WorldWideScience

Sample records for africano eleusine coracana

  1. The genetic map of finger millet, Eleusine coracana.

    Science.gov (United States)

    Dida, Mathews M; Srinivasachary; Ramakrishnan, Sujatha; Bennetzen, Jeffrey L; Gale, Mike D; Devos, Katrien M

    2007-01-01

    Restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), expressed-sequenced tag (EST), and simple sequence repeat (SSR) markers were used to generate a genetic map of the tetraploid finger millet (Eleusine coracana subsp. coracana) genome (2n = 4x = 36). Because levels of variation in finger millet are low, the map was generated in an inter-subspecific F(2) population from a cross between E. coracana subsp. coracana cv. Okhale-1 and its wild progenitor E. coracana subsp. africana acc. MD-20. Duplicated loci were used to identify homoeologous groups. Assignment of linkage groups to the A and B genome was done by comparing the hybridization patterns of probes in Okhale-1, MD-20, and Eleusine indica acc. MD-36. E. indica is the A genome donor to E. coracana. The maps span 721 cM on the A genome and 787 cM on the B genome and cover all 18 finger millet chromosomes, at least partially. To facilitate the use of marker-assisted selection in finger millet, a first set of 82 SSR markers was developed. The SSRs were identified in small-insert genomic libraries generated using methylation-sensitive restriction enzymes. Thirty-one of the SSRs were mapped. Application of the maps and markers in hybridization-based breeding programs will expedite the improvement of finger millet.

  2. The 'A' genome donor of Eleusine coracana (L.) Gaertn. (Gramineae).

    Science.gov (United States)

    Hiremath, S C; Salimath, S S

    1992-08-01

    In an attempt to discover 'A' and 'B' genome donor(s) to finger millet, Eleusine coracana, or its progenitor species, E. africana (both allotetraploid 2n=4x=36), five diploid species, E. Indica, E. Floccifolia, E. multiflora, E. tristachya and E. intermedia, were crossed to finger millet and its progenitor taxon. Crosses were successful only with E. coracana. Three combinations of triploid hybrids E. coracana x E. indica, E. coracana x E. floccifolia, and E. coracana x E. multiflora were obtained and analysed. Meiotic behaviour was perfectly normal in parental species. The regular number of 18 bivalents in E. coracana, 9 bivalents in E. indica, E. intermedia, E. tristachya and E. floccifolia and 8 bivalents in E. multiflora were invariably noticed. In E. coracana x E. indica hybrids a mean chromosome pairing of 8.84I+8.80II+0.03III+0.10IV per cell was found. About 86.5% of the cells showed the typical 9I+9II configuration, suggesting that E. indica (AA) is one of the diploid genome donors to cultivated species E. coracana. A mean chromosome pairing of 11.08I+7.63II+0.16III+0.04IV per cell was found in E. coracana x E. floccifolia hybrids. Two to ten bivalents and varying numbers of univalents were seen in 55% of the cells. About 45% of the cells showed the 9I+9II configuration. Various evidence suggests that perennial E. floccifolia is a primitive member of the 'A' genome group of Eleusine species, and it may not be a genome donor to E. coracana. In E. coracana x E. multiflora hybrids (2n=26) mean chromosome pairing of 21.45I+1.97II+0.13III+0.04IV per cell was found. About 91% of the cells were observed to have 20-26 univalents. Only a small percentage of the cells contained bivalents or multivalents. This pairing behaviour indicates that E. multiflora lacks genomic homology with the 'A' or 'B' genome of E. coracana. Genomically E. multiflora is a distinct species and a genomic symbol of 'C' is assigned to it. Identification of the 'B' genome donor species to

  3. Radiation studies in Eleusine coracana (L.) Gaertn

    International Nuclear Information System (INIS)

    Singh, D.N.; Godward, M.B.E.

    1974-01-01

    The effects of irradiation with high energy β-rays, hard X-rays and γ-rays have been studied on Eleusine coracana, the finger millet using dry dormant seed, which was germinated and grown on to maturity and allowed to form seed. The doses of 2 to 500 kr were used. The following general effects were observed: There was 100 percent germination at all doses. The percentage of seedings surviving decreased with increased dose. There was 7-8 percent survival at 100 kr and there was no survival beyond one week above 150 kr. At 500 kr, there was germination but no further growth. At high doses an ultimate increase of height was found. The time before, flowering increased with dose. The longevity of the plant increased with dose provided. It survived for a minimum of 151 days. There was increased branching, giving increased spike production with increase dose (β-rays). This has the effect of counteracting the reduction in number of seeds per spike with increasing dose, since this reduction is compensated for by the presence of more spikes. Thus, there is not much difference in seed yield up to 50 kr and then there is a slight reduction. The weight of seeds produced by growing plants from irradiated seeds at all doses is constant. There is little difference in the viability of M 1 seeds of all doses. A percentage of sterile spiked and of sterile plants occurred among survivors of 70 kr and 100 kr but not at lower doses. Chlorophyll content first rises sharply, then falls off gradually with dose. Little change in xanthophyll and carotin content is noticed. The following cytological effects were observed: The percentage of anaphase bridges and of fragments increases with increasing dose. The percentage of anaphase bridges falls off with time. Below 50 kr plants surviving for 50 days no more anaphase bridges in root tips. Meiosis was normal. Plants surviving 70 kr and 100 kr still showed translocations and other abnormalities at meiosis. (author)

  4. Population Structure and Diversity in Finger Millet (Eleusine coracana) Germplasm.

    Science.gov (United States)

    A genotypic analysis of 79 finger millet accessions (E. coracana subsp. coracana) from 11 African and 5 Asian countries, plus 14 wild E. coracana subsp. africana lines collected in Uganda and Kenya was conducted with 45 SSR markers distributed across the finger millet genome. Phylogenetic and popula...

  5. Review of Finger millet (Eleusine coracana (L.) Gaertn): A power house of health benefiting nutrients

    OpenAIRE

    Dinesh Chandra; Satish Chandra; Pallavi; A.K. Sharma

    2016-01-01

    The bulk of the world's millet crop is produced by India, Nigeria, Niger, Mali, Burkina Faso, Chad, and China. Finger millet (Eleusine coracana (L.) Gaertn), little millet (Panicum sumatrense Roth ex Roem. & Schult.), foxtail millet (Setaria italica (L.) P. Beauvois) and proso millet (Panicum miliaceum L.) are most commonly found species among various millet varieties. In India, finger millet occupy the largest area under cultivation among the small millets. Finger millet stands unique among ...

  6. Low-copy nuclear gene and McGISH resolves polyploid history of Eleusine coracana and morphological character evolution in Eleusine

    OpenAIRE

    LIU, Qing; JIANG, Bin; WEN, Jun; PETERSON, Paul Michael

    2014-01-01

    Eleusine coracana (L.) Gaertn. (finger millet) is the third most important cereal crop in semiarid regions of the world, but the degree of relatedness of finger millet with other species in the genus is unverified. The study of morphological character evolution in Eleusine Gaertn. has lagged behind due to lack of relevant research. Polyploidy history of finger millet was analyzed using waxy sequences together with multicolor genomic in situ hybridization (McGISH). In the waxy phylogenetic tre...

  7. RETRACTED ARTICLE: Nutritional, technological, and medical approach of finger millet (Eleusine coracana)

    OpenAIRE

    Amir Gull; Gulzar Ahmad Nayik; Kamlesh Prasad; Pradyuman Kumar

    2015-01-01

    Finger millet (Eleusine coracana L.) is also known as African millet and is commonly called “ragi” in India. It has excellent nutritional value and is even superior to other common cereals. It is a richest source of calcium (344 mg) and magnesium (408 mg) than other millets. Predominant fatty acids of this millet are oleic (49%), linoleic (25%), and palmitic acids (25%). Finger millet contains both water-soluble and lipo-soluble vitamins. Emerging bakery products prepared from this millet are...

  8. RETRACTED ARTICLE: Nutritional, technological, and medical approach of finger millet (Eleusine coracana

    Directory of Open Access Journals (Sweden)

    Amir Gull

    2015-12-01

    Full Text Available Finger millet (Eleusine coracana L. is also known as African millet and is commonly called “ragi” in India. It has excellent nutritional value and is even superior to other common cereals. It is a richest source of calcium (344 mg and magnesium (408 mg than other millets. Predominant fatty acids of this millet are oleic (49%, linoleic (25%, and palmitic acids (25%. Finger millet contains both water-soluble and lipo-soluble vitamins. Emerging bakery products prepared from this millet are pasta, noodles, vermicelli, and bread. Being gluten free, it is suitable for individuals suffering from celiac disease. Finger millet grain is a rich source of several phytochemicals. Finger millet possesses blood glucose lowering, cholesterol lowering, and antiulcerative, wound healing properties as indicated by in vitro and in vivo studies. Commonly used processing techniques for this millet are milling, malting, popping, and decortications.

  9. Phenotypic characterization of Ethiopian finger millet accessions (Eleusine coracana (L. Gaertn, for their agronomically important traits

    Directory of Open Access Journals (Sweden)

    Tesfaye Kassahun

    2017-12-01

    Full Text Available Cereal finger millet (Eleusine coracana (L. Gaertn is one of the most promising vital crops of Asia and Africa in the face of climate change. It has a capacity to adapt to extreme environmental conditions and can be grown under a wide range of wider agroecology. It is believed to be originated in the highlands of Ethiopia and then disseminated across the globe. It is mainly cultivated as dietary staple food for humans, animal feeds and also used as medicinal crop. Though finger millet is recognized as the most important staple crop, particularly for the poor people in dry and semidry areas, it has been neglected and given little concern in mainstreaming the crop for its improvement research.

  10. Computational Identification of MicroRNAs and Their Targets from Finger Millet (Eleusine coracana).

    Science.gov (United States)

    Usha, S; Jyothi, M N; Suchithra, B; Dixit, Rekha; Rai, D V; Nagesh Babu, R

    2017-03-01

    MicroRNAs are endogenous small RNAs regulating intrinsic normal growth and development of plant. Discovering miRNAs, their targets and further inferring their functions had become routine process to comprehend the normal biological processes of miRNAs and their roles in plant development. In this study, we used homology-based analysis with available expressed sequence tag of finger millet (Eleusine coracana) to predict conserved miRNAs. Three potent miRNAs targeting 88 genes were identified. The newly identified miRNAs were found to be homologous with miR166 and miR1310. The targets recognized were transcription factors and enzymes, and GO analysis showed these miRNAs played varied roles in gene regulation. The identification of miRNAs and their targets is anticipated to hasten the pace of key epigenetic regulators in plant development.

  11. Assessment of genetic diversity in ragi [Eleusine coracana (L.) Gaertn] using morphological, RAPD and SSR markers.

    Science.gov (United States)

    Prabhu, Kalapad Santosh; Das, Anath Bandhu; Dikshit, Nilamani

    2018-04-25

    Finger millet (Eleusine coracana L. Gaertn., 2n=36) is one of the most important minor crops, commonly known as 'ragi' and used as a staple food grain in more than 25 countries including Africa and south Asia. Twenty-seven accessions of ragi were collected from different parts of India and were evaluated for morpho-genetic diversity studies. Simple sequence repeat (SSR) and random amplified polymorphic DNA (RAPD) markers were used for assessment of genetic diversity among 27 genotypes of E. coracana. High degree of similarity (90%) was obtained between 'IC49979A' and 'IC49974B' genotypes, whereas low level of similarity (9.09%) was found between 'IC204141' and 'IC49985' as evident in morphological and DNA markers. A total of 64 SSR and 301 RAPD amplicons were produced, out of which 87.50% and 77.20% DNA fragments showed polymorphism, respectively. The clustering pattern obtained among the genotypes corresponded well with their morphological and cytological data with a monophyletic origin of this species which was further supported by high bootstrap values and principal component analysis. Cluster analysis showed that ragi accessions were categorised into three distinct groups. Genotypes IC344761, IC340116, IC340127, IC49965 and IC49985 found accession specific in RAPD and SSR markers. The variation among ragi accessions might be used as potential source of germplasm for crop improvement.

  12. Genome and Transcriptome sequence of Finger millet (Eleusine coracana (L.) Gaertn.) provides insights into drought tolerance and nutraceutical properties

    OpenAIRE

    Hittalmani, Shailaja; Mahesh, H. B.; Shirke, Meghana Deepak; Biradar, Hanamareddy; Uday, Govindareddy; Aruna, Y. R.; Lohithaswa, H. C.; Mohanrao, A.

    2017-01-01

    Background Finger millet (Eleusine coracana (L.) Gaertn.) is an important staple food crop widely grown in Africa and South Asia. Among the millets, finger millet has high amount of calcium, methionine, tryptophan, fiber, and sulphur containing amino acids. In addition, it has C4 photosynthetic carbon assimilation mechanism, which helps to utilize water and nitrogen efficiently under hot and arid conditions without severely affecting yield. Therefore, development and utilization of genomic re...

  13. Eleusine coracana

    African Journals Online (AJOL)

    concentration, 32.5 oC reaction temperature, 4 days of fermentation time, and maximum of 7.28 %w/v of ethanol content was obtained using Pycnometer ... Ethanol production through biotechnological methods has acquired considerable ..... an unfavorable effect on sugar conversion of FMS due to formation of 5-HMS and ...

  14. Bioaccessible nutrients and bioactive components from fortified products prepared using finger millet (Eleusine coracana).

    Science.gov (United States)

    Oghbaei, Morteza; Prakash, Jamuna

    2012-08-30

    Finger millet (Eleusine coracana), a staple food in semi-arid parts of the world, is a rich source of nutrients and bioactive components comparable to rice and wheat but with higher fibre content. Unprocessed and processed finger millet (whole flour (WFM), sieved flour (SFM), wafers and vermicelli with altered matrices (added Fe or Zn or reduced fibre)) were analysed for chemical composition, bioaccessible Fe, Zn and Ca, in vitro digestible starch (IVSD) and protein (IVPD) and bioactive components (polyphenols and flavonoids). WFM and SFM flours differed significantly in their composition. Sieving decreased the content of both nutrients and antinutrients in WFM but increased their digestibility/bioaccessibility. WFM products with Zn and Fe showed highest IVPD, whereas SFM products with Fe showed highest IVSD. Products with externally added Fe and Zn showed maximum bioaccessibility of Fe and Zn respectively. WFM had the highest levels of total polyphenols and flavonoids, 4.18 and 15.85 g kg⁻¹ respectively; however, bioaccessibility was highest in SFM vermicelli. The availability of nutrients and bioactive components was influenced by both processing methods and compositional alterations of the food matrix in finger millet products, and bioaccessibility of all constituents was higher in vermicelli (wet matrix) than in wafers (dry matrix). Copyright © 2012 Society of Chemical Industry.

  15. Health benefits of finger millet (Eleusine coracana L.) polyphenols and dietary fiber: a review.

    Science.gov (United States)

    Devi, Palanisamy Bruntha; Vijayabharathi, Rajendran; Sathyabama, Sathyaseelan; Malleshi, Nagappa Gurusiddappa; Priyadarisini, Venkatesan Brindha

    2014-06-01

    The growing public awareness of nutrition and health care research substantiates the potential of phytochemicals such as polyphenols and dietary fiber on their health beneficial properties. Hence, there is in need to identify newer sources of neutraceuticals and other natural and nutritional materials with the desirable functional characteristics. Finger millet (Eleusine coracana), one of the minor cereals, is known for several health benefits and some of the health benefits are attributed to its polyphenol and dietary fiber contents. It is an important staple food in India for people of low income groups. Nutritionally, its importance is well recognised because of its high content of calcium (0.38%), dietary fiber (18%) and phenolic compounds (0.3-3%). They are also recognized for their health beneficial effects, such as anti-diabetic, anti-tumerogenic, atherosclerogenic effects, antioxidant and antimicrobial properties. This review deals with the nature of polyphenols and dietary fiber of finger millet and their role with respect to the health benefits associated with millet.

  16. Nutraceutical Value of Finger Millet [Eleusine coracana (L.) Gaertn.], and Their Improvement Using Omics Approaches.

    Science.gov (United States)

    Kumar, Anil; Metwal, Mamta; Kaur, Sanveen; Gupta, Atul K; Puranik, Swati; Singh, Sadhna; Singh, Manoj; Gupta, Supriya; Babu, B K; Sood, Salej; Yadav, Rattan

    2016-01-01

    The science of nutritional biology has progressed extensively over the last decade to develop food-based nutraceuticals as a form of highly personalized medicine or therapeutic agent. Finger millet [Eleusine coracana (L.) Gaertn.] is a crop with potentially tremendous but under-explored source of nutraceutical properties as compared to other regularly consumed cereals. In the era of growing divide and drawback of nutritional security, these characteristics must be harnessed to develop finger millet as a novel functional food. In addition, introgression of these traits into other staple crops can improve the well-being of the general population on a global scale. The objective of this review is to emphasize the importance of biofortification of finger millet in context of universal health and nutritional crisis. We have specifically highlighted the role that recent biotechnological advancements have to offer for enrichment of its nutritional value and how these developments can commission to the field of nutritional biology by opening new avenues for future research.

  17. Review of Finger millet (Eleusine coracana (L. Gaertn: A power house of health benefiting nutrients

    Directory of Open Access Journals (Sweden)

    Dinesh Chandra

    2016-09-01

    Full Text Available The bulk of the world's millet crop is produced by India, Nigeria, Niger, Mali, Burkina Faso, Chad, and China. Finger millet (Eleusine coracana (L. Gaertn, little millet (Panicum sumatrense Roth ex Roem. & Schult., foxtail millet (Setaria italica (L. P. Beauvois and proso millet (Panicum miliaceum L. are most commonly found species among various millet varieties. In India, finger millet occupy the largest area under cultivation among the small millets. Finger millet stands unique among the cereals such as barley, rye and oats with higher nutritional contents and has outstanding properties as a subsistence food crop. It is rich in calcium (0.34%, dietary fiber (18%, phytates (0.48%, protein (6%–13% minerals (2.5%–3.5%, and phenolics (0.3%–3%. Moreover, it is also a rich source of thiamine, riboflavin, iron, methionine, isoleucine, leucine, phenylalanine and other essential amino acids. The abundance of these phytochemicals enhances the nutraceutical potential of finger millet, making it a powerhouse of health benefiting nutrients. It has distinguished health beneficial properties, such as anti-diabetic (type 2 diabetes mellitus, anti-diarrheal, antiulcer, anti-inflammatory, antitumerogenic (K562 chronic myeloid leukemia, atherosclerogenic effects, antimicrobial and antioxidant properties.

  18. Fitorremediação de solo contaminado com picloram por capim-pé-de-galinha-gigante (Eleusine coracana Phytoremediation of picloram-contaminated soil by Eleusine coracana

    Directory of Open Access Journals (Sweden)

    Sergio de Oliveira Procópio

    2008-12-01

    Full Text Available O longo efeito residual do herbicida picloram no solo aumenta o risco de lixiviação e de fitotoxicidade em culturas sucedâneas; sua presença no solo pode ser abreviada com o uso da fitorremediação. O objetivo deste trabalho foi avaliar a influência da densidade populacional de capim-pé-de-galinha-gigante (Eleusine coracana sobre a fitorremediação de solo contaminado com o herbicida picloram. O experimento foi realizado em casa de vegetação localizada no município de Rio Verde-GO, no período de setembro de 2006 a fevereiro de 2007. Os tratamentos foram compostos pela combinação entre quatro densidades populacionais da espécie vegetal Eleusine coracana (capim-pé-de-galinha-gigante (0, 7, 14 e 21 plantas por vaso, correspondendo a 0, 172, 344 e 516 plantas m-2, respectivamente e três doses do picloram (0, 80 e 160 g ha-1 - aplicadas diretamente nos vasos, simulando níveis de contaminação do solo. Após o cultivo da espécie vegetal fitorremediadora no substrato por 100 dias, efetuou-se, no próprio vaso, a semeadura da soja (Glycine max L., espécie utilizada como bioindicadora da presença do picloram. A espécie Eleusine coracana mostrou ter capacidade de remediar solos contaminados com o herbicida picloram. A partir de 172 plantas m-2, aumentos na densidade populacional da espécie fitorremediadora não proporcionaram redução de carryover do herbicida picloram sobre a cultura da soja semeada em sucessão.The long-term residual effect of the herbicide picloram poses risks of leaching and phytotoxicity to successive crops. Phytoremediation can abbreviate the long carryover effect. This research was carried out from September 2006 to February 2007, under green house conditions, in Rio Verde, Goiás, Brazil, to study the influence of Eleusine coracana population density on phytoremediation of soil contaminated with picloram. The treatments consisted of the combination of four Eleusine coracana population densities (0, 7, 14

  19. Translocation of 14C-photosynthates under normal and moisture stress conditions in finger millet (Eleusine coracana) gaertin

    International Nuclear Information System (INIS)

    Udayakumar, M.; Rama Rao, S.; Krishna Sastry, K.S.

    1981-01-01

    Translocation of photosynthates into different sinks was studied following feeding a single leaf with 14 CO 2 in 40 day old stressed and non-stressed plants of Eleusine coracana. The rate of efflux of 14 C-photosynthates was twice as much in non-stressed plants compared to stressed plants. Young developing leaves, stem apex and stem which are the potential sinks under non-stressed conditions received very little activity under stress conditions. Percent activity in the roots was enhanced under stress suggesting the pattern of translocation was altered under stress conditions. In the plants subjected to moisture stress, after feeding with 14 CO 2 the rate of efflux of 14 C-photosynthates from the fed leaf decreased and the pattern of translocation was altered. Though the effect of stress seems to be directly on the translocation system, the photosynthetic rate appears to be more sensitive to stress than translocation. (author)

  20. Spermidine sprays alleviate the water deficit-induced oxidative stress in finger millet (Eleusine coracana L. Gaertn.) plants.

    Science.gov (United States)

    Satish, Lakkakula; Rency, Arockiam Sagina; Ramesh, Manikandan

    2018-01-01

    Severe drought stress (water deficit) in finger millet ( Eleusine coracana L. Gaertn.) plants significantly reduced total leaf chlorophyll and relative water content in shoots and roots, whereas electrolyte leakage, concentrations of proline and hydrogen peroxide, as well as caspase-like activity were significantly increased. The role of spermidine in plant defence to water-stress was investigated after subjected to various drought treatments. Three weeks of daily spermidine sprays (0.2 mM) at early flowering stage significantly changed shoot and root growth, in both fresh and dry weights terms. At 75% of water deficit stress, leaves accumulated twice as much proline as unstressed plants, and roots accumulated thrice. Plants treated with spermidine under water stress showed lower electrolyte leakage, hydrogen peroxide and caspase-like activity than unstressed and untreated control.

  1. Risk of Soil Recontamination Due to Using Eleusine coracana and Panicum maximum Straw After Phytoremediation of Picloram.

    Science.gov (United States)

    Nascimento, Alex Favaro; Pires, Fábio Ribeiro; Chagas, Kristhiano; de Oliveira Procópio, Sergio; Oliveira, Marcelo Antonio; Cargnelutti Filho, Alberto; Belo, Alessandra Ferreira; Egreja Filho, Fernando Barboza

    2015-01-01

    This study aimed to evaluate the herbicidal activity of picloram on the biomass of the remediation plants Eleusine coracana and Panicum maximum after cultivation in a soil contaminated with this herbicide. These species were grown in three soils, differentiated based on texture (clayish, middle, and sandy, with 460, 250, and 40 g kg(-1) of the clay, respectively), previously contaminated with picloram (0, 80, and 160 g ha(-1)). After 90 days, the plants were harvested and an extract was produced by maceration of leaves and stems of these plants. It was applied to pots containing washed sand, comprising a bioassay in a growth chamber using soybean as a bioindicator for picloram. Soil and plant samples were analyzed by HPLC. The results showed the presence of picloram or metabolites with herbicidal activity in the shoots of E. coracana and P. maximum at phytotoxic levels with regard to soybean plants, indicating that they work only as phytoextractors and that the presence of straw on the soil surface can promote recontamination within the area. It is not recommended to cultivate species susceptible to picloram in areas where it was reported remediation by E. indica and P. maximum and still present residues of these species.

  2. Effect of domestic processing on the polyphenol content and bioaccessibility in finger millet (Eleusine coracana) and pearl millet (Pennisetum glaucum).

    Science.gov (United States)

    Hithamani, Gavirangappa; Srinivasan, Krishnapura

    2014-12-01

    Finger millet (Eleusine coracana) and pearl millet (Pennisetum glaucum) were evaluated for polyphenolic content and their bioaccessibility. Total polyphenols of native finger millet was 10.2mg/g which reduced by 50% after sprouting or pressure-cooking, while 12-19% reduction was seen after open-pan boiling. Total flavonoids of the grain reduced drastically on sprouting, pressure-cooking or open-pan boiling. Concentration of phenolic acids generally increased during sprouting and roasting of finger millet. Pressure cooking, open-pan boiling and microwave-heating reduced the bioaccessible polyphenols by 30-35%, while the same was increased by 67% by sprouting. Significant reduction of total polyphenols was observed in pressure-cooked, open-pan boiled and microwave-heated pearl millet. Concentration of sinapic and salicylic acids were highest phenolic acids of pearl millet. Total polyphenols reduced during sprouting and pressure-cooking. There was a 20% increase in the bioaccessible polyphenols after sprouting of pearl millet. Thus, sprouting and roasting provided more bioaccessible phenolics from these two common millets studied. Copyright © 2014. Published by Elsevier Ltd.

  3. The extent of variation in salinity tolerance of the minicore collection of finger millet (Eleusine coracana L. Gaertn.) germplasm.

    Science.gov (United States)

    Krishnamurthy, Lakshmanan; Upadhyaya, Hari Deo; Purushothaman, Ramamoorthy; Gowda, Cholenahalli Lakkegowda Laxmipathi; Kashiwagi, Junichi; Dwivedi, Sangam Lal; Singh, Sube; Vadez, Vincent

    2014-10-01

    Finger millet (Eleusine coracana L. Gaertn.) ranks third in production among the dry land cereals. It is widely cultivated in Africa and South Asia where soil salinization is a major production constraint. It is a potential crop for salt affected soils. To identify salt tolerant germplasm, the minicore finger millet germplasm (n=80) was screened for grain yield performance in a soil saturated with NaCl solution of 100 or 125mM. Genotype effect was significant for most traits, while salinity×genotype interaction was significant only in one year. Salinity delayed phenology, marginally reduced shoot biomass and grain yield. There was a large range of genotypic variation in grain yield under salinity and other traits. The yield loss was higher in accessions with prolific growth and yield potential was associated with saline yields. Based on saline yields, accessions were grouped in to four groups and the top tolerant group had 22 accessions with IE 4797 remaining at the top. Salinity had no adverse impact on grain yield of five accessions. Root anatomy in selected genotype of pearl and finger millet showed presence of porous cortex and well fortified endodermis in finger millet that can exclude Na(+) and enhance N absorption. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  4. [Obtaining the transgenic lines of finger millet Eleusine coracana (L.) Gaertn. With dinitroaniline resistance].

    Science.gov (United States)

    Baer, G Ia; Emets, A I; Blium, Ia B

    2014-01-01

    The current data is dedicated to the study of bioballistic and Agrobacterium-mediated transformation of finger millet with the constructs carrying the mutant alpha-tubulin gene (TUAm 1), isolated from R-biotype goosegrass (Eleusine indica L.), for the decision of problem of dinitroaniline-resistance. It was found that 10 microM of trifluralin is optimal for the selection of transgene plants of finger millet. PCR analysis of transformed lines confirmed the transgene nature of plants. The analysis of seed of T1 oftransgene lines confirmed heterozygous character of inheritance of the resistance.

  5. Gene Discovery and Advances in Finger Millet [Eleusine coracana (L.) Gaertn.] Genomics—An Important Nutri-Cereal of Future

    Science.gov (United States)

    Sood, Salej; Kumar, Anil; Babu, B. Kalyana; Gaur, Vikram S.; Pandey, Dinesh; Kant, Lakshmi; Pattnayak, Arunava

    2016-01-01

    The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat) of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [Eleusine coracana (L.) Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologs from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2–4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet. PMID:27881984

  6. Transcriptome analysis of salinity responsiveness in contrasting genotypes of finger millet (Eleusine coracana L.) through RNA-sequencing.

    Science.gov (United States)

    Rahman, Hifzur; Jagadeeshselvam, N; Valarmathi, R; Sachin, B; Sasikala, R; Senthil, N; Sudhakar, D; Robin, S; Muthurajan, Raveendran

    2014-07-01

    Finger millet (Eleusine coracana L.) is a hardy cereal known for its superior level of tolerance against drought, salinity, diseases and its nutritional properties. In this study, attempts were made to unravel the physiological and molecular basis of salinity tolerance in two contrasting finger millet genotypes viz., CO 12 and Trichy 1. Physiological studies revealed that the tolerant genotype Trichy 1 had lower Na(+) to K(+) ratio in leaves and shoots, higher growth rate (osmotic tolerance) and ability to accumulate higher amount of total soluble sugar in leaves under salinity stress. We sequenced the salinity responsive leaf transcriptome of contrasting finger millet genotypes using IonProton platform and generated 27.91 million reads. Mapping and annotation of finger millet transcripts against rice gene models led to the identification of salinity responsive genes and genotype specific responses. Several functional groups of genes like transporters, transcription factors, genes involved in cell signaling, osmotic homeostasis and biosynthesis of compatible solutes were found to be highly up-regulated in the tolerant Trichy 1. Salinity stress inhibited photosynthetic capacity and photosynthesis related genes in the susceptible genotype CO 12. Several genes involved in cell growth and differentiation were found to be up-regulated in both the genotypes but more specifically in tolerant genotype. Genes involved in flavonoid biosynthesis were found to be down-regulated specifically in the salinity tolerant Trichy 1. This study provides a genome-wide transcriptional analysis of two finger millet genotypes differing in their level of salinity tolerance during a gradually progressing salinity stress under greenhouse conditions.

  7. Genome and Transcriptome sequence of Finger millet (Eleusine coracana (L.) Gaertn.) provides insights into drought tolerance and nutraceutical properties.

    Science.gov (United States)

    Hittalmani, Shailaja; Mahesh, H B; Shirke, Meghana Deepak; Biradar, Hanamareddy; Uday, Govindareddy; Aruna, Y R; Lohithaswa, H C; Mohanrao, A

    2017-06-15

    Finger millet (Eleusine coracana (L.) Gaertn.) is an important staple food crop widely grown in Africa and South Asia. Among the millets, finger millet has high amount of calcium, methionine, tryptophan, fiber, and sulphur containing amino acids. In addition, it has C4 photosynthetic carbon assimilation mechanism, which helps to utilize water and nitrogen efficiently under hot and arid conditions without severely affecting yield. Therefore, development and utilization of genomic resources for genetic improvement of this crop is immensely useful. Experimental results from whole genome sequencing and assembling process of ML-365 finger millet cultivar yielded 1196 Mb covering approximately 82% of total estimated genome size. Genome analysis showed the presence of 85,243 genes and one half of the genome is repetitive in nature. The finger millet genome was found to have higher colinearity with foxtail millet and rice as compared to other Poaceae species. Mining of simple sequence repeats (SSRs) yielded abundance of SSRs within the finger millet genome. Functional annotation and mining of transcription factors revealed finger millet genome harbors large number of drought tolerance related genes. Transcriptome analysis of low moisture stress and non-stress samples revealed the identification of several drought-induced candidate genes, which could be used in drought tolerance breeding. This genome sequencing effort will strengthen plant breeders for allele discovery, genetic mapping, and identification of candidate genes for agronomically important traits. Availability of genomic resources of finger millet will enhance the novel breeding possibilities to address potential challenges of finger millet improvement.

  8. Transcriptional expression analysis of genes involved in regulation of calcium translocation and storage in finger millet (Eleusine coracana L. Gartn.).

    Science.gov (United States)

    Mirza, Neelofar; Taj, Gohar; Arora, Sandeep; Kumar, Anil

    2014-10-25

    Finger millet (Eleusine coracana) variably accumulates calcium in different tissues, due to differential expression of genes involved in uptake, translocation and accumulation of calcium. Ca(2+)/H(+) antiporter (CAX1), two pore channel (TPC1), CaM-stimulated type IIB Ca(2+) ATPase and two CaM dependent protein kinase (CaMK1 and 2) homologs were studied in finger millet. Two genotypes GP-45 and GP-1 (high and low calcium accumulating, respectively) were used to understand the role of these genes in differential calcium accumulation. For most of the genes higher expression was found in the high calcium accumulating genotype. CAX1 was strongly expressed in the late stages of spike development and could be responsible for accumulating high concentrations of calcium in seeds. TPC1 and Ca(2+) ATPase homologs recorded strong expression in the root, stem and developing spike and signify their role in calcium uptake and translocation, respectively. Calmodulin showed strong expression and a similar expression pattern to the type IIB ATPase in the developing spike only and indicating developing spike or even seed specific isoform of CaM affecting the activity of downstream target of calcium transportation. Interestingly, CaMK1 and CaMK2 had expression patterns similar to ATPase and TPC1 in various tissues raising a possibility of their respective regulation via CaM kinase. Expression pattern of 14-3-3 gene was observed to be similar to CAX1 gene in leaf and developing spike inferring a surprising possibility of CAX1 regulation through 14-3-3 protein. Our results provide a molecular insight for explaining the mechanism of calcium accumulation in finger millet. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Gene Discovery and Advances in Finger Millet [Eleusine coracana (L.) Gaertn.] Genomics-An Important Nutri-Cereal of Future.

    Science.gov (United States)

    Sood, Salej; Kumar, Anil; Babu, B Kalyana; Gaur, Vikram S; Pandey, Dinesh; Kant, Lakshmi; Pattnayak, Arunava

    2016-01-01

    The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat) of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [ Eleusine coracana (L.) Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologs from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2-4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet.

  10. Gene Discovery and Advances in Finger millet [Eleusine coracana (L. Gaertn.] Genomics - An Important Nutri-cereal of Future

    Directory of Open Access Journals (Sweden)

    Salej Sood

    2016-11-01

    Full Text Available The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [Eleusine coracana (L. Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologues from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2-4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet.

  11. Development and evaluation of nutritional, sensory and glycemic properties of finger millet (Eleusine coracana L.) based food products.

    Science.gov (United States)

    Shobana, Shanmugam; Selvi, Ravi Poovizhi; Kavitha, Vasudevan; Gayathri, Nagamuthu; Geetha, Gunasekaran; Gayathri, Rajagopal; Vijayalakshmi, Parthasarthy; Balasubramaniam, K Kandappa Gounder; Ruchi, Vaidya; Sudha, Vasudevan; Anjana, Ranjit Mohan; Unnikrishnan, Ranjit; Malleshi, Nagappa Gurusiddappa; Henry, C Jk; Krishnaswamy, Kamala; Mohan, Viswanathan

    2018-01-01

    Finger millet (Eleusine coracana L.) (FM) is rich in dietary fibre and is therefore expected to elicit a lower glycemic response compared to other grains. However, there is little data on the glycemic properties of FM-based products. We evaluated the nutritional, sensory and glycemic properties of decorticated millet with lower polish (DFM-LDP), flakes (FMF), vermicelli (FMV) and extruded snack (FMES) (both FMV and FMES with 7-8% added soluble fibre). The nutrient contents of the FM products were evaluated by standard AOAC (Association of Official Analytical Chemists) and AACC (American Association of Cereal Chemists) methods. Sensory evaluation was conducted monadically using a 9-point hedonic scale using untrained panel members. GI testing was conducted using a standardized validated protocol. The study was conducted according to the guidelines laid down by the Declaration of Helsinki, and was approved by the Ethics Committee of the Madras Diabetes Research Foundation. The products had dietary fibre (DF) content between 5.8-15.6 g%. FMES was unique in having a very low fat content (0.17%). Evaluation of sensory perception revealed moderate acceptance of millet based products. The glycemic indices (GI) (mean±SEM) of the products were 84.7±7.7%, 82.3±6.4%, 65.5±5.1% and 65.0±6.6% for DFM-LDP, FMF, FMV and FMES respectively. DFM-LDP and FMF (purely finger millet based products) elicited higher glycemic responses. Comparatively, FMV and FMES (with added functional ingredients) exhibited medium GI values and, are healthier dietary options. It is possible to prepare FM products with lower GI by utilizing functional ingredients.

  12. Some physical and functional properties of finger millet (Eleusine coracana) obtained in sub-Saharan Africa.

    Science.gov (United States)

    Ramashia, S E; Gwata, E T; Meddows-Taylor, S; Anyasi, T A; Jideani, A I O

    2018-02-01

    The study determined the physical properties of finger millet (FM) (Eluesine coracana) grains and the functional properties of FM flour. Physical properties such as colour attributes, sample weight, bulk density, true density, porosity, surface area, sample volume, aspect ratio, sphericity, dimensional properties and moisture content of grain cultivars were determined. Water absorption capacity (WAC), bulk density (BD), dispersibility, viscosity and micro-structure of FM flours were also evaluated. Data collected were analyzed using SPSS statistical software version 23.0. Results showed that milky cream cultivar was significantly higher (pmillet, used as a control, was significantly different from FM flour on all dimensional properties. Moisture content of milky cream showed higher significant difference for both grains and flours as compared to brown and black grain/flours. Milky cream cultivar was significantly different in L*, b*, C*, H* values, WAC, BD and dispersibility for both FM grains and flours. Data showed that brown flour was significantly higher in viscosity than in milky and black flours. Microstructure results revealed that starch granules of raw FM flours had oval/spherical and smooth surface. The study is important for agricultural and food engineers, designers, scientists and processors in the design of equipment for FM grain processing. Results are likely to be useful in assessing the quality of grains used to fortify FM flour. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Influência do período de cultivo do capim-pé-de-galinha-gigante (Eleusine coracana na fitorremediação de solo contaminado com picloram Influence of Eleusine coracana cultivation period on phytoremediation of soil contaminated with picloram

    Directory of Open Access Journals (Sweden)

    M.L. Carmo

    2008-01-01

    Full Text Available O objetivo deste trabalho foi avaliar a influência do período de cultivo do capim-pé-de-galinha-gigante (Eleusine coracana sobre a fitorremediação de solo contaminado com picloram. O experimento foi conduzido em casa de vegetação, no período de setembro de 2006 a fevereiro de 2007. Os tratamentos foram compostos pela combinação entre quatro períodos de cultivo da espécie vegetal Eleusine coracana (0, 60, 80 e 100 dias e três doses do picloram (0, 80 e 160 g ha-1, totalizando 12 tratamentos. O delineamento experimental utilizado foi o inteiramente casualizado em esquema fatorial 4 x 3, com quatro repetições. Como substrato para o crescimento das plantas, utilizaram-se amostras de solo classificado como Latossolo Vermelho eutroférrico. Ao término do período estabelecido de atuação da espécie fitorremediadora, efetuou-se a semeadura das espécies bioindicadoras da presença do picloram: tomate (cultivar Santa Clara e soja (cultivar Monsoy 6101. As espécies bioindicadoras demonstraram alta sensibilidade à presença do picloram no solo, sendo inviável o cultivo dessas culturas em áreas contaminadas com esse herbicida sem a execução de algum procedimento remediador. O cultivo prévio de E. coracana por 60 dias reduziu a contaminação do solo com picloram e permitiu crescimento inicial satisfatório das plantas de soja e de tomate cultivadas em solo que recebeu previamente a aplicação de até 160 g ha-1 de picloram; contudo, essas plantas bioindicadoras apresentaram ainda sintomas visíveis de intoxicação do herbicida.The objective of this study was to evaluate the influence of Eleusine coracana cultivation period on phytoremediation of soil contaminated with picloram. The experiment was carried out at a greenhouse from September 2006 to February 2007, in 12 treatments combining four Eleusine coracana cultivation periods ((0, 60, 80 and 100 days and three picloram rates (0, 80 and 160 g ha-1, arranged in a completely

  14. Functional markers based molecular characterization and cloning of resistance gene analogs encoding NBS-LRR disease resistance proteins in finger millet (Eleusine coracana).

    Science.gov (United States)

    Panwar, Preety; Jha, Anand Kumar; Pandey, P K; Gupta, Arun K; Kumar, Anil

    2011-06-01

    Magnaporthe grisea, the blast fungus is one of the main pathological threats to finger millet crop worldwide. A systematic search for the blast resistance gene analogs was carried out, using functional molecular markers. Three-fourths of the recognition-dependent disease resistance genes (R-genes) identified in plants encodes nucleotide binding site (NBS) leucine-rich repeat (LRR) proteins. NBS-LRR homologs have only been isolated on a limited scale from Eleusine coracana. Genomic DNA sequences sharing homology with NBS region of resistance gene analogs were isolated and characterized from resistant genotypes of finger millet using PCR based approach with primers designed from conserved regions of NBS domain. Attempts were made to identify molecular markers linked to the resistance gene and to differentiate the resistant bulk from the susceptible bulk. A total of 9 NBS-LRR and 11 EST-SSR markers generated 75.6 and 73.5% polymorphism respectively amongst 73 finger millet genotypes. NBS-5, NBS-9, NBS-3 and EST-SSR-04 markers showed a clear polymorphism which differentiated resistant genotypes from susceptible genotypes. By comparing the banding pattern of different resistant and susceptible genotypes, five DNA amplifications of NBS and EST-SSR primers (NBS-05(504,) NBS-09(711), NBS-07(688), NBS-03(509) and EST-SSR-04(241)) were identified as markers for the blast resistance in resistant genotypes. Principal coordinate plot and UPGMA analysis formed similar groups of the genotypes and placed most of the resistant genotypes together showing a high level of genetic relatedness and the susceptible genotypes were placed in different groups on the basis of differential disease score. Our results provided a clue for the cloning of finger millet blast resistance gene analogs which not only facilitate the process of plant breeding but also molecular characterization of blast resistance gene analogs from Eleusine coracana.

  15. Calcium Biofortification: Three Pronged Molecular Approaches for Dissecting Complex Trait of Calcium Nutrition in Finger Millet (Eleusine coracana) for Devising Strategies of Enrichment of Food Crops.

    Science.gov (United States)

    Sharma, Divya; Jamra, Gautam; Singh, Uma M; Sood, Salej; Kumar, Anil

    2016-01-01

    Calcium is an essential macronutrient for plants and animals and plays an indispensable role in structure and signaling. Low dietary intake of calcium in humans has been epidemiologically linked to various diseases which can have serious health consequences over time. Major staple food-grains are poor source of calcium, however, finger millet [ Eleusine coracana (L.) Gaertn.], an orphan crop has an immense potential as a nutritional security crop due to its exceptionally high calcium content. Understanding the existing genetic variation as well as molecular mechanisms underlying the uptake, transport, accumulation of calcium ions (Ca 2+ ) in grains is of utmost importance for development of calcium bio-fortified crops. In this review, we have discussed molecular mechanisms involved in calcium accumulation and transport thoroughly, emphasized the role of molecular breeding, functional genomics and transgenic approaches to understand the intricate mechanism of calcium nutrition in finger millet. The objective is to provide a comprehensive up to date account of molecular mechanisms regulating calcium nutrition and highlight the significance of bio-fortification through identification of potential candidate genes and regulatory elements from finger millet to alleviate calcium malnutrition. Hence, finger millet could be used as a model system for explaining the mechanism of elevated calcium (Ca 2+ ) accumulation in its grains and could pave way for development of nutraceuticals or designer crops.

  16. Amelioration of hyperglycaemia and its associated complications by finger millet ( Eleusine coracana L.) seed coat matter in streptozotocin-induced diabetic rats.

    Science.gov (United States)

    Shobana, Shanmugam; Harsha, Mysore R; Platel, Kalpana; Srinivasan, Krishnapura; Malleshi, Nagappa G

    2010-12-01

    Finger millet (Eleusine coracana) is extensively cultivated and consumed in India and Africa. The millet seed coat is a rich source of dietary fibre and phenolic compounds. The effect of feeding a diet containing 20% finger millet seed coat matter (SCM) was examined in streptozotocin-induced diabetic rats. Diabetic rats maintained on the millet SCM diet (diabetic experimental (DE) group) for 6 weeks exhibited a lesser degree of fasting hyperglycaemia and partial reversal of abnormalities in serum albumin, urea and creatinine compared with the diabetic control (DC) group. The DE group of rats excreted comparatively lesser amounts of glucose, protein, urea and creatinine and was accompanied by improved body weights compared with their corresponding controls. Hypercholesterolaemia and hypertriacylglycerolaemia associated with diabetes were also notably reversed in the DE group. Slit lamp examination of the eye lens revealed an immature subcapsular cataract with mild lenticular opacity in the DE group of rats compared to the mature cataract with significant lenticular opacity and corneal vascularisation in the DC group. Lower activity of lens aldose reductase, serum advanced glycation end products and blood glycosylated Hb levels were observed in the DE group. The millet SCM feeding showed pronounced ameliorating effects on kidney pathology as reflected by near normal glomerular and tubular structures and lower glomerular filtration rate compared with the shrunken glomerulus, tubular vacuolations in the DC group. Thus, the present animal study evidenced the hypoglycaemic, hypocholesterolaemic, nephroprotective and anti-cataractogenic properties of finger millet SCM, suggesting its utility as a functional ingredient in diets for diabetics.

  17. Ação de Eleusine coracana na remediação de solos contaminados com picloram Action of Eleusine coracana in the remediation of soils contaminated with picloram

    Directory of Open Access Journals (Sweden)

    L.O.C. Silva

    2012-09-01

    Full Text Available A evolução do método químico de controle das plantas daninhas tem sido fundamental para o cultivo de grandes áreas com custos de produção compatíveis com os mercados nacional e internacional. Atualmente, os herbicidas representam cerca de 45,0% de todos os agrotóxicos consumidos no Brasil. Esses compostos, em sua grande maioria, podem apresentar longa persistência no ambiente e contaminar o solo, impedindo novos cultivos, e também as águas superficiais e subterrâneas, gerando como consequência problemas ambientais. Objetivou-se com este trabalho quantificar, por meio da técnica cromatográfica, a capacidade da espécie E. coracana em reduzir a persistência do picloram em dois tipos de solo - um Latossolo Vermelho-Amarelo e um Argissolo Vermelho-Amarelo - largamente cultivados com pastagens e culturas no Brasil, contaminados com esse herbicida. Conclui-se que a espécie E. coracana é eficiente na remediação de solos contaminados por esse herbicida, evidenciando o potencial de uso dela em programas de fitorremediação de áreas contaminadas e redução do risco de impacto ambiental, e que os valores da meia-vida do picloram nos solos avaliados são distintos para uma mesma condição climática, o que pode ser ainda mais diferente em campo.The evolution of chemical weed control methods has been fundamental to cultivation of large areas where production costs are compatible with national and international markets. Currently, herbicides account for approximately 45.0% of all pesticides used in Brazil. Most of these compounds present long persistence in the environment, contaminating soil, hindering new crops as well as surface water and groundwater, thus leading to environmental problems. The objective of this work was to quantify, using the chromatographic technique, the efficacy of the species E. coracana in reducing picloram persistence in two soils, a Red Yellow Ultisol and a Red Yellow Latosol, treated with this herbicide

  18. Assessment of genetic diversity, population structure and relationships in Indian and non-Indian genotypes of finger millet (Eleusine coracana (L.) Gaertn) using genomic SSR markers.

    Science.gov (United States)

    Ramakrishnan, M; Antony Ceasar, S; Duraipandiyan, V; Al-Dhabi, N A; Ignacimuthu, S

    2016-01-01

    We evaluated the genetic variation and population structure in Indian and non-Indian genotypes of finger millet using 87 genomic SSR primers. The 128 finger millet genotypes were collected and genomic DNA was isolated. Eighty-seven genomic SSR primers with 60-70 % GC contents were used for PCR analysis of 128 finger millet genotypes. The PCR products were separated and visualized on a 6 % polyacrylamide gel followed by silver staining. The data were used to estimate major allele frequency using Power Marker v3.0. Dendrograms were constructed based on the Jaccard's similarity coefficient. Statistical fitness and population structure analyses were performed to find the genetic diversity. The mean major allele frequency was 0.92; the means of polymorphic alleles were 2.13 per primer and 1.45 per genotype; the average polymorphism was 59.94 % per primer and average PIC value was 0.44 per primer. Indian genotypes produced an additional 0.21 allele than non-Indian genotypes. Gene diversity was in the range from 0.02 to 0.35. The average heterozygosity was 0.11, close to 100 % homozygosity. The highest inbreeding coefficient was observed with SSR marker UGEP67. The Jaccard's similarity coefficient value ranged from 0.011 to 0.836. The highest similarity value was 0.836 between genotypes DPI009-04 and GPU-45. Indian genotypes were placed in Eleusine coracana major cluster (EcMC) 1 along with 6 non-Indian genotypes. AMOVA showed that molecular variance in genotypes from various geographical regions was 4 %; among populations it was 3 % and within populations it was 93 %. PCA scatter plot analysis showed that GPU-28, GPU-45 and DPI009-04 were closely dispersed in first component axis. In structural analysis, the genotypes were divided into three subpopulations (SP1, SP2 and SP3). All the three subpopulations had an admixture of alleles and no pure line was observed. These analyses confirmed that all the genotypes were genetically diverse and had been grouped based on

  19. Development and molecular characterization of genic molecular markers for grain protein and calcium content in finger millet (Eleusine coracana (L.) Gaertn.).

    Science.gov (United States)

    Nirgude, M; Babu, B Kalyana; Shambhavi, Y; Singh, U M; Upadhyaya, H D; Kumar, Anil

    2014-03-01

    Finger millet (Eleusine coracana (L.) Gaertn), holds immense agricultural and economic importance for its high nutraceuticals quality. Finger millets seeds are rich source of calcium and its proteins are good source of essential amino acids. In the present study, we developed 36 EST-SSR primers for the opaque2 modifiers and 20 anchored-SSR primers for calcium transporters and calmodulin for analysis of the genetic diversity of 103 finger millet genotypes for grain protein and calcium contents. Out of the 36 opaque2 modifiers primers, 15 were found polymorphic and were used for the diversity analysis. The highest PIC value was observed with the primer FMO2E33 (0.26), while the lowest was observed FMO2E27 (0.023) with an average value of 0.17. The gene diversity was highest for the primer FMO2E33 (0.33), however it was lowest for FMO2E27 (0.024) at average value of 0.29. The percentage polymorphism shown by opaque2 modifiers primers was 68.23%. The diversity analysis by calcium transporters and calmodulin based anchored SSR loci revealed that the highest PIC was observed with the primer FMCA8 (0.30) and the lowest was observed for FMCA5 (0.023) with an average value of 0.18. The highest gene diversity was observed for primer FMCA8 (0.37), while lowest for FMCA5 (0.024) at an average of 0.21. The opaque2 modifiers specific EST-SSRs could able to differentiate the finger millet genotypes into high, medium and low protein containing genotypes. However, calcium dependent candidate gene based EST-SSRs could broadly differentiate the genotypes based on the calcium content with a few exceptions. A significant negative correlation between calcium and protein content was observed. The present study resulted in identification of highly polymorphic primers (FMO2E30, FMO2E33, FMO2-18 and FMO2-14) based on the parameters such as percentage of polymorphism, PIC values, gene diversity and number of alleles.

  20. Isolation, characterization and immunolocalization of a seed dominant CaM from finger millet (Eleusine coracana L. Gartn.) for studying its functional role in differential accumulation of calcium in developing grains.

    Science.gov (United States)

    Kumar, Anil; Mirza, Neelofar; Charan, Tara; Sharma, Netrapal; Gaur, Vikram Singh

    2014-03-01

    To understand the exceptional high grain calcium accumulation in finger millet grains, a calmodulin (CaM) gene that is strongly expressed during developing spikes of high grain calcium genotype was further characterized. Using 5'-3' RACE, the full-length CaM open reading frame (ORF) was isolated and the deduced protein sequence showed the presence of four characteristic EF motifs. Phylogenetic analysis showed that the finger millet CaM (Eleusine coracana calmodulin [EcCaM]) was identical to the rice CaM 1-1. Southern hybridization showed the presence of at least four copies of CaM gene that might be located on different regions of the finger millet "AABB" genome. Immunodetection using monospecific polyclonal anti-EcCaM antibodies revealed that EcCaM is localized in the embryo and aleurone layer and accumulates in higher amounts in high grain calcium genotype compared to the low grain calcium genotype. Furthermore, in silico analysis showed that EcCaM interacts with aquaporin which indicates that calcium is probably delivered to developing spike via mass flow of water. These results indicate that higher expression of CaM might cause greater stimulation of the downstream calcium transport machinery operative in the aleurone layer leading to the higher calcium accumulation in the grains of high grain calcium genotype.

  1. Níveis de grão de capim-pé-de-galinha (Eleusine coracana em dietas para ovinos: consumo e digestibilidade Finger millet grain levels in sheep diets: intake and digestibility

    Directory of Open Access Journals (Sweden)

    José Walter dos Santos

    2008-10-01

    Full Text Available Objetivou-se avaliar em ovinos o consumo e a digestibilidade de nutrientes de dietas contendo grão de capim-pé-de-galinha (Eleusine coracana. Foram utilizados 20 ovinos com peso vivo inicial de 18,90 kg, em delineamento inteiramente casualizado, com cinco tratamentos e quatro repetições. Os animais foram alimentados com dietas isoprotéicas formuladas com 50% de volumoso e 50% de concentrado contendo 0; 16,0; 32,5; 48,0 ou 67,0% de grão de capim-pé-de-galinha em substituição ao fubá de milho. Utilizou-se a fibra indigestível em detergente neutro (FDNi como indicador para estimativa da excreção fecal. Os níveis de grão de pé-de-galinha não influenciaram os consumos de MS, NDT e FDN. Os valores médios de consumo de matéria seca foram de 1,2 kg/animal/dia e 3,2% do peso vivo. O coeficiente de digestibilidade da matéria seca (CDMS e o NDT reduziram linearmente em 0,1425 e 0,1612%, respectivamente, a cada 1% de grão de capim-pé-de-galinha no concentrado, o que está relacionado aos maiores teores de FDN e FDNi desse alimento. Os coeficientes de digestibilidade de MO e FDN apresentaram valores máximos de 57,64 e 53,60% nos níveis de 42,36 e 39,56% de grão de capim-pé-de-galinha no concentrado. Os valores médios de digestibilidade aparente de PB e EE foram 56,90 e 66,86%, respectivamente. A substituição do fubá de milho por grão do capim pé-de-galinha na dieta de ovinos não influenciou o consumo de matéria seca dos nutrientes, mas reduziu o coeficiente de digestibilidade da matéria seca, da matéria orgânica, dos carboidratos totais e os nutrientes digestíveis totais, logo, esse ingrediente pode substituir até 50% do fubá de milho no concentrado para ovinos.The objective was to evaluate in sheep the intake and apparent digestibility of nutrients diets containing finger millet grain (Eleusine coracana. Twenty lambs were used with average initial 18.90 kg BW, in a completely randomized design, with five diets and

  2. Finger millet [Eleusine coracana (L.) Gaertn].

    Science.gov (United States)

    Ceasar, Stanislaus Antony; Ignacimuthu, Savarimuthu

    2015-01-01

    Millets are the primary food source for millions of people in tropical regions of the world supplying mineral nutrition and protein. In this chapter, we describe an optimized protocol for the Agrobacterium-mediated transformation of finger millet variety GPU 45. Agrobacterium strain LBA4404 harboring plasmid pCAMBIA1301 which contains hygromycin phosphotransferase (hph) as selectable marker gene and β-glucuronidase (GUS) as reporter gene has been used. This protocol utilizes the shoot apex explants for the somatic embryogenesis and regeneration of finger millet after the transformation by Agrobacterium. Desiccation of explants during cocultivation helps for the better recovery of transgenic plants. This protocol is very useful for the efficient production of transgenic plants in finger millet through Agrobacterium-mediated transformation.

  3. Assessment of genome origins and genetic diversity in the genus Eleusine with DNA markers.

    Science.gov (United States)

    Salimath, S S; de Oliveira, A C; Godwin, I D; Bennetzen, J L

    1995-08-01

    Finger millet (Eleusine coracana), an allotetraploid cereal, is widely cultivated in the arid and semiarid regions of the world. Three DNA marker techniques, restriction fragment length polymorphism (RFLP), randomly amplified polymorphic DNA (RAPD), and inter simple sequence repeat amplification (ISSR), were employed to analyze 22 accessions belonging to 5 species of Eleusine. An 8 probe--3 enzyme RFLP combination, 18 RAPD primers, and 6 ISSR primers, respectively, revealed 14, 10, and 26% polymorphism in 17 accessions of E. coracana from Africa and Asia. These results indicated a very low level of DNA sequence variability in the finger millets but did allow each line to be distinguished. The different Eleusine species could be easily identified by DNA marker technology and the 16% intraspecific polymorphism exhibited by the two analyzed accessions of E. floccifolia suggested a much higher level of diversity in this species than in E. coracana. Between species, E. coracana and E. indica shared the most markers, while E. indica and E. tristachya shared a considerable number of markers, indicating that these three species form a close genetic assemblage within the Eleusine. Eleusine floccifolia and E. compressa were found to be the most divergent among the species examined. Comparison of RFLP, RAPD, and ISSR technologies, in terms of the quantity and quality of data output, indicated that ISSRs are particularly promising for the analysis of plant genome diversity.

  4. Phylogeny of Eleusine (Poaceae: Chloridoideae) based on nuclear ITS and plastid trnT-trnF sequences.

    Science.gov (United States)

    Neves, Susana S; Swire-Clark, Ginger; Hilu, Khidir W; Baird, Wm Vance

    2005-05-01

    Phylogenetic relationships in the genus Eleusine (Poaceae: Chloridoideae) were investigated using nuclear ITS and plastid trnT-trnF sequences. Separate and combined data sets were analyzed using parsimony, distance, and likelihood based methods, including Bayesian. Data congruence was examined using character and topological measures. Significant data heterogeneity was detected, but there was little conflict in the topological substructure measures for triplets and quartets, and resolution and clade support increased in the combined analysis. Data incongruence may be a result of noise and insufficient information in the slower evolving trnT-trnF. Monophyly of Eleusine is strongly supported in all analyses, but basal relationships in the genus remain uncertain. There is good support for a CAIK clade (E. coracana subsp. coracana and africana, E. indica, and E. kigeziensis), with E. tristachya as its sister group. Two putative ITS homeologues (A and B loci) were identified in the allotetraploid E. coracana; the 'B' locus sequence type was not found in the remaining species. Eleusine coracana and its putative 'A' genome donor, the diploid E. indica, are confirmed close allies, but sequence data contradicts the hypothesis that E. floccifolia is its second genome donor. The 'B' genome donor remains unidentified and may be extinct.

  5. Development of transgenic finger millet (Eleusine coracana (L ...

    Indian Academy of Sciences (India)

    2012-01-18

    Jan 18, 2012 ... plants engineered with chitinase gene have been found to be effective in .... primers (forward: 5′ GCTTCTACACCTACGACGCCTT 3′; reverse: ..... and Toppan A 1996 Field tolerance to fungal pathogens of. Brassica napus ...

  6. Study of genetic diversity in finger millet (Eleusine coracana L ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-07-19

    Jul 19, 2010 ... Radioactive detection. Yes/No. No. Yes/No. No. Yes/No. Yes/No. Development costs. Medium. Low. Medium. Medium/High. High. Medium. Start-up costs. Medium/High. Low. Medium. High. High. Medium. Applications. Genetic diversity, polyploidy, hybridization, phylogeny, mating system. Fingerprinting,.

  7. An induced early mutant in finger millet Eleusin coranaca Gaertn

    International Nuclear Information System (INIS)

    Shivashankar, G.; Kempanna, C.; Viswanatha, S.R.

    1975-01-01

    Among the several collections of ragi (Eleusine coracana. Gaertn.) from all over the world, the strain 'H.E.S.927' has been found to be the highest yielder compared to other cultivars. Mutation studies have been conducted on this variety at Bangalore in India to make it suitable for the rainfall pattern of the ragi tract of the Karnataka state. A mutant induced by gamma radiation at 30 K rad has been stabilized. This mutant is early by 30-35 days with comparatively better straw quality. Various morphological characters concerning the yield and yield attributes and the possibility of exploiting it as a genotype for future breeding work and as a promising variety is discussed. Another promising mutant with earhead measuring 15 cm as against the earhead length of 5 to 10 cm of the cultivated varieties is illustrated. (K.B.)

  8. Allotetraploid origin and divergence in Eleusine (Chloridoideae, Poaceae): evidence from low-copy nuclear gene phylogenies and a plastid gene chronogram.

    Science.gov (United States)

    Liu, Qing; Triplett, Jimmy K; Wen, Jun; Peterson, Paul M

    2011-11-01

    Eleusine (Poaceae) is a small genus of the subfamily Chloridoideae exhibiting considerable morphological and ecological diversity in East Africa and the Americas. The interspecific phylogenetic relationships of Eleusine are investigated in order to identify its allotetraploid origin, and a chronogram is estimated to infer temporal relationships between palaeoenvironment changes and divergence of Eleusine in East Africa. Two low-copy nuclear (LCN) markers, Pepc4 and EF-1α, were analysed using parsimony, likelihood and Bayesian approaches. A chronogram of Eleusine was inferred from a combined data set of six plastid DNA markers (ndhA intron, ndhF, rps16-trnK, rps16 intron, rps3, and rpl32-trnL) using the Bayesian dating method. The monophyly of Eleusine is strongly supported by sequence data from two LCN markers. In the cpDNA phylogeny, three tetraploid species (E. africana, E. coracana and E. kigeziensis) share a common ancestor with the E. indica-E. tristachya clade, which is considered a source of maternal parents for allotetraploids. Two homoeologous loci are isolated from three tetraploid species in the Pepc4 phylogeny, and the maternal parents receive further support. The A-type EF-1α sequences possess three characters, i.e. a large number of variations of intron 2; clade E-A distantly diverged from clade E-B and other diploid species; and seven deletions in intron 2, implying a possible derivation through a gene duplication event. The crown age of Eleusine and the allotetraploid lineage are 3·89 million years ago (mya) and 1·40 mya, respectively. The molecular data support independent allotetraploid origins for E. kigeziensis and the E. africana-E. coracana clade. Both events may have involved diploids E. indica and E. tristachya as the maternal parents, but the paternal parents remain unidentified. The habitat-specific hypothesis is proposed to explain the divergence of Eleusine and its allotetraploid lineage.

