in the Si nanocluster formation

  9. The ice nucleation activity of extremophilic algae.

    Science.gov (United States)

    Kviderova, Jana; Hajek, Josef; Worland, Roger M

    2013-01-01

    Differences in the level of cold acclimation and cryoprotection estimated as ice nucleation activity in snow algae (Chlamydomonas cf. nivalis and Chloromonas nivalis), lichen symbiotic algae (Trebouxia asymmetrica, Trebouxia erici and Trebouxia glomerata), and a mesophilic strain (Chlamydomonas reinhardti) were evaluated. Ice nucleation activity was measured using the freezing droplet method. Measurements were performed using suspensions of cells of A750 (absorbance at 750 nm) ~ 1, 0.1, 0.01 and 0.001 dilutions for each strain. The algae had lower ice nucleation activity, with the exception of Chloromonas nivalis contaminated by bacteria. The supercooling points of the snow algae were higher than those of lichen photobionts. The supercooling points of both, mesophilic and snow Chlamydomonas strains were similar. The lower freezing temperatures of the lichen algae may reflect either the more extreme and more variable environmental conditions of the original localities or the different cellular structure of the strains examined. PMID:23625082

  10. Nucleation in an ultra low ionization environment

    DEFF Research Database (Denmark)

    Pedersen, Jens Olaf Pepke; Enghoff, Martin Andreas Bødker; Paling, Sean;

    Atmospheric ions can enhance the nucleation of aerosols, as has been established by experiments, observation, and theory. In the clean marine atmosphere ionization is mainly caused by cosmic rays which in turn are controlled by the activity of the Sun, thus providing a potential link between solar...... Underground Laboratory, located 1100 meters below ground, thus reducing the flux of ionizing cosmic radiation by six orders of magnitude. Similarly we have reduced the gamma background by shielding the experiment in lead and copper. Finally we have used air stored for several weeks and passed through an...... active charcoal filter in order to reduce the Radon concentration. In this way we have been able to make nucleation experiments with very low ionizing background, meaning that we can rule out ion induced nucleation as a contributing mechanism. Our experimental setup is a 50 L electropolished stainless...

  11. Trapping crystal nucleation of cholesterol monohydrate

    DEFF Research Database (Denmark)

    Solomonov, I.; Weygand, M.J.; Kjær, K.; Rapaport, H.; Leiserowitz, L.

    2005-01-01

    Crystalline nucleation of cholesterol at the air-water interface has been studied via grazing incidence x-ray diffraction using synchrotron radiation. The various stages of cholesterol molecular assembly from monolayer to three bilayers incorporating interleaving hydrogen-bonded water layers in a...... least initially, an intralayer cholesterol rearrangement in a single-crystal-to-single-crystal transition. The preferred nucleation of the monoclinic phase of cholesterol . H2O followed by transformation to the stable monohydrate phase may be associated with an energetically more stable cholesterol...... bilayer arrangement of the former and a more favorable hydrogen-bonding arrangement of the latter. The relevance of this nucleation process of cholesterol monohydrate to pathological crystallization of cholesterol from cell biomembranes is discussed....

  12. Nucleation and structural growth of cluster crystals

    CERN Document Server

    Leitold, Christian

    2016-01-01

    We study the nucleation of crystalline cluster phases in the generalized exponential model with exponent n=4. Due to the finite value of this pair potential for zero separation, at high densities the system forms cluster crystals with multiply occupied lattice sites. Here, we investigate the microscopic mechanisms that lead to the formation of cluster crystals from a supercooled liquid in the low-temperature region of the phase diagram. Using molecular dynamics and umbrella sampling, we calculate the free energy as a function of the size of the largest crystalline nucleus in the system, and compare our results with predictions from classical nucleation theory. Employing bond-order parameters based on a Voronoi tessellation to distinguish different crystal structures, we analyze the average composition of crystalline nuclei. We find that even for conditions where a multiply-occupied fcc crystal is the thermodynamically stable phase, the nucleation into bcc cluster crystals is strongly preferred. Furthermore, w...

  13. Liquid Nucleation at Superheated Grain Boundaries

    Science.gov (United States)

    Frolov, T.; Mishin, Y.

    2011-04-01

    Grain boundaries with relatively low energies can be superheated above the melting temperature and eventually melt by heterogeneous nucleation of liquid droplets. We propose a thermodynamic model of this process based on the sharp-interface approximation with a disjoining potential. The distinct feature of the model is its ability to predict the shape and size of the critical nucleus by using a variational approach. The model reduces to the classical nucleation theory in the limit of large nuclei but is more general and remains valid for small nuclei. Contrary to the classical nucleation theory, the model predicts the existence of a critical temperature of superheating and offers a simple formula for its calculation. The model is tested against molecular dynamic simulations in which liquid nuclei at a superheated boundary were obtained by an adiabatic trapping procedure. The simulation results demonstrate a reassuring consistency with the model.

  14. The AGS CNI polarimeter

    International Nuclear Information System (INIS)

    A new polarimeter is being installed in the Brookhaven AGS, based on the successful proton-carbon polarimeters in RHIC. The polarimeter will measure the left-right asymmetry for proton-carbon elastic scattering in the Coulomb-nuclear interference (CNI) region, for vertically polarized protons in the AGS. The polarimeter offers a much higher figure of merit than the existing AGS polarimeter which is based on larger angle proton-proton elastic scattering. We expect to measure the polarization in the AGS with a single or a few acceleration cycles. We also plan to measure the polarization in 2 ms bins during the AGS acceleration ramp. Multiple ramps will be necessary, probably over 30 minutes to an hour

  15. AGS experiments: 1993 - 1994 - 1995

    Energy Technology Data Exchange (ETDEWEB)

    Depken, J.C.

    1996-04-01

    This report contains: FY 1995 AGS Schedule as Run; FY 1996-97 AGE Schedule (working copy); AGS Beams 1995; AGS Experimental Area FY 1993 Physics Program; AGS Experimental Area FY 1994 Physics Program; AGS Experimental Area FY 1995 Physics Program; AGS Experimental Area FY 1996 Physics Program (In progress); A listing of experiments by number; Two-page summaries of each experiment begin here, also ordered by number; Listing of publications of AGS experiments begins here; and Listing of AGS experimenters begins here. This is the twelfth edition.

  16. AGS experiments: 1993 - 1994 - 1995

    International Nuclear Information System (INIS)

    This report contains: FY 1995 AGS Schedule as Run; FY 1996-97 AGE Schedule (working copy); AGS Beams 1995; AGS Experimental Area FY 1993 Physics Program; AGS Experimental Area FY 1994 Physics Program; AGS Experimental Area FY 1995 Physics Program; AGS Experimental Area FY 1996 Physics Program (In progress); A listing of experiments by number; Two-page summaries of each experiment begin here, also ordered by number; Listing of publications of AGS experiments begins here; and Listing of AGS experimenters begins here. This is the twelfth edition

  17. Cavitation Bubble Nucleation by Energetic Particles

    Energy Technology Data Exchange (ETDEWEB)

    West, C.D.

    1998-12-01

    In the early sixties, experimental measurements using a bubble chamber confirmed quantitatively the thermal spike theory of bubble nucleation by energetic particles: the energy of the slow, heavy alpha decay recoils used in those experiments matched the calculated bubble nucleation energy to within a few percent. It was a triumph, but was soon to be followed by a puzzle. Within a couple of years, experiments on similar liquids, but well below their normal boiling points, placed under tensile stress showed that the calculated bubble nucleation energy was an order of magnitude less than the recoil energy. Why should the theory work so well in the one case and so badly in the other? How did the liquid, or the recoil particle, "know" the difference between the two experiments? Another mathematical model of the same physical process, introduced in 1967, showed qualitatively why different analyses would be needed for liquids with high and low vapor pressures under positive or negative pressures. But, the quantitative agreement between the calculated nucleation energy and the recoil energy was still poor--the former being smaller by a factor of two to three. In this report, the 1967 analysis is extended and refined: the qualitative understanding of the difference between positive and negative pressure nucleation, "boiling" and "cavitation" respectively, is retained, and agreement between the negative pressure calculated to be needed for nucleation and the energy calculated to be available is much improved. A plot of the calculated negative pressure needed to induce bubble formation against the measured value now has a slope of 1.0, although there is still considerable scatter in the individual points.

  18. Transformation of truncated gold octahedrons into triangular nanoprisms through the heterogeneous nucleation of silver

    Science.gov (United States)

    Gilroy, K. D.; Sundar, A.; Hajfathalian, M.; Yaghoubzade, A.; Tan, T.; Sil, D.; Borguet, E.; Hughes, R. A.; Neretina, S.

    2015-04-01

    Described is a straightforward procedure for forming organized substrate-immobilized nanoprisms which are single crystalline, surfactant-free and which form a heteroepitaxial relationship with the underlying substrate. The devised route utilizes truncated Au octahedrons formed through solid state dewetting techniques as high temperature heterogeneous nucleation sites for Ag adatoms which are arriving to the substrate surface in the vapour phase. Observed is a morphological and compositional transformation of the Au structures to triangular nanoprisms comprised of a homogeneous AuAg alloy. During this transformation, the localized surface plasmon resonance red-shifts, broadens and increases in strength. The shape transformation, which cannot be rationalized using thermodynamic arguments dependent on the surface energy minimization, is described in terms of a kinetically driven growth mode, previously predicted by molecular dynamic simulations. The so-formed structures, when coated with a thin layer of Pd, are demonstrated as plasmonic sensing elements for hydrogen detection.Described is a straightforward procedure for forming organized substrate-immobilized nanoprisms which are single crystalline, surfactant-free and which form a heteroepitaxial relationship with the underlying substrate. The devised route utilizes truncated Au octahedrons formed through solid state dewetting techniques as high temperature heterogeneous nucleation sites for Ag adatoms which are arriving to the substrate surface in the vapour phase. Observed is a morphological and compositional transformation of the Au structures to triangular nanoprisms comprised of a homogeneous AuAg alloy. During this transformation, the localized surface plasmon resonance red-shifts, broadens and increases in strength. The shape transformation, which cannot be rationalized using thermodynamic arguments dependent on the surface energy minimization, is described in terms of a kinetically driven growth mode

  19. Simultaneous expression and transportation of insulin by supramolecular polysaccharide nanocluster

    Science.gov (United States)

    Zhang, Yu-Hui; Zhang, Ying-Ming; Zhao, Qi-Hui; Liu, Yu

    2016-03-01

    Drug/gene transportation systems with stimuli-responsive release behaviors are becoming research hotspots in biochemical and biomedical fields. In this work, a glucose-responsive supramolecular nanocluster was successfully constructed by the intermolecular complexation of phenylboronic acid modified β-cyclodextrin with adamantane modified polyethylenimine, which could be used as a biocompatible carrier for insulin and pCMV3-C-GFPSpark-Ins DNA which could express insulin co-delivery. Benefiting from the response capability of phenylboronic acid moiety toward glucose, the encapsulated insulin could be specifically released and the corresponding targeted DNA could efficiently express insulin in HepG2 cell, accompanied by the high-level insulin release in vitro. Our results demonstrate that the simultaneous insulin drug delivery and insulin gene transfection in a controlled mode may have great potential in the clinical diabetes treatments.

  20. Nucleation and characterization of hydroxyapatite on thioglycolic acid-capped reduced graphene oxide/silver nanoparticles in simplified simulated body fluid

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Jun; Zhang, Zhaochun, E-mail: zhangzhaochun@shu.edu.cn; Yu, Zhenwei; He, Zhenni; Yang, Shanshan; Jiang, Huiyi

    2014-01-15

    Herein hydroxyapatite (HA) has been synthesized by the nucleation on the surfaces of reduced graphene oxide/silver nanoparticles (rGO/AgNPs) chemisorbed with thioglycolic acid (TGA). The self-assembled monolayer of TGA formed on rGO/AgNPs was immersed in simplified simulated body fluid under gentle growth conditions, forming rGO/AgNPs/TGA/HA biocomposite. The phase structures and functional groups of biocomposite were analyzed by X-ray diffraction spectroscopy, Fourier transform infrared spectroscopy and Raman spectroscopy. Enhanced Raman spectrum of TGA on prepared rGO/AgNPs was obtained with excitation at 633 nm, showing that TGA was chemisorbed on AgNPs through S atom and TGA molecular plane exhibited a tilted orientation with respect to AgNPs. The morphologies of biocomposite were investigated by means of atomic force microscope and transmission electron microscope coupled with energy dispersive spectrum. Analysis shows that the AgNPs uniformly distributed on the rGO nanosheets with the size of about 15–20 nm and HA formation initiated through Ca{sup 2+}-adsorption upon complexation with -COO{sup −} groups of TGA on AgNPs. The results obtained indicated that the rGO/AgNPs/TGA/HA biocomposite may have immense potential application in bone tissue engineering fields for its outstanding and stable activities.

  1. Nucleation and characterization of hydroxyapatite on thioglycolic acid-capped reduced graphene oxide/silver nanoparticles in simplified simulated body fluid

    International Nuclear Information System (INIS)

    Herein hydroxyapatite (HA) has been synthesized by the nucleation on the surfaces of reduced graphene oxide/silver nanoparticles (rGO/AgNPs) chemisorbed with thioglycolic acid (TGA). The self-assembled monolayer of TGA formed on rGO/AgNPs was immersed in simplified simulated body fluid under gentle growth conditions, forming rGO/AgNPs/TGA/HA biocomposite. The phase structures and functional groups of biocomposite were analyzed by X-ray diffraction spectroscopy, Fourier transform infrared spectroscopy and Raman spectroscopy. Enhanced Raman spectrum of TGA on prepared rGO/AgNPs was obtained with excitation at 633 nm, showing that TGA was chemisorbed on AgNPs through S atom and TGA molecular plane exhibited a tilted orientation with respect to AgNPs. The morphologies of biocomposite were investigated by means of atomic force microscope and transmission electron microscope coupled with energy dispersive spectrum. Analysis shows that the AgNPs uniformly distributed on the rGO nanosheets with the size of about 15–20 nm and HA formation initiated through Ca2+-adsorption upon complexation with -COO− groups of TGA on AgNPs. The results obtained indicated that the rGO/AgNPs/TGA/HA biocomposite may have immense potential application in bone tissue engineering fields for its outstanding and stable activities.

  2. Nucleation and crystallization of Ca doped basaltic glass for the production of a glass-ceramic material

    Science.gov (United States)

    Tarrago, Mariona; Royo, Irene; Garcia-Valles, Maite; Martínez, Salvador

    2016-04-01

    Sewage sludge from wastewater treatment plants is a waste with a composition roughly similar to that of a basalt. It may contain potentially toxic elements that can be inertized by vitrification. Using a glass-ceramic process, these elements will be emplaced in newly formed mineral phases. Glass-ceramic production requires an accurate knowledge of the temperatures of nucleation (TN) and crystal growth of the corresponding minerals. This work arises from the study of the addition of ions to a basaltic matrix in order to establish a model of vitrification of sewage sludge. In this case a glass-ceramic is obtained from a glass made with a basalt that has been doped with 16% CaO. Two glasses which underwent different cooling processes have been produced and compared. The first was annealed at 650oC (AG) and the second was quenched (QG). The chemical composition of the glasses is SiO2 36.11 wt%, Al2O312.19 wt%, CaO 24.44 wt%, FeO 10.06 wt%, MgO 9.19 wt%, Na2O 2.28 wt%, TiO2 2.02 wt%, K2O 1.12 wt%, P2O5 0.46 wt%. Glass transition temperature obtained by dilatometry varies from 640 oC (AG) to 700 oC (QG). The temperatures of nucleation and crystal growth of the glass have been determined by Differential Thermal Analysis (DTA). The phases formed after these treatments were identified by X-Ray Diffraction. The temperatures of exothermic and endothermic peaks measured in the quenched glass are, in average, 10 oC higher than those found for the annealed glass. The exothermic peaks provide crystallization temperatures for different phases: a first event at 857 oC corresponds to the growth of magnetite, pyroxene and nepheline, whereas a second event at 1030 oC is due to the crystallization of melilite from the reaction between previous minerals and a remaining amorphous phase. The complete melting of this system occurs at 1201 oC. This glass has been nucleated inside the DTA furnace (500-850° C/3 hours) and then heated up to 1300 oC using the fraction between 400-500μm. TN

  3. Unraveling a generic growth pattern in structure evolution of thiolate-protected gold nanoclusters

    Science.gov (United States)

    Xu, Wen Wu; Li, Yadong; Gao, Yi; Zeng, Xiao Cheng

    2016-03-01

    Precise control of the growth of thiolate-protected gold nanoclusters is a prerequisite for their applications in catalysis and bioengineering. Here, we bring to bear a new series of thiolate-protected nanoclusters with a unique growth pattern, i.e., Au20(SR)16, Au28(SR)20, Au36(SR)24, Au44(SR)28, and Au52(SR)32. These nanoclusters can be viewed as resulting from the stepwise addition of a common structural motif [Au8(SR)4]. The highly negative values of the nucleus-independent chemical shift (NICS) in the center of the tetrahedral Au4 units suggest that the overall stabilities of these clusters stem from the local stability of each tetrahedral Au4 unit. Generalization of this growth-pattern rule to large-sized nanoclusters allows us to identify the structures of three new thiolate-protected nanoclusters, namely, Au60(SR)36, Au68(SR)40, and Au76(SR)44. Remarkably, all three large-sized nanoclusters possess relatively large HOMO-LUMO gaps and negative NICS values, suggesting their high chemical stability. Further extension of the growth-pattern rule to the infinitely long nanowire limit results in a one-dimensional (1D) thiolate-protected gold nanowire (RS-AuNW) with a band gap of 0.78 eV. Such a unique growth-pattern rule offers a guide for precise synthesis of a new class of large-sized thiolate-protected gold nanoclusters or even RS-AuNW which, to our knowledge, has not been reported in the literature.Precise control of the growth of thiolate-protected gold nanoclusters is a prerequisite for their applications in catalysis and bioengineering. Here, we bring to bear a new series of thiolate-protected nanoclusters with a unique growth pattern, i.e., Au20(SR)16, Au28(SR)20, Au36(SR)24, Au44(SR)28, and Au52(SR)32. These nanoclusters can be viewed as resulting from the stepwise addition of a common structural motif [Au8(SR)4]. The highly negative values of the nucleus-independent chemical shift (NICS) in the center of the tetrahedral Au4 units suggest that the overall

  4. Stress-induced thickening of Ω phase in Al–Cu–Mg alloys containing various Ag additions

    International Nuclear Information System (INIS)

    The thickening of Ω phase in Al–Cu–Mg alloys containing various bulk Ag contents during stress aging at 200 °C with a tensile stress of 240 MPa was investigated by a combination of transmission electron microscopy (TEM), high resolution transmission electron microscopy (HRTEM) and atom probe tomography (APT). TEM characterization confirmed preferred orientation of Ω phase in all stress-aged samples. Corresponding quantitative TEM calculations revealed the thickening kinetics of Ω phase was significantly accelerated during stress aging as compared to that during stress-free aging at 200 °C. HRTEM analysis on the α/Ω interfacial structure confirmed that the applied tensile stress facilitated the rapid nucleation of the growth ledge on the broad face of Ω phase, thereby resulting in the accelerated plate thickening during stress aging at 200 °C. Meanwhile, quantitative TEM analysis highlighted the stress-induced thickening of Ω phase at 200 °C was affected by the bulk Ag content. This was consistent with the HRTEM observation as the ledge nucleation was found to be suppressed with increasing Ag addition. Our APT analysis on different stress-aged samples further suggested the progressive enrichment of Ag atoms in the segregation layer helped to stabilize the interfacial structure and was responsible for the lowest nucleation rate of the ledge in 1.77Ag alloy as compared to that in 0.46Ag alloy

  5. Effects of graphene defects on Co cluster nucleation and intercalation

    International Nuclear Information System (INIS)

    Four kinds of defects are observed in graphene grown on Ru (0001) surfaces. After cobalt deposition at room temperature, the cobalt nanoclusters are preferentially located at the defect position. By annealing at 530°C, cobalt atoms intercalate at the interface of Graphene/Ru (0001) through the defects. Further deposition and annealing increase the sizes of intercalated Co islands. This provides a method of controlling the arrangement of cobalt nanoclusters and also the density and the sizes of intercalated cobalt islands, which would find potential applications in catalysis industries, magnetism storage, and magnetism control in future information technology. (interdisciplinary physics and related areas of science and technology)

  6. Effects of clustered nucleation on recrystallization

    DEFF Research Database (Denmark)

    Storm, Søren; Juul Jensen, Dorte

    2009-01-01

    experimentally observed clustering is not very strong, it changes the kinetics and the recrystallized microstructural morphology plus leads to a recrystallized grain size distribution, which is significantly broadened compared to that of random nucleation simulations. (C) 2009 Published by Elsevier Ltd. on...

  7. Nucleation theory and growth of nanostructures

    CERN Document Server

    Dubrovskii, Vladimir G

    2013-01-01

    Semiconductor nanostructures such as nanowires are promising building blocks of future nanoelectronic, nanophotonic and nanosensing devices. Their physical properties are primarily determined by the epitaxy process which is rather different from the conventional thin film growth. This book shows how the advanced nucleation theory can be used in modeling of growth properties, morphology and crystal phase of such nanostructures.

  8. The ice nucleation activity of extremophilic algae

    Czech Academy of Sciences Publication Activity Database

    Kvíderová, Jana; Hájek, J.; Worland, M. R.

    2013-01-01

    Roč. 34, č. 2 (2013), s. 137-148. ISSN 0143-2044 R&D Projects: GA AV ČR KJB601630808; GA AV ČR KJB600050708 Institutional support: RVO:67985939 Keywords : Ice nucleation * snow algae * lichen photobionts Subject RIV: EF - Botanics Impact factor: 0.640, year: 2013

  9. NUCLEATION STUDIES OF GOLD ON CARBON ELECTRODES

    Directory of Open Access Journals (Sweden)

    S. SOBRI

    2008-04-01

    Full Text Available Interest has grown in developing non-toxic electrolytes for gold electrodeposition to replace the conventional cyanide-based bath for long term sustainability of gold electroplating. A solution containing thiosulphate and sulphite has been developed specially for microelectronics applications. However, at the end of the electrodeposition process, the spent electrolyte can contain a significant amount of gold in solution. This study has been initiated to investigate the feasibility of gold recovery from a spent thiosulphate-sulphite electrolyte. We have used flat-plate glassy carbon and graphite electrodes to study the mechanism of nucleation and crystal growth of gold deposition from the spent electrolyte. It was found that at the early stages of reduction process, the deposition of gold on glassy carbon exhibits an instantaneous nucleation of non-overlapping particles. At longer times, the particles begin to overlap and the deposition follows a classic progressive nucleation phenomenon. On the other hand, deposition of gold on graphite does not follow the classical nucleation phenomena.

  10. Nucleation modes in sharp concentration gradients

    Energy Technology Data Exchange (ETDEWEB)

    Hodaj, F.; Desre, P.J. [LTPCM-UMR CNRS/INPG/UJF, Saint Martin d`Heres (France); Gusak, A.M.; Kovalchuk, A.O. [Cherkassy State Univ. (Ukraine). Dept. of Theoretical Physics

    1998-12-31

    Reaction kinetics in bimetallic multilayers have demonstrated that sharp unidirectional concentration gradient, which develop as interdiffusion proceeds at the interface are able to delay or to suppress nucleation of intermetallics. It has been found that the existence of a critical gradient beyond which nucleation is inhibited is strongly dependent on the mechanism of formation of the embryo. A mechanism of nucleation under concentration gradient ({gradient}c) is proposed and treated on the basis of the Fokker-Planck equation for the distribution in the size space. The influence of the aspect ratio of the embryo on the critical concentration gradient is also studied. Due to the fluctuations of the embryo shape, it is shown that the minimization of the thermodynamic potential leading to the aspect ratio of the embryo is only significant beyond a certain value of the concentration gradient. Application is presented to the nucleation of the compound Ni{sub 10}Zr{sub 7} in an amorphous layer Ni-Zr.

  11. Heterogeneous nucleation of aspartame from aqueous solutions

    Science.gov (United States)

    Kubota, Noriaki; Kinno, Hiroaki; Shimizu, Kenji

    1990-03-01

    Waiting times, the time from the instant of quenching needed for a first nucleus to appear, were measured at constant supercoolings for primary nucleation of aspartame (α-L-aspartyl-L-phenylalanine methylester) from aqueous solutions, which were sealed into glass ampoules (solution volume = 3.16 cm 3). Since the waiting time became shorter by filtering the solution prior to quenching, the nucleation was concluded to be heterogeneously induced. The measured waiting time consisted of two parts: time needed for the nucleus to grow to a detactable size (growth time) and stochastic time needed for nucleation (true waiting time). The distribution of the true waiting time, is well explained by a stochastic model, in which nucleation is regarded to occur heterogeneously and in a stochastic manner by two kinds of active sites. The active sites are estimated to be located on foreign particles in which such elements as Si, Al and Mg were contained. The amount of each element is very small in the order of magnitude of ppb (mass basis) of the whole solution. The growth time was correlated with the degree of supercooling.

  12. Binary nucleation of water and sodium chloride

    Czech Academy of Sciences Publication Activity Database

    Němec, Tomáš; Maršík, František; Palmer, A.

    2006-01-01

    Roč. 124, č. 4 (2006), 0445091-0445096. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA101/05/2536 Institutional research plan: CEZ:AV0Z20760514 Keywords : binary nucleation * sodium chloride * water Subject RIV: BJ - Thermodynamics Impact factor: 3.166, year: 2006

  13. Ion-Induced Nucleation of Cesium Vapor

    Czech Academy of Sciences Publication Activity Database

    Uchtmann, H.; Katz, J. L.; Ždímal, Vladimír

    Vol. 2. Budapest, 2004, S103-S104. [European Aerosol Conference EAC 2004. Budapest (HU), 06.09.2004-10.09.2004] Grant ostatní: NATO(XX) SA979351/6993/FP Institutional research plan: CEZ:AV0Z4072921 Keywords : fundamental aerosol physics * ion-induced nucleation Subject RIV: CF - Physical ; Theoretical Chemistry

  14. Atmospheric Measurements of Neutral Nucleating Clusters (Invited)

    Science.gov (United States)

    Zhao, J.; Eisele, F. L.; Smith, J. N.; Chen, M.; Jiang, J.; Kuang, C.; McMurry, P. H.

    2010-12-01

    Nanoparticles produced by nucleation can subsequently grow to cloud condensation nuclei (CCN) within one or two days and hence affect cloud formation, precipitation, and atmospheric radiation budgets. As an intermediate stage between molecules and nanoparticles, neutral molecular clusters are believed to play an important role in processes that lead to boundary layer nucleation. Therefore, knowledge of chemical composition, concentrations, thermodynamic properties, and evolution of neutral molecular clusters is essential to better elucidate the nucleation mechanism and to reduce the uncertainty in nucleation rates used in global climate models. Here we present laboratory and field measurements from a recently developed chemical ionization mass spectrometer (the Cluster-CIMS) designed to measure atmospheric neutral clusters (Zhao et al., 2010). The sensitivity of the Cluster-CIMS was significantly improved by using a unique conical octopole device in the first vacuum stage for transmitting and focusing ions, which was further confirmed by ion trajectory simulations using SIMION. The ion cluster formation in the atmospheric-pressure inlet was controlled by two processes: neutral ionization and ion-induced clustering (IIC), which can be differentiated from the time independency of the intensity ratio between the cluster and monomer ions. Two methods were employed to separate neutral clusters from the ion-induced clustering. The concentrations and distribution of the neutral nucleating clusters containing up to 4 H2SO4 are estimated from the above methods at three measurement sites in the US (NCAR foothill laboratory, Manitou Forest Observatory, and Atlanta). Typically, the molecular cluster concentrations are well correlated with the concentrations of nanoparticles measured simultaneously during the nucleation event periods. The Cluster-CIMS was employed to measure clusters containing both sulfuric acid and amines in summer 2010 at NCAR foothill laboratory

  15. High-yield clicking and dissociation of doxorubicin nanoclusters exhibiting differential cellular uptakes and imaging.

    Science.gov (United States)

    Kim, Hye Sung; Yoon, Sujin; Son, Young Ju; Park, Yeonju; Jung, Young Mee; Yoo, Hyuk Sang

    2015-11-10

    Gold nanoparticles (AuNPs) and quantum dots (Qdots) were clicked into doxorubicin nanoclusters that showed enzyme-dependent dissociation behaviors for differential cellular uptakes and imaging. The AuNPs were co-functionalized with doxorubicin (DOX) and azide-terminated polymer (DOX/azide@AuNP), while an enzyme-cleavable peptide and alkyne-terminated polymer were sequentially conjugated on Qdot surface (Alkyne-MMP@Qdot). Fourier transform infrared spectroscopy (FTIR), Raman spectroscopy, and fluorescence imaging detected the azide and alkyne groups on DOX/azide@AuNP and Alkyne-MMP@Qdot, respectively, and the click-reactivity was also confirmed. In the presence of the catalyst, two nanoparticles were clicked to doxorubicin nanoclusters, which increased the volume of the particles ca. 343-fold within 30min. Upon matrix metalloproteinase-2 (MMP-2) digestion, the nanoclusters were clearly dissociated into smaller particles, and the fluorescence of the quenched Qdot was also recovered, which suggests that the nanoclusters respond to MMP-2 concentrations and can thus be employed for cancer imaging. Confocal microscopy and an elemental analysis of the cancer cells revealed that the cellular uptakes of doxorubicin nanoclusters significantly increased at higher MMP-2 concentrations, and doxorubicin could also be cleaved for anti-cancer effects. In vivo and in vitro cytotoxicity assay accordingly showed that the cytotoxicity of doxorubicin nanoclusters against cancer cells increased in MMP-2-rich environments such as tumor site. Thus, these nanoclusters containing DOX/azide@AuNP and Alkyne-MMP@Qdot are expected to be multifunctional carriers for targeted anti-cancer treatments and imaging. PMID:26315815

  16. Coating of hydroxyapatite doped Ag on commercially pure titanium surface

    International Nuclear Information System (INIS)

    This paper presents results of bioactive coating on commercially pure titanium surface (CpTi) doped with Ag ions. The coating consists of 3 steps, in step 1- surface chemical treatment of the samples with NaOH, step 2 - immersing the substrate in question in a sodium silicate solution (SS) to the nucleation and step 3 - reimmersion these substrates in synthetic solution that simulates the blood serum for precipitation and growth of apatite layer. After the coating step the AgNO3 substrates were immersed in solutions with concentrations of 20 ppm and 100 ppm at 37 ° C for 48h. The substrates were characterized by scanning electron microscopy (SEM), infrared spectroscopy (IR) and X-ray diffraction (XRD). By the results verified the formation of an apatite layer with aspects of cells, on the surface of CpTi. The increase in Ag concentration causes an increase in Ag amount doped in apatite layer. With the results we concluded that it is possible to obtain an apatite layer on a metal surface as the CpTi doped with Ag ions

  17. In situ DNA-templated synthesis of silver nanoclusters for ultrasensitive and label-free electrochemical detection of microRNA.

    Science.gov (United States)

    Yang, Cuiyun; Shi, Kai; Dou, Baoting; Xiang, Yun; Chai, Yaqin; Yuan, Ruo

    2015-01-21

    On the basis of the use of silver nanoclusters (AgNCs) in situ synthesized by cytosine (C)-rich loop DNA templates as signal amplification labels, the development of a label-free and highly sensitive method for electrochemical detection of microRNA (miRNA-199a) is described. The target miRNA-199a hybridizes with the partial dsDNA probes to initiate the target-assisted polymerization nicking reaction (TAPNR) amplification to produce massive intermediate sequences, which can be captured on the sensing electrode by the self-assembled DNA secondary probes. These surface-captured intermediate sequences further trigger the hybridization chain reaction (HCR) amplification to form dsDNA polymers with numerous C-rich loop DNA templates on the electrode surface. DNA-templated synthesis of AgNCs can be realized by subsequent incubation of the dsDNA polymer-modified electrode with AgNO3 and sodium borohydride. With this integrated TAPNR and HCR dual amplification strategy, the amount of in situ synthesized AgNCs is dramatically enhanced, leading to substantially amplified current response for highly sensitive detection of miRNA-199a down to 0.64 fM. In addition, the developed method also shows high selectivity toward the target miRNA-199a. Featured with high sensitivity and label-free capability, the proposed sensing scheme can thus offer new opportunities for achieving sensitive, selective, and simple detection of different types of microRNA targets. PMID:25537119

  18. Homogeneous Water Nucleation in a Laminar Flow Diffusion Chamber

    Czech Academy of Sciences Publication Activity Database

    Manka, A.; Brus, David; Hyvärinen, A-P.; Lihavainen, H.; Wölk, J.; Strey, R.

    -: -, 2009, T032A02. [European Aerosol Conference 2009. Karlsruhe (DE), 06.09.2009-11.09.2009] Institutional research plan: CEZ:AV0Z40720504 Keywords : homogeneous nucleation * water * nucleation rate Subject RIV: CF - Physical ; Theoretical Chemistry

  19. Seeded Induction Period and Secondary Nucleation of Lithium Carbonate

    Institute of Scientific and Technical Information of China (English)

    SUN Yu-zhu; SONG Xing-fu; WANG Jin; LUO Yan; YU Jian-guo

    2009-01-01

    Seeded nucleation of lithinm carbonate in aqueous solution during reactive crystallization was monitored by FBRM (focused beam reflectance measurement) and PVM (particle video microscope). The impacts of operating variables, such as seed size and loading, stirring speed, on induction period and secondary nucleation were investigated and explained by an adsorption model. The results show that seed surface area plays an important role in secondary nucleation, for more surface area has higher adsorption capacity and consumes more supersaturation on seed growth, thus restrains nucleation better. A method through comparison between pure breakage/attrition and nucleation process was put forward to distinguish attrition-induced and surface-induced nucleations quantitatively, which can reveal the contributions of different nucleation mechanisms. The nucleation processes in different conditions were studied, the principles and valuable experimental data were obtained for seeding approach primarily. FBRM and PVM are useful on-line apparatuses to facilitate seed selection and seeding optimization.

  20. Interpretation of dc and ac conductivity of Ag{sub 2}O–SeO{sub 2}–MoO{sub 3} glass-nanocomposite-semiconductor

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharya, Sanjib, E-mail: sanjib_ssp@yahoo.co.in [Department of Engineering Sciences and Humanities, Siliguri Institute of Technology, Darjeeeling 734009, West Bengal (India); Kundu, Ranadip [Department of Engineering Sciences and Humanities, Siliguri Institute of Technology, Darjeeeling 734009, West Bengal (India); Department of Mechanical Engineering, Jadavpur University, Jadavpur, Kolkata 700032 (India); Das, Anindya Sundar [Department of Mechanical Engineering, Jadavpur University, Jadavpur, Kolkata 700032 (India); Department of Electronics and Communication Engineering, Regent Education and Research Foundation, Barrackpore, Kolkata 7000121 (India); Roy, Debasish [Department of Mechanical Engineering, Jadavpur University, Jadavpur, Kolkata 700032 (India)

    2015-07-15

    Highlights: • Polaron hopping. • Dc and ac conductivity. • Mott's model and Greave's model. • Ag{sub 2}MoO{sub 4}, Ag{sub 2}Mo{sub 2}O{sub 7} and Ag{sub 6}Mo{sub 10}O{sub 33} nanoparticles and SeO{sub 3} and SeO{sub 4} nanoclusters. • XRD and FESEM studies. - Abstract: A new type of semiconducting glass-nanocomposites 0.3Ag{sub 2}O–0.7 (xMoO{sub 3}–(1 − x) SeO{sub 2}) is prepared by melt-quenching route. The formation of Ag{sub 2}MoO{sub 4}, Ag{sub 2}Mo{sub 2}O{sub 7} and Ag{sub 6}Mo{sub 10}O{sub 33} nanoparticles and SeO{sub 3} and SeO{sub 4} nanoclusters in glass-nanocomposites has been confirmed from X-ray diffraction (XRD) and field emission scanning electron microscopic (FESEM) studies. Fourier transform infrared (FTIR) spectroscopy is employed to find out Se−O stretching vibration as well as stretching vibrations of Mo{sub 2}O{sub 7}{sup 2−} ions. The dc conductivity of them is studied on the light of polaron hopping approach in a wide temperature range. At low temperatures, variable range hopping model (Mott's model) is employed to analyze the conductivity data. Greave's model is used to predict temperature dependent variable range hopping in the high temperature region. Frequency dependent ac conductivity is well explained on the basis of tunneling. I–V characteristics of the as-prepared samples have also been investigated.