  9. Chloroplast genes as genetic markers for inferring patterns of change, maternal ancestry and phylogenetic relationships among Eleusine species.

    Science.gov (United States)

    Agrawal, Renuka; Agrawal, Nitin; Tandon, Rajesh; Raina, Soom Nath

    2014-01-01

    Assessment of phylogenetic relationships is an important component of any successful crop improvement programme, as wild relatives of the crop species often carry agronomically beneficial traits. Since its domestication in East Africa, Eleusine coracana (2n = 4x = 36), a species belonging to the genus Eleusine (x = 8, 9, 10), has held a prominent place in the semi-arid regions of India, Nepal and Africa. The patterns of variation between the cultivated and wild species reported so far and the interpretations based upon them have been considered primarily in terms of nuclear events. We analysed, for the first time, the phylogenetic relationship between finger millet (E. coracana) and its wild relatives by species-specific chloroplast deoxyribonucleic acid (cpDNA) polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and chloroplast simple sequence repeat (cpSSR) markers/sequences. Restriction fragment length polymorphism of the seven amplified chloroplast genes/intergenic spacers (trnK, psbD, psaA, trnH-trnK, trnL-trnF, 16S and trnS-psbC), nucleotide sequencing of the chloroplast trnK gene and chloroplast microsatellite polymorphism were analysed in all nine known species of Eleusine. The RFLP of all seven amplified chloroplast genes/intergenic spacers and trnK gene sequences in the diploid (2n = 16, 18, 20) and allotetraploid (2n = 36, 38) species resulted in well-resolved phylogenetic trees with high bootstrap values. Eleusine coracana, E. africana, E. tristachya, E. indica and E. kigeziensis did not show even a single change in restriction site. Eleusine intermedia and E. floccifolia were also shown to have identical cpDNA fragment patterns. The cpDNA diversity in Eleusine multiflora was found to be more extensive than that of the other eight species. The trnK gene sequence data complemented the results obtained by PCR-RFLP. The maternal lineage of all three allotetraploid species (AABB, AADD) was the same, with E. indica being the

  10. Mapping of rDNA on the chromosomes of Eleusine species by fluorescence in situ hybridization.

    Science.gov (United States)

    Bisht, M S; Mukai, Y

    2000-12-01

    Mapping of rDNA sites on the chromosomes of four diploid and two tetraploid species of Eleusine has provided valuable information on genome relationship between the species. Presence of 18S-5.8S-26S rDNA on the largest pair of the chromosomes, location of 5S rDNA at four sites on two pairs of chromosomes and presence of 18S-5.8S-26S and 5S rDNA at same location on one pair of chromosomes have clearly differentiated E. multiflora from rest of the species of Eleusine. The two tetraploid species, E. coracana and E. africana have the same number of 18S-5.8S-26S and 5S rDNA sites and located at similar position on the chromosomes. Diploid species, E. indica, E. floccifolia and E. tristachya have the same 18S-5.8S-26S sites and location on the chromosomes which also resembled with the two pairs of 18S-5.8S-26S rDNA locations in tetraploid species, E. coracana and E. africana. The 5S rDNA sites on chromosomes of E. indica and E. floccifolia were also comparable to the 5S rDNA sites of E. africana and E. coracana. The similarity of the rDNA sites and their location on chromosomes in the three diploid and two polyploid species also supports the view that genome donors to tetraploid species may be from these diploid species.

  11. Ribosomal DNA variation in finger millet and wild species of Eleusine (Poaceae).

    Science.gov (United States)

    Hilu, K W; Johnson, J L

    1992-04-01

    Finger millet is an important cereal crop in the semi-arid regions of Africa and India. The crop belongs to the grass genus Eleusine, which includes nine annual and perennial species native to Africa except for the New World species E. tristachya. Ribosomal DNA (rDNA) variation in finger millet and related wild species was used to provide information on the origin of the genomes of this tetraploid crop and point out genetic relationships of the crop to other species in the genus. The restriction endonucleases used revealed a lack of variability in the rDNA spacer region in domesticated finger millet. All the rDNA variants of the crop were found in the proposed direct tetraploid ancestor, E. coracana subsp. africana. Wild and domesticated finger millet displayed the phenotypes found in diploid E. indica. Diploid Eleusine tristachya showed some similarity to the crop in some restriction sites. The remaining species were quite distinct in rDNA fragment patterns. The study supports the direct origin of finger millet from subspecies africana shows E. indica to be one of the genome donors of the crop, and demonstrates that none of the other species examined could have donated the second genome of the crop. The rDNA data raise the possibility that wild and domesticated finger millet could have originated as infraspecific polyploid hybrids from different varieties of E. indica.

  12. Effect of Ethanol on Germination and Enzyme Activities in Finger millet (Eleusine coracana Gaertn. Seeds

    Directory of Open Access Journals (Sweden)

    S.S. Kulkarni

    2014-08-01

    Full Text Available Influence of ethanol the end product of alcoholic fermentation on the growth of finger millet (var. GPU-28, CO-9 seedlings of two finger millet was studied as a means of evaluating growth responses under anoxia. The germination was delayed by ethanol treatment in case of both the cultivars. Ethanol treatment affected the growth of both radicle and coleoptile of seedlings. In this respect the radicle growth is more sensitive to ethanol than the coleoptile in both varieties of finger millet. The activities of enzymes nitrate reductase, ATPase, acid phosphatase, amylase were reduced by alcohol treatment in germinating seeds of both the cultivars. However, lower concentration of alcohol (1% caused stimulation of peroxidase in var. CO-9. In case of var. GPU-28 showed stimulation of enzyme alkaline phosphatase in both concentration of alcohol.

  13. SCAR marker specific to detect Magnaporthe grisea infecting finger millets (Eleusine coracana).

    Science.gov (United States)

    Gnanasing Jesumaharaja, L; Manikandan, R; Raguchander, T

    2016-09-01

    To determine the molecular variability and develop specific Sequence Characterized Amplified Region (SCAR) marker for the detection of Magnaporthe grisea causing blast disease in finger millet. Random amplified polymorphic DNA (RAPD) was performed with 14 isolates of M. grisea using 20 random primers. SCAR marker was developed for accurate and specific detection of M. grisea infecting only finger millets. The genetic similarity coefficient within each group and variation between the groups was observed. Among the primers, OPF-08 generated a RAPD polymorphic profile that showed common fragment of 478 bp in all the isolates. This fragment was cloned and sequenced. SCAR primers, Mg-SCAR-FP and Mg-SCAR-RP, were designed using sequence of the cloned product. The specificity of the SCAR primers was evaluated using purified DNA from M. grisea isolates from finger millets and other pathogens viz., Pyricularia oryzae, Colletotrichum gloeosporioides, Colletotrichum falcatum and Colletotrichum capcisi infecting different crops. The SCAR primers amplified only specific 460 bp fragment from DNA of M. grisea isolates and this fragment was not amplified in other pathogens tested. SCAR primers distinguish blast disease of finger millet from rice as there is no amplification in the rice blast pathogen. PCR-based SCAR marker is a convenient tool for specific and rapid detection of M. grisea in finger millets. Genetic diversity in fungal population helps in developing a suitable SCAR marker to identify the blast pathogen at the early stage of infection. © 2016 The Society for Applied Microbiology.

  14. Development of transgenic finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast disease.

    Science.gov (United States)

    Ignacimuthu, S; Ceasar, S Antony

    2012-03-01

    Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.

  15. Agrobacterium-mediated transformation of finger millet (Eleusine coracana (L.) Gaertn.) using shoot apex explants.

    Science.gov (United States)

    Ceasar, S Antony; Ignacimuthu, S

    2011-09-01

    A new Agrobacterium-mediated transformation system was developed for finger millet using shoot apex explants. The Agrobacterium strain LBA4404 harboring binary vector pCAMBIA1301, which contained hygromycin phosphotransferase (hptII) as selectable marker gene and β-glucuronidase (GUS) as reporter gene, was used for optimization of transformation conditions. Two finger millet genotypes, GPU 45 and CO 14, were used in this study. The optimal conditions for the Agrobacterium-mediated transformation of finger millet were found to be the co-cultivation of explants obtained on the 16th day after callus induction (DACI), exposure of explants for 30 min to agrobacterial inoculum and 3 days of co-cultivation on filter paper placed on medium supplemented with 100 μM acetosyringone (AS). Addition of 100 μM L: -cysteine in the selection medium enhanced the frequency of transformation and transgenic plant recovery. Both finger millet genotypes were transformed by Agrobacterium. A frequency of 19% transient expression with 3.8% stable transformation was achieved in genotype GPU 45 using optimal conditions. Five stably transformed plants were fully characterized by Southern blot analysis. A segregation analysis was also performed in four R(1) progenies, which showed normal Mendelian pattern of transgene segregation. The inheritance of transgenes in R(1) progenies was also confirmed by Southern blot analysis. This is the first report on Agrobacterium-mediated transformation of finger millet. This study underpins the introduction of numerous agronomically important genes into the genome of finger millet in the future.

  16. Arabinoxylan from finger millet (Eleusine coracana, v. Indaf 15) bran: purification and characterization.

    Science.gov (United States)

    Savitha Prashanth, M R; Muralikrishna, G

    2014-01-01

    Water unextractable portion from finger millet bran was sequentially extracted with saturated barium hydroxide (BE) and 1M potassium hydroxide (KE) solutions. They consisted preponderantly of arabinose and xylose in different ratios. Ferulic, caffeic, coumaric and vanillic acids were identified as major bound phenolic acids. BE and KE were purified on DEAE-cellulose column by eluting successively with different eluants. The major fractions (0.1 M ammonium carbonate) were resolved into one (BE) and two subfractions (KE1 and KE2) respectively on Sephacryl S-400 gel filtration chromatography and their homogeneity was ascertained by gel filtration, cellulose acetate membrane electrophoresis and capillary electrophoresis. The average molecular weight of BE, KE1 and KE2 were found to be 430, 1028 and 40 kDa respectively. The structural elucidation of the purified polysaccharides by (1)H and (13)C NMR analysis indicated the backbone to be 1,4-β-D-linked xylan with substitution mainly at O-2 or O-3 and/or both by α-l-arabinose residues. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Assessment of Genetic Diversity of Some Finger Millet (Eleusine coracana (L. Gaertn. Accessions Using Morphological Markers

    Directory of Open Access Journals (Sweden)

    D.V.S. Kaluthanthri

    2017-03-01

    Full Text Available AbstractGermplasm characterization is an important link between conservation and utilizationof plant genetic resources. The study was conducted to characterize randomly selected 20finger millet germplasm accessions obtained from Plant Genetic Resource Center,Gannoruwa, Sri Lanka using morphological markers. Morphological study was carried outusing Randomized Complete Block Design (RCBD and 15 morphological markers wererecorded. Analysis of variance (ANOVA results for quantitative morphological charactersrevealed that all quantitative morphological characters measured differed significantly(p˂0.05 among the accessions used for the study, indicating higher levels of morphologicaldiversity. According to the ANOVA results, days to flowering and days to maturity showhigh level of predictive capability while flag leaf length and number of productive tillersshow comparatively low level of predictive capability. Principal component analysisindicated that morphological characters such as days to flowering, finger number and yieldper plant were the important traits contributing for the overall variability implying thatbreeding effort on those traits can meet the targeted objective. The clustering pattern ofstudied finger millet accessions based on morphological markers comprised of two majorclusters. Both clusters comprised of Indian accessions those conserved at PGRC, Gannoruwaand as well as Sri Lankan accessions.Results of the study suggest a considerable morphological variability, which couldexist among the studied traits. Furthermore, this study revealed that the genetic diversityexisted irrespective to the geographical origin. This finding justifies the importance ofgermplasm characterization.Keywords: Finger Millet, Morphological Markers, Germplasm Accessions, GeneticDiversity, Crop Improvement

  18. Finger millet (Eleusine coracana) - an economically viable source for antihypercholesterolemic metabolites production by Monascus purpureus.

    Science.gov (United States)

    Venkateswaran, V; Vijayalakshmi, G

    2010-08-01

    Rice, parboiled rice, finger millet, germinated finger millet, broken wheat, njavara (medicinal rice), sorghum and maize were used as substrates for solid state fermentation of Monascus purpureus at 28°C for 7 days using 2% seed medium as inoculum for the production of its metabolites. The fungus exhibited good growth in all the substrates. The fermented substrates were dried at 45°C and analysed for antihypercholesterolemic metabolite statins by standardized HPLC method and dietary sterol contents by spectrophotometric method using reference standards of statin (pravastatin and lovastatin) and cholesterol, respectively. Germinated finger millet yielded higher total statin production of 5.2 g/kg dry wt with pravastatin and lovastatin content of 4.9 and 0.37 g/kg dry wt respectively than other substrates which range from 1.04-4.41 g/kg. In addition to statin, monascus fermented germinated finger millet yielded dietary sterol of 0.053 g/kg dry wt which is 7.6 folds higher than the control. The value addition of finger millet by germination and fermentation with Monascus purpureus provides scope for development of functional food.

  19. Immunomodulatory activity of purified arabinoxylans from finger millet (Eleusine coracana, v. Indaf 15) bran.

    Science.gov (United States)

    Savitha Prashanth, M R; Shruthi, R R; Muralikrishna, G

    2015-09-01

    Biological activities of alkali extracted (Barium hydroxide: BE-480 kDa, Potassium hydroxide: KE1-1080 and KE2-40 kDa), purified arabinoxylans (AX) from the finger millet bran varying in their molecular weight, phenolic acid content, arabinose to xylose ratios were evaluated for their immune-stimulatory activities using murine lymphocytes and peritoneal exudate macrophages. All three purified AX displayed significant (p 2 fold) and macrophage phagocytosis than KE1 and KE2. The above results clearly documented that the immunostimulatory activity of arabinoxylans is directly proportional to the amount of ferulic acid content (0.11 mg/100 g), whereas molecular weight as well as arabinose/xylose ratio, did not have any bearing. Purified AX from the finger millet bran can be explored as a potent natural immunomodulator.

  20. Effect of Ethanol on Germination and Enzyme Activities in Finger millet (Eleusine coracana Gaertn.) Seeds

    OpenAIRE

    S.S. Kulkarni; P.D. Chavan

    2014-01-01

    Influence of ethanol the end product of alcoholic fermentation on the growth of finger millet (var. GPU-28, CO-9) seedlings of two finger millet was studied as a means of evaluating growth responses under anoxia. The germination was delayed by ethanol treatment in case of both the cultivars. Ethanol treatment affected the growth of both radicle and coleoptile of seedlings. In this respect the radicle growth is more sensitive to ethanol than the coleoptile in both varieties of finger millet. T...

  1. Compilation of an informative microsatellite set for genetic characterisation of East African finger millet (Eleusine coracana

    Directory of Open Access Journals (Sweden)

    Santie M. De Villiers

    2015-03-01

    Discussion: Five individual samples from an accession captured the largest number of alleles per locus compared to the four different bulked sampling strategies but this difference was not significant. The identified set comprised 20 markers: UGEP24, UGEP53, UGEP84, UGEP27, UGEP98, UGEP95, UGEP64, UGEP33, UGEP67, UGEP106, UGEP110, UGEP57, UGEP96, UGEP66, UGEP46, UGEP79, UGEP20, UGEP12, UGEP73 and UGEP5 and was since used to assess East African finger millet genetic diversity in two separate studies.

  2. An endophytic fungus isolated from finger millet (Eleusine coracana) produces anti-fungal natural products.

    Science.gov (United States)

    Mousa, Walaa K; Schwan, Adrian; Davidson, Jeffrey; Strange, Philip; Liu, Huaizhi; Zhou, Ting; Auzanneau, France-Isabelle; Raizada, Manish N

    2015-01-01

    Finger millet is an ancient African cereal crop, domesticated 7000 years ago in Ethiopia, reaching India at 3000 BC. Finger millet is reported to be resistant to various fungal pathogens including Fusarium sp. We hypothesized that finger millet may host beneficial endophytes (plant-colonizing microbes) that contribute to the antifungal activity. Here we report the first isolation of endophyte(s) from finger millet. Five distinct fungal species were isolated from roots and predicted taxonomically based on 18S rDNA sequencing. Extracts from three putative endophytes inhibited growth of F. graminearum and three other pathogenic Fusarium species. The most potent anti-Fusarium strain (WF4, predicted to be a Phoma sp.) was confirmed to behave as an endophyte using pathogenicity and confocal microscopy experiments. Bioassay-guided fractionation of the WF4 extract identified four anti-fungal compounds, viridicatol, tenuazonic acid, alternariol, and alternariol monomethyl ether. All the purified compounds caused dramatic breakage of F. graminearum hyphae in vitro. These compounds have not previously been reported to have anti-Fusarium activity. None of the compounds, except for tenuazonic acid, have previously been reported to be produced by Phoma. We conclude that the ancient, disease-tolerant crop, finger millet, is a novel source of endophytic anti-fungal natural products. This paper suggests the value of the crops grown by subsistence farmers as sources of endophytes and their natural products. Application of these natural chemicals to solve real world problems will require further validation.

  3. Characterization of Antifungal Natural Products Isolated from Endophytic Fungi of Finger Millet (Eleusine coracana).

    Science.gov (United States)

    Mousa, Walaa Kamel; Schwan, Adrian L; Raizada, Manish N

    2016-09-03

    Finger millet is an ancient African-Indian crop that is resistant to many pathogens including the fungus, Fusarium graminearum. We previously reported the first isolation of putative fungal endophytes from finger millet and showed that the crude extracts of four strains had anti-Fusarium activity. However, active compounds were isolated from only one strain. The objectives of this study were to confirm the endophytic lifestyle of the three remaining anti-Fusarium isolates, to identify the major underlying antifungal compounds, and to initially characterize the mode(s) of action of each compound. Results of confocal microscopy and a plant disease assay were consistent with the three fungal strains behaving as endophytes. Using bio-assay guided fractionation and spectroscopic structural elucidation, three anti-Fusarium secondary metabolites were purified and characterized. These molecules were not previously reported to derive from fungi nor have antifungal activity. The purified antifungal compounds were: 5-hydroxy 2(3H)-benzofuranone, dehydrocostus lactone (guaianolide sesquiterpene lactone), and harpagoside (an iridoide glycoside). Light microscopy and vitality staining were used to visualize the in vitro interactions between each compound and Fusarium; the results suggested a mixed fungicidal/fungistatic mode of action. We conclude that finger millet possesses fungal endophytes that can synthesize anti-fungal compounds not previously reported as bio-fungicides against F. graminearum.

  4. Assessment of Nutrient Contents of Modified Finger Millet (Eleusine coracana Starch

    Directory of Open Access Journals (Sweden)

    Tukura Bitrus Wokhe

    2017-02-01

    Full Text Available Modification processes can change the physicochemical and structural properties of native starch, thereby increasing its industrial applications. Finger millet starch (FMS was modified with casava starch (CS, guar gum (GG and xanthan gum (XG modifiers at the ratios of 95:5%, 90:10%, 80:20% and 75: 25%, for each of the modifier. The proximate and mineral compositions of the modified starch were determined using standard methods. Atomic absorption spectrometry method was used to quantify the mineral contents of the modified starch. Proximate contents of the modified FMS starch varied according to the type of the modifier and FMS/modifier ratios. Concentrations of carbohydrate in CS (66.97±0.03%, GG (64.42±0.05% and XG (64.64 ± 0.01% FMS modified starches were highest at 10%, 25% and 5% of the modifier contents repectively. The highest levels of fat in GG (8.91±0.02%, XG (7.89±0.01 and ash (3.55±0.02% in CS modified starches were recorded when the quantity of the modifiers were increased to 25%. Fatty acid levels in the modified starches varied in the order of XG (7.74±0.03% at 20% > GG (7.13±0.02% at 25% > CS (5.14±0.20% at 10%. At 25% modifier contents, levels of mineral element were highest in the modified CS and GG starches. Modifications decreased Mg, Mn, Fe, Zn, and Cu contents, while the concentrations Na, K, Ca and P increased. The modified starches can be used for production of some foods for specific health purposes.

  5. Insights using the molecular model of Lipoxygenase from Finger millet (Eleusine coracana (L.)).

    Science.gov (United States)

    Tiwari, Apoorv; Avashthi, Himanshu; Jha, Richa; Srivastava, Ambuj; Kumar Garg, Vijay; Wasudev Ramteke, Pramod; Kumar, Anil

    2016-01-01

    Lipoxygenase-1 (LOX-1) protein provides defense against pests and pathogens and its presence have been positively correlated with plant resistance against pathogens. Linoleate is a known substrate of lipoxygenase and it induces necrosis leading to the accumulation of isoflavonoid phytoalexins in plant leaves. Therefore, it is of interest to study the structural features of LOX-1 from Finger millet. However, the structure ofLOX-1 from Finger millet is not yet known. A homology model of LOX-1 from Finger millet is described. Domain architecture study suggested the presence of two domains namely PLAT (Phospho Lipid Acyl Transferase) and lipoxygenase. Molecular docking models of linoleate with lipoxygenase from finger millet, rice and sorghum are reported. The features of docked models showed that finger millet have higher pathogen resistance in comparison to other cereal crops. This data is useful for the molecular cloning of fulllength LOX-1 gene for validating its role in improving plant defense against pathogen infection and for various other biological processes.

  6. Characterization of Antifungal Natural Products Isolated from Endophytic Fungi of Finger Millet (Eleusine coracana

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa

    2016-09-01

    Full Text Available Finger millet is an ancient African-Indian crop that is resistant to many pathogens including the fungus, Fusarium graminearum. We previously reported the first isolation of putative fungal endophytes from finger millet and showed that the crude extracts of four strains had anti-Fusarium activity. However, active compounds were isolated from only one strain. The objectives of this study were to confirm the endophytic lifestyle of the three remaining anti-Fusarium isolates, to identify the major underlying antifungal compounds, and to initially characterize the mode(s of action of each compound. Results of confocal microscopy and a plant disease assay were consistent with the three fungal strains behaving as endophytes. Using bio-assay guided fractionation and spectroscopic structural elucidation, three anti-Fusarium secondary metabolites were purified and characterized. These molecules were not previously reported to derive from fungi nor have antifungal activity. The purified antifungal compounds were: 5-hydroxy 2(3H-benzofuranone, dehydrocostus lactone (guaianolide sesquiterpene lactone, and harpagoside (an iridoide glycoside. Light microscopy and vitality staining were used to visualize the in vitro interactions between each compound and Fusarium; the results suggested a mixed fungicidal/fungistatic mode of action. We conclude that finger millet possesses fungal endophytes that can synthesize anti-fungal compounds not previously reported as bio-fungicides against F. graminearum.

  7. Bioaccessible mineral content of malted finger millet (Eleusine coracana), wheat (Triticum aestivum), and barley (Hordeum vulgare).

    Science.gov (United States)

    Platel, Kalpana; Eipeson, Sushma W; Srinivasan, Krishnapura

    2010-07-14

    Malted grains are extensively used in weaning and geriatric foods. Malting generally improves the nutrient content and digestibility of foods. The present investigation examined the influence of malting of finger millet, wheat, and barley on the bioaccessibility of iron, zinc, calcium, copper, and manganese. Malting increased the bioaccessibility of iron by >3-fold from the two varieties of finger millet and by >2-fold from wheat, whereas such a beneficial influence was not seen in barley. The bioaccessibility of zinc from wheat and barley increased to an extent of 234 and 100%, respectively, as a result of malting. However, malting reduced the bioaccessibility of zinc from finger millet. Malting marginally increased the bioaccessibility of calcium from white finger millet and wheat. Whereas malting did not exert any influence on bioaccessibility of copper from finger millet and wheat, it significantly decreased (75%) the same from barley. Malting did increase the bioaccessibility of manganese from brown finger millet (17%) and wheat (42%). Thus, malting could be an appropriate food-based strategy to derive iron and other minerals maximally from food grains.

  8. Eleusine indica resistance to Accase inhibitors

    OpenAIRE

    Vidal, Ribas Antonio; Portes, Emerson da Silva; Lamego, Fabiane Pinto; Trezzi, Michelangelo Muzell

    2006-01-01

    Dentre as causas da ineficácia no controle de plantas daninhas destaca-se a resistência delas aos herbicidas. Os objetivos deste trabalho foram avaliar a suspeita de resistência de Eleusine indica a inibidores de acetil-CoA carboxilase (ACCase) e investigar a ocorrência de resistência cruzada entre os inibidores de ACCase. Biótipo de Eleusine indica originado do Mato Grosso com suspeita de resistência aos herbicidas inibidores de ACCase foi avaliado em casa de vegetação na sua suscetibilidade...

  9. Cancro em mogno africano no estado do Pará

    Directory of Open Access Journals (Sweden)

    Célia Regina Tremacoldi

    2013-06-01

    Full Text Available Sintomas de cancro foram observados em plantios de mogno africano, no município de Dom Eliseu, Pará. Os fungos associados aos tecidos sintomáticos foram identificados como Lasiodiplodia theobromae e Fusarium subglutinans. Culturas puras desses fungos foram testadas quanto à patogenicidade em mudas de mogno africano sadias. Apenas L. theobromae produziu cancro, por meio de inoculação por ferimento e alta umidade. A confirmação de L. theobromae como agente causal do cancro ocorreu após o reisolamento do fungo a partir das plantas inoculadas em casa de vegetação, concluindo a primeira verificação do postulado de Koch para esse patossistema.

  10. Intervarietal variations in various oxidative stress markers and antioxidant potential of finger millet (Eleusine coracana) subjected to drought stress.

    Science.gov (United States)

    Bartwal, Arti; Pande, Anjali; Sharma, Priyadarshini; Arora, Sandeep

    2016-07-01

    Drought is a major form of abiotic stress leading to lower crop productivity. Experiment was carried out for selecting the most tolerant genotype among six different genotypes of finger millet under drought stress. Seeds of six finger millet genotypes were sown in pots and grown for 35 days. After this period, drought was induced by withholding watering for stressed plants while control plants were watered regularly for comparison. Among all six different varieties of finger millet screened (PR202, PES400, PRM6107, VL283, VL328 and VL149) under varying intensities of drought stress,PRM6107 and PR202 showed highest stress tolerance by limiting excessive accumulation of reactive oxygen species (ROS) through activation of ROS scavenging antioxidative enzymes. A 200% increase in ascorbate content was recorded in PRM6107 and PR202, while in other varieties limited increase in ascorbate content was observed. Maximum decrease in chlorophyll content was observed in VL328 (83%) while least drop was observed in VL149 (65%). Relative water content indicated that PR202 was able to retain maximum water content under stress, as it recorded least drop in relative water content (55%), contributing to its better survival under stress. In conclusion finger millet genotypes PRM6107 and PR202 possessed maximum drought tolerance potential and thus may be used for allele mining of drought tolerant genes, which can further be employed for the development of more drought stress tolerant staple crops using biotechnological approach.

  11. Induced mutagenesis in finger-millet (Eleusine coracana Gaertn.) with gamma-rays and ethyl methane sulphonate

    International Nuclear Information System (INIS)

    Aradhya, R.S.; Madhavamenon, P.

    1979-01-01

    The seeds of CO-1 variety were treated with gamma-rays and EMS, each in 5 doses, 10 to 50 kR and 0.5 to 2.5% respectively. The chlorophyll mutation rate was characterized by linearity at low to medium doses and saturation as well as erratic behavior at high doses. As per mutation rate, estimated on the basis of M 2 plants, EMS induced as high frequency. The spectrum consisted of albina, chlorina zantha, albo-viridis, tigrina (3 types) and striata (2 types), with tigrina being predominant. The treatments varied in their spectrum, with 2.0% yielding the widest spectrum of mutants. (author)

  12. Finger millet (Ragi, Eleusine coracana L.): a review of its nutritional properties, processing, and plausible health benefits.

    Science.gov (United States)

    Shobana, S; Krishnaswamy, K; Sudha, V; Malleshi, N G; Anjana, R M; Palaniappan, L; Mohan, V

    2013-01-01

    Finger millet or ragi is one of the ancient millets in India (2300 BC), and this review focuses on its antiquity, consumption, nutrient composition, processing, and health benefits. Of all the cereals and millets, finger millet has the highest amount of calcium (344mg%) and potassium (408mg%). It has higher dietary fiber, minerals, and sulfur containing amino acids compared to white rice, the current major staple in India. Despite finger millet's rich nutrient profile, recent studies indicate lower consumption of millets in general by urban Indians. Finger millet is processed by milling, malting, fermentation, popping, and decortication. Noodles, vermicilli, pasta, Indian sweet (halwa) mixes, papads, soups, and bakery products from finger millet are also emerging. In vitro and in vivo (animal) studies indicated the blood glucose lowering, cholesterol lowering, antiulcerative, wound healing properties, etc., of finger millet. However, appropriate intervention or randomized clinical trials are lacking on these health effects. Glycemic index (GI) studies on finger millet preparations indicate low to high values, but most of the studies were conducted with outdated methodology. Hence, appropriate GI testing of finger millet preparations and short- and long-term human intervention trials may be helpful to establish evidence-based health benefits. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Expression of four phosphate transporter genes from Finger millet (Eleusine coracana L.) in response to mycorrhizal colonization and Pi stress.

    Science.gov (United States)

    Pudake, Ramesh Namdeo; Mehta, Chandra Mohan; Mohanta, Tapan Kumar; Sharma, Suvigya; Varma, Ajit; Sharma, Anil Kumar

    2017-05-01

    Phosphorus (P) is a vital nutrient for plant growth and development, and is absorbed in cells with the help of membrane-spanning inorganic phosphate transporter (Pht) protein. Symbiosis with arbuscular mycorrhiza (AM) also helps in transporting P from the soil to plant and Pht proteins play an important role in it. To understand this phenomenon in Finger Mille plant, we have cloned four Pht genes from Finger millet, which shares the homology with Pht1 protein family of cereals. Expression pattern analysis during the AM infection indicated that EcPT4 gene was AM specific, and its expression was higher in roots where AM colonization percentage was high. The expression level of EcPT1-4 gene under the phosphorous (Pi) stress in seedlings was found to be consistent with its role in acquisition of phosphorus. Homology study of the EcPt proteins with Pht proteins of cereals shows close relationship. The findings of the study indicate that Pht1 family genes from finger millet can serve to be an important resource for the better understanding of phosphorus use efficiency.

  14. A somaclonal line SE7 of finger millet (Eleusine coracana) exhibits modified cytokinin homeostasis and increased grain yield

    Czech Academy of Sciences Publication Activity Database

    Radchuk, V.; Radchuk, R.; Pirko, Y.; Vaňková, Radomíra; Gaudinová, Alena; Korkhovoy, V.; Yemets, A.; Weber, H.; Weschke, W.; Blume, Y. B.

    2012-01-01

    Roč. 63, č. 15 (2012), s. 5497-5506 ISSN 0022-0957 R&D Projects: GA ČR GA522/09/2058 Institutional research plan: CEZ:AV0Z50380511 Keywords : Cytokinin * cytokinin metabolism * finger millet Subject RIV: ED - Physiology Impact factor: 5.242, year: 2012

  15. Resistência de Eleusine indica aos inibidores de ACCase Eleusine indica resistance to ACCase inhibitors

    Directory of Open Access Journals (Sweden)

    R.A. Vidal

    2006-01-01

    Full Text Available Dentre as causas da ineficácia no controle de plantas daninhas destaca-se a resistência delas aos herbicidas. Os objetivos deste trabalho foram avaliar a suspeita de resistência de Eleusine indica a inibidores de acetil-CoA carboxilase (ACCase e investigar a ocorrência de resistência cruzada entre os inibidores de ACCase. Biótipo de Eleusine indica originado do Mato Grosso com suspeita de resistência aos herbicidas inibidores de ACCase foi avaliado em casa de vegetação na sua suscetibilidade para diversos produtos do grupo dos ariloxifenoxipropionatos e cicloexanodionas. Estudos de resposta à dose confirmaram que o biótipo era 18 vezes mais insensível ao sethoxydim do que biótipo suscetível nunca aspergido com herbicidas. Também se constatou resistência cruzada ao fenoxaprop, cyhalofop, propaquizafop e butroxydim. Não se observou resistência cruzada aos produtos fluazifop, haloxyfop, quizalofop e clethodim.Among the causes for weed control inefficacy, the worst one is resistance to herbicides. The objectives of this work were to evaluate an Eleusine indica biotype suspected of resistance to ACCase inhibitors and to investigate the occurrence of cross- resistance to several ACCase inhibitors. One biotype of Eleusine indica originated from Mato Grosso with suspected resistance to ACCase inhibitors was evaluated in a greenhouse in relation to its susceptibility to several products of the ariloxyphenoxypropionate and cyclohexanedione groups. Studies on dose response confirmed that the suspected biotype was 18 times more insensitive to sethoxydim than the susceptible biotype that had never been treated with herbicides. Cross-resistance was confirmed for fenoxaprop, cyhalofop, propaquizafop and butroxydim. No cross-resistance was observed with fluazifop, haloxyfop, quizalofop, and clethodim.

  16. Obituary: John Louis Africano III, 1951-2006

    Science.gov (United States)

    Barker, Edwin, S.

    2007-12-01

    The orbital debris, space surveillance, and astronomical communities lost a valued and beloved friend when John L. Africano passed away on July 27, 2006, at the young age of 55. John passed away in Honolulu, Hawaii, from complications following a heart attack suffered while playing racquetball, which was his avocation in life. Born on February 8, 1951, in Saint Louis, Missouri, John graduated with a B.S. in Physics from the University of Missouri at Saint Louis in 1973, and received a Master's degree in Astronomy from Vanderbilt University in 1974. John had a real love for astronomical observing and for conveying his many years of experience to others. He encouraged many young astronomers and mentored them in the basics of photometry and astronomical instrumentation. John was author or co-author on nearly one-hundred refereed publications ranging from analyses of cool stars to the timing of occultations to space surveillance. He was honored for his contributions to minor planet research when the Jet Propulsion Laboratory named Minor Planet 6391 (Africano) after him. John held operational staff positions at several major observatories including McDonald Observatory in Texas, Kitt Peak National Observatory in Arizona, and the Cloudcroft Telescope Facility in New Mexico. He observed at numerous observatories worldwide, including Cerro Tololo Inter-American Observatory (CTIO) in Chile, developing a world-wide network of friends and colleagues. John's ability to build diverse teams through his managerial and technical skills, not to mention his smiling personality, resulted in numerous successes in the observational astronomy and space surveillance arenas. As an astronomer for Boeing LTS Inc., he worked for many years at the Advanced Maui Optical and Space Surveillance site (AMOS) on Maui, Hawaii, where he contributed his operational and instrumental expertise to both the astronomy and space surveillance communities. He was also the co-organizer of the annual AMOS

  17. Mutagen induced variability in Ragi (Eleucine coracana Gaertn)

    International Nuclear Information System (INIS)

    Haider, Z.A.; Mahto, J.L.; Kumar, Binod

    1996-01-01

    Varieties A-404 and HR-374 of Ragi (Eleucine coracana Gaertn) when subjected to different doses of gamma rays, EMS and their combination treatments showed a linear reverse relationship between doses and germination percentage. The same was true for seedling survival and pollen fertility. Variety A-404 proved to be more sensitive to all mutagenic treatments as compared to the variety HR-374. There was, however, a general gain with respect to panicle length in most of the treatments, where as for a number of fingers per panicle no order could be observed in any of the mutagen used. (author). 10 refs., 2 tabs

  18. Arte africano como punto de partida para una actividad de arte terapia

    OpenAIRE

    Vassiliadou Yiannaka, María

    2001-01-01

    La visita a una exposición de arte africano realizada con un grupo de pacientes de un Hospital Psiquiátrico sirve en este artículo para reflexionar sobre los aspectos implicados en la organización de actividades de arte terapia y sobre el problema de la accesibilidad de todos los ciudadanos a la vida cultural

  19. Identification of putative QTLs for seedling stage phosphorus starvation response in finger millet (Eleusine coracana L. Gaertn. by association mapping and cross species synteny analysis.

    Directory of Open Access Journals (Sweden)

    M Ramakrishnan

    Full Text Available A germplasm assembly of 128 finger millet genotypes from 18 countries was evaluated for seedling-stage phosphorus (P responses by growing them in P sufficient (Psuf and P deficient (Pdef treatments. Majority of the genotypes showed adaptive responses to low P condition. Based on phenotype behaviour using the best linear unbiased predictors for each trait, genotypes were classified into, P responsive, low P tolerant and P non-responsive types. Based on the overall phenotype performance under Pdef, 10 genotypes were identified as low P tolerants. The low P tolerant genotypes were characterised by increased shoot and root length and increased root hair induction with longer root hairs under Pdef, than under Psuf. Association mapping of P response traits using mixed linear models revealed four quantitative trait loci (QTLs. Two QTLs (qLRDW.1 and qLRDW.2 for low P response affecting root dry weight explained over 10% phenotypic variation. In silico synteny analysis across grass genomes for these QTLs identified putative candidate genes such as Ser-Thr kinase and transcription factors such as WRKY and basic helix-loop-helix (bHLH. The QTLs for response under Psuf were mapped for traits such as shoot dry weight (qHSDW.1 and root length (qHRL.1. Putative associations of these QTLs over the syntenous regions on the grass genomes revealed proximity to cytochrome P450, phosphate transporter and pectin methylesterase inhibitor (PMEI genes. This is the first report of the extent of phenotypic variability for P response in finger millet genotypes during seedling-stage, along with the QTLs and putative candidate genes associated with P starvation tolerance.

  20. Identification of putative QTLs for seedling stage phosphorus starvation response in finger millet (Eleusine coracana L. Gaertn.) by association mapping and cross species synteny analysis.

    Science.gov (United States)

    Ramakrishnan, M; Ceasar, S Antony; Vinod, K K; Duraipandiyan, V; Ajeesh Krishna, T P; Upadhyaya, Hari D; Al-Dhabi, N A; Ignacimuthu, S

    2017-01-01

    A germplasm assembly of 128 finger millet genotypes from 18 countries was evaluated for seedling-stage phosphorus (P) responses by growing them in P sufficient (Psuf) and P deficient (Pdef) treatments. Majority of the genotypes showed adaptive responses to low P condition. Based on phenotype behaviour using the best linear unbiased predictors for each trait, genotypes were classified into, P responsive, low P tolerant and P non-responsive types. Based on the overall phenotype performance under Pdef, 10 genotypes were identified as low P tolerants. The low P tolerant genotypes were characterised by increased shoot and root length and increased root hair induction with longer root hairs under Pdef, than under Psuf. Association mapping of P response traits using mixed linear models revealed four quantitative trait loci (QTLs). Two QTLs (qLRDW.1 and qLRDW.2) for low P response affecting root dry weight explained over 10% phenotypic variation. In silico synteny analysis across grass genomes for these QTLs identified putative candidate genes such as Ser-Thr kinase and transcription factors such as WRKY and basic helix-loop-helix (bHLH). The QTLs for response under Psuf were mapped for traits such as shoot dry weight (qHSDW.1) and root length (qHRL.1). Putative associations of these QTLs over the syntenous regions on the grass genomes revealed proximity to cytochrome P450, phosphate transporter and pectin methylesterase inhibitor (PMEI) genes. This is the first report of the extent of phenotypic variability for P response in finger millet genotypes during seedling-stage, along with the QTLs and putative candidate genes associated with P starvation tolerance.

  1. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L. Gaertn. Genotypes through Association Mapping and in silico Comparative Genomics Analyses.

    Directory of Open Access Journals (Sweden)

    M Ramakrishnan

    Full Text Available Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX for tiller production, calmodulin (CaM binding protein for seed yield and pectin methylesterase inhibitor (PMEI for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of fungal resistant and high yielding varieties of finger millet.

  2. Over-expression of a NAC 67 transcription factor from finger millet (Eleusine coracana L.) confers tolerance against salinity and drought stress in rice.

    Science.gov (United States)

    Rahman, Hifzur; Ramanathan, Valarmathi; Nallathambi, Jagedeeshselvam; Duraialagaraja, Sudhakar; Muthurajan, Raveendran

    2016-05-11

    NAC proteins (NAM (No apical meristem), ATAF (Arabidopsis transcription activation factor) and CUC (cup-shaped cotyledon)) are plant-specific transcription factors reported to be involved in regulating growth, development and stress responses. Salinity responsive transcriptome profiling in a set of contrasting finger millet genotypes through RNA-sequencing resulted in the identification of a NAC homolog (EcNAC 67) exhibiting differential salinity responsive expression pattern. Full length cDNA of EcNAC67 was isolated, characterized and validated for its role in abiotic stress tolerance through agrobacterium mediated genetic transformation in a rice cultivar ASD16. Bioinformatics analysis of putative NAC transcription factor (TF) isolated from a salinity tolerant finger millet showed its genetic relatedness to NAC67 family TFs in related cereals. Putative transgenic lines of rice over-expressing EcNAC67 were generated through Agrobacterium mediated transformation and presence/integration of transgene was confirmed through PCR and southern hybridization analysis. Transgenic rice plants harboring EcNAC67 showed enhanced tolerance against drought and salinity under greenhouse conditions. Transgenic rice plants were found to possess higher root and shoot biomass during stress and showed better revival ability upon relief from salinity stress. Upon drought stress, transgenic lines were found to maintain higher relative water content and lesser reduction in grain yield when compared to non-transgenic ASD16 plants. Drought induced spikelet sterility was found to be much lower in the transgenic lines than the non-transgenic ASD16. Results revealed the significant role of EcNAC67 in modulating responses against dehydration stress in rice. No detectable abnormalities in the phenotypic traits were observed in the transgenic plants under normal growth conditions. Results indicate that EcNAC67 can be used as a novel source for engineering tolerance against drought and salinity stress in rice and other crop plants.

  3. Application of Copper-Chitosan Nanoparticles Stimulate Growth and Induce Resistance in Finger Millet (Eleusine coracana Gaertn.) Plants against Blast Disease.

    Science.gov (United States)

    Sathiyabama, Muthukrishnan; Manikandan, Appu

    2018-02-28

    Copper-chitosan nanoparticle (CuChNp) was synthesized and used to study its effect on finger millet plant as a model plant system. Our objective was to explore the efficacy of CuChNp application to control blast disease of finger millet. CuChNp was applied to finger millet either as a foliar spray or as a combined application (involving seed coat and foliar spray). Both the application methods enhanced growth profile of finger millet plants and increased yield. The increased yield was nearly 89% in combined application method. Treated finger millet plants challenged with Pyricularia grisea showed suppression of blast disease development when compared to control. Nearly 75% protection was observed in the combined application of CuChNp to finger millet plants. In CuChNp treated finger millet plants, a significant increase in defense enzymes was observed, which was detected both qualitatively and quantitatively. The suppression of blast disease correlates well with increased defense enzymes in CuChNp treated finger millet plants.

  4. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L.) Gaertn.) Genotypes through Association Mapping and in silico Comparative Genomics Analyses.

    Science.gov (United States)

    Ramakrishnan, M; Antony Ceasar, S; Duraipandiyan, V; Vinod, K K; Kalpana, Krishnan; Al-Dhabi, N A; Ignacimuthu, S

    2016-01-01

    Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs) for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX) for tiller production, calmodulin (CaM) binding protein for seed yield and pectin methylesterase inhibitor (PMEI) for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of fungal resistant and high yielding varieties of finger millet.

  5. Alleviation of nickel toxicity in finger millet (Eleusine coracana L. germinating seedlings by exogenous application of salicylic acid and nitric oxide

    Directory of Open Access Journals (Sweden)

    Kasi Viswanath Kotapati

    2017-06-01

    Full Text Available This study investigated the effect of salicylic acid (SA and sodium nitroprusside (SNP; NO donor on nickel (Ni toxicity in germinating finger millet seedlings. Fourteen-day-old finger millet plants were subjected to 0.5 mmol L−1 Ni overload and treated with 0.2 mmol L−1 salicylic acid and 0.2 mmol L−1 sodium nitroprusside to lessen the toxic effect of Ni. The Ni overload led to high accumulation in the roots of growing plants compared to shoots, causing oxidative stress. It further reduced root and shoot length, dry mass, total chlorophyll, and mineral content. Exogenous addition of either 0.2 mmol L−1 SA or 0.2 mmol L−1 SNP reduced the toxic effect of Ni, and supplementation with both SA and SNP significantly reduced the toxic effect of Ni and increased root and shoot length, chlorophyll content, dry mass, and mineral concentration in Ni-treated plants. The results show that oxidative stress can be triggered in finger millet plants by Ni stress by induction of lipoxygenase activity, increase in levels of proline, O2•− radical, MDA, and H2O2, and reduction in the activity of antioxidant enzymes such as CAT, SOD, and APX in shoots and roots. Exogenous application of SA or SNP, specifically the combination of SA + SNP, protects finger millet plants from oxidative stress observed under Ni treatment.

  6. Identification and molecular characterization of 48 kDa calcium binding protein as calreticulin from finger millet (Eleusine coracana) using peptide mass fingerprinting and transcript profiling.

    Science.gov (United States)

    Singh, Manoj; Metwal, Mamta; Kumar, Vandana A; Kumar, Anil

    2016-01-30

    Attempts were made to identify and characterize the calcium binding proteins (CaBPs) in grain filling stages of finger millet using proteomics, bioinformatics and molecular approaches. A distinctly observed blue color band of 48 kDa stained by Stains-all was eluted and analyzed as calreticulin (CRT) using nano liquid chromatography-tandem mass spectrometry (nano LC-MS). Based on the top hits of peptide mass fingerprinting results, conserved primers were designed for isolation of the CRT gene from finger millet using calreticulin sequences of different cereals. The deduced nucleotide sequence analysis of 600 bp amplicon showed up to 91% similarity with CRT gene(s) of rice and other plant species and designated as EcCRT1. Transcript profiling of EcCRT1 showed different levels of relative expression at different stages of developing spikes. The higher expression of EcCRT1 transcripts and protein were observed in later stages of developing spikes which might be due to greater translational synthesis of EcCRT1 protein during seed maturation in finger millet. Preferentially higher synthesis of this CaBP during later stages of grain filling may be responsible for the sequestration of calcium in endoplasmic reticulum of finger millet grains. © 2015 Society of Chemical Industry.

  7. Molecular characterization of EcCIPK24 gene of finger millet (Eleusine coracana) for investigating its regulatory role in calcium transport.

    Science.gov (United States)

    Chinchole, Mahadev; Pathak, Rajesh Kumar; Singh, Uma M; Kumar, Anil

    2017-08-01

    Finger millet grains contain exceptionally high levels of calcium which is much higher compared to other cereals and millets. Since calcium is an important macronutrient in human diet, it is necessary to explore the molecular basis of calcium accumulation in the seeds of finger millet. CIPK is a calcium sensor gene, having role in activating Ca 2+ exchanger protein by interaction with CBL proteins. To know the role of EcCIPK24 gene in seed Ca 2+ accumulation, sequence is retrieved from the transcriptome data of two finger millet genotypes GP1 (low Ca 2+ ) and GP45 (high Ca 2+ ), and the expression was determined through qRT-PCR. The higher expression was found in root, shoot, leaf and developing spike tissue of GP45 compared to GP1; structural analysis showed difference of nine SNPs and one extra beta sheet domain as well as differences in vacuolar localization was predicted; besides, the variation in amino acid composition among both the genotypes was also investigated. Molecular modeling and docking studies revealed that both EcCBL4 and EcCBL10 showed strong binding affinity with EcCIPK24 (GP1) compared to EcCIPK24 (GP45). It indicates a genotypic structural variation, which not only affects the affinity but also calcium transport efficiency after interaction of CIPK-CBL with calcium exchanger ( Ec CAX1b) to pull calcium in the vacuole. Based on the expression and in silico study, it can be suggested that by activating EcCAX1b protein, EcCIPK24 plays an important role in high seed Ca 2+ accumulation.

  8. Overexpression of EcbHLH57 Transcription Factor from Eleusine coracana L. in Tobacco Confers Tolerance to Salt, Oxidative and Drought Stress.

    Directory of Open Access Journals (Sweden)

    K C Babitha

    Full Text Available Basic helix-loop-helix (bHLH transcription factors constitute one of the largest families in plants and are known to be involved in various developmental processes and stress tolerance. We report the characterization of a stress responsive bHLH transcription factor from stress adapted species finger millet which is homologous to OsbHLH57 and designated as EcbHLH57. The full length sequence of EcbHLH57 consisted of 256 amino acids with a conserved bHLH domain followed by leucine repeats. In finger millet, EcbHLH57 transcripts were induced by ABA, NaCl, PEG, methyl viologen (MV treatments and drought stress. Overexpression of EcbHLH57 in tobacco significantly increased the tolerance to salinity and drought stress with improved root growth. Transgenic plants showed higher photosynthetic rate and stomatal conductance under drought stress that resulted in higher biomass. Under long-term salinity stress, the transgenic plants accumulated higher seed weight/pod and pod number. The transgenic plants were also tolerant to oxidative stress and showed less accumulation of H202 and MDA levels. The overexpression of EcbHLH57 enhanced the expression of stress responsive genes such as LEA14, rd29A, rd29B, SOD, APX, ADH1, HSP70 and also PP2C and hence improved tolerance to diverse stresses.

  9. Studies on mutagenic effectiveness and efficiency of gamma rays and its effect on quantitative traits in finger millet (Eleusine coracana L. Gaertn

    Directory of Open Access Journals (Sweden)

    A.R. Ambavane

    2015-01-01

    Full Text Available Dry seeds (12% moisture of two finger millet cultivar viz., Dapoli-1 and Dapoli Safed were irradiated with four doses of gamma-rays viz., 400 Gy, 500 Gy, 600 Gy and 700 Gy at BARC, Mumbai. In laboratory test, root and shoot lengths of seedlings were decreased with increase in dose of gamma rays. Similarly, germination percentage and survival rate of seedlings were decreased with increase in dose of gamma irradiation during field study. In M1 generation, three types of chlorophyll mutations viz., albino, xantha and viridis were observed. Albino and xantha were observed in all treatments, whereas, viridis observed only in lower doses viz., 400 Gy and 500 Gy. Based on the chlorophyll mutation frequency on M1 plants, mutagenic effectiveness and efficiency were computed. In Dapoli-1 variety, two early maturing mutants and three high yielding mutants were isolated from 500 Gy dose and 600 Gy dose, respectively. In M2 generation, the mutagenic treatments were effective in inducing various types of chlorophyll and morphological macro mutants, few of those show significant change in flowering, maturity and plant height character and few of them have good breeding value.

  10. Dinâmicas de Gênero e Feminismos em Contextos Africanos

    Directory of Open Access Journals (Sweden)

    Eufémia Vicente Rocha

    2016-09-01

    Full Text Available O presente dossiê visa contribuir para os debates promovidos pela Revista Estudos Feministas sobre feminismos descoloniais e pós-coloniais, apresentando reflexões oriundas de estudos desenvolvidos em contextos africanos – Cabo Verde, São Tomé e Príncipe, Guiné Bissau, Angola, Moçambique e África do Sul

  11. Distribution of Multipple Herbicide Resistant Eleusine Indica L. Gaertn. an Oil Palm Estate in North Sumatera

    OpenAIRE

    syahputra, ahmad bayu; Purba, Edison Purba; Hasanah, Yaya Hasanah

    2016-01-01

    Goosegrass (Eleusine indica) in a block of oil palm Estate at Serdang Bedagai, North Sumatera had been controlled using glyphosate and paraquat for more than 26 years continuously. Recently, it had been reported that the two herbicides failed to control the population. The estate consists of 4000 Ha or 437 blocks which had slightly different history in weed management. The objective of this study was to determine the distribution Eleusine indica Resistant to glyphosate and paraquat in the oil...

  12. Phytochemistry, cytotoxicity and antiviral activity of Eleusine indica (sambau)

    Science.gov (United States)

    Iberahim, Rashidah; Yaacob, Wan Ahmad; Ibrahim, Nazlina

    2015-09-01

    Goose grass also known as Eleusine indica (EI) is a local medicinal plant that displays antioxidant, antimicrobial and anticancer activities. The present study is to determine the phytochemical constituents, cytotoxicity and antiviral activities for both crude extract and fraction obtained from the plant. The crude extract contained more secondary metabolites compared to the hexane fraction as gauged using standard phytochemical tests. Cytotoxicity screening against Vero cells using MTT assay showed that the CC50 values for crude extract and hexane fraction were 2.07 and 5.62 mg/ml respectively. The antiviral activity towards Herpes Simplex Virus type 1 (HSV-1) was determined using plaque reduction assay. The selective indices (SI = CC50 / EC50) for both methanol extract and hexane fraction were 12.2 and 6.2 respectively. These results demonstrate that the extract prepared from E. indica possesses phytochemical compound that was non cytotoxic to the cell with potential antiviral activity.

  13. El concepto de identidad en la novela "El africano" de Le Clézio

    OpenAIRE

    Margueliche, Juan Cruz Ramón

    2018-01-01

    En las últimas décadas, la problemática de las identidades se tornó recurrente en diversos dominios académicos. La novela El africano del escritor francés Le Clézio por ser una autobiografía novelada, nos permite analizar el concepto de identidad a partir de la vida del autor sobre algunos tópicos que se interrelacionan a lo largo de la obra. La novela presenta un interesante ejemplo de cómo el concepto de identidad se emparenta más con las perspectivas constructivistas ya que inicia un recor...

  14. Characterisation of glufosinate resistance mechanisms in Eleusine indica.

    Science.gov (United States)

    Jalaludin, Adam; Yu, Qin; Zoellner, Peter; Beffa, Roland; Powles, Stephen B

    2017-06-01

    An Eleusine indica population has evolved resistance to glufosinate, a major post-emergence herbicide of global agriculture. This population was analysed for target-site (glutamine synthetase) and non-target-site (glufosinate uptake, translocation and metabolism) resistance mechanisms. Glutamine synthetase (GS) activity extracted from susceptible (S) and resistant (R*) plants was equally sensitive to glufosinate inhibition, with IC 50 values of 0.85 mm and 0.99 mm, respectively. The extractable GS activity was also similar in S and R* samples. Foliar uptake of [ 14 C]-glufosinate did not differ in S and R* plants, nor did glufosinate net uptake in leaf discs. Translocation of [ 14 C]-glufosinate into untreated shoots and roots was also similar in both populations, with 44% to 47% of the herbicide translocated out from the treated leaf 24 h after treatment. The HPLC and LC-MS analysis of glufosinate metabolism revealed no major metabolites in S or R* leaf tissue. Glufosinate resistance in this resistant population is not due to an insensitive GS, or increased activity, or altered glufosinate uptake and translocation, or enhanced glufosinate metabolism. Thus, target-site resistance is likely excluded and the exact resistance mechanism(s) remain to be determined. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  15. Anticonvulsant potentials of ethanolic extract of Eleusine indica

    Directory of Open Access Journals (Sweden)

    Ette Okon Ettebong

    2016-11-01

    Full Text Available Objective: To assess the anticonvulsant potentials of ethanolic extract of Eleusine indica. Methods: Albino Wistar mice were separated into five groups with six animals in each group and thereafter pretreated with distilled water, various doses of the extract (200–600 mg/kg and standard drug diazepam (0.5 mg/kg. Thirty minutes later, pentylenetetrazole (70 mg/kg, aminophylline (280 mg/kg and isoniazid (250 mg/kg were used to induce convulsions by intraperitoneal administration. These mice were then placed in plexiglas cages and monitored for the occurrence of seizures over a thirty-minute time period. The latency of convulsions, duration of tonic convulsions and mortality protection were recorded. Data obtained were analyzed using GraphPad InStat 3.10. Results: The results showed that the extract exhibited a dose-dependent increase in the latency of clonic convulsions and decrease in duration of tonic convulsions as compared to the control and these effects were statistically significant (P < 0.001. The extract also provided protection against the mortality which was similar to that produced by the standard drug diazepam. Conclusions: The significant increase in the latency of clonic convulsions and decrease in duration of tonic convulsions caused by the extract show anticonvulsant activity and corroborate with the claims of the traditional use of the plant as an anticonvulsant remedy.

  16. El origen africano del cultivo del arroz en Las Américas

    Directory of Open Access Journals (Sweden)

    Carney, Judith A.

    2015-06-01

    Full Text Available Until the period of the transatlantic slave trade, rice was not cultivated in the Americas. By the eighteenth century the crop was widely established across plantation societies from South Carolina to Brazil. Grown by slaves as well as maroons, for subsistence and also for export, the onset of rice cultivation in the Americas has long been attributed to European planters. This article presents evidence that supports African agency in establishing rice culture in the New World. Emphasis is on African rice (Oryza glaberrima, enslaved West Africans for whom the crop was a dietary staple, and an indigenous rice knowledge system with identical features across the African and American Atlantic. A comparative analysis of land use, methods of cultivation, milling and cooking traditions illuminates the diffusion of African rice culture to the Americas and the role of West African slaves in pioneering rice as a New World subsistence staple.El arroz no empezó a ser cultivado en las Américas sino hasta el periodo del comercio transatlántico de esclavos. Para el siglo XVIII este cultivo ya se había establecido extensamente en plantaciones desde Carolina del Sur hasta Brasil. Cultivado por esclavos así como cimarrones, tanto para la subsistencia como para la exportación, el comienzo de la cultivación de arroz en las Américas invariablemente se ha atribuido a los dueños de plantaciones europeos. Este artículo presenta evidencia del importante papel que desempeñaron los africanos en establecer la cultura del arroz en el Nuevo Mundo. Este trabajo se enfoca sobre el arroz africano (Oryza glaberrima, personas esclavizadas de África occidental para quienes este cultivo era un alimento básico, y un sistema de conocimiento indígena sobre el arroz con características idénticas entre el Atlántico africano y americano. Un estudio comparativo de usos del suelo, métodos de cultivo, procesos de molienda y tradiciones culinarias ilumina el tema de la

  17. Sobre el envío de tropas de la Legio VII Gemina al limes africano

    Directory of Open Access Journals (Sweden)

    Juan José PALAO VICENTE

    2010-02-01

    Full Text Available RESUMEN: Las relaciones entre Hispania y Africa en época romana fueron corrientes en todos los campos, incluyendo el militar. Este artículo intenta analizar la presencia en territorio africano de tropas de la Legio VII Gemina, tratando de conocer cuáles fueron los verdaderos motivos de dicha estancia. El estudio del material amplía la visión tradicional de las posibles funciones allí desempeñadas por estos destacamentos, que posiblemente abarcaron aspectos administrativos y logísticos.ABSTRACT: The relationship between Hispania and Africa in the Roman world were very strong in alls fields incluiding the military, too. This paper purposes to analize the presence of legio VII Gemina's troops in African territories, attempting to know the true reasons of this presence.The study of material presents a new vision about the mission of those troops, which undertake possibly administratives and logistics works.

  18. O Cultivo do Mogno Africano (Khaya spp. e o Crescimento da Atividade no Brasil

    Directory of Open Access Journals (Sweden)

    Andressa Ribeiro

    2017-04-01

    Full Text Available RESUMO O setor florestal brasileiro está em plena expansão e com um aumento gradativo de investidores florestais optando pelo cultivo de espécies de madeira nobre. O mogno africano (Khaya spp. é uma espécie que vêm se destacando na preferência dos empresários como opção no investimento florestal. Porém, estudos e pesquisas sobre a espécie, principalmente no Brasil, são escassos. Assim, a presente revisão procurou reunir diversas fontes de publicação, nacionais e internacionais, abordando aspectos históricos do mogno, buscando aclarar as características da espécie e a experiência de outros países no manejo dessa cultura.

  19. Intrusiones de polvo africano en la región Caribe de Colombia

    Directory of Open Access Journals (Sweden)

    Omar Javier Ramírez Hernández

    2015-02-01

    Full Text Available El transporte intercontinental de material mineral desde África hacia el Caribe, Norteamérica y Suramérica es un fenómeno de interés investigativo internacional. Varios estudios han llamado la atención sobre los efectos meteorológicos y las implicaciones climáticas derivadas de la presencia de este aerosol en la atmósfera, como también de los potenciales efectos sobre la salud humana. La región Caribe colombiana no es ajena a esta problemática, pero son escasos los estudios realizados. Por lo anterior, el objetivo de este artículo es identificar eventos de intrusión de polvo de origen africano en la región Caribe de Colombia. Metodológicamente se analizaron mapas de concentración de polvo generados por los modelos GEOS-5, SKIRON, NAAPS y CALIPSO, entre el 01 de enero y el 31 de diciembre de 2012. También se utilizaron imágenes generadas por el sensor satelital MODIS e información de redes de calidad del aire de la región. Según los resultados obtenidos, existen evidencias para afirmar que al norte de Colombia, en la región Caribe, se detectan eventos de intrusión de polvo de origen africano. El periodo del año en que se presentan mayores niveles de concentración es entre marzo y septiembre, sobresaliendo los meses de marzo, junio, julio y agosto.