  1. TATTOOLING AND HBS Ag

    Directory of Open Access Journals (Sweden)

    P. Farjam

    1976-12-01

    Full Text Available To investigate the association between tattooing and hepatitis B surface antigen (HBsAg, sera form 49 tattooed individuals, mostly men aged 15-62 years, and 82 healthy controls matched for age, sex and social class were tested for HBsAg and anti-HBsAg. HBsAg was detected more significantly in tattooed cases than in controls, 24.5% and 6% respectively. Seven (33% of the individuals who had been tattooed within the preceding year, the average time between tattooing and serum collection being 18 weeks, were found to be HBsAg positive, and the predominant subtype was AWY . Anti-HBsAg was detected in %30 and %18 of the tattooed cases and controls respectively. Four of the 18 tattooed individuals and two of the five controls with a history of jaundice had abnormal liver function tests. Drug addiction was notice equally among the tattooed and control groups. Since tattooing is still popular among some population groups in Iran, public Health measures are recommended for the prevention and control of the medical hazards of tattooing, including hepatitis type B.

  2. Nucleation Characteristics in Physical Experiments/explosions

    International Nuclear Information System (INIS)

    Large-scale vapor explosion experiments have shown that intimate contact between hot and cold liquids, and a temperature upon contact that is greater than the spontaneous nucleation temperature of the system, are two necessary conditions for the onset of large scale vapor explosions. A model, based on spontaneous nucleation of the homogeneous type, has been proposed to describe the relevant processes and the resulting energetics for explosive boiling systems. The model considers that spontaneous nucleation cannot occur either during the relief time for constant volume heating or until the thermal boundary layer is sufficiently thick to support a vapor cavity of the critical size. After nucleation, bubble growth does not occur until an acoustic wave establishes a pressure gradient in the cold liquid. These considerations lead to the prediction that, for a given temperature, drops greater than a critical size will remain in film boiling due to coalescence of vapor nuclei and drops smaller than this value will wet and be captured by the hot liquid surface. These results are compared to small drop data for well-wetted systems and excellent agreement is obtained between the observed behavior and the model predictions. In conclusion: A model, based on spontaneous nucleation, has been proposed to describe vaporization potential and behavior upon contact in a liquid/liquid system. This behavior is determined by the size of the liquid mass, single-phase pressurization and acoustic relief, nucleation frequency due to random density fluctuations, the initiation of unstable growth and acoustic relief, and the development of the thermal boundary layer in the cold liquid. The proposed model predicts that the stability of a given size drop upon intimate contact with another liquid is extremely dependent upon the interface temperature. For low interface temperatures, large masses will be captured by the hot liquid and the resulting vaporization rates will be extremely low because

  3. Future topics in basic nucleation and growth research

    International Nuclear Information System (INIS)

    An adequate knowledge of nucleation and growth processes leads to the design and manufacture of thin film deposits of desired properties. Research in randon heterogeneous nucleation, epitaxial nucleation and growth, angstrom-particle chemistry, and surface replication with atomistic resolution is discussed

  4. Atmospheric nucleation: highlights of the EUCAARI project and future directions

    OpenAIRE

    V.-M. Kerminen; T. Petäjä; Manninen, H. E.; Paasonen, P.; Nieminen, T.; Sipilä, M.; Junninen, H.; M. Ehn; Gagné, S.; Laakso, L.; Riipinen, I; Vehkamäki, H.; Kurten, T.; Ortega, I.K.; Dal Maso, M.

    2010-01-01

    Within the project EUCAARI (European Integrated project on Aerosol Cloud Climate and Air Quality interactions), atmospheric nucleation was studied by (i) developing and testing new air ion and cluster spectrometers, (ii) conducting homogeneous nucleation experiments for sulphate and organic systems in the laboratory, (iii) investigating atmospheric nucleation mechanism under field conditions, and (iv) applying new theoretical and modelling tools for data interpretation and development...

  5. Visible-Light-Sensitive Photocatalysts: Nanocluster-Grafted Titanium Dioxide for Indoor Environmental Remediation.

    Science.gov (United States)

    Miyauchi, Masahiro; Irie, Hiroshi; Liu, Min; Qiu, Xiaoqing; Yu, Huogen; Sunada, Kayano; Hashimoto, Kazuhito

    2016-01-01

    Photocatalytic degradation of organic compounds requires photoexcited holes with strong oxidative power in the valence band (VB) of semiconductors. Although numerous types of doped semiconductors, such as nitrogen-doped TiO2, have been studied as visible-light-sensitive photocatalysts, the quantum yields of these materials were very low because of the limited oxidation power of holes in the nitrogen level above the VB. Recently, we developed visible-light-sensitive Cu(II) and Fe(III) nanocluster-grafted TiO2 using a facile impregnation method and demonstrated that visible-light absorption occurs at the interface between the nanoclusters and TiO2, as electrons in the VB of TiO2 are excited to the nanoclusters under visible-light irradiation. In addition, photogenerated holes in the VB of TiO2 efficiently oxidize organic contaminants, and the excited electrons that accumulate in nanoclusters facilitate the multielectron reduction of oxygen. Notably, Cu(II) and Fe(III) nanocluster-grafted TiO2 photocatalyst has the highest quantum yield among reported photocatalysts and has antiviral, self-cleaning, and air purification properties under illumination by indoor light fixtures equipped with white fluorescent bulbs or white light-emitting diodes. PMID:26654353

  6. Gold nanocluster-sensitized TiO2 nanotubes to enhance the photocatalytic hydrogen generation under visible light

    Science.gov (United States)

    Wang, Hongkai; Chen, Fuyi; Li, Weiyin; Tian, Tian

    2015-08-01

    The wide band-gap of TiO2 semiconductors hinders the photocatalytic hydrogen generation under visible light. In this research, we introduce glutathione-protected gold (Au-GSH) nanoclusters as a sensitizer to extend the active region of TiO2 up to a wavelength of 510 nm under visible light spectrum. We demonstrate that Au-GSH nanoclusters are capable of enhancing photocatalytic effects for hydrogen generation in photo-electrochemical cells (PECs). The combined effects of metal nanoclusters and sacrificial agent (EDTA) enhance the photocurrent up to six times more than what can be achieved using Au-GSH nanoclusters without EDTA. Moreover, the mechanisms of interaction between Au-GSH nanoclusters and EDTA have been investigated through instantaneous photoresponse measurements. A single electrode system has been designed to simplify PECs for hydrogen generation, which exhibits the same enhanced photocatalytic effect.

  7. Nucleation in a Sheared Liquid Binary Mixture.

    Science.gov (United States)

    Min, Kyung-Yang

    When a binary liquid mixture of lutidine plus water (LW) is quenched to a temperature T and is exposed to a continuous shear rate S, the result is a steady-state droplet distribution. This steady state can be probed by measuring the unscattered intensity I_{f}, or the scattered intensity I_{s}, as a function of delta T and S. In the experiments described here, S is fixed and delta T is varied in a step-wise fashion. The absence of hysteresis was probed in two separate experiments: First, I_{f} was measured as a function of S for a given delta T. Next, I_{f} was measured as a function of delta T for a given S. In either case, the hysteresis associated with the shear-free nucleation is absent. In addition, a flow-history dependent hysteresis was studied. In the 2-dimensional parameter space consisting of S and delta T, the onset of nucleation uniquely determines a cloud point line. A plot of the cloud point line exhibits two segments of different slopes with a cross-over near the temperature corresponding to the Becker-Doring limit. The classical picture of a free energy barrier was reformulated to explain this cross-over behavior. Next, photon correlation spectroscopy was used to study the dependence of the transient nucleation behavior on the initial states. A unique feature of this study is that this initial state can be conveniently adjusted by varying the shear rate S to which the mixture is initially exposed. The shear is then turned off, and the number density N(t), as well as the mean radius of the growing droplets, is monitored as a function of time. It was possible to measure the droplet density at a very early stage of phase separation where the nucleation rate J was close to zero. The measurement reveals that N(t) depends critically on the initial state of the metastable system. When the shear is large enough to rupture the droplets as small as the critical size, N(t) increases very slowly. Measurements of the nucleation rates vs. the square of the

  8. A new label-free fluorescent sensor for human immunodeficiency virus detection based on exonuclease III-assisted quadratic recycling amplification and DNA-scaffolded silver nanoclusters.

    Science.gov (United States)

    Yang, Wen; Tian, Jianniao; Wang, Lijun; Fu, Shui; Huang, Hongyun; Zhao, Yanchun; Zhao, Shulin

    2016-05-10

    A label-free and sensitive fluorescence biosensing platform for human immunodeficiency virus gene (HIV-DNA) detection has been fabricated based on luminescent DNA-scaffolded silver nanoclusters (DNA/AgNCs) and autonomous exonuclease III (Exo III)-assisted recycling signal amplification. One long-chain DNA (X-DNA) molecule can hybridize with two assistant DNA (F-DNA) molecules and one HIV-DNA molecule; after Exo III digests X-DNA to liberate F-DNA and HIV-DNA. F-DNA combines with P-DNA (template of DNA/AgNCs), accordingly, P-DNA is cut and the fluorescence of the system is quenched. This assay can finish in one-step without any labelling of the DNA chain or complex construction, and the strategy is sensitive with the detection limit as low as 35 pM. At the same time, the approach exhibits good selectivity even against a single base mismatch. What's more, the method is able to monitor HIV-DNA in real human serum samples; it holds great potential for early diagnosis in gene-related diseases. PMID:27053438

  9. Growth of Ag thin films on ZnO(0 0 0 -1) investigated by AES and STM

    Energy Technology Data Exchange (ETDEWEB)

    Duriau, E. [Interuniversity Microelectronic Center (IMEC), SPDT-MCA, Kapeldreef 75, B-3001 Leuven (Belgium); Agouram, S. [Dpto. Fisica Aplicada y Electromagnetismo c/Dr. Moliner no. 50, 46100 Burjassot, Valencia (Spain); Laboratoire de Physique des Materiaux Electroniques (LPME), University of Namur, Rue de Bruxelles 61, B-5000 Namur (Belgium); Morhain, C. [Centre de Recherche sur l' HeteroEpitaxie et ses Applications (CRHEA), CNRS, Rue Bernard Gregory, F-06560 Valbonne Sophia-Antipolis (France); Seldrum, T. [Laboratoire de Physique des Materiaux Electroniques (LPME), University of Namur, Rue de Bruxelles 61, B-5000 Namur (Belgium); Sporken, R. [Laboratoire de Physique des Materiaux Electroniques (LPME), University of Namur, Rue de Bruxelles 61, B-5000 Namur (Belgium); Dumont, J. [Laboratoire de Physique des Materiaux Electroniques (LPME), University of Namur, Rue de Bruxelles 61, B-5000 Namur (Belgium)]. E-mail: jacques.dumont@fundp.ac.be

    2006-11-15

    The growth of Ag films on ZnO(0 0 0 -1) has been investigated by Auger electron spectroscopy (AES) and scanning tunneling microscopy (STM). A high density of islands is nucleated at the earliest stages of the growth. An upstepping mechanism causes these islands to coalesce while the uncovered fraction of the ZnO surface remains constant (30%)

  10. How does surface wettability influence nucleate boiling?

    Science.gov (United States)

    Phan, Hai Trieu; Caney, Nadia; Marty, Philippe; Colasson, Stéphane; Gavillet, Jérôme

    2009-05-01

    Although the boiling process has been a major subject of research for several decades, its physics still remain unclear and require further investigation. This study aims at highlighting the effects of surface wettability on pool boiling heat transfer. Nanocoating techniques were used to vary the water contact angle from 20° to 110° by modifying nanoscale surface topography and chemistry. The experimental results obtained disagree with the predictions of the classical models. A new approach of nucleation mechanism is established to clarify the nexus between the surface wettability and the nucleate boiling heat transfer. In this approach, we introduce the concept of macro- and micro-contact angles to explain the observed phenomenon. To cite this article: H.T. Phan et al., C. R. Mecanique 337 (2009).

  11. Surface Nanobubble Nucleation Visualized with TIRF Microscopy

    CERN Document Server

    Chan, Chon U

    2012-01-01

    Nanobubbles are observed with optical microscopy using the total internal reflection fluorescence (TIRF) excitation. We report on TIRF visualization using Rhodamine 6G at 5$\\mu\\,$M concentration which results to strongly contrasted pictures. The preferential absorption and the high spatial resolution allow to detect nanobubbles with diameters of 230\\,nm and above. We present a study of the nucleation dynamics from the water-ethanol-water exchange and report the size distributions. Nanobubble nucleation is observed within 4 min after the exchange, later a stable population of nanobubbles with a surface density of 0.55 bubbles\\,/$\\mu$m$^2$ is formed. Interestingly, unstable, slowly dissolving nanobubbles are observed during the first stage of water-ethanol exchange; only after the ethanol-water exchange stable nanobubbles appear.

  12. Observable effects of anisotropic bubble nucleation

    CERN Document Server

    Blanco-Pillado, Jose J

    2010-01-01

    Our universe may have formed via bubble nucleation in an eternally-inflating background. Furthermore, the background may have a compact dimension--the modulus of which tunnels out of a metastable minimum during bubble nucleation--which subsequently grows to become one of our three large spatial dimensions. Then the reduced symmetry of the background is equivalent to anisotropic initial conditions in our bubble universe. We compute the inflationary spectrum in such a scenario and, as a first step toward understanding the effects of anisotropy, project it onto spherical harmonics. The resulting spectrum exhibits anomalous multipole correlations, their relative amplitude set by the present curvature parameter, which extend to arbitrarily large multipole moments. This raises the possibility of future detection, if slow-roll inflation does not last too long within our bubble. A full understanding of the observational signal must account for the effects of background anisotropy on photon free streaming, and is left...

  13. Inhomogeneous nucleation in quark hadron phase transition

    CERN Document Server

    Shukla, P K; Sen-Gupta, S K; Gleiser, Marcello; Gleiser, Marcelo

    2000-01-01

    The effect of subcritical hadron bubbles on a first-order quark-hadron phase transition is studied. These subcritical hadron bubbles created due to thermal fluctuations introduce a finite amount of phase mixing (quark phase mixed with hadron phase) even at and above the critical temperature. For sufficiently strong transitions, as is expected to be the case for the quark-hadron transition, we show that the amount of phase mixing at the critical temperature remains much below the percolation threshold. Thus, as the system cools below the critical temperature, the transition proceeds through the nucleation of critical-size hadron bubbles from a metastable quark-gluon phase (QGP) within an inhomogeneous background populated by an equilibrium distribution of subcritical hadron bubbles. The inhomogenity of the medium is incorporated consistently by modelling the subcritical bubbles as Gaussian fluctuations, resulting in a large reduction of the nucleation barrier for the critical bubbles. Using the corrected nucle...

  14. Nucleation and growth of tin whiskers

    Science.gov (United States)

    Cheng, Jing; Vianco, Paul T.; Zhang, Bei; Li, James C. M.

    2011-06-01

    Pure tin film of one micron thick was evaporated onto a silicon substrate with chromium and nickel underlayers. The tinned silicon disk was bent by applying a dead load at the center and supported below around the edge to apply biaxial compressive stresses to the tin layer. After 180 C vacuum annealing for 1,2,4,6, and 8 weeks, tin whiskers/hillocks grew. A quantitative method revealed that the overall growth rate decreased with time with a tendency for saturation. A review of the literature showed in general, tin whisker growth has a nucleation period, a growth period and a period of saturation, very similar to recrystallization or phase transformation. In fact we found our data fit Avrami equation very well. This equation shows that the nucleation period was the first week.

  15. Sensitivity of ice-nucleating bacteria to ultraviolet irradiation

    International Nuclear Information System (INIS)

    The effect of ultraviolet (UV) irradiation on the ice-nucleating activity of the ice-nucleating bacteria was examined. Bacterial suspension was irradiated with UV (254 nm, 6Wx2) for 5 min at a distance of 20 cm from UV source. Although no viable cells were detected, the ice-nucreating activity of the cells was not affected. Furthermore, after UV irradiation for 3 hr, the ice-nucleating activity of Pseudomonas fluorescens and P. syringae was only slightly decreased, although that of P. viridiflava and Erwinia herbicola was significantly lowered. We succeeded in killing the ice-nucleating bacteria, while retaining their ice-nucleating activity with UV irradiation. (author)

  16. Sensitivity of ice-nucleating bacteria to ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Obata, Hitoshi; Tanahashi, Shinji; Kawahara, Hidehisa (Kansai Univ., Suita, Osaka (Japan). Faculty of Engineering)

    1992-01-01

    The effect of ultraviolet (UV) irradiation on the ice-nucleating activity of the ice-nucleating bacteria was examined. Bacterial suspension was irradiated with UV (254 nm, 6Wx2) for 5 min at a distance of 20 cm from UV source. Although no viable cells were detected, the ice-nucreating activity of the cells was not affected. Furthermore, after UV irradiation for 3 hr, the ice-nucleating activity of Pseudomonas fluorescens and P. syringae was only slightly decreased, although that of P. viridiflava and Erwinia herbicola was significantly lowered. We succeeded in killing the ice-nucleating bacteria, while retaining their ice-nucleating activity with UV irradiation. (author).

  17. Synthesis and properties of polyamide-Ag2S composite based solar energy absorber surfaces

    Science.gov (United States)

    Krylova, Valentina; Baltrusaitis, Jonas

    2013-10-01

    Silver sulfide (Ag2S), an efficient solar light absorber, was synthesized using a modified chemical bath deposition (CBD) method and polyamide 6 (PA) as a host material via solution phase reaction between AgNO3 and Na2S2O3. X-ray diffraction (XRD) data showed a single, α-Ag2S (acanthite), crystalline phase present while surface and bulk chemical analyses, performed using X-ray photoelectron (XPS) and energy dispersive (EDS) spectroscopies, showed 2:1 Ag:S ratio. Direct and indirect bandgaps obtained from Tauc plots were 1.3 and 2.3 eV, respectively. Detailed surface chemical analysis showed the presence of three distinct sulfur species with majority component due to the Ag2S chemical bonds and minority components due to two types of oxygen-sulfur bonds. Conductivity of the resulting composite material was shown to change with the reaction time thus enabling to obtain controlled conductivity composite material. The synthesis method presented is based on the low solubility of Ag2S and is potentially green, no by-product producing, as all Ag2S nucleated outside the host material can be recycled into the process via dissolving it in HNO3.

  18. Synthesis and properties of polyamide–Ag{sub 2}S composite based solar energy absorber surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Krylova, Valentina, E-mail: valentina.krylova@ktu.lt [Department of Inorganic Chemistry, Kaunas University of Technology, Radvilenu st. 19, LT-50254 Kaunas (Lithuania); Baltrusaitis, Jonas, E-mail: j.baltrusaitis@utwente.nl [PhotoCatalytic Synthesis Group, MESA Institute for Nanotechnology, Faculty of Science and Technology, University of Twente, Meander 229, P.O. Box 217, 7500 AE Enschede (Netherlands)

    2013-10-01

    Silver sulfide (Ag{sub 2}S), an efficient solar light absorber, was synthesized using a modified chemical bath deposition (CBD) method and polyamide 6 (PA) as a host material via solution phase reaction between AgNO{sub 3} and Na{sub 2}S{sub 2}O{sub 3}. X-ray diffraction (XRD) data showed a single, α-Ag{sub 2}S (acanthite), crystalline phase present while surface and bulk chemical analyses, performed using X-ray photoelectron (XPS) and energy dispersive (EDS) spectroscopies, showed 2:1 Ag:S ratio. Direct and indirect bandgaps obtained from Tauc plots were 1.3 and 2.3 eV, respectively. Detailed surface chemical analysis showed the presence of three distinct sulfur species with majority component due to the Ag{sub 2}S chemical bonds and minority components due to two types of oxygen–sulfur bonds. Conductivity of the resulting composite material was shown to change with the reaction time thus enabling to obtain controlled conductivity composite material. The synthesis method presented is based on the low solubility of Ag{sub 2}S and is potentially green, no by-product producing, as all Ag{sub 2}S nucleated outside the host material can be recycled into the process via dissolving it in HNO{sub 3}.

  19. Nucleation of (4)R brane universes

    International Nuclear Information System (INIS)

    The creation of brane universes induced by a totally antisymmetric tensor living in a fixed background spacetime is presented, where a term involving the intrinsic curvature of the brane is considered. A canonical quantum mechanical approach employing the Wheeler-DeWitt equation is used. The probability nucleation for the brane is calculated by means of the corresponding instanton and the WKB approximation. Some cosmological implications from the model are presented

  20. Nucleation of {sup (4)}R brane universes

    Energy Technology Data Exchange (ETDEWEB)

    Cordero, Ruben [Departamento de FIsica, Escuela Superior de FIsica y Matematicas del IPN, Unidad Adolfo Lopez Mateos, Edificio 9, 07738 Mexico, DF (Mexico); Rojas, EfraIn [Facultad de FIsica e Inteligencia Artificial, Universidad Veracruzana, Sebastian Camacho 5, Xalapa, Veracruz, 91000 (Mexico)

    2004-09-07

    The creation of brane universes induced by a totally antisymmetric tensor living in a fixed background spacetime is presented, where a term involving the intrinsic curvature of the brane is considered. A canonical quantum mechanical approach employing the Wheeler-DeWitt equation is used. The probability nucleation for the brane is calculated by means of the corresponding instanton and the WKB approximation. Some cosmological implications from the model are presented.

  1. Homogeneous nucleation kinetics in a closed system

    Czech Academy of Sciences Publication Activity Database

    Kožíšek, Zdeněk; Demo, Pavel; Sveshnikov, Alexey

    Bratislava: x, 2005 - (Koman, M.; Mikloš, D.), s. 35-35 ISBN 80-89088-42-2. [Development of Materials Science in Research and Education - DMS -RE 2005 /15./. Kežmarské Žĺaby (SK), 05.09.2005-09.09.2005] R&D Projects: GA AV ČR(CZ) IAA1010311 Institutional research plan: CEZ:AV0Z10100521 Keywords : phase transition * nucleation * closed system Subject RIV: BJ - Thermodynamics

  2. Refining Predictions of the Classical Nucleation Theory

    Czech Academy of Sciences Publication Activity Database

    Němec, Tomáš; Maršík, František; Krejčí, A. Petr

    Mount Laurel : AAAR, 2006 - (Biswas, P.; Chen, D.; Hering, S.), s. 1599-1600 ISBN 0-9788735-0-5. [IAC 2006 /7./. St. Paul (US), 10.09.2006-15.09.2006] R&D Projects: GA MŠk(CZ) 1P05ME726 Institutional research plan: CEZ:AV0Z20760514 Keywords : binary nucleation * microscopic surface tension Subject RIV: BJ - Thermodynamics

  3. Nucleation and crystallization in fluoroindate glasses

    OpenAIRE

    Messaddeq, Younes; Delben, A. A. S. T.; Aegerter, Michel A.; Poulain, M.

    1993-01-01

    Devitrification of fluoride glasses of ZBSI and ZBCdSI composition has been studied by non isothermal differential thermal analysis. For all compositions the Avrami exponent n varies between 3 and 4 suggesting a tridimensional interface controlled growth process with a decreasing nucleation rate. For ZBSI glasses, he curves of activation energy and stability parameters versus InF3 concentration show an anomaly for x=35% InF3. No anomaly has been observed for ZBCdSI glasses composition. Mecha...

  4. Circular domains nucleation in magnetic microwires

    Czech Academy of Sciences Publication Activity Database

    Chizhik, A.; Zablotskyy, Vitaliy A.; Stupakiewicz, A.; Dejneka, Alexandr; Polyakova, T.; Tekielak, M.; Maziewski, A.; Zhukov, A.; Gonzalez, J.

    2013-01-01

    Roč. 102, č. 20 (2013), "202406-1"-"202406-4". ISSN 0003-6951 R&D Projects: GA MŠk(CZ) LM2011029; GA TA ČR TA01010517; GA ČR GAP108/12/1941 Grant ostatní: SAFMAT(XE) CZ.2.16/3.1.00/22132 Institutional support: RVO:68378271 Keywords : magnetic microwires * magnetization reversal * domains nucleation Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.515, year: 2013

  5. Systematic coarse-graining in nucleation theory

    International Nuclear Information System (INIS)

    In this work, we show that the standard method to obtain nucleation rate-predictions with the aid of atomistic Monte Carlo simulations leads to nucleation rate predictions that deviate 3 − 5 orders of magnitude from the recent brute-force molecular dynamics simulations [Diemand et al., J. Chem. Phys. 139, 074309 (2013)] conducted in the experimental accessible supersaturation regime for Lennard-Jones argon. We argue that this is due to the truncated state space the literature mostly relies on, where the number of atoms in a nucleus is considered the only relevant order parameter. We here formulate the nonequilibrium statistical mechanics of nucleation in an extended state space, where the internal energy and momentum of the nuclei are additionally incorporated. We show that the extended model explains the lack in agreement between the molecular dynamics simulations by Diemand et al. and the truncated state space. We demonstrate additional benefits of using the extended state space; in particular, the definition of a nucleus temperature arises very naturally and can be shown without further approximation to obey the fluctuation law of McGraw and LaViolette. In addition, we illustrate that our theory conveniently allows to extend existing theories to richer sets of order parameters

  6. Systematic coarse-graining in nucleation theory

    Science.gov (United States)

    Schweizer, M.; Sagis, L. M. C.

    2015-08-01

    In this work, we show that the standard method to obtain nucleation rate-predictions with the aid of atomistic Monte Carlo simulations leads to nucleation rate predictions that deviate 3 - 5 orders of magnitude from the recent brute-force molecular dynamics simulations [Diemand et al., J. Chem. Phys. 139, 074309 (2013)] conducted in the experimental accessible supersaturation regime for Lennard-Jones argon. We argue that this is due to the truncated state space the literature mostly relies on, where the number of atoms in a nucleus is considered the only relevant order parameter. We here formulate the nonequilibrium statistical mechanics of nucleation in an extended state space, where the internal energy and momentum of the nuclei are additionally incorporated. We show that the extended model explains the lack in agreement between the molecular dynamics simulations by Diemand et al. and the truncated state space. We demonstrate additional benefits of using the extended state space; in particular, the definition of a nucleus temperature arises very naturally and can be shown without further approximation to obey the fluctuation law of McGraw and LaViolette. In addition, we illustrate that our theory conveniently allows to extend existing theories to richer sets of order parameters.

  7. Black holes as bubble nucleation sites

    International Nuclear Information System (INIS)

    We consider the effect of inhomogeneities on the rate of false vacuum decay. Modelling the inhomogeneity by a black hole, we construct explicit Euclidean instantons which describe the nucleation of a bubble of true vacuum centred on the inhomogeneity. We find that inhomogeneity significantly enhances the nucleation rate over that of the Coleman-de Luccia instanton — the black hole acts as a nucleation site for the bubble. The effect is larger than previously believed due to the contributions to the action from conical singularities. For a sufficiently low initial mass, the original black hole is replaced by flat space during this process, as viewed by a single causal patch observer. Increasing the initial mass, we find a critical value above which a black hole remnant survives the process. This resulting black hole can have a higher mass than the original black hole, but always has a lower entropy. We compare the process to bubble-to-bubble transitions, where there is a semi-classical Lorentzian description in the WKB approximation

  8. Dislocation nucleation and multiplication during nanoindentation testing

    International Nuclear Information System (INIS)

    Small volumes of crystalline material can exhibit near theoretical lattice strengths due to the absence of pre-existing defects. The authors show here that careful control of experimental parameters and surface preparation are important in observing these increased stresses. In particular, tip impact kinetic energies at the initial contact of only a few eV have been found to influence events occurring at a much later stage in the loading cycle. This can be understood in terms of the energy required to deform a small number of atomic scale asperities and thus release sufficient surface energy to permit dislocation nucleation at impact. If the K.E. is not sufficient to overcome the asperities, dislocations must be nucleated at a later stage in the loading cycle, giving an apparently different mechanical property. The authors outline the implications for thin film systems where a hard surface layer may play a vital role, firstly, in preventing dislocation nucleation on impact and, secondly, in impeding the propagation of any such dislocations into the bulk below

  9. Selective Semiconductor Nanocluster Deposition on Eptaxially Patterned Semicrystalline Block Copolymer Film

    Science.gov (United States)

    Park, Cheolmin; Lee, Jinwook; Jensen, Klavs F.; Bawendi, Moungi G.; Thomas, Edwin L.

    2001-03-01

    Monodisperse ZnS encapsulated CdSe semiconductor nanoclusters are sequestered in between the crystalline polyethylene (PE) lamellae of poly (ethylene-b-ethylene-alt-propylene-b ethylene) semicrystalline triblock copolymer epitaxially crystallized on single crystal of anthracene (AN). Epitaxy between PE block and An created a cross oriented texture of the edge-on crystalline PE lamellae in the thin film. At the same time, the nanoclusters, initially dissolved in the mixture of block copolymer and AN, were rejected out of the crystalline lamellae during epitaxial crystallization and selectively deposited in the amorphous region of the block copolymer. Selective distribution of nanoclusters on the cross oriented pattern structure is clearly evidenced by selected area diffraction (SAD) and bright field transmission electron microscope (TEM).

  10. Fabrication and modification of metal nanocluster composites using ion and laser beams

    International Nuclear Information System (INIS)

    Metal nanocluster composites have attractive properties for applications in nonlinear optics. However, traditional fabrication techniques -- using melt-glass substrates -- are severely constrained by equilibrium thermodynamics and kinetics. This paper describes the fabrication of metal nanoclusters in both crystalline and glassy hosts by ion implantation and pulsed laser deposition. The size and size distribution of the metal nanoclusters can be modified by controlling substrate temperature during implantation, by subsequent thermal annealing, or by laser irradiation. The authors have characterized the optical response of the composites by absorption and third-order nonlinear-optical spectroscopies; electron and scanning-probe microscopies have been used to benchmark the physical characteristics of the composites. The outlook for controlling the structure and nonlinear optical response properties of these nanophase materials appears increasingly promising

  11. Layered Double Hydroxide Nanoclusters: Aqueous, Concentrated, Stable, and Catalytically Active Colloids toward Green Chemistry.

    Science.gov (United States)

    Tokudome, Yasuaki; Morimoto, Tsuyoshi; Tarutani, Naoki; Vaz, Pedro D; Nunes, Carla D; Prevot, Vanessa; Stenning, Gavin B G; Takahashi, Masahide

    2016-05-24

    Increasing attention has been dedicated to the development of nanomaterials rendering green and sustainable processes, which occur in benign aqueous reaction media. Herein, we demonstrate the synthesis of another family of green nanomaterials, layered double hydroxide (LDH) nanoclusters, which are concentrated (98.7 g/L in aqueous solvent), stably dispersed (transparent sol for >2 weeks), and catalytically active colloids of nano LDHs (isotropic shape with the size of 7.8 nm as determined by small-angle X-ray scattering). LDH nanoclusters are available as colloidal building blocks to give access to meso- and macroporous LDH materials. Proof-of-concept applications revealed that the LDH nanocluster works as a solid basic catalyst and is separable from solvents of catalytic reactions, confirming the nature of nanocatalysts. The present work closely investigates the unique physical and chemical features of this colloid, the formation mechanism, and the ability to act as basic nanocatalysts in benign aqueous reaction systems. PMID:27124717

  12. A nanoscale temperature-dependent heterogeneous nucleation theory

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Y. Y. [Nanosurface Science and Engineering Research Institute, College of Mechatronics and Control Engineering, Shenzhen University, Shenzhen, 518060 Guangdong (China); Yang, G. W., E-mail: stsygw@mail.sysu.edu.cn [State Key Laboratory of Optoelectronic Materials and Technologies, Nanotechnology Research Center, School of Materials Science and Engineering, School of Physics and Engineering, Sun Yat-Sen University, Guangzhou, 510275 Guangdong (China)

    2015-06-14

    Classical nucleation theory relies on the hypothetical equilibrium of the whole nucleation system, and neglects the thermal fluctuations of the surface; this is because the high entropic gains of the (thermodynamically extensive) surface would lead to multiple stable states. In fact, at the nanometer scale, the entropic gains of the surface are high enough to destroy the stability of the thermal equilibrium during nucleation, comparing with the whole system. We developed a temperature-dependent nucleation theory to elucidate the heterogeneous nucleation process, by considering the thermal fluctuations based on classical nucleation theory. It was found that the temperature not only affected the phase transformation, but also influenced the surface energy of the nuclei. With changes in the Gibbs free energy barrier, nucleation behaviors, such as the nucleation rate and the critical radius of the nuclei, showed temperature-dependent characteristics that were different from those predicted by classical nucleation theory. The temperature-dependent surface energy density of a nucleus was deduced based on our theoretical model. The agreement between the theoretical and experimental results suggested that the developed nucleation theory has the potential to contribute to the understanding and design of heterogeneous nucleation at the nanoscale.

  13. Structural Basis of Actin Filament Nucleation by Tandem W Domains

    Directory of Open Access Journals (Sweden)

    Xiaorui Chen

    2013-06-01

    Full Text Available Spontaneous nucleation of actin is very inefficient in cells. To overcome this barrier, cells have evolved a set of actin filament nucleators to promote rapid nucleation and polymerization in response to specific stimuli. However, the molecular mechanism of actin nucleation remains poorly understood. This is hindered largely by the fact that actin nucleus, once formed, rapidly polymerizes into filament, thus making it impossible to capture stable multisubunit actin nucleus. Here, we report an effective double-mutant strategy to stabilize actin nucleus by preventing further polymerization. Employing this strategy, we solved the crystal structure of AMPPNP-actin in complex with the first two tandem W domains of Cordon-bleu (Cobl, a potent actin filament nucleator. Further sequence comparison and functional studies suggest that the nucleation mechanism of Cobl is probably shared by the p53 cofactor JMY, but not Spire. Moreover, the double-mutant strategy opens the way for atomic mechanistic study of actin nucleation and polymerization.