  20. USE OF ELEUSINE INDICA (L. GAERTN. (KECHILA GHAS AS AN ANTIPYRETIC MEDICINE OF HERBIVORES

    Directory of Open Access Journals (Sweden)

    Shibabrata Pattanayak

    2017-06-01

    Full Text Available In Murshidabad district of West Bengal state, India, the traditionally animal rearing people feed parts of Kechila ghas as an antipyretic medicine to their herbivorous animals. The plant is identified as Eleusine indica (L. Gaertn. of the family Poaceae. After collection from the soil, the plants are washed and the whole root along with 1-2 centimeter of stems are cut and fed directly at fresh, succulent stage to the ailing animals for that purpose.

  1. Two New Records from Lebanon: Chamaesyce nutans (Lag.) Small (Euphorbiaceae) and Eleusine indica (L.) Gaertner (Poaceae)

    OpenAIRE

    HABER, Ricardus M.; SEMAAN, Myrna T.

    2007-01-01

    Chamaesyce nutans (Lag.) Small (Euphorbiaceae) and Eleusine indica (L.) Gaertner (Poaceae) are described as new records for the flora of Lebanon. Specimens of C. nutans collected from roadsides and rocks in a middle mountain forest confirm the occurrence of the species on the western slopes of the Mount Lebanon Range. Additionally, specimens of E. indica were collected from wasteland and roadsides in the coastal town of Kaslik. The species were observed to thrive abundantly in similar habitat...

  2. EL GOLFO DE GUINEA: ¿FUTURO GOLFO PÉRSICO AFRICANO?

    Directory of Open Access Journals (Sweden)

    Yoslán Silverio González

    2016-05-01

    Full Text Available Las diferentes regiones africanas no han dejado de estar en el epicentro de los rejuegos y de las influencias de las potencias capitalistas, sobre todo de las ex metrópolis europeas como Francia y de Estados Unidos, debido a que cada una de ellas resulta tener una significativa importancia en el contexto de las relaciones internacionales, ya sea por su posición geográfica como por sus recursos naturales. En las últimas décadas, garantizar los suministros energéticos se ha convertido en un asunto de seguridad nacional para todos los países, principalmente para aquellos con un alto nivel de consumo y desarrollo industrial. Este artículo estudia cómo las regiones productoras de petróleo en África Subsahariana desempeñan un rol estratégico en este contexto, pero teniendo en vista que el continente africano ha sido siempre objeto de la codicia por parte de los países capitalistas desarrollados.

  3. Os portugueses no Índico Africano no século XVII

    Directory of Open Access Journals (Sweden)

    Manuel Nunes Dias

    1961-09-01

    Full Text Available No comêço do século XVI, com a organização da rota atlân-tica das especiarias asiáticas pelos portuguêses, cristãos e mou-ros disputaram, numa luta de morte, os campos auríferos do Monomotapa . As minas dos sertões de Sofala eram, então, uma das prêsas mais cobiçadas das grandes potências. Na ânsia de possuirem o precioso metal amarelo, capitães e mercadores manuelinos tomaram contacto com a terra enigmática do Ín-dico africano, reconhecendo, através de repetição e conjuga-ção de esforços, as vantagens e as possibilidades do seu do-mínio econômico e político. O ouro em pó, que se apanhava nos aluviões ao longo dos rios, era uma obsessão.

  4. Aporte aborigen y africano de diferentes regiones de la Argentina en Buenos Aires

    Directory of Open Access Journals (Sweden)

    Avena, Sergio Alejandro

    2003-01-01

    Full Text Available En trabajos anteriores realizados en muestras poblacionales de la Región Metropolitana de Buenos Aires (RMBA hemos observado un 15,2 % de aporte indígena (AI y un 3,8% de africano (AA. En el presente estudio se analizó una muestra de 169 individuos provenientes de las regiones del noroeste (NOA, del nordeste (NEA y del centro del país (CP, se excluye la RMBA que fueron donantes en el Banco de Sangre de la Provincia de Buenos Aires. Esta muestra se adicionó a las previamente obtenidas de las mismas regiones en los hospitales de Clínicas e Italiano. El objetivo fue evaluar si existe una distribución diferencial del AI y el AA según la región de origen de los dadores. Para ello se determinaron los sistemas ABO, Rh, MNS, Diego, Duffy, Gm y Km. Las frecuencias génicas y haplotípicas fueron calculadas mediante métodos de máxima verosimilitud y la mezcla génica se calculó aplicando el programa ADMIX. La región con mayor AI fue NOA (49,5% seguida por NEA (28,4% y CP (17,2%, mientras que el AA fue similar en las tres regiones (NOA 3,2%, NEA 3,5% y CP 3,8.

  5. Dinâmica Socio-Cultural da Cidade: A Conflitualidade dos Imigrantes Africanos em Lisboa

    Directory of Open Access Journals (Sweden)

    Anelino Francisco Silva

    2010-01-01

    Full Text Available O artigo analisa sobre a dinâmica sociocultural, o direito dos imigrantes à cidade, caso da Área Metropolitana de Lisboade Lisboa, traz uma reflexão do atual processo de inserção ou não dos imigrantes africanos de Angola, Cabo-Verde, São Tomé e Guine-Bissau, como um fator de conflito gerado pela sua permanência na cidade. A globalização atua no global-local, ajuizando a cidade reforçar as características local baseada da legitimidade cultural e política. A cidade metrópole precisa estar preparada às novas exigências produtivas do sistema econômico e da reprodução social. Sendo Lisboa, no contexto dos processos de estruturação econômico-territorial e de diferenciação sócio-urbanística, o espaço polarizado pela capital do país e, ter sido a metrópole que teve sob seu domínio Angola, Cabo -Verde, São Tomé e Guine – Bissau, que com o fim da colonização inicia um processo migratório para Portugal, especialmente, Lisboa. A baixa inserção ao mercado de trabalho, a tênue socialização cultural e a negação ao direito à cidade passam a ser obstáculos em toda sua plenitude

  6. Asociaciones de migrantes africanos. Educación y formación

    Directory of Open Access Journals (Sweden)

    Palaudàrias i Martí, Josep M.

    2013-06-01

    Full Text Available Based on the data obtained in a survey of 206 representatives of African immigrant associations, nine life histories and 54 interviews carried out with representatives of these associations, this article analyzes their educational reality from different points of view. First, we establish the importance the association leaders give to education (the role that education played in their migration processes and in the associations they lead. Second, we take a close look at their educational level and training. And finally, we analyze the training activities promoted by these associations or the activities in which they are involved (collaborating with other associations, institutions or services. Concerning these activities, we analyze their types (topics covered: language, religion, labor market integration, etc., and orientation (tendency to multiculturalism and collaboration or distance from formal education institutions.A partir de los datos obtenidos a través de un cuestionario suministrado a 206 representantes de asociaciones de inmigrantes de origen africano y de 20 historias de vida y 66 entrevistas realizadas a representantes de estas asociaciones, este artículo analiza la realidad educativa de las asociaciones desde diferentes puntos de vista. Primero, estableciendo el valor que los dirigentes asociativos dan a la educación (papel que ha jugado en sus procesos migratorios y papel que juega en las asociaciones que dirigen. En segundo lugar, aproximándonos a su nivel de estudios e itinerario formativo. Y finalmente, analizando las actividades formativas que estas asociaciones impulsan o en las que participan (colaborando con otras asociaciones, instituciones o servicios. De estas actividades, se han analizado tanto su tipología (temas que se abordan: lengua, religión, inserción laboral, entre otros, como su orientación (tendencia al multiculturalismo y colaboración o distanciamiento respecto al ámbito educativo formal.

  7. CARAMUJO AFRICANO: APENAS UMA ESPÉCIE INTRODUZIDA OU UM PROBLEMA DE SAÚDE PÚBLICA?

    Directory of Open Access Journals (Sweden)

    Marcelo Nocelle ALMEIDA

    2016-12-01

    Full Text Available Esta revisão objetiva alertar e informar a população em geral e os profissionais de saúde quanto à atuação do caramujo africano [Achatina fulica (Bowdich, 1822], como hospedeiro intermediário, na transmissão de nematoides de interesse veterinário e humano. Também demonstra o papel das conchas como criadouros para mosquitos vetores de diversas viroses, algumas inclusive com alta incidência no norte e noroeste fluminense.

  8. REGINALDO, Lucilene. Os Rosários dos Angolas: Irmandades de africanos e crioulos na Bahia setecentista.

    Directory of Open Access Journals (Sweden)

    Ênio José da Costa Brito

    2013-06-01

    Full Text Available Os Rosários dos Angolas realiza um estudo da Irmandade de Nossa Senhora do Rosário dos Pretos das Portas do Carmo( Bahia A novidade do estudo está nos subsidios coletados na Africa, Portugal e Brasil , no resgate da presença banto na Bahia e na abertura para um dialogo das cosmovisões banto e cristã.REGINALDO, Lucilene. Os Rosários dos Angolas: Irmandades de africanos e crioulos na Bahia setecentista. São Paulo: Alameda, 2011. 416p. ISBN 978-85-7939-082-1 

  9. Una tipología analítica de las redes de apoyo social en inmigrantes africanos en Andalucía

    OpenAIRE

    Martínez García, Manuel Francisco; García Ramírez, Manuel; Maya Jariego, Isidro

    2001-01-01

    Elaboramos, por medio del análisis de conglomerados, una clasificación de las redes de apoyo social de los inmigrantes africanos afincados en Andalucía. Como variables criterio, utilizamos diversos indicadores del tamaño, la composición, la disponibilidad, la utilización y la suficiencia de la estructura personal de ayuda. Con un colectivo de 600 africanos, obtuvimos cuatro categorías: 1) redes pequeñas con predominio de amigos compatriotas; 2) redes mínimas con predominio de a...

  10. Una tipología analítica de las redes de apoyo social en inmigrantes africanos en Andalucía

    OpenAIRE

    MANUEL F. MARTÍNEZ GARCÍA; MANUEL GARCÍA RAMÍREZ; ISIDRO MAYA JARIEGO

    2001-01-01

    Se elabora una clasificación de las redes de apoyo social de inmigrantes africanos en Andalucía. Para ello se empleó un análisis de conglomerados con varias variables: el tamaño, la composición, la disponibilidad, la utilización y la capacidad de la red de apoyo social. Con un grupo de 600 inmigrantes africanos, se obtuvieron cuatro categorías: pequeñas redes de compatriotas amigos; redes insuficientes; redes de tamaño medio compuestas por españoles y compatriotas amigos; redes de tamaño medi...

  11. La mediación intercultural en las asociaciones de inmigrantes de origen africano

    Directory of Open Access Journals (Sweden)

    Llevot Calvet, Núria

    2013-06-01

    Full Text Available The article presents an analysis of intercultural mediation in the associations of African-origin immigrants in three regions (Catalonia, Valencia and Navarre. Specifically, we present how this is being carried out together with the situation of the mediators based on a survey of 206 associations of immigrant-origin people and thirty interviews (fifteen with managers; ten with administrations and entities that habitually work with these associations and five with non-associated immigrants. The results indicate that the associations are place of coexistence, but a significant proportion of these lack specific clear objectives in their work with their users and other social agents. This practice in the associations is incipient, in contrast with the trend in the Spanish entities, witch now are beginning to apply this in the educational, health and family environments. Furthermore, the African associations often distort this concept considering it simply as a conversation among their own people.El artículo analiza cómo realizan la mediación intercultural las asociaciones de inmigrantes de origen africano de tres comunidades autónomas (Cataluña, Valencia y Navarra y qué caracteriza a sus actores. El análisis se basa en una encuesta realizada a 206 asociaciones de inmigrantes y en 30 entrevistas: 15 a directivos, 10 a administraciones y entidades que trabajan con ellas, y 5 a inmigrantes no asociados. Los resultados apuntan a que las asociaciones son espacios de convivencia, pero una parte importante de ellas carece de objetivos específicos claros en sus planteamientos de trabajo con sus usuarios y otros agentes sociales. También hemos visto que la mediación es una práctica incipiente en las asociaciones, al contrario de lo que sucede en el seno de las instituciones españolas del ámbito educativo, sanitario y familiar. Por otra parte, hemos apreciado que las asociaciones africanas desvirtúan, a menudo, el concepto de mediación consider

  12. Breve historia del cine en el África negra. Cuando el cinc era "africano", pero sólo de nombre.

    OpenAIRE

    Speciale, Alessandra

    1999-01-01

    Speciale, A. (1999). Breve historia del cine en el África negra. Cuando el cinc era "africano", pero sólo de nombre. Nosferatu. Revista de cine. (30):4-19. http://hdl.handle.net/10251/41132. 4 19 30

  13. Complete plastid genome sequence of goosegrass (Eleusine indica) and comparison with other Poaceae.

    Science.gov (United States)

    Zhang, Hui; Hall, Nathan; McElroy, J Scott; Lowe, Elijah K; Goertzen, Leslie R

    2017-02-05

    Eleusine indica, also known as goosegrass, is a serious weed in at least 42 countries. In this paper we report the complete plastid genome sequence of goosegrass obtained by de novo assembly of paired-end and mate-paired reads generated by Illumina sequencing of total genomic DNA. The goosegrass plastome is a circular molecule of 135,151bp in length, consisting of two single-copy regions separated by a pair of inverted repeats (IRs) of 20,919 bases. The large (LSC) and the small (SSC) single-copy regions span 80,667 bases and 12,646 bases, respectively. The plastome of goosegrass has 38.19% GC content and includes 108 unique genes, of which 76 are protein-coding, 28 are transfer RNA, and 4 are ribosomal RNA. The goosegrass plastome sequence was compared to eight other species of Poaceae. Although generally conserved with respect to Poaceae, this genomic resource will be useful for evolutionary studies within this weed species and the genus Eleusine. Copyright © 2016. Published by Elsevier B.V.

  14. Produtividade e qualidade de frutos de pepino africano em resposta à adubação nitrogenada

    Directory of Open Access Journals (Sweden)

    Guilherme Antunes

    2014-02-01

    Full Text Available O pepino africano (Cucumis metuliferus é uma planta nativa do continente africano, com potencial para comércio internacional, destinado tanto ao consumo, na forma de sucos, como ao uso farmacêutico. Todavia, pouco se sabe sobre seu manejo cultural, em nossas condições, sobretudo quanto à adubação nitrogenada. Objetivou-se, com este trabalho, avaliar o efeito de doses de nitrogênio sobr e o crescimento da planta, a produtividade e a qualidade de frutos. O trabalho foi conduzido em casa de vegetação, em vasos de 10 L. Constou de seis tratamentos, correspondentes às doses de N de 0, 40, 80, 120, 160 e 200 kg ha-1, distribuídas no delineamento inteiramente casualizado, com 11 repetições. Avaliaram-se: produção de frutos, massas de matéria seca de parte aérea e de raízes e características físicas e químicas de frutos. O número de frutos e a massa de matéria fresca de frutos apresentaram valores máximos estimados de 2,24 frutos/planta e de 516,41 g/planta, respectivamente, com as doses de 122,50 e de 154,44 kg ha-1 de N. A massa média de fruto estimada foi de 240,27 g/fruto, obtida com a dose máxima testada (200 kg ha-1 de N. A massa seca de parte aérea teve máximo estimado de 39,12 g/planta, com a dose de 144,0 kg ha-1 de N. As doses de N não interferiram na qualidade dos frutos. Para o cultivo do pepino africano, sugere-se a dose de 154,44 kg ha-1 de N, que proporciona 2,18 frutos/ planta, com massa média de 237,07 g/fruto, e produtividade estimada de 516,41 g/planta.

  15. In-silico mining, type and frequency analysis of genic microsatellites of finger millet (Eleusine coracana (L.) Gaertn.): a comparative genomic analysis of NBS-LRR regions of finger millet with rice.

    Science.gov (United States)

    Kalyana Babu, B; Pandey, Dinesh; Agrawal, P K; Sood, Salej; Kumar, Anil

    2014-05-01

    In recent years, the increased availability of the DNA sequences has given the possibility to develop and explore the expressed sequence tags (ESTs) derived SSR markers. In the present study, a total of 1956 ESTs of finger millet were used to find the microsatellite type, distribution, frequency and developed a total of 545 primer pairs from the ESTs of finger millet. Thirty-two EST sequences had more than two microsatellites and 1357 sequences did not have any SSR repeats. The most frequent type of repeats was trimeric motif, however the second place was occupied by dimeric motif followed by tetra-, hexa- and penta repeat motifs. The most common dimer repeat motif was GA and in case of trimeric SSRs, it was CGG. The EST sequences of NBS-LRR region of finger millet and rice showed higher synteny and were found on nearly same positions on the rice chromosome map. A total of eight, out of 15 EST based SSR primers were polymorphic among the selected resistant and susceptible finger millet genotypes. The primer FMBLEST5 could able to differentiate them into resistant and susceptible genotypes. The alleles specific to the resistant and susceptible genotypes were sequenced using the ABI 3130XL genetic analyzer and found similarity to NBS-LRR regions of rice and finger millet and contained the characteristic kinase-2 and kinase 3a motifs of plant R-genes belonged to NBS-LRR region. The In-silico and comparative analysis showed that the genes responsible for blast resistance can be identified, mapped and further introgressed through molecular breeding approaches for enhancing the blast resistance in finger millet.

  16. Characterization of metabolic network of oxalic acid biosynthesis through RNA seq data analysis of developing spikes of finger millet (Eleusine coracana): Deciphering the role of key genes involved in oxalate formation in relation to grain calcium accumulation.

    Science.gov (United States)

    Akbar, Naved; Gupta, Supriya; Tiwari, Apoorv; Singh, K P; Kumar, Anil

    2018-04-05

    In the present study, we identified seven major genes of oxalic acid biosynthesis pathway (SGAT, GGAT, ICL, GLO, MHAR, APO and OXO) from developing spike transcriptome of finger millet using rice as a reference. Sequence alignment of identified genes showed high similarity with their respective homolog in rice except for OXO and GLO. Transcript abundance (FPKM) reflects the higher accumulation of identified genes in GP-1 (low calcium genotype) as compared to GP-45 (high calcium genotype) which was further confirmed by qRT-PCR analysis, indicating differential oxalate formation in both genotypes. Determination of oxalic acid and tartaric acid content in developing spikes explain that higher oxalic acid content in GP-1 however, tartaric acid content was more in GP-45. Higher calcium content in GP-45 and lower oxalate accumulation may be due to the diversion of more ascorbic acid into tartaric acid and may correspond to less formation of calcium oxalate. Our results suggest that more than one pathway for oxalic acid biosynthesis might be present in finger millet with probable predominance of ascorbate-tartarate pathway rather than glyoxalate-oxalate conversion. Thus, finger millet can be use as an excellent model system for understanding more specific role of nutrients-antinutrients interactions, as evident from the present study. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Fluctuation of Dof1/Dof2 expression ratio under the influence of varying nitrogen and light conditions: involvement in differential regulation of nitrogen metabolism in two genotypes of finger millet (Eleusine coracana L.).

    Science.gov (United States)

    Gupta, Supriya; Gupta, Sanjay Mohan; Gupta, Alok Kumar; Gaur, Vikram Singh; Kumar, Anil

    2014-08-10

    In order to gain insights into the mechanism of high nitrogen use efficiency (NUE) of finger millet (FM) the role of Dof2 transcription factor (TF), which is a repressor of genes involved in C/N metabolism was investigated. The partial cDNA fragment of EcDof2 (912-bp; GenBank acc. no. KF261117) was isolated and characterized from finger millet (FM) that showed 63% and 58% homology with Dof2 of Zea mays at nucleotide and protein level, respectively. Its expression studies were carried out along with the activator EcDof1 in two genotypes (GE3885, high protein genotype (HPG); GE1437, low protein genotype (LPG)) of FM differing in grain protein contents (13.8% and 6.2%) showed that EcDof2 is expressed in both shoot and root tissues with significantly (p≤0.05) higher expression in the roots. The diurnal expression of both EcDof1 and EcDof2 in shoots was differential having different time of peak expression indicating a differential response to diurnal condition. Under continuous dark conditions, expression of EcDof1 and EcDof2 oscillated in both the genotypes whereas on illumination, the fold expression of EcDof1 was higher as compared to EcDof2. Under increasing nitrate concentration, EcDof2 expression increases in roots and shoots of LPG while it remains unchanged in HPG. However, the EcDof1 expression was found to increase in both genotypes. Further, time kinetics studies under single nitrate concentration revealed that EcDof2 was repressed in the roots of both genotypes whereas EcDof1 oscillated with time. The EcDof1/EcDof2 ratio measured showed differential response under different light and nitrogen conditions. It was higher in the roots of HPG indicating higher activation of genes involved in N uptake and assimilation resulting in high grain protein accumulation. The results indicate that both light and nitrogen concentration influence Dof1 and Dof2 expression and suggests a complex pattern of regulation of genes influenced by these plant specific TFs. In nutshell, the Dof1/Dof2 ratio can serve as an index for measuring the N responsiveness and NUE of crops and can be further validated by Dof2 knock down approach. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Root growth of Cynodon dactylon and Eleusine indica collected from motorways at different concentrations of lead.

    Science.gov (United States)

    Wong, M H; Lau, W M

    1985-04-01

    An ecological survey was conducted on the roadside vegetation at three different sites: Tai Po, a commercial and residential area (average annual daily traffic (AADT) = 23730; and Shek O and Wu Kai Sha, recreational areas (AADT = 1590 and 20, respectively). Cynodon dactylon and Eleusine indica were the two most dominant species recorded. The Tai Po site had higher Pb contents in both soil and plant, followed by Shek O, and then Wu Kai Sha. Tillers of C. dactylon and E. indica from the three sites were subjected to a series concentrations of Pb(NO3)2. By comparing their indexes of tolerance and values of 14-day EC50 (effective concentration reducing the normal root growth by 50%), roadside populations of the two grasses collected from Tai Po and Shek O, especially the former one, were more tolerant to elevated levels of Pb compared with those collected from Wu Kai Sha.

  19. Cytotoxicity and antiviral activities of Asplenium nidus, Phaleria macrocarpa and Eleusine indica

    Science.gov (United States)

    Tahir, Mariya Mohd; Ibrahim, Nazlina; Yaacob, Wan Ahmad

    2014-09-01

    Three local medicinal plants namely Asplenium nidus (langsuyar), Eleusine indica (sambau) and Phaleria macrocarpa (mahkota dewa) were screened for the cytotoxicity and antiviral activities. Six plant extracts were prepared including the aqueous and methanol extracts from A. nidus leaf and root, aqueous extract from dried whole plant of E. indica and methanol extract from P. macrocarpa fruits. Cytotoxicity screening in Vero cell line by MTT assay showed that the CC50 values ranged from 15 to 60 mg/mL thus indicating the safety of the extracts even at high concentrations. Antiviral properties of the plant extracts were determined by plaque reduction assay. The EC50 concentrations were between 3.2 to 47 mg/mL. The selectivity indices (SI = CC50/EC50) of each tested extracts ranged from 4.3 to 63.25 indicating the usefulness of the extracts as potential antiviral agents.

  20. Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

    Science.gov (United States)

    Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

    2015-10-01

    Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.

  1. Una tipología analítica de las redes de apoyo social en inmigrantes africanos en Andalucía

    Directory of Open Access Journals (Sweden)

    MANUEL F. MARTÍNEZ GARCÍA

    2001-01-01

    Full Text Available Se elabora una clasificación de las redes de apoyo social de inmigrantes africanos en Andalucía. Para ello se empleó un análisis de conglomerados con varias variables: el tamaño, la composición, la disponibilidad, la utilización y la capacidad de la red de apoyo social. Con un grupo de 600 inmigrantes africanos, se obtuvieron cuatro categorías: pequeñas redes de compatriotas amigos; redes insuficientes; redes de tamaño medio compuestas por españoles y compatriotas amigos; redes de tamaño medio de familiares. La tipología sirve para distinguir niveles de bienestar psicológico, tipos de utilización de servicios y otras características sociales, demográficas y psicológicas.

  2. Ressignificando identidades: um estudo antropológico sobre experiências migratórias dos estudantes africanos no Brasil

    Directory of Open Access Journals (Sweden)

    Dulce Maria Domingos Chale João Mungoi

    Full Text Available Partindo do pressuposto de que alteridade é um fenômeno universal e de que todos os grupos constroem categorias para classificar a si e ao outro, no presente artigo faz-se uma reflexão sobre a experiência singular de imigração estudantil no Brasil, a partir de uma perspectiva relacional que busca analisar as percepções e as configurações identitárias desses estudantes na sua relação com a população local que os classifica como africanos. Os dados analisados neste trabalho permitem refletir sobre a presença dos universitários africanos no Brasil, em geral, e em Porto Alegre, em particular, a partir de uma tríplice identidade: identidade nacional, identidade continental e identidade racial.

  3. Studi Efisiensi Penyisihan COD dalam Lindi dengan Sistem Evapotranspirasi Menggunakan Tumbuhan Sente (Alocasia macrorrhiza dan Rumput Belulang (Eleusine indica

    Directory of Open Access Journals (Sweden)

    Badrus Zaman

    2017-11-01

    Full Text Available COD dalam lindi merupakan salah satu parameter yang secara umum berada pada konsentrasi yang tiggi sebagai salah satu hasil biodegradasi material organik dan anorganik dalam sampah di TPA. Sistem evapotranspirasi yang menggunakan tumbuhan lokal merupakan salah satu sistem yang menjanjikan. Penelitian dilakukan untuk mengetahui efisiensi penyisihan COD dalam lindi dengan reaktor evapotranspirasi secara kontinyu yang menggunakan tumbuhan Tumbuhan Sente (Alocasia macrorrhiza dan Rumput Belulang (Eleusine indica. Hasil uji menunjukkan efisiensi pada semua reaktor mulai sekitar hari ke 3 hingga hari ke 25 mengalami fluktuasi yang cenderung menurun (dari ± 75% menjadi ± 50%, tetapi hari selanjutnya cenderung meningkat. Pola tersebut dipengaruhi oleh peran media tanam, bakteri dalam media tanam, bakteri pada akar tumbuhan dan aktivitas metabolisme tumbuhan uji. Secara keseluruhan reaktor yang menggunakan Tumbuhan Sente (Alocasia macrorrhiza lebih fluktuatif dibandingkan denga menggunakan Rumput Belulang (Eleusine indica yang dipengaruhi pola pertumbuhan dan perkembangannya.

  4. Desconocimiento social, exotismo y discriminación racial: representaciones y prácticas hacia migrantes africanos en la sociedad argentina

    Directory of Open Access Journals (Sweden)

    Orlando Morales

    2017-12-01

    Full Text Available Este artículo desarrolla dos cuestiones que consideramos de interés en relación con la integración de migrantes africanos recientes en la sociedad argentina, donde la negritud y la afrodescendencia han sido históricamente negadas e invisibilizadas: sus identificaciones sociales; y las representaciones y prácticas que los construyen como Otros. El corpus de análisis que retoma el artículo corresponde a una investigación desarrollada entre los años 2008 y 2014, que interpeló a través de una aproximación etnográfica, con observación participante y entrevistas abiertas y semi-estructuradas, a un grupo de migrantes procedentes de África y radicados desde la década de 2000 en las ciudades de Buenos Aires y La Plata (Argentina. Con base en ese corpus describimos las identificaciones de los migrantes, en tensión con un imaginario social dominante en la sociedad mayor que representa a las personas socialmente construidas como negras y de origen africano en términos de diferentes, exóticas, desconocidas y objeto de discriminación. Luego avanzamos puntualmente sobre el desconocimiento social, el exotismo y la discriminación racial en tanto representaciones y prácticas recurrentes hacia los migrantes africanos, que entregan elementos de conocimiento sobre las (discontinuidades de la invisibilización de lo africano y lo negro en Argentina.

  5. A concorrência entre o Brasil e a China no mercado Sul-africano: uma aplicação do modelo constant-market-share

    Directory of Open Access Journals (Sweden)

    Ariane Danielle Baraúna da Silva

    2012-04-01

    Full Text Available O forte crescimento da economia chinesa nos últimos anos foi acompanhado pelo aumento de suas necessidades por recursos naturais para atender a demanda crescente de sua indústria de base. O continente africano tem representado, nesse contexto, uma importante fonte de matérias-primas para a China, dado que este continente se apresenta como uma das últimas regiões com abundância de recursos naturais ainda pouco explorados. A presença chinesa no continente africano tem trazido consigo mudanças quanto à vinculação econômica da região com o Brasil. Diante desse cenário, o presente trabalho realiza uma análise das relações econômicas entre o Brasil e a África do Sul, maior economia da África, que representa dentro do continente africano um importante mercado para as exportações brasileiras. Neste trabalho, será feito uso do modelo constant-market-share, com o objetivo de analisar os ganhos ou perdas da competitividade do Brasil e mensurar o quanto o avanço das exportações chinesas contribuíram para as possíveis perdas do Brasil. Os resultados obtidos permitem concluir que boa parte das perdas de exportações brasileiras na África do Sul é devida aos ganhos de participação da China.

  6. Characterization of Eleusine indica with gene mutation or amplification in EPSPS to glyphosate.

    Science.gov (United States)

    Chen, Jingchao; Jiang, Cuilan; Huang, Hongjuan; Wei, Shouhui; Huang, Zhaofeng; Wang, Huimin; Zhao, Dandan; Zhang, Chaoxian

    2017-11-01

    The evolution of weed-resistant species threatens the sustainable use of glyphosate, which is the most important herbicide widely used in agriculture worldwide. Moreover, the high glyphosate resistance (>180-fold based on LD 50 ) of Eleusine indica found in Malaysia, which carries a double mutation in its 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), made the control of this species more difficult. By contrast, the same species carrying the same double mutation in EPSPS (T102I+P106S) but found in China only shows a resistance level of not more than 14-fold based on GR 50 . The resistance level of this population is four times higher than that of the population carrying a single mutation (P106L). Although the members of this population survive under a high glyphosate dosage of 10,080gaeha -1 , their growth was significantly inhibited by glyphosate under the recommend dose (840gaeha -1 ), where in the fresh weight was 85.4% of the control. EPSPS expression, relative copy number, and EPSPS activity in this population were similar to those of the susceptible population. In addition, the expression of two glutathione transferase (GST) genes (GST-U8 and GST-23) and the enzyme activity of the GST in this population did not significantly differ from those of the susceptible population. This finding is important in elucidating the resistance of the naturally evolved glyphosate-resistant (GR) weed species carrying a double mutation in EPSPS to glyphosate. Copyright © 2017. Published by Elsevier Inc.

  7. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    Science.gov (United States)

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  8. Herbicide effects on cuticle ultrastructure in Eleusine indica and Portulaca oleracea.

    Science.gov (United States)

    Malpassi, Rosana N

    2006-04-01

    Eleusine indica and Portulaca oleracea are two common weeds in peanut crops in southern Córdoba. Two chemicals are frequently used to control them, quizalofop for grasses and lactofen for dicots. The objective is to study the effects of quizalofop and lactofen on cuticle ultrastructure in E. indica and P. oleracea, respectively. In the lab, quizalofop was applied on E. indica and lactofen on P. oleracea. Three plant categories were analyzed in each species: 3, 1-2, and no tiller in E. indica, and 8, 6, and 2 nomophylls in P. oleracea. Leaf samples from both species were collected at 7 and 16 days post-application and were treated for scanning electron microscopy. E. indica cuticle treated with lethal dose shows areas where epicuticular waxes disappear, specially in the youngest individuals. These areas are located predominantly on periclinal walls of typical epidermic cells and subsidiary cells. On the other hand, P. oleracea shows cuticle discontinuities that may be caused by lactofen entry. They are smaller and less frequent in plants having 8 or more nomophylls. The remaining waxes act as a herbicide accumulation compartment and, therefore, would partially prevent the active ingredient entry to epidermic cells.

  9. Molecular basis for resistance to ACCase-inhibiting fluazifop in Eleusine indica from Malaysia.

    Science.gov (United States)

    Cha, Thye San; Najihah, Mohamed Ghazani; Sahid, Ismail Bin; Chuah, Tse Seng

    2014-05-01

    Eleusine indica (goosegrass) populations resistant to fluazifop, an acetyl-CoA carboxylase (ACCase: EC6.4.1.2)-inhibiting herbicide, were found in several states in Malaysia. Dose-response assay indicated a resistance factor of 87.5, 62.5 and 150 for biotypes P2, P3 and P4, respectively. DNA sequencing and allele-specific PCR revealed that both biotypes P2 and P3 exhibit a single non-synonymous point mutation from TGG to TGC that leads to a well known Trp-2027-Cys mutation. Interestingly, the highly resistant biotype, P4, did not contain any of the known mutation except the newly discovered target point Asn-2097-Asp, which resulted from a nucleotide change in the codon AAT to GAT. ACCase gene expression was found differentially regulated in the susceptible biotype (P1) and highly resistant biotype P4 from 24 to 72h after treatment (HAT) when being treated with the recommended field rate (198gha(-1)) of fluazifop. However, the small and erratic differences of ACCase gene expression between biotype P1 and P4 does not support the 150-fold resistance in biotype P4. Therefore, the involvement of the target point Asn-2097-Asp and other non-target-site-based resistance mechanisms in the biotype P4 could not be ruled out. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Amelioration of chilling effects by CO/sub 2/ enrichment. [Echinochloa crus-galli; Eleusine indica

    Energy Technology Data Exchange (ETDEWEB)

    Potvin, C.

    1985-01-01

    To analyze the effect of CO/sub 2/ enrichment on the chilling-sensitivity of C/sub 4/ plants from contrasting habitats, plants of Echinochloa crus-galli from Quebec, North Carolina and Mississippi and Eleusine indica from Mississippi were grown for 4 weeks under three thermoperiods (28/22, 24/18 and 21/15/sup 0/C) and two atmospheric CO/sub 2/ concentrations (350 and 675 ..mu..l l/sup -1/). They were then submitted to 1 night chilling at 7/sup 0/C. Photosynthetic carbon uptake, stomatal conductances, and internal CO/sub 2/ concentration were measured using an infra-red gas analyzer in an open system before and after the chilling and during the recovery. Chilling induces a decrease in photosynthesis and conductance and, at 350 ..mu..l l/sup -1/, in internal CO/sub 2/. The decrease in photosynthesis is less important for high CO/sub 2/ grown plants at 28/22/sup 0/C. Chilling generates chlorotic bands on leaf blades but less chlorosis is observed in enriched CO/sub 2/. 17 references, 3 figures, 3 tables.

  11. Alpha-tubulin missense mutations correlate with antimicrotubule drug resistance in Eleusine indica.

    Science.gov (United States)

    Yamamoto, E; Zeng, L; Baird, W V

    1998-02-01

    Dinitroaniline herbicides are antimicrotubule drugs that bind to tubulins and inhibit polymerization. As a result of repeated application of dinitroaniline herbicides, highly resistant and intermediately resistant biotypes of goosegrass (Eleusine indica) developed in previously wild-type populations. Three alpha-tubulin cDNA classes (designated TUA1, TUA2, and TUA3) were isolated from each biotype. Nucleotide differences between the susceptible and the resistant (R) alpha-tubulins were identified in TUA1 and TUA2. The most significant differences were missense mutations that occurred in TUA1 of the R and intermediately resistant (I) biotypes. Such mutations convert Thr-239 to Ile in the R biotype and Met-268 to Thr in the I biotype. These amino acid substitutions alter hydrophobicity; therefore, they may alter the dinitroaniline binding property of the protein. These mutations were correlated with the dinitroaniline response phenotypes (Drp). Plants homozygous for susceptibility possessed the wild-type TUA1 allele; plants homozygous for resistance possessed the mutant tua1 allele; and plants heterozygous for susceptibility possessed both wild-type and mutant alleles. Thus, we conclude that TUA1 is at the Drp locus. Using polymerase chain reaction primer-introduced restriction analysis, we demonstrated that goosegrass genomic DNA can be diagnosed for Drp alleles. Although not direct proof, these results suggest that a mutation in an alpha-tubulin gene confers resistance to dinitroanilines in goosegrass.

  12. Radiosensitivity of fingermillet genotypes

    Energy Technology Data Exchange (ETDEWEB)

    Raveendran, T S; Nagarajan, C; Appadurai, R; Prasad, M N; Sundaresan, N [Tamil Nadu Agricultural Univ., Coimbatore (India)

    1984-07-01

    Varietal differences in radiosensitivity were observed in a study involving 4 genotypes of fingermillet (Eleusine coracana (Linn.) Gaertn.) subjected to gamma-irradiation. Harder seeds were found to tolerate a higher dose of the mutagen.

  13. Genetic studies and a search for molecular markers that are linked ...

    African Journals Online (AJOL)

    SERVER

    White sorghum is ground into flour and used ... Eleusine coracana (L.) Gaertn], maize (Zea mays L.), rice. (Oryza sativa L.) and sugar cane (Saccharum species). (Stroud .... ng/ul solutions were prepared and were used in the construction of.

  14. Controle do capim-braquiária associado à nutrição com boro no cultivo do mogno-africano em sistema silvipastoril

    Directory of Open Access Journals (Sweden)

    Alexandre Magno Brighenti

    Full Text Available Dois experimentos foram conduzidos com o objetivo de avaliar o controle do capim-braquiária (Urochloa decumbens nas linhas de plantio do mogno-africano (Khaya ivorensis com aplicações de herbicidas isoladas ou combinadas com boro (B, bem como a resposta do mogno-africano a esse micronutriente. Ambos os experimentos foram implantados em delineamento experimental em blocos casualizados em parcelas subdivididas, com quatro repetições. Seis tratamentos foram aplicados nas parcelas: testemunha capinada; testemunha sem capina; glyphosate (1.080 g e.a. ha-1 + chlorimuron-ethyl (10 g i.a. ha-1 + 0,05% v/v de óleo mineral, glyphosate (1.080 g e.a. ha-1 + imazethapyr (100 g i.a. ha-1, glyphosate (1.080 g e.a. ha-1 e oxyfluorfen (480 g i.a. ha-1. As subparcelas foram constituídas pela ausência ou presença de 4 kg de ácido bórico (17% B para 100 L de água. A associação do ácido bórico aos herbicidas glyphosate mais chlorimuron-ethyl, glyphosate mais imazethapyr, glyphosate ou oxyfluorfen não interfere no controle do capim-braquiária. A adição do ácido bórico à calda dos herbicidas proporciona incrementos nos teores de boro no solo e, consequentemente, aumento nos teores de boro nas folhas do mogno-africano.

  15. A Dinitroaniline-Resistant Mutant of Eleusine indica Exhibits Cross-Resistance and Supersensitivity to Antimicrotubule Herbicides and Drugs 1

    Science.gov (United States)

    Vaughn, Kevin C.; Marks, M. David; Weeks, Donald P.

    1987-01-01

    A dinitroaniline-resistant (R) biotype of Eleusine indica (L.) Gaertner. (goosegrass) is demonstrated to be cross-resistant to a structurally non-related herbicide, amiprophosmethyl, and supersensitive to two other classes of compounds which disrupt mitosis. These characteristics of the R biotype were discovered in a comparative test of the effects of 24 different antimitotic compounds on the R biotype and susceptible (S) wild-type Eleusine. The compounds tested could be classified into three groups based upon their effects on mitosis in root tips of the susceptible (S) biotype. Class I compounds induced effects like the well known mitotic disrupter colchicine: absence of cortical and spindle microtubules, mitosis arrested at prometaphase, and the formation of polymorphic nuclei after arrested mitosis. The R biotype was resistant to treatment with some class I inhibitors (all dinitroaniline herbicides and amiprophosmethyl) but not all (e.g. colchicine, podophyllotoxin, vinblastine, and pronamide). Roots of the R biotype, when treated with either dinitroaniline herbicides or amiprophosmethyl, exhibited no or only small increases in the mitotic index nor were the spindle and cortical microtubules affected. Compounds of class II (carbamate herbicides and griseofulvin) cause misorientation of microtubules which results in multinucleated cells. Compounds of class III (caffeine and structually related alkaloids) cause imcomplete cell walls to form at telophase. Each of these last two classes of compounds affected the R biotype more than the S biotype (supersensitivity). The cross-resistance and high levels of resistance of the R biotype of Eleusine to the dinitroaniline herbicides and the structurally distinct herbicide, amiprophosmethyl, indicate that a mechanism of resistance based upon metabolic modification, translocation, or compartmentation of the herbicides is probably not operative. Images Fig. 1 Fig. 2 Fig. 3 Fig. 5 Fig. 6 PMID:16665371

  16. A Dinitroaniline-Resistant Mutant of Eleusine indica Exhibits Cross-Resistance and Supersensitivity to Antimicrotubule Herbicides and Drugs.

    Science.gov (United States)

    Vaughn, K C; Marks, M D; Weeks, D P

    1987-04-01

    A dinitroaniline-resistant (R) biotype of Eleusine indica (L.) Gaertner. (goosegrass) is demonstrated to be cross-resistant to a structurally non-related herbicide, amiprophosmethyl, and supersensitive to two other classes of compounds which disrupt mitosis. These characteristics of the R biotype were discovered in a comparative test of the effects of 24 different antimitotic compounds on the R biotype and susceptible (S) wild-type Eleusine. The compounds tested could be classified into three groups based upon their effects on mitosis in root tips of the susceptible (S) biotype. Class I compounds induced effects like the well known mitotic disrupter colchicine: absence of cortical and spindle microtubules, mitosis arrested at prometaphase, and the formation of polymorphic nuclei after arrested mitosis. The R biotype was resistant to treatment with some class I inhibitors (all dinitroaniline herbicides and amiprophosmethyl) but not all (e.g. colchicine, podophyllotoxin, vinblastine, and pronamide). Roots of the R biotype, when treated with either dinitroaniline herbicides or amiprophosmethyl, exhibited no or only small increases in the mitotic index nor were the spindle and cortical microtubules affected. Compounds of class II (carbamate herbicides and griseofulvin) cause misorientation of microtubules which results in multinucleated cells. Compounds of class III (caffeine and structually related alkaloids) cause imcomplete cell walls to form at telophase. Each of these last two classes of compounds affected the R biotype more than the S biotype (supersensitivity). The cross-resistance and high levels of resistance of the R biotype of Eleusine to the dinitroaniline herbicides and the structurally distinct herbicide, amiprophosmethyl, indicate that a mechanism of resistance based upon metabolic modification, translocation, or compartmentation of the herbicides is probably not operative.

  17. C-glycosylflavones from the aerial parts of Eleusine indica inhibit LPS-induced mouse lung inflammation.

    Science.gov (United States)

    De Melo, Giany O; Muzitano, Michelle F; Legora-Machado, Alexandre; Almeida, Thais A; De Oliveira, Daniela B; Kaiser, Carlos R; Koatz, Vera Lucia G; Costa, Sônia S

    2005-04-01

    The infusion of aerial parts (EI) of Eleusine indica Gaertn (Poaceae) is used in Brazil against airway inflammatory processes like influenza and pneumonia. Pre-treatment with 400 mg/kg of crude extract inhibited 98% of lung neutrophil recruitment in mice exposed to aerosols of lipopolysaccharide (LPS) from Gram-negative bacteria, in a dose-dependent manner. At 400 microg/kg, schaftoside (6-C-beta-glucopyranosyl-8-C-alpha-arabinopyranosylapigenin) and vitexin (8-C-beta-glucopyranosylapigenin), isolated from EI, inhibited 62% and 80% of lung neutrophil influx, respectively. These results may justify the popular use of E. indica against airway inflammatory processes.

  18. Transcriptome profiling to discover putative genes associated with paraquat resistance in goosegrass (Eleusine indica L..

    Directory of Open Access Journals (Sweden)

    Jing An

    Full Text Available BACKGROUND: Goosegrass (Eleusine indica L., a serious annual weed in the world, has evolved resistance to several herbicides including paraquat, a non-selective herbicide. The mechanism of paraquat resistance in weeds is only partially understood. To further study the molecular mechanism underlying paraquat resistance in goosegrass, we performed transcriptome analysis of susceptible and resistant biotypes of goosegrass with or without paraquat treatment. RESULTS: The RNA-seq libraries generated 194,716,560 valid reads with an average length of 91.29 bp. De novo assembly analysis produced 158,461 transcripts with an average length of 1153.74 bp and 100,742 unigenes with an average length of 712.79 bp. Among these, 25,926 unigenes were assigned to 65 GO terms that contained three main categories. A total of 13,809 unigenes with 1,208 enzyme commission numbers were assigned to 314 predicted KEGG metabolic pathways, and 12,719 unigenes were categorized into 25 KOG classifications. Furthermore, our results revealed that 53 genes related to reactive oxygen species scavenging, 10 genes related to polyamines and 18 genes related to transport were differentially expressed in paraquat treatment experiments. The genes related to polyamines and transport are likely potential candidate genes that could be further investigated to confirm their roles in paraquat resistance of goosegrass. CONCLUSION: This is the first large-scale transcriptome sequencing of E. indica using the Illumina platform. Potential genes involved in paraquat resistance were identified from the assembled sequences. The transcriptome data may serve as a reference for further analysis of gene expression and functional genomics studies, and will facilitate the study of paraquat resistance at the molecular level in goosegrass.

  19. Efficient callus formation and plant regeneration of goosegrass [Eleusine indica (L.) Gaertn.].

    Science.gov (United States)

    Yemets, A I; Klimkina, L A; Tarassenko, L V; Blume, Y B

    2003-02-01

    Efficient methods in totipotent callus formation, cell suspension culture establishment and whole-plant regeneration have been developed for the goosegrass [ Eleusine indica (L.) Gaertn.] and its dinitroaniline-resistant biotypes. The optimum medium for inducing morphogenic calli consisted of N6 basal salts and B5 vitamins supplemented with 1-2 mg l(-1) 2,4-dichlorophenoxyacetic acid (2,4-D), 2 mg l(-1) glycine, 100 mg l(-1) asparagine, 100 mg l(-1) casein hydrolysate, 30 g l(-1) sucrose and 0.6% agar, pH 5.7. The presence of organogenic and embryogenic structures in these calli was histologically documented. Cell suspension cultures derived from young calli were established in a liquid medium with the same composition. Morphogenic structures of direct shoots and somatic embryos were grown into rooted plantlets on medium containing MS basal salts, B5 vitamins, 1 mg l(-1) kinetin (Kn) and 0.1 mg l(-1) indole-3-acetic acid (IAA), 3% sucrose, 0.6% agar, pH 5.7. Calli derived from the R-biotype of E. indica possessed a high resistance to trifluralin (dinitroaniline herbicide) and cross-resistance to a structurally non-related herbicide, amiprophosmethyl (phosphorothioamidate herbicide), as did the original resistant plants. Embryogenic cell suspension culture was a better source of E. indica protoplasts than callus or mesophyll tissue. The enzyme solution containing 1.5% cellulase Onozuka R-10, 0.5% driselase, 1% pectolyase Y-23, 0.5% hemicellulase and N(6) mineral salts with an additional 0.2 M KCl and 0.1 M CaCl(2) (pH 5.4-5.5) was used for protoplast isolation. The purified protoplasts were cultivated in KM8p liquid medium supplemented with 2 mg l(-1) 2,4-D and 0.2 mg l(-1) Kn.

  20. Transcriptome profiling to discover putative genes associated with paraquat resistance in goosegrass (Eleusine indica L.).

    Science.gov (United States)

    An, Jing; Shen, Xuefeng; Ma, Qibin; Yang, Cunyi; Liu, Simin; Chen, Yong

    2014-01-01

    Goosegrass (Eleusine indica L.), a serious annual weed in the world, has evolved resistance to several herbicides including paraquat, a non-selective herbicide. The mechanism of paraquat resistance in weeds is only partially understood. To further study the molecular mechanism underlying paraquat resistance in goosegrass, we performed transcriptome analysis of susceptible and resistant biotypes of goosegrass with or without paraquat treatment. The RNA-seq libraries generated 194,716,560 valid reads with an average length of 91.29 bp. De novo assembly analysis produced 158,461 transcripts with an average length of 1153.74 bp and 100,742 unigenes with an average length of 712.79 bp. Among these, 25,926 unigenes were assigned to 65 GO terms that contained three main categories. A total of 13,809 unigenes with 1,208 enzyme commission numbers were assigned to 314 predicted KEGG metabolic pathways, and 12,719 unigenes were categorized into 25 KOG classifications. Furthermore, our results revealed that 53 genes related to reactive oxygen species scavenging, 10 genes related to polyamines and 18 genes related to transport were differentially expressed in paraquat treatment experiments. The genes related to polyamines and transport are likely potential candidate genes that could be further investigated to confirm their roles in paraquat resistance of goosegrass. This is the first large-scale transcriptome sequencing of E. indica using the Illumina platform. Potential genes involved in paraquat resistance were identified from the assembled sequences. The transcriptome data may serve as a reference for further analysis of gene expression and functional genomics studies, and will facilitate the study of paraquat resistance at the molecular level in goosegrass.

  1. Investigating the mechanisms of glyphosate resistance in goosegrass (Eleusine indica (L.) Gaertn.) by RNA sequencing technology.

    Science.gov (United States)

    Chen, Jingchao; Huang, Hongjuan; Wei, Shouhui; Huang, Zhaofeng; Wang, Xu; Zhang, Chaoxian

    2017-01-01

    Glyphosate is an important non-selective herbicide that is in common use worldwide. However, evolved glyphosate-resistant (GR) weeds significantly affect crop yields. Unfortunately, the mechanisms underlying resistance in GR weeds, such as goosegrass (Eleusine indica (L.) Gaertn.), an annual weed found worldwide, have not been fully elucidated. In this study, transcriptome analysis was conducted to further assess the potential mechanisms of glyphosate resistance in goosegrass. The RNA sequencing libraries generated 24 597 462 clean reads. De novo assembly analysis produced 48 852 UniGenes with an average length of 847 bp. All UniGenes were annotated using seven databases. Sixteen candidate differentially expressed genes selected by digital gene expression analysis were validated by quantitative real-time PCR (qRT-PCR). Among these UniGenes, the EPSPS and PFK genes were constitutively up-regulated in resistant (R) individuals and showed a higher copy number than that in susceptible (S) individuals. The expressions of four UniGenes relevant to photosynthesis were inhibited by glyphosate in S individuals, and this toxic response was confirmed by gas exchange analysis. Two UniGenes annotated as glutathione transferase (GST) were constitutively up-regulated in R individuals, and were induced by glyphosate both in R and S. In addition, the GST activities in R individuals were higher than in S. Our research confirmed that two UniGenes (PFK, EPSPS) were strongly associated with target resistance, and two GST-annotated UniGenes may play a role in metabolic glyphosate resistance in goosegrass. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  2. El Muntu: la diáspora del pensamiento filosófico africano en Changó, el gran putas de Manuel Zapata Olivella

    Directory of Open Access Journals (Sweden)

    Diana Carolina Sierra Díaz

    2016-01-01

    Full Text Available La problemática del fenómeno diaspórico en América es un elemento notable en Changó, el gran putas. En esta novela el éxodo africano se encuentra estrechamente relacionado con la filosofía Muntu. Esta filosofía agrupa unos saberes africanos compuestos de diversos elementos que resurgen en América transformándose dentro de un contexto de intercambio cultural postcolonial. En Changó, el Muntu nos permite analizar no solo la posibilidad de tejer una alianza africana y mestiza en pos de libertad en América, sino que constituye además una metáfora del mestizaje americano, una oportunidad de ver la Historia de este continente desde un punto de vista literario involucrando asimismo diferentes dimensiones del ser humano. Proponemos una reflexión en torno a la manera como las diferentes categorías filosóficas del Muntu (Kintu, Kuntu, Hantu y Muntu son abordadas y ad[a/o]ptadas desde una perspectiva filosófico-literaria, cuestionando su relevancia dentro de la obra.

  3. Construindo vidas na diáspora. Os africanos da cidade do Desterro, Ilha de Santa Catarina (Século XIX

    Directory of Open Access Journals (Sweden)

    Claudia Mortari Malavota

    2013-06-01

    Full Text Available Este artigo tem como objetivo evidenciar e analisar os vínculos parentais estabelecidos por escravos e libertos de procedência africana, sujeitos de diferentes categorias sociais e origens étnicas, no contexto de uma cidade portuária ao Sul do Brasil: Nossa Senhora do Desterro, localizada na Ilha de Santa Catarina. O ponto de partida do artigo é a trajetória de vida, construída a partir de alguns indícios, do africano forro Francisco de Quadros, da africana Catharina, de nação Benguela, e de Francisco de Siqueira, os quais, no contexto do século XIX, estabeleceram relações de solidariedade e vínculos familiares. A partir de suas trajetórias, nossa intenção é descortinar outras inúmeras experiências de vida das populações de origem africana na cidade. Partimos do princípio de que os estabelecimentos de vínculos parentais constituem, num contexto escravista, uma maneira de criar esperanças, de possibilitar a sobrevivência e de reinventar as identidades. Os africanos, ao criar seus vínculos familiares, conferiram sentido a suas vidas e marcaram de forma significativa o espaço social em que viviam.

  4. As “Ticas” de “Matema” de um povo africano: Um exercício para sala de aula brasileira.

    Directory of Open Access Journals (Sweden)

    Eliane Costa Santos

    2008-08-01

    Full Text Available Este artigo tem como foco central apontar uma das alternativas para a introdução da cultura africana numa sala de aula de matemática – concorrendo para a transformação deste espaço formal de uma sala de aula, um espaço no qual a cultura está entrelaçada aos saberes escolares por meio da transdisciplinaridade da etnomatemática. A relação que permeia pode ser delineada de como a cultura africana, por meio da representatividade dos fazeres dos teares africanos Kente pode contribuir com os processos de ensino e aprendizagem em uma sala de aula de matemática. As tramas estão por meio do referencial teórico de Stuart Hall sobre cultura e multiculturalismo; D’Ambrósio sobre transdisciplinaridade e etnomatemática; Dennis sobre tecido Kente e os tecelões de Gana com as tecnologias do tear Kente. Para uma compreensão geral localizamos Gana no Continente Africano, citamos o mitos do tear e por fim apresentamos uma proposta de como exercitar uma relação transcultural a partir do saber fazer da cultura Africana em uma sala de aula de matemática no Brasil.

  5. Corrosion inhibition of Eleusine aegyptiaca and Croton rottleri leaf extracts on cast iron surface in 1 M HCl medium

    International Nuclear Information System (INIS)

    Rajeswari, Velayutham; Kesavan, Devarayan; Gopiraman, Mayakrishnan; Viswanathamurthi, Periasamy; Poonkuzhali, Kaliyaperumal; Palvannan, Thayumanavan

    2014-01-01

    Graphical abstract: - Highlights: • Eleusine aegyptiaca and Croton rottleri are commonly available, less-toxic and eco-friendly inhibitors for cast iron corrosion. • The active constituents present in extracts adsorbed on the iron surface to inhibit the acidic corrosion. • The higher values of E a and ΔH * point out the higher inhibition efficiency noticed for the inhibitors. • Weight loss methods at various temperature and spectral data provides evidence for adsorption mechanism of inhibitors. - Abstract: The adsorption and corrosion inhibition activities of Eleusine aegyptiaca (E. aegyptiaca) and Croton rottleri (C. rottleri) leaf extracts on cast iron corrosion in 1 M hydrochloric acid solution were studied first time by weight loss and electrochemical techniques viz., Tafel polarization and electrochemical impedance spectroscopy. The results obtained from the weight loss and electrochemical methods showed that the inhibition efficiency increased with inhibitor concentrations. It was found that the extracts acted as mixed-type inhibitors. The addition of halide additives (KCl, KBr, and KI) on the inhibition efficiency has also been investigated. The adsorption of the inhibitors on cast iron surface both in the presence and absence of halides follows the Langmuir adsorption isotherm model. The inhibiting nature of the inhibitors was supported by FT-IR, UV–vis, Wide-angle X-ray diffraction and SEM methods

  6. La historia blanqueada: representaciones de los africanos y sus descendientes en Antioquia a través de la obra de Tomás Carrasquilla

    Directory of Open Access Journals (Sweden)

    Lina del Mar Moreno Tovar

    2010-06-01

    Full Text Available After independence was achieved and throughout the 19th century, political, economical and cultural Colombian elites invented a model of nation based on the idea that highlands and white race were progress exclusive raw material, as though; based on racial and geographical attributions a regional hierarchy was built, and this allowed the configuration of local identities defined by this model. Meanwhile, besides Antioquia had an important presence of African and African descendant population since colonial times, from different enunciation places and turning over the colonization entrepreneurship of the 19th century as a the foundational myth, representations that showed Antioquia and its inhabitants as a successful correlate of the relationship between Andean highlands and white race started to be created, opposing to the negative valuation over lowlands and black population. This article, on one side, examines which were the representational mechanisms of Africans and their descendants in Antioquia through Tomas Carrasquilla literary work, and, on the other, wants to make evident that those creations marginalized the contributions done by Africans and their descendants to Antioquean history.//Tras el logro de la independencia y a lo largo de todo el siglo xix, las élites políticas, económicas y culturales colombianas trazaron un modelo de nación basado en la idea de que las tierras altas y la raza blanca eran materias primas privilegiadas del progreso; así, con base en atribuciones raciales y geográficas se construyó una jerarquía regional que dio lugar a la configuración de identidades locales definidas en función de ese modelo. Entretanto, aun a pesar de que Antioquia contaba con una importante presencia de africanos y afrodescendientes desde la época colonial, desde diversos lugares de enunciación y acudiendo a la empresa colonizadora del siglo xix como mito fundacional, se empezaron a elaborar representaciones que mostraban a

  7. Pedro Claver y la labor de evangelización en Cartagena de Indias (Siglo XVII: Fuentes claves para analizar a los africanos en el Nuevo Mundo

    Directory of Open Access Journals (Sweden)

    Paola Vargas Arana

    2006-12-01

    Full Text Available El artículo analiza el documento de canonización de Pedro Claver referido a su trabajo de evangelización de africanos en Cartagena de Indias durante el siglo XVII. El objetivo es cuestionar la labor y la utilidad del santo en la formación identitaria del puerto. En particular propone que el santo intentó hacer del cristianismo uno de los pilares de esa identidad, al punto de generar alianzas entre los sectores europeos que se hallaban en pugna por el control político y económico del puerto. Sin embargo, fracasó en la empresa de extirpar las herencias africanas recreadas como respuesta a las tentativas de evangelización de Claver.

  8. Al otro lado del Atlántico. Los africanos y sus descencientes en Argentina /Across the Atlantic. Africans and their Descendants in Argentina

    Directory of Open Access Journals (Sweden)

    Diego Buffa

    2014-12-01

    Full Text Available El propósito de este trabajo es hacer un recorrido histórico, rastreando la presencia africana y afrodescendiente en el actual territorio argentino, desde el período colonial hasta la actualidad. Centraremos nuestro análisis en los momentos más significativos de su llegada, observando ciertos parámetros que las caracterizan y, al mismo tiempo, identificaremos patrones de marginación o exclusión social de los migrantes africanos y sus descendientes.The purpose of this work is to make a historical journey, tracing presence of Africans and Afro-descendants in the Argentinean territory, from the colonial period to the present. We focus our analysis on the most significant moments of their arrivals, observing certain parameters that characterize them and at the same time, identifying patterns of marginalization and social exclusion of African migrants and their descendants.

  9. O Cinema brasileiro e as identidades híbridas em Ruy Guerra: O olhar latino-africano de um cidadão da vida

    Directory of Open Access Journals (Sweden)

    Anderson Lopes da Silva

    2014-07-01

    Full Text Available • Resumo: O artigo tem o objetivo de apresentar a vida e a obra do cineasta Ruy Guerra a partir da perspectiva identitária, mais especificamente, das identidades híbridas. Como aporte reflexivo serão usadas as concepções de hibridização para Stuart Hall e Homi Bhabha, teóricos dos Estudos Culturais. O trabalho ainda apresenta a presença do diretor no Cinema Novo brasileiro. Por fim, utilizando-se da própria definição de Ruy Guerra, chega-se a conclusão de que sua identidade é híbrida por ser ele um latino-africano sem noção de nacionalidade como espaço fixo, mas sim um cidadão da vida. Uma vida nômade.

  10. Assessment of the Potential Allelopathic Effects of Pennisetum purpureum Schumach. on the Germination and Growth of Eleusine indica (L.) Gaertn

    International Nuclear Information System (INIS)

    Ismail, B.S.; Tan, P.W.; Chuah, T.S.

    2015-01-01

    Pennisetum purpureum Schumach. is a weed that is currently spreading rapidly to many parts of the world particularly tropical countries. The abundance of P. purpureum in Malaysia is presently a serious problem. A study was conducted to investigate and evaluate the potential allelopathic effects of P. purpureum on Eleusine indica L. Gaertn. using the aqueous leaf extract and plant debris incorporated into the soil. Low concentrations of the P. purpureum aqueous extract (2%) and debris incorporated into the soil (25/ 500 g) inhibited germination and seedling growth of the bioassay species (E. indica) by >80 %. The responses of the bioassay species to the aqueous extract and debris-incorporated soil were concentration dependent. The aqueous extract had higher total phenolic content compared to that from the debris incorporated soil, indicating the presence of certain phyto toxic compounds in the leaf debris and leaf extracts. (author)

  11. Identification of the ``a'' Genome of Finger Millet Using Chloroplast DNA

    Science.gov (United States)

    Hilu, K. W.