  14. How does degree heterogeneity affect nucleation on complex networks?

    International Nuclear Information System (INIS)

    Nucleation is an initiating process of a stable phase from a metastable phase in a first-order phase transition. Taking the Ising model as a paradigm, we investigate the dynamics of nucleation on complex networks and focus on the role played by the heterogeneity of degree distribution on nucleation rate. Using Monte Carlo simulation combined with forward flux sampling, we find that for a weak external field the nucleation rate decreases monotonically as degree heterogeneity increases. Interestingly, for a relatively strong external field the nucleation rate exhibits a nonmonotonic dependence on degree heterogeneity, in which there exists a maximal nucleation rate at an intermediate level of degree heterogeneity. Furthermore, we develop a heterogeneous mean-field theory for evaluating the free-energy barrier of nucleation. The theoretical estimations are qualitatively consistent with the simulation results. Our study suggests that degree heterogeneity plays a nontrivial role in the dynamics of phase transitions in networked Ising systems. (paper)

  15. Crystal structure and electronic properties of a thiolate-protected Au24 nanocluster

    Science.gov (United States)

    Das, Anindita; Li, Tao; Li, Gao; Nobusada, Katsuyuki; Zeng, Chenjie; Rosi, Nathaniel L.; Jin, Rongchao

    2014-05-01

    Solving the total structures of gold nanoclusters is of critical importance for understanding their electronic, optical and catalytic properties. Herein, we report the X-ray structure of a charge-neutral Au24(SCH2Ph-tBu)20 nanocluster. This structure features a bi-tetrahedral Au8 kernel protected by four tetrameric staple-like motifs. Electronic structure analysis is further carried out and the optical absorption spectrum is interpreted. The Au24(SCH2Ph-tBu)20, Au23(S-c-C6H11)16 and Au25(SCH2CH2Ph)18 nanoclusters constitute the first crystallographically characterized ``trio''.Solving the total structures of gold nanoclusters is of critical importance for understanding their electronic, optical and catalytic properties. Herein, we report the X-ray structure of a charge-neutral Au24(SCH2Ph-tBu)20 nanocluster. This structure features a bi-tetrahedral Au8 kernel protected by four tetrameric staple-like motifs. Electronic structure analysis is further carried out and the optical absorption spectrum is interpreted. The Au24(SCH2Ph-tBu)20, Au23(S-c-C6H11)16 and Au25(SCH2CH2Ph)18 nanoclusters constitute the first crystallographically characterized ``trio''. Electronic supplementary information (ESI) available: Experimental and supporting Fig. S1-S3. CCDC NUMBER(1000102). For ESI and crystallographic data in CIF or other electronic format see DOI: 10.1039/c4nr01350f

  16. Inorganic Nanoparticle Nucleation on Polymer Matrices

    Science.gov (United States)

    Kosteleski, Adrian John

    The introduction of inorganic nanoparticles into organic materials enhances both the mechanical and chemical properties of the material. Metallic nanoparticles, like silver and gold, have been introduced into polymers for use as antimicrobial coatings or dielectric materials, respectively. The challenge in creating these materials currently is the difficulty to homogeneously disperse the particles throughout the polymer matrix. The uneven dispersion of nanoparticles can lead to less than optimal quality and undesired properties. By creating a polymer nanocomposite material with well-controlled size inorganic materials that are evenly dispersed throughout the polymer matrix; we can improve the materials performance and properties. The objective for this research is to use polymer networks for the in situ mineralization of silver and other metallic materials to create intricate inorganic structures. The work performed here studied the ability to nucleate silver nanoparticles using poly (acrylic acid) (PAA) as the templating agent. Ionic silver was chemically reduced by sodium borohydride (NaBH4) in the presence of PAA. The effect of varying reactant concentrations of silver, NaBH 4, and PAA on particle size was studied. Reaction conditions in terms of varying temperature and pH levels of the reaction solution were monitored to observe the effect of silver nanoparticle size, shape, and concentration. By monitoring the UV spectra over time the reaction mechanism of the silver reduction process was determined to be an autocatalytic process: a period of slow, continuous nucleation followed by rapid, autocatalytic growth. The reaction kinetics for this autocatalytic process is also reported. PAA was crosslinked both chemically and physically to 3 biopolymers; ELP, an elastin like peptide, cotton fabrics, and calcium alginate hydrogels. Various compositions of PAA were physically crosslinked with calcium alginate gels to design an antimicrobial hydrogel for use in wound

  17. Support-induced Catalytic Activity of Gold Nanocluster

    Science.gov (United States)

    Zhang, Chun; Yoon, Bokwon; Landman, Uzi

    2007-03-01

    The catalytic activity of gold nanoclusters supported on metal-oxide surfaces is a topic of active research efforts. Recently, a dimensionality crossover of gold clusters, adsorbed on a metal-supported thin film of MgO(100), has been predicted^1. We present here a first- principles study of the catalytic activity of a planer Au20 cluster on two- layer MgO(100) film supported by a Mo surface. Both Langmuir-Hinshelwood (LH) and Eley--Rideal (ER) mechanisms of CO oxidation are investigated. The barrier of the LH mechanism is found to be 0.15 eV. For the ER mechanism, the barrier depends on the direction of approach of the CO molecule to the preadsorbed oxygen molecule, varying between a vanishing barrier height and 0.2 eV. Charge transfer from the Mo surface to the cluster supported on the thin MgO(100) film plays a key role in the catalyzed CO oxidation process.

  18. Rigid rod spaced fullerene as building block for nanoclusters

    Indian Academy of Sciences (India)

    Pallikara K Sudeep; James P Varkey; K George Thomas; Manappurathu V George; Prashant V Kamat

    2003-10-01

    By using phenylacetylene based rigid-rod linkers (PhA), we have successfully synthesized two fullerene derivatives, C60-PhA and C60-PhA-C60. The absorption spectral features of C60, as well as that of the phenylacetylene moiety are retained in the monomeric forms of these fullerene derivatives, ruling out the possibility of any strong interaction between the two chromophores in the ground state. Both the fullerene derivatives form optically transparent clusters, absorbing in the UV-Vis region; this clustering leads to a significant increase in their molar extinction coefficients. TEM characterization of the C60-PhA showed large spherical clusters, with sizes ranging from 150-350 nm, while an elongated wire-type structure was observed for the bisfullerene derivative (C60-PhA-C60). AFM section analysis studies of isolated nanoclusters of C60-PhA-C60, deposited on mica, indicate that smaller clusters associate to form larger nanostructures.

  19. "Light-on" sensing of antioxidants using gold nanoclusters.

    Science.gov (United States)

    Hu, Lianzhe; Deng, Lin; Alsaiari, Shahad; Zhang, Dingyuan; Khashab, Niveen M

    2014-05-20

    Depletion of intracellular antioxidants is linked to major cytotoxic events and cellular disorders, such as oxidative stress and multiple sclerosis. In addition to medical diagnosis, determining the concentration of antioxidants in foodstuffs, food preservatives, and cosmetics has proved to be very vital. Gold nanoclusters (Au-NCs) have a core size below 2 nm and contain several metal atoms. They have interesting photophysical properties, are readily functionalized, and are safe to use in various biomedical applications. Herein, a simple and quantitative spectroscopic method based on Au-NCs is developed to detect and image antioxidants such as ascorbic acid. The sensing mechanism is based on the fact that antioxidants can protect the fluorescence of Au-NCs against quenching by highly reactive oxygen species. Our method shows great accuracy when employed to detect the total antioxidant capacity in commercial fruit juice. Moreover, confocal fluorescence microscopy images of HeLa cells show that this approach can be successfully used to image antioxidant levels in living cells. Finally, the potential application of this "light-on" detection method in multiple logic gate fabrication was discussed using the fluorescence intensity of Au-NCs as output. PMID:24785707

  20. Exotic high activity surface patterns in PtAu nanoclusters

    KAUST Repository

    Mokkath, Junais Habeeb

    2013-05-09

    The structure and chemical ordering of PtAu nanoclusters of 79, 135, and 201 atoms are studied via a combination of a basin hopping atom-exchange technique (to locate the lowest energy homotops at fixed composition), a symmetry orbit technique (to find the high symmetry isomers), and density functional theory local reoptimization (for determining the most stable homotop). The interatomic interactions between Pt and Au are derived from the empirical Gupta potential. The lowest energy structures show a marked tendency toward PtcoreAushell chemical ordering by enrichment of the more cohesive Pt in the core region and of Au in the shell region. We observe a preferential segregation of Pt atoms to (111) facets and Au atoms to (100) facets of the truncated octahedron cluster motif. Exotic surface patterns are obtained particularly for Pt-rich compositions, where Pt atoms are being surrounded by Au atoms. These surface arrangements boost the catalytic activity by creating a large number of active sites. © 2013 American Chemical Society.

  1. Photoluminescent gold nanoclusters as sensing probes for uropathogenic Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Po-Han Chan

    Full Text Available Glycan-bound nanoprobes have been demonstrated as suitable sensing probes for bacteria containing glycan binding sites. In this study, we demonstrated a facile approach for generating glycan-bound gold nanoclusters (AuNCs. The generated AuNCs were used as sensing probes for corresponding target bacteria. Mannose-capped AuNCs (AuNCs@Mann were generated and used as the model sensors for target bacteria. A one-step synthesis approach was employed to generate AuNCs@Mann. In this approach, an aqueous solution of tetrachloroauric acid and mannoside that functionized with a thiol group (Mann-SH was stirred at room temperature for 48 h. The mannoside functions as reducing and capping agent. The size of the generated AuNCs@Mann is 1.95±0.27 nm, whereas the AuNCs with red photoluminescence have a maximum emission wavelength of ~630 nm (λexcitation = 375 nm. The synthesis of the AuNCs@Mann was accelerated by microwave heating, which enabled the synthesis of the AuNCs@Mann to complete within 1 h. The generated AuNCs@Mann are capable of selectively binding to the urinary tract infection isolate Escherichia coli J96 containing the mannose binding protein FimH expressed on the type 1 pili. On the basis of the naked eye observation, the limit of detection of the sensing approach is as low as ~2×10(6 cells/mL.

  2. "light-on" sensing of antioxidants using gold nanoclusters

    KAUST Repository

    Hu, Lianzhe

    2014-05-20

    Depletion of intracellular antioxidants is linked to major cytotoxic events and cellular disorders, such as oxidative stress and multiple sclerosis. In addition to medical diagnosis, determining the concentration of antioxidants in foodstuffs, food preservatives, and cosmetics has proved to be very vital. Gold nanoclusters (Au-NCs) have a core size below 2 nm and contain several metal atoms. They have interesting photophysical properties, are readily functionalized, and are safe to use in various biomedical applications. Herein, a simple and quantitative spectroscopic method based on Au-NCs is developed to detect and image antioxidants such as ascorbic acid. The sensing mechanism is based on the fact that antioxidants can protect the fluorescence of Au-NCs against quenching by highly reactive oxygen species. Our method shows great accuracy when employed to detect the total antioxidant capacity in commercial fruit juice. Moreover, confocal fluorescence microscopy images of HeLa cells show that this approach can be successfully used to image antioxidant levels in living cells. Finally, the potential application of this "light-on" detection method in multiple logic gate fabrication was discussed using the fluorescence intensity of Au-NCs as output. © 2014 American Chemical Society.

  3. Radical attached aluminum nanoclusters: an alternative way of cluster stabilization.

    Science.gov (United States)

    Sengupta, Turbasu; Pal, Sourav

    2016-08-21

    The stability and electronic structure of radical attached aluminum nanoclusters are investigated using density functional theory (DFT). A detailed investigation shows good correlation between the thermodynamic stability of radical attached clusters and the stability of the attached radical anions. All other calculated parameters like HOMO-LUMO gap and charge transfer are also found to be consistent with the observed thermodynamic stabilities of the complexes. Investigation of the electronic structure of radical attached complexes further shows the presence of jellium structures within the core similar to the ligated clusters. Comparison with available experimental and theoretical data also proves the validity of superatomic complex theory for the radical attached clusters as well. Based on the evaluated thermodynamic parameters, selected radical attached clusters are observed to be more thermodynamically stable in comparison with experimentally synthesized ligated clusters. Stabilization of small metal clusters is one of the greatest challenges in current cluster science and the present investigation confirms the fact that radical attached clusters can provide a viable alternative to ligated clusters in the future. PMID:27435912

  4. Atomic-scale structure of single-layer MoS2 nanoclusters

    DEFF Research Database (Denmark)

    Helveg, S.; Lauritsen, J. V.; Lægsgaard, E.;

    2000-01-01

    We have studied using scanning tunneling microscopy (STM) the atomic-scale realm of molybdenum disulfide (MoS2) nanoclusters, which are of interest as a model system in hydrodesulfurization catalysis. The STM gives the first real space images of the shape and edge structure of single-layer MoS2...... nanoparticles synthesized on Au(lll), and establishes a new picture of the active edge sires of the nanoclusters. The results demonstrate a way to get detailed atomic-scale information on catalysts in general....

  5. Atomic-scale structure of single-layer MoS2 nanoclusters

    OpenAIRE

    Helveg, S.; Lauritsen, J.V.; Lægsgaard, E.; Stensgaard, I.; Nørskov, Jens Kehlet; Clausen, B.S, Helveg S; Topsøe, H.; Besenbacher, Flemming

    2000-01-01

    We have studied using scanning tunneling microscopy (STM) the atomic-scale realm of molybdenum disulfide (MoS2) nanoclusters, which are of interest as a model system in hydrodesulfurization catalysis. The STM gives the first real space images of the shape and edge structure of single-layer MoS2 nanoparticles synthesized on Au(lll), and establishes a new picture of the active edge sires of the nanoclusters. The results demonstrate a way to get detailed atomic-scale information on catalysts in ...

  6. The ice nucleation activity of biological aerosols

    Science.gov (United States)

    Grothe, H.; Pummer, B.; Bauer, H.; Bernardi, J.

    2012-04-01

    Primary Biological Aerosol Particles (PBAPs), including bacteria, spores and pollen may be important for several atmospheric processes. Particularly, the ice nucleation caused by PBAPs is a topic of growing interest, since their impact on ice cloud formation and thus on radiative forcing, an important parameter in global climate is not yet fully understood. In laboratory model studies we investigated the ice nucleation activity of selected PBAPs. We studied the immersion mode freezing using water-oil emulsion, which we observed by optical microscopy. We particularly focused on pollen. We show that pollen of different species strongly differ in their ice nucleation behavior. The average freezing temperatures in laboratory experiments range from 240 K to 255 K. As the most efficient nuclei (silver birch, Scots pine and common juniper pollen) have a distribution area up to the Northern timberline, their ice nucleation activity might be a cryoprotective mechanism. For comparison the ice nucleation activity of Snomax, fungal spores, and mushrooms will be discussed as well. In the past, pollen have been rejected as important atmospheric IN, as they are not as abundant in the atmosphere as bacteria or mineral dust and are too heavy to reach higher altitudes. However, in our experiments (Pummer et al. 2011) it turned out that water, which had been in contact with pollen and then been separated from the bodies, nucleates as good as the pollen grains themselves. So the ice nuclei have to be easily-suspendable macromolecules (100-300 kDa) located on the pollen. Once extracted, they can be distributed further through the atmosphere than the heavy pollen grains and so augment the impact of pollen on ice cloud formation even in the upper troposphere. It is widely known, that material from the pollen, like allergens and sugars, can indeed leave the pollen body and be distributed independently. The most probable mechanism is the pollen grain bursting by rain, which releases

  7. AGS improvement program

    International Nuclear Information System (INIS)

    The interest of both particle and nuclear physicists are coverging on the AGS; this machine is almost ideally and uniquely suited to perform a new class of frontier experiments. Particle physicists would like to study the extremely heavy (multi-TeV) particles posited by new theories by searching for rare k-decays. Nuclear physicists want to create the extremely denser form of nuclear matter which exists within neutron stars by studying heavy ion collisions. The particle physicists require extremely intense proton beams in order to produce enough k's. The nuclear physicists require heavy ions accelerated in the top energies of the AGS. The AGS recently acquired a new capability of accelerating polarized protons to 16.5-GeV and will extend its energy to full energy of the machine. This new capability will open the way to extend the surprising lower energy result of spin-spin correlation at high momentum transfer collisions to much higher energy

  8. Influence of aerosol lifetime on the interpretation of nucleation experiments with respect to the first nucleation theorem

    Directory of Open Access Journals (Sweden)

    S. Ehrhart

    2013-04-01

    Full Text Available The SAWNUC microphysical aerosol nucleation model is used to study the effect of reactor walls on the interpretation of nucleation experiments with respect to nucleation theory. This work shows that loss processes, such as wall losses, influence the interpretation of nucleation experiments, especially at low growth rates and short lifetime of freshly nucleated particles. In these cases the power dependency of the formation rates, determined at a certain particle size, with respect to H2SO4 does not correspond to the approximate number of H2SO4 molecules in the critical cluster as expected by the first nucleation theorem. Observed ∂log(J/∂log([H2SO4] therefore can vary widely for identical nucleation conditions but different sink terms.

  9. Molecular simulations of heterogeneous ice nucleation. I. Controlling ice nucleation through surface hydrophilicity

    Energy Technology Data Exchange (ETDEWEB)

    Cox, Stephen J.; Kathmann, Shawn M.; Slater, B.; Michaelides, Angelos

    2015-05-14

    Ice formation is one of the most common and important processes on earth and almost always occurs at the surface of a material. A basic understanding of how the physicochemical properties of a material’s surface affect its ability to form ice has remained elusive. Here, we use molecular dynamics simulations to directly probe heterogeneous ice nucleation at a hexagonal surface of a nanoparticle of varying hydrophilicity. Surprisingly, we find that structurally identical surfaces can both inhibit and promote ice formation and analogous to a chemical catalyst, it is found that an optimal interaction between the surface and the water exists for promoting ice nucleation.We use our microscopic understanding of the mechanism to design a modified surface in silico with enhanced ice nucleating ability. C 2015 Author(s). All article content, except where otherwise noted, is licensed under a Creative Commons Attribution 3.0 Unported License.