    1988-01-01

    Finger millet (Eleusine corocana subsp. coracana), an important cereal in East Africa and India, is a tetraploid species with unknown genomic components. A recent cytogenetic study confirmed the direct origin of this millet from the tetraploid E. coracana subsp. africana but questioned Eleusine indica as a genomic donor. Chloroplast (ct) DNA sequence analysis using restriction fragment pattern was used to examine the phylogenetic relationships between E. coracana subsp. coracana (domesticated finger millet), E. coracana subspecies africana (wild finger millet), and E. indica. Eleusine tristachya was included since it is the only other annual diploid species in the genus with a basic chromosome number of x = 9 like finger millet. Eight of the ten restriction endonucleases used had 16 to over 30 restriction sites per genome and were informative. E. coracana subsp. coracana and subsp. africana and E. indica were identical in all the restriction sites surveyed, while the ct genome of E. tristachya differed consistently by at least one mutational event for each restriction enzyme surveyed. This random survey of the ct genomes of these species points out E. indica as one of the genome donors (maternal genome donor) of domesticated finger millet contrary to a previous cytogenetic study. The data also substantiate E. coracana subsp. africana as the progenitor of domesticated finger millet. The disparity between the cytogenetic and the molecular approaches is discussed in light of the problems associated with chromosome pairing and polyploidy. PMID:8608927

  12. Identification of the "A" genome of finger millet using chloroplast DNA.

    Science.gov (United States)

    Hilu, K W

    1988-01-01

    Finger millet (Eleusine corocana subsp. coracana), an important cereal in East Africa and India, is a tetraploid species with unknown genomic components. A recent cytogenetic study confirmed the direct origin of this millet from the tetraploid E. coracana subsp. africana but questioned Eleusine indica as a genomic donor. Chloroplast (ct) DNA sequence analysis using restriction fragment pattern was used to examine the phylogenetic relationships between E. coracana subsp. coracana (domesticated finger millet), E. coracana subspecies africana (wild finger millet), and E. indica. Eleusine tristachya was included since it is the only other annual diploid species in the genus with a basic chromosome number of x = 9 like finger millet. Eight of the ten restriction endonucleases used had 16 to over 30 restriction sites per genome and were informative. E. coracana subsp. coracana and subsp. africana and E. indica were identical in all the restriction sites surveyed, while the ct genome of E, tristachya differed consistently by at least one mutational event for each restriction enzyme surveyed. This random survey of the ct genomes of these species points out E. indica as one of the genome donors (maternal genome donor) of domesticated finger millet contrary to a previous cytogenetic study. The data also substantiate E. coracana subsp. africana as the progenitor of domesticated finger millet. The disparity between the cytogenetic and the molecular approaches is discussed in light of the problems associated with chromosome pairing and polyploidy.

  13. Resistance to ACCase inhibitors in Eleusine indica from Brazil involves a target site mutation Resistência aos inibidores de ACCase em Eleusine indica do Brasil envolve uma mutação na enzima alvo

    Directory of Open Access Journals (Sweden)

    M.D. Osuna

    2012-09-01

    Full Text Available Eleusine indica (goosegrass is a diploid grass weed which has developed resistance to ACCase inhibitors during the last ten years due to the intensive and frequent use of sethoxydim to control grass weeds in soybean crops in Brazil. Plant dose-response assays confirmed the resistant behaviour of one biotype obtaining high resistance factor values: 143 (fenoxaprop, 126 (haloxyfop, 84 (sethoxydim to 58 (fluazifop. ACCase in vitro assays indicated a target site resistance as the main cause of reduced susceptibility to ACCase inhibitors. PCR-generated fragments of the ACCase CT domain of the resistant and sensitive reference biotype were sequenced and compared. A point mutation was detected within the triplet of aspartate at the amino acid position 2078 (referred to EMBL accession no. AJ310767 and resulted in the triplet of glycine. These results constitute the first report on a target site mutation for a Brazilian herbicide resistant grass weed.Eleusine indica (ELEIN é uma espécie monocotiledônea, diploide. No Brasil, ela desenvolveu resistência aos inibidores da ACCase durante os últimos dez anos, devido ao uso intensivo e frequente desses graminicidas para controlar plantas daninhas em lavouras de soja. Experimentos de dose-resposta realizados com a planta confirmaram a resistência de um biótipo. Houve elevada tolerância aos herbicidas, com fatores de resistência da ordem de 143 (fenoxaprop, 126 (haloxyfop, 84 (sethoxydim e 58 (fluazifop. Ensaios com a enzima ACCase in vitro indicaram a insensibilidade desta como a principal causa de suscetibilidade reduzida a esses herbicidas. Fragmentos de PCR gerados do domínio CT da enzima ACCase dos biótipos resistente e sensível de referência foram sequenciados e comparados. Foi detectada uma mutação dentro do tripleto de asparagina na posição do aminoácido 2078 (referente ao acesso número AJ310767 no EMBL, que resultou no tripleto de glicina. Esses resultados constituem o primeiro caso

  14. Liderazgo femenino. Un análisis de las diferencias de género en la formación y desarrollo de asociaciones de inmigrantes africanos

    Directory of Open Access Journals (Sweden)

    Molina Luque, Fidel

    2013-06-01

    Full Text Available This study describes, analyses and compares manifestations of female leadership in associations of African immigrants, examining such factors as work objectives, themes and forms, organisation and institutionalisation. It was based on an in-depth analysis of ten life hi stories, starting from the hypothesis that there is a clearly gender-based difference between the objectives of African associations comprised of men and of women and that this difference stems from the basic inequality of the respective social statuses of men and women and, more specifically, from gender-related culture. The results obtained suggest the existence of “strong” (neither submissive nor ignorant female immigrants with the capacity to lead associations, but whose character is not the result of any supposedly specifically “feminine” characteristics, but rather to a process of early (adolescent learning, academic success and relatively high social origin, all of which help to forge a certain rebellious streak and to lead certain women to assume positions of authority. Whatever the case, it was not possible to observe any relevant differences between female and male leadership; both tend to be characterised by a certain “charisma” and the presence of personal qualities that were the result of interactions within specific social contexts.En el presente estudio se describen, analizan y comparan las manifestaciones del liderazgo femenino en las asociaciones de inmigrantes africanos: sus objetivos de trabajo, temáticas y formas, organización e institucionalización. Para ello se analizan en profundidad diez historias de vida, partiendo de la hipótesis de la existencia de una clara diferenciación de objetivos entre las asociaciones de hombres y mujeres africanos derivados de la desigualdad básica de las posiciones sociales entre hombres y mujeres, y muy especialmente, de las culturas de género. Los resultados obtenidos sugieren que existen mujeres

  15. Relaciones entre africanos e indígenas en Chiapas y Guatemala Relations between africans and indigenous peoples in Chiapas and Guatemala

    Directory of Open Access Journals (Sweden)

    Juan Pablo Peña Vicenteño

    2009-01-01

    Full Text Available La presencia africana en la Audiencia de Guatemala en los siglos XVI y XVII ha sido poco estudiada. Por lo tanto, en este trabajo se analizarán los diferentes mecanismos que utilizó la corona española para el traslado de esclavos, como las licencias y el sistema de asientos. Asimismo, se estudiará la inserción de los africanos en la sociedad colonial y principalmente su interrelación con la población indígena nativa de la región. En los documentos coloniales referentes a matrimonios, podemos observar los procesos de "interculturalidad" en los cuales el esclavo africano intercambió elementos culturales que influyeron en la música. Tal fue el caso de la marimba, instrumento que dio identidad a la región de estudio. Por último, se pretende observar, a través del análisis de las narrativas indígenas originadas en la década de los 90' del siglo XX, cómo en la cosmovisión indígena aún continúa la presencia de los "negros".The presence of African population at the "Audiencia" of Guatemala between 16th and 17th centuries has been vaguely studied by historians and other social scientists. This paper emphasizes on several ways -as slave trade licenses and 'asientos'- that were used by the Spanish Crown for slave trade and transportation. In addition, this article analyses the integration of African slaves and their descendents in Colonial Mexican society, especially their mixture with indigenous population. In Colonial records, as marriages and baptisms files, it is possibly to regard a profound influence on inter-cultural processes between African people and the rest of the Colonial casts. As an example, the musical instrument 'marimba' that brought cultural identity to Guatemala 'Audiencia'. Finally, in this article we will analyze the indigenous literature of the last decade of the 20th century, in which is clear the evidence of "negro" agents in indigenous cosmology.

  16. La representación televisiva de los inmigrantes africanos: invisibilidad, desconocimiento y precariedad. The television representation of African immigrants: invisibility, ignorance and uncertainty

    Directory of Open Access Journals (Sweden)

    Vanessa Rodríguez Breijo

    Full Text Available ResumenLa imagen televisiva de los inmigrantes africanos se caracteriza por su aparición poco frecuente, la falta de información sobre ellos, la precariedad de sus condiciones de trabajo, su tendencia a desempeñar el rol de víctimas y una mayor incidencia de transgresiones a la ley respecto a otros grupos. Estos datos proceden del estudio de la representación de los inmigrantes en este medio. La técnica utilizada fue el análisis de contenido de una muestra de la programación con mayor audiencia, en la que se incluyeron todos los géneros televisivos. Los resultados correspondientes a los africanos los vincularon escasamente con el mundo laboral, lo que no contribuye a que los nativos los valoren como ciudadanos útiles y necesarios. No se promovió el interés por el conocimiento de este colectivo, ni la noción de que ya forman parte de la sociedad; debido a su poca visibilidad y a los exiguos datos ofrecidos sobre ellos. En lugar de resaltar sus aportes, se enfatizó su recurrencia a ayudas gubernamentales y su dependencia, transmitiendo una idea de competencia por los recursos y de normalidad de su situación de desigualdad. Finalmente, sus más frecuentes acciones ilegales podrían estar justificando esas peores condiciones de integración, liberando de responsabilidad a la sociedad receptora.AbstractThe television image of African immigrants is characterized by its infrequent occurrence, the lack of information about them, poor working conditions, their tendency to play the role of victims and a higher incidence of violations of the law regarding other groups. This data comes from examining the representation of immigrants in this media. The technique used was content analysis of a sample of the most watched programs, which included all television genres. The results for the Africans pointed a weak link with the workplace, which doesn't contribute to their valuing as necessary and useful citizens. The interest in knowledge of this

  17. Espejo cultural africano: imágenes de los reinos del Congo y Angola en la Costa Caribe del reino de Nueva Granada

    Directory of Open Access Journals (Sweden)

    Andrea Guerrero Mosquera

    2014-01-01

    Full Text Available Esta investigación pretendió a nalizar los escritos sobre África realizados durante el siglo XVII, con el fin de adentrarse a los imaginarios que se plasmaron acerca de las culturas de los reinos del Congo y Angola . Para el caso particula r de esta investigación , se usaron los textos de los capuchinos Giovanni António Cavazzi y Anto nio de Teruel . Estos textos son discursos escritos desde una perspectiva de lo observado y bajo el amparo de un discurso histórico - antropológico del africano, una imagen eurocentrista y católica que permeó tanto en Europa como en la s Indias. Con estos textos se intentó un acer camiento a los Black Atlantic Studies con lo que se logró a partir de las imágenes que se interpretar on , realizar una confrontación con la herencia cultural que se manifestaba en los escritos de la época y establecer los imaginar ios que llegaron desde África al reino de Nueva Granada .

  18. Interetnicidad y espacios de convivencia. Indígenas, españoles y africanos en la Mérida novohispana, 1542-1620

    Directory of Open Access Journals (Sweden)

    Jorge Victoria Ojeda

    2015-05-01

    Full Text Available En este artículo los autores, apoyados principalmente en material de archivo proveniente del Sagrario de la ciudad de Mérida, y en otras fuentes históricas y bibliográficas, proponen desdibujar antiguas ideas acerca de la ocupación del centro de Mérida en el siglo xvi y primeros años del siguiente, basado únicamente por españoles y sus descendientes. Asimismo, plantean que la ocupación del pueblo maya de Santa Lucía como barrio para los africanos y sus castas, no corresponde a su lectura en los textos históricos del Sagrario. Por último, bosquejan una relación de convivencia entre las etnias existentes en el centro de la ciudad –españoles, mayas y africanos–, mucho más dinámica que lo que se ha sugerido hasta ahora, puesto que en el lapso estudiado se propone que parte de esos grupos vivían en el mismo solar que muchos de los vecinos españoles.

  19. Carabalíes y culíes en El Cobre: esclavos africanos trabajadores chinos al servicio del cobre para Swansea, siglo XIX

    Directory of Open Access Journals (Sweden)

    Chris Evans

    2017-06-01

    Full Text Available El objetivo de este artículo es analizar el impacto del Mundo del Cobre en la isla de Cuba hasta el inicio de la segunda mitad del siglo XIX. El estímulo británico producido sobre la minería se expresó en la modernización de las instalaciones, la circulación de capitales y la migración de mano de obra. Respecto a este último punto, la migración transoceánica no solo contempló a los británicos que acudieron a la explotación minera de la isla, sino también dio origen a una reactivación del comercio esclavo que tuvo a carabalíes africanos y culíes asiáticos como principales protagonistas. A partir del registro documental de los principales gestores de la modernización minera y la base de datos del comercio transatlántico de esclavos, se relevará la importancia económica y cultural de la circulación de mano obra en Cuba.

  20. Expression of miRNAs confers enhanced tolerance to drought and salt stress in Finger millet (Eleusine coracona

    Directory of Open Access Journals (Sweden)

    Nageshbabu R.

    2013-08-01

    Full Text Available Plants respond to the environmental cues in various ways, recent knowledge of RNA interference in conferring stress tolerance had become a new hope of developing tolerant varieties. Here we attempt to unfold the molecular mechanism of stress tolerance through miRNA profiling and expression analysis in Finger millet (Eleusine coracona under salt and drought stress conditions. The expression analysis of 12 stress specific conserved miRNAs was studied using semi-quantitative real time PCR and Northern blot assay. Our studies revealed that, although most of the miRNAs responded to the stresses, the expression of particular miRNA differed with the nature of stress and the tissue. The expression analysis was correlated with the existing data of their target genes. Abiotic stress up-regulated miRNAs are expected to target negative regulators of stress responses or positive regulators of processes that are inhibited by stresses. On the other hand, stress down-regulated miRNAs may repress the expression of positive regulators and/or stress up-regulated genes. Thus the current study of miRNAs and their targets under abiotic stress conditions displays miRNAs may be good candidates to attribute the stress tolerance in plants by transgenic technology.

  1. Porcine Pancreatic Lipase Inhibitory Agent Isolated from Medicinal Herb and Inhibition Kinetics of Extracts from Eleusine indica (L. Gaertner

    Directory of Open Access Journals (Sweden)

    Siew Ling Ong

    2016-01-01

    Full Text Available Eleusine indica (Linnaeus Gaertner is a traditional herb known to be depurative, febrifuge, and diuretic and has been reported with the highest inhibitory activity against porcine pancreatic lipase (PPL among thirty two plants screened in an earlier study. This study aims to isolate and identify the active components that may possess high potential as an antiobesity agent. Of the screened solvent fractions of E. indica, hexane fraction showed the highest inhibitory activity of 27.01±5.68% at 100 μg/mL. Bioactivity-guided isolation afforded three compounds from the hexane fraction of E. indica, namely, β-sitosterol, stigmasterol, and lutein. The structures of these compounds were elucidated using spectral techniques. Lutein showed an outstanding inhibitory activity against PPL (55.98±1.04%, with activity 60% higher than that of the reference drug Orlistat. The other compounds isolated and identified were β-sitosterol (2.99±0.80% and stigmasterol (2.68±0.38%. The enzyme kinetics of E. indica crude methanolic extract on PPL showed mixed inhibition mechanism.

  2. Molecular characterization of four beta-tubulin genes from dinitroaniline susceptible and resistant biotypes of Eleusine indica.

    Science.gov (United States)

    Yamamoto, E; Baird, W V

    1999-01-01

    Dinitroaniline herbicides are antimicrotubule drugs that bind to tubulins and inhibit polymerization. As a result of repeated application of dinitroaniline herbicides, resistant biotypes of goosegrass (Eleusine indica) developed in previously susceptible wild-type populations. We have previously reported that alpha-tubulin missense mutations correlate with dinitroaniline response phenotypes (Drp) (Plant Cell 10: 297-308, 1998). In order to ascertain associations of other tubulins with dinitroaniline resistance, four beta-tubulin cDNA classes (designated TUB1, TUB2, TUB3, and TUB4) were isolated from dinitroaniline-susceptible and -resistant biotypes. Sequence analysis of the four beta-tubulin cDNA classes identified no missense mutations. Identified nucleotide substitutions did not result in amino acid replacements. These results suggest that the molecular basis of dinitroaniline resistance in goosegrass differs from those of colchicine/dinitroaniline cross-resistant Chlamydomonas reinhardtii and benzimidazole-resistant fungi and yeast. Expression of the four beta-tubulins was highest in inflorescences. This is in contrast to alpha-tubulin TUA1 that is expressed predominantly in roots. Collectively, these results imply that beta-tubulin genes are not associated with dinitroaniline resistance in goosegrass. Phylogenetic analysis of the four beta-tubulins, together with three alpha-tubulins, suggests that the resistant biotype developed independently in multiple locations rather than spreading from one location.

  3. Eleusine indica L. possesses antioxidant activity and precludes carbon tetrachloride (CCl₄)-mediated oxidative hepatic damage in rats.

    Science.gov (United States)

    Iqbal, Mohammad; Gnanaraj, Charles

    2012-07-01

    The purpose of this study was to evaluate the ability of aqueous extract of Eleusine indica to protect against carbon tetrachloride (CCl₄)-induced hepatic injury in rats. The antioxidant activity of E. indica was evaluated using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) free radical scavenging assay. The total phenolic content of E. indica was also determined. Biochemical parameters [e.g. alanine aminotransferase (ALT), aspartate aminotransferase (AST), malondialdehyde (MDA), glutathione (GSH), catalase, glutathione peroxidase, glutathione reductase, glutathione S-transferase and quinone reductase] were used to evaluate hepatic damage in animals pretreated with E. indica and intoxicated with CCl₄. CCl₄-mediated hepatic damage was also evaluated by histopathologically. E. indica extract was able to reduce the stable DPPH level in a dose-dependent manner. The half maximal inhibitory concentration (IC₅₀) value was 2350 μg/ml. Total phenolic content was found to be 14.9 ± 0.002 mg/g total phenolic expressed as gallic acid equivalent per gram of extract. Groups pretreated with E. indica showed significantly increased activity of antioxidant enzymes compared to the CCl₄-intoxicated group (p indica pretreatment (p indica-pretreated groups as compared to the CCl₄-intoxicated group. The protective effect of E. indica was further evident through decreased histopathological alterations in the liver. The results of our study indicate that the hepatoprotective effects of E. indica might be ascribable to its antioxidant and free radical scavenging property.

  4. Pro-106-Ser mutation and EPSPS overexpression acting together simultaneously in glyphosate-resistant goosegrass (Eleusine indica).

    Science.gov (United States)

    Gherekhloo, Javid; Fernández-Moreno, Pablo T; Alcántara-de la Cruz, Ricardo; Sánchez-González, Eduardo; Cruz-Hipolito, Hugo E; Domínguez-Valenzuela, José A; De Prado, Rafael

    2017-07-27

    Glyphosate has been used for more than 15 years for weed management in citrus groves in the Gulf of Mexico, at up to 3-4 applications per year. Goosegrass (Eleusine indica (L.) Gaertn.) control has sometimes failed. In this research, the mechanisms governing three goosegrass biotypes (Ein-Or from an orange grove, and Ein-Pl1 and Ein-Pl2 from Persian lime groves) with suspected resistance to glyphosate were characterized and compared to a susceptible biotype (Ein-S). Dose-response and shikimate accumulation assays confirmed resistance of the resistant (R) biotypes. There were no differences in glyphosate absorption, but the R biotypes retained up to 62-78% of the herbicide in the treated leaf at 96 h after treatment (HAT), in comparison to the Ein-S biotype (36%). The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity in the Ein-Or and Ein-S biotypes was over 100-fold lower than the Ein-Pl1 and Ein-Pl2 ones. The latter showed a high EPSPS-basal activity, a mutation at Pro-106-Ser position in the EPSPS gene, and EPSPS overexpression. The EPSPS basal and EPSPS overexpression were positively correlated. The R goosegrass biotypes displayed poor glyphosate translocation. Furthermore, this grassweed showed, for the first time, two mechanisms at the target-site level (Pro-106-Ser mutation + EPSPS overexpression) acting together simultaneously against glyphosate.

  5. Porcine Pancreatic Lipase Inhibitory Agent Isolated from Medicinal Herb and Inhibition Kinetics of Extracts from Eleusine indica (L.) Gaertner.

    Science.gov (United States)

    Ong, Siew Ling; Mah, Siau Hui; Lai, How Yee

    2016-01-01

    Eleusine indica (Linnaeus) Gaertner is a traditional herb known to be depurative, febrifuge, and diuretic and has been reported with the highest inhibitory activity against porcine pancreatic lipase (PPL) among thirty two plants screened in an earlier study. This study aims to isolate and identify the active components that may possess high potential as an antiobesity agent. Of the screened solvent fractions of E. indica , hexane fraction showed the highest inhibitory activity of 27.01 ± 5.68% at 100  μ g/mL. Bioactivity-guided isolation afforded three compounds from the hexane fraction of E. indica , namely,  β -sitosterol, stigmasterol, and lutein. The structures of these compounds were elucidated using spectral techniques. Lutein showed an outstanding inhibitory activity against PPL (55.98 ± 1.04%), with activity 60% higher than that of the reference drug Orlistat. The other compounds isolated and identified were  β -sitosterol (2.99 ± 0.80%) and stigmasterol (2.68 ± 0.38%). The enzyme kinetics of E. indica crude methanolic extract on PPL showed mixed inhibition mechanism.

  6. Low night temperature effect on photosynthate translocation of two C/sub 4/ grasses. [Echinochloa crus-galli; Eleusine indica

    Energy Technology Data Exchange (ETDEWEB)

    Potvin, C.; Strain, B.R.; Goeschl, J.D.

    1985-01-01

    Translocation of assimilates in plants of Echinochloa crus-galli, from Quebec and Mississippi, and of Eleusine indica from Mississippi was monitored, before and after night chilling, using radioactive tracing with the short-life isotope /sup 11/C. Plants were grown at 28/sup 0//22/sup 0/C (day/night temperatures) under either 350 or 675 ..mu..l . l/sup -1/ CO/sub 2/. Low night temperature reduced translocation mainly by increasing the turn-over times of the export pool. E. crus-galli plants from Mississippi were the most susceptible to chilling; translocation being completely inhibited by exposure for one night to 7/sup 0/C at 350 ..mu..l . l/sup -1/ CO/sub 2/. Overall, plants from Quebec were the most tolerant to chilling-stress. For plants of all three populations, growth under CO/sub 2/ enrichment resulted in higher /sup 11/C activity in the leaf phloem. High CO/sub 2/ concentrations also seemd to buffer the transport system against chilling injuries.

  7. Selection of relatively exact reference genes for gene expression studies in goosegrass (Eleusine indica) under herbicide stress.

    Science.gov (United States)

    Chen, Jingchao; Huang, Zhaofeng; Huang, Hongjuan; Wei, Shouhui; Liu, Yan; Jiang, Cuilan; Zhang, Jie; Zhang, Chaoxian

    2017-04-21

    Goosegrass (Eleusine indica) is one of the most serious annual grassy weeds worldwide, and its evolved herbicide-resistant populations are more difficult to control. Quantitative real-time PCR (qPCR) is a common technique for investigating the resistance mechanism; however, there is as yet no report on the systematic selection of stable reference genes for goosegrass. This study proposed to test the expression stability of 9 candidate reference genes in goosegrass in different tissues and developmental stages and under stress from three types of herbicide. The results show that for different developmental stages and organs (control), eukaryotic initiation factor 4 A (eIF-4) is the most stable reference gene. Chloroplast acetolactate synthase (ALS) is the most stable reference gene under glyphosate stress. Under glufosinate stress, eIF-4 is the best reference gene. Ubiquitin-conjugating enzyme (UCE) is the most stable reference gene under quizalofop-p-ethyl stress. The gene eIF-4 is the recommended reference gene for goosegrass under the stress of all three herbicides. Moreover, pairwise analysis showed that seven reference genes were sufficient to normalize the gene expression data under three herbicides treatment. This study provides a list of reliable reference genes for transcript normalization in goosegrass, which will facilitate resistance mechanism studies in this weed species.

  8. Double mutation in eleusine indica alpha-tubulin increases the resistance of transgenic maize calli to dinitroaniline and phosphorothioamidate herbicides

    Science.gov (United States)

    Anthony; Hussey

    1999-06-01

    The repeated use of dinitroaniline herbicides on the cotton and soybean fields of the southern United States has resulted in the appearance of resistant biotypes of one of the world's worst weeds, Eleusine indica. Two biotypes have been characterized, a highly resistant (R) biotype and an intermediate resistant (I) biotype. In both cases the resistance has been attributed to a mutation in alpha-tubulin, a component of the alpha/beta tubulin dimer that is the major constituent of microtubules. We show here that the I-biotype mutation, like the R-biotype mutation shown in earlier work, can confer dinitroaniline resistance on transgenic maize calli. The level of resistance obtained is the same as that for E. indica I- or R-biotype seedlings. The combined I- and R-biotype mutations increase the herbicide tolerance of transgenic maize calli by a value close to the summation of the maximum herbicide tolerances of calli harbouring the single mutations. These data, taken together with the position of the two different mutations within the atomic structure of the alpha/beta tubulin dimer, imply that each mutation is likely to exert its effect by a different mechanism. These mechanisms may involve increasing the stability of microtubules against the depolymerizing effects of the herbicide or changing the conformation of the alpha/beta dimer so that herbicide binding is less effective, or a combination of both possibilities.

  9. Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

    Science.gov (United States)

    Zhang, Chun; Feng, Li; Tian, Xing-Shan

    2018-04-26

    The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

  10. Potential of Electric Power Production from Microbial Fuel Cell (MFC) in Evapotranspiration Reactor for Leachate Treatment Using Alocasia macrorrhiza Plant and Eleusine indica Grass

    Science.gov (United States)

    Zaman, Badrus; Wardhana, Irawan Wisnu

    2018-02-01

    Microbial fuel cell is one of attractive electric power generator from nature bacterial activity. While, Evapotranspiration is one of the waste water treatment system which developed to eliminate biological weakness that utilize the natural evaporation process and bacterial activity on plant roots and plant media. This study aims to determine the potential of electrical energy from leachate treatment using evapotranspiration reactor. The study was conducted using local plant, namely Alocasia macrorrhiza and local grass, namely Eleusine Indica. The system was using horizontal MFC by placing the cathodes and anodes at different chamber (i.e. in the leachate reactor and reactor with plant media). Carbon plates was used for chatode-anodes material with size of 40 cm x 10 cm x1 cm. Electrical power production was measure by a digital multimeter for 30 days reactor operation. The result shows electric power production was fluctuated during reactor operation from all reactors. The electric power generated from each reactor was fluctuated, but from the reactor using Alocasia macrorrhiza plant reach to 70 μwatt average. From the reactor using Eleusine Indica grass was reached 60 μwatt average. Electric power production fluctuation is related to the bacterial growth pattern in the soil media and on the plant roots which undergo the adaptation process until the middle of the operational period and then in stable growth condition until the end of the reactor operation. The results indicate that the evapotranspiration reactor using Alocasia macrorrhiza plant was 60-95% higher electric power potential than using Eleusine Indica grass in short-term (30-day) operation. Although, MFC system in evapotranspiration reactor system was one of potential system for renewable electric power generation.

  11. Potential of Electric Power Production from Microbial Fuel Cell (MFC in Evapotranspiration Reactor for Leachate Treatment Using Alocasia macrorrhiza Plant and Eleusine indica Grass

    Directory of Open Access Journals (Sweden)

    Zaman Badrus

    2018-01-01

    Full Text Available Microbial fuel cell is one of attractive electric power generator from nature bacterial activity. While, Evapotranspiration is one of the waste water treatment system which developed to eliminate biological weakness that utilize the natural evaporation process and bacterial activity on plant roots and plant media. This study aims to determine the potential of electrical energy from leachate treatment using evapotranspiration reactor. The study was conducted using local plant, namely Alocasia macrorrhiza and local grass, namely Eleusine Indica. The system was using horizontal MFC by placing the cathodes and anodes at different chamber (i.e. in the leachate reactor and reactor with plant media. Carbon plates was used for chatode-anodes material with size of 40 cm x 10 cm x1 cm. Electrical power production was measure by a digital multimeter for 30 days reactor operation. The result shows electric power production was fluctuated during reactor operation from all reactors. The electric power generated from each reactor was fluctuated, but from the reactor using Alocasia macrorrhiza plant reach to 70 μwatt average. From the reactor using Eleusine Indica grass was reached 60 μwatt average. Electric power production fluctuation is related to the bacterial growth pattern in the soil media and on the plant roots which undergo the adaptation process until the middle of the operational period and then in stable growth condition until the end of the reactor operation. The results indicate that the evapotranspiration reactor using Alocasia macrorrhiza plant was 60-95% higher electric power potential than using Eleusine Indica grass in short-term (30-day operation. Although, MFC system in evapotranspiration reactor system was one of potential system for renewable electric power generation.

  12. Respostas de plantas de Eleusine indica sob diferentes condições hídricas a herbicidas inibidores da ACCase Responses of Eleusine indica plants under different water conditions to ACCase-inhibiting herbicides

    Directory of Open Access Journals (Sweden)

    M.R.R. Pereira

    2011-06-01

    Full Text Available Objetivou-se neste estudo avaliar a eficiência de controle de herbicidas inibidores da ACCase aplicados em pós-emergência em plantas de Eleusine indica submetidas a diferentes teores de água no solo. Os experimentos foram conduzidos em casa de vegetação, com a aplicação de três diferentes herbicidas (fluazifop-p-butil, haloxyfop-methyl e sethoxydim + óleo mineral Assist; o delineamento experimental utilizado para cada herbicida foi inteiramente casualizado, com quatro repetições, constituído de um fatorial 3 x 4, sendo a combinação de três manejos hídricos (-0,03, -0,07 e -1,5 MPa e quatro doses desses produtos (100, 50, 25 e 0% da dose recomendada. Os parâmetros fisiológicos avaliados foram: taxa fotossintética, condutância estomática, transpiração, temperatura da folha e matéria seca das plantas. As avaliações visuais de fitotoxicidade foram realizadas aos 14 dias após a aplicação. Os manejos hídricos aplicados não influenciaram o controle das plantas nos tratamentos testados, com exceção do herbicida sethoxydim, que teve sua eficiência hídrica prejudicada quando da deficiência hídrica nas aplicações das doses fracionadas. A taxa fotossintética, a transpiração e a condutância estomática foram maiores em plantas submetidas ao manejo hídrico de 13%, as quais apresentaram as menores temperaturas foliares em relação à temperatura ambiente.The objective of this study to evaluate the control efficiency of ACCase -inhibiting herbicides applied during post-emergence on plants of Eleusine indica under different soil water contents. The experiments were conducted in a greenhouse, with the application of three different herbicides (fluazifop-p-butyl, haloxyfop-methyl and sethoxydim + oil Assist Each herbicide experiment was arranged in a completely randomized design with four replications, consisting of a 3 x 4 factorial scheme, with the water management strategy combinations (-0.03, -0.07 and -1.5 MPa and

  13. O despertar empresarial brasileiro para o mercado africano nas décadas de 1970 a 1990 The brazilian business awakening to the african market from the 1970's to 1990

    Directory of Open Access Journals (Sweden)

    Ivo de Santana

    2003-06-01

    Full Text Available Este artigo traz reflexões acerca da presença empresarial brasileira no mercado africano enfocando os empreendimentos nacionais que atuaram no comércio Brasil-África entre as décadas de 70 e de 90. O texto busca identificar os motivos que levaram ao acentuado crescimento do comércio naquele período e as perspectivas que se abriram para o empresário brasileiro que deseja efetuar negócios junto ao mercado africano. Por meio de pesquisa bibliográfica, entrevistas com executivos que atuaram na África no período mencionado e com especialistas em comércio exterior, constatou-se que nos anos mencionados o governo brasileiro concedeu generosos incentivos aos empreendimentos voltados para o mercado africano. Com o fim dessa política privilegiada, muitas empresas fracassaram mas algumas permanecem em atividade, propiciando importantes lições a empreendedores que desejam iniciar negócios no mercado africano. Verifica-se que a despeito da redução do apoio estatal e das mudanças no cenário econômico (interno e externo brasileiro, as oportunidades comerciais no continente africano existem e muitas delas são ignoradas pelos homens de negócios, que tendem a julgar a África como um todo em função dos aspectos negativos ressaltados pela imprensa, da mesma forma que muitos empresários africanos desconhecem a qualidade dos serviços e produtos brasileiros.This article brings reflections concerning the Brazilian business presence in the African market focusing on national enterprises that acted in the trade Brazil-Africa during the 1970's to the 90's. The article aims to identify both the motivations that made the trade to grow strongly in that period, and the perspectives that came about for the Brazilian entrepreneur that wanted to do businesses with the African market. Through bibliographical research, interviews with executives that acted in Africa in the mentioned period and with specialists in foreign trade, it was verified that in

  14. Carcinoma bronquíolo-alveolar em leão-africano (Panthera leo Bronchioloalveolar carcinoma in an African Lion (Panthera leo

    Directory of Open Access Journals (Sweden)

    Ricardo B. Lucena

    2010-06-01

    Full Text Available Um caso de carcinoma bronquíolo-alveolar difuso do tipo misto foi diagnosticado em um leão-africano (Panthera leo, hospitalizado com sinais de dispnéia e emagrecimento progressivo. Em todos os lobos pulmonares havia múltiplos nódulos esbranquiçados, macios e homogêneos, de 0,2-0,5cm em diâmetro. Histologicamente, os nódulos eram constituídos por células neoplásicas arranjadas em alvéolos e papilas sustentados por moderado estroma fibrovascular, um padrão que lembrava a estrutura pulmonar pré-existente. Na reação pelo ácido periódico de Schiff (PAS foi observada marcação positiva no citoplasma de numerosas células neoplásicas. Todas as células neoplásicas demonstraram forte e uniforme imunorreatividade citoplasmática para pancitoceratina. A marcação para o fator 1 de transcrição da tireóide (TTF-1 foi observada em focos nos núcleos das células neoplásicas das margens dos nódulos. Nas secções avaliadas para surfactante A, a marcação foi observada em múltiplas áreas focais, tanto no citoplasma como na membrana citoplasmática das células neoplásicas. O diagnóstico de carcinoma bronquíolo-alveolar difuso do tipo misto foi feito com base nos achados histológicos, histoquímicos e imuno-histoquímicos. Essa parece ser a primeira descrição de um neoplasma pulmonar primário maligno em leão-africano.A case of diffuse bronchioloalveolar carcinoma of the mixed type was diagnosed in the lung of an adult female African lion (Panthera leo with presenting signs of progressive dyspnea and weight loss. In all pulmonary lobes there were multiple 0.2-0.5cm in diameter soft and homogenous white nodules. Histologically, these nodules consisted of neoplastic cells with an alveolar and papillary disposition, a pattern reminiscent of the preexistent pulmonary structure. The cytoplasms of numerous neoplastic cells were positive in the periodic acid-Schiff (PAS stain. At immunohistochemistry examination, all neoplastic

  15. La oportunidad de un atlas sobre el estado del continente africano / The Opportunity of an Atlas about the Situation of the African Continent

    Directory of Open Access Journals (Sweden)

    Eva Pérez Hernández

    2014-12-01

    Full Text Available Desde la Antigüedad clásica hasta nuestros días se han multiplicado las representaciones cartográficas de la Tierra, sin embargo, no todos los territorios del planeta han recibido la misma atención. En el caso del continente africano son escasas las colecciones de mapas recientes y, especialmente, las que conforman atlas temáticos. Esta circunstancia fue determinante en la orientación de las prácticas desarrolladas en Casa África durante el curso académico 2012-2013, al amparo del Consorcio Casa África-Universidad de Las Palmas de Gran Canaria. El objetivo de las prácticas fue la elaboración de un atlas digital de África que tuvo como resultado la realización de cuarenta mapas temáticos basados en indicadores geográficos, ambientales, demográficos, económicos, sociales, geopolíticos, culturales y de sus relaciones económicas y políticas con España. La elaboración de dicho atlas se vio afectada por numerosas dificultades en cuanto a la búsqueda y tratamiento de las fuentes de información y por un trabajo de diseño y edición que requirió de la utilización de las nuevas tecnologías de la información geográfica. El presente artículo reflexiona acerca de la importancia de la cartografía como herramienta imprescindible de conocimiento geográfico y acerca de la superación de dificultades que entrañan retos como el de la realización de un atlas sobre el estado actual del continente africano.From Classical Antiquity to the present days, cartographic representations of the Earth have multiplied. However, not all the territories of the planet have received the same attention. In the case of the African continent, there are few collections of recent maps, especially, of those that are composed of thematic atlases. This circumstance was decisive in determining the focus of the internship in Casa África during academic year 2012-2013, under the auspices of the Consortium Casa África - University of Las Palmas de Gran

  16. Potential Lipid-Lowering Effects of Eleusine indica (L) Gaertn. Extract on High-Fat-Diet-Induced Hyperlipidemic Rats.

    Science.gov (United States)

    Ong, Siew Ling; Nalamolu, Koteswara Rao; Lai, How Yee

    2017-01-01

    To date, anti-obesity agents based on natural products are tested for their potential using lipase inhibition assay through the interference of hydrolysis of fat by lipase resulting in reduced fat absorption without altering the central mechanisms. Previous screening study had indicated strong anti-obesity potential in Eleusine indica ( E. indica ), but to date, no pharmacologic studies have been reported so far. This study was performed to investigate the lipid-lowering effects of E. indica using both in vitro and in vivo models. The crude methanolic extract of E. indica was fractionated using hexane (H-Ei), dichloromethane (DCM-Ei), ethyl acetate (EA-Ei), butanol (B-Ei), and water (W-Ei). All the extracts were tested for antilipase activity using porcine pancreatic lipase. Because H-Ei showed the highest inhibition, it was further subjected to chemical profiling using high-performance liquid chromatography. Subsequently, oral toxicity analysis of H-Ei was performed [Organization for Economic Cooperation and Development guidelines using fixed dose procedure (No. 420)]; efficacy analysis was performed using high-fat diet (HFD)-induced hyperlipidemic female Sprague-Dawley rats. According to the toxicity and efficacy analyses, H-Ei did not demonstrate any noticeable biochemical toxicity or physiologic abnormalities and did not cause any tissue damage as per histologic analysis. Furthermore, H-Ei significantly reduced body weight and improved serum profile and did not show hepatotoxicity and nephrotoxicity based on the serum profile. Moreover, H-Ei alleviated HFD-induced hepatosteatosis and ameliorated induced adiposity in both visceral and subcutaneous adipose tissue. Our results demonstrate that H-Ei effectively improved hyperlipidemia. Further studies to explore its possibility as an alternative pharmacologic agent to treat obesity are warranted. Hexane extract of Eleusine indica (H-Ei) showed strong potential in the inhibition of porcine pancreatic lipase (27.01

  17. Historia poblacional, orígenes africanos y microevolución de los actuales afro-colombianos inferidos desde caracteres epigenéticos en la dentición decidua y permanente

    Directory of Open Access Journals (Sweden)

    Delgado Burbano, Miguel E.

    2006-01-01

    Full Text Available Setenta y cinco rasgos coronales no-métricos en la dentición permanente y decidua fueron registrados en 178 modelos dentales de individuos afro-colombianos pertenecientes a la comunidad de Guapi. Se recolectaron datos comparativos de 33 grupos africanos, otro grupo afro-estadounidense en la dentición permanente, en 4 grupos afro-americanos y otros 12 grupos de diferente ascendencia étnica, en la dentición decidua. Un análisis multivariado de componentes principales basado en frecuencias dentales, mostró que los afro-colombianos poseen gran afinidad genética con el Africa Sub-Sahariana, específicamente con grupos del Occidente, del Oriente y del Sur-Oriente africano. Este mismo análisis detectó una marcada divergencia dental con las poblaciones Norafricanas. Los resultados de esta investigación concuerdan con recientes estudios genéticos, basados en marcadores de ADNmt. A pesar que la dentición es evolutivamente conservativa y estable en una escala diacrónica corta, se concluyó que en 400 años de microevolución de los africanos en Colombia, su pool genético original se ha modificado levemente, debido a la influencia de presiones selectivas y flujo génico interétnico, con nativos americanos y grupos de origen caucásico. Se sugiere que los grupos afro-descendientes del Norte, Centro y Sur de América poseen historias poblacionales y evolutivas distintas, debido tanto a procesos de diferenciación fenotípica regional y local como a orígenes geográficos y étnicos diferentes.

  18. Condições microbiológicas e de ocorrência do caramujo terrestre africano na cidade de Araguaína no Estado do Tocantins

    Directory of Open Access Journals (Sweden)

    Lilyan Luizaga Monteiro

    2015-12-01

    Full Text Available Com base na grande incidência da espécie invasora de caramujo africano, Achatina fulica, na cidade de Araguaína, objetivamos investigar a relação existente entre as condições microbiológicas do caramujo e a ocorrência deste nas hortas domésticas na cidade. Foram seguidas metodologias laboratoriais na determinação de presença/ausência de microrganismos na superfície do caramujo, assim como de fungos filamentosos. Para complementar o trabalho foram entrevistados cento e um (101 moradores domiciliados em dezenove setores de Araguaína. Os resultados microbiológicos da superfície do caramujo apresentam valores acima de 1,2x105 UFC/g de bactérias heterotróficas, foram também isolados fungos dos gêneros Aspergillus, Penicillum, Trichophyton e Cryptococcus. No levantamento por entrevista, 86% dos entrevistados relataram uma alta incidência do caramujo nos seus domicílios no período chuvoso e 50% deles afirmaram ter algum tipo de canteiro em casa, porém 85% desconhecem as doenças que poderiam ser transmitidas por este caramujo. Concluímos que existe uma elevada contaminação microbiológica na superfície dos caramujos analisados, o que combinado com a preferencia pelos produtos de hortas domesticas desconhecendo os riscos que a invasão por caramujos pode acarretar, indicam a necessidade de ampliar o conhecimento sobre a determinação das condições de risco inerentes a A. fulica, assim como sua divulgação na sociedade araguaínense sobre seus efeitos, não somente na saúde das pessoas mas também na produtividade da agricultura artesanal.

  19. Herbicidal activity of pre and post emergent herbicide on control of Eleusine indica in aerobic rice system

    International Nuclear Information System (INIS)

    Selvarajh, G.; Zain, N.M.; Aminudin, A.; Seng, C.T.

    2018-01-01

    Aerobic rice system can be an alternate way to cultivate rice in less water conditions. However, weeds are a major constrain in aerobic rice field which decline its success. Weeds are being controlled by herbicides in aerobic rice but not all herbicides are effective in controlling various types of weeds. In this study, two pre-emergent (pretilachor and pendimethalin) and two post-emergent (cyhalofop-butyl and bispyribac-sodium) herbicides were evaluated for effective control of the bioassay species, Eleusine indica. It was found that pendimethalin at a higher application rate of 1.0 kg ai ha-1 strongly inhibit the emergence and shoot growth of E. indica by >75% with negligible effect on the rice growth with stimulation on the leaf greenness. Conversely, pretilachor, cyhalofop-butyl and bispyribac-sodium gave moderate inhibition (55-60% inhibition) on weed emergence and shoot growth at higher application rates of 0.44, 0.1 and 0.035 kg ai ha-1, respectively. Significant inhibitory effects on rice root growth were noticed at highest application rates of pretilachor, cyhalofop-butyl and bispyribac-sodium (40-50% inhibition) across the growth stage of rice seedlings. Great reduction in shoot height, shoot fresh weight, and greenness of rice plant also was evident at 0 DAS across herbicides rates. However, with increasing growth stages, the rice plant became less susceptible to the applied treatments. The finding suggested that pendimethalin at 1.0 kg ai ha-1 was the most suitable application rate for inhibiting E. indica without injuring the rice seedlings. (author)

  20. Evidence for distinct roles of the SEPALLATA gene LEAFY HULL STERILE1 in Eleusine indica and Megathyrsus maximus (Poaceae).

    Science.gov (United States)

    Reinheimer, Renata; Malcomber, Simon T; Kellogg, Elizabeth A

    2006-01-01

    LEAFY HULL STERILE1 (LHS1) is an MIKC-type MADS-box gene in the SEPALLATA class. Expression patterns of LHS1 homologs vary among species of grasses, and may be involved in determining palea and lemma morphology, specifying the terminal floret of the spikelet, and sex determination. Here we present LHS1 expression data from Eleusine indica (subfamily Chloridoideae) and Megathyrsus maximus (subfamily Panicoideae) to provide further insights into the hypothesized roles of the gene. E. indica has spikelets with three to eight florets that mature acropetally; E. indica LHS1 (EiLHS1) is expressed in the palea and lemma of all florets. In contrast, M. maximus has spikelets with two florets that mature basipetally; M. maximus LHS1 (MmLHS1) is expressed in the palea and lemma of the distal floret only. These data are consistent with the hypothesis that LHS1 plays a role in determining palea and lemma morphology and specifies the terminal floret of basipetally maturing grass spikelets. However, LHS1 expression does not correlate with floret sex expression; MmLHS1 is restricted to the bisexual distal floret, whereas EiLHS1 is expressed in both sterile and bisexual floret meristems. Phylogenetic analyses reconstruct a complex pattern of LHS1 expression evolution in grasses. LHS1 expression within the gynoecium has apparently been lost twice, once before diversification of a major clade within tribe Paniceae, and once in subfamily Chloridoideae. These data suggest that LHS1 has multiple roles during spikelet development and may have played a role in the diversification of spikelet morphology.

  1. El rol del asociacionismo de inmigrantes africanos en la construcción de cohesión social y la convivencia en Cataluña, Navarra y la Comunidad Valenciana. Miradas Cruzadas

    Directory of Open Access Journals (Sweden)

    Moncusí Ferré, Albert

    2013-06-01

    Full Text Available This article aims to analyse some possible contributions from organisations funded by immigrants from the African continent to the socio-cultural integration in three Regions in Spain. In order to do so, first there is a definition of integrations as a process, paying special attention to the role that national and international literature have given to the associations of immigrants. Afterwards, there is a focus on associations from people with an African origin, paying attention to the double view point, from one side the one from representatives from African associations and on the other, from administration technicians and representatives of social entities that collaborate with them. The point is to analyse the speech of those actors, about the reasons of its existence, the objectives and activities of the associations of Africans, for the associates themselves as well as for those immigrants from their countries and for the society that welcomes them. The elements in favour and against in the studied perspectives build an action field shared by both actors, in the process of construction of social cohesion and living partnership, but, at the same time, they suggest the existence of some limitations in itself.El objetivo de este artículo es analizar algunas posibles contribuciones de las organizaciones fundadas por personas emigradas desde el continente africano a la integración sociocultural en tres Comunidades Autónomas españolas. Para ello, se empieza definiendo la integración como proceso, con particular atención al papel que la literatura nacional e internacional ha otorgado al asociacionismo de inmigrantes en él. Posteriormente, se enfoca el caso particular del asociacionismo de las personas de origen africano y su incidencia en la integración en todo lo referido a la interadaptación social y cultural, según la doble mirada que encontramos en las entrevistas realizadas tanto a representantes de asociaciones de africanos como

  2. Effects of CO/sub 2/ enrichment and temperature on growth in two C/sub 4/ weeds, Echinochloa crus-galli and Eleusine indica

    Energy Technology Data Exchange (ETDEWEB)

    Potvin, C.; Strain, B.R.

    1985-01-01

    Mathematical growth analyses were carried out on two C/sub 4/ grasses, Echinochloa crus-galli and Eleusine indica, to test the influence of CO/sub 2/ enrichment and temperature on growth. Echinochloa populations from Quebec, North Carolina, and Mississippi and a single population of Eleusine from Mississippi were grown for 48 days at two CO/sub 2/ concentrations (350 and 675 ..mu..L/center dot/L/sup /minus/1/) and three temperature regimes (28:22, 24:18, and 21: 15/degree/C). CO/sub 2/ enrichment generated an increased root dry weight and induced an earlier development of inflorescences. Net assimilation rate, the only other parameter to respond to CO/sub 2/ enrichment, was higher for plants grown at high CO/sub 2/ concentration during the first harvest interval. Biomass partitioning was affected by temperature. Root dry weight was greater in plants grown at 21:15/degree/C while more leaf area was produced in warmer temperature regimes. Only plants from Quebec maintained normal growth rates under the 21:15/degree/C regime, suggesting that northern C/sub 4/ plants are better suited for growth at low temperatures than southern ones. 18 refs., 2 figs., 3 tabs.

  3. Susceptibilidade do besouro rola-bosta africano a reguladores de crescimento de insetos Susceptibility of African dung beetle to insect growth regulators

    Directory of Open Access Journals (Sweden)

    L.N. Domingues

    2009-10-01

    Full Text Available Verificou-se a ação dos reguladores de crescimento de insetos (IGR, diflubenzuron e methoprene, sobre o besouro rola-bosta africano, Digitonthophagus gazella (Fabricius, um inimigo natural da mosca-dos-chifres, Haematobia irritans irritans (Linnaeus. Casais de besouros foram colocados em baldes contendo terra úmida e alimentados com fezes bovinas contendo 1, 0,5 ou 0,2ppm de diflubenzuron e 0,2ppm de methoprene. Os insetos e sua prole foram recuperados com o auxílio de armadilhas pitfall. Diflubenzuron e methoprene não afetaram a sobrevivência dos adultos inicialmente expostos, mas interferiram na produção de descendentes. Diflubenzuron, nas concentrações de 1 e 0,5ppm, também afetou a duração do ciclo de vida dos besouros. Nenhum dos IGRs alterou a razão sexual dos descendentes obtidos. As concentrações testadas de diflubenzuron mostraram-se moderadamente nocivas ao besouro enquanto methoprene a 0,2ppm mostrou ser pouco nocivo, segundo os critérios da International Organization for Biological Control.The effects of insect growth regulators (IGR, diflubenzuron and methoprene, on African dung beetle, Digitonthophagus gazella (Fabricius, a natural enemy of the horn fly, Haematobia irritans irritans (Linnaeus, was studied. Beetles were placed in buckets partially filled with humid soil and were fed bovine feces containing 1, 0.5, or 0.2ppm diflubenzuron and 0.2ppm methoprene. Insects and their progenies were recovered by pitfall traps. Diflubenzuron and methoprene did not affect the survival of the adults but reduced their progenies. Diflubenzuron 1 and 0.5ppm also affected the life cicle of the beetles. None of the IGR modified the gender ratio of the progenies. According to the IOBC criteria, diflubenzuron tested concentrations showed to be moderately harmful to the beetles, whereas methoprene 0.2ppm was slightly harmful.

  4. Análisis antropogenético de los aportes indígena y africano en muestras hospitalarias de la ciudad de Buenos Aires

    Directory of Open Access Journals (Sweden)

    Avena, Sergio Alejandro

    2001-01-01

    Full Text Available Como consecuencia de las masivas corrientes migratorias de origen europeo que arribaron a la ciudad de Buenos Aires, las frecuencias génicas de los sistemas ABO y Rh en muestras hospitalarias de las décadas de 1930 y 1940 eran similares a las registradas en España e Italia. A partir de los años cuarenta, poblaciones del interior del país y de países limítrofes, de elevada composición indígena y posiblemente también africana, migraron hacia la ciudad. Para evaluar su repercusión sobre la estructura genética de la población nos propusimos analizar muestras poblacionales actuales. Los estudios se realizaron sobre dos muestras del Banco de Sangre del Hospital Italiano denominadas MI y MII. La MI comprendió la información del Registro de Dadores de Sangre de esa unidad, para los sistemas ABO y Rh (D (N=13.217. Para la MII se analizaron 9 sistemas eritrocitarios y los alotipos GM/KM (N=202. En este último caso se realizó una encuesta con la finalidad de obtener información sobre lugar de nacimiento, residencia actual y datos genealógicos. Las frecuencias génicas se determinaron empleando métodos de máxima verosimilitud. El mestizaje se estimó aplicando el programa ADMIX (trihíbrido. Las frecuencias génicas obtenidas para ABO y Rh difieren significativamente de las detectadas antes de mitad del siglo. Se registró 10.5% de aporte aborigen en la MI y 15.9% en la MII, mientras que sólo se detectó la presencia de componente africano en una región de la MI (1.0% y en la MII (3.3%. Estos resultados, que confirmarían la existencia de cambios en la composición genética de la población de la ciudad de Buenos Aires, se discuten en referencia a la información demográfica e histórica.

  5. Antioxidant and anti-inflammatory activities of extracts from Cassia alata, Eleusine indica, Eremomastax speciosa, Carica papaya and Polyscias fulva medicinal plants collected in Cameroon.

    Science.gov (United States)

    Sagnia, Bertrand; Fedeli, Donatella; Casetti, Rita; Montesano, Carla; Falcioni, Giancarlo; Colizzi, Vittorio

    2014-01-01

    The vast majority of the population around the world has always used medicinal plants as first source of health care to fight infectious and non infectious diseases. Most of these medicinal plants may have scientific evidence to be considered in general practice. The aim of this work was to investigate the antioxidant capacities and anti-inflammatory activities of ethanol extracts of leaves of Cassia alata, Eleusine indica, Carica papaya, Eremomastax speciosa and the stem bark of Polyscias fulva, collected in Cameroon. Chemiluminescence was used to analyze the antioxidant activities of plant extracts against hydrogen peroxide or superoxide anion. Comet assays were used to analyze the protection against antioxidant-induced DNA damage induced in white blood cells after treating with hydrogen peroxide. Flow cytometry was used to measure γδ T cells proliferation and anti-inflammatory activity of γδ T cells and of immature dendritic cells (imDC) in the presence of different concentrations of plant extracts. Ethanol extracts showed strong antioxidant properties against both hydrogen peroxide and superoxide anion. Cassia alata showed the highest antioxidant activity. The effect of plant extracts on γδ T cells and imDC was evidenced by the dose dependent reduction in TNF-α production in the presence of Cassia alata, Carica papaya, Eremomastax speciosa Eleusine indica, and Polyscias fulva. γδ T cells proliferation was affected to the greatest extent by Polyscias fulva. These results clearly show the antioxidant capacity and anti-inflammatory activities of plant extracts collected in Cameroon. These properties of leaves and stem bark extracts may contribute to the value for these plants in traditional medicine and in general medical practice.

  6. Antioxidant and anti-inflammatory activities of extracts from Cassia alata, Eleusine indica, Eremomastax speciosa, Carica papaya and Polyscias fulva medicinal plants collected in Cameroon.

    Directory of Open Access Journals (Sweden)

    Bertrand Sagnia

    Full Text Available BACKGROUND: The vast majority of the population around the world has always used medicinal plants as first source of health care to fight infectious and non infectious diseases. Most of these medicinal plants may have scientific evidence to be considered in general practice. OBJECTIVE: The aim of this work was to investigate the antioxidant capacities and anti-inflammatory activities of ethanol extracts of leaves of Cassia alata, Eleusine indica, Carica papaya, Eremomastax speciosa and the stem bark of Polyscias fulva, collected in Cameroon. METHODS: Chemiluminescence was used to analyze the antioxidant activities of plant extracts against hydrogen peroxide or superoxide anion. Comet assays were used to analyze the protection against antioxidant-induced DNA damage induced in white blood cells after treating with hydrogen peroxide. Flow cytometry was used to measure γδ T cells proliferation and anti-inflammatory activity of γδ T cells and of immature dendritic cells (imDC in the presence of different concentrations of plant extracts. RESULTS: Ethanol extracts showed strong antioxidant properties against both hydrogen peroxide and superoxide anion. Cassia alata showed the highest antioxidant activity. The effect of plant extracts on γδ T cells and imDC was evidenced by the dose dependent reduction in TNF-α production in the presence of Cassia alata, Carica papaya, Eremomastax speciosa Eleusine indica, and Polyscias fulva. γδ T cells proliferation was affected to the greatest extent by Polyscias fulva. CONCLUSION: These results clearly show the antioxidant capacity and anti-inflammatory activities of plant extracts collected in Cameroon. These properties of leaves and stem bark extracts may contribute to the value for these plants in traditional medicine and in general medical practice.

  7. CRITICAL REVIEW - O Brasil Africano

    OpenAIRE

    Nery, Valéria

    2017-01-01

    Three maps that provide multiple understandings and information that transcend time and space, bringing together lives, traditions and memories that lead us to rethink our knowledge about Brazil and Africa.

  8. Sudáfrica: La Clase Obrera y el Congreso Nacional Africano después de la Segunda Guerra Mundial

    Directory of Open Access Journals (Sweden)

    Musso, Javier

    2010-01-01

    Full Text Available El tema a trabajar será “Los movimientos nacionalistas y la clase obrera en Sudáfrica”, en el período que va desde la Segunda Guerra Mundial hasta principios de la década del sesenta. Más específicamente se analizará cómo los movimientos nacionalistas sudafricanos, principalmente el A.N.C. (African National Congress, se ligan a un importante número de trabajadores africanos y a los sindicatos que los dirigen; se establecerá cuáles eran sus programas políticos y sus estrategias de luchas contra el gobierno de la Unión y el Imperio inglés para la independencia nacional; y a partir de esto se precisaran sus límites tácticos y programáticos, sosteniendo como hipótesis de trabajo que en Sudáfrica, dada la importancia estructural de la clase obrera, existió la posibilidad de un programa y una dirección política que organizara a los trabajadores con sus propios métodos de lucha y que fuera más allá de la independencia política y nacional, es decir una alternativa socialista; y que, para ello, definiera claramente que la lucha por la independencia debía ser en contra, no sólo del gobierno de la minoría blanca, sino también de los verdaderos beneficiarios del régimen de segregación y superexplotación: las empresas transnacionales de capitales extranjeros, principalmente británicos. Para sostener esta hipótesis se realizará un análisis estructural de las distintas clases sociales en Sudáfrica desde una mirada marxista, como así también se analizarán las diversas luchas llevadas adelantes por los trabajadores sudafricanos y las respuestas que a éstas dieron los partidos y sindicatos que las dirigieron.The subject to work will be “the nationalistic movements and the working class in South Africa”, in the period that goes from World War II until the beginning of the Sixties. More specifically one will analyze how the South African nationalistic movements, mainly A.N.C. (African National Congress, they league

  9. Relationship of status of polymorphic rapd bands with genotypic ...

    African Journals Online (AJOL)

    Relationship of status of polymorphic rapd bands with genotypic adaptation in early finger millet genotypes. S Das, RC Misra, GR Rout, MC Pattanaik, S Aparajita. Abstract. Molecular characterisation of the 15 early duration finger millet (Eleusine coracana G) genotypes was done through RAPD markers. Twenty-five ...

  10. Apoptotic induction activity of Dactyloctenium aegyptium (L. P.B. and Eleusine indica (L. Gaerth. extracts on human lung and cervical cancer cell lines

    Directory of Open Access Journals (Sweden)

    Pintusorn Hansakul

    2009-08-01

    Full Text Available Dactyloctenium aegyptium (L. P.B. (Yaa paak khwaai and Eleusine indica (L. Gaerth. (Yaa teen-ka have long been used in traditional Thai medicine because of their diuretic, anti-inflamatory, and antipyretic effects. The present study examined the antiproliferative and cytotoxic effects of the hexane and butanolic extracts of these two grass species. All the grass extracts exhibited selective growth inhibition effect on human lung cancer (A549 and cervical cancer (HeLa cells relative to normal human lung MRC-5 fibroblasts with IC50 values in a range of 202 to 845 mg/ml. Apparently, HeLa cellswere more sensitive to the extracts than A549 cells. Moreover, all the extracts induced lethality in both cancer cell lines atconcentrations close to 1,000 mg/ml, indicating their selective cytotoxicity effects. ELISA assay showed that only the hexaneextract of D. aegyptium (L. P.B. and E. indica (L. Gaerth. significantly increased the apoptotic level in extract-treatedA549 cells. However, DNA ladder assay detected classic DNA ladder patterns, a characteristic feature of apoptosis, in both cancer cell lines treated with all the extracts in a dose- and time-dependent manner. Taken together, these results indicatethat the cytotoxic activity of the grass extracts against lung and cervical cancer cells is mediated through the induction ofapoptosis.

  11. Identification and characterization of RAPD-SCAR markers linked to glyphosate-susceptible and -resistant biotypes of Eleusine indica (L.) Gaertn.

    Science.gov (United States)

    Cha, Thye San; Anne-Marie, Kaben; Chuah, Tse Seng

    2014-02-01

    Eleusine indica is one of the most common weed species found in agricultural land worldwide. Although herbicide-glyphosate provides good control of the weed, its frequent uses has led to abundant reported cases of resistance. Hence, the development of genetic markers for quick detection of glyphosate-resistance in E. indica population is imperative for the control and management of the weed. In this study, a total of 14 specific random amplified polymorphic DNA (RAPD) markers were identified and two of the markers, namely S4R727 and S26R6976 were further sequence characterized. Sequence alignment revealed that marker S4R727 showing a 12-bp nucleotides deletion in resistant biotypes, while marker S26R6976 contained a 167-bp nucleotides insertion in the resistant biotypes. Based on these sequence differences, three pairs of new sequence characterized amplified region (SCAR) primers were developed. The specificity of these primer pairs were further validated with genomic DNA extracted from ten individual plants of one glyphosate-susceptible and five glyphosate-resistant (R2, R4, R6, R8 and R11) populations. The resulting RAPD-SCAR markers provided the basis for assessing genetic diversity between glyphosate-susceptible and -resistant E. indica biotypes, as well for the identification of genetic locus link to glyphosate-resistance event in the species.