  10. Growth and characterization of ZnO multipods on functional surfaces with different sizes and shapes of Ag particles

    Institute of Scientific and Technical Information of China (English)

    A Kamalianfar; S A Halim; Mahmoud Godarz Naseri; M Navasery; Fasih Ud Din; J A M Zahedi; Kasra Behzad

    2013-01-01

    Three-dimensional ZnO multipods are successfully synthesized on functional substrates using the vapor transport method in a quartz tube.The functional surfaces,which include two different distributions of Ag nanoparticles and a layer of commercial Ag nanowires,are coated onto silicon substrates before the growth of ZnO nanostructures.The structures and morphologies of the ZnO/Ag heterostructures are investigated using X-ray diffraction and field emission scanning electron microscopy.The sizes and shapes of the Ag particles affect the growth rates and initial nucleations of the ZnO structures,resulting in different numbers and shapes of multipods.They also influence the orientation and growth quality of the rods.The optical properties are studied by photoluminescence,UV-vis,and Raman spectroscopy.The results indicate that the surface plasmon resonance strongly depends on the sizes and shapes of the Ag particles.

  11. Effects of O defects on adsorption of small Ag clusters on a MgO(001) surface

    International Nuclear Information System (INIS)

    The interaction of Ag atoms with a defective MgO(001) surface is systematically studied based on density functional theory. The Ag clusters are deposited on neutral and charged oxygen vacancies of the MgO(001) surface. The structures of Ag clusters take the shape of simple models of two- or three-dimensional (2D and 3D) metal particles deposited on the MgO surface. When the nucleation of the metal clusters occurs in the Fs (missing neutral O) centre, the interaction with the substrate is considerably stronger than that in the Fs+ (missing O−) centre. The results show that the adsorption of Ag atoms on the MgO surface with oxygen vacancy is stronger than on a clear MgO surface, thereby attracting more Ag atoms to cluster together, and forming atomic islands. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  12. Absorption and luminescence of silver nanocomposite soda-lime glass formed by Ag+-Na+ ion-exchange

    International Nuclear Information System (INIS)

    Metal nanocomposite glasses are formed by a multi step methodology which involves incorporation of the metal ions into the glass by ion-exchange process followed by suitable treatments like low mass ion irradiation or thermal annealing resulting in the aggregation of the metal ions to form nano dimension metal clusters. These embedded metal nanoclusters are well investigated by the optical absorption spectroscopy which gives information regarding the size and shape of the metal clusters embedded in the dielectric matrix. The Ag+ ion-exchanged and annealed soda-lime glasses exhibit photoluminescence around 445 nm at two excitation wavelengths. He+ ion irradiation of the ion-exchanged soda-lime glass resulted in the formation of Ag metal nano crystallites with a thin metal film on the irradiated surface. The Glancing incidence X-ray diffraction study confirmed the formation of Ag nano crystals inside the dielectric matrix. Photoluminescence vanished in the irradiated samples with the neutralization of Ag+ ions into Ag metal nano crystallites

  13. Irradiation-induced Ag-colloid formation in ion-exchanged soda-lime glass

    Science.gov (United States)

    Caccavale, F.; De Marchi, G.; Gonella, F.; Mazzoldi, P.; Meneghini, C.; Quaranta, A.; Arnold, G. W.; Battaglin, G.; Mattei, G.

    1995-03-01

    Ion-exchanged glass samples were obtained by immersing soda-lime slides in molten salt baths of molar concentration in the range 1-20% AgNO 3 in NaNO 3, at temperatures varying from 320 to 350°C, and processing times of the order of a few minutes. Irradiations of exchanged samples were subsequently performed by using H +m, He +, N + ions at different energies in order to obtain comparable projected ranges. The fluence was varied between 5 × 10 15 and 2 × 10 17 ions/cm 2. Most of the samples were treated at current densities lower than 2 μA/cm 2, in order to avoid heating effects. Some samples were irradiated with 4 keV electrons, corresponding to a range of 250 nm. The formation of nanoclusters of radii in the range 1-10 nm has been observed after irradiation, depending on the treatment conditions. The precipitation process is governed by the electronic energy deposition of incident particles. The most desirable results are obtained for helium implants. The process was characterized by the use of Secondary Ion Mass Spectrometry (SIMS) and nuclear techniques (Rutherford Backscattering (RBS), Nuclear Reactions (NRA)), in order to determine concentration-depth profiles and by optical absorption and Transmission Electron Microscopy (TEM) measurements for the silver nanoclusters detection and size evaluation.

  14. Using silver nanocluster/graphene nanocomposite to enhance photoelectrochemical activity of CdS:Mn/TiO2 for highly sensitive signal-on immunoassay.

    Science.gov (United States)

    Song, Jie; Wang, Jiamian; Wang, Xiuyun; Zhao, Wei; Zhao, Yanqiu; Wu, Shuo; Gao, Zhanming; Yuan, Jingli; Meng, Changgong

    2016-06-15

    A highly sensitive signal-on photoelectrochemical (PEC) immunosensor was fabricated here using CdS:Mn/TiO2 as photoelectrochemical sensing platform, and silver nanoclusters and graphene naocomposites (AgNCs-GR) as signal amplification tags. The immunosensor was constructed based on the specific sandwich immunoreaction, and the photo-to-current conversion efficiency of the isolated protein modified CdS:Mn/TiO2 matrix was improved based on the synergistic effect of AgNCs-GR. Under irradiation, the photogenerated electrons from the AgNCs at a higher conduction band edge level could be transport to the CdS:Mn/TiO2 matrix with the assistance of highly conductive graphene nanosheets, as well as recycle the trapped excitons in the defects-rich CdS:Mn/TiO2 interface. The electron transport and exciton recycle reduced the possibility of electron-hole recombination and greatly improved the photo-to-current conversion efficiency of the sensing matrix. Based on the signal enhancement, a signal-on PEC immunosensors was fabricated for the detection of carcinoembryonic antigen (CEA), a model analyte related to many malignant diseases. Under optimal conditions, the as-prepared immunosensor showed excellent analytical performance, with a wide linear range from 1.0pg/mL to 100ng/mL and a low limit of detection of 1.0pg/mL. The signal-on mode provided 2.48 times higher sensitivity compared with signal-off mode. This strategy demonstrated good accuracy and high selectivity for practical sample analysis, thus may have great application prospective in the prediction and early diagnosis of diseases. PMID:26901458

  15. Label-free and turn-on aptamer strategy for cancer cells detection based on a DNA-silver nanocluster fluorescence upon recognition-induced hybridization.

    Science.gov (United States)

    Yin, Jinjin; He, Xiaoxiao; Wang, Kemin; Xu, Fengzhou; Shangguan, Jingfang; He, Dinggeng; Shi, Hui

    2013-12-17

    We present here a label-free and turn-on aptamer strategy for cancer cell detection based on the recognition-induced conformation alteration of aptamer and hybridization-induced fluorescence enhancement effect of DNA-silver nanoclusters (DNA-Ag NCs) in proximity of guanine-rich DNA sequences. In this strategy, two tailored DNA probes were involved. One is designed as a hairpin-shaped structure consisting of a target specific aptamer sequence at the 3'-end, a guanine-rich DNA sequence, and an arm segment at the 5'-end (denote as recognition probe). The other, serving as a signal probe, contains a sequence for Ag NCs templated synthesis and a link sequence complementary to the arm segment of the recognition probe. Recognizing and binding of the aptamer to cancer cells enforces the recognition probe to undergo a conformational alteration and then initiates hybridization between the arm segment of the recognition probe and the link sequence of the signal probe. The Ag NCs are then close to the guanine-rich DNA, leading to an enhanced fluorescence readout. As proof-of-concept, the CCRF-CEM cancer cell detection were performed by using the specific aptamer, sgc8c. It was demonstrated that this strategy could specially image the CCRF-CEM cells. Determination by flow cytometry allowed for detection of as low as 150 CCRF-CEM cells in 200 μL binding buffer. The general applicability of the strategy is also achieved in the successful detection of Ramos cells. These results implied that this strategy holds considerable potential for simple, sensitive, universal, and specific cancer cell detection with no required washing and separation steps. PMID:24266455

  16. Effects of shear flow on phase nucleation and crystallization

    Science.gov (United States)

    Mura, Federica; Zaccone, Alessio

    2016-04-01

    Classical nucleation theory offers a good framework for understanding the common features of new phase formation processes in metastable homogeneous media at rest. However, nucleation processes in liquids are ubiquitously affected by hydrodynamic flow, and there is no satisfactory understanding of whether shear promotes or slows down the nucleation process. We developed a classical nucleation theory for sheared systems starting from the molecular level of the Becker-Doering master kinetic equation and we analytically derived a closed-form expression for the nucleation rate. The theory accounts for the effect of flow-mediated transport of molecules to the nucleus of the new phase, as well as for the mechanical deformation imparted to the nucleus by the flow field. The competition between flow-induced molecular transport, which accelerates nucleation, and flow-induced nucleus straining, which lowers the nucleation rate by increasing the nucleation energy barrier, gives rise to a marked nonmonotonic dependence of the nucleation rate on the shear rate. The theory predicts an optimal shear rate at which the nucleation rate is one order of magnitude larger than in the absence of flow.

  17. Atmospheric nucleation: highlights of the EUCAARI project and future directions

    Directory of Open Access Journals (Sweden)

    V.-M. Kerminen

    2010-11-01

    Full Text Available Within the project EUCAARI (European Integrated project on Aerosol Cloud Climate and Air Quality interactions, atmospheric nucleation was studied by (i developing and testing new air ion and cluster spectrometers, (ii conducting homogeneous nucleation experiments for sulphate and organic systems in the laboratory, (iii investigating atmospheric nucleation mechanism under field conditions, and (iv applying new theoretical and modelling tools for data interpretation and development of parameterisations. The current paper provides a synthesis of the obtained results and identifies the remaining major knowledge gaps related to atmospheric nucleation. The most important technical achievement of the project was the development of new instruments for measuring sub-3 nm particle populations, along with the extensive application of these instruments in both the laboratory and the field. All the results obtained during EUCAARI indicate that sulphuric acid plays a central role in atmospheric nucleation. However, also vapours other than sulphuric acid are needed to explain the nucleation and the subsequent growth processes, at least in continental boundary layers. Candidate vapours in this respect are some organic compounds, ammonia, and especially amines. Both our field and laboratory data demonstrate that the nucleation rate scales to the first or second power of the nucleating vapour concentration(s. This agrees with the few earlier field observations, but is in stark contrast with classical thermodynamic nucleation theories. The average formation rates of 2-nm particles were found to vary by almost two orders of magnitude between the different EUCAARI sites, whereas the formation rates of charged 2-nm particles varied very little between the sites. Overall, our observations are indicative of frequent, yet moderate, ion-induced nucleation usually outweighed by much stronger neutral nucleation events in the continental lower troposphere. The most concrete

  18. Improved age-hardening behavior of Mg–Sn–Mn alloy by addition of Ag and Zn

    International Nuclear Information System (INIS)

    Highlights: ► Age-hardening response of Mg–Sn–Mn alloy is enhanced by Ag and Ag + Zn. ► Ag promotes the nucleation and growth of the major Mg2Sn precipitates. ► Zn refines the Mg2Sn, promotes the formation of the blocky Mg54Ag17 phase. ► Ag segregates in the Mg2Sn precipitates. ► A new orientation relationship between Mg54Ag17 with α-Mg is discovered. - Abstract: The effect of 0.5 at% Ag and its combination with 0.4 at% Zn on the precipitation hardening behavior of Mg–1.5Sn–0.5Mn (at%) alloy have been investigated using hardness measurements and transmission electron microscopy (TEM). The results show that sole addition of Ag can remarkably improve the peak hardness from 58HV to 77HV after ageing at 200 °C, which is attributed to the increased number density, the size and so the volume fraction of the Mg2Sn lath precipitates. A combination addition of Ag and Zn further improves the peak-hardness to 83HV and the time to peak hardness has been reduced from 120 h to 100 h. The joint addition of Ag and Zn both increases the number density and refines the Mg2Sn precipitates. Zn also promotes the Mg2Sn precipitates lying on the non-basal plane of matrix, as well as the blocky Mg54Ag17 phase which has an orientation relationship with α-Mg matrix as (0 0 1)ε′//(0 0 0 1)α, [2 0 0]ε′//[ 1 −1 2 0]α, [0 −2 0]ε′//[1 −1 0 0]α. In the peak-aged Ag modified alloys, Ag atoms are segregated in the Mg2Sn precipitates. Nucleation, growth and coarsening of the Mg2Sn precipitates simultaneously occur as the ageing proceeds. The growth of Mg2Sn precipitates exhibits a significant anisotropic behavior. Addition of Ag can promote the precipitation process during the underage period and retarding the growth of Mg2Sn during the overage period, leading to a more thermal stable microstructure of the Ag and Ag + Zn modified alloys, from which only a small hardness decrease after 700 h ageing is detected.

  19. AGS experiments: 1990, 1991, 1992

    International Nuclear Information System (INIS)

    This report contains a description of the following: AGS Experimental Area - High Energy Physics FY 1993 and Heavy Ion Physics FY 1993; Table of Beam Parameters and Fluxes; Experiment Schedule ''as run''; Proposed 1993 Schedule; A listing of experiments by number; Two-page summaries of each experiment begin here, also ordered by number; Publications of AGS Experiments; and List of AGS Experimenters

  20. Kinetics of hole nucleation in biomembrane rupture

    Energy Technology Data Exchange (ETDEWEB)

    Evans, Evan [Biomedical Engineering, Boston University, Boston, MA 02215 (United States); Smith, Benjamin A, E-mail: evanse@bu.edu [Departments of Physics and Pathology, University of British Columbia, Vancouver, BC, V6T 2A6 (Canada)

    2011-09-15

    The core component of a biological membrane is a fluid-lipid bilayer held together by interfacial-hydrophobic and van der Waals interactions, which are balanced for the most part by acyl chain entropy confinement. If biomembranes are subjected to persistent tensions, an unstable (nanoscale) hole will emerge at some time to cause rupture. Because of the large energy required to create a hole, thermal activation appears to be requisite for initiating a hole and the activation energy is expected to depend significantly on mechanical tension. Although models exist for the kinetic process of hole nucleation in tense membranes, studies of membrane survival have failed to cover the ranges of tension and lifetime needed to critically examine nucleation theory. Hence, rupturing giant ({approx}20 {mu}m) membrane vesicles ultra-slowly to ultra-quickly with slow to fast ramps of tension, we demonstrate a method to directly quantify kinetic rates at which unstable holes form in fluid membranes, at the same time providing a range of kinetic rates from <0.01 to >100 s{sup -1}. Measuring lifetimes of many hundreds of vesicles, each tensed by precision control of micropipette suction, we have determined the rates of failure for vesicles made from several synthetic phospholipids plus 1:1 mixtures of phospho- and sphingo-lipids with cholesterol, all of which represent prominent constituents of eukaryotic cell membranes. Plotted on a logarithmic scale, the failure rates for vesicles are found to rise dramatically with an increase in tension. Converting the experimental profiles of kinetic rates into changes of activation energy versus tension, we show that the results closely match expressions for thermal activation derived from a combination of meso-scale theory and molecular-scale simulations of hole formation. Moreover, we demonstrate a generic approach to transform analytical fits of activation energies obtained from rupture experiments into energy landscapes characterizing the

  1. Kinetics of hole nucleation in biomembrane rupture

    Science.gov (United States)

    Evans, Evan; Smith, Benjamin A.

    2011-09-01

    The core component of a biological membrane is a fluid-lipid bilayer held together by interfacial-hydrophobic and van der Waals interactions, which are balanced for the most part by acyl chain entropy confinement. If biomembranes are subjected to persistent tensions, an unstable (nanoscale) hole will emerge at some time to cause rupture. Because of the large energy required to create a hole, thermal activation appears to be requisite for initiating a hole and the activation energy is expected to depend significantly on mechanical tension. Although models exist for the kinetic process of hole nucleation in tense membranes, studies of membrane survival have failed to cover the ranges of tension and lifetime needed to critically examine nucleation theory. Hence, rupturing giant (~20 μm) membrane vesicles ultra-slowly to ultra-quickly with slow to fast ramps of tension, we demonstrate a method to directly quantify kinetic rates at which unstable holes form in fluid membranes, at the same time providing a range of kinetic rates from 100 s-1. Measuring lifetimes of many hundreds of vesicles, each tensed by precision control of micropipette suction, we have determined the rates of failure for vesicles made from several synthetic phospholipids plus 1:1 mixtures of phospho- and sphingo-lipids with cholesterol, all of which represent prominent constituents of eukaryotic cell membranes. Plotted on a logarithmic scale, the failure rates for vesicles are found to rise dramatically with an increase in tension. Converting the experimental profiles of kinetic rates into changes of activation energy versus tension, we show that the results closely match expressions for thermal activation derived from a combination of meso-scale theory and molecular-scale simulations of hole formation. Moreover, we demonstrate a generic approach to transform analytical fits of activation energies obtained from rupture experiments into energy landscapes characterizing the process of hole nucleation

  2. New method for computer analysis of complex intermetallic compounds and nanocluster model of the samson phase Cd3Cu4

    International Nuclear Information System (INIS)

    A new method is proposed for the computer analysis of crystal structures of complex intermetallic compounds (with more than 1000 atoms per unit cell) using a developed algorithm of the complete decomposition of the 3D graph of the structure into nanocluster substructures. This method has been implemented in the TOPOS software package and approved successfully in an analysis of the complex Cu3Cd4 structure (Samson phase). Cu3Cd4 structure models were used to establish a structural relationship between nanoclusters in this intermetallic compound and nanoclusters in other complex crystal structures: ZrZn22, Ru7Mg44, NaCd2, and Mg2Al3.

  3. Kinetics of nucleation on highly curved surfaces

    Czech Academy of Sciences Publication Activity Database

    Sveshnikov, Alexey; Demo, Pavel; Kožíšek, Zdeněk

    Bratislava: Slovak Expert Group of Solid State Chemistry and Physics , 2011 - (Koman, M.; Jorík, V.), 70-71 ISBN 978-80-8134-002-4. [Joint Seminar – Development of materials science in research and education (DMRSE)/21.th./. Kežmarské Žlaby (SK), 29.08.2011-02.09.2011] R&D Projects: GA AV ČR IAA100100806 Institutional research plan: CEZ:AV0Z10100521 Keywords : phase transitions * nucleation Subject RIV: BM - Solid Matter Physics ; Magnetism

  4. Crystal nucleation and growth on heterogeneous surface

    Czech Academy of Sciences Publication Activity Database

    Kožíšek, Zdeněk; Demo, Pavel; Sveshnikov, Alexey; Tichá, Petra

    Bratislava: Slovak Expert Group of Solid State Chemistry and Physics , 2011 - (Koman, M.; Jorík, V.), 30-31 ISBN 978-80-8134-002-4. [Joint Seminar – Development of materials science in research and education (DMRSE)/21.th./. Kežmarské Žlaby (SK), 29.08.2011-02.09.2011] R&D Projects: GA AV ČR IAA100100806 Institutional research plan: CEZ:AV0Z10100521 Keywords : nucleation on active centers * crystallization Subject RIV: BM - Solid Matter Physics ; Magnetism

  5. Homogeneous nucleation kinetics in finite systems

    Czech Academy of Sciences Publication Activity Database

    Kožíšek, Zdeněk; Demo, Pavel

    Helsinki : Yliopistopaino, 2006 - (Vehkamaki, H.; Bergman, T.; Julin, J.; Salonen, M.; Kulmala, M.), s. 157-160 ISBN 952-5027-76-7. ISSN 0784-3496. - ( Report Series in Aerosol Science. 83). [NOSA 2006 Aerosol Symposium. Helsinky (FI), 08.11.2006-10.11.2006] R&D Projects: GA ČR GA101/05/2214; GA AV ČR IAA1010311 Institutional research plan: CEZ:AV0Z10100521 Keywords : nucleation * phase transitions * finite system * aerosol Subject RIV: BJ - Thermodynamics

  6. Thermal properties of radiolytically synthesized PVA/Ag nanocomposites

    Directory of Open Access Journals (Sweden)

    Krklješ Aleksandra N.

    2007-01-01

    crystallization was retarded. The half time of melting is non-linearly dependent on the amount of nanofiller. In the range from 0.25 to 1 wt% Ag it slightly increases, because at a low Ag content the nanoparticles act as a heterogeneous nucleation agent during the crystallization process. For large amounts of nanofiller, the half time of melting is markedly higher than for pure PVA. At a higher Ag content, the nanoparticles act as a barrier that restricts the thermal motion of PVA molecular chains and the half time of complete melting increases. The significantly lower melting activation energy of the nanocomposites with high amount of nanofiller compared to pure PVA, calculated by the Kissinger method, indicated that nanoparticles reduced the heat barrier for the melting process. .

  7. Solute Nucleation and Growth in Supercritical Fluid Mixtures

    Science.gov (United States)

    Smedley, Gregory T.; Wilemski, Gerald; Rawlins, W. Terry; Joshi, Prakash; Oakes, David B.; Durgin, William W.

    1996-01-01

    This research effort is directed toward two primary scientific objectives: (1) to determine the gravitational effect on the measurement of nucleation and growth rates near a critical point and (2) to investigate the nucleation process in supercritical fluids to aid in the evaluation and development of existing theoretical models and practical applications. A nucleation pulse method will be employed for this investigation using a rapid expansion to a supersaturated state that is maintained for approximately 1 ms followed by a rapid recompression to a less supersaturated state that effectively terminates nucleation while permitting growth to continue. Nucleation, which occurs during the initial supersaturated state, is decoupled from growth by producing rapid pressure changes. Thermodynamic analysis, condensation modeling, apparatus design, and optical diagnostic design necessary for the initiation of a theoretical and experimental investigation of naphthalene nucleation from supercritical CO2 have been completed.

  8. Aerosol nucleation induced by a high energy particle beam

    DEFF Research Database (Denmark)

    Enghoff, Martin Andreas Bødker; Pedersen, Jens Olaf Pepke; Uggerhøj, Ulrik I.;

    The effect of ions in aerosol nucleation is a subject where much remains to be discovered. That ions can enhance nucleation has been shown by theory, observations, and experiments. However, the exact mechanism still remains to be determined. One question is if the nature of the ionization affects...... the nucleation. This is an essential question since many experiments have been performed using radioactive sources that ionize differently than the cosmic rays which are responsible for the majority of atmospheric ionization. Here we report on an experimental study of sulphuric acid aerosol nucleation under near...... atmospheric conditions using a 580 MeV electron beam to ionize the volume of the reaction chamber. We find a clear and significant contribution from ion induced nucleation and consider this to be an unambiguous observation of the ion-effect on aerosol nucleation using a particle beam under conditions not far...

  9. Revision of the classical nucleation theory for supersaturated solutions

    CERN Document Server

    Borisenko, Alexander

    2015-01-01

    During the processes of nucleation and growth of a precipitate cluster from a supersaturated solution, the diffusion flux between the cluster and the solution changes the solute concentration near the cluster-solution interface from its average bulk value. This feature affects the rates of attachment and detachment of solute atoms at the interface and, therefore, alters the entire nucleation kinetics. Unless quite obvious, this effect has been ignored in the classical nucleation theory. To illustrate the results of this new approach, for the case of homogeneous nucleation, we calculate the total solubility (including the contribution from heterophase fluctuations) and the nucleation rate as functions of two parameters of the model and compare these results to the classical ones. One can conclude that discrepancies with the classical nucleation theory are great in the diffusion-limited regime, when the bulk diffusion mobility of solute atoms is small compared to the interfacial one, while in the opposite inter...

  10. Optically active red-emitting Cu nanoclusters originating from complexation and redox reaction between copper(ii) and d/l-penicillamine

    Science.gov (United States)

    Long, Tengfei; Guo, Yanjia; Lin, Min; Yuan, Mengke; Liu, Zhongde; Huang, Chengzhi

    2016-05-01

    Despite a significant surge in the number of investigations into both optically active Au and Ag nanostructures, there is currently only limited knowledge about optically active Cu nanoclusters (CuNCs) and their potential applications. Here, we have succeeded in preparing a pair of optically active red-emitting CuNCs on the basis of complexation and redox reaction between copper(ii) and penicillamine (Pen) enantiomers, in which Pen serves as both a reducing agent and a stabilizing ligand. Significantly, the CuNCs feature unique aggregation induced emission (AIE) characteristics and therefore can serve as pH stimuli-responsive functional materials. Impressively, the ligand chirality plays a dramatic role for the creation of brightly emissive CuNCs, attributed to the conformation of racemic Pen being unfavorable for the electrostatic interaction, and thus suppressing the formation of cluster aggregates. In addition, the clusters display potential toward cytoplasmic staining and labelling due to the high photoluminescence (PL) quantum yields (QYs) and remarkable cellular uptake, in spite that no chirality-dependent effects in autophagy and subcellular localization are observed in the application of chiral cluster enantiomer-based cell imaging.Despite a significant surge in the number of investigations into both optically active Au and Ag nanostructures, there is currently only limited knowledge about optically active Cu nanoclusters (CuNCs) and their potential applications. Here, we have succeeded in preparing a pair of optically active red-emitting CuNCs on the basis of complexation and redox reaction between copper(ii) and penicillamine (Pen) enantiomers, in which Pen serves as both a reducing agent and a stabilizing ligand. Significantly, the CuNCs feature unique aggregation induced emission (AIE) characteristics and therefore can serve as pH stimuli-responsive functional materials. Impressively, the ligand chirality plays a dramatic role for the creation of

  11. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    Science.gov (United States)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  12. A facile route to aqueous Ag:ZnCdS and Ag:ZnCdSeS quantum dots: Pure emission color tunable over entire visible spectrum

    International Nuclear Information System (INIS)

    Highlights: • For the first time, a highly reactive and aqueous sulfur precursor was obtained. • The obtained Ag-doped QDs exhibited high PL QY as high as 40%. • The emission color was tunable and could span entire visible spectrum. • We provided a versatile approach to other aqueous multinary chalcogenide QDs. - Abstract: Aqueous Ag:ZnCdS quantum dots (QDs) with pure, color-tunable fluorescence were prepared based on co-nucleation doping strategy by using a highly reactive S powder precursor, which was reduced by NaBH4 at high temperature of 180 °C in a closed hydrothermal autoclave. For a meaningful comparison, thiourea as a relatively low reactive precursor was employed to test the advantages of this highly reactive S powder precursor in synthetic chemistry. The influences of various experimental variables, including the Zn/Cd ratio and Ag-doping concentration, on the optical properties of Ag:ZnCdS QDs were systematically investigated. The color-tunable quarternary Ag:ZnCdSeS QDs were also successfully prepared via the variation of Se/S precursor ratio based on the similar reactivity of the Se and S powder precursors. Further, the highly efficient Ag:ZnCdS/ZnS and Ag:ZnCdSeS/ZnS core/shell QDs were constructed by the deposition of the ZnS shell around the crude Ag:ZnCdS and Ag:ZnCdSeS core QDs. The results indicated that this facile synthetic route would provide a versatile approach for preparation of other aqueous multinary metal chalcogenide QDs

  13. Blue, green and red emissive silver nanoclusters formed in organic solvents

    OpenAIRE

    Díez, Isabel

    2012-01-01

    Strongly luminescent silver nanoclusters with tunable emission are directly synthesized in organic polar and apolar solvents. We show that an amphiphilic polystyrene-block-poly(methacrylic acid) block copolymer can be universally used as their support medium. A remarkable similarity in spectroscopic properties is observed between these clusters and charge-transfer organic dyes. This journal is © 2012 The Royal Society of Chemistry.

  14. The role of oxygen and water on molybdenum nanoclusters for electro catalytic ammonia production

    Directory of Open Access Journals (Sweden)

    Jakob G. Howalt

    2014-01-01

    Full Text Available The presence of water often gives rise to oxygen adsorption on catalyst surfaces through decomposition of water and the adsorbed oxygen or hydroxide species often occupy important surfaces sites, resulting in a decrease or a total hindrance of other chemical reactions taking place at that site. In this study, we present theoretical investigations of the influence of oxygen adsorption and reduction on pure and nitrogen covered molybdenum nanocluster electro catalysts for electrochemical reduction of N2 to NH3 with the purpose of understanding oxygen and water poisoning of the catalyst. Density functional theory calculations are used in combination with the computational hydrogen electrode approach to calculate the free energy profile for electrochemical protonation of O and N2 species on cuboctahedral Mo13 nanoclusters. The calculations show that the molybdenum nanocluster will preferentially bind oxygen over nitrogen and hydrogen at neutral bias, but under electrochemical reaction conditions needed for nitrogen reduction, oxygen adsorption is severely weakened and the adsorption energy is comparable to hydrogen and nitrogen adsorption. The potentials required to reduce oxygen off the surface are −0.72 V or lower for all oxygen coverages studied, and it is thus possible to (reactivate (partially oxidized nanoclusters for electrochemical ammonia production, e.g., using a dry proton conductor or an aqueous electrolyte. At lower oxygen coverages, nitrogen molecules can adsorb to the surface and electrochemical ammonia production via the associative mechanism is possible at potentials as low as −0.45 V to −0.7 V.

  15. Photophysical characterization of fluorescent metal nanoclusters synthesized using oligonucleotides, proteins and small molecule ligands

    Science.gov (United States)

    Yeh, Hsin-Chih; Sharma, Jaswinder; Yoo, Hyojong; Martinez, Jennifer S.; Werner, James H.

    2010-02-01

    The size transition from bulk conducting metals to insulating nanoparticles and eventually to single atoms passes through the relatively unexplored few-atom nanocluster region. With dimensions close to the Fermi wavelength, these nanoclusters demonstrate molecule-like properties distinct from bulk metals or atoms, such as discrete and size-tunable electronic transitions which lead to photoluminescence. Current research aims to elucidate the fundamental photophysical properties of metal nanoclusters made by different means and based on different encapsulation agents. Here, we report the study of the photophysical properties, including quantum yields, lifetimes, extinction coefficients, blinking dynamics and sizes, of silver and gold nanoclusters synthesized using oligonucleotides, a protein (bovine serum albumin) and a Good's buffer molecule (MES, 2-(N-morpholino) ethanesulfonic acid) as encapsulation agents. We also investigate the change of photoluminescence as a function of temperature. Furthermore, we show that the fluorescent metal clusters can be used as a donor in forming a resonance energy transfer pair with a commercial organic quencher. These new fluorophores have great potential as versatile tools for a broad range of applications in biological and chemical detection.

  16. Gold Nanocluster and Quantum Dot Complex in Protein for Biofriendly White-Light-Emitting Material.

    Science.gov (United States)

    Bhandari, Satyapriya; Pramanik, Sabyasachi; Khandelia, Rumi; Chattopadhyay, Arun

    2016-01-27

    We report the synthesis of a biofriendly highly luminescent white-light-emitting nanocomposite. The composite consisted of Au nanoclusters and ZnQ2 complex (on the surface of ZnS quantum dots) embedded in protein. The combination of red, green, and blue luminescence from clusters, complex, and protein, respectively, led to white light generation. PMID:26741861

  17. Magnetic properties of Fe nanoclusters on Cu(111) studied with X-ray magnetic circular dichroism

    Energy Technology Data Exchange (ETDEWEB)

    Fauth, Kai [Physikalisches Institut, Universitaet Wuerzburg (Germany); MPI for Metals Research, Stuttgart (Germany); Ballentine, Greg E. [MPI for Metals Research, Stuttgart (Germany); Praetorius, Christian [Physikalisches Institut, Universitaet Wuerzburg (Germany); Kleibert, Armin; Wilken, Norman; Voitkans, Andris; Meiwes-Broer, Karl-Heinz [Institute of Physics, University of Rostock (Germany)

    2010-05-15

    The magnetisation and magnetic response of Fe nanoclusters are studied by temperature and density dependent in situ X-ray magnetic circular dichroism after deposition onto Cu(111). The nanoclusters possess enhanced spin magnetic moments at low temperature, whereas no enhancement is found for the orbital moments. The analysis of magnetisation curves and the temperature dependent remnant magnetisation reveals that the individual magnetic anisotropy energies are distributed over a wide range of values, ranging from below to far above the value of bulk {alpha}-Fe. As a result, ferromagnetic response is obtained at ambient temperature, even though the nanocluster densities range well below percolation threshold. At higher cluster densities agglomeration and substrate mediated interaction increase the mean blocking temperature in the particle ensemble. The observed macroscopic magnetic in-plane anisotropy derives from the average dipolar interactions between the nanoclusters. Single particle properties, substrate mediated coupling and dipolar interactions thus independently contribute to magnetic characteristics on equal footing. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  18. Self-Assembled Superparamagnetic Iron Oxide Nanoclusters for Universal Cell Labeling and MRI.

    Science.gov (United States)

    Chen, Shuzhen; Zhang, Jun; Jiang, Shengwei; Lin, Gan; Luo, Bing; Yao, Huan; Lin, Yuchun; He, Chengyong; Liu, Gang; Lin, Zhongning

    2016-12-01

    Superparamagnetic iron oxide (SPIO) nanoparticles have been widely used in a variety of biomedical applications, especially as contrast agents for magnetic resonance imaging (MRI) and cell labeling. In this study, SPIO nanoparticles were stabilized with amphiphilic low molecular weight polyethylenimine (PEI) in an aqueous phase to form monodispersed nanocomposites with a controlled clustering structure. The iron-based nanoclusters with a size of 115.3 ± 40.23 nm showed excellent performance on cellular uptake and cell labeling in different types of cells, moreover, which could be tracked by MRI with high sensitivity. The SPIO nanoclusters presented negligible cytotoxicity in various types of cells as detected using MTS, LDH, and flow cytometry assays. Significantly, we found that ferritin protein played an essential role in protecting stress from SPIO nanoclusters. Taken together, the self-assembly of SPIO nanoclusters with good magnetic properties provides a safe and efficient method for universal cell labeling with noninvasive MRI monitoring capability. PMID:27216601

  19. Photophysical characterization of fluorescent metal nanoclusters sythesized using oligonucleotides, proteins and small reagent moleucles

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, Hsin-chih [Los Alamos National Laboratory; Jaswinder, Sharma K [Los Alamos National Laboratory; Martinez, Jennifer S [Los Alamos National Laboratory; Werner, James H [Los Alamos National Laboratory; Yoo, Hyojong [Los Alamos National Laboratory

    2009-01-01

    The size transition from bulk metals to insulating nanoparticles and eventually to single atoms passes through the relatively unexplored few-atom nanocluster region. With climensions close to the Fermi wavelength, these nanoclusters demonstrate molecule-like properties distinct from bulk metals or atoms, such as discrete and size-tunable electronic transitions which lead to photoluminescence. Current research aims to elucidate the fundamental photophysical properties of the existing metal nanoclusters made by different means and based on different encapsulation agents. Here, we report the study of the photophysical properties, including quantum yields, lifetimes, extinction coefficients, blinking dynamics and sizes, of silver and gold nanoclusters synthesized using oligonucleotides, a protein (bovine serum albumin) and a Good's buffer molecule (MES, 2-(N-morpholino)ethanesulfonic acid) as encapsulation agents. We also investigate the change of photoluminescence under varying conditions (time, temperature and salt). Furthermore, it is demonstrated here that fluorescent metal clusters can be used as a donor in forming resonance energy transfer pairs with a commercial organic quenching dye.