  12. The potential of wild vegetation species of Eleusine indica L., and Sonchus arvensis L. for phytoremediation of Cd-contaminated soil

    Directory of Open Access Journals (Sweden)

    Amir Hamzah

    2017-04-01

    Full Text Available Phytoremediation has been intensively studied due its costs effectiveness and environmentally sound. Studies of heavy metal pollution phytoremediation has been done in develop countries, but still limited in Indonesia. This study aims to explore the potential of wild plant species Eleusine indica L. and Sonchus arvensis L. as an agent of phytoremediation on Cd-contaminated soil. This study was done descriptively in Pujon, Malang, Indonesia, to test the ability of two species of wild plants E. indica and S. arvensis in absorbing Cd. Along this research, plant growth and the concentration of Cd in roots, stems and leaves, was monitored. Plant growth was measured every week for three months. The plant roots, stems, and leaves collected separately, then analyzed its Cd levels. The results showed that both of two species of wild plants grew well on soil contaminated Cd. Plant roots can accumulate higher Cd than the stem part. In addition, E indica has the ability to accumulate Cd higher than S. arvensis, i.e. 57.11% and 35.84%, respectively

  13. Avaliação do espermograma de leões africanos (Panthera leo, Linnaeus, 1758, mantidos na Fundação Parque Zoológico de São Paulo

    Directory of Open Access Journals (Sweden)

    Priscylla Sayuri Miya

    2007-12-01

    Full Text Available O presente estudo teve por objetivo avaliar o espermograma de um grupo de leões africanos mantidos em cativeiro na Fundação Parque Zoológico de São Paulo, como um aspecto a ser considerado na avaliação do potencial reprodutivo para a aplicação de técnicas de reprodução assistida. Foram submetidos a eletroejaculação 14 exemplares machos, adultos de Leão Africano, utilizando-se o método da eletroejaculação. Logo após a colheita, cada uma das 13 amostras obtidas foi examinada quanto ao volume, pH e aspecto geral, seguida pela avaliação da motilidade, movimento progressivo, índice de motilidade espermática e concentração. Uma alíquota do ejaculado foi fixada em solução de formol-salina a 10% e analisado em câmara úmida ao microscópio de interferência de fase, para o estudo dos aspectos morfológicos, classificando as alterações dos espermatozóides em defeitos maiores e menores. Os resultados foram: volume 5,83 ± 3,35 ml; concentração 11,62 ± 14,51 x 10(6 espermatozóides/ml; motilidade total 73,85 ± 11,02%; motilidade progressiva 3,35 ± 0,63; índice de motilidade espermática 70,42%, pH 8,1 ± 0,5; defeitos maiores 38,12 ± 19,41%; defeitos menores 17,43 ± 10,36%; defeitos totais 55,55 ± 19,30%. Os defeitos maiores mais freqüentes foram gota citoplasmática proximal, peça intermediária dobrada com gota citoplasmática e peça intermediária dobrada. A cauda dobrada foi o defeito menor mais encontrado.

  14. First report of acariasis by Caparinia tripilis in African hedgehogs, (Atelerix albiventris, in Costa Rica Primeiro relato de acariasis por Caparinia tripilis em ouriços Africanos, (Atelerix albiventris, na Costa Rica

    Directory of Open Access Journals (Sweden)

    Andrés Moreira

    2013-03-01

    Full Text Available The African hedgehog is one of the newly imported exotic pets which have been observed with increasing regularity in veterinary clinics in Costa Rica. Despite their popularity, information about their diseases is scarce. Within skin diseases of hedgehogs, mange caused by Caparinia spp. is a common diagnosis in other countries. Two adult African hedgehogs, one male and one female, were brought to a private clinic in Heredia, Costa Rica, with chronic pruritic dermatitis, scabs, nearly complete loss of spines, lethargy, dehydration, and weight loss. During physical exam, deposits of dry seborrhea were taken and processed for diagnosis. Microscopic examination revealed psoroptid mites identified as Caparinia tripilis. This is the first report of the presence of Caparinia tripilis in Costa Rica and, to the authors' knowledge, the rest of Central America. O ouriço africano é um dos animais de estimação exótico, recém-importado que tem sido observado com maior regularidade nas clínicas veterinárias da Costa Rica. Apesar da sua popularidade, informações sobre suas doenças são escassas. Dentre as doenças de pele de ouriços, a sarna causada por Caparinia spp. é um diagnóstico comum nos outros países. Dois adultos ouriços africanos, um macho e uma fêmea, foram levados para uma clínica particular, em Heredia, Costa Rica, com a dermatite pruriginosa crônica, crostas, perda quase completa de espinhos, letargia, desidratação e perda de peso. Ao exame físico, os depósitos de seborreia seca foram retirados e processados para o diagnóstico. O exame microscópico revelou ácaros (psoroptidae identificados como Caparinia tripilis. Esse é o primeiro relato da presença de Caparinia tripilis na Costa Rica e, para conhecimento dos autores, o resto da América Central.

  15. Evolution of a Double Amino Acid Substitution in the 5-Enolpyruvylshikimate-3-Phosphate Synthase in Eleusine indica Conferring High-Level Glyphosate Resistance1

    Science.gov (United States)

    Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R. Douglas; Powles, Stephen B.

    2015-01-01

    Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I + P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. PMID:25717039

  16. Evolution of a double amino acid substitution in the 5-enolpyruvylshikimate-3-phosphate synthase in Eleusine indica conferring high-level glyphosate resistance.

    Science.gov (United States)

    Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R Douglas; Powles, Stephen B

    2015-04-01

    Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I+P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. © 2015 American Society of Plant Biologists. All Rights Reserved.

  17. Ecofisiologia de plantas jovens de mogno-africano submetidas a deficit hídrico e reidratação Ecophysiology of young African mahogany plants subjected to water deficit and rewetting

    Directory of Open Access Journals (Sweden)

    Marcos Paulo Ferreira de Albuquerque

    2013-01-01

    Full Text Available O objetivo deste trabalho foi avaliar a capacidade de plantas jovens de mogno-africano (Khaya ivorensis em recuperar seu status hídrico e trocas gasosas após período de deficit hídrico. Plantas com aproximadamente 315 dias, irrigadas (controle e não irrigadas, foram avaliadas aos 14 dias da suspensão da irrigação e após um, três e sete dias da retomada da irrigação (reidratação. No dia 14, o potencial hídrico foliar de antemanhã (Ψam das plantas estressadas foi reduzido a -2,66 MPa. Com a restrição hídrica, foram observadas reduções significativas no conteúdo relativo de água na antemanhã (redução de 32%, na taxa de assimilação líquida de CO2 (90%, na condutância estomática (95%, na transpiração (93% e na razão entre concentração intercelular e ambiental de CO2 (37%. Durante a reidratação, o status hídrico das plantas estressadas foi restabelecido após três dias. As trocas gasosas também se restabeleceram, mas de forma mais lenta que o status hídrico. Sob deficit hídrico, a concentração de prolina aumentou e a de carboidratos solúveis totais diminuiu. Plantas jovens de mogno-africano são tolerantes ao deficit hídrico moderado.The objective of this work was to evaluate the capacity of young plants of African mahogany (Khaya ivorensis to recover their water status and gas exchange after water deficit. Plants with approximately 315 days, irrigated (control and non-irrigated, were evaluated after water was withheld for 14 days, and after one, three, and seven days of irrigation resumption (rehydration. On day 14, the predawn leaf water potential (Ψam of stressed plants was reduced to -2.66 MPa. With water deficit, significant decreases were observed in predawn relative water content (32% reduction, in net assimilation rate of CO2 (90%, in stomatal conductance (95%, in transpiration (93%, and in intercellular to ambient ratio of CO2 concentration (37%. During rehydration, the water status of stressed

  18. O problema do tráfico africano de escravos na Independência e formação do Estado (Brasil, décadas de 1820 a 1840

    Directory of Open Access Journals (Sweden)

    Sidney Chalhoub

    2011-12-01

    Full Text Available Por ocasião da Independência (1822 e em anos subsequentes, a demanda por trabalho escravo para a produção de açúcar, algodão e café intensificou o tráfico negreiro e consolidou o comprometimento do Império brasileiro com a instituição da escravidão. No entanto, em decorrência de compromissos internacionais decorrentes do reconhecimento da Independência do país, o parlamento brasileiro aprovou uma lei de abolição do tráfico africano de escravos em 7 de novembro de 1831. O principal objetivo deste artigo é explorar algumas conseqüências políticas e sociais do não cumprimento da lei de 1831, em especial quanto a práticas cotidianas destinadas a dar aparência de legalidade à propriedade escrava adquirida ao arrepio da lei. English: During the times of Brazilian Independence (1820s, the high demand for slave labor for the production of sugar, cotton and coffee brought with it the intensification of the African slave trade and consolidated slavery as a core institution pertaining to the new nation. Nonetheless, as a result of international agreements associated with the recognition of Independence from Portugal, the Brazilian parliament enacted a law abolishing the slave trade on 7 November 1831. In this article I seek to explore some political and social consequences of the non fulfillment of the law of 1831, especially regarding daily practices intended to give the appearance of legality to slave property acquired by contraband.

  19. La reagrupación familiar de africanos y latinoamericanos en la España mediterránea. Dinámicas y estructuras sociodemográficas

    Directory of Open Access Journals (Sweden)

    Gozálvez Pérez, Vicente

    2012-12-01

    Full Text Available The amount of foreigners authorised to live in Spain as residents between 2006 and 2009 due to family reunification reflects the significance of this type of immigration in the number of new registered foreigners. This research is based on a specific survey carried out on Africans and Latin Americans, who also provide information on the family members who have joined them here, in accordance with reunification laws or not. Africans and Latin Americans have very different dynamics and socio-demographic structures due, amongst other reasons, to the antiquity of their flows, their fertility rates, their command of Spanish, their level of education, their possibility of income, their structure by sex and age, the size of the reunited families, etc. Information is provided on both continental groups and family subgroups —those who reunite the family, spouses, children, parents and other family members— using scales for the group studied and for the geographical area —coastal Catalonia, the Region of Valencia, Murcia and Almeria—. Africans report the most negative structural aspects —Spanish language, education, income, etc.—; nevertheless it is this group that claim to have more firm and generalised intentions of staying in Spain. The conclusions in this paper give an indication of future flows for these two groups.

    Los extranjeros autorizados en 2006-2009 a residir en España por motivos de reagrupación familiar, muestran la importancia que ha alcanzado esta forma de inmigración en el total de nuevos extranjeros empadronados. La investigación se basa en una encuesta específica a reagrupantes africanos y latinoamericanos, que también informan sobre sus familiares reagrupados, hayan utilizado, o no, las leyes de reagrupación. Africanos y latinoamericanos ofrecen dinámicas y estructuras sociodemográficas muy diferentes, a resultas, entre otras causas, de la antigüedad de sus flujos, su fecundidad, su dominio del idioma espa

  20. Influence of the sowing depth and amount of sugarcane straw on the emergence of Chloris polydactyla and Eleusine indica and their control by herbicides applied pre-emergence

    Directory of Open Access Journals (Sweden)

    Marcelo Rafael Malardo

    2017-06-01

    Full Text Available The objective of this study was to evaluate the effect of the sowing depth and amount of sugarcane straw on the soil on the emergence of Chloris polydactyla (‘capim-branco’ and Eleusine indica (Indian goosegrass and to determine the efficacy of herbicides applied pre-emergence in the control of these species under different straw amount and rainfall regime conditions. The experiments were conducted in a completely randomized design with four replications. In the first experiment, the effects of six sowing depths (0.5, 1, 2, 4, 8, and 10 cm and six sugarcane straw amounts (0, 1, 2, 4, 8 and 10 t ha -1 were assessed on the emergence of Indian goosegrass and ‘capim-branco’ in a 6 x 6 factorial arrangement. In the second experiment, the efficacy in the control of these species was evaluated for one control without herbicide and five treatments (indaziflam, metribuzin, tebuthiuron, indaziflam + metribuzin, and indaziflam + tebuthiuron applied pre-emergence over four straw amounts (0, 1, 2, and 4 t ha-1 in a 6 x 4 factorial arrangement. This experiment was evaluated under two rainfall regimes in separate experiments (simulation of 20 mm of rainfall 1 or 10 days after herbicide application. The ‘capim-branco’ showed a marked reduction in emergence beginning at 2 t ha-1 of straw and a 2 cm sowing depth. For the Indian goosegrass, the decline in emergence mainly occurred beginning at 4 t ha-1 of straw and a 4 cm sowing depth. Only some of the Indian goosegrass plants emerged at the greater sowing depths (8 and 10 cm and straw amounts (8 and 10 t ha-1, whereas no emergence of the ‘capim-branco’ was observed under these conditions. The treatments with sowing at a 1 cm depth and with 0, 1, 2, and 4 t ha-1 of straw provided the highest emergence percentage for the species. Application of the herbicide indaziflam alone was the only ineffective treatment for the control of the weeds regardless of the amount of straw and the water regime used

  1. Evolution of finger millet: evidence from random amplified polymorphic DNA.

    Science.gov (United States)

    Hilu, K W

    1995-04-01

    Finger millet (Eleusine coracana ssp. coracana) is an annual tetraploid member of a predominantly African genus. The crop is believed to have been domesticated from the tetraploid E. coracana ssp. africana. Cytogenetic and isozyme data point to the allopolyploid nature of the species and molecular information has shown E. indica to be one of the genomic donors. A recent isozyme study questioned the proposed phylogenetic relationship between finger millet and its direct ancestor subspecies africana. An approach using random amplified polymorphic DNA (RAPD) was employed in this study to examine genetic diversity and to evaluate hypotheses concerning the evolution of domesticated and wild annual species of Eleusine. Unlike previous molecular approaches, the RAPD study revealed genetic diversity in the crop. The pattern of genetic variation was loosely correlated to geographic distribution. The allotetraploid nature of the crop was confirmed and molecular markers that can possibly identify the other genomic donor were proposed. Genotypes of subspecies africana did not group closely with those of the crop but showed higher affinities to E. indica, reflecting the pattern of similarity revealed by the isozyme study. The multiple origin of subspecies africana could explain the discrepancy between the isozyme-RAPD evidence and previous information. The RAPD study showed the close genetic affinity of E. tristachya to the E. coracana--E. indica group and understood the distinctness of E. multiflora.

  2. RESENHA CRÍTICA - O BRASIL AFRICANO

    OpenAIRE

    Nery, Valéria

    2017-01-01

    Três mapas que proporcionam compreensões múltiplas e informações que transcendem tempo e espaço, que reúnem vidas, tradições e memórias, que nos levam a repensar os nossos conhecimentos sobre o Brasil e a África.

  3. Nas fímbrias da liberdade: agregados, índios, africanos livres e forros na Província de Minas Gerais (século XIX On the fringes of freedom: aggregates, Indians, free Africans and manumitted slaves in Minas Gerais in the nineteenth century

    Directory of Open Access Journals (Sweden)

    Andréa Lisly Gonçalves

    2011-12-01

    Full Text Available O objetivo deste artigo é tratar alguns aspectos do trabalho compulsório, não escravo, nas Minas Gerais oitocentista. Através da abordagem do trabalho de indígenas, de recrutas, de africanos livres e de agregados pretendeu-se evidenciar o tema da vulnerabilidade e da instabilidade a que estavam sujeitos alguns homens livres pobres, em um contexto marcadamente escravista da Província: o Termo de Mariana, Comarca de Ouro Preto.This paper aims at approaching some aspects of compulsory labor, not slave labor, in the nineteenth century Minas Gerais. Through the analysis of the work of indigenous, recruits, free Africans and aggregates it intends to evidence the issue of vulnerability and instability to which some free poor men were submitted in the context of a markedly slavery region: Term of Mariana, County of Ouro Preto.

  4. Evaluation of nutraceutical and antinutritional properties in barnyard and finger millet varieties grown in Himalayan region

    OpenAIRE

    Panwar, Priyankar; Dubey, Ashutosh; Verma, A. K.

    2016-01-01

    Five elite varieties of barnyard (Echinochloafrumentacea) and finger (Eleusine coracana) growing at northwestern Himalaya were investigated for nutraceutical and antinutritional properties. Barnyard millet contained higher amount of crude fiber, total dietary fiber, tryptophan content, total carotenoids, ��-tocopherol compared to the finger millet whereas the finger millet contains higher amount of methionine and ascorbic acid as compared to the barnyard millet. The secondary metabolites of b...

  5. Traços do proprium cultural africano e sua relação com o sagrado (Features of African culture and conceptions of the sacred - DOI: 10.5752/P.2175-5841.2013v11n29p88

    Directory of Open Access Journals (Sweden)

    Antonio Geraldo Cantarela

    2013-03-01

    Full Text Available Na esteira da conquista colonial de África, desencadeada na segunda metade do século XIX, alguns antropólogos e missionários europeus, que estabeleceram longa convivência com sociedades de diferentes regiões do continente  africano, lograram realizar as primeiras recolhas e sistematizações acadêmicas do imaginário cultural de comunidades tradicionais. Tomando tal contexto como pano de fundo e contraponto, o artigo destaca algumas vozes de teóricos “nativos” (Ki-Zerbo, Hampaté Bâ, Honorat Aguessy, com vistas a explicitar e discutir alguns traços do proprium cultural africano. Na concepção daquelas culturas tradicionais, a religião, assentada no mesmo arco da cultura oral, funda todos os demais componentes da vida social. Sobre tal pressuposto, o texto discute quatro aspectos principais: a concepção (ingênua de uma unidade cultural africana; a importância da tradição oral para o conhecimento da história e do imaginário das sociedades daquele continente; as imbricações da ação política e das questões culturais;  as polarizações (desnecessárias de Europa versus África para fins de caracterizar adequadamente as culturas africanas. Palavras-chave: Culturas africanas. Religião tradicional africana. Oralidade.   Abstract During the colonial conquest of Africa, which began in the second half of the nineteenth century, some European missionaries and anthropologists, who have established long acquaintance with some societies from different regions of Africa, managed to make the first academic collection and systematization of African traditional thought. Taking such a context as a backdrop and counterpoint, this article highlights some voices of African theorists (Ki-Zerbo, Hampaté Bâ, Honorat Aguessy, in order to explain and discuss some essential features of African culture. Within the traditional African conception, the religion, founded on the same pillars of oral culture, founds all other components of

  6. STD/AIDS prevention in Portuguese-speaking Africa: a review of the recent literature in the social sciences and health Prevenção das DST/AIDS nos países africanos de língua oficial portuguesa: revisão da literatura recente em ciências sociais e da saúde

    Directory of Open Access Journals (Sweden)

    Simone Monteiro

    2009-03-01

    Full Text Available The article reviews academic literature in the social sciences and health on the problems and challenges of STD/AIDS prevention in Portuguese-speaking African countries. Based on a bibliographic survey of the SciELO, PubMed, and Sociological Abstracts databases between 1997 and 2007, the research under review was organized into two groups, according to content. The first group of studies sought to understand STD/AIDS vulnerability among social groups by examining local cultural and socioeconomic factors as related to gender dynamics, sexuality, color/race, religion and health care. The second group encompassed critical assessments of shortcomings in the STD/AIDS educational messages delivered by governments and international agencies. Attention is called to the way in which the presence of traditional medicine systems and the occurrence of civil wars in the post-colonial period impact the STD/AIDS epidemic in the African countries under study.O artigo analisa a produção acadêmica, no campo das ciências sociais e da saúde, sobre os problemas e desafios das ações de prevenção das DST/AIDS nos países africanos de língua oficial portuguesa. A partir do levantamento bibliográfico nas bases SciELO, PubMed e Sociological Abstracts, entre 1997 a 2007, o conteúdo dos trabalhos selecionados foi organizado em dois eixos. O primeiro centra-se na descrição dos estudos sobre a relevância dos fatores culturais e sócio-econômicos locais, relacionados às dinâmicas de gênero, à sexualidade, cor/raça, religião e cuidados em saúde, para o entendimento da vulnerabilidade às DST/AIDS dos diversos grupos sociais. O segundo eixo aborda as avaliações críticas acerca dos equívocos das mensagens educativas sobre DST/AIDS, promovidas pelos governos e agências internacionais, bem como as implicações da presença dos sistemas de medicinas tradicionais e da ocorrência de guerras civis no período pós-colonial para a dinâmica das DST

  7. Reflexión sobre la dimensión espectatorial de las películas africanas: o cómo los cines africanos piensan de otra manera en sus públicos / Reflection On the Spectatorial Dimension of African Films: Or How African Cinemas Think About Their Public Different

    Directory of Open Access Journals (Sweden)

    Mahomed Bamba

    2016-03-01

    Full Text Available Este artículo investiga la construcción textual del espectador en varias películas africanas. Un espectador que aparece inscrito «en filigrana» a través de los ges-tos enunciativos y estrategias paratextuales de cineastas que siguen la lógica poética del cine de autor. Es a través del análisis de estas estrategias estilísticas y narrativas, de los recursos simbólicos utilizados, de las huellas metadiscursivas presentes en los textos, como se puede averiguar, más allá de las intenciones expresadas por los propios cineastas, o de los resultados en taquilla, en qué medida los autores han pensado o no en los públicos africanos, y si se dirigen exclusivamente a ellos.Palabras clave: relato, sistema textual, paratexto, espectador implícito, semiopragmática, griot, cine de autor.AbstractThis article explores the textual construction of the spectator in various African films. A spectator that seems to be registered as a ‘watermark’ through the expository gestures and paratextual strategies of filmmakers that follow the poetic logic of auteur cinema. It is through the analysis of these stylistic and narrative strategies, of the symbolic resources used, and of the metadiscursive traces present in the texts, that the extent to which the authors have taken into consideration the African audience, and whether or not they are aiming exclusively at them, can be explored - even in terms beyond those directly expressed by the filmmakers themselves.Keywords: story, textual system, paratext, implicit spectator, semio-pragmatics, griot, auteur cinema

  8. Forum: challenges in STD/AIDS prevention in Portuguese-speaking African countries: contributions from social research and from a gender approach: Introduction Fórum: desafios da prevenção das DST/AIDS em países africanos de língua oficial portuguesa: contribuições da pesquisa social e do recorte de gênero: Introdução

    Directory of Open Access Journals (Sweden)

    Simone Monteiro

    2009-03-01

    Full Text Available This forum on the challenges of preventing STD/AIDS in Portuguese-speaking African countries contains three articles and a postscript. The first paper reviews academic production on the topic from the fields of the social sciences and of health, with special attention on how local cultural and socioeconomic factors impact the dynamics of the epidemic. Based on an ethnographic study of a region in southern Mozambique, the second paper analyzes the notion of 'tradition' within the context of Mozambique and how it affects perceptions of the local population's vulnerability to STD/AIDS. The third and final article discusses common ground and differences between government and civil society in gender approaches by community HIV/AIDS projects in Mozambique. Their observations suggest that important mistakes have been made in STD/AIDS prevention discourse and initiatives in African countries because the unique features of local development models and cultural systems have not been taken into account.Esta introdução apresenta o Fórum sobre os desafios da prevenção às DST/AIDS em países africanos de língua oficial portuguesa, constituído por três artigos e um posfácio. O primeiro trabalho traz uma revisão da produção acadêmica no campo das ciências sociais e da saúde sobre o tema, focalizando as implicações dos fatores culturais e sócio-econômicos locais para a dinâmica da epidemia. A partir de um estudo etnográfico numa região do sul de Moçambique, o segundo texto analisa a noção de "tradição" no contexto moçambicano e suas conseqüências para a percepção da vulnerabilidade às DST/AIDS da população local. O terceiro artigo discute pontos de aproximação e de desencontro entre o governo e a sociedade civil na abordagem de gênero de projetos comunitários de enfrentamento do HIV/AIDS em Moçambique. As reflexões revelam que os discursos e ações de prevenção das DST/AIDS em países africanos apresentam equ

  9. Influência do tipo e da quantidade de resíduos vegetais na eficácia de herbicidas aplicados em pré-emergência na cultura da soja Influence of the type and amount of crop residues in efficiency of herbicides applied pre-emergence in soybean

    Directory of Open Access Journals (Sweden)

    Núbia Maria Correia

    2007-01-01

    Full Text Available Com o objetivo de avaliar, em condições de campo e na região originalmente sob cerrado, os efeitos de resíduos vegetais [sorgo de cobertura (híbrido Cober Exp, milheto forrageiro (var. BN2, capim-pé-de-galinha (Eleusine coracana e capim-braquiária (Brachiaria brizantha] e duas quantidades de palha (3,0 e 5,5 t ha-1, no primeiro ano do estudo, e 3,5 e 5,8 t ha-1, no segundo na eficácia de herbicidas residuais (diclosulam e imazaquin aplicados em pré-emergência na cultura da soja, foi desenvolvido experimento, no ano agrícola 2003/2004 e repetido em 2004/2005, na fazenda Três Marcos, em Uberlândia (MG. Os herbicidas diclosulam e imazaquin não tiveram a eficácia afetada pela presença de palha na superfície do solo, independentemente da quantidade. Associados às coberturas, obteve-se melhor controle. No primeiro ano, após a instalação da cultura da soja, plantas de Eleusine coracana tornaram-se as principais infestantes na parcela de capim-pé-de-galinha.This work was conducted in the agricultural years 2003/04 and 2004/05, at the farm 'Três Marcos', Uberlândia, MG - Brazil to evaluate the effect of crop residues [coverage sorghum (hybrid Cober Exp, forage millet (var. BN2, finger millet (Eleusine coracana and St. Lucia Grass (Brachiaria brizantha] and two amounts of straw (3.0 and 5.5 t ha-1 in the first year and 3.5 and 5.8 t ha-1, in the second year in efficiency of herbicides (diclosulam and uimazaquin applied pre-emergence in soybean, 'Cerrado' conditions. The efficiency of herbicides diclosulam and imazaquin was not affected by the straw at any amount. Associated to the straw coverage, it had best weed control. In the first year, after the soybean field was installed, Eleusine coracana became the major weed species in the finger millet plot.

  10. Dietary canitine maintains energy reserves and delays fatigue of exercised african catfish (Clarias gariepinus fed high fat diets Carnitina dietética mantem reservas energéticas e evita a fatiga de bagre-africano durante exercício

    Directory of Open Access Journals (Sweden)

    Rodrigo Ozório

    2005-06-01

    Full Text Available Lipids, together with proteins, are traditionally considered as primary fuels during aerobic swimming. The effects of dietary fat and carnitine supplements and exercise on the energy metabolism of juvenile fish were investigated. One hundred African catfish (Clarias gariepinus were fed four isonitrogenous diets containing a fat level of 100 or 190 g kg-1 diet and one of the two levels of carnitine (15 and 1000 mg kg-1. Fish grew from 61 to 162 g in 10 wk. Thereafter, 6 fish per group swam vigorously for 3 h and the results were compared with unexercised groups. Fish receiving 1,000 mg carnitine accumulated 2- to 3-fold more carnitine than fish receiving 15 mg carnitine. Plasma acyl-carnitine level was affected by an interaction between dietary treatment and exercise (P Lipídios e proteínas são tradicionalmente considerados combustíveis primários durante natação aeróbica. Nesse ensaio foi investigado o efeito da suplementação de vários níveis de gordura e carnitina no metabolismo de 100 bagres africanos juvenis (Clarias gariepinus. Os peixes foram arraçoados com quatro dietas isoprotéicas, cada uma contendo 100 ou 190 g gordura kg-1 dieta, e um dos dois níveis de carnitina (15 e 1000 mg kg-1. Os peixes cresceram de 61 a 162 g em 10 semanas. No final do ensaio de alimentação, grupos de seis peixes por tratamento foram induzidos a nadar vigorosamente por 3 h e em seguida vários parâmetros foram determinados no tecido muscular e plasma, e os resultados observados nos grupos exercitados foram comparados com grupos controles (não exercitados. Os peixes arraçoados com 1,000 mg carnitina acumularam de duas a três vezes mais carnitina que os peixes arraçoados com 15 mg carnitina. O nível de acyl-carnitina no plasma foi influenciado pela interação entre os tratamentos dietéticos e exercício físico (P < 0.05. As concentrações de adenosina trifosfato (ATP e fosfocreatina no tecido muscular branco (WM foram mais elevadas em

  11. Las religiones y culturas de origen africano (Brasil, Cuba, Venezuela a prueba de políticas turísticas y rivalidades ¿ Un desarrollo sostenible ? Religions and cultures of African origin (Brazil, Cuba, Venezuela to test tourism policies and rivalries. A sustainable development? Religions et cultures d'origine africaine (Brésil, Cuba, Venezuela à l'épreuve des politiques touristiques et des rivalités. Un développement soutenable?

    Directory of Open Access Journals (Sweden)

    Montserrat Fitó

    2012-05-01

    Full Text Available Les religions1 d’origine africaine ont été transformées, au Brésil, à Cuba et plus récemment au Venezuela, en instruments pour augmenter la captation de devises, par le biais de programmes présentés par les autorités comme répondant aux normes du développement durable. Mais, tant le contrôle exercé sur ces manifestations culturelles, à des fins de commercialisation, que les rivalités engendrées entre pays, ou entre villes dans certains cas, mènent à une aliénation des acteurs de leur propre culture (après Guillermo Bonfill, contredisant la définition même de “développement durable”.The religions of African origin have been taken in Brazil, in Cuba and more recently in Venezuela as instruments to increase the inflow of currency, in tourism development programs presented by the authorities as sustainable. But the control exercised on them by the State organizations, with marketing purposes, as well as the rivalries between countries, as well as between cities of the same country in some cases, carry an alienation of the culture (according to Guillermo Bonfill's theory of cultural control, questioning the possibility of a balanced development, that is to say a sustainable development.Las religiones de origen africano han sido tomadas en Brasil, en Cuba y más recientemente en Venezuela como instrumento para incrementar la entrada de divisas, en programas de desarrollo del turismo presentados por las autoridades como sostenibles. Pero, tanto el control ejercido sobre ellas por los organismos oficiales, con fines de comercialización, como las rivalidades entre paises, así como en algún caso, entre ciudades de un mismo país, conllevan una enajenación de la cultura (según la teoría del control cultural de Guillermo Bonfill, cuestionando la posibilidad de un desarrollo equilibrado, es decir sostenible.

  12. Influência do tipo e da quantidade de resíduos vegetais associados a herbicidas residuais no desenvolvimento da cultura da soja Influence of the type and amound of crop residues combined with residual herbicides on soybean development

    Directory of Open Access Journals (Sweden)

    Núbia Maria Correia

    2006-01-01

    Full Text Available O objetivo do trabalho foi avaliar, em condições de campo e na região originalmente sob cerrado, os efeitos de resíduos vegetais [sorgo de cobertura (híbrido Cober Exp, milheto forrageiro (var. BN2, capim pé-de-galinha (Eleusine coracana e capim braquiária (Brachiaria brizantha] e duas quantidades de palha (3,0 e 5,5 t ha-1, no primeiro ano do estudo, e 3,5 e 5,8 t ha-1, no segundo, associados a herbicidas residuais (diclosulam a 35 g ha-1 e imazaquin a 140 g ha-1 aplicados em pré-emergência, no desenvolvimento da cultura da soja. Para tal, foi desenvolvido experimento no ano agrícola 2003/2004 e repetido em 2004/2005, na Fazenda Três Marcos, em Uberlândia (MG. No primeiro ano, após a instalação da cultura da soja, plantas de Eleusine coracana tornaram-se as principais infestantes na cobertura de capim pé-de-galinha. Devido à ausência de controle dessa espécie pelos herbicidas testados, a convivência entre ela e a cultura refletiu negativamente nas plantas de soja. O herbicida imazaquin afetou, indiretamente, as plantas de soja, em virtude do seu controle insatisfatório das plantas daninhas. Nas plantas de soja crescidas sobre cobertura de capim braquiária (nos dois anos e de capim pé-de-galinha (no segundo ano observaram-se maior produtividade de grãos, acúmulo de massa e altura de plantas. Os resíduos vegetais de sorgo influenciaram negativamente no desenvolvimento das plantas de soja, nos dois anos. Quanto aos níveis de palha, houve diferença entre eles para milheto forrageiro (no primeiro ano e sorgo (no segundo ano. O menor nível de milheto forrageiro e o maior de sorgo ocasionaram prejuízos às plantas de soja.This work was conducted in the agricultural years 2003/2004 and 2004/2005, at the "Três Marcos" Farm, Uberlândia (MG, Brazil. It was aimed to evaluate the effect of crop residues [coverage sorghum (hybrid Cober Exp, forage millet (var. BN2, finger millet (Eleusine coracana and St. Lucia Grass

  13. Effect of gamma radiation on total antioxidant capacity, total lipid concentration and shelf life of finger millet flour

    International Nuclear Information System (INIS)

    Lathika; Manupriya, B.R.; Shenoy, K.B.; Patil, S.L.; Somashekarappa, H.M.

    2016-01-01

    The present study is an attempt to study the impact of gamma radiation on the shelf life, total antioxidant capacity and total lipid concentration of finger millet (Eleusine coracana L.) flour. Finger millet flour was procured from market. Flour samples of 50 g were taken in triplicates in a polyethylene pouch, air sealed and subjected to gamma irradiation doses ranging from 0.25 to 10 kGy and stored in polyethylene bags and plastic containers for a period of 1 year. Within 24 hours of irradiation, the samples were tested for moisture (2 ± 0.2%), total antioxidant capacity (0.12 ± 0.010 mg) and lipid concentration (15 ± 0.4 mg)

  14. Impact of mine waste dumps on growth and biomass of economically important crops.

    Science.gov (United States)

    Mathiyazhagan, Narayanan; Natarajan, Devarajan

    2012-11-01

    The present study aimed to investigate the effect of magnesite and bauxite waste dumps on growth and biochemical parameters of some edible and economically important plants such as Vigna radiata, V. mungo, V. unguiculata, Eleusine coracana, Cajanus cajan, Pennisetum glaucum, Macrotyloma uniflorum, Oryza sativa, Sorghum bicolour, Sesamum indicum, Ricinus communis, Brassica juncea, Gossypium hirsutum and Jatropha curcas. The growth rate of all the crops was observed in the range of 75 to 100% in magnesite and 15 to 100% in bauxite mine soil. The moisture content of roots and shoots of all the crops were in the range of 24 to 77, 20 to 88% and 42 to 87, 59 to 88% respectively. The height of the crops was in the range of 2.6 to 48 cm in magnesite soil and 3 to 33 cm in bauxite soil. Thus the study shows that both mine soils reflects some physical and biomolecule impact on selected crops.

  15. Espécies vegetais para cobertura do solo: influência sobre plantas daninhas e a produtividade do algodoeiro em sistema plantio direto

    Directory of Open Access Journals (Sweden)

    Alexandre Cunha de Barcellos Ferreira

    2010-12-01

    Full Text Available Este trabalho objetivou avaliar a produção, a persistência e os efeitos de coberturas vegetais sobre as plantas daninhas e a produtividade do algodoeiro em sistema plantio direto. Os tratamentos consistiram das espécies de cobertura: milheto (Pennisetum glaucum (L. R. Brown, Brachiaria ruziziensis Germain & Evrard, sorgo forrageiro (Sorghum bicolor L. Moench, capim-pé-de-galinha (Eleusine coracana L. Gaerth, Crotalaria juncea L., Crotalaria spectabilis Roth, aveia-preta (Avena strigosa Schreb., nabo forrageiro (Raphanus sativus L., P. glaucum + C. juncea, P. glaucum + C. spectabilis, B. ruziziensis + C. juncea, B. ruziziensis + C. spectabilis, S. bicolor + C. juncea, S. bicolor + C. spectabilis, E. coracana + C. juncea, E. coracana + C. spectabilis, A. strigosa + R. sativus, P. glaucum + R. sativus e pousio. As espécies foram semeadas no final do verão, após a colheita de soja, e o algodoeiro BRS 269-Buriti, nove meses após. O delineamento experimental foi em blocos ao acaso, com quatro repetições. As espécies B. ruziziensis, B. ruziziensis + C. juncea, B. ruziziensis + C. spectabilis e P. glaucum + R. sativus produziram mais de 6,8 t ha-1 de biomassa seca. A palhada produzida pela B. ruziziensis garantiu boa cobertura do solo durante o ciclo do algodoeiro. A biomassa seca de B. ruziziensis, B. ruziziensis + C. juncea e B. ruziziensis + C. spectabilis reduziu a infestação de plantas daninhas até a época de semeadura do algodão e durante os estádios iniciais de seu desenvolvimento. Palhas de R. sativus e A. strigosa, solteiras e consorciadas, interferiram negativamente na produtividade do algodoeiro.

  16. USSR Report, International Affairs, Peoples of Asia and Africa,No 6, November-December 1986.

    Science.gov (United States)

    1987-05-05

    people, for whom the active process of political socialization began as early as after the winning of independence. Insofar as their consciousness...uncovered allowed the author to describe the process of political socialization of these groups of African youth as "the beginning of a transition

  17. El estigma africano en los mundos hispano-atlánticos (Siglos XIV al XIX

    Directory of Open Access Journals (Sweden)

    Alejandro E. Gómez

    2005-12-01

    Full Text Available The present article studies an ethno-social prejudice that people of European ancestry (both Whites and Mulattoes developed towards black slaves and their descendants in the Hispanic Worlds from late 15th century. To analyze this phenomenon, we have gathered many manifestations that reflected its existence at both sides of the Atlantic, so we can distinguish its ideological and mental characteristics as we aim to determine its extension and the socio-cultural consequences it had on the communities it appeared.

  18. Migrantes africanos en Buenos Aires: Entre estigmatización y exotización

    Directory of Open Access Journals (Sweden)

    Régis Minvielle

    2015-03-01

    Full Text Available African Migrants in Buenos Aires: between Stigma and Exoticization Abstract Since the 1990s decade, but especially since 2000, immigrants coming mostly from West Africa, have gradually weaved the contours of a transatlantic south-south migration device between Africa and Latin America. In Buenos Aires they trade on the streets. This activity was initiated mainly by the Senegalese community.This article aims to expose the stereotypes and the relationships between the Argentine society and the African migrants in order to observe the reception of an unknown population in that part of the continent. To do this research, the ethnographic method and discourse analysis were used. The recent nature of the African migration to Argentina generates clichés and prejudices but the desire for exoticism also gives rise to fascination.

  19. Gibraltar, identidad de un colectivo de origen africano en el Zulia (1820-1840

    Directory of Open Access Journals (Sweden)

    Marisol Rodríguez Arrieta

    2000-01-01

    Full Text Available Gibraltar durante el siglo XIX fue el espacio atípico de la región zuliana. La forma de actuar y de resolver sus problemas al parecer responde al trato dado por las autoridades españolas y crio- llas durante dos siglos de historia esclavista; se constituyó en uno de los puertos más importantes y necesarios para pasar los productos que salían de Maracaibo y los que ésta recibía de Mérida y Tru- jillo. Su localización geográfica privilegiada fue el principal elemento que contribuyó a la creación de su identidad local, el apego a su espacio y las ventajas que este les ofreció permitió en el tiempo crear una micro-región con áreas productivas de gran provecho para los espacios ubicados en sus al - rededores. La defensa de su modo de vida, condujo al colectivo a enfrentarse con el centro de poder provincial; situación que hacía complejo el ejercicio del poder en la capital de la provincia ante la diversidad de demandas y formas de oposición. Las peculiaridades de su proceso histórico: pobla- ción no esclava logró en un período de larga duración definirse como un grupo social con sus pro- pios mecanismos y normativas de defensa y ataque.

  20. África y sus mujeres. Reflexiones sobre el feminismo poscolonial africano

    Directory of Open Access Journals (Sweden)

    Eugenia Arduino

    2016-12-01

    Full Text Available European colonization of the African continent affected, among other things, the status of gender in general and to women in particular. In the postcolonial time, they need to overcome the schemes lived under that regime, and to propose a methodological differentiation over the diversity of situations: ethnicity, culture, worldview, historicity and agency, in addition to the usual, class and gender there had occurred. So they were sketched lines of thought and action that allowed understand how African were subjected to three oppressions: gender, ethnicity and socio-economic-cultural subordination. From this position, the black feminism tried to deconstruct the subject of Eurocentric masculinist discourse and empower women for local appreciation

  1. REPRESENTACIONES DE LOS AFRICANOS Y SUS DESCENDIENTES EN LA OBRA DE TOMÁS CARRASQUILLA

    OpenAIRE

    Moreno Tovar, Lina Del Mar

    2012-01-01

    Parte de las preguntas que inspiraron esta tesis surgieron hace un par de años en San Andrés, una pequeña isla colombiana de apenas 26 km 2 ubicada en el mar Caribe a 190 km de la costa nicaragüense y 755 km de Cartagena, la ciudad colombiana más cercana. Junto con las islas de Providencia y Santa Catalina, San Andrés hace parte del único departamento insular colombiano, así como el que presenta mayores contrastes culturales respecto de la Colombia continental, no sólo andina o...

  2. Finger millet (Eleucine coracana) flour as a vehicle for fortification with zinc.

    Science.gov (United States)

    Tripathi, Bhumika; Platel, Kalpana

    2010-01-01

    Millets, being less expensive compared to cereals and the staple for the poorer sections of population, could be the choice for fortification with micronutrients such as zinc. In view of this, finger millet, widely grown and commonly consumed in southern India, was explored as a vehicle for fortification with zinc in this investigation. Finger millet flour fortified with either zinc oxide or zinc stearate so as to provide 50mg zinc per kg flour, was specifically examined for the bioaccessibility of the fortified mineral, as measured by in vitro simulated gastrointestinal digestion procedure and storage stability. Addition of the zinc salts increased the bioaccessible zinc content by 1.5-3 times that of the unfortified flour. Inclusion of EDTA along with the fortified salt significantly enhanced the bioaccessibility of zinc from the fortified flours, the increase being three-fold. Inclusion of citric acid along with the zinc salt and EDTA during fortification did not have any additional beneficial effect on zinc bioaccessiblity. Moisture and free fatty acid contents of the stored fortified flours indicated the keeping quality of the same, up to 60 days. Both zinc oxide and zinc stearate were equally effective as fortificants, when used in combination with EDTA as a co-fortificant. The preparation of either roti or dumpling from the fortified flours stored up to 60 days did not result in any significant compromise in the bioaccessible zinc content. Thus, the present study has revealed that finger millet flour can effectively be used as a vehicle for zinc fortification to derive additional amounts of bioaccessible zinc, with reasonably good storage stability, to combat zinc deficiency. Copyright 2009 Elsevier GmbH. All rights reserved.

  3. Produção de biomassa por cultivos de cobertura do solo e produtividade do algodoeiro em plantio direto Cover crops biomass production and cotton yield in no-tillage system

    Directory of Open Access Journals (Sweden)

    Alexandre Cunha de Barcellos Ferreira

    2010-06-01

    Full Text Available O objetivo deste trabalho foi avaliar a produção, a persistência da matéria seca e a eficiência da dessecação em espécies vegetais utilizadas para cultivos de cobertura do solo, e quantificar seus efeitos sobre a produtividade do algodoeiro em plantio direto. O trabalho foi realizado em Santa Helena de Goiás, GO, com 16 tratamentos: Panicum maximum, cultivares Mombaça, Tanzânia e Massai; Urochloa brizantha, cultivares Piatã, Xaraés, Marandu e MG4; U. decumbens; Paspalum atratum cv. Pojuca; Sorghum bicolor cultivares Santa Eliza e BRS 700; Pennisetum glaucum cv. ADR 500; Raphanus sativus; Eleusine coracana, Crotalaria spectabilis, além da testemunha em pousio. As espécies foram semeadas no início de março (2007. As espécies com menores produtividades e persistência da matéria seca foram C. spectabilis, E. coracana e R. sativus. As produtividades de algodão em caroço e fibra foram maiores no cultivo sobre palhas residuais das cultivares Tanzânia e Mombaça de P. maximum, em comparação às observadas com uso de P. atratum cv. Pojuca, R. sativus e pousio. Em geral, S. bicolor, P. glaucum e as cultivares Tanzânia e Mombaça de P. maximum, e MG4, Piatã e Xaraés de U. brizantha apresentam produção e persistência da matéria seca adequadas para o cultivo do algodoeiro no sistema de plantio direto, no cerrado brasileiro.The objectives of this work were to evaluate biomass production and persistence and the desiccation efficiency in plant species used as cover crops, and to quantify its effects on cotton yield in a no-tillage system. The study was carried out in Santa Helena de Goiás, GO, Brazil, using 16 plant species: Panicum maximum, cultivars Mombaça, Tanzânia and Massai; Urochloa brizantha, cultivars Piatã, Xaraés, Marandu and MG4; U. decumbens; Paspalum atratum cv. Pojuca; Sorghum bicolor cultivars Santa Eliza and BRS 700; Pennisetum glaucum cv. ADR 500; Raphanus sativus; Eleusine coracana, Crotalaria spectabilis

  4. Envelhecimento de resíduos vegetais sobre o solo e os reflexos na eficácia de herbicidas aplicados em pré-emergência Crop residues aging on soil and their effects on pre-emergence herbicides

    Directory of Open Access Journals (Sweden)

    Núbia Maria Correia

    2007-01-01

    Full Text Available Com o objetivo de avaliar os efeitos do envelhecimento dos resíduos vegetais de diferentes espécies [sorgo de cobertura (Sorghum bicolor x S. sudanensis 'Cober Exp', milheto forrageiro (Pennisetum americanum 'BN2', capim-pé-de-galinha (Eleusine coracana e capim-braquiária (Brachiaria brizantha], no controle de Ipomoea grandifolia, pelos herbicidas diclosulam e imazaquin, aplicados em pré-emergência, foi desenvolvido experimento em casa de vegetação, no período de agosto a dezembro de 2004. Foram realizadas determinações químicas nos materiais vegetais em decomposição. A eficácia do herbicida diclosulam não foi afetada pelo envelhecimento da palha de nenhuma das coberturas estudadas. Pelo contrário, a associação desse herbicida a qualquer dos resíduos vegetais estudados, principalmente o de capim-braquiária, favoreceu o controle da planta daninha. O imazaquin teve o potencial de controle influenciado pelas coberturas de milheto forrageiro e capim-braquiária, aos 90 dias após a deposição dos resíduos vegetais sobre o solo. Tal comportamento pode ser atribuído ao enriquecimento de celulose e lignina nos materiais vegetais de milheto forrageiro e capim braquiária.An experiment was conducted from August to December 2004 under greenhouse conditions to evaluate the effects of aging residues of different plant species [coverage sorghum (Sorghum bicolor x S. sudanensis 'Cober Exp', forage millet (Pennisetum americanum 'BN2', finger millet (Eleusine coracana and St. Lucia Grass (Brachiaria brizantha], on the control of Ipomoea grandifolia using the pre-emergence herbicides diclosulam and imazaquin. Crop residues were subjected to chemical analyses. The efficiency of diclosulam was not affected by any of the residues. On the other hand, in association with residues of any of the species, but especially with St. Lucia Grass, this herbicide showed increased weed control efficiency. The control potential of imazaquin was influenced

  5. Influência do tipo e da quantidade de resíduos vegetais na emergência de plantas daninhas Influence of type and amount of crop residues on weed emergence

    Directory of Open Access Journals (Sweden)

    N.M. Correia

    2006-06-01

    Full Text Available Com o objetivo de avaliar os efeitos da semeadura no outono/inverno de diferentes espécies: sorgo de cobertura (Sorghum bicolor x Sorghum sudanense 'híbrido Cober Exp', milheto forrageiro (Pennisetum americanum 'var. BN2', capim-pé-de-galinha (Eleusine coracana e braquiária (Brachiaria brizantha para formação de palha (nas quantidades de 3,0 e 5,5 t ha¹, na emergência de plantas daninhas, foi conduzido experimento no ano agrícola 2003/04, na fazenda Três Marcos, em Uberlândia, MG. Foi mantida uma testemunha como tratamento adicional, sem cobertura com restos vegetais. A composição específica e as densidades populacionais das comunidades infestantes foram influenciadas pelos sistemas de produção de cobertura morta. A emergência das plantas daninhas foi menor nas coberturas de sorgo e braquiária e nos maiores níveis de palha. O número de plântulas emergidas de Bidens pilosa, Amaranthus spp., Commelina benghalensis, Leucas martinicensis e gramíneas foi inibido pelas coberturas, enquanto para Chamaesyce spp. os resíduos contribuíram para incremento na sua emergência.To evaluate the effects on weed emergence of autumn/winter sowing of different species [sorghum (Sorghum bicolor x Sorghum sudanense 'Cober Exp hybrid', forage millet (Pennisetum americanum 'var. BN2', finger millet (Eleusine coracana and St Lucia grass (Brachiaria brizantha, for mulch formation (at rates of 3.0 and 5.5 t ha-1, an experiment was carried out in the agricultural year 2003/2004, in Uberlândia, Minas Gerais, Brazil. The specific composition and population densities of the infesting community were influenced by the mulch production systems. Weed emergence was minor under sorghum and Sta Lucia grass cover and in greater amounts of straw. Straw cover inhibited the emergence of seedlings of Bidens pilosa, Amaranthus spp., Commelina benghalensis, Leucas martinicensis and grasses and stimulated the emergence of Chamaesyce spp.

  6. Avaliação de marcadores moleculares associados à qualidade da carne de bovinos Simental Sul Africano x Nelore

    OpenAIRE

    Roberta Doriguello Fonseca

    2016-01-01

    No Brasil, a perspectiva de aumento do volume de exportações e a exigência dos diferentes mercados faz com que a adaptação da cadeia produtiva da carne seja necessária, assim como a mudança de conceitos e critérios de seleção dos animais, de forma a melhorar as características consideradas pelo consumidor como de primeira importância: aparência e a palatabilidade. Porém existem diversos fatores que podem influenciar na qualidade da carne: sexo, raça (genética), idade, nutrição e estresse dura...

  7. As "Ticas" de "Matema" de UmPovo Africano: Umexercício para sala de aula Brasileira.

    Directory of Open Access Journals (Sweden)

    Eliane Costa Santos

    2008-01-01

    Full Text Available This article has as its central focus the examination of one of the ways that African culture can be introduced into the mathematics classroom, contributing to the transformation of this formal space of the classroom into an area in which culture is intertwined with scholarly knowledge through the transdisciplinarity of ethnomathematics. The thesis that permeates [this work] can be delineated as how African culture, through the representation of African Kente cloth looms, can contribute to the processes of teaching and learning in a mathematics classroom. The wefts are the theoretical references of Stuart Hall on culture and multiculturalism; D'Ambrosio on transdisciplinarity and ethnomathematics; Dennis on Kente cloth; and the weavers of Ghana on the technologies of Kente cloth. To find a general understanding, we locate Ghana on the African Continent, we quote the myths of the Kente looms, and finally, we present a proposal on how to create a transcultural connection between the knowledge of African culture and a mathematics classroom in Brazil.

  8. Posibilidades abiertas por las nuevas tecnologías en el desarrollo de los cines africanos contemporáneos

    Directory of Open Access Journals (Sweden)

    Beatriz Leal Riesco

    2012-05-01

    Full Text Available From its beginnings with the wave of independence that swept the continent in the middle of the previous century, African cinema has remained subordinate to and dependent upon Western aid. Barring a few prominent exceptions, the effects of this phenomenon have been visible, with films made catering to the tastes of occidental critics and cinephiles while African viewers have been left thirsting for images and sounds of an autochthonous character. Since the 1990’s, thanks to new technologies, African cinema has achieved a previously inconceivable vitality and autonomy. The democratizing effects of the reduction in the cost of production, distribution, and exhibition, as well as the easier accessibility of new technologies to non-professionals, has made of Africa a creative flashpoint, where myriad voices work to create a nuanced and polyphonic imaginary leagues beyond those prejudices and stereotypes of occidental provenance that have overshadowed this continent’s cinematography for more than five decades.

  9. Niños y niñas esclavos de origen africano en la capital novohispana (siglo xvii)

    OpenAIRE

    León, Cristina V Masferrer

    2013-01-01

    Sin niños, está uno como desnudo. Proverbio yoruba Durante mucho tiempo las poblaciones africanas y afrodescendientes de México fueron olvidadas de la memoria histórica, de la identidad nacional y de las ciencias sociales. Sin embargo, desde hace varias décadas se realizan investigaciones que favorecen el desarrollo del conocimiento de estos grupos no sólo a lo largo de la historia, sino en la actualidad. Los temas que se han abordado son diversos y se ha buscado dar cuenta tanto de los hombr...

  10. El internacionalismo, la solidaridad y el interés mutuo: encuentros entre cubanos, africanos, y alemanes de la RDA

    Directory of Open Access Journals (Sweden)

    Berthold Unfried

    Full Text Available Resumen La asistencia militar cubana en Angola y Etiopía es muy conocida en el ámbito internacional. Sin embargo, la historia de la asistencia civil aún no ha sido escrita en toda su magnitud. Esta contribución esboza una comparación entre el "internacionalismo" cubano y el sector de la "solidaridad" o "ayuda socialista" de la República Democrática Alemana (RDA. ¿Qué significaron y cuáles fueron las terminologías y prácticas correspondientes de los alemanes? ¿Qué tipos de internacionalismo y solidaridad de práctica pueden identificarse? ¿Cómo fueron las relaciones entre cubanos y alemanes con sus contrapartes etíopes y angolanos y con el pueblo de esos países y qué se transfirió en ese encuentro triangular? La contribución se basa en material de los archivos cubanos y alemanes, así como en entrevistas.

  11. Entre champeta y sonidos africanos: fronteras difusas y discusiones sobre “músicas negras” en el Caribe Colombiano

    Directory of Open Access Journals (Sweden)

    Jorge Enrique Giraldo Barbosa

    2014-01-01

    Full Text Available Este texto apunta a una reflexión en relación con la s música s champeta y africana, entendida s las dos como “músicas negras”, alrededor de sus representaciones de africanidad y culturalmente racializadas hacia lo “negro”. Músicas u rbanas que enfrentan dispositivos discriminatorios, prohibitorios, de negación o invisivilización social, a sí como para dojas en sus lógicas de representación en que son asumidas por las tendencias de estudio que las abordan. Se pueden organizar tres tendencias de estudio: 1 corriente afrocentrista y cartagenista, 2 perspectiva alternativa en lo cult ural y territorial, 3 economía c ultural y de circulación mus ical .

  12. Los "Flamines Annui" del Norte africano. Notas sobre la duración del sacerdocio municipal del culto al emperador.

    Directory of Open Access Journals (Sweden)

    Rosa María CID LÓPEZ

    2010-02-01

    Full Text Available RESUMEN: La aparición en los documentos epigráficos de expresiones como flamen annuus o anno flamonii sui, sirvió para que determinados autores defendieran la tesis de que el flaminado de las comunidades romanas provinciales tenía una duración anual . No obstante, el hecho de que en numerosas inscripciones figuren flamines perpetui originó discrepancias entre los especialistas sobre el carácter temporal o vitalicio de este sacerdocio, hasta el punto de que en un libro de reciente aparición, este tema sigue considerándose «un problema aún no resuelto». El período que un sacerdote del culto imperial permanecía ejerciendo sus funciones ofrece un cierto interés, dado que ello puede relacionarse con otro tipo de cuestiones sociales y/o económicas. De ser cierta la anualidad del flaminado, sería preciso que en cada comunidad romana hubiese un amplio grupo de familias con recursos disponibles para hacer frente a los gastos que ocasionaba el acceso a este sacerdocio. A primera vista, no parece que las coloniae y municipia del territorio imperial, salvo casos excepcionales, estuviesen en condiciones de contar con una gran número de personajes adinerados, y que, rotativamente, se encargasen de dirigir los asuntos políticos y religiosos de sus respectivas ciudades.

  13. A Review of Nutrient Management Studies Involving Finger Millet in the Semi-Arid Tropics of Asia and Africa

    Directory of Open Access Journals (Sweden)

    Malinda S. Thilakarathna

    2015-06-01

    Full Text Available Finger millet (Eleusine coracana (L. Gaertn is a staple food crop grown by subsistence farmers in the semi-arid tropics of South Asia and Africa. It remains highly valued by traditional farmers as it is nutritious, drought tolerant, short duration, and requires low inputs. Its continued propagation may help vulnerable farmers mitigate climate change. Unfortunately, the land area cultivated with this crop has decreased, displaced by maize and rice. Reversing this trend will involve achieving higher yields, including through improvements in crop nutrition. The objective of this paper is to comprehensively review the literature concerning yield responses of finger millet to inorganic fertilizers (macronutrients and micronutrients, farmyard manure (FYM, green manures, organic by-products, and biofertilizers. The review also describes the impact of these inputs on soils, as well as the impact of diverse cropping systems and finger millet varieties, on nutrient responses. The review critically evaluates the benefits and challenges associated with integrated nutrient management, appreciating that most finger millet farmers are economically poor and primarily use farmyard manure. We conclude by identifying research gaps related to nutrient management in finger millet, and provide recommendations to increase the yield and sustainability of this crop as a guide for subsistence farmers.

  14. Genetic diversity and genomic resources available for the small millet crops to accelerate a New Green Revolution.

    Science.gov (United States)

    Goron, Travis L; Raizada, Manish N

    2015-01-01

    Small millets are nutrient-rich food sources traditionally grown and consumed by subsistence farmers in Asia and Africa. They include finger millet (Eleusine coracana), foxtail millet (Setaria italica), kodo millet (Paspalum scrobiculatum), proso millet (Panicum miliaceum), barnyard millet (Echinochloa spp.), and little millet (Panicum sumatrense). Local farmers value the small millets for their nutritional and health benefits, tolerance to extreme stress including drought, and ability to grow under low nutrient input conditions, ideal in an era of climate change and steadily depleting natural resources. Little scientific attention has been paid to these crops, hence they have been termed "orphan cereals." Despite this challenge, an advantageous quality of the small millets is that they continue to be grown in remote regions of the world which has preserved their biodiversity, providing breeders with unique alleles for crop improvement. The purpose of this review, first, is to highlight the diverse traits of each small millet species that are valued by farmers and consumers which hold potential for selection, improvement or mechanistic study. For each species, the germplasm, genetic and genomic resources available will then be described as potential tools to exploit this biodiversity. The review will conclude with noting current trends and gaps in the literature and make recommendations on how to better preserve and utilize diversity within these species to accelerate a New Green Revolution for subsistence farmers in Asia and Africa.

  15. Evaluation of nutraceutical and antinutritional properties in barnyard and finger millet varieties grown in Himalayan region.

    Science.gov (United States)

    Panwar, Priyankar; Dubey, Ashutosh; Verma, A K

    2016-06-01

    Five elite varieties of barnyard (Echinochloa frumentacea) and finger (Eleusine coracana) growing at northwestern Himalaya were investigated for nutraceutical and antinutritional properties. Barnyard millet contained higher amount of crude fiber, total dietary fiber, tryptophan content, total carotenoids, α-tocopherol compared to the finger millet whereas the finger millet contains higher amount of methionine and ascorbic acid as compared to the barnyard millet. The secondary metabolites of biological functions were analyzed and found that barnyard millet contained the higher amount of polyphenols, tannins and ortho-dihydroxy phenol content compared to finger millet. Among antinutitional compounds barnyard millet contained lower phytic acid content compare to finger millet whereas no significant difference in trypsin inhibition activity of barnyard millet and finger millet varieties were found. Barnyard millet contained higher acid phosphatase, α-galactosidase and α-amylase inhibitor activity compared to finger millet. Finger millet seeds contained about 10-13 folds higher calcium content and double amount of manganese content in comparison to barnyard millet seeds. Present study suggests that barnyard millet varieties studied under present investigation were found nutritionally superior compared to finger millet varieties.

  16. The membrane tethered transcription factor EcbZIP17 from finger millet promotes plant growth and enhances tolerance to abiotic stresses.

    Science.gov (United States)

    Ramakrishna, Chopperla; Singh, Sonam; Raghavendrarao, Sangala; Padaria, Jasdeep C; Mohanty, Sasmita; Sharma, Tilak Raj; Solanke, Amolkumar U

    2018-02-01

    The occurrence of various stresses, as the outcome of global climate change, results in the yield losses of crop plants. Prospecting of genes in stress tolerant plant species may help to protect and improve their agronomic performance. Finger millet (Eleusine coracana L.) is a valuable source of superior genes and alleles for stress tolerance. In this study, we isolated a novel endoplasmic reticulum (ER) membrane tethered bZIP transcription factor from finger millet, EcbZIP17. Transgenic tobacco plants overexpressing this gene showed better vegetative growth and seed yield compared with wild type (WT) plants under optimal growth conditions and confirmed upregulation of brassinosteroid signalling genes. Under various abiotic stresses, such as 250 mM NaCl, 10% PEG6000, 400 mM mannitol, water withdrawal, and heat stress, the transgenic plants showed higher germination rate, biomass, primary and secondary root formation, and recovery rate, compared with WT plants. The transgenic plants exposed to an ER stress inducer resulted in greater leaf diameter and plant height as well as higher expression of the ER stress-responsive genes BiP, PDIL, and CRT1. Overall, our results indicated that EcbZIP17 improves plant growth at optimal conditions through brassinosteroid signalling and provide tolerance to various environmental stresses via ER signalling pathways.

  17. [cDNA library construction from panicle meristem of finger millet].

    Science.gov (United States)

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  18. Efficiency of green manure species on the population of reniform nematode

    Directory of Open Access Journals (Sweden)

    Cristiane Gonçalves Gardiano

    2014-02-01

    Full Text Available The objective of this study was to evaluate the growing of soil improving crops on the population of Rotylenchulus reniformis in naturally infested soil. It was evaluated the effect of 6 species of plants as cover crops in winter and 13 summer species and a fallow treatment on the nematode population under greenhouse. After 60 days, the root system was collected. Then, a sample of soil was taken in order to extract juveniles from the soil and quantification the final population of the pathogen in each pot for determining of the reproduction factor (RF. Fallow and all winter species of green manure, except hairy vetch, reduced the population of R. reniformis after cultivation in infested soil, in comparison to the control. Regarding summer cover crops, it was observed that sorghum ‘SI03204’ (Sorghum vulgare, millet ‘BRS1501’ (Pennisetum glaucum, Brachiaria ruziziensis, finger millet (Eleusine coracana, estylo ‘Campo Grande’ (Stylosanthes capitata x S. macrocephala, peanut ‘IAC Tatu ST’ (Arachis hypogaea and dwarf velvet bean (Mucuna deeringiana reduced the population of R. reniformis, when compared to the control, could be used in the management of this nematode.

  19. Harnessing Finger Millet to Combat Calcium Deficiency in Humans: Challenges and Prospects.

    Science.gov (United States)

    Puranik, Swati; Kam, Jason; Sahu, Pranav P; Yadav, Rama; Srivastava, Rakesh K; Ojulong, Henry; Yadav, Rattan

    2017-01-01

    Humans require more than 20 mineral elements for healthy body function. Calcium (Ca), one of the essential macromineral, is required in relatively large quantities in the diet for maintaining a sound overall health. Young children, pregnant and nursing women in marginalized and poorest regions of the world, are at highest risk of Ca malnutrition. Elderly population is another group of people most commonly affected by Ca deficiency mainly in the form of osteoporosis and osteopenia. Improved dietary intake of Ca may be the most cost-effective way to meet such deficiencies. Finger millet [ Eleusine coracana (L.) Gaertn.], a crop with inherently higher Ca content in its grain, is an excellent candidate for understanding genetic mechanisms associated with Ca accumulation in grain crops. Such knowledge will also contribute toward increasing Ca contents in other staple crops consumed on daily basis using plant-breeding (also known as biofortification) methods. However, developing Ca-biofortified finger millet to reach nutritional acceptability faces various challenges. These include identifying and translating the high grain Ca content to an adequately bioavailable form so as to have a positive impact on Ca malnutrition. In this review, we assess some recent advancements and challenges for enrichment of its Ca value and present possible inter-disciplinary prospects for advancing the actual impact of Ca-biofortified finger millet.

  20. Isolation and expression analysis of EcbZIP17 from different finger millet genotypes shows conserved nature of the gene.

    Science.gov (United States)

    Chopperla, Ramakrishna; Singh, Sonam; Mohanty, Sasmita; Reddy, Nanja; Padaria, Jasdeep C; Solanke, Amolkumar U

    2017-10-01

    Basic leucine zipper (bZIP) transcription factors comprise one of the largest gene families in plants. They play a key role in almost every aspect of plant growth and development and also in biotic and abiotic stress tolerance. In this study, we report isolation and characterization of EcbZIP17 , a group B bZIP transcription factor from a climate smart cereal, finger millet ( Eleusine coracana L.). The genomic sequence of EcbZIP17 is 2662 bp long encompassing two exons and one intron with ORF of 1722 bp and peptide length of 573 aa. This gene is homologous to AtbZIP17 ( Arabidopsis ), ZmbZIP17 (maize) and OsbZIP60 (rice) which play a key role in endoplasmic reticulum (ER) stress pathway. In silico analysis confirmed the presence of basic leucine zipper (bZIP) and transmembrane (TM) domains in the EcbZIP17 protein. Allele mining of this gene in 16 different genotypes by Sanger sequencing revealed no variation in nucleotide sequence, including the 618 bp long intron. Expression analysis of EcbZIP17 under heat stress exhibited similar pattern of expression in all the genotypes across time intervals with highest upregulation after 4 h. The present study established the conserved nature of EcbZIP17 at nucleotide and expression level.

  1. Harnessing Finger Millet to Combat Calcium Deficiency in Humans: Challenges and Prospects

    Directory of Open Access Journals (Sweden)

    Swati Puranik

    2017-07-01

    Full Text Available Humans require more than 20 mineral elements for healthy body function. Calcium (Ca, one of the essential macromineral, is required in relatively large quantities in the diet for maintaining a sound overall health. Young children, pregnant and nursing women in marginalized and poorest regions of the world, are at highest risk of Ca malnutrition. Elderly population is another group of people most commonly affected by Ca deficiency mainly in the form of osteoporosis and osteopenia. Improved dietary intake of Ca may be the most cost-effective way to meet such deficiencies. Finger millet [Eleusine coracana (L. Gaertn.], a crop with inherently higher Ca content in its grain, is an excellent candidate for understanding genetic mechanisms associated with Ca accumulation in grain crops. Such knowledge will also contribute toward increasing Ca contents in other staple crops consumed on daily basis using plant-breeding (also known as biofortification methods. However, developing Ca-biofortified finger millet to reach nutritional acceptability faces various challenges. These include identifying and translating the high grain Ca content to an adequately bioavailable form so as to have a positive impact on Ca malnutrition. In this review, we assess some recent advancements and challenges for enrichment of its Ca value and present possible inter-disciplinary prospects for advancing the actual impact of Ca-biofortified finger millet.

  2. Malting process optimization for protein digestibility enhancement in finger millet grain.

    Science.gov (United States)

    Hejazi, Sara Najdi; Orsat, Valérie

    2016-04-01

    Finger millet (Eleusine coracana) is a nutritious, gluten-free, and drought resistant cereal containing high amounts of protein, carbohydrate, and minerals. However, bio-availability of these nutrients is restricted due to the presence of an excessive level of anti-nutrient components, mainly phytic acid, tannin, and oxalate. It has been shown that a well-designed malting/germination process can significantly reduce these anti-nutrients and consequently enhance the nutrient availability. In the present study, the effects of two important germination factors, duration and temperature, on the enhancement of in-vitro protein digestibility of finger millet were thoroughly investigated and optimized. Based on a central composite design, the grains were germinated for 24, 36, and 48 h at 22, 26, and 30 °C. For all factor combinations, protein, peptide, phytic acid, tannin, and oxalate contents were evaluated and digestibility was assessed. It was shown that during the malting/germinating process, both temperature and duration factors significantly influenced the investigated quantities. Germination of finger millet for 48 h at 30 °C increased protein digestibility from 74 % (for native grain) up to 91 %. Besides, it notably decreased phytic acid, tannin, and oxalate contents by 45 %, 46 %, and 29 %, respectively. Linear correlations between protein digestibility and these anti-nutrients were observed.

  3. Multiple hybrid de novo genome assembly of finger millet, an orphan allotetraploid crop.

    Science.gov (United States)

    Hatakeyama, Masaomi; Aluri, Sirisha; Balachadran, Mathi Thumilan; Sivarajan, Sajeevan Radha; Patrignani, Andrea; Grüter, Simon; Poveda, Lucy; Shimizu-Inatsugi, Rie; Baeten, John; Francoijs, Kees-Jan; Nataraja, Karaba N; Reddy, Yellodu A Nanja; Phadnis, Shamprasad; Ravikumar, Ramapura L; Schlapbach, Ralph; Sreeman, Sheshshayee M; Shimizu, Kentaro K

    2017-09-05

    Finger millet (Eleusine coracana (L.) Gaertn) is an important crop for food security because of its tolerance to drought, which is expected to be exacerbated by global climate changes. Nevertheless, it is often classified as an orphan/underutilized crop because of the paucity of scientific attention. Among several small millets, finger millet is considered as an excellent source of essential nutrient elements, such as iron and zinc; hence, it has potential as an alternate coarse cereal. However, high-quality genome sequence data of finger millet are currently not available. One of the major problems encountered in the genome assembly of this species was its polyploidy, which hampers genome assembly compared with a diploid genome. To overcome this problem, we sequenced its genome using diverse technologies with sufficient coverage and assembled it via a novel multiple hybrid assembly workflow that combines next-generation with single-molecule sequencing, followed by whole-genome optical mapping using the Bionano Irys® system. The total number of scaffolds was 1,897 with an N50 length >2.6 Mb and detection of 96% of the universal single-copy orthologs. The majority of the homeologs were assembled separately. This indicates that the proposed workflow is applicable to the assembly of other allotetraploid genomes. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  4. Antioxidant properties of digestive enzyme-treated fibre-rich fractions from wheat, finger millet, pearl millet and sorghum: A comparative evaluation

    Directory of Open Access Journals (Sweden)

    Aisha Siddiq A.

    2015-12-01

    Full Text Available Whole grains are rich in antioxidant components (AC, most of which are bound to fibre fraction and released during digestion. The study investigated the effect of digestive enzymes on the antioxidant properties of fibre-rich fractions from wheat (Triticum aestivum, finger millet (Eleusine coracana, pearl millet (Pennisetum typhoides and sorghum (Sorghum bicolor. Coarse (CF and fine fractions (FF of milled flour were separated using a standard sieve and analysed for nutritional composition, AC extractable in different solvents and antioxidant activity (AA in untreated and enzyme-treated fractions. The CF had a higher range of insoluble dietary fibre (17.26–20.93% than FF (10.65–17.29%. The highest amount of polyphenols and flavonoids was extractable in different solvents from finger millet and pearl millet, respectively. FF of pearl millet showed higher total AA in all solvents. Enzyme-treated samples had a much higher content of AC as well as higher total AA. Free radical scavenging assay revealed that enzyme-treated millet flours had higher activity in comparison to wheat. Between fractions, wheat exhibited variable results. Among millets, CF of finger millet and FF of pearl millet and sorghum had higher AA. In conclusion, digestive enzyme treatment released more AC from grains, and exhibited a higher AA.

  5. Fusarium verticillioides from finger millet in Uganda.

    Science.gov (United States)

    Saleh, Amgad A; Esele, J P; Logrieco, Antonio; Ritieni, Alberto; Leslie, John F

    2012-01-01

    Finger millet (Eleusine coracana) is a subsistence crop grown in Sub-Saharan Africa and the Indian Sub-continent. Fusarium species occurring on this crop have not been reported. Approximately 13% of the Fusarium isolates recovered from finger millet growing at three different locations in eastern Uganda belong to Fusarium verticillioides, and could produce up to 18,600 µg/g of total fumonisins when cultured under laboratory conditions. These strains are all genetically unique, based on AFLP analyses, and form fertile perithecia when crossed with the standard mating type tester strains for this species. All but one of the strains is female-fertile and mating-type segregates 13:20 Mat-1:Mat-2. Three new sequences of the gene encoding translation elongation factor 1-α were found within the population. These results indicate a potential health risk for infants who consume finger millet gruel as a weaning food, and are consistent with the hypothesis that F. verticillioides originated in Africa and not in the Americas, despite its widespread association with maize grown almost anywhere worldwide.

  6. Genetic diversity and genomic resources available for the small millet crops to accelerate a New Green Revolution

    Directory of Open Access Journals (Sweden)

    Travis Luc Goron

    2015-03-01

    Full Text Available Small millets are nutrient-rich food sources traditionally grown and consumed by subsistence farmers in Asia and Africa. They include finger millet (Eleusine coracana, foxtail millet (Setaria italica, kodo millet (Paspalum scrobiculatum, proso millet (Panicum miliaceum, barnyard millet (Echinochloa spp., and little millet (Panicum sumatrense. Local farmers value the small millets for their nutritional and health, tolerance to extreme stress including drought, and ability to grow under low nutrient input conditions, ideal in an era of climate change and steadily depleting natural resources. Little scientific attention has been paid to these crops, hence they have been termed orphan cereals. Despite this challenge, an advantageous quality of the small millets is that they continue to be grown in remote regions of the world which has preserved their biodiversity, providing breeders with unique alleles for crop improvement. The purpose of this review, first, is to highlight the diverse traits of each small millet species that are valued by farmers and consumers (e.g. nutritional quality which hold potential for selection, improvement or mechanistic study. For each species, the germplasm, genetic and genomic resources available will then be described as potential tools to exploit this biodiversity. The review will conclude with noting current trends and gaps in the literature and make recommendations on how to better preserve and utilize diversity within these species to accelerate a New Green Revolution for subsistence farmers in Asia and Africa.

  7. Agricultural activities of the malayali tribal for subsistence and economic needs in the mid elevation forest of pachamalai hills, eastern ghats, Tamil nadu

    Directory of Open Access Journals (Sweden)

    V. Anburaja

    2012-06-01

    Full Text Available This paper is aimed to study the Agricultural activities of the Malayali Tribal for Subsistence and Economic needs in the mid elevation forest of Pachamalai Hills, Eastern Ghats, Tamil nadu. About 8 percent of the Indian population belongs to a category listed as “Scheduled Tribes” enumerated in the Schedule to Article 342 of the Constitution of India. Tribal people has been seen to be strongly associated with the forests, hills and remote areas, practicing a unique life style, having a unique set of cultural and religious beliefs. For millennia, tribal communities have lived in forests and survived on hunting and gathering. However, with growing population and resource pressure, it is now witnessing that a rise in livelihoods based on settled farming. In the study area, cereals are the major crop cultivated for their edible grains. The tribal people living in the hills tops of the study area were cultivated 11 major agricultural crops. They are, Eleusine coracana, Panicum miliare, Oryza sativa (verity I (Mara Nellu, Oryza sativa (verity II, Manihot esculenta, Macrotyloma uniflorum, Vigna mungo, Sesamum orientale, Paspalum sp, Pennisetum americanum and Setaria italica. Among them, Paspalum sp gives the maximum yield with 655 kg acre-1.

  8. Population dynamics of caterpillars on three cover crops before sowing cotton in Mato Grosso (Brazil).

    Science.gov (United States)

    Silvie, P J; Menzel, C A; Mello, A; Coelho, A G

    2010-01-01

    Direct seeding mulch-based cropping systems under a preliminary cover crop such as millet are common in some areas of Brazil. Lepidopteran pests that damage cotton, soybean and maize crops can proliferate on cover crops, so preventive chemical treatments are necessary. Very little data is available on these pests on cover crops. This paper presents the dynamics of Spodoptera frugiperda, S. eridania, Mocis latipes and Diatraea saccharalis caterpillars monitored at Primavera do Leste, Mato Grosso state (Brazil) during the of 2005/2006 and 2006/2007 cropping seasons on four cover crops, i.e. finger millet (Eleusine coracana), pearl millet (Pennisetum glaucum), sorghum (Sorghum bicolor) and ruzigrass (Brachiaria ruziziensis). The pests were visually counted on plants within a 1 m2 transect (wooden frame). Caterpillars were reared to facilitate identification of collected species and parasitoids. Many S. frugiperda caterpillars were observed on millet in 2005, with a maximum of 37 caterpillars/m2. On sorghum, we found 30 caterpillars/m2, or 0.83 caterpillars/plant. The Diatraea borer attacked sorghum later than the other pests. M. latipes was also observed on millet. The millet cover crop had to be dried for at least 1 month before direct drilling the main cotton crop in order to impede S. frugiperda infestations on cotton plantlets, thus avoiding the need for substantial resowing. The comparative methodological aspects are discussed.

  9. Enhanced sensitivity to mutagens - EMS, MH, SM by pre-soaking - A taxometric study based on M{sub 1} parameters in finger millet

    Energy Technology Data Exchange (ETDEWEB)

    Singh, B; Sinha, S.K. [Plant Breeding and Genetics, OUAT, Bhubaneswar (India)], E-mail: sing_baburam@yahoo.co.in

    2008-07-01

    Pre-soaking seeds before treatment enhances sensitivity to many chemical mutagens; but little work has been done with maleic hydrazide (MH), a chromosome breaking agent and preferential inducer of micromutation and streptomycin (SM), a cytoplasmic mutagen. In the present investigation on pre-soaking (PS) effects in finger millet (Eleusine coracana, Gaertn), we included these two mutagens, besides one commonly used mutagen, EMS to determine a common effective PS range usingM{sub 1}seedling traits. Since differentM{sub 1}parameters, mutagens and their doses showed different peaks of response, we adopted a taxometric approach using all characters together. Combinations of chemicals, doses and sixM{sub 1}seedling attributes gave 48 characters for the numerical classification of PS periods (0, 8, 10, 12, 14, 16 and 18 h) as OTUs. Dendrogram from the similarity matrix using UPGMA clustering showed two clusters : (1) Cl. 1 of three OTUs (0, 8 and 10 h PS) and (2) Cl.2 of four OTUs(12-18h PS).We considered 12-18h as effective PS range and 0-10h as ineffective for all kinds of mutagens. The effective range would contain the major peak of sensitivity; the ineffective range might show a small peak. We confirmed these inferences with SM induced albinism as an indicator of plastid mutations. Higher doses shifted the peak within the effective range towards lower PS and low dose towards longer PS. Taxometrics could be usefully adopted in mutagenesis studies. (author)

  10. Evaluation of the nutritional characteristics of a finger millet based complementary food.

    Science.gov (United States)

    Mbithi-Mwikya, Stephen; Van Camp, John; Mamiro, Peter R S; Ooghe, Wilfried; Kolsteren, Patrick; Huyghebaert, Andre

    2002-05-08

    Finger millet (Eleusine coracana), kidney beans (Phaseolus vulgaris), peanuts (Arachis hypogoea), and mango (Mangifera indica) were processed separately and then combined, on the basis of their amino acid scores and energy content, into a complementary food for children of weaning age. The finger millet and kidney beans were processed by germination, autoclaving, and lactic acid fermentation. A mixture containing, on a dry matter basis, 65.2, 19.1, 8.0, and 7.7% of the processed finger millet, kidney beans, peanuts, and mango, respectively, gave a composite protein with an in vitro protein digestibility of 90.2% and an amino acid chemical score of 0.84. This mixture had an energy density of 16.3 kJ.g(-1) of dry matter and a decreased antinutrient content and showed a measurable improvement in the in vitro extractability for calcium, iron, and zinc. A 33% (w/v) pap made from a mix of the processed ingredients had an energy density of 5.4 kJ.g(-1) of pap, which is sufficient to meet the energy requirements of well-nourished children of 6-24 months of age at three servings a day and at the FAO average breast-feeding frequency.

  11. Emergency and growth of cover crops in function of the sowing depth / Emergência e crescimento de plantas de cobertura em função da profundidade de semeadura

    Directory of Open Access Journals (Sweden)

    Fabiano André Petter

    2009-07-01

    Full Text Available The objective of this study was evaluated emergence of four cover crops at different seeding depths, in order to use them intercropped and oversown with annual crops. The experiment was installed in a greenhouse, and it was organized as a 5 × 7 factorial combination, with crop of fve cover crops: Pennisetum glaucum var. ADR 300, ADR 500, and BN2, Eleusine coracana (fnger millet, and a cober crop( hybrid sorghum with sudan-grass [Sorghum bicolor x Sorghum sudanese]; seven cover crops seeding depths: (0 cm without any mulch; 0 cm with a mulch of leaves over the seeds;1; 4; 8; 10; and 15 cm.The cover crops were cropping in vases for 40 days. It was evaluated emergence index, emergence time, plant height, green biomass and dry biomass of the above-ground part, leaf area, root dry biomass and root length density. There was reduction of emergence when cover crops was seeded at zero cm depth with a mulch of leaves, except for the E. coracana, that had a better performance in the oversown. Pearl millets and hybrid S. bicolor x S. sudanense show up some restrictions when used in simultaneous consortium. The 15 cm sowing depth must not be used.O objetivo do trabalho foi avaliar a emergência de cinco plantas de cobertura em diferentes profundidades de semeadura, visando à obtenção de informações que subsidiem sua utilização na consorciação e sobressemeadura de culturas anuais. O experimento foi conduzido em casa-de-vegetação, no delineamento experimental de blocos ao acaso, em esquema fatorial 5 x 7, composto pelas plantas de cobertura Pennisetum glaucum var. ADR 300, ADR 500 e BN2, Eleusine coracana e cober crop [híbrido de sorgo com capim-sudão (Sorghum bicolor x Sorghum sudanense], e por sete profundidades de semeadura das plantas de cobertura (0 cm sem presença de folhas de soja sobre as sementes, 0 com presença de folhas de soja sobre as sementes, 1, 4, 8, 10 e 15 cm. As sementes foram semeadas em vasos e as plantas cultivadas por 40

  12. Effect of different milling methods on glycaemic response of foods made with finger millet (Eucenea coracana) flour.

    Science.gov (United States)

    Jayasinghe, M A; Ekanayake, S; Nugegoda, D B

    2013-12-01

    Compare glycaemic response of foods prepared with finger millet flour, using traditional stone grinding and industrial milling. Crossover study. Healthy volunteers (n=11) consisting of five males and six females), aged between 20 and 30 years, with a body mass index of 18.5-23.5 Kgm-2. Blood glucose concentration was measured at fasting and 30, 45, 60, 90, 120 minutes after ingestion of roti and pittu made with stone ground or industrially milled finger millet flour, containing 50 g of available carbohydrates. Glycaemic Index (GI) values were expressed as the average value of the 11 subjects. Significant differences (p0.05) in proximate compositions of the different foods or raw flours. Foods prepared with finger millet (kurakkan) flour with a larger particle size distribution resulted in a lower glycaemic response.

  13. Relations globales entre sédimentation de black shales océaniques et dépôts subséquents de phosphates. L'exemple du Crétacé moyen-supérieur de l'Atlantique centre et nord et du Crétacé supérieur-Eocène de la bordure ouest et nord du bouclier Africano-arabe Global Relations Between the Sedimentation of Oceanic Black Shales and Subsequent Phosphate Deposits. Example of the Middle-Upper Cretaceous in the Central and Northern Atlantic and of the Upper Cretaceous-Eocene on the Western and Northern Edges of the African-Arabian Shield

    Directory of Open Access Journals (Sweden)

    Busson G.

    2006-11-01

    Full Text Available A l'échelle mondiale, les grandes accumulations de phosphates sédimentaires apparaissent irrégulièrement réparties dans le temps. Celles du Crétacé supérieur-Eocène de la bordure ouest et nord du bouclier africano-arabe sont quantitativement exceptionnelles et intéressantes par les réflexions qu'elles suggèrent sur un mécanisme global. On insiste d'abord sur certaines données océanographiques actuelles : flux des matières phosphatées vers l'océan et dans l'océan; répartition des phosphates dans les masses d'eaux océaniques et en particulier dans les eaux euxiniques. Puis quelques théories proposées pour rendre compte du caractère épisodique de la sédimentation phosphatée sont rappelées et critiquées (Strakhov, Fischer, Arthur, Sheldon, etc. . Puis la répartition par pays des quantités de phosphates déposées dans une partie des domaines mésogéen et atlantique est précisée. Elle justifie de focaliser notre attention sur les phosphates marocains, de loin les plus abondants et localisés en position clé. On rappelle néanmoins que la double évolution latitudinale au Crétacé et au Paléogène du Nord vers le Sud dans l'actuel hémisphère nord et du Sud vers le Nord dans l'actuel hémisphère sud rend peu crédibles les interprétations purement latitudino-climatiques de ces dépôts phosphatés. Sur le cas du Maroc, les conditions préalables à cette sédimentation phosphatée sont précisées et discutées : existence de transgressions marines pelliculaires, de séries condensées; rémission des apports détritiques ( le silence de la terre ; confinement (origine et modalité d'action. Ces conditions à elles seules ne peuvent pas expliquer l'extraordinaire flux phosphaté de cette époque. On rappelle alors que les accumulations de matière organique des black shales du Crétacé moyen-supérieur de l'Atlantique -parmi les plus importantes de l'histoire de la terre- ne présentent nulle part leur

  14. Optimizing Transcriptome Assemblies for Eleusine indica Leaf and Seedling by Combining Multiple Assemblies from Three De Novo Assemblers

    Directory of Open Access Journals (Sweden)

    Shu Chen

    2015-03-01

    Full Text Available Due to rapid advances in sequencing technology, increasing amounts of genomic and transcriptomic data are available for plant species, presenting enormous challenges for biocomputing analysis. A crucial first step for a successful transcriptomics-based study is the building of a high-quality assembly. Here, we utilized three different de novo assemblers (Trinity, Velvet, and CLC and the EvidentialGene pipeline tr2aacds to assemble two optimized transcript sets for the notorious weed species, . Two RNA sequencing (RNA-seq datasets from leaf and aboveground seedlings were processed using three assemblers, which resulted in 20 assemblies for each dataset. The contig numbers and N50 values of each assembly were compared to study the effect of read number, k-mer size, and in silico normalization on assembly output. The 20 assemblies were then processed through the tr2aacds pipeline to remove redundant transcripts and to select the transcript set with the best coding potential. Each assembly contributed a considerable proportion to the final transcript combination with the exception of the CLC-k14. Thus each assembler and parameter set did assemble better contigs for certain transcripts. The redundancy, total contig number, N50, fully assembled contig number, and transcripts related to target-site herbicide resistance were evaluated for the EvidentialGene and Trinity assemblies. Comparing the EvidentialGene set with the Trinity assembly revealed improved quality and reduced redundancy in both leaf and seedling EvidentialGene sets. The optimized transcriptome references will be useful for studying herbicide resistance in and the evolutionary process in the three allotetraploid offspring.

  15. Allelopathic potential of leaf and seed of Mucuna bracteata DC. ex Kurz on Eleusine indica (L.) gaertn

    Science.gov (United States)

    Halimshah, Syamimi; Ismail B., S.; Ahmad, Wan Juliana Wan

    2015-09-01

    A study was conducted to determine the allelopathic potential of leaf and seed of Mucuna bracteata on the growth of E. indica through aqueous extract and debris (incorporated into the soil) experiment. Three concentrations of leaf and seed aqueous extract (16.7, 33.3 and 66.7 g/L) and debris (2.5, 5.0 and 10.0 g/500 g soil) of M. bracteata were used in the experiment. Complete randomized design (CRD) with three replications was applied in this experiment which was conducted twice. Results demonstrated that the leaf and seed extracts of M. bracteata exhibited higher suppression effect on the growth and germination of E. indica as the concentration increased. The leaf and seed extracts significantly reduced all measured parameters at all concentrations except for the shoot length and germination of E. indica by seed extract at 16.7 g/L which recorded insignificant reduction by 40.5% and 4% respectively. The leaf and seed debris significantly reduced the root length of E. indica at all treatments. Seed debris also showed significant reduction on the germination at all treatments and other seedling growth parameters (shoot length, fresh weight and dry weight) at 2.5 and 10.0 g/500 g soil. Meanwhile, the leaf debris demonstrated stimulation effect on the seedling growth parameters. As a whole, the leaf showed higher suppression effect in aqueous extract experiment while the seed recorded higher suppression effect in the debris experiment. Further studies need to be conducted to investigate the type of inhibition mechanism involved in both experiments.

  16. Inheritance of resistance to anti-microtubule dinitroaniline herbicides in an "intermediate" resistant biotype of Eleusine indica (Poaceae).

    Science.gov (United States)

    Zeng, L; Baird, W V

    1999-07-01

    Inheritance of resistance to the anti-microtubule dinitroaniline herbicides was investigated in a goosegrass biotype displaying an intermediate level of resistance (I). Reciprocal crosses were made between the I biotype and previously characterized susceptible (S) or resistant (R) biotypes. Eight F(1) hybrids were identified, and F(2) populations were produced by selfing. The dinitroaniline-herbicide response phenotype (DRP) of F(1) plants, and F(2) seedlings was determined using a root-growth bioassay. The DRP of F(1) plants of S × I was "susceptible" (i.e., identical to the S parental plants), and the DRP of F(1) plants of I × R was "intermediate" (i.e., identical to the I parental plants). Nonparental phenotypes were not observed in F(1) plants. Results indicated susceptibility to be dominant over intermediate resistance and intermediate resistance to be dominant over high resistance. Analysis of reciprocal crosses ruled out any role for cytoplasmic inheritance. When treated at the discriminating concentration (e.g., 0.28 ppm oryzalin), F(2) seedlings of S × I were classified as either S or I phenotype, and F(2) seedlings of I × R were classified as either I or R phenotype. Again, nonparental phenotypes were not observed. The 3:1 (S:I or I:R) segregation ratios in F(2) seedlings were consistent across all eight F(2) families. The results show that dinitroaniline herbicide resistance in the I biotype of goosegrass is inherited as a single, nuclear gene. Furthermore, it suggests that dinitroaniline resistance in goosegrass is controlled by three alleles at a single locus (i.e., Drp-S, Drp-i, and Drp-r).

  17. Consumo da costa africana: comunicações entre os portos turísticos sul-africanos do oceano Índico

    Directory of Open Access Journals (Sweden)

    Pamila Gupta

    2015-12-01

    Full Text Available Do início até meados do século XX, os cruzeiros turísticos ao longo da costa sul-africana eram uma atividade de lazer popular, empreendida pelas elites (brancas europeias (predominantemente os britânicos, americanas e sul-africanas, com paradas que incluíam diversas cidades portuárias do oceano Índico, como Cidade do Cabo e Durban, na África do Sul, e Lourenço Marques e Beira, no Moçambique português. Considerando as cidades portuárias anteriormente mencionadas como cidades-gêmeas em relação aos seus entrelaçados passados coloniais e turísticos e como funcionando dentro de um “corredor cultural” regional distinto (NUTALL, 2009 da África do Sul, este artigo explora uma série de portos de lazer interligados via cruzeiros de passageiros. A base da minha navegação histórica são os anuários de turismo produzidos pelas companhias de cruzeiro marítimo Union-Castle Line e serviço Round África em 1939 e 1949, respectivamente. A justificativa é que esses guias de viagem servem como entrada ao microcosmo cosmopolita de barcos de cruzeiro, o que os torna inestimáveis para entender a história do lazer (concomitantemente aos bens de consumo e publicidade relacionados na África do Sul.

  18. Procesos de formación de los yacimientos plio-pleistocenicos africanos y su relevancia para los modelos de comportamiento homínido

    Directory of Open Access Journals (Sweden)

    Ignacio de la Torre Sainz

    1999-01-01

    Full Text Available La controversia surgida a principios de los años 80 sobre la naturaleza del registro del Plio-Pleistoceno, ha conducido a un debate aún vigente en torno a los agentes envueltos en la formación de los primeros yacimientos arqueológicos. Algunos autores argüyeron que estos depósitos eran palimpsestos en los que la actividad humana fue marginal, mientras que otros opinan que son el resultado de unas estrategias complejas llevadas a cabo por los primeros representantes del género Homo. En el presente trabajo se hace una valoración crítica de los datos disponibles sobre el registro arqueológico plio-pleistocénico, y se propone el marco conductual que hizo posible la formación de estos primeros yacimientos.The controversy about the formation of the early Piio-Pieistocene archaeological site formation has resulted in a wide array of studies regarding the different processes involved therein. Some authors argüe that early sites were palimpsest where hominid intervention was minimal, whereas other researchers support the idea that sites were referential places used by the earliest representatives of the genus Homo. This paper presents the available evidence supporting either hyphoteses and several behavioral models are critically revised.

  19. Rhinometry: spectrum of nasal profile among Nigerian Africans Rinometria: espectro do perfil nasal entre os africanos da Nigéria

    Directory of Open Access Journals (Sweden)

    Rabiu O. Jimoh

    2011-10-01

    Full Text Available Nasal parameters measurements are useful in anthropology to distinguish people into racial and ethnic groups. MATERIALS AND METHODS: A cross-sectional survey among Nigerians aged 18 to 70 years of Nigerian parentage randomly selected at the ENT Clinic of the University of Ilorin teaching hospital (U.I.T.H., Ilorin, Nigeria without gender discrimination had measurement of their nasal parameters done using a sliding caliper: Nasal height, width, tip protrusion, alar thickness, nasal septal thickness and nares diameter. RESULTS: 105 subjects were seen, the age range 18 to 70 years (mean of 28.63 + 13.06 years. There was 58 males and 47 females with a male/female ratio of 1.2:1. The mean nasal width/height (Nasal index -NI was 90.7 in males and 88.2 in females. Males had a higher NI compared to female (p As medidas de parâmetros nasais são úteis em antropologia para distinguir pessoas em grupos étnicos e raciais. MATERIAIS E MÉTODOS: Pesquisa transversal entre nigerianos com idades entre 18 e 70 anos, filhos de pais nigerianos, aleatoriamente selecionados na clínica de otorrinolaringologia do Hospital Universitário de Ilorin (U.I.T.H., Ilorin, Nigéria; sem discriminação de gênero, tiveram seus parâmetros nasais medidos usando-se um compasso deslizante: altura nasal, largura, protrusão da ponta, espessura alar, espessura do septo nasal e diâmetro das narinas. RESULTADOS: 105 indivíduos foram avaliados, e suas idades variaram entre 18 e 70 anos (média de 28,63 + 13,06 anos. Havia 58 homens e 47 mulheres, com coeficiente entre homens de mulheres de: 1.2:1. A medida largura/ altura nasal média (Índice nasal - IN foi de 90,7 em homens e 88,2 em mulheres. Os homens tiveram IN mais alto quando comparados às mulheres (p < 0,03. O tipo mais comum de variabilidade nasal foi o Tipo A (70,5%, Platirrinia, Tipo B (26,7%, especialmente em mulheres, (mosorrinia e o Tipo C (leptorrinia (2,8%. CONCLUSÕES: Há associação significativa entre o gênero do indivíduo e seu tipo nasal. A platirrinia, entre homens, e a mosorrinia, entre mulheres; somente 2,8% sendo leptorrinia. Os índices nasais foram mais altos em homens do que em mulheres.

  20. Studio della convezione durante il monsone africano: osservazioni e modellazione della precipitazione e del ruolo della circolazione regionale sulla composizione atmosferica

    OpenAIRE

    Orlandi, Emiliano

    2010-01-01

    The improvement of knowledge and understanding of the West African Monsoon (WAM) is a fundamental scientific issue with implications on economy, health, water resources and food security in West African countries. In a region where agriculture is mainly rain fed, a delay in the rainy season onset or a dry year could compromise food and water security and lead to dearth conditions. The natural interannual and interseasonal variability of the WAM and the dramatic change from wet ...

  1. Fotografando o mundo colonial africano Moçambique, 1929 Taking pictures of the African Colonial World Moçambique, 1929

    Directory of Open Access Journals (Sweden)

    Ana Cristina Fonseca Nogueira da Silva

    2009-06-01

    Full Text Available O registo fotográfico transformou-se, a partir da segunda metade do século XIX, num instrumento privilegiado de observação e de descrição do mundo. Um instrumento capaz de sugerir a realidade "objectiva" dos elementos fotografados, mas também de registar as realidades imaginadas por quem fotografa, pessoas e instituições que "encomendam" fotografias, por quem as recolhe, selecciona e organiza em álbuns ou caixas. Além de registar "realidades", as fotografias também condicionam a percepção daqueles que as visionam - os seus "públicos alvo", previamente escolhidos, ou outros públicos, mais espontâneos, difusos ou até imprevistos. Nesse sentido, com maior ou menor intencionalidade e com diferentes graus de "sucesso", as fotografias são performativas, fazem parte do processo de construção e de reconstrução da ordem (natural, social do mundo, produzem e/ou reproduzem as classificações e as identificações do espaço social. A "autoridade" do discurso fotográfico, associada à "crença espontânea" na sua veracidade, na possibilidade de registar de forma "objectiva" uma realidade autónoma, neutra, independente do sujeito que fotografa, reforça ainda mais esta sua dimensão prescritiva. O que pretendo com este texto é, partindo dos sentidos que atrás expus, ensaiar uma interpretação sobre o modo como foi organizado o mundo colonial moçambicano e classificadas as suas populações num conjunto de álbuns fotográficos dos finais da década de 20 do século XX.The photographic record has become, from the second half of the nineteenth century, a privileged instrument of observation and description of the world. An instrument able to suggest the "objective" reality of the elements photographed, but also to record the realities imagined by those photographers, people and institutions that "ordered" the photos, and also by those who collect, select and organize them into albums or boxes. In addition to record "reality", the photographs also influence the perception of those whom the photos were taken for - their "target audiences", previously chosen, or other public, more spontaneous, diffuse or even unexpected. In this sense, more or less intentional and with different degrees of "success", the photographs are performing, are part of the construction and reconstruction of the order (natural, social of the world, producing and/or reproducing the classifications and identification of the social space. The "authority" of the photographic discourse, associated with "spontaneous belief" in its truthfulness, in the possibility of registering an "objective" reality that is independent and neutral from the subject that is pictured, strength their prescriptive dimension. My objective with this text is to try to achieve an interpretation on how was organized the colonial Mozambique world and its people was classified using a set of photographic albums from the end of the second decade of the XX century.

  2. Estudo de carcaça do bagre africano (Clarias gariepinus em diferentes categorias de peso Study of African Catfish (Clarias gariepinus carcass in different weight categories

    Directory of Open Access Journals (Sweden)

    Adriana Aparecida Pinto

    1999-11-01

    Full Text Available O objetivo deste experimento foi estudar carcaças de Clarias gariepinus, em três categorias de peso (P1=inferior a 1kg; P2=de 1 a 2kg e P3=superior a 2kg, para analisar o rendimento de carcaça com cabeça (RCC, sem cabeça (RCS, filé (RFI, músculos abdominais (RMA, partes comestíveis (RPC, tronco limpo (RTL, porcentagem de pele (PPE, cabeça (PCA, vísceras (PVI, resíduos totais (PRE e determinar a composição proximal do filé (proteína bruta, umidade, gordura e cinza. Foram utilizados 60 bagres, em delineamento inteiramente casualizado, 3 tratamentos com 20 repetições, em nível de significância de 5%. O rendimento de filé foi maior para P2 (38,61% que para P1 e P3. O rendimento das partes comestíveis e tronco limpo foram superiores para P2 (RPC=46,27% e RTL=56,67%, mas sem diferirem do P3. O rendimento de carcaça sem cabeça foi maior para P3, não diferindo de P2. O P2 foi inferior para PPE (4,64%, PCA (23,62% e PRE (53,73%, sem diferir de P3, para porcentagem de cabeça e de resíduos totais. Não houve diferença significativa para rendimentos dos músculos abdominais, carcaça com cabeça e vísceras. P2 (2,25% e 77,49% não diferiu do P1 (1,51% e 77,78% e P3 (3,03% e 76,39%, para gordura e umidade, respectivamente, enquanto, para proteína bruta, não houve diferença significativa. Conclui-se que P2 apresentou melhores rendimentos de filetagem, ao passo que a composição proximal do filé, nas três categorias de peso, foi relativamente similar, com aumento de deposição de gordura nos peixes acima de 1kg de peso vivo.The aim of this experiment was to study Clarias gariepinus carcass in three weight categories (P1=below 1kg; P2= 1 to 2kg and P3=over 2kg to analyze yield of carcass with head (YCH, without head (YCW, fillet (YF, abdominal muscles (YAM, eatable parts (YEP, dressed out (YDO and percentages of skin (PSK, head (PHE, viscera (PVI, total residues (PTR; and to determine the proximate composition of fillet (crude protein, moisture, fat and ash . Sixty catfish were used in a completely randomized design (3 trataments with 20 replications, with 5% significance level. Fillet yield was higher for P2 (38,61% than for P1 and for P3 fillet. The eatable parts and dressed out yield were higher for P2 (YEP=46,27% and YDO=56,67%, but were not different from P3. The carcass with head was higher than P3, and didn’t differ from P2. P2 was lower in PSK (4,64%, PHE (23,62% and PTR (53,73%, without being different from P3 in percentages of head and total residues. There was no significant difference for yield of abdominal muscles, carcass with head, percentages of viscera. P2 (2,25% and 77,49% did not differ from P1 (1,51% and 77,78% and from P3 (3,03% and 76,39% for fat and moisture, respectively, while for crude protein there was no significant difference (P > 0.01. It may be concluded that P2 provided better filleting yieds, while the proximate composition of fillet in the three weight categories was relatively similar to the increase of fat deposition in the fish over 1kg live weight.

  3. Morfologfa conchffera, crecimiento, reproducción y letargo de los caracoles gigantes africanos : observaciones en laboratorio sobre Archachatina marginata suturalis, Achatina achatina y Achatina fulica'

    Directory of Open Access Journals (Sweden)

    Stiévenart, C.

    1997-01-01

    Full Text Available hell Shape, Growth, Reproduction and Estivation in Giant African Landsnails : Observations in Laboratory on"Archachatina marginata suturalis, Achatina achatina and Achatina fulica". Commercial frog farms exist in several countries. It seems hopeless believing that frog leg consumption can be prohibited, and the solution is probably a very strict control of the origin of the legs sold and imported. Uncontrolled hunting-poaching of frogs should be replaced by sustainable and rational breeding of frogs for sale. A large frog farm located near Singapore is described with the infrastructure and the management of the production. The two species bred are the American and the Asian bull-frogs Rana catesbeiana and R. tigerina. It is also mentioned that appropriate slaughtering techniques exist for frogs based on same guidelines as for conventional farm animals.

  4. A Abordagem dos Modos de Vida Como Ferramenta de Análise das Estratégias de Sobrevivência no Meio Rural Africano

    Directory of Open Access Journals (Sweden)

    Tomás Adriano Sitoe

    2011-01-01

    Full Text Available Diversification is a social and economic process that interprets creation of many and different sources of income in a given period of time. The constancy and eventually the increase of diversification of activities and income sources in rural spaces led to a revision of theories and approaches for better understanding this phenomenon. The Sustainable Livelihood Approach (SLA was adopted in the 1990s as a new paradigm to address the issue of diversification and poverty in developing countries, with emphasis on rural Africa. Currently, this approach has been used by various organizations and individuals as an analytical tool for studying the livelihood strategies; however, little attention has been made to the its limitations. Based on literature revision the article presents and discusses the SLA. A conclusion is that although it has some limitation in general it can provide a better understanding of realities evolving rural spaces, mainly in low developed societies. The main limitation is regarding the difficulty for capturing the dynamics and complexity that involves the process of assets transformation into livelihood strategies.

  5. China and the African Internet: Perspectives from Kenya and Ethiopia / China y el Internet africano: Perspectivas desde Kenia y Etiopía

    Directory of Open Access Journals (Sweden)

    Iginio Gagliardone

    2013-11-01

    Full Text Available Through the lens of China in Africa, this paper explores the transformations in the relationship between the Internet and the state. China’s economic success, impressive growth of Internet users and relative stability have quietly promoted an example of how the Internet can be deployed within the larger political and economic strategies of developing states, moving beyond the democratization paradigm promoted in the West. New evidence suggests that this model is becoming increasingly popular, but it is not clear why and how it is spreading. Through a case study comparison of an emerging democracy, Kenya, and a semi-authoritarian country, Ethiopia, where China has recently increased its involvement in the communications sector, this paper investigates whether and how the ideas of state stability, development and community that characterize the strategies pursued by the Chinese government are influencing and legitimizing the development of a less open model of the Internet. It analyses how new ideas, technologies and norms integrate with existing ones and which factors influence their adoption or rejection. It is based on fieldwork conducted in Ethiopia and in Kenya between 2011 and 2013, where data was collected through mapping Internet related projects involving Chinese companies and authorities, analysing Internet policies and regulations, and interviewing officials in Ministries of Communication, media lawyers, Internet activists, and Chinese employed in the media and telecommunication sector in Kenya and Ethiopia.Desde la óptica de China en África, este artículo explora las transformaciones en la relación entre Internet y el estado. El éxito económico de China, el impresionante crecimiento de usuarios de Internet y estabilidad relativa ha promovido un ejemplo tranquilo de cómo Internet puede ser desplegado dentro de las más amplias estrategias políticas y económicas de los estados en desarrollo, más allá del paradigma de la democratización promovida en Occidente. Existen nuevas evidencias que sugieren que este modelo está siendo cada vez más popular, pero no está claro por qué y cómo se está extendiendo. A través de un estudio de caso comparativo de una democracia emergente, Kenia, y un país semi-autoritario, Etiopía, donde China ha aumentado recientemente su participación en el sector de las comunicaciones, este trabajo investiga hasta qué punto y de qué manera las ideas de la estabilidad del Estado, el desarrollo y la comunidad que caracterizan las estrategias adoptadas por el gobierno chino están influyendo y legitimando el desarrollo de un modelo menos abierto de Internet. Se analiza cómo las nuevas ideas, tecnologías y normas se integran con las ya existentes y qué factores influyen en su adopción o rechazo. El artículo se basa en el trabajo de campo llevado a cabo en Etiopía y en Kenia entre 2011 y 2013, donde se recogieron datos a través del análisis de proyectos relacionados con Internet en los que participan empresas y autoridades chinas, así como el estudio de las políticas y reglamentos de internet, y complementando con entrevistas a funcionarios de los Ministerios de Comunicación, especialistas en derecho de las comunicaciones, activistas de Internet, así como profesionales chinos del sector de las telecomunicaciones en Kenia y Etiopía.

  6. Cimarrones africanos e indios en la frontera española con los Estados Unidos. El caso de los Seminoles negros de La Florida

    Directory of Open Access Journals (Sweden)

    Jane Landers

    2003-12-01

    Full Text Available This essay explores Andrew Jackson's bloody victories over the Red Stick Creeks and Seminoles of Florida and the triumph of "the White man's republic", with a particular interest in the participation of persons of African descent. The people who would become the Seminoles moved into Florida from Georgia and Alabama in the eighteenth century to fill the vacuum created by the exodus or extinction of Florida's indigenous nations. Initially the Seminoles were staunch allies of the British, but in the late eighteenth century, Chief Payne and Payne’s successors, Micanopy and Bowlegs, reshaped Seminole foreign policy and became allies of the Spanish government.Under their leadership the Seminoles also accepted into their lands many slaves who had run away from the United States and who lived in a sort of feudal arrangement with their "masters" and intermarried with them. These blacks recognized that Anglo rule would return them to slavery, so they, too, became fierce enemies of the Americans and allies of the Spaniards. For about a half century black and blood Seminoles struggled to maintain their autonomy on the volatile Southern frontier, but the United States was firmly committed to an expansionist foreign policy. Its interventions were motivated by territorial ambition, by the lingering fear that Britain would displace the weakened Spanish regimes in the Southeast, and by racial politics. The very success of the Spanish/ Indian/black alliance, in effect, ensured further intervention by Americans. The War of 1812 and the simultaneous Creek War of 1813-14 evolved into a long-term effort to push the Creeks, Seminoles, and blacks out of their settlements in western and central Florida, and eventually to drive out the Spaniards as well. Jackson led the first Seminole War in 1818 and in 1821, when the United States acquired Florida, as governor of the new territorial government he began the removal of the fugitive Creeks, Seminoles, and free blacks from the peninsula.//Este ensayo explora las victorias sangrientas de Andrew Jackson sobre los Red Stick Creeks y los Seminoles de la Florida y el triunfo de “la República del Hombre blanco”, con un interés particular de personas afro descendientes. Aquellos que se convirtieron en Seminoles se trasladaron a Florida desde Georgia y Alabama en el siglo XVIII para llenar el vacío dejado por el éxodo y la extinción de las naciones indígenas de aquella región. Inicialmente los Seminoles fueron firmes aliados de los británicos, pero bien entrado el siglo XVIII, el Jefe Payne y sus sucesores, Micanopy y Piernas arqueadas, le dieron nueva forma a su política exterior y se convirtieron en aliados del gobierno español. Bajo su liderazgo los Seminoles también aceptaron en sus tierras a un gran número de esclavos que habían huido de los Estados Unidos y que vivían en una especie de sociedad “feudal” con sus patrones. Estos negros sabían que el dominio inglés los devolvería a la esclavitud, por lo que también se convirtieron en enemigos feroces de los estadounidenses y en aliados de los españoles. Durante cerca de medio siglo los Seminoles y los negros lucharon por mantener su autonomía en la volátil frontera sur, pero Estados Unidos estaba firmemente comprometido con una política exterior expansionista. Sus intervenciones fueron motivadas por la ambición territorial, por el temor persistente de que Gran Bretaña pudiese desplazar a los débiles regímenes españoles en el sureste, y por la política racial. El éxito de los españoles de los indígenas y de la alianza negra aseguró la posterior intervención estadounidense. La guerra de 1812 y la simultánea Guerra Creek de 1813-14, se convirtieron en un esfuerzo a largo plazo para desplazar a los Creek, los Seminoles y los negros de sus asentamientos en el oeste y centro de Florida, y, finalmente, para expulsar a los españoles también. Jackson dirigió la primera Guerra Seminole en 1818 y en 1821, cuando Estados Unidos adquirió la Florida, como gobernador del nuevo gobierno territorial que expulsó a los Creek fugitivos a los Seminoles y a los negros libres de la península.

  7. Da partilha as independências: o continente africano nos livros didáticos de Geografía do Brasil (1890-2003

    Directory of Open Access Journals (Sweden)

    Rosemberg Ferracini

    2011-06-01

    Full Text Available Este texto es un resumen de la tesis doctoral en curso. Nuestro objeto de estudio es investigar la presencia de África en los libros de texto de Geografía en el período 1890-2003. Tenemos como objetivo discutir cómo este contenido escolar fue publicado, por ejemplo, con un enfoque de dominación territorial. Esto nos lleva a entender otras categorías como la de guerra, poder, raza, etnia, civilización y lo salvaje. El análisis se divide en cinco partes, con la elección de un libro por período, en función de su difusión entre el público estudiantil. La bibliografía de la investigación está disponible en el Laboratorio de Ciencias Humanas de la Facultad de Educación y en el Laboratorio de libros de texto de la Facultad de Filosofía y Humanidades de la Universidade de São Paulo.

  8. “El colonialismo como clave”. Discurso africano y transición española en la obra de Fernando González

    Directory of Open Access Journals (Sweden)

    Elmar Schmidt

    2015-01-01

    The Spanish transition to democracy after Franco’s death constitutes a decisive moment for the formation of new and heterogeneous discourses on Africa. Correspondingly, the journalist and writer Fernando González (1939-80 proposes new reflections about the place of Africa, especially Morocco, in the cultural imaginary and collective memory. In his articles, he investigates the continent’s postcolonial situation and the Spanish-Maghrebian relations. In his essay Liturgias para un caudillo (1977, he emphasizes the importance of colonialist ways of thinking for an understanding of the ideology, structures and ‘Africanist’ rituality of the Francoist system. In his novel Kábila (1980, he describes the Rif War as well the Spanish Civil War from the perspective of a Moroccan soldier. He applies a strategy of double codification to deconstruct the Francoist versions of history that were still perpetuated during the transition.

  9. Descendientes de africanos en la Región de las Américas y equidad en materia de salud

    Directory of Open Access Journals (Sweden)

    Cristina Torres

    2002-06-01

    Full Text Available The Region of the Americas and the Caribbean has a complex demographic profile from an ethnic and racial perspective. One of the largest groups is composed of persons of African descent, who in some countries, such as Brazil and the Dominican Republic, comprise 46 and 84% of the total population, respectively. Recent analyses of the statistics available in some countries of the Region show wide gaps in terms of living conditions and health in these communities, as well as gaps in access to health services. PAHO, through its Public Policy and Health Program, under the Division of Health and Human Development, supports sectorial efforts and those of civil organizations that aim to improve health conditions in this segment of the population, while taking into account their sociodemographic and cultural characteristics. This article briefly summarizes health conditions and access to health services in selected countries, as well as some aspects of the recent changes to the legislation in those countries. Finally, collaborative activities on the part of United Nations agencies and international financial institutions for the benefit of people of African descent and other ethnic minorities are described.

  10. FOTOGRAFÍAS DE AMAS DE LECHE EN BAHÍA. EVIDENCIA VISUAL DE LOS APORTES AFRICANOS A LA FAMILIA ESCLAVISTA EN BRASIL

    Directory of Open Access Journals (Sweden)

    Christianne Silva Vasconcellos

    2011-01-01

    Full Text Available Este artículo presenta un análisis de la producción y el uso de fotografías de personas africanas y afrodescendientes, realizadas en Brasil entre 1840, cuando esta técnica fue introducida al país, y 1920, cuando las primeras fotografías aún estaban en circulación. Desde la evidencia visual, se analizan tres temas recurrentes en el Brasil del siglo XIX: la difusión de teorías del racismo científico europeo a través de la fotografía, la creación de los tipos urbanos en las ciudades esclavistas y las nodrizas (amas de leche como agentes culturales en el seno de la familia colonial en Bahía.

  11. Estado nutricional e produção do capim-pé-de-galinha e da soja cultivada em sucessão em sistema antecipado de adubação Nutritional condition and yield of finger millet and soybean grown in succession in a system of anticipated fertilization

    Directory of Open Access Journals (Sweden)

    Eros Artur Bohac Francisco

    2007-01-01

    Full Text Available Argumenta-se sobre a viabilidade de manejo químico do solo estar relacionado à adubação de todo o sistema de cultivo (adubação antecipada visando promover o incremento de material orgânico no agroecossistema, devido as suas inúmeras vantagens no aspecto da conservação do solo, preservação dos recursos naturais renováveis e na reciclagem dos nutrientes; ou mantém-se o tradicional sistema de adubação de base, isto é, aplicação de fertilizantes simultaneamente à semeadura da cultura. O objetivo deste trabalho foi avaliar o efeito da antecipação da adubação para a cultura da soja sobre: (a produção de matéria seca e extração de nutrientes pelo capim-pé-de-galinha [Eleusine coracana (L. Gaertn.] e (b acúmulo de matéria seca, exportação de nutrientes e produtividade de grãos da cultura da soja semeada em sucessão ao capim-pé-de-galinha. O experimento foi desenvolvido em Piracicaba (SP, na safra agrícola 2001/2002, utilizando o delineamento de blocos completos casualizados com três repetições. A antecipação da adubação da soja, por ocasião da semeadura do capim-pé-de-galinha, não interferiu no acúmulo de matéria seca, na exportação de nutrientes pelos grãos, nem na produtividade agrícola da soja. O capim-pé-de-galinha respondeu positivamente à adubação da soja aumentando a produção de matéria seca e a extração de nutrientes. Os resultados deste estudo mostram que o manejo da adubação, visando ao rendimento operacional do processo de semeadura, pode ser utilizado para favorecer a instalação da cultura da soja na época recomendada.Questions arise on the viability of the chemical management of soil being related to the fertilization of the cropping system (anticipated fertilization aiming to increase organic matter in agroecosystems due to their several advantages regarding soil conservation, natural resources preservation and nutrient recycling; or whether the traditional fertilization

  12. Ciclagem de nutrientes por plantas de cobertura na entressafra em um solo de cerrado Nutrient cycling in off-season cover crops on a Brazilian savanna soil

    Directory of Open Access Journals (Sweden)

    Carlo Adriano Boer

    2007-09-01

    Full Text Available O objetivo deste trabalho foi avaliar o acúmulo e a liberação de nutrientes (N, P, K, Ca, Mg e S de resíduos culturais de plantas de cobertura na entressafra, em condições de Cerrado. O experimento foi conduzido em um Latossolo Vermelho distroférrico com textura argilosa. As plantas de cobertura avaliadas foram: amaranto (Amaranthus cruentus L., milheto (Pennisetum glaucum L. e capim-pé-de-galinha (Eleusine coracana (L. Gaertn.. O delineamento experimental utilizado foi o de blocos ao acaso, no esquema de parcelas subdivididas, com quatro repetições. Na fase de florescimento das espécies, foi avaliada a produção de matéria seca e o acúmulo de nutrientes. A fim de avaliar a liberação de nutrientes dos resíduos culturais, o material vegetal de cada espécie foi acondicionado em sacolas de náilon, as quais foram dispostas sobre o solo e seu conteúdo analisado em intervalos de 30 dias, até 240 dias após sua instalação. As maiores quantidades de nutrientes acumulados na fitomassa das plantas de cobertura foram observadas no milheto e no capim-pé-de-galinha. O potássio foi o nutriente acumulado em maior quantidade, chegando a atingir 416,9 kg ha-1 no milheto. As maiores taxas de liberação de nutrientes foram observadas nos resíduos culturais do amaranto.The objective of this work was to evaluate the accumulation and the liberation of nutrients (N, P, K, Ca, Mg and S of cultural residues by three species of cover crops, in off-season. Tested cover crops were amaranthus (Amaranthus cruentus L., pearl millet (Pennisetum glaucum L. and finger millet (Eleusine coracana (L. Gaertn.. The experiment was carried out in a Typic Haplorthox clay texture soil. A randomized block desing in a split-plot array in time, with four replications, was used. At the flowering of the species, the production of dry matter and the accumulation of nutrients were evaluated. Proportional samples of dry matter of each cover crop species were placed in

  13. Selection of species tolerant to the herbicide sulfentrazone with potential for phytoremediation of contaminated soilsSeleção de espécies tolerantes ao herbicida sulfentrazone com potencial para a fitorremediação de solos contaminados

    Directory of Open Access Journals (Sweden)

    João Carlos Madalão

    Full Text Available This paper aimed to select species with potential for phytoremediation of soils contaminated with the herbicide sulfentrazone. Eight species were evaluated: Arachis pintoi, Eleusine coracana, Crotalaria spectabilis, Crotalaria ochroleuca, Cajanus cajan, Leucaena leucocephala, Stizolobium cinereum, and Raphanus sativus. The experiment was set-up inside a greenhouse, using pots with a capacity of 6dm3 filled with soil samples collected at a depth of 0-20cm. The experimental design was arranged into randomised blocks in a factorial scheme (8 × 5 with four replications, which consisted of the combination between the species and five doses of sulfentrazone (0, 200, 400, 800, and 1,600g ha-1. The herbicide phytotoxicity, plant heights, and dry masses of shoots and roots were evaluated. The species Cajanus cajan and Leucaena leucocephala had a higher tolerance to sulfentrazone up to a dose of 400g ha-1, showing minor symptoms of phytotoxicity and smaller decreases in plant heights and in dry matter accumulation, both in the shoots and roots, when compared to the control treatment, indicating, thus, the potential to be used for further studies on phytoremediation of sulfentrazone in soil. Este trabalho teve como objetivo selecionar espécies com potencial para a fitorremediação de solos contaminados com o herbicida sulfentrazone. Foram avaliadas oito espécies: Arachis pintoi, Eleusine coracana, Crotalaria spectabilis, Crotalaria ochroleuca, Cajanus cajan, Leucaena leucocephala, Stizolobium cinereum e Raphanus sativus. O experimento foi instalado em casa de vegetação, com a utilização de vasos com capacidade para 6 dm3 preenchidos com porções de solo coletadas na profundidade de 0-20 cm. O delineamento experimental foi o de blocos casualizados em esquema fatorial 8 × 5, com quatro repetições, composto pela combinação entre as espécies e cinco doses do sulfentrazone (0, 200, 400, 800 e 1.600 g ha-1. Foram avaliadas a fitotoxicidade do

  14. Finger Millet: A "Certain" Crop for an "Uncertain" Future and a Solution to Food Insecurity and Hidden Hunger under Stressful Environments.

    Science.gov (United States)

    Gupta, Sanjay Mohan; Arora, Sandeep; Mirza, Neelofar; Pande, Anjali; Lata, Charu; Puranik, Swati; Kumar, J; Kumar, Anil

    2017-01-01

    Crop growth and productivity has largely been vulnerable to various abiotic and biotic stresses that are only set to be compounded due to global climate change. Therefore developing improved varieties and designing newer approaches for crop improvement against stress tolerance have become a priority now-a-days. However, most of the crop improvement strategies are directed toward staple cereals such as rice, wheat, maize etc., whereas attention on minor cereals such as finger millet [ Eleusine coracana (L.) Gaertn.] lags far behind. It is an important staple in several semi-arid and tropical regions of the world with excellent nutraceutical properties as well as ensuring food security in these areas even during harsh environment. This review highlights the importance of finger millet as a model nutraceutical crop. Progress and prospects in genetic manipulation for the development of abiotic and biotic stress tolerant varieties is also discussed. Although limited studies have been conducted for genetic improvement of finger millets, its nutritional significance in providing minerals, calories and protein makes it an ideal model for nutrition-agriculture research. Therefore, improved genetic manipulation of finger millets for resistance to both abiotic and biotic stresses, as well as for enhancing nutrient content will be very effective in millet improvement. Key message: Apart from the excellent nutraceutical value of finger millet, its ability to tolerate various abiotic stresses and resist pathogens make it an excellent model for exploring vast genetic and genomic potential of this crop, which provide us a wide choice for developing strategies for making climate resilient staple crops.

  15. Identification and characterization of finger millet OPAQUE2 transcription factor gene under different nitrogen inputs for understanding their role during accumulation of prolamin seed storage protein.

    Science.gov (United States)

    Gaur, Vikram Singh; Kumar, Lallan; Gupta, Supriya; Jaiswal, J P; Pandey, Dinesh; Kumar, Anil

    2018-03-01

    In this study, we report the isolation and characterization of the mRNA encoding OPAQUE2 (O2) like TF of finger millet (FM) ( Eleusine coracana) ( EcO2 ). Full-length EcO2 mRNA was isolated using conserved primers designed by aligning O2 mRNAs of different cereals followed by 3' and 5' RACE (Rapid Amplification of cDNA Ends). The assembled full-length EcO2 mRNA was found to contain an ORF of 1248-nt coding the 416 amino acids O2 protein. Domain analysis revealed the presence of the BLZ and bZIP-C domains which is a characteristic feature of O2 proteins. Phylogenetic analysis of EcO2 protein with other bZIP proteins identified using finger millet transcriptome data and O2 proteins of other cereals showed that EcO2 shared high sequence similarity with barley BLZ1 protein. Transcripts of EcO2 were detected in root, stem, leaves, and seed development stages. Furthermore, to investigate nitrogen responsiveness and the role of EcO2 in regulating seed storage protein gene expression, the expression profiles of EcO2 along with an α-prolamin gene were studied during the seed development stages of two FM genotypes (GE-3885 and GE-1437) differing in grain protein content (13.8 and 6.2%, respectively) grown under increasing nitrogen inputs. Compared to GE-1437, the EcO2 was relatively highly expressed during the S2 stage of seed development which further increased as nitrogen input was increased. The Ecα - prolamin gene was strongly induced in the high protein genotype (GE-3885) at all nitrogen inputs. These results indicate the presence of nitrogen responsiveness regulatory elements which might play an important role in accumulating protein in FM genotypes through modulating EcO2 expression by sensing plant nitrogen status.

  16. Genetic diversity in tef [Eragrostis tef (Zucc. Trotter

    Directory of Open Access Journals (Sweden)

    Kebebew eAssefa

    2015-03-01

    Full Text Available Tef [Eragrostis tef (Zucc. Trotter] is a cereal crop resilient to adverse climatic and soil conditions, and possessing desirable storage properties. Although tef provides high quality food and grows under marginal conditions unsuitable for other cereals, it is considered to be an orphan crop because it has benefited little from genetic improvement. Hence, unlike other cereals such as maize and wheat, the productivity of tef is extremely low. In spite of the low productivity, tef is widely cultivated by over six million small-scale farmers in Ethiopia where it is annually grown on more than three million hectares of land, accounting for over 30% of the total cereal acreage. Tef, a tetraploid with 40 chromosomes (2n=4x=40, belongs to the Family Poaceae and, together with finger millet (Eleusine coracana Gaertn, to the Subfamily Chloridoideae. It was believed to have originated in Ethiopia. There are about 350 Eragrostis species of which E. tef is the only species cultivated for human consumption. At the present time, the gene bank in Ethiopia holds over five thousand tef accessions collected from geographical regions diverse in terms of climate and elevation. These germplasm accessions appear to have huge variability with regard to key agronomic and nutritional traits. In order to properly utilize the variability in developing new tef cultivars, various techniques have been implemented to catalog the extent and unravel the patterns of genetic diversity. In this review, we show some recent initiatives investigating the diversity of tef using genomics, transcriptomics and proteomics and discuss the prospect of these efforts in providing molecular resources that can aid modern tef breeding.

  17. Beneficial Effects of ragi (Finger Millet) on Hematological Parameters, Body Mass Index, and Scholastic Performance among Anemic Adolescent High-School Girls (AHSG).

    Science.gov (United States)

    Karkada, Suja; Upadhya, Sharmila; Upadhya, Subramanya; Bhat, Gopalakrishna

    2018-03-29

    Adolescence is a period characterized by rapid physical, emotional, and mental growth and changes potentially resulting in health challenges. Anemia, which is a fairly common complication in this age group, is reported to negatively affect the cognitive ability of adolescents. Traditionally, ragi (Finger millet: Eleusine coracana), a cereal available in India, has been recommended as nutritional supplement to combat anemia because of its high protein and mineral content as well as anti-microbial property. This study sought to establish the effect of ragi in improving hematological parameters, body mass index, and scholastic performance among adolescent school girls. Sixty adolescent girls were randomly selected and divided into intervention (n = 30) and control groups (n = 30). The effect of dietary supplementation of ragi porridge on hematological parameters was evaluated on the intervention group at 45 and 90 days. Both groups were monitored for changes in body mass index and scholastic performance. A statistically significant increase in hemoglobin levels was observed in the intervention group after 90 days (from a mean of 11.3 g% to 12.54 g%; t (29)  = 7.514, p < .0001), with no significant changes in the control group. No statistically significant differences between the two groups were observed for mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, mean corpuscular volume, red cell distribution width, body mass index, and scholastic performance. The data show that daily dietary supplementation with ragi porridge has a positive effect on hemoglobin levels in adolescent high schools girls. A well planned nutrition education with dietary supplementation is thus recommended for better outcomes.

  18. Gibberellin Deficiency Confers Both Lodging and Drought Tolerance in Small Cereals

    Directory of Open Access Journals (Sweden)

    Sonia ePlaza-Wüthrich

    2016-05-01

    Full Text Available Tef [Eragrostis tef (Zucc. Trotter] and finger millet [Eleusine coracana Gaertn] are staple cereal crops in Africa and Asia with several desirable agronomic and nutritional properties. Tef is becoming a life-style crop as it is gluten-free while finger millet has a low glycemic index which makes it an ideal food for diabetic patients. However, both tef and finger millet have extremely low grain yields mainly due to moisture scarcity and susceptibility of the plants to lodging. In this study, the effects of gibberellic acid (GA inhibitors particularly paclobutrazol (PBZ on diverse physiological and yield-related parameters were investigated and compared to GA mutants in rice (Oryza sativa L.. The application of PBZ to tef and finger millet significantly reduced the plant height and increased lodging tolerance. Remarkably, PBZ also enhanced the tolerance of both tef and finger millet to moisture deficit. Under moisture scarcity, tef plants treated with PBZ did not exhibit drought-related symptoms and their stomatal conductance was unaltered, leading to higher shoot biomass and grain yield. Semi-dwarf rice mutants altered in GA biosynthesis, were also shown to have improved tolerance to dehydration. The combination of traits (drought tolerance, lodging tolerance and increased yield that we found in plants with altered GA pathway is of importance to breeders who would otherwise rely on extensive crossing to introgress each trait individually. The key role played by PBZ in the tolerance to both lodging and drought calls for further studies using mutants in the GA biosynthesis pathway in order to obtain candidate lines which can be incorporated into crop-breeding programs to create lodging tolerant and climate-smart crops.

  19. Proteomic analysis of JAZ interacting proteins under methyl jasmonate treatment in finger millet.

    Science.gov (United States)

    Sen, Saswati; Kundu, Sangeeta; Dutta, Samir Kr

    2016-11-01

    Jasmonic acid (JA) signaling pathway in plants is activated against various developmental processes as well as biotic and abiotic stresses. The Jasmonate ZIM-domain (JAZ) protein family, the key regulator of plant JA signaling pathway, also participates in phytohormone crosstalk. This is the first study revealing the in vivo interactions of finger millet (Eleusine coracana (L.) Gaertn.) JAZ protein (EcJAZ) under methyl jasmonate (MJ) treatment. The aim of the study was to explore not only the JA signaling pathway but also the phytohormone signaling crosstalk of finger millet, a highly important future crop. From the MJ-treated finger millet seedlings, the EcJAZ interacting proteins were purified by affinity chromatography with the EcJAZ-matrix. Twenty-one proteins of varying functionalities were successfully identified by MALDI-TOF-TOF Mass spectrometry. Apart from the previously identified JAZ binding proteins, most prominently, EcJAZ was found to interact with transcription factors like NAC, GATA and also with Cold responsive protein (COR), etc. that might have extended the range of functionalities of JAZ proteins. Moreover, to evaluate the interactions of EcJAZ in the JA-co-receptor complex, we generated ten in-silico models containing the EcJAZ degron and the COI1-SKP1 of five monocot cereals viz., rice, wheat, maize, Sorghum and Setaria with JA-Ile or coronatine. Our results indicated that the EcJAZ protein of finger millet could act as the signaling hub for the JA and other phytohormone signaling pathways, in response to a diverse set of stressors and developmental cues to provide survival fitness to the plant. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  20. Finger Millet: A “Certain” Crop for an “Uncertain” Future and a Solution to Food Insecurity and Hidden Hunger under Stressful Environments

    Science.gov (United States)

    Gupta, Sanjay Mohan; Arora, Sandeep; Mirza, Neelofar; Pande, Anjali; Lata, Charu; Puranik, Swati; Kumar, J.; Kumar, Anil

    2017-01-01

    Crop growth and productivity has largely been vulnerable to various abiotic and biotic stresses that are only set to be compounded due to global climate change. Therefore developing improved varieties and designing newer approaches for crop improvement against stress tolerance have become a priority now-a-days. However, most of the crop improvement strategies are directed toward staple cereals such as rice, wheat, maize etc., whereas attention on minor cereals such as finger millet [Eleusine coracana (L.) Gaertn.] lags far behind. It is an important staple in several semi-arid and tropical regions of the world with excellent nutraceutical properties as well as ensuring food security in these areas even during harsh environment. This review highlights the importance of finger millet as a model nutraceutical crop. Progress and prospects in genetic manipulation for the development of abiotic and biotic stress tolerant varieties is also discussed. Although limited studies have been conducted for genetic improvement of finger millets, its nutritional significance in providing minerals, calories and protein makes it an ideal model for nutrition-agriculture research. Therefore, improved genetic manipulation of finger millets for resistance to both abiotic and biotic stresses, as well as for enhancing nutrient content will be very effective in millet improvement. Key message: Apart from the excellent nutraceutical value of finger millet, its ability to tolerate various abiotic stresses and resist pathogens make it an excellent model for exploring vast genetic and genomic potential of this crop, which provide us a wide choice for developing strategies for making climate resilient staple crops. PMID:28487720

  1. Finger Millet: A “Certain” Crop for an “Uncertain” Future and a Solution to Food Insecurity and Hidden Hunger under Stressful Environments

    Directory of Open Access Journals (Sweden)

    Anil Kumar

    2017-04-01

    Full Text Available Crop growth and productivity has largely been vulnerable to various abiotic and biotic stresses that are only set to be compounded due to global climate change. Therefore developing improved varieties and designing newer approaches for crop improvement against stress tolerance have become a priority now-a-days. However, most of the crop improvement strategies are directed toward staple cereals such as rice, wheat, maize etc., whereas attention on minor cereals such as finger millet [Eleusine coracana (L. Gaertn.] lags far behind. It is an important staple in several semi-arid and tropical regions of the world with excellent nutraceutical properties as well as ensuring food security in these areas even during harsh environment. This review highlights the importance of finger millet as a model nutraceutical crop. Progress and prospects in genetic manipulation for the development of abiotic and biotic stress tolerant varieties is also discussed. Although limited studies have been conducted for genetic improvement of finger millets, its nutritional significance in providing minerals, calories and protein makes it an ideal model for nutrition-agriculture research. Therefore, improved genetic manipulation of finger millets for resistance to both abiotic and biotic stresses, as well as for enhancing nutrient content will be very effective in millet improvement.Key message: Apart from the excellent nutraceutical value of finger millet, its ability to tolerate various abiotic stresses and resist pathogens make it an excellent model for exploring vast genetic and genomic potential of this crop, which provide us a wide choice for developing strategies for making climate resilient staple crops.

  2. Whole plant acclimation responses by finger millet to low nitrogen stress

    Directory of Open Access Journals (Sweden)

    Travis Luc Goron

    2015-08-01

    Full Text Available The small grain cereal, finger millet (FM, Eleusine coracana L. Gaertn, is valued by subsistence farmers in India and East Africa as a low-input crop. It is reported by farmers to require no added nitrogen, or only residual N, to produce grain. Exact mechanisms underlying the acclimation responses of FM to low N are largely unknown, both above and below ground. In particular, the responses of FM roots and root hairs to N or any other nutrient have not previously been reported. Given its low N requirement, FM also provides a rare opportunity to study long-term responses to N starvation in a cereal. The objective of this study was to survey the shoot and root morphometric responses of FM, including root hairs, to low N stress. Plants were grown in pails in a semi-hydroponic system on clay containing extremely low background N, supplemented with N or no N. To our surprise, plants grown without deliberately added N grew to maturity, looked relatively normal and produced healthy seed heads. Plants responded to the low N treatment by decreasing shoot, root and seed head biomass. These declines under low N were associated with decreased shoot tiller number, crown root number, total crown root length and total lateral root length, but with no consistent changes in root hair traits. Changes in tiller and crown root number appeared to coordinate the above and below ground acclimation responses to N. We discuss the remarkable ability of FM to grow to maturity without deliberately added N. The results suggest that FM should be further explored to understand this trait. Our observations are consistent with indigenous knowledge from subsistence farmers in Africa and Asia that this crop can survive extreme environments.

  3. Salt tolerance and activity of antioxidative enzymes of transgenic finger millet overexpressing a vacuolar H(+)-pyrophosphatase gene (SbVPPase) from Sorghum bicolor.

    Science.gov (United States)

    Anjaneyulu, Ediga; Reddy, Palle Surender; Sunita, Merla Srilakshmi; Kishor, Polavarapu B Kavi; Meriga, Balaji

    2014-06-15

    A vacuolar proton pyrophosphatase cDNA clone was isolated from Sorghum bicolor (SbVPPase) using end-to-end gene-specific primer amplification. It showed 80-90% homology at the nucleotide and 85-95% homology at the amino acid level with other VPPases. The gene was introduced into expression vector pCAMBIA1301 under the control of the cauliflower mosaic virus 35S (CaMV35S) promoter and transformed into Agrobacterium tumifaciens strain LBA4404 to infect embryogenic calli of finger millet (Eleusine coracana). Successful transfer of SbVPPase was confirmed by a GUS histochemical assay and PCR analysis. Both, controls and transgenic plants were subjected to 100 and 200mM NaCl and certain biochemical and physiological parameters were studied. Relative water content (RWC), plant height, leaf expansion, finger length and width and grain weight were severely reduced (50-70%), and the flowering period was delayed by 20% in control plants compared to transgenic plants under salinity stress. With increasing salt stress, the proline and chlorophyll contents as well as the enzyme activities of superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), guaiacol peroxidase (GPX) and glutathione reductase (GR) increased by 25-100% in transgenics, while malondialdehyde (MDA) showed a 2-4-fold decrease. The increased activities of antioxidant enzymes and the reduction in the MDA content suggest efficient scavenging of reactive oxygen species (ROS) in transgenics and, as a consequence, probably alleviation of salt stress. Also, the leaf tissues of the transgenics accumulated 1.5-2.5-fold higher Na(+) and 0.4-0.8-fold higher K(+) levels. Together, these results clearly demonstrate that overexpression of SbVPPase in transgenic finger millet enhances the plant's performance under salt stress. Copyright © 2014 Elsevier GmbH. All rights reserved.

  4. Whole plant acclimation responses by finger millet to low nitrogen stress.

    Science.gov (United States)

    Goron, Travis L; Bhosekar, Vijay K; Shearer, Charles R; Watts, Sophia; Raizada, Manish N

    2015-01-01

    The small grain cereal, finger millet (FM, Eleusine coracana L. Gaertn), is valued by subsistence farmers in India and East Africa as a low-input crop. It is reported by farmers to require no added nitrogen (N), or only residual N, to produce grain. Exact mechanisms underlying the acclimation responses of FM to low N are largely unknown, both above and below ground. In particular, the responses of FM roots and root hairs to N or any other nutrient have not previously been reported. Given its low N requirement, FM also provides a rare opportunity to study long-term responses to N starvation in a cereal species. The objective of this study was to survey the shoot and root morphometric responses of FM, including root hairs, to low N stress. Plants were grown in pails in a semi-hydroponic system on clay containing extremely low background N, supplemented with N or no N. To our surprise, plants grown without deliberately added N grew to maturity, looked relatively normal and produced healthy seed heads. Plants responded to the low N treatment by decreasing shoot, root, and seed head biomass. These declines under low N were associated with decreased shoot tiller number, crown root number, total crown root length and total lateral root length, but with no consistent changes in root hair traits. Changes in tiller and crown root number appeared to coordinate the above and below ground acclimation responses to N. We discuss the remarkable ability of FM to grow to maturity without deliberately added N. The results suggest that FM should be further explored to understand this trait. Our observations are consistent with indigenous knowledge from subsistence farmers in Africa and Asia, where it is reported that this crop can survive extreme environments.

  5. Identification and characterization of calcium transporter gene family in finger millet in relation to grain calcium content.

    Science.gov (United States)

    Singh, Uma M; Metwal, Mamta; Singh, Manoj; Taj, Gohar; Kumar, Anil

    2015-07-15

    Calcium (Ca) is an essential mineral for proper growth and development of plants as well as animals. In plants including cereals, calcium is deposited in seed during its development which is mediated by specialized Ca transporters. Common cereal seeds contain very low amounts of Ca while the finger millet (Eleusine coracana) contains exceptionally high amounts of Ca in seed. In order to understand the role of Ca transporters in grain Ca accumulation, developing seed transcriptome of two finger millet genotypes (GP-1, low Ca and GP-45 high Ca) differing in seed Ca content was sequenced using Illumina paired-end sequencing technology and members of Ca transporter gene family were identified. Out of 109,218 and 120,130 contigs, 86 and 81 contigs encoding Ca transporters were identified in GP-1 and GP-45, respectively. After removal of redundant sequences, a total of 19 sequences were confirmed as Ca transporter genes, which includes 11 Ca(2+) ATPases, 07 Ca(2+)/cation exchangers and 01 Ca(2+) channel. The differential expressions of all genes were analyzed from transcriptome data and it was observed that 9 and 3 genes were highly expressed in GP-45 and GP-1 genotypes respectively. Validation of transcriptome expression data of selected Ca transporter genes was performed on different stages of developing spikes of both genotypes grown under different concentrations of exogenous Ca. In both genotypes, significant correlation was observed between the expression of these genes, especially EcCaX3, and on the amount of Ca accumulated in seed. The positive correlation of seed mass with the amount of Ca concentration was also observed. The efficient Ca transport property and responsiveness of EcCAX3 towards exogenous Ca could be utilized in future biofortification program. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Enhancing micronutrient content of beverage powder by incorporating malted finger millet

    Directory of Open Access Journals (Sweden)

    Jaya Tripathi

    2014-12-01

    Full Text Available Introduction: There is growing interest in the role of the micronutrients in optimizing health, and in prevention or treatment of disease. Micronutrients play a central part in metabolism and in the maintenance of tissue function, an adequate intake therefore is necessary. Rationale: This research work was concerned with the development of micronutrient especially calcium rich instant health beverage powder from malted finger millet (Eleusine coracana and gurhal powder (Hibiscus rosa- sinensis. Aims & Objectives: In this study attempts have been made to investigate that whether the extruded malted finger millet flour and hibiscus flower powder has improved the nutritional and phytochemical quality of instant health beverage powder without deteriorating their sensory properties and whether it can be a supplement for calcium deficit sedentary women. Materials and methods: Instant health beverage powder was prepared by adding malted and extruded finger millet with glucose, hibiscus flower powder, citric acid and vanilla essence. All the ingredients were mixed well. Prior to consumption this powder was dissolved in water and stirred well manually. Further Instant health beverage powder was assessed for nutritional composition. Results: Results shows that beverage powder has very high content of protein (12.25 % and calcium (96.5 % along with highly beneficial neutraceutical properties as compared with the health drinks available in market, it is because of enhanced antioxidant activity resulted due to the incorporation of gurhal leaf powder and malting of the finger millet. Conclusion: This study may prove as a potential step to utilise malted finger millet as a supplement for calcium deficit women. The nutritional composition was found sufficient enough to meet approximately one fourth of RDA of Protein and Calcium as prescribed by NIN, India for sedentary women who are the main sufferers of calcium deficiencies in various life stages

  7. Influence of heat processing on the bioaccessibility of zinc and iron from cereals and pulses consumed in India.

    Science.gov (United States)

    Hemalatha, Sreeramaiah; Platel, Kalpana; Srinivasan, Krishnapura

    2007-01-01

    Influence of heat processing on the bioaccessibility of zinc and iron from food grains consumed in India was evaluated. Cereals - rice (Oryza sativa), finger millet (Eleusine coracana), sorghum (Sorghum vulgare), wheat (Triticum aestivum), and maize (Zea mays), and pulses - chickpea (Cicer arietinum) - whole and decorticated, green gram (Phaseolus aureus) - whole and decorticated, decorticated black gram (Phaseolus mungo), decorticated red gram (Cajanus cajan), cowpea (Vigna catjang), and French bean (Phaseolus vulgaris) were examined for zinc and iron bioaccessibility by employing an in vitro dialysability procedure. Both pressure-cooking and microwave heating were tested for their influence on mineral bioaccessibility. Zinc bioaccessibility from food grains was considerably reduced upon pressure-cooking, especially in pulses. Among cereals, pressure-cooking decreased zinc bioaccessibility by 63% and 57% in finger millet and rice, respectively. All the pressure-cooked cereals showed similar percent zinc bioaccessibility with the exception of finger millet. Bioaccessibility of zinc from pulses was generally lower as a result of pressure-cooking or microwave heating. The decrease in bioaccessibility of zinc caused by microwave heating ranged from 11.4% in chickpea (whole) to 63% in cowpea. Decrease in zinc bioaccessibility was 48% in pressure-cooked whole chickpea, 45% and 55% in pressure-cooked or microwave-heated whole green gram, 32% and 22% in pressure-cooked or microwave-heated decorticated green gram, and 45% in microwave-heated black gram. Iron bioaccessibility, on the other hand, was significantly enhanced generally from all the food grains studied upon heat treatment. Thus, heat treatment of grains produced contrasting effect on zinc and iron bioaccessibility.

  8. Misturas de forrageiras anuais e perenes para sucessão à soja em sistemas de integração lavoura‑pecuária

    Directory of Open Access Journals (Sweden)

    Luís Armando Zago Machado

    2012-04-01

    Full Text Available O objetivo deste trabalho foi avaliar a produção de forragem de espécies perenes e de suas misturas com espécies anuais, durante a estação seca, e a produtividade de grãos de soja cultivada em sucessão. Os experimentos foram realizados em 2007 e 2008, em Dourados e em São Gabriel do Oeste, MS. Em 2007, foram avaliadas as espécies Urochloa brizantha ('Xaraés' e Megathyrsus maximus ('Tanzânia', em cultivos solteiros ou em misturas com Eleusine coracana (capim‑pé‑de‑galinha, Pennisetum glaucum (milheto e Sorghum bicolor (sorgo forrageiro. Em 2008, foram avaliados U. decumbens e as cultivares Xaraés e Tanzânia em cultivos solteiros ou em misturas com milheto e sorgo forrageiro. As forrageiras foram avaliadas sob sucessivos cortes, durante a estação seca, e a soja no verão, no cultivo em sucessão. As misturas de espécies anuais e perenes não aumentam a produção de forragem, mas melhoram sua distribuição ao longo da estação seca. As forrageiras anuais têm maior participação na produção de forragem das misturas no início da estação seca, e as perenes no final dessa estação. A relação folha/colmo das forrageiras perenes individuais é maior do que a das misturas. Os tratamentos avaliados não têm efeito sobre a soja cultivada em sucessão.

  9. Land-use change in Indian tropical agro-ecosystems: eco-energy estimation for socio-ecological sustainability.

    Science.gov (United States)

    Nautiyal, Sunil; Kaechele, Harald; Umesh Babu, M S; Tikhile, Pavan; Baksi, Sangeeta

    2017-04-01

    This study was carried out to understand the ecological and economic sustainability of floriculture and other main crops in Indian agro-ecosystems. The cultivation practices of four major flower crops, namely Jasminum multiflorum, Crossandra infundibuliformis, Chrysanthemum and Tagetes erecta, were studied in detail. The production cost of flowers in terms of energy was calculated to be 99,622-135,996 compared to 27,681-69,133 MJ ha -1 for the main crops, namely Oryza sativa, Eleusine coracana, Zea mays and Sorghum bicolor. The highest-energy input amongst the crops was recorded for Z. mays (69,133 MJ ha -1 ) as this is a resource-demanding crop. However, flower cultivation requires approximately twice the energy required for the cultivation of Z. mays. In terms of both energy and monetary inputs, flower cultivation needs two to three times the requirements of the main crops cultivated in the region. The monetary inputs for main crop cultivation were calculated to be ₹ 27,349 to ₹ 46,930 as compared to flower crops (₹ 62,540 to ₹ 144,355). Floriculture was found to be more efficient in monetary terms when compared to the main crops cultivated in the region. However, the energy efficiency of flower crops is lower than that of the main crops, and the energy output from flower cultivation was found to be declining in tropical agro-ecosystems in India. Amongst the various inputs, farmyard manure accounts for the highest proportion, and for its preparation, most of the raw material comes from the surrounding ecosystems. Thus, flower cultivation has a direct impact on the ecosystem resource flow. Therefore, keeping the economic and environmental sustainability in view, this study indicates that a more field-based research is required to frame appropriate policies for flower cultivation to achieve sustainable socio-ecological development.

  10. Physiological Role of a Multigrain Diet in Metabolic Regulations of Lipid and Antioxidant Profiles in Hypercholesteremic Rats

    Directory of Open Access Journals (Sweden)

    Rupal A. Vasant

    2014-06-01

    Full Text Available Objectives:The objective of the present study was to investigate the lipid and the antioxidant regulatory potential of a multigrain diet in laboratory animals with reference to lipid profiles, tissue lipid peroxidation and antioxidant status. Methods: Two types of diets, with or without addition of cholesterol, were used in the study – a commercial diet and a formulated multigrain diet (with Sorghum vulgare, Avena sativa, Pennisetum typhoideum, Oryza sativa, Eleusine coracana and Zea mays grains. After a 10-week period of feeding the diets to albino rats the plasma, liver and fecal lipid profiles and the hepatic and renal antioxidant status of the animals that were fed the commercial and the formulated diets (with and without cholesterol addition were assessed. Results: The commercial diet supplemented with cholesterol elevated the levels of plasma total lipids, total cholesterol, triglycerides, low-density lipoprotein cholesterol (LDL-C, and very low-density lipoprotein cholesterol (VLDL-C, as well as the atherogenic index (AI. The high-density lipoprotein cholesterol (HDL-C content and the antioxidant profiles (total ascorbic acid, superoxide dismutase, catalase, glutathione peroxidase reduced glutathione declined along with increases in lipid peroxidation. The formulated diet (with and without addition of cholesterol was found to be more efficient than the commercial diet in controlling plasma, hepatic and fecal lipid profiles, as well as hepatic and renal lipid peroxidation and antioxidant status, than of the hypercholesteremic animals. Conclusion:The multigrain diet used in the present study is effective in countering the hyperlipidemia and oxidative stress caused by high cholesterol intake.

  11. Effect of gamma irradiation on total carbohydrate concentration of finger millet flour

    International Nuclear Information System (INIS)

    Lathika; Patil, Shrikant L.; Bhasker Shenoy, K.; Somashekarappa, H.M.

    2015-01-01

    Ragi or finger millet (Eleusine coracana L.) is one of the common millets in several regions of India. The effect of gamma irradiation, on ragi flour was investigated in the study. Ragi flour is procured from market. Flour samples of 50 gms were taken in triplicates in a polyethylene pouch, air sealed and subjected to gamma irradiation doses ranging from 0.25 to 10 kGy and stored in polyethylene bags and plastic containers for a period of 30 and 90 days. Within 24 hours of irradiation, the samples were tested for total carbohydrate concentration by phenol-sulphuric acid method. The same was repeated after 30 and 90 days of storage. The comparative study showed that, at 0 day, total carbohydrate concentration has decreased slightly when compared to the non-irradiated sample (0.024 mg/ml). The lowest concentration of carbohydrate is seen at 0.025 kGy (0.019mg/ml). The samples stored in polyethylene bag, after 30 days showed both increase (0.056 mg/ml at 0.025 kGy) and decrease (0.04 mg/ml at 10 kGy) in total carbohydrate concentration when compared to control (0.046 mg/ml). 90 days stored samples showed increase in carbohydrate concentration when compared to control (0.029 mg/ml). The highest carbohydrate concentration is seen in 1 kGy dose (0.037 mg/ml). The samples stored at container after 30 days showed both increase (0.045 mg/ml at 5 kGy) and decrease (0.034 mg/ml at 0.025 mg/ml) of carbohydrate concentration when compared to control (0.043 mg/ml). 90 days stored samples showed decrease in carbohydrate concentration when compared to control (0.034 mg/ml). The lowest concentration is seen at 5 kGy (0.022 mg/ml). (author)

  12. Análisis de los recursos de apoyo social de los inmigrantes africanos y latinoamericanos en Andalucía tipología de redes y proceso de adaptación

    OpenAIRE

    Maya Jariego, Isidro

    1999-01-01

    Nuestra investigación es un análisis de la estructura y las funciones del microsistema de los inmigrantes extra-comunitarios residentes en Andalucía, una vez que han empezado a experimentar el efecto de la reubicación geográfica. En concreto, los objetivo

  13. O CARAMUJO AFRICANO EM CONTEXTO ESCOLAR: AS PERCEPÇÕES DE ESTUDANTES DO ENSINO FUNDAMENTAL E O ESTUDO DA HELMINTOFAUNA ASSOCIADA AO CARAMUJO EM BARRA DO PIRAÍ (RJ

    Directory of Open Access Journals (Sweden)

    Zilene Moreira Pereira

    2012-01-01

    Full Text Available The study investigates elementary students’ perception of the species Achatina fulica (African snail and the risks this mollusc may pose to the population of Barra do Piraí – in the state of Rio de Janeiro. The research involved questionnaires, focus groups and field observations, besides A. fulica specimens parasitological analysis. The results indicated the presence of snails infected with nematodes of medical and veterinary interest in the locality. The students have a negative perception of the snail, and there is great difference between their perceptions and scientific knowledge. Based on the contributions of the perceptions study and of Meaningful Learning Theory, guidelines are suggested so that strategies for teaching the content regarding the African snail at school environment can be developed.

  14. Avaliação dos problemas enfrentados no manejo do caramujo gigante africano Achatina fulica (Gastropoda: Pulmonata no Brasil Evaluation of the problems faced in the management of the giant African snail Achatina fulica (Gastropoda: Pulmonata in Brazil

    Directory of Open Access Journals (Sweden)

    Eduardo Colley

    2009-12-01

    Full Text Available The giant African snail Achatina fulica Bowdich, 1822 was introduced into Paraná, Brazil, in the 1980s. Since then, it has spread across the country, despite its known invasive status on a global scale. The main objective of this study was to assess the problems faced in the management of the giant African snail. To accomplish that, we gathered and analyzed information available on the internet, scientific databases, field studies, as well as interviews and consultations with official agencies, NGOs, museums, the scientific community and people that coexist with the species. Despite the fact that extensive information has been generated regarding A. fulica (1,340 articles, 65 summaries in national annals, 40,700 pages on the internet, essential to promote control measures to hinder the propagation of this species, the majority of the available information remains inaccessible to the world at large. Moreover, the environmental, economic and health impacts of this species remain unclear, which may contribute to discouraging the initiation of management actions. Finally, control measures are still inefficient due to the generalist profile of this species and the lack of knowledge concerning its biology and ecology. Thus, in conclusion, even though A. fulica has been an invasive species for over a century in many other countries, it is difficult to find evidence supporting the need to subsidize its management. This may be an indication that many other, poorly known exotic species will have time and the proper conditions to become established and cause problems before they come to be recognized as invasive.

  15. Intervención dirigida a población diabética de origen africano subshariano residente en la ciudad de Lleida desde una perspectiva de desigualdades sociales en salud

    OpenAIRE

    Torres Salguero, Cristian

    2013-01-01

    Este trabajo tiene como objetivo mejorar el estado de salud de la población inmigrante subsahariana residente en Lleida que sufre desigualdades en salud y que ha sido diagnosticada de diabetes mellitus. Para ello se utilizará como herramienta la educación sanitaria sobre alimentación y hábitos dietéticos adaptada a las necesidades individuales de cada paciente.

  16. Entre a fábrica e a senzala: um estudo sobre o cotidiano dos africanos livres na Real Fábrica de Ferro São João do Ipanema - Sorocaba - SP (1840-1870)

    OpenAIRE

    Ribeiro, Mariana Alice Pereira Schatzer [UNESP

    2014-01-01

    This thesis intend to analyze the experience of free Africans in an imperial factory environment, the Fábrica de Ferro São João do Ipanema, located in Sorocaba – SP, searching to see them as historical subjects, inserted in the slavery and active resistance of such a system relations. This study is a sequence of work done in scientific research developed during the year of 2010, which we examine the life of slave laborers between 1835-1838. As already held a work with the slaves, called Creol...

  17. Biomassa, decomposição e cobertura do solo ocasionada por resíduos culturais de três espécies vegetais na região centro-oeste do Brasil Biomass, decomposition and soil cover by residues of three plant species in central- western Brazil

    Directory of Open Access Journals (Sweden)

    Carlo Adriano Boer

    2008-04-01

    Full Text Available Com a crescente adoção da semeadura direta na região Centro-Oeste do Brasil, faz-se necessário maior conhecimento sobre as plantas de cobertura para produção de palha. O presente estudo teve como objetivo avaliar a produção de biomassa verde e seca, a percentagem de cobertura do solo, bem como a dinâmica da decomposição da palhada de três espécies de plantas de cobertura em safrinha: amaranto (Amaranthus cruentus L. BRS Alegria, milheto (Pennisetum glaucum L. var. ADR500 e capim-pé-de-galinha [Eleusine coracana (L. Gaertn.]. O trabalho foi conduzido em um Latossolo Vermelho distroférrico textura argilosa. O delineamento experimental utilizado foi o de blocos casualizados, no esquema de parcelas subdivididas no tempo, com quatro repetições. Nas parcelas foram alocadas as espécies, subdivididas em nove épocas de avaliação (0, 30, 60, 90, 120, 150, 180, 210 e 240 dias após dessecação química das espécies em estudo. Amostras proporcionais da biomassa seca de cada espécie foram acondicionadas em bolsas de decomposição, que foram dispostas sobre o solo, sendo coletadas a cada 30 dias e pesadas até 240 dias após a instalação, para avaliar a dinâmica de decomposição, após o manejo das plantas de cobertura. O milheto ADR500 e o capim-pé-de-galinha proporcionaram maior produção de biomassa verde e seca, maior cobertura do solo e menores taxas de decomposição da palhada, não diferindo entre si. O milheto ADR500 apresentou maior relação C/N, seguido pelo capim-pé-de-galinha e amaranto. Ajustaram-se, para a percentagem de cobertura do solo e a decomposição de palhadas com o tempo, os modelos sigmoidal e exponencial decrescente, respectivamente. O milheto ADR500 e o capim-pé-de-galinha apresentaram comportamentos semelhantes, não diferindo na comparação dos modelos de cobertura do solo e decomposição de palhadas.With the prevalence of no-till systems in Central-Western Brazil, a more in-depth knowledge

  18. "Expedição portuguesa ao Muatiânvua" como fonte para a história social dos grupos de carregadores africanos do comércio de longa distância na África centro-ocidental

    Directory of Open Access Journals (Sweden)

    Elaine Ribeiro

    2013-12-01

    Full Text Available The objective of this paper is to analyze the spaces and the African agents described in Henrique de Carvalho’s Expedição portuguesa ao Muatiânvua. Considering the civilizational discourse of late nineteenth century, we intend to argue that such descriptions of the expedition routes, because they coincide with the regional trade routes and were performance spaces of different African porters, can be used as a source of social history of long-distance trade of western central Africa.

  19. El lenguaje de los negros congos de Panamá: estudio linguístico

    Directory of Open Access Journals (Sweden)

    John M. Lipski

    1986-06-01

    Full Text Available Es indiscutible la influencia africana sobre el español de la región caribeña; y sin embargo la naturaleza de los contactos hispano-africanos de lossiglos pasados es poco entendida. Al examinar los documentos históricos quellegan hasta el siglo presente, se pone de manifiesto la existencia de modalidades distintamente afrohispánicas entre los esclavos y peones de origen africano.

  20. Herbicidal activity of Pennisetum purpureum (Napier grass)

    African Journals Online (AJOL)

    Yomi

    2012-03-20

    Mar 20, 2012 ... Although, it had no phytotoxic activity on the root or shoot growth of bioassay species, it had ... mays and Eleusine indica seedlings by 11, 31, 37 and. 54%, respectively ..... might provide chemical basis for the development of.

  1. Introducción: Diversidad de poderes en África y resolución de conflictos

    OpenAIRE

    Farré, Albert; Lourenço, Vitor; Tomàs, Jordi

    2009-01-01

    El conjunto de textos recogidos en este volumen son el resultado del seminario internacional “La Paz y la Palabra. Procesos de reconciliación posbélica en el África Subsahariana” celebrado los días 27 y 28 de noviembre de 2008 en Barcelona, coordinado científicamente por el Centro de Estudos Africanos del ISCTE de Lisboa y la red de estudios africanos ARDA/RIDA, con sede en Barcelona, y organizado por la Fundación CIDOB. Este encuentro significaba la segunda edición de un proyecto internacion...

  2. El multiculturalismo en un juego de contextos estatales, regionales y globales en África

    Directory of Open Access Journals (Sweden)

    Maguemati Wabgou

    2013-01-01

    Full Text Available En este artículo se hacen algunas referencias a la riqueza y vitalidad de las culturas de África que sirvan para cimentar políticas multiculturales en el continente. Esto lleva a abordar la problemática sobre la nación incluyente y el Estado en África, y a examinar los alcances de la búsqueda de la unidad nacional a partir de la diversidad cultural de los pueblos africanos; es decir, este artículo se enfoca en el análisis de las relaciones entre los Estados africanos y las diversidades culturales.

  3. A política externa brasileira em relação à Àfrica: o Soft Power em ação no caso angolano

    OpenAIRE

    Sobreira, Shimenia Monte Claro de Araújo

    2013-01-01

    Dissertação de mestrado em Relações Internacionais Esta dissertação tem por objetivo analisar e explicar as ações da política externa brasileira da perspectiva do soft power , que tem sido levadas a cabo no continente africano, durante o governo de Luís Inácio Lula da Silva (2003-2010). Num contexto de Renascimento Africano e subsequente valorização do investimento em África, o Brasil procurou aproveitar a afinidade histórica que aproximava os dois países para aprofundar as rel...

  4. Responsabilidade Social e Desenvolvimento Económico: Uma Análise do Consórcio de Gás Natural em Moçambique

    OpenAIRE

    Massapa, Sebastião João

    2017-01-01

    Pretende-se com esta dissertaçãoanalisar o impacto no desenvolvimento económico e social junto das comunidades locais de Pande e Timane, Província de Inhambane, Moçambique, resultante da responsabilidade social do Consórcio sul-africano Sasolde Gás Natural. A presença do Consórcio sul-africano em Moçambique reflecte os processos de mudançasprofundasque o país vive desde a transição da economia centralmente planificada para uma economia liberal que assenta na relação de complementaridade en...

  5. Organization Development: An Approach for Achieving Desired Organizational Goals within the Venezuelan Navy.

    Science.gov (United States)

    1982-06-01

    major parties, COPEI 3(Social Christian) and AD (Social Democrat). In elections, 3COPEI stands for Comite para Organizacion Politica Independiente...Africanos en la Formacion de la Cultura Venezolana, Caracas: Universidad Central de Venezuela, 1955. 12. Siso, Carlos, La Formacion del Pueblo

  6. Conflito em Darfur: das motivações internas à reação internacional

    Directory of Open Access Journals (Sweden)

    Evandro Farid Zago

    2010-10-01

    Full Text Available Desde 2003 se estende na região sudanesa de Dafur um intenso conflito, tido como um dos mais sangrentos do continente africano. Nesse sentido este artigo busca explicar as questões internacionais e os constrangimentos locais que envolvem tal conflito.

  7. Coetzee, Nooteboom, e o “ilusionismo realista”

    Directory of Open Access Journals (Sweden)

    Felipe Charbel Teixeira

    2011-08-01

    Full Text Available O artigo analisa romances escritos pelo sul-africano J. M. Coetzee e pelo holandês Cees Nooteboom como modo de propor algumas questões sobre o significado do realismo na história literária ocidental.

  8. Editorial: Geopolítica y solidaridad en el siglo XXI

    Directory of Open Access Journals (Sweden)

    Jesús A. Osuna Ceballos

    2015-01-01

    Full Text Available El 26 de mayo de 2013, en el marco de la celebración de los 50 años de la fundación de la Unión Africana, en Addis Abeba, capital de Etiopía, la Señora Dilma Rousseff, Presidenta de Brasil, anunció la condonación de la deuda externa de 870 millones de dólares de un conjunto de doce países africanos, entre los cuales figuran la República del Congo, Sudán, Gabón y Guinea Ecuatorial, países gobernados por dictadores a quienes se les acusa de violación de los derechos humanos, y en algunos casos de genocidio. Gobernantes que han accedido al poder mediante golpes de estado, manteniendo su mandato, en algunos casos a perpetuidad, como Teodoro Obiang Mguena, realizando “elecciones frecuentes, libres y democráticas”, con resultados invariablemente predecibles. ¿Gesto humanitario el de Brasil con los países africanos?. Según opinión de expertos, Brasil tomó esa decisión para que su Banco de Desarrollo Económico y Social pueda financiar proyectos de empresas brasileñas en aquellos estados africanos. Prevaleció el interés económico y el posicionamiento de Brasil en el continente africano.

  9. JPRS Report, West Europe, Reference Aid, Acronyms and Abbreviations of Portugal

    Science.gov (United States)

    1988-09-02

    Bank of Portugal Portuguese Bank of the Atlantic Banco Portugues de Investimentos Portuguese Investment Bank BPSM Banco Pinto & Sotto Mayor BRI...Pinto & Sotto Mayor Bank Boletim de Registo de Importacao Import Register Bulletin BSB Batalhao de Sapadores Bombeiros fire-fighting battalion...3. Congresso Nacional Africano CNAEBA Conselho Nacional de ^ Alfabetizacao e Educacao de Base de Adultos CNASPEL Comissao Nacional de Apoio e

  10. Bellulicauda dialii on Dialium guianense (Leguminosae) in Brazil

    OpenAIRE

    Pereira, Olinto L.; Bosquetti, Lorrayne B.; Barreto, Robert W.

    2005-01-01

    This is the first report of Bellulicauda dialii on Dialium guianense leaves, and the second record of this fungus, previously known only from Africa (Sierra Leone). Bellulicauda dialii é relatado pela primeira vez em folhas de Dialium guianense. Trata-se do segundo registro dessa espécie fúngica, anteriormente conhecida apenas do Continente Africano (Serra Leoa).

  11. Plants diversity and phytoaccumulators identification on the ...

    African Journals Online (AJOL)

    The dominant taxa on the old waste dumpsite having an average density superior to 5 plants/m2 and occurring less frequently on the control site were Alternanthera sessilis, Amaranthus spinosus, Cyperus rotundus, Cyperus iria, Eleusine indica, Euphorbia glomerifera, Ipomoea triloba, Portulaca oleracea and Trianthema ...

  12. Influence de la date de semis et de la fertilisation inorganique sur le ...

    African Journals Online (AJOL)

    SARAH

    30 avr. 2014 ... sont la désorganisation complète de la structure agricole, le manque de matériel .... digitatum, Eleusine indica, Tithonia diversifolia,. Panicum maximum ..... effects on electro-chemical properties of. Ferralsols in the Upper ...

  13. Glyphosate-resistant goosegrass from Mississippi

    Science.gov (United States)

    A glyphosate resistant population of goosegrass (Eleusine indica (L.) Gaertn.) was documented near Stoneville, Mississippi, USA, in an area which had received multiple applications of glyphosate each year for the previous eleven years. Resistance ratios based on dose response growth reduction assays...

  14. Distribution host status and potential sources of resistance to Vittatidera zeaphila

    Science.gov (United States)

    Vittatidera zeaphila was described from stunted Zea mays (corn) roots collected in northwestern Tennessee (Obion County) in 2006. Similar cyst specimens had previously been collected in 1978 from Lauderdale County, TN, on Eleusine indica (goosegrass). Comparison of the 1978 specimens deposited in t...

  15. Cultural Resources Reconnaissance Study of the Black Warrior-Tombigbee System Corridor, Alabama. Volume 1. Archaeology.

    Science.gov (United States)

    1983-01-01

    rigidulum and P. dichotomi- florum, goose grass ( Eleusine indica ), the love grass (Eragrostis glome- rata), and red-root sedge (Cyperus erythrorhizos...type, Weeden Island Incised, is considered to be an indica - tion of late Porter. This assumption is apparently supported by the dated assemblage at Site

  16. Prevalence of Finger Millet Diseases in Kaberamaido Subcounty ...

    African Journals Online (AJOL)

    world, the most important disease of finger mil- let is blast caused by the fungus Pyricularia grisea (Cook) Sacc (Adipala, 1980; Emechebe,. 1975i MCrae, 1922). Tar spot, caused by. Phyllachora eleusines P. Hen, is common on fin- ger millet approaching maturity especially in cooler and wetter areas of Uganda (Hen, 1970).

  17. Cultura material, oralidade e simbologia. Existe uma filosofia em África?

    Directory of Open Access Journals (Sweden)

    Vicente Geraldo Amâncio Diniz Oliveira

    2003-10-01

    Full Text Available Considerando-se o modus vivendi africano, não há dúvida de que há uma visão de mundo que poderia se configurar como “Filosofia”. A valorização, tanto da cultura material como da riqueza espiritual e princípios éticos dos diversos grupos que compõem o mosaico cultural africano, evidencia o legado de gerações passadas às novas gerações. Mesmo não havendo uma sistematização do conhecimento, haveria, pois, uma filosofia de vida em que a herança cultural recebida é continuamente reelaborada e confrontada com a dinamicidade da realidade circundante, que se mostra em contínuo vir-a-ser.

  18. La presencia de Negros en la Nordpatagonia. 1779-1837

    Directory of Open Access Journals (Sweden)

    Dora Noemí Martínez de Gorla

    2003-12-01

    Full Text Available This paper studies the juridical and social effects created by the individual assimilation of the slave and freeperson in the Rio Negro and the massive entrance of blacks during the war with Brazil, a historic moment when differences were established between African blacks and American blacks. This distinction was modified with the decree of September 12, 1827, when such distinctions were abolished.//Este trabajo estudia los efectos jurídicos y sociales creados por la asimilación individual del esclavo y de la persona libre en el Rio Negro y la entrada masiva de africanos durante la guerra con Brasil, momento histórico en el que las diferencias entre africanos negros y americanos negros fueron establecidas. Esta distinción fue modificada con el decreto 12 de 1827, cuando se abolieron tales diferencias.

  19. EL BREXIT, LA UE Y LAS INCERTIDUMBRES ESTRATÉGICAS: IMPLICACIONES A CORTO, MEDIANO Y LARGO PLAZO PARA ÁFRICA SUBSAHARIANA

    Directory of Open Access Journals (Sweden)

    Yoslán Silverio González

    2017-09-01

    Full Text Available El presente artículo analisa los posibles efectos de la salida del Reino Unido de la Unión Europea para el continente africano. El contenido lleva en consideración los elementos políticos, financeros, económicos y de seguridad y defensa para las relaciones bilaterales y multilaterales de África. Además, un importante elemento de la analisis es avaluar como la influencia de otros países de Europa en África, en especial de Francia, podrá cambiar en consequencia de una distinta actuación británica hacia el continente africano. El articulo plantea distintos cenarios, algunos más optimistas que otros.

  20. The plateau of trials: modern ethnicity in Angola

    OpenAIRE

    Martins, Vasco

    2015-01-01

    Tese de Doutoramento em Estudos Africanos This thesis is a study about the modern ethnicity of the Ovimbundu of the central highlands of Angola. It shows how Ovimbundu conceptions of ethnicity became altered and enhanced by processes of modernisation, usually introduced by foreign agents, and how this modernisation came to play a critical role after independence. Following a contrast in existing literature between either the attribution of vital importance to ethnicity in human agency o...

  1. Cinco dificultades para construir la historia de la filosofía africana

    OpenAIRE

    de Diego González, Antonio

    2013-01-01

    Desde la teoría postcolonial se han cuestionado los modelos de historia de las ideas impuestos por el africanismo y el orientalismo. Diferentes teóricos africanos –Bachir Diagne, Mundimbe, Wiredu o Kete Asante– han formulado diversas soluciones para superar las dificultades. Este trabajo explora las principales dificultades y las propuestas para elaborar una historia de la filosofía africana. The postcolonial theory was questioning the patterns of History of Ideas imposed by Orientalism an...

  2. African leaders and trust deficit culture: Power, politics, and the ...

    African Journals Online (AJOL)

    Este artigo traça a elevação das ondas das incursões militares com particular ênfase sobre o regime do General Ibrahim Babangida, desaires de liderança e sucessos da sua administração, de modo a estabelecer o uso apropriado da frase “Líderes Africanos e Cultura Deficitária de Confiança” dentro do contexto de ...

  3. Novas dimensões do terror: ramificações da Al-Qaeda na Somália e seus significados para a segurança internacional

    Directory of Open Access Journals (Sweden)

    IZADORA XAVIER DO MONTE

    2010-11-01

    Full Text Available O presente artigo tem como foco a expansão do terror à África, causada pelas ramificações da Al-Qaeda sob território Somali. Nesse sentido buscar-se-á delinear os impactos e conseqüências que a expansão dessa organização terá para a segurança internacional, em particular no continente africano.

  4. El auge y el declive de las culturas del África Occidental (o Atlántica / The Rise and Fall of West (or Atlantic African Cultures

    Directory of Open Access Journals (Sweden)

    Justo Bolekia Boleká

    2014-12-01

    Full Text Available Cada uno de los pueblos negro-africanos presenta un perfil cultural que le hace ser singular y esencialmente semejante a otros, como parte importante de un todo cultural, algunas veces difícil de determinar explícitamente.  Los procesos que definían a los negro-africanos experimentaron una acelerada transformación debido al choque cultural que vivieron durante casi cinco siglos de su historia. Este choque debilitó sus estructuras culturales, creando Estados con lenguas extranjeras oficiales,  religiones de importación, escuelas desvernacularizadas, etc., y desplazando los tradicionales sistemas sociopolíticos negro-africanos. Esta fuerte aculturación del África negra se ve fortalecida por la dominancia de la cultura exógena, que impide la reconfiguración etnocultural de sus habitantes y sociedades. Este es el gran reto de su futuro: fortalecer sus diversidades y enseñar a sus habitantes a aprender a ser africanos.Each black African peoples presents a cultural identity that makes it unique and essentially similar to others, as an important element of a whole culture, sometimes difficult to determine. The processes that defined black Africans experienced a accelerated transformation due to the culture shock lived for five centuries of their history. This shock weakened their cultural structures, creating states with official foreign languages, imported religions, acculturated schools, etc., and replacing the traditional black-African socio-political systems with Western models. This strong acculturation of black Africa was strengthened by the exogenous culture dominance; avoiding the ethno-cultural reconfiguration of its people and societies. This is the great challenge of their future: to strengthen African diversities and to teach the people to learn to be Africans.

  5. Medicines registration in Portuguese-speaking African countries, focusing in the following countries: Angola, Cap Verde and Mozambique

    OpenAIRE

    Figueiredo, Alina Maria Moreira de

    2015-01-01

    This work aims to present the regulation perspective on the medicines registration in PALOPs – Países Africanos de Língua Oficial Portuguesa (Portuguese‐speaking African countries), their regulatory requirements, constraints and opportunities, focusing on the following countries: Angola, Cape Verde and Mozambique. This thesis has as purpose to deepen and systematize knowledge with regard to the registration procedure of medicines in the selected countries. Regulatory pers...

  6. Fitotossine di Inula viscosa per il controllo di piante parassite

    OpenAIRE

    Avolio, Fabiana

    2013-01-01

    Le piante parassite sono incapaci di sintetizzare dagli elementi minerali e nutritivi materiali sufficienti per la loro crescita e sopperiscono a questa deficienza fisiologica utilizzando le sostanze elaborate dalle piante ospiti, che di conseguenza manifestano generalmente una crescita ridotta. Le Orobanche, la Striga e la Cuscuta sono le piante parassite più diffuse nelle regioni del Mediterraneo e del continente africano interessando colture di rilevanza strategica. Diverse strategie...

  7. Weed Hosts of Meloidogyne arenaria and M. incognita Common in Tobacco Fields in South Carolina.

    Science.gov (United States)

    Tedford, E C; Fortnum, B A

    1988-10-01

    Thirty-two weed species common in South Carolina and one cultivar of tobacco were evaluated as hosts of Meloidogyne arenaria race 2 and M. incognita race 3 in the greenhouse. Egg mass production and galling differed (P Eleusine indica, Sorghum halepense, Setaria viridis, Digitaria sanguinalis, and Datura stramonium were poor hosts for M. arenaria. Amaranthus palmeri, Amaranthus hybridus, Chenopodium album, Euphorbia maculata, Setaria lutescens, Vicia villosa, Sida spinosa, Rumex crispus, and Portulaca oleracea were moderate hosts and Ipomoea hederacea var. integriuscula, Xanthium strumarium, Cyperus esculentus, Cynodon dactylon, Paspalum notatum, Eleusine indica, Setaria viridis, and Rumex acetosella were poor hosts for M. incognita. None of the above were good hosts for M. incognita. Tobacco 'PD4' supported large numbers of both nematode species.

  8. Géneros narrativos nas literaturas africanas de língua portuguesa – entre a tradição africana e o “cânone ocidental”

    Directory of Open Access Journals (Sweden)

    Inocência Mata

    2015-11-01

    Full Text Available Depois do golpe de Estado em Portugal, a 25 de Abril de 1974, começámos, nos países africanos ainda colónias de Portugal, a estudar os “nossos” escritores. Andava eu ainda no liceu e naquele tempo não me lembro de termos estudado autores brasileiros e muito menos africanos. Por isso, na altura, uma questão que me intrigou q uando tive contacto com os primeiros textos africanos, foi a palavra estória – em vez de conto – para referir narrativas curtas. Primeiro pensei tratar-se de mais um “africanismo” (explicação então em voga para qualquer “desvio”; depois, quando fui aprofundando o estudo das literaturas africanas, na Faculdade de Letras da Universidade de Lisboa, como aluna do Professor Manuel Ferreira, esta questão nunca foi referida como “problema” e, por isso, a designação “naturalizou-se”… Até que me tornei estudiosa dessas literaturas, já então conhecedora da presença do termo na literatura brasileira.

  9. África fuera de África: apuntes para pensar el africanismo en Colombia

    Directory of Open Access Journals (Sweden)

    Martín Kalulambi Pongo

    2005-06-01

    Full Text Available From the generic notion of Africanism, understood like the set of "social and human sciences applied to Africa", the author makes a balance on the African studies in Colombia, especially in anthropology and history. He sustains that African studies do not have to loose their specificity before the height of afro Colombian studies. As objectives one sets out: a To explain the genesis of the different writings of the black Colombias and Africa; b to discuss the emptiness and the present dilemmas of African studies and c to indicate the susceptible perspective to position the African studies in the Colombian average where the knowledge take place.//Desde la noción genérica de africanismo, entendida como el "conjunto de ciencias sociales y humanas aplicadas al África", el autor realiza un balance sobre los estudios africanos en Colombia, especialmente en antropología y en historia. Sostiene que los estudios africanistas no deben perder su especificidad ante el auge de los estudios afro-co��lombianos. Como objetivos se propone: a explicar la génesis de Ias distintas escrituras sobre las Colombias negras y el África; b discutir las lagunas y los dilemas actuales de los estudios africanos y c señalar las perspectivas susceptibles de posicionar los estudios africanos en los medios colombianos donde se producen los conocimientos.

  10. A «África (eternamente renascida». Relendo três dos «seus» insignes pensadores: Léopold Sédar Senghor, Frantz Fanon e Amílcar Cabral / «Africa (eternally reborn». Revising three of the most important intelectualls: Léopold Sédar Senghor, Frantz...

    Directory of Open Access Journals (Sweden)

    José Carlos Venâncio

    2014-12-01

    Full Text Available Partindo do pressuposto de que a ideia de África é, em muito, devedora do entendimento que os nacionalistas africanos tinham das suas sociedades, discute-se o contributo específico de três nacionalistas, conquanto um deles, Frantz Fanon não seja de origem africana, mas sim antilhana. O nacionalismo é, neste contexto, entendido como parte de um movimento mais vasto, o do renascimento africano, ciclicamente evocado pelos líderes africanos e, deste modo, entendido como um movimento de longa duração (longue durée. Assuming that the idea of Africa owes much to the understanding African nationalists had of their societies, the specific contribution of three nationalists is here discussed, although one of them, Frantz Fanon, is not of African origin, but from the Antilles. In this context, nationalism is understood as part of a larger movement, the African renaissance movement, cyclically evoked by African leaders and therefore must be understood as a long-term movement (longue durée.

  11. Botánica y Medicina africanas en la Nueva Granada, Siglo XVII.

    Directory of Open Access Journals (Sweden)

    Luz Adriana Maya Restrepo.

    2000-06-01

    Full Text Available La relación que los bozales (africanos que llegaban directamente de Africa que no se expresaban en lengua castellana ni conocían la fe católica y sus hijos nacidos en la Nueva Granada mantuvieron con los vegetales y los animales, en particular las aves, es otro de los legados ancestrales que la nación colombiana le debe a Africa. Los africanos le transmitieron a sus descendientes saberes y técnicas sobre el mundo vegetal y animal. Estos conocimientos, que fueron utilizados para curar los males del cuerpo y los del alma, se caracterizaban por un componente experimental cuyo éxito dependía también de la interacción con los espíritus. De ahí que el Tribunal de la Inquisición de Cartagena hubiera juzgado a los africanos y a sus hijos en calidad de "brujos(as", "hechiceros(as" y "curanderos(as".

  12. Relações de interferência entre plantas daninhas e a cultura do grão-de-bico

    OpenAIRE

    Amaral, Carita Liberato do [UNESP; Pavan, Guilherme Bacarim [UNESP; Souza, Marcelo Claro de; Martins, José Valcir Fidelis [UNESP; Alves, Pedro Luis da Costa Aguiar [UNESP

    2015-01-01

    The grains of chickpea consumed in Brazil are almost entirely imported. Considering that chickpeas presents conditions to be cultivated in some regions of Brazil, this study aimed to study interference of six weed plants (Amaranthus viridis, Bidens pilosa, Raphanus raphanistrum, Cyperus rotundus, Digitaria nuda and Eleusine indica) on the vegetative development of chickpeas. Thus, we evaluated the shoot length, number of leaves, leaf area, chlorophyll content and dry weight of leaves, stem an...

  13. Electrochemiluminescence from Tunicate, Tunichrome--Metal Complexes and Other Biological Samples (Postprint)

    Science.gov (United States)

    1996-05-17

    terrestrial grass ( Eleusine indica ) was gathered from wooded areas around St Andrew Sound. Several blades of each plant species were crushed with...that live (green) grass (E. indica ) extracts exhibited high solution-phase ECL levels 200 ~ Ill c Cll .. .E .J 0 w c Ill Cll :;: 900 800...Figure 12. Comparison of intrinsic biological ECL from live (green) and dead (brown) terrestrial grass (E. indica ) and liv’ seagrass (T. testudinum

  14. Host Status of Seven Weed Species and Their Effects on Ditylenchus destructor Infestation of Peanut

    OpenAIRE

    De Waele, D.; Jordaan, Elizabeth M.; Basson, Selmaré

    1990-01-01

    The host suitability to Ditylenchus destructor of seven common weed species in peanut (Arachis hypogaea) fields in South Africa was determined. Based on the number of nematodes per root unit, white goosefoot (Chenopodium album), feathertop chloris (Chloris virgata), purple nutsedge (Cyperus rotundus), jimson weed (Datura stramonium), goose grass (Eleusine indica), khaki weed (Tagetes minuta), and cocklebur (Xanthium strumarium) were poor hosts. Ditylenchus destructor survived on all weed spec...

  15. Notas e comentários sobre a dinâmica do comércio Brasil-África nas décadas de 1970 a 1990

    Directory of Open Access Journals (Sweden)

    Ivo de Santana

    2003-12-01

    Full Text Available Este artigo traz algumas reflexões acerca da presença empresarial brasileira no mercado africano, enfocando particularmente a visão de diferentes autores que se voltaram para o estudo das relações comerciais entre o Brasil e a África. O texto objetiva responder a duas questões principais. Primeiramente, sob que motivações o comércio Brasil-África obteve um notável crescimento entre os anos 1970 e 1990? Segundo, quais as perspectivas que se apresentam para o empresário brasileiro que deseje iniciar negócios na África? Através da pesquisa bibliográfica e entrevistas com executivos que atuaram na África no período mencionado, além de especialistas em comércio exterior, constatou-se que nos anos mencionados o governo brasileiro concedeu generosos incentivos aos empreendimentos direcionados para o mercado africano. Com o fim dessa política privilegiada, muitas empresas fracassaram, no entanto algumas permanecem em atividade, a exemplo da Câmara de Comércio Afro-Brasileira e da Construtora Norberto Odebrecht cujas trajetórias proporcionaram a entrada de outras empresas brasileiras no mercado africano, além de propiciarem importantes lições a empreendedores que desejam iniciar negócios no mercado africano. Concluímos que, a despeito da redução do apoio estatal e das mudanças no ambiente econômico interno e externo brasileiro, as oportunidades comerciais no continente africano existem e não podem ser ignoradas pelos homens de negócios, que tendem a julgar a África como um todo em função dos aspectos negativos ressaltados pela imprensa, da mesma forma que muitos empresários africanos desconhecem a qualidade dos nossos produtos e serviços.This article brings some reflections about the presence of Brazilian enterprises in the African market, focusing particularly the vision of different authors that had studied the trade relationship between Brazil and Africa. The text aims to answer two main questions. Firstly

  16. Levantamento de plantas infestantes em lavouras de milho 'safrinha'no estado de São Paulo Weed survey in autumn corn crops in the state of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Aildson P. Duarte

    1999-08-01

    Full Text Available Fez-se o levantamento da flora infestante na lavoura do milho "safrinha" nas duas principais regiões de plantio no Estado de São Paulo, em 1995. Foram visitadas 85 lavouras na Região do Médio Vale do Paranapanema e 29 na Região Norte. Nesta, em quatro lavouras fez-se a semeadura na palha e em 25, em solo com preparo de gradagem simples, todos sem herbicida. Naquela, a semeadura na palha foi em 68 lavouras, em 11 fez-se gradagem simples e, em seis, gradagem dupla, havendo aplicação de herbicidas de POS em algumas áreas. As espécies que ocorreram, segundo a sua freqüência, foram, na Região Norte: Glycine max> Amaranthus retroflexus> Acanthospermum hispidum = Bidens pilosa = Alternanthera tenella > Cenchrus echinatus > Euphorbia heterophylla > Ipomoea spp. > Commelina benghalensis > Sida spp. = Eleusine indica; e, na Região do Médio Vale do Paranapanema: Euphorbia heterophylla = Glycine max = Commelina benghalensis > Bidens pilosa = Raphanus sativus > Cenchrus echinatus = Acanthospermum hispidum > Brachiaria plantaginea > Sida spp. = Coronopus didymus > Eleusine indica > Digitaria horizontalis > Amaranthus retroflexus. O preparo do solo com gradagem dupla, resultou em menor índice de ocorrência de alta infestação, seguida da gradagem simples. O uso de herbicidas, de modo geral, também reduziu esse índice. As espécies Commelina benghalensis, Digitaria horizontalis, Sida spp., Eleusine indica e Amaranthus hibridus ocorreram apenas com a semeadura direta na Região do Paranapanema. Na Região Norte, Ipomoea spp. e Euphorbia heterophylla só ocorreram nas áreas com gradagem simples.A weed infestation survey was carried out in the two main cultivation regions of autumn corn crops in the State of São Paulo. In the Médio Vale do Paranapanema 85 plantations were visited and in the Região Norte 29 plantations. In this region four crops were sowed directly and 25 after soil preparation with a single harrowing, all without herbicides

  17. The Black Consciousness Movement in South Africa: A Product of The Entire Black World

    Directory of Open Access Journals (Sweden)

    Mgwebi Snail

    2009-12-01

    Full Text Available El trabajo ilustra cómo el surgimiento del Movimiento de Conciencia Negra en Sudáfrica puede estar diametralmente unido a la emergencia de los movimientos de Conciencia Negra y Black Power en América. Pretende demostrar además cómo, en el contexto africano, el Movimiento de Conciencia Negra fue impulsado por el nacionalismo africano y cómo ese nacionalismo fue moldeado y transformado por pensadores africanos de la década de los 50 y 60 en el Panafricanismo. El artículo también mostrará similitudes y diferencias entre la Negritud Africana y el Movimiento de Conciencia Negra. El texto de nuevo explicará de manera cronológica cómo el Garveyismo, la Conciencia Negra en América y el nacionalismo africano, la personalidad africana y la Negritud en África contribuyeron al surgimiento del Movimiento de Conciencia Negra en Sudáfrica. El estudio advierte de que la falta de comprensión de estos antecedentes, podría llevar a la confusión y a una mala interpretación de concepto vital en la historia de África. Finalmente, este trabajo busca hacer hincapié en la historización del desarrollo del por qué el Movimiento de Conciencia Negra en Sudáfrica no puede estar divorciado del contexto global.____________________ABSTRACT:The paper illustrates how the rise of the Black Consciousness Movement in South Africa can be diametrically tied up with the emergence of the Black Consciousness and Black-Power Movements in America. It goes further to demonstrate how, in the African context, the Black Consciousness Movement was given impetus by African nationalism and how that nationalism was later moulded and shaped by African thinkers of the 1950’s and 1960’s into Pan Africanism. The paper, will also try to show similarities and the disparities between Negritude African personality and the Black Consciousness Movement. The paper will again explain in a chronological manner how Garveyism, Black Consciousness in America and African Nationalism in

  18. El yeso, un material apropiado para una construcción barata

    OpenAIRE

    Nolhier, Marc

    1986-01-01

    En este artículo se hace una valoración de las propiedades del yeso en cuanto a resistencia, trabajabilidad y bajo costo con el fin de aplicarlo a una construcción de viviendas baratas en países poco desarrollados. Basándose en experimentos llevados a cabo en países africanos, se estudia el problema de tecnología, de la adaptación de la mano de obra al proceso de construcción con bloques de yeso prefabricados y de su rentabilidad.

  19. Anowa: The Revolutionary Woman as the Epitome of African Feminism in the Post-Colonial Theatre of Sub-Saharan Africa

    OpenAIRE

    Higuera Gómez, Ángela María

    2011-01-01

    [ES] La dramaturga ghanesa Ama Ata Aidoo es una dramaturga y activista que representa la voz de todas aquellas mujeres que luchan por la libertad, el respeto y la justicia. Su obra teatral Anowa, puede ser considerada por tanto más que una obra; es una forma de producir cambios y transformar la sociedad y el concepto de mujer. Este estudio esboza y analiza las razones por las que el personaje de Anowa representa el feminismo africano y a la mujer revolucionaria del África subsahariana. El es...

  20. “Un tocotín mestizo de español y mexicano..."

    Directory of Open Access Journals (Sweden)

    Serge Gruzinski

    2005-02-01

    Full Text Available Una sociedad pluriétnica y pluricultural Cabe   recordar la peculiaridad de la ciudad de México. Desde su conquista en el año 1521, la ciudad de México se volvió una ciudad en la que se codeaba Europeos, Africanos y Amerindios.Su población era sumamente heterogénea y en este aspecto totalmente distinta de las de las ciudades europeas.  Esta peculiaridad,  el manchego  Bernardo de Balbuena la comentó en unos versos famosos - aunque, a mi parecer, pocas veces comentados - de su poema Grandeza m...

  1. “Un tocotín mestizo de español y mexicano..."

    OpenAIRE

    Serge Gruzinski

    2005-01-01

    Una sociedad pluriétnica y pluricultural Cabe   recordar la peculiaridad de la ciudad de México. Desde su conquista en el año 1521, la ciudad de México se volvió una ciudad en la que se codeaba Europeos, Africanos y Amerindios.Su población era sumamente heterogénea y en este aspecto totalmente distinta de las de las ciudades europeas.  Esta peculiaridad,  el manchego  Bernardo de Balbuena la comentó en unos versos famosos - aunque, a mi parecer, pocas veces comentados - de su poema Grandeza m...

  2. Trajectórias Familiares e Vivências Escolares: Projectos de vida e processos identitários nos descendentes de imigrantes guineenses na Escola Secundária de Odivelas

    OpenAIRE

    Fati, David Lamine

    2017-01-01

    Dissertação de Mestrado em Sociologia O tema central desta investigação é a análise das trajectórias pessoais e escolares dos descendentes de imigrantes africanos provenientes da Guiné-Bissau. Com base nesse intuito, realizou-se uma análise das trajectórias migratórias, educativas e sociais dos progenitores de cada um dos nossos entrevistados, visando entrecruzar essas trajectórias com as vivências pessoais e escolares de cada um dos jovens entrevistados a fim de entender em que medida as ...

  3. Elefantes e intervención humana en los yacimientos del Pleistoceno Inferior y Medio de África y Europa

    OpenAIRE

    Martos Romero, Juan Antonio

    1998-01-01

    En el presente artículo se revisan yacimientos africanos y europeos donde se ha planteado la existencia de una intervención humana sobre elefantes. Se establece una diferencia entre sitios con un sólo individuo (tipo 1) o un número alto de elefantes (tipo 2). Con independencia del carácter de la intervención humana, cuando ésta es evidente, tales diferencias responden a unos procesos de formación distintos con problemáticas singulares que condicionan finalmente la capacidad informativa del ya...

  4. Nigeria y la resolución de conflictos en Africa: La experiencia de Darfur

    OpenAIRE

    Ebegbulem, Joseph C

    2011-01-01

    Los conflictos en África en los últimos años han llevado a la pérdida de vidas humanas; el desplazamiento de personas y la miseria en muchas partes del continente. La necesidad de resolver; gestionar y prevenir estos conflictos; e igualmente frente a los desafíos socio-económicos derivados de estos s; se ha convertido en una fuente de preocupación para los países africanos como Nigeria; el gigante de África. Es a la luz de lo anterior que este artículo se propone analizar el papel de Nigeria ...

  5. Mecanismos de Negociación y Resolución de Conflictos entre los Maninka

    OpenAIRE

    Cordero Domínguez, Hernán

    2012-01-01

    El continente africano es sin duda rico en recursos naturales y en potencialidades económicas, culturales y diplomáticas. Desde este punto de vista, África estaría predestinada a ocupar los primeros puestos a nivel de desarrollo económico y a jugar roles importantes en un mundo globalizado. Varios países festejan los cincuenta años de independencia en 2010, y sus niveles de desarrollo siguen ocupando los últimos puestos a nivel mundial; el continente se presenta hacia el exterior como una tie...

  6. A importancia das contas longas de vidro de origem mediterrânica recolhidas na "Baixa Pombalina" de Lisboa (Contribuição para o estudo de contas tipo "Nueva Cadiz"

    OpenAIRE

    M. Conceição RODRIGUES

    2009-01-01

    RESUMO: Pretendemos com este trabalho dar a nossa contribuição para o estudo das contas de vidro e introduzir novos dados e valores no estudo do comercio entre Portugal e o mundo africano, nomeadamente com a costa Ocidental da África , onde a permuta de pessoas, bens e ideias foi em parte determinante. Estes contactos permitiram alargar os horizontes socio-culturais entre diferentes povos e simultaneamente entre dois continentes para onde as contas de vidro foram levadas, permutadas e usadas....

  7. Reflexos invertidos: As migrações clandestinas no filme de ficção e documentário

    Directory of Open Access Journals (Sweden)

    Elsa Lechner

    2014-12-01

    Full Text Available As notícias sobre a chegada de migrantes clandestinos às fronteiras da Europa são uma constante da atualidade. Relata-se a pressão na fronteira terrestre do continente, a leste da Grécia e Turquia, ou conta-se a impressionante odisseia na bacia do Mediterrâneo, onde chegam milhares de migrantes oriundos dos continentes africano e asiático, todos tentando entrar no espaço idealizado da Europa, fugindo de guerras, repressão, pobreza e falta de perspetivas. Nos últimos tempos, as notícias dos na...

  8. ENTRE O DISCURSO SOLIDÁRIO E A AÇÃO PRAGMÁTICA DA COOPERAÇÃO BRASILEIRA EM MOÇAMBIQUE: os casos dos projetos de implantação da fábrica de medicamentos antirretrovirais e o ProSavana

    OpenAIRE

    Almeida,Elga Lessa de

    2016-01-01

    A cooperação brasileira com países africanos ganhou importante relevo ao longo do governo de Lula da Silva, apoiada pelo discurso da solidariedade internacional e da existência de uma dívida histórica com a África, bem como por uma prática que busca, sobretudo, estruturar setorialmente as demandas desses países, sem impor condicionalidades. Percebe-se, no entanto, que a presença brasileira em Moçambique – país que recebeu especial atenção no governo Lula da Silva – aponta para uma...

  9. Risco e saúde no contexto do VIH/sida: o caso da prostituição na Baixa da Cidade de Maputo

    OpenAIRE

    Muianga, Baltazar Samuel

    2009-01-01

    Mestrado em Estudos Africanos. Desenvolvimento Social e Económico em África: Análise e Gestão Tendo como estudo de caso a “Rua do Bagamoyo”, na baixa da cidade de Maputo, a presente dissertação tem por objectivo identificar as estratégias a que as trabalhadoras de sexo recorrem para fazer frente ao risco de infecção pelo VIH/SIDA, por um lado e, por outro, compreender a eficácia destas respostas face aos condicionalismos sociais que influenciam significativamente a gestão de...

  10. O dembo caculo cacahenda: a história de uma região e de uma chefatura (1780-1860)

    OpenAIRE

    Vieira , Daiana Lucas

    2014-01-01

    O termo dembo é usado para nos referirmos a um território situado em Angola e a um título político africano (Dembo) que é dado para o chefe e/ou líder do dembo (território.). Em Angola havia a região dos dembos. Entre estes dembos escolhemos um, chamado Dembo Caculo Cacahenda para nossa pesquisa. O Dembo Caculo Cacahenda, como veremos no primeiro capítulo desta dissertação, nos deixou um arquivo composto por cartas, requerimentos, processos e outros documentos escritos. O Dembo Caculo Cacahen...

  11. Reis do Congo no Brasil, séculos XVIII e XIX

    Directory of Open Access Journals (Sweden)

    Marina de Mello e Souza

    2005-06-01

    Full Text Available Esse artigo busca explicar a presença de reinados negros, depois chamados de congadas, em quase todas as regiões do Brasil que receberam escravos africanos, do século XVI ao XIX. O enfoque adotado abarca Portugal, África Central e Brasil como partes integrantes de um mesmo sistema econômico, social e cultural, tecido em torno do Atlântico. A esfera da cultura e as relações de poder são os centros focais da análise, que se preocupa acima de tudo com a formação de identidades.

  12. Huellas de las religiones tradicionales del áfrica subsahariana en américa latina y el caribe

    OpenAIRE

    Cabrera Thompson, Lazaro

    2010-01-01

    El artículo explora las religiones tradicionales practicadas por los pueblos ewe-mina, ewe-fon, bantú y yoruba del África subsahariana, antes de abordar las formas como estas prácticas religiosas persisten en el “Nuevo Mundo” tras la llegada forzosa de aquellos esclavizados africanos. Con base en la presencia de estas religiones tradicionales africanas en distintos países latinoamericanos y caribeño, se evidencia un conjunto religioso fusionado por historias, mitos, leyendas, danza, mú...

  13. La imperiosa necesidad de ser diferente en la globalización: el mercadeo territorial. La experiencia de las regiones chilenas

    OpenAIRE

    Sergio Boisier

    2006-01-01

    El artículo se centra en un tema emergente: el nuevo papel de los territorios en la competencia mundial empujada por la globalización. Todos y cada uno de los territorios persigue lo mismo: atraer capital, tecnología, turismo y vender sus productos transables en todo el mundo. Como se dice en un antiguo proverbio africano, en la llanura da lo mismo ser león o gacela; en cualquier caso hay que correr desde que sale el sol para no morir de hambre o en las garras de un depredador. En América Lat...

  14. Retrospectiva histórica de la minería en Marmato

    OpenAIRE

    Duque Escobar, Gonzalo

    2012-01-01

    Anotaciones históricas sobre la minería de este colonial poblado de Colombia, donde se pretende una explotación a cielo abierto cuando está de por medio la voluntad de cientos de familias de etnias mayoritariamente afrodescendientes e indígenas que no han negociado sus raíces culturales. Allí llegan legiones de esclavos africanos cuando los Cartamas fueron exterminados, y luego los ingleses para asegurarse con el oro el pago de los empréstitos de la independencia

  15. Chikungunya, o la incapacidad del sistema general de seguridad social en salud para prevenir. Preguntas para reflexionar

    Directory of Open Access Journals (Sweden)

    Lídice Alvarez-Miño

    2015-04-01

    Full Text Available De acuerdo con la Organización Mundial de la Salud (OMS, el virus del Chikungunya no es un evento nuevo. La fiebre Chikungunya es una enfermedad vírica transmitida al ser humano por mosquitos, la cual fue descrita por primera vez durante un brote ocurrido en el sur de Tanzanía en 19521 . Este país africano, ubicado en el trópico, tiene características similares, en lo ambiental y climático, a Colombia. Es decir, compartimos ambientes comunes en los cuales el mismo vector (Aedes Aegypti puede transmitir diferentes enfermedades, entre ellas el dengue.

  16. Espécie invasora em unidade de conservação: Achatina fulica (Bowdich, 1822 no Parque Estadual Carlos Botelho, Sete Barras, SP, Brasil (Nota Científica. Invasive species in conservation unit: Achatina fulica (Bowdich, 1822 in Carlos Botelho State Park, Sete Barras, SP, Brazil (Scientific Note.

    Directory of Open Access Journals (Sweden)

    Marilda Rapp de ESTON

    2006-12-01

    Full Text Available O caramujo-gigante-africano, Achatinafulica (Mollusca-Achatinidae, considerado umadas cem piores espécies invasoras do mundo,causando sérios danos ambientais, é registrado pelaprimeira vez para o Parque Estadual CarlosBotelho, município de Sete Barras, Estado de SãoPaulo, Brasil.The Giant African Snail, Achatina fulica(Mollusca-Achatinidae, considered as one of ahundred worst world’s invasive species, causingserious environmental damages, is registered forthe first time for Carlos Botelho State Park, countyof Sete Barras, state of São Paulo, Brazil.

  17. Orishas, demonios y santos. Un acercamiento al sincretismo de la santer??a, caso Catemaco, Veracruz

    OpenAIRE

    Sald??var Arellano, Juan Manuel

    2009-01-01

    La presente ponencia es resultado de un estudio socio-antropol??gico sobre la religi??n conocida como santer??a, realizado en Catemaco, Veracruz. Dicha religi??n ha sido producto de un sincretismo religioso entre cultos africanos y cat??licos en tiempos de la Colonia en Cuba. Fusi??n no s??lo de deidades, sino tambi??n de productos transnacionales mismos que se han re-utilizado para reforzar pr??cticas como la brujer??a, la curander??a, el espiritismo, entre otras que se practican en la local...

  18. El sello de correos, como medio informativo. La antigua Guinea española, en su filatelia

    Directory of Open Access Journals (Sweden)

    Dr. Victoriano Darias

    2001-01-01

    Full Text Available A través de la observación detallada de las colecciones y catálogos filatélicos de un determinado país es posible obtener interesantes consideraciones históricas y periodísticas del mismo. Como ejemplo de ello proponemos en estas líneas el estudio de la faceta filatélica de la Guinea Española, territorio africano discontinuo (islas y zona continental que ocupó España desde 1778, mediante la desafortunada expedición del conde de Argelejo.

  19. La genética de las poblaciones centroamericanas

    OpenAIRE

    Barrantes, Ramiro

    2005-01-01

    Las poblaciones centroamericanas no han sido objeto de muchos estudios genéticos con la excepción de análisis esporádicos de la variación entre y dentro de los grupos amerindios y de origen africano ubicados en el área. No obstante, en los últimos 15 años se efectuaron investigaciones sistemáticas en este sentido incluyendo poblaciones mestizas, particularmente las de Costa Rica y Panamá. En los amerindios se efectuaron estudios detallados de su estructura genética y las relaciones filogenéti...

  20. El esclavo como valor en las Américas españolas

    Directory of Open Access Journals (Sweden)

    Jean-Pierre Tardieu

    2014-06-01

    Full Text Available Durante varios siglos, la Corona española sacó un provecho sustancial del traslado al Nuevo Mundo de millones de africanos, merced a las licencias y a los asientos concedidos a los negreros y, luego, de su venta en las provincias de ultramar, sometida, como cualquier transacción, a las pautas fiscales vigentes en materia de almojarifazgo ad valorem al entrar y salir de los puertos y de avería, que servía para costear los gastos de la flota encargada de la seguridad de los viajes transatlánticos.

  1. (Re)Descobrimento do Brasil

    OpenAIRE

    Gatti, José; Universidade Federal de Santa Catarina

    2008-01-01

    Como todos aprendemos nas escolas brasileiras, os navegadores portugueses chegaram ao Brasil em 1500. Desde então, esse evento tem sido objeto de controvérsias (casualidade? intencionalidade dos navegadores?) e disputas (quem os teria precedido? espanhóis? franceses? africanos?). Acima das polêmicas, o que continua sendo ensinado é que a frota comandada por Pedro Álvares Cabral realizou o primeiro contato oficial de Portugal com a nova terra a 16° Sul e a identificou como possessão Del Rey, c...

  2. Papel de la comunidad internacional en la resocialización de niños soldados desvinculados del ejército de resistencia del señor en Uganda (2002-2013)

    OpenAIRE

    Correa Ávila, Paula Valentina

    2016-01-01

    El objetivo de esta investigación diagnóstica es evaluar las acciones de la Comunidad Internacional en materia de resocialización de niños soldados desvinculados del Ejército de Resistencia del Señor (ERS) en Uganda durante el periodo de 2002 a 2013. Para ello, se hace un análisis de las causas de la existencia de niños soldados, donde se tiene en cuenta la evolución del concepto de la infancia y las particularidades que éste representa en el contexto africano. Así mismo, son analizados los a...

  3. PRESENTACIÓN

    Directory of Open Access Journals (Sweden)

    Justus Fenner

    2009-12-01

    Full Text Available Como en los números anteriores, estaba previsto que el actual número ocho de nuestra revista Pueblos y Fronteras digital se constituyera a partir de una unidad temática, como un especial sobre una etnia poco estudiada: los garínagu o garífuna, nación caribeña producto del proceso de mestizaje entre esclavos africanos y población originaria, en el marco de un largo proceso de resistencia contra los colonizadores europeos. Hoy los aproximadamente trescientos mil garínagu habitan parte de la costa caribe de Belice, Guatemala, Honduras y Nicaragua....

  4. Os desafios da educação quilombola no Brasil: o território como contexto e texto

    OpenAIRE

    Lourdes de Fátima Bezerra Carril

    2017-01-01

    El reconocimiento legal de los quilombos en Brasil representa un hito en la visibilidad de las diferencias étnicas y culturales de la sociedad. El mito de la democracia racial borran el dolor de la esclavitud, haciendo lesiones de identidades en los descendentes africanos. Tomando en cuenta la lucha por el reconocimiento, buscase la ampliación de sus derechos, como la educación quilombola. Hay grandes retos, incluso el de cambiar la cultura de la escuela que no atenta para la diversidad étnic...

  5. Gonçalves, António Custódio: A história revisitada do Kongo e de Angola. Lisboa: Editorial Estampa, 2005

    Directory of Open Access Journals (Sweden)

    Rosana Gonçalves

    2006-12-01

    Full Text Available Antônio Custódio Gonçalves é sociólogo e professor catedrático de Geografia da Universidade do Porto, onde dirige o Centro de Estudos Africanos (CEAUP, coordenando um importante periódico sobre África, a Africana Studia. Há anos debruçado sobre temáticas africanas, António Custódio Gonçalves sintetiza muitas das complexas questões sobre a história do Kongo e Angola nesta publicação.

  6. Desarrollo de un modelo de negocio para una cooperativa hortícola de mujeres en Benín

    OpenAIRE

    Herías Sáenz, Marina

    2016-01-01

    La República de Benín es un país africano situado en el área subsahariana occidental. Es un país catalogado con un bajo índice de desarrollo, en el que una proporción considerable de los habitantes vive por debajo del umbral de la pobreza y cuyo principal motor económico actual es la agricultura comercial. En este país, concretamente en la comuna de Nikki, una de las 12 comunas que lo integran, es donde la ONG española OAN International focaliza su actividad. Su fin último es cooperar en el d...

  7. Un canto en movimiento: No nos moverán" en Estados Unidos, España y Chile en los siglos XIX y XX

    OpenAIRE

    Spener, David

    2015-01-01

    En este trabajo se presentan los resultados de un estudio que examina la historia de la canción " No nos moverán" y su canto en diversos contextos culturales y sociopolíticos durante el transcurso de dos siglos. Esta canción tiene su origen en las prácticas religiosas de los esclavos africanos en Estados Unidos del siglo XIX. En el siglo XX fue adoptada como himno por los movimientos sindicales y de derechos civiles estadounidenses. Posteriormente llegó a España, donde cumplió un papel en la ...

  8. Neo-patrimonialismo e populismo : uma leitura pela reciprocidade

    Directory of Open Access Journals (Sweden)

    Eric Sabourin

    2011-10-01

    Full Text Available Este artigo propõe uma leitura dos processos de neo-patrimonialismo em particular nos Estados africanos e de neo populismo nos Estados latino-americanos a luz da lógica de reciprocidade. Defende a hipótese que o principio de reciprocidade sendo diferente daquele da troca (e em particular da troca mercantil, ele pode gerar formas de alienação especificas e não redutíveis a principal forma de alienação do sistema de troca: a exploração capitalista analisada por Marx.

  9. Esculpir o tempo: arte, educação e ancestralidade entre os Fons, os Iorubás e os Tchokwes

    OpenAIRE

    Júlio César Boaro

    2013-01-01

    Esta dissertação aponta para um caminho cuja trajetória é a busca e o entendimento da complexidade da arte e da cultura africana, especialmente da África subsaariana e, dessa forma, contribuir para uma reflexão sobre a formação da cultura brasileira nos seus modos de ser e de pensar, através das características atribuídas aos descendentes de africanos que para o Brasil foram trazidos na condição de escravos. Nosso ponto de partida é a religiosidade de matriz africana reinventada no Brasil, e ...

  10. Evaluating sampling strategy for DNA barcoding study of coastal and inland halo-tolerant Poaceae and Chenopodiaceae: A case study for increased sample size.

    Directory of Open Access Journals (Sweden)

    Peng-Cheng Yao

    Full Text Available Environmental conditions in coastal salt marsh habitats have led to the development of specialist genetic adaptations. We evaluated six DNA barcode loci of the 53 species of Poaceae and 15 species of Chenopodiaceae from China's coastal salt marsh area and inland area. Our results indicate that the optimum DNA barcode was ITS for coastal salt-tolerant Poaceae and matK for the Chenopodiaceae. Sampling strategies for ten common species of Poaceae and Chenopodiaceae were analyzed according to optimum barcode. We found that by increasing the number of samples collected from the coastal salt marsh area on the basis of inland samples, the number of haplotypes of Arundinella hirta, Digitaria ciliaris, Eleusine indica, Imperata cylindrica, Setaria viridis, and Chenopodium glaucum increased, with a principal coordinate plot clearly showing increased distribution points. The results of a Mann-Whitney test showed that for Digitaria ciliaris, Eleusine indica, Imperata cylindrica, and Setaria viridis, the distribution of intraspecific genetic distances was significantly different when samples from the coastal salt marsh area were included (P < 0.01. These results suggest that increasing the sample size in specialist habitats can improve measurements of intraspecific genetic diversity, and will have a positive effect on the application of the DNA barcodes in widely distributed species. The results of random sampling showed that when sample size reached 11 for Chloris virgata, Chenopodium glaucum, and Dysphania ambrosioides, 13 for Setaria viridis, and 15 for Eleusine indica, Imperata cylindrica and Chenopodium album, average intraspecific distance tended to reach stability. These results indicate that the sample size for DNA barcode of globally distributed species should be increased to 11-15.

  11. Haplotipos del gen de la globina beta en portadores de hemoglobina S en Colombia

    Directory of Open Access Journals (Sweden)

    Claudia Liliana Durán

    2012-03-01

    Resultados. Los haplotipos de la hemoglobina S encontrados con mayor frecuencia en la muestra analizada son de origen africano y su orden de aparición fue mayor para el haplotipo Bantú (36,4 %, seguido por Senegal (30,3 %, Benín (21,2 % y Camerún (12,1 %. La electroforesis de hemoglobina confirmó el fenotipo AS; la dosificación de hemoglobina fetal mostró niveles por debajo de 1 % y los parámetros hematológicos analizados mostraron valores normales en el 100 % de los individuos. Conclusión. Los haplotipos de la HbS encontrados con mayor frecuencia en la muestra estudiada eran de origen africano y su distribución variaba de acuerdo con el lugar de prodedencia del individuo. La mayor frecuencia correspodió al haplotipo Bantú.   DOI: http://dx.doi.org/10.7705/biomedica.v32i1.600

  12. O Brasil, a África e o Atlântico no século XIX

    Directory of Open Access Journals (Sweden)

    Alberto da Costa e Silva

    1994-08-01

    Full Text Available Até o último quartel do século XIX, a presença européia na África reduzia-se a poucos pontos litorâneos. Em toda a sua grande extensão, a África era governada por africanos. O continente dividia-se em impérios, reinos e cidades-estado. Do lado do Atlântico, havia intensas relações entre essas estruturas políticas e o Brasil. O que se passava num lado do oceano repercutia no outro. A cruzada anti-escravagista desembocou num novo imperialismo europeu. A ocupação da África pelas potências européias não logrou destruir muitas dessas estruturas de poder, algumas das quais serviram de intermediárias entre o colonizador e os africanos enquanto que outras persistiram na clandestinidade. A ocupação colonial ocasionou o quase completo corte das antigas e fortes relações com o Brasil.

  13. El conflicto de Darfur: un reto para la credibilidad de la Unión Africana

    Directory of Open Access Journals (Sweden)

    María Ángeles Alaminos

    2008-01-01

    Full Text Available En el caso de la crisis de Darfur la Unión Africana esperaba conseguir su primer éxito a nivel internacional en la pacificación de un conflicto africano; el conflicto de Darfur ha supuesto un reto para su credibilidad. La Misión de la Unión Africana en Sudán (AMIS intentó poner fin a la crisis, pero los recursos limitados, tanto económicos como humanos fueron incapaces de frenarla. La protección de tres millones y medio de personas en situación de riesgo en Darfur ha constituido un desafío para la UA y una prueba de la efectividad de su misión AMIS. La Unión Africana quiere demostrar su valía como organización, su potencial en el desarrollo de acciones concretas, su preponderancia como actor en el ámbito africano y su relevancia como actor internacional.

  14. Comparison of plant growth-promotion with Pseudomonas aeruginosa and Bacillus subtilis in three vegetables Comparação da promoção de crescimento de plantas por Pseudomonas aeruginosa e Bacillus subtilis em três vegetais

    Directory of Open Access Journals (Sweden)

    A.O. Adesemoye

    2008-09-01

    Full Text Available Our objective was to compare some plant growth promoting rhizobacteria (PGPR properties of Bacillus subtilis and Pseudomonas aeruginosa as representatives of their two genera. Solanum lycopersicum L. (tomato, Abelmoschus esculentus (okra, and Amaranthus sp. (African spinach were inoculated with the bacterial cultures. At 60 days after planting, dry biomass for plants treated with B. subtilis and P. aeruginosa increased 31% for tomato, 36% and 29% for okra, and 83% and 40% for African spinach respectively over the non-bacterized control. Considering all the parameters tested, there were similarities but no significant difference at P Nosso objetivo foi comparar as propriedades PGPR (rizobactérias promotoras de crescimento de plantas de Bacillus subtilis e Pseudomonas aeruginosa. Solanum licopersicum (tomate, Asbelmoschus esculentus (ocra e Amaranthus sp (espinafre africano foram inoculados com as culturas bacterianas. Após 60 dias de plantio, a biomassa seca das plantas tratadas com B.subtilis e P. aeruginosa aumentou 31% para o tomate, 36% e 29% para ocra, e 83% e 40% para espinafre africano, respectivamente, em comparação com o controle não inoculado. Considerando os parâmetros testados, o desempenho dos dois microrganismos foi similar, sem diferença estatisticamente significativa (p< 0,05.

  15. La cuestión del nacionalismo actual, el racismo y los procesos de movilización política de las identidades étnicas en Belice: reflexiones de campo

    Directory of Open Access Journals (Sweden)

    Carlos Correa

    2017-12-01

    Full Text Available El propósito de este trabajo es analizar cómo se articulan los procesos de nacionalismo actual en Belice con manifestaciones de racismo. Se hace hincapié en la producción de identidades excluidas de los marcos de construcción nacional en el contexto de la movilización política de la etnicidad y de proyectos oficiales de corte nacionalista. Los criollos afro-beliceños han sido tomados como el centro de proyectos nacionalistas promovidos por el Estado en su período posterior a la independencia en el contexto de un discurso sobre multiculturalismo. Mientras otros grupos étnicos disputan espacios de representación dentro de estas construcciones de identidad nacional mediante la movilización cultural articulada con la promoción oficial de la diversidad. En ese sentido, el estatus de los criollos nos permite cuestionar las imágenes de la negritud y los descendientes de africanos comúnmente considerados marginados de los espacios de poder para mostrarnos cómo la dinámica histórica del colonialismo juega con categorías como la raza y la clase para dar forma a escenarios de negociaciones políticas en los cuales las poblaciones de origen africano, en algunas ocasiones, pueden ocupar espacios de predominio.

  16. Paz y seguridad humana en África: una visión desde la Unión Africana

    Directory of Open Access Journals (Sweden)

    Jerónimo Delgado

    2009-11-01

    Full Text Available En este artículo se analizan las diferentes iniciativas que ha tenido el continente africano en materia de solución de conflictos y consolidación de la paz desde la perspectiva de la seguridad humana. En la primera parte, se identifican los componentes de la seguridad humana y los factores de inseguridad a los que se exponen los individuos en África, para luego examinar los avances del marco legal de la Unión Africana en la prevención de conflictos con énfasis en la seguridad de los individuos.La segunda parte contiene un estudio de las medidas enmarcadas dentro de la seguridad humana con las que cuentan los estados africanos y la comunidad internacional para la adecuada protección de los individuos, mientras se da un acercamiento entre las partes del conflicto para alcanzar el fin de las hostilidades. Finalmente, se afirma que África reconoce que la seguridad de sus ciudadanos es viable si se entienda que ésta es una responsabilidad compartida por todo el continente, en donde el individuo juega un papel central.

  17. Prospects for area-wide integrated control of tsetse flies (Diptera: Glossinidae and trypanosomosis in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Marc J.B. VREYSEN

    2006-01-01

    Full Text Available Los países del África sub-Sahariana están entre los menos desarrollados del mundo, y el hambre y la pobreza continúan siendo muy extendidos en la mayoría de las comunidades rurales. Se considera que disminuir el hambre y la sub-alimentación mediante la introducción de ganado productivo, como fuente de tracción y abono para la producción agrícola, el transporte, los lácteos y la carne, es un primer paso fundamental hacia un mejor desarrollo rural. La presencia de la mosca tse-tsé en un tercio del continente africano y la tripanosomiasis que transmite, se consideran la principal barrera para el desarrollo del ganado productivo. A pesar de la administración anual de 35 millones de dosis de drogas tripanocidas (a 1 (un dólar por dosis, los granjeros africanos pierden 3 millones de cabezas de ganado por año debido a esta enfermedad, y las pérdidas económicas directas se estiman entre 600 y 1200 millones de dólares...

  18. Revisiting aspects of language in South Africa durting the Apartheid area

    Directory of Open Access Journals (Sweden)

    Mgwebi Lavin Snail

    2011-04-01

    Full Text Available En este artículo, nuestro principal objetivo es mostrar como los africanos usaron su lengua para construir su nacionalismo, los africanos usaron el poder del estado para emplear la situación lingüística en Sudáfrica para implementar su política. La existencia de diferencias lingüísticas fue manipulada para crear varias naciones –“multiculturalismo” como prefirireron llamarlo los arquitectos del ApartheidPalabras Clave: Sudáfrica, Apartheid, lengua, diferencias lingüísticas, multi-nacionalismo___________________________Abstract:In this article, our aim is show how the Afrikaners succeeded in using their language to build their nationalism, the Afrikaners used the state power to use the language situation in South Africa to implement their policy of divide and rule. The existing linguistic differences were manipulated to create many nations called – “multi-nationalism “as the architects of Apartheid would prefer to call it.   Keywords: South Africa, Apartheid, language, linguistic differences, multi-nationalism.

  19. Una valoración de la geografía y la diáspora africana

    Directory of Open Access Journals (Sweden)

    Judith A. Carney

    2006-01-01

    Full Text Available El estudio de la diáspora Africana se ha vuelto un area vibrante de investigación y enseñanza en los años recientes a través de las disciplinas. Sin embargo, hay muy pocas contribuciones geográficas. Este artículo busca invertir esta tendencia. Se revisa el trabajo relevante de geógrafos en el Atlántico Negro para identificar temas prometedores para la investigación futura. La dispersión de plantas Africanas y el papel de los esclavos en establecer estas plantas es especialmente prometedor. Esta dirección de investigación clarifica los componentes Africanos de Intercambio Colombino mientras llama la atención sobre la importancia de la subsistencia en el negocio transatlántico de esclavos y la economía de las plantaciones. Las comidas básicas de origen Africano sirvieron a la subsistencia y a la memoria. Plantas Africanas figuran de manera prominente en los caminos de la comida en la diáspora, las practicas litúrgicas de las religiones Afro-sincréticas, y en las historias orales de Maroon.

  20. A política africana do governo Lula: (2003-2006 The Lula government's African policy: (2003-2006

    Directory of Open Access Journals (Sweden)

    Cláudio Oliveira Ribeiro

    2009-01-01

    Full Text Available O artigo analisa as relações Brasil-África entre 2003 e 2006, procurando demonstrar que a eleição de Luiz Inácio Lula da Silva trouxe nova dinâmica às relações do Brasil com o continente africano. O discurso e a prática diplomática deste governo convergem para a construção de alianças preferenciais com parceiros no âmbito das relações Sul-Sul. Nesse contexto, defende-se que África do Sul, Angola e Nigéria são parceiros políticos e econômicos essenciais à estratégia diplomática brasileira para o continente africano.The article analyzes Brazil-Africa relations between 2003 and 2006, aiming to demonstrate that the election of Luiz Inácio Lula da Silva injected a new dynamic to Brazil's relations with the African continent. The discourse and diplomatic practice of the Lula government have combined to help build preferential alliances with partners within the arena of South-South relations. In this context the text argues that South Africa, Angola and Nigeria are essential political and economic partners in Brazil's diplomatic strategy for the African continent.

  1. Una contribución al estudio de la nueva inmigración africana subsahariana en la Argentina Uma contribuição ão estudo da nova imigração desde Africa Subsahariana à Argentina A contribution to study the immigration from Sub Saharan Africa to Argentina

    Directory of Open Access Journals (Sweden)

    Marta M. Maffia

    2010-07-01

    Full Text Available Si bien en la Argentina poseemos una inmigración desde el África subsahariana a partir de fines del siglo XIX y principios del XX, como la de los sudafricanos y los caboverdeanos, esta nueva inmigración, de la última década del siglo XX y la primera del XXI, que llega desde Senegal, Nigeria, Camerún, Ghana, entre otros países, aparece en un contexto histórico y político diferente, enfrentada a regímenes jurídicos y estatutos administrativos cada vez más restrictivos, enmarcada en la creciente globalización de la economía. Este trabajo constituye una parte de los primeros resultados de la investigación iniciada en el año 2009 sobre esta migración desde una perspectiva antropológica, sumando los aportes que nos brindan la historia, la ciencia política y la demografía -entre otras disciplinas-, haciendo uso de los materiales producidos por científicos sociales africanos y no africanos, con el convencimiento de que en el diálogo de miradas se pueden superar las propias limitaciones.Ainda que na Argentina se conheça uma imigração da África subsahsariana desde finais do século XIX e princípio do século XX, como a dos sul-africanos e a dos cabo-verdianos, esta nova imigração (entre a última década do século XX e a primeira década do século XXI que chega do Senegal, Nigéria, Camarões, Ghana, entre outros países, aparece num contexto histórico e político diferenciado, submetida a regimes jurídicos e estatutos administrativos cada vez mais restritivos demarcados pela acrescente globalização da economia. Este trabalho é resultado parcial dos primeiros resultados da investigação iniciada no ano de 2009, sobre esta migração numa perspectiva antropológica, somada aos aportes da história, das ciencias políticas, da demografía, entre outras disciplinas e fazendo uso de materiais produzidos por cientistas sociais africanos e não-africanos temos a convicção de que, por meio do diálogo de diferentes olhares

  2. Novel Weed-Extracted Silver Nanoparticles and Their Antibacterial Appraisal against a Rare Bacterium from River and Sewage Treatment Plan

    Directory of Open Access Journals (Sweden)

    Achmad Syafiuddin

    2017-12-01

    Full Text Available This is the first investigation to demonstrate the use of biochemical contents present within Cyperus rotundus, Eleusin indica, Euphorbia hirta, Melastoma malabathricum, Clidemia hirta and Pachyrhizus erosus extracts for the reduction of silver ion to silver nanoparticles (AgNPs form. In addition, the antibacterial capability of the synthesized AgNPs and plant extracts alone against a rare bacterium, Chromobacterium haemolyticum (C. haemolyticum, was examined. Moreover, ultraviolet-visible spectroscopy (UV-vis, Fourier transform infrared spectroscopy (FTIR, field emission scanning electron microscopy (FESEM, energy-dispersive X-ray spectroscopy (EDX and inductively coupled plasma atomic emission spectroscopy (ICPOES of the synthesized AgNPs were characterized. The smallest AgNPs can be produced when Cyperus rotundus extracts were utilized. In addition, this study has found that the synthesis efficiencies using all plant extracts are in the range of 72% to 91% with the highest percentage achieved when Eleusin indica extract was employed. All synthesized AgNPs have antibacterial capability against all examined bacteria depending on their size and bacteria types. Interestingly, Melastoma malabathricum and Clidemia hirta extracts have demonstrated an antibacterial ability against C. haemolyticum.

  3. EXPLORATION UNDER SHADE PLANTS OF CASSAVA AND IT’S POTENTIAL AS FORAGE

    Directory of Open Access Journals (Sweden)

    Novia Qomariyah

    2014-01-01

    Full Text Available Utilization of forage plants growing among cassava (Manihot esculenta Crantz is not optimal. Potential for development of integration of both very large and mutually beneficial. Purpose of this study is to explore and identify types of forage that grows in shade of the cassava plant and potential for development as a source of forage. This study took place in March 2014 Month held at IPB Sinar Sari Complex Dramaga. This research method to define area of cassava plants as treatments that cassava plants were planted separately with another crop (monoculture and cassava crops are planted among crops and horticultural crops such as pariah plants, beans, squash and corn (polyculture. Furthermore, observed and forage samples taken were grown in both location and made herbarium and identified its kind. Results: forage crops are grown between cassava monoculture is more diverse than polyculture. Types of forage crops grown on cassava monoculture is Echinochloa colona, Setaria barbata, Family Juncaceae, Cyperus sp., Conjugatum paspalum, Cynodon dactylon, Stenotaphrum secundatum, Axonophus compressus (Swartz P. Beauv, Eleusine indica and Panicum maximum. Types of forage crops grown on cassava polyculture is colona Echinochloa, Setaria barbata, Family Juncaceae, Cyperus sp., Stenotaphrum secundatum, Eleusine indica and Leucaena leucephala.

  4. STRUKTUR KOMUNITAS TANAMAN BAWAH, DAN JENIS-JENIS YANG BERMANFAAT SEBAGAI TANAMAN OBAT DI KAWAASAN HUTAN LINDUNG KALIURANG

    Directory of Open Access Journals (Sweden)

    SUTOMO SUTOMO

    2012-09-01

    Full Text Available ABSTRACT Low layer plants as one of component in forest ecosystem today still lack of attention due to the limited information about them. Low layer plants plays an important role in forest ecosystem, and also they are potential to be use as a medicinal plants, genetic resources and other uses that are not yet revealed. For that reason reseach about Low Layer Plants ; Community Structure and Their Use as Medicinal Plants need to be conducted. The objective of this research was to get the information about : (1 Community structure of low layer plants in compartment seven Kaliurang protection forest and (2 Species that are use as a medicinal pants. To fulfill this goal, small plots of 1 x 1 m along forest pathways were made in sampling area. Result showed that as many as 47 species of low layer plants were found in sampling area. There were five main species which has high importance value index : Eupatorium riparium Regel. with importance value index 21,29%, followed by Eleusine indica Gaertn.17,82 % , Oplismenus burmanii Beauv. 14,61 %, Diplazium proliferum 14,04% and Panicum reptans Kunth. 11,27 %. From those 47 species, as many as 10 species are known as a medicinal plants, they are : Melastoma malabathricum L., Physalis angulata Heyne, ex. Wall., Ageratum conyzoides Linn., Elephantopus scaber Linn., Psidium guajava Linn., Justicia gendarussa Linn., Alocasia macrorhiza Schott., Eleusine indica Gaertn., Villebrunea rubescens Bl. and Phyllanthus niruri L.

  5. Mycorrhizal association in soybean and weeds in competition

    Directory of Open Access Journals (Sweden)

    Cíntia Maria Teixeira Fialho

    2016-04-01

    Full Text Available The purpose of this study was to evaluate the effects of mycorrhizal association on the interference of Bidens pilosa, Urochloa decumbens and Eleusine indica on soybean culture in two conditions: a plants competing without contact with roots of another species; b with contact between roots. At 60 days after planting, growth, nutrient accumulation and mycorrhizal colonization of soybean and weeds were evaluated. The contact between roots of soybean plant and weed species increased the negative interference effects for both species, with less growth and nutrient accumulation. With the individualization of roots, higher competition occurred for soil resources up to 60 days of coexistence between species. In competition with soybean, Bidens pilosa and Urochloa decumbens stood out in accumulation of most nutrients without differing from when cultivated in monocultivation. The increase of the soybean mycorrhizal colonization was 53, 40 and 33% when in competition with Urochloa decumbens, Eleusine indica and Bidens pilosa species, respectively. A positive interaction occurred for soybean mycorrhizal colonization and competing plants irrespective of weed species or root contact.

  6. KERAGAMAN VEGETASI GULMA DI BAWAH TEGAKAN POHON KARET ( Hevea brasiliensis PADA UMUR DAN ARAH LERENG YANG BERBEDA DI PTPN IX BANYUMAS

    Directory of Open Access Journals (Sweden)

    Bhaskara Anggarda Gathot Subroto

    2018-02-01

    Full Text Available This research was conducted in PTPN IX Afdeling Krumput Banyumas in July 2016, with observational survey method is by field orientation, exploration, and analysis of vegetation. The data collection is done by means of interviews and direct observation. Preliminary surveys conducted to seek information from relevant agencies, environmental conditions around the rubber planting. The main survey is done to take samples of weeds in every age group, every group performed 5 times the sampling is considered to represent the age group. The variables measured were type of weed, SDR, and the coefficient Communities (C.The results showed that the weed dominant in the younger age group (1-5 years: Cyperus Kyllingia, Axonopus compressus, Clibadium Surinames, adolescent age group (6-10 years: Cyperus Kyllingia, Paspalum conjugatum Berg, Calopogonium mucuinoides Desv., Group age youth (11-15 years: Cyperus Kyllingia, Paspalum conjugatum Berg, Chromolaena odorata., adult group (16-20 years: Eleusine indica, Paspalum conjugatum Berg, Chromolaena odorata, then the dominant weeds on the slopes of the West-East direction (BT is Calopogonium mucuinoides Desv., Clibadium Surinames, Paspalum conjugatum Berg, and the dominant weed species in the North-South direction of the slope (US is Calopogonium mucuinoides Desv., Paspalum conjugatum Berg., and Axonopus compressus. Weeds dominant age group and Directions Slope is Cyperus killingia and Eleusine indica (L, Paspalum conjugatum Berg, Axonopus compressus, Clibadium Surinames and Calopogonium mucuinoides Desv.Keywords : weeds, rubber tree, group age, slopes, SDR

  7. Evaluating sampling strategy for DNA barcoding study of coastal and inland halo-tolerant Poaceae and Chenopodiaceae: A case study for increased sample size.

    Science.gov (United States)

    Yao, Peng-Cheng; Gao, Hai-Yan; Wei, Ya-Nan; Zhang, Jian-Hang; Chen, Xiao-Yong; Li, Hong-Qing

    2017-01-01

    Environmental conditions in coastal salt marsh habitats have led to the development of specialist genetic adaptations. We evaluated six DNA barcode loci of the 53 species of Poaceae and 15 species of Chenopodiaceae from China's coastal salt marsh area and inland area. Our results indicate that the optimum DNA barcode was ITS for coastal salt-tolerant Poaceae and matK for the Chenopodiaceae. Sampling strategies for ten common species of Poaceae and Chenopodiaceae were analyzed according to optimum barcode. We found that by increasing the number of samples collected from the coastal salt marsh area on the basis of inland samples, the number of haplotypes of Arundinella hirta, Digitaria ciliaris, Eleusine indica, Imperata cylindrica, Setaria viridis, and Chenopodium glaucum increased, with a principal coordinate plot clearly showing increased distribution points. The results of a Mann-Whitney test showed that for Digitaria ciliaris, Eleusine indica, Imperata cylindrica, and Setaria viridis, the distribution of intraspecific genetic distances was significantly different when samples from the coastal salt marsh area were included (P Imperata cylindrica and Chenopodium album, average intraspecific distance tended to reach stability. These results indicate that the sample size for DNA barcode of globally distributed species should be increased to 11-15.

  8. Plants Growth Rate in Evapotranspiration continuous system reactors as the 2nd Treatment at Anaerobic-evapotranspiration system with High Strength Ammonium in Leachate Influent

    Directory of Open Access Journals (Sweden)

    Badrus Zaman

    2014-05-01

    Full Text Available Ammonium is one of parameter which responsible to leachate toxicity. Preliminary research was shown that the Fimbristylis globulosa (water plant, Alocasia macrorrhiza (terrestrial plant and Eleusine indica (terrestrial grass were potential plants for used as object in evaporation reactor system with high strength ammonium  concentration in leachate treatment. This research was integrated of anaerobic system with evapotranspiration system with continuous influent using ammonium concentration in leachate was 2000 mg/l NH4-N. Plants growth rate was analyzed for 25 days operated. The result shown that average of thallus growth rate of Fimbristylis globulosa was 17,5 cm d-1. The average of leaf and thallus growth rate of Alocasia macrorrhiza was 18,1 cm d-1 and 3,2 cm d-1 respectively. The average of blade and thallus of Eleusine indica were same that was 4,7 cm d-1.This research conclude that integration system of anaerobic and evpotranspiration was be potential used for high strength ammonium in leachate treatment.

  9. LA ACTIVIDAD LABORAL DE LAS FAMILIAS AFRICANAS Y LATINOAMERICANAS REAGRUPADAS EN LA ESPAÑA MEDITERRÁNEA

    Directory of Open Access Journals (Sweden)

    Vicente Gozálvez Pérez

    2012-01-01

    Full Text Available La investigación se basa en los resultados de una encuesta realizada en 2009-2010, por el equipo investigador, a 348 inmigrados reagrupantes africanos y a 457 lati- noamericanos que residen en las provincias litorales entre Girona y Almería. La in- formación que se ofrece está referida a los aspectos laborales de estos dos colectivos continentales, tanto a escala del conjunto territorial indicado como para tres subá- reas incluidas en él: Cataluña litoral, Comunidad Valenciana y Murcia-Almería; se- gún los temas, se trata por separado a los reagrupantes y a los subgrupos familiares que conviven en España (reagrupantes, cónyuges, hijos. El estudio se centra en las estructuras de empleo por sectores económicos. También se estudian las redes mi- gratorias, tan decisivas en la orientación de estos flujos hacia España, la regulación laboral de estos trabajadores, la repercusión de la crisis actual en los empleos de las familias reagrupadas (paro, número de ocupados por familia e ingresos, la satisfac- ción laboral de los miembros de las familias (horas de trabajo, problemas laborales y salariales y la estabilidad laboral (antigüedad en el empleo, cursos de formación profesional, trabajo actual y expectativas del inmigrante. El recorrido por los temas laborales indicados, vinculados a los distintos grupos continentales y familiares y a las diferentes escalas territoriales, concluyen en mostrar situaciones económicas y sociales muy diferentes entre africanos y latinoamericanos, y entre los que residen en Cataluña litoral y en Murcia-Almería, en lo que intervienen, entre otras causas, los distintos «capitales» personales aportados por los dos colectivos continentales para acceder al empleo (formación, idioma, ... y las diferentes estructuras econó- micas de los territorios estudiados. Los africanos y los que residen en las provincias meridionales son los que presentan peores situaciones socioeconómicas.

  10. The STR polymorphism (AAAATn within the intron 1 of the tumor protein 53 (TP53 locus in 17 populations of different ethnic groups of Africa, America, Asia and Europe

    Directory of Open Access Journals (Sweden)

    Jorge Azofeifa

    2004-09-01

    Full Text Available The STR (AAAATn within intron 1 of the TP53 locus was screened in 17 populations from 3 main ethnic groups: Europeans, Asiatics, and Africans, and from the hybrid population of Costa Rica (1968 samples. Three alleles, 126/7 (bp/copies of the repeat, 131/8 and 136/9 were the most prevalent in all populations. Other alleles rarely reached frequencies of 10% or higher. Observed heterozygosities ranged between 0.351 and 0.829. Patterns of diversity fit well with both the geographic origin of the samples and the history of the populations screened. A statistical test suggests that single-step mutational events have been the main mechanism producing new alleles at this locus. Fixation indexes (R ST for this marker showed an effect of population subdivision on divergence only within the Asiatic group; they were insensitive at the level of major ethnic groups as well as within Africans and within Europeans. Rev. Biol. Trop. 52(3: 645-657. Epub 2004 Dic 15.Se estudió el polimorfismo del microsatélite (AAAATn del intrón 1 del gene TP53 en 17 poblaciones de 3 grupos étnicos: europeos, asiáticos, y africanos subsaharianos, así como de la población híbrida de Costa Rica (en total 1968 muestras. Tres alelos, 126/7 (pares de bases/ copias de la repetición, 131/8 y 136/9 fueron los más frecuentes en todas las poblaciones, aunque se observaron otros alelos usualmente a frecuencias menores al 10%. Las heterocigosis observadas variaron de 0.351 a 0.829. La distribución de la diversidad parece concordar con el origen geográfico de las muestras y con la historia de las poblaciones estudiadas. Una prueba estadística indica que el evento mutacional que más alelos nuevos produce en este marcador es el de un solo paso (expansión o contracción de una sola copia de la repetición. El índice de fijación R ST mostró los efectos de la subdivision de poblaciones sólo dentro del grupo de los asiáticos y mostró falta de sensibilidad cuando los grupos

  11. Epidemia de sarampo e trabalho escravo no Grão-Pará (1748-1778

    Directory of Open Access Journals (Sweden)

    Antonio Otaviano Vieira Junior

    2015-08-01

    Full Text Available ResumoO artigo apresenta o impacto populacional provocado pela epidemia de sarampo (1748-1750 na capitania do Grão-Pará e sua relação com o processo de inserção da mão de obra escrava africana. A análise é fundamentada na documentação produzida no século XVIII, levantada em diferentes arquivos brasileiros e portugueses, incluindo correspondências oficiais, crônicas, memórias, mapas populacionais e listagens de mortos pela epidemia. A documentação serial foi posta em base de dados, construída a partir das 80 listagens de mortos pelo sarampo, o que permitiu uma análise do impacto demográfico da epidemia. Concomitantemente, a contagem populacional das vilas e povoações da capitania, do terceiro quartel do século XVIII, compôs uma segunda base de dados e auxiliou na compreensão da distribuição interna de escravos africanos. O ponto de interseção entre as bases de dados é formado pelo conjunto da documentação histórica administrativa, que trata dos efeitos da epidemia e das possibilidades de solução da crise de mão de obra - ocasionada pela alta mortalidade de indígenas. O estudo procura mostrar não apenas a mortalidade causada pelo sarampo, mas também a construção de uma política para a inserção de escravos africanos na região. Para tanto abordam-se a epidemia em Belém, a importância do trabalho indígena para os colonos, o número de mortos e a distribuição da mortalidade considerando espaço e sazonalidade (meses e anos. Também se discutem a luta entre projetos para sanar a demanda de mão de obra, gerada pela alta mortalidade do sarampo, e a política de inserção de escravos africanos para combater a carência de trabalhadores, bem como a distribuição desses escravos na capitania.

  12. El vínculo simbólico con África en la poesía y cultura afromexicana

    Directory of Open Access Journals (Sweden)

    Judith Solís Téllez

    2018-06-01

    Full Text Available En el siglo XVI, como consecuencia de la expansión geográfica de los Siglos de Oro, los africanos llegaron a la Nueva España acompañando a los conquistadores, al principio como afirma Aguirre Beltrán, en calidad de criados. Fue debido al exterminio de los indígenas que comenzaron a introducirlos de manera masiva como esclavos. El mismo autor considera que el sistema de la esclavitud prácticamente borró los rastros de la cultura africana en México. A ello hay que agregar el sincretismo cultural y el mestizaje, porque los negros se integraron a la sociedad nacional. En la literatura mexicana la huella africana es exigua; la encontramos en los villancicos de Sor Juana, en donde transmite el habla trastocada y el bullicio cotidiano de los africanos; con quienes la autora tuvo un contacto cercano a través de los criados de la familia y de su esclava. Carmen Boullosa en Azúcar negra sigue los indicios del Negrito Poeta mexicano del que se duda haya tenido una existencia real, no obstante considera que: «No es menos importante que un hecho histórico, la creación imaginaria colectiva —la leyenda, el mito— es la huella más honda, más presente, de algo real. Es el caso del Negrito Poeta». Judith Solís considera que las poblaciones afrodescendientes, desafortunadamente, no conservaron una memoria oral sobre sus orígenes, ni de la esclavitud o de los trabajos de sus antecesores como siervos domésticos o vaqueriles en estancias ganaderas, más allá de unas cuantas generaciones. No tuvieron las condiciones para reconstruir —en palabras de Roger Bastide— la aldea africana en el lugar al que fueron trasladados, lo que hubiera hecho posible la transmisión de su memoria histórica y colectiva. Por supuesto, son y se sienten mexicanos. Sin embargo, con el paso del tiempo comenzaron a considerar el origen africano de sus antepasados y han empezado a construir la distinción frente al otro por medio del vínculo simbólico con

  13. PENTECOSTALES DE ITALIA

    Directory of Open Access Journals (Sweden)

    Enzo Pace

    2012-06-01

    Full Text Available El artículo se refiere al Pentecostalismo en Italia, centrándose en particular en Iglesias Pentecostales africanas. Como los inmigrantes africanos comenzaron a asentarse en la sociedad italiana, allí recrearon o crearon una red de comunidades carismáticas, sobre todo en la parte norte del país. Las iglesias pentecostales proporcionan apoyo espiritual, social y práctico a sus miembros con el fin de que puedan hacer frente los diversos problemas derivados de la condición del migrante en un nuevo país como Italia, monopolizado histórica y socialmente por el catolicismo. Por lo tanto, el objetivo del artículo es mostrar la relación entre el entorno socio-religioso y el impacto de las nuevas Iglesias africanas Pentecostales.

  14. Análise crítica da metáfora no discurso inaugural de Nelson Mandela

    OpenAIRE

    Candia, Guilene Detimermane de Souza

    2009-01-01

    Esta dissertação de mestrado refere-se à pesquisa, sob a perspectiva crítica e pragmática, das metáforas conceptuais e lingüísticas que tenham o sentido de portadora de ideologia e de estratégia de polidez num discurso político. Teve como base de estudo o Discurso Inaugural do líder sul-africano, Nelson Rolihlahla Mandela, proferido na ocasião de sua posse como presidente da África do Sul, em 10 de maio de 1994, na cidade de Johannesburgo, capital daquele país. O discurso fo...

  15. Uma lição vinda da África do Sul: os cartéis da construção estão aumentando significativamente os custos de infraestrutura da copa do mundo FIFA 2014 no Brasil?

    Directory of Open Access Journals (Sweden)

    Eddie Cottle

    2013-11-01

    Full Text Available http://dx.doi.org/10.5007/2175-8042.2013v25n41p166 O artigo é o resultado da parceria acadêmica entre IELA / UFSC - Instituto de Estudos Latino-Americanos  e Edie Cottle, um pesquisador Sul-Africano, autor de artigos críticos sobre os impactos da Copa do Mundo da FIFA de 2010 na vida da população daquele país. A metodologia utilizada na pesquisa é a desenvolvida pelo pesquisador Edie Cottle e o estudo tem como objetivo revelar os verdadeiros custos e possíveis superfaturamentos na construção de arenas brasileiras que receberão os jogos da Copa do Mundo 2014.

  16. ¿Qué deber saber un médico sobre el ébola?

    Directory of Open Access Journals (Sweden)

    2014-12-01

    Full Text Available El reciente brote provocado por el virus Ébola en varios países del oeste africano (Guinea, Liberia, Sierra Leona y Nigeria, se ha traducido, según el último informe de la Organización mundial de la Salud (OMS, en 13.567 infectados y 4.951 fallecidos, cifra que se cree, está subestimada debido a los inexistentes sistemas de sanitarios disponibles en los países centro de la epidemia. Con una mortalidad cercana al 40% ha supuesto una gran preocupación para todos servicios de salud pública mun-diales, especialmente, una vez que se ha tenido conocimiento de los primeros casos en los países desarrollados

  17. Elephants and human intervention in the Lower and Middle Pleistocene sites of Africa and Europe

    Directory of Open Access Journals (Sweden)

    Martos Romero, Juan Antonio

    1998-06-01

    Full Text Available In this paper, we review some African and European sites at which it is claimed that elephants were exploted by humans. The differences between sites with only one individual (type 1 and sites with a large number of elephants (type 2 are related to different formation processes and particular problems which limit the informative potential of sites.

    En el presente artículo se revisan yacimientos africanos y europeos donde se ha planteado la existencia de una intervención humana sobre elefantes. Se establece una diferencia entre sitios con un sólo individuo (tipo 1 o un número alto de elefantes (tipo 2. Con independencia del carácter de la intervención humana, cuando ésta es evidente, tales diferencias responden a unos procesos de formación distintos con problemáticas singulares que condicionan finalmente la capacidad informativa del yacimiento.

  18. Comparisons of phaseolin type and α-amylase inhibitor in common bean(Phaseolus vulgaris L.)in China

    Institute of Scientific and Technical Information of China (English)

    Yang Yao; Yibo Hu; Yingying Zhu; Yue Gao; Guixing Ren

    2016-01-01

    The objective of this study was to characterize the phaseolin type and a-amylase(αAI) level in common bean(Phaseolus vidgaris L.) accessions deposited in the Chinese National Genebank.The 40 accessions sampled were common varieties originating in Asia,North America,South America,Europe,and Africa.No Inca(I-) phaseolin was observed in the accessions.Only four accessions contained Tendergreen(T-) phaseolin and the remaining36 contained Sanilac(S-) phaseolin.aAI proteins extracted from nine accessions showed