  20. UV-laser-induced nanoclusters in silver ion-exchanged soda-lime silicate glass

    International Nuclear Information System (INIS)

    Excimer-laser irradiation (ArF: 193 nm) was performed on silver-exchanged commercial soda-lime silicate glass. Silver nanoclusters were obtained with an average size dependent on the irradiation time, without subsequent heating. Laser irradiation induces the reduction of silver ions and promotes the silver atoms aggregation

  1. Synthesis of crystalline Ge nanoclusters in PE-CVD-deposited SiO2 films

    DEFF Research Database (Denmark)

    Leervad Pedersen, T.P.; Skov Jensen, J.; Chevallier, J.; Jensen, J. M.; Hansen, Ole

    2005-01-01

    controlled in the range of 3-6 nm by variation of the annealing parameters. Using a combination of transmission electron microscopy and Raman-scattering spectroscopy, the nanoclusters were shown to be crystalline. However, photoluminescence measurements showed no light emission that could be definitively...

  2. Electrochemistry and the mechanisms of nucleation and growth of neodymium during electroreduction from LiCl–KCl eutectic salts on Mo substrate

    International Nuclear Information System (INIS)

    The electrochemical behavior of NdCl3 was studied on a Mo electrode in molten LiCl–KCl eutectic salts. The electroreduction of Nd(III)/Nd(0) involved two reaction steps, as confirmed by three different electrochemical techniques. In the first reaction step, Nd(III) is converted into soluble Nd(II), which undergoes further reduction into metallic Nd(0) in the second reaction step. The standard reaction rate constants for each reaction step were determined by Nicholson method. The rate constant values were used in Matsuda-Ayabe’s criteria for testing the electrochemical reversibility. Accordingly, both reaction steps were quasi-reversible redox reactions. The nucleation mechanisms of neodymium metal deposited on a Mo substrate were predicted by using Scharifker–Hill model, and tested for the first time by scanning electron microscopy (SEM) studies of the electrode surface. The SEM studies confirmed that for the low initial concentration of NdCl3, neodymium nucleates and grows progressively, while for higher NdCl3 concentrations, the related mechanism is instantaneous. Both are governed by the aggregative growth mechanisms based on surface mobility of formed nanoclusters

  3. Electrochemistry and the mechanisms of nucleation and growth of neodymium during electroreduction from LiCl–KCl eutectic salts on Mo substrate

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Hao [Key Laboratory of Superlight Materials and Surface Technology, Ministry of Education, College of Materials Science and Chemical Engineering, Harbin Engineering University, Harbin 150001 (China); Department of Chemical and Materials Engineering, University of Idaho, Moscow, ID 83844 (United States); Pesic, Batric, E-mail: pesic@uidaho.edu [Department of Chemical and Materials Engineering, University of Idaho, Moscow, ID 83844 (United States)

    2015-03-15

    The electrochemical behavior of NdCl{sub 3} was studied on a Mo electrode in molten LiCl–KCl eutectic salts. The electroreduction of Nd(III)/Nd(0) involved two reaction steps, as confirmed by three different electrochemical techniques. In the first reaction step, Nd(III) is converted into soluble Nd(II), which undergoes further reduction into metallic Nd(0) in the second reaction step. The standard reaction rate constants for each reaction step were determined by Nicholson method. The rate constant values were used in Matsuda-Ayabe’s criteria for testing the electrochemical reversibility. Accordingly, both reaction steps were quasi-reversible redox reactions. The nucleation mechanisms of neodymium metal deposited on a Mo substrate were predicted by using Scharifker–Hill model, and tested for the first time by scanning electron microscopy (SEM) studies of the electrode surface. The SEM studies confirmed that for the low initial concentration of NdCl{sub 3}, neodymium nucleates and grows progressively, while for higher NdCl{sub 3} concentrations, the related mechanism is instantaneous. Both are governed by the aggregative growth mechanisms based on surface mobility of formed nanoclusters.

  4. Nucleation of ferrite in austenite: the role of crystallography

    OpenAIRE

    Landheer, H.

    2010-01-01

    The nucleation mechanisms during solid-state phase transformations in polycrystalline materials are still not completely understood. The nucleation stage has a strong influence on the overall evolution of phase transformations, which determines the final microstructure and thereby the properties of the material. The understanding of grain nucleation is important for controlling the production process, the design of new steel grades with optimal mechanical properties, and the production of tai...

  5. Simulations of nucleation and elongation of amyloid fibrils

    OpenAIRE

    Zhang, Jianing; Muthukumar, M.

    2009-01-01

    We present a coarse-grained model for the growth kinetics of amyloid fibrils from solutions of peptides and address the fundamental mechanism of nucleation and elongation by using a lattice Monte Carlo procedure. We reproduce the three main characteristics of nucleation of amyloid fibrils: (1) existence of lag time, (2) occurrence of a critical concentration, and (3) seeding. We find the nucleation of amyloid fibrils to require a quasi-two-dimensional configuration, where a second layer of β ...

  6. Atmospheric nucleation: highlights of the EUCAARI project and future directions

    OpenAIRE

    Kerminen, V.-M.; T. Petäjä; Manninen, H. E.; Paasonen, P.; Nieminen, T.; Sipilä, M.; Junninen, H.; M. Ehn; Gagné, S.; Laakso, L.; Riipinen, I; Vehkamäki, H.; Kurten, T.; Ortega, I.K.; Dal Maso, M.

    2010-01-01

    Within the project EUCAARI (European Integrated project on Aerosol Cloud Climate and Air Quality interactions), atmospheric nucleation was studied by (i) developing and testing new air ion and cluster spectrometers, (ii) conducting homogeneous nucleation experiments for sulphate and organic systems in the laboratory, (iii) investigating atmospheric nucleation mechanism under field conditions, and (iv) applying new theoretical and modelling tools for data interpretation and development of para...

  7. Atomic scale simulation of carbon nanotube nucleation from hydrocarbon precursors

    OpenAIRE

    Khalilov, Umedjon; Bogaerts, Annemie; Neyts, Erik C.

    2015-01-01

    Atomic scale simulations of the nucleation and growth of carbon nanotubes is essential for understanding their growth mechanism. In spite of over twenty years of simulation efforts in this area, limited progress has so far been made on addressing the role of the hydrocarbon growth precursor. Here we report on atomic scale simulations of cap nucleation of single-walled carbon nanotubes from hydrocarbon precursors. The presented mechanism emphasizes the important role of hydrogen in the nucleat...

  8. Comment on "Simple improvements to classical bubble nucleation models"

    Science.gov (United States)

    Schmelzer, Jürn W. P.; Baidakov, Vladimir G.

    2016-08-01

    A critical analysis of several statements concerning experimental studies, molecular dynamics simulations, and the theoretical interpretation of bubble nucleation processes is performed. In particular, it is shown that the Tolman equation does not supply us, in general, with a satisfactory theoretically founded description of the curvature dependence of the surface tension and the dependence of the steady-state nucleation rate of bubbles and droplets on supersaturation in the framework of classical nucleation theory.

  9. Three separate classes of bacterial ice nucleation structures.

    OpenAIRE

    Turner, M.A.; Arellano, F; Kozloff, L. M.

    1990-01-01

    Studies of the properties of the ice nucleation structure exposed on the surfaces of various bacteria such as Pseudomonas syringae, Erwinia herbicola, or various strains of Ice+ recombinant Escherichia coli have shown that there are clearly three major related but chemically distinct types of structures on these cells. First, the ability of Ice+ cells to nucleate super-cooled D2O has been examined, and it has been found that this ability (relative to the ability of the same cells to nucleate ...

  10. NUCLEATION RATE OF DIAMOND FILMS ON WC-Co ALLOYS

    OpenAIRE

    SHA LIU

    2005-01-01

    Diamond-coated hard alloys are prospective tool materials for extreme cutting conditions. Nucleation rate is one of important factors that affect the qualities of diamond thin films on WC-Co alloys. However, theoretical reports on nucleation rate of diamond films on WC-Co alloys are scarce. Combining the unique diamond strong orientation with substrate surface properties, an improved theoretical formula on nucleation rate of diamond films on the WC-Co alloys is deduced in this paper. First, t...

  11. Mediating conducting polymer growth within hydrogels by controlling nucleation

    OpenAIRE

    A. J. Patton; Green, R A; L. A. Poole-Warren

    2015-01-01

    This study examines the efficacy of primary and secondary nucleation for electrochemical polymerisation of conductive polymers within poly(vinyl alcohol) methacrylate hydrogels. The two methods of nucleation investigated were a primary heterogeneous mechanism via introduction of conductive bulk metallic glass (Mg64Zn30Ca5Na1) particles and a secondary mechanism via introduction of “pre-polymerised” conducting polymer within the hydrogel (PEDOT:PSS). Evidence of nucleation was not seen in the ...

  12. Modified in situ and self-catalytic growth method for fabrication of Ag-coated nanocomposites with tailorable optical properties

    International Nuclear Information System (INIS)

    Inorganic or organic solid supported metal nanostructures have been attracted intensive interests in recent years. In this study, a novel and versatile approach for the preparation of solid supported silver nanocomposites is presented for the first time. In this method, the modified aldehyde groups on solid supporters are employed to reduce Ag[(NH3)2]+ ions. The in situ reduced silver nucleus are directly coated on the surfaces of the supports and then used as both seeds and catalysts for the self-catalytic growth of Ag NPs. In this reaction, no additional reduction and protective agents are needed. Moreover, the size of the Ag NPs can be tuned by varying the concentration of the Ag[(NH3)2]+ ions and the reaction time, which leads to the interesting change of the localized surface plasmon resonance absorption of the NPs. Such a synthesis method may realize the separation of nucleation and growth stages for the formation of Ag NPs and is proved to be a versatile method for the preparation of solid supported Ag nanocomposites (PS–Ag, Fe3O4–Ag, and SiO2–Ag), which would benefit the preparations and further applications of functional materials in near future.

  13. Direct laser planting of hybrid Au-Ag/C nanostructures - nanoparticles, flakes and flowers

    CERN Document Server

    Manshina, Alina; Bashouti, Muhammad; Povolotskiy, Alexey; Petrov, Yuriy; Koshevoy, Igor; Christiansen, Silke; Tunik, Sergey; Leuchs, Gerd

    2015-01-01

    We demonstrate a new approach for forming hybrid metal/carbonaceous nanostructures in a controlled direct laser planting process. Au-Ag nanoclusters in amorphous or crystalline carbonaceous matrices are formed with different morphology: nanoparticles, nanoflakes, and nanoflowers. In contrast to other generation techniques our approach is simple, involving only a single laser-induced process transforming supramolecular complexes dissolved in solvent such as acetone, acetophenone, or dichloroethane into hybrid nanostructures in the laser-affected area of the substrate. The morphology of the hybrid nanostructures can be steered by controlling the deposition parameters, the composition of the liquid phase and the type of substrate, amorphous or crystalline. The carbonaceous phase of the hybrid nanostructures consists of hydrogenated amorphous carbon in the case of nanoparticles and of crystalline orthorhombic graphite of nanoscale thickness in the case of flakes and flowers. To the best of our knowledge this is t...

  14. Thermodynamics of ice nucleation in liquid water.

    Science.gov (United States)

    Wang, Xin; Wang, Shui; Xu, Qinzhi; Mi, Jianguo

    2015-01-29

    We present a density functional theory approach to investigate the thermodynamics of ice nucleation in supercooled water. Within the theoretical framework, the free-energy functional is constructed by the direct correlation function of oxygen-oxygen of the equilibrium water, and the function is derived from the reference interaction site model in consideration of the interactions of hydrogen-hydrogen, hydrogen-oxygen, and oxygen-oxygen. The equilibrium properties, including vapor-liquid and liquid-solid phase equilibria, local structure of hexagonal ice crystal, and interfacial structure and tension of water-ice are calculated in advance to examine the basis for the theory. The predicted phase equilibria and the water-ice surface tension are in good agreement with the experimental data. In particular, the critical nucleus radius and free-energy barrier during ice nucleation are predicted. The critical radius is similar to the simulation value, suggesting that the current theoretical approach is suitable in describing the thermodynamic properties of ice crystallization. PMID:25546012

  15. Evaluation of onset of nucleate boiling models

    International Nuclear Information System (INIS)

    This article discusses available models and correlations for predicting the required heat flux or wall superheat for the Onset of Nucleate Boiling (ONB) on plain surfaces. It reviews ONB data in the open literature and discusses the continuing efforts of Heat Transfer Research, Inc. in this area. Our ONB database contains ten individual sources for ten test fluids and a wide range of operating conditions for different geometries, e.g., tube side and shell side flow boiling and falling film evaporation. The article also evaluates literature models and correlations based on the data: no single model in the open literature predicts all data well. The prediction uncertainty is especially higher in vacuum conditions. Surface roughness is another critical criterion in determining which model should be used. However, most models do not directly account for surface roughness, and most investigators do not provide surface roughness information in their published findings. Additional experimental research is needed to improve confidence in predicting the required wall superheats for nucleation boiling for engineering design purposes. (author)

  16. Twin nucleation and migration in FeCr single crystals

    International Nuclear Information System (INIS)

    Tension and compression experiments were conducted on body-centered cubic Fe -47.8 at pct. Cr single crystals. The critical resolved shear stress (CRSS) magnitudes for slip nucleation, twin nucleation and twin migration were established. We show that the nucleation of slip occurs at a CRSS of about 88 MPa, while twinning nucleates at a CRSS of about 191 MPa with an associated load drop. Following twin nucleation, twin migration proceeds at a CRSS that is lower than the initiation stress (≈ 114–153 MPa). The experimental results of the nucleation stresses indicate that the Schmid law holds to a first approximation for the slip and twin nucleation cases, but to a lesser extent for twin migration particularly when considerable slip strains preceded twinning. The CRSSs were determined experimentally using digital image correlation (DIC) in conjunction with electron back scattering diffraction (EBSD). The DIC measurements enabled pinpointing the precise stress on the stress–strain curves where twins or slip were activated. The crystal orientations were obtained using EBSD and used to determine the activated twin and slip systems through trace analysis. - Highlights: ► Digital image correlation allows to capture slip/twin initiation for bcc FeCr. ► Crystal orientations from EBSD allow slip/twin system indexing. ► Nucleation of slip always precedes twinning. ► Twin growth is sustained with a lower stress than required for nucleation. ► Twin-slip interactions provide high hardening at the onset of plasticity.

  17. Aerosol nucleation induced by a high energy particle beam

    DEFF Research Database (Denmark)

    Enghoff, Martin Andreas Bødker; Pedersen, Jens Olaf Pepke; Uggerhøj, Ulrik I.;

    2011-01-01

    We have studied sulfuric acid aerosol nucleation in an atmospheric pressure reaction chamber using a 580 MeV electron beam to ionize the volume of the reaction chamber. We find a clear contribution from ion-induced nucleation and consider this to be the first unambiguous observation of the ion-effect...... on aerosol nucleation using a particle beam under conditions that resemble the Earth's atmosphere. By comparison with ionization using a gamma source we further show that the nature of the ionizing particles is not important for the ion-induced component of the nucleation. This implies that...

  18. Modeling HIV-1 viral capsid nucleation by dynamical systems.

    Science.gov (United States)

    Sadre-Marandi, Farrah; Liu, Yuewu; Liu, Jiangguo; Tavener, Simon; Zou, Xiufen

    2015-12-01

    There are two stages generally recognized in the viral capsid assembly: nucleation and elongation. This paper focuses on the nucleation stage and develops mathematical models for HIV-1 viral capsid nucleation based on six-species dynamical systems. The Particle Swarm Optimization (PSO) algorithm is used for parameter fitting to estimate the association and dissociation rates from biological experiment data. Numerical simulations of capsid protein (CA) multimer concentrations demonstrate a good agreement with experimental data. Sensitivity and elasticity analysis of CA multimer concentrations with respect to the association and dissociation rates further reveals the importance of CA trimer-of- dimers in the nucleation stage of viral capsid self- assembly. PMID:26596714

  19. Experimental investigation of the role of ions in aerosol nucleation

    DEFF Research Database (Denmark)

    Enghoff, Martin Andreas Bødker

    nucleation theory. Several ideas have been put forward to solve this nucleation problem, e.g. Ion-Induced Nucleation (Raes & Janssens 1985) and Ternary Nucleation (Kulmala et al. 2000). Experimental investigations exploring the role of ions in particle production are scarce, and often at conditions far...... energetic cosmic rays can promote the production of cloud condensation nuclei at low altitudes constitutes a link between cosmic rays and Earth's climate and there is thus a need to corroborate the results in a different experiment The present results are obtained in the same laboratory, but using a new...

  20. Substrate dependent buffer-layer assisted growth of nanoclusters

    Energy Technology Data Exchange (ETDEWEB)

    Honolka, Jan; Sessi, Violetta; Hertenberger, Simon; Kern, Klaus [Max-Planck Institute for Solid State Research, Stuttgart (Germany); Zhang, Jian [Max-Planck Institute for Solid State Research, Stuttgart (Germany); School of Material Science and Engineering, Hebei University of Technology, TianJin (China); Enders, Axel [Department of Physics and Astronomy and NCMN, University of Nebraska, Lincoln, Nebraska (United States)

    2010-05-15

    The role of the substrate on the morphology of nanometer size clusters fabricated by buffer layer assisted growth (BLAG) was studied using scanning tunneling microscopy. Clusters of Fe and Co were deposited on Ag(111), Cu(100), Rh(111), and Pt(111) surfaces using identical BLAG parameters, which are temperature, as well as metal and buffer layer coverage. Semi-hemispherical clusters are found on Ag(111) and Cu(100), while flat monolayer high islands are observed on Rh(111) and Pt(111) due to complete wetting. The results of this study are in agreement with the common notion that BLAG is useful to deposit clusters of virtually any material on any substrate, however, the shape, size, and lateral distribution of the resulting clusters depend strongly on the substrate surface free energy and diffusion processes. (Abstract Copyright [2010], Wiley Periodicals, Inc.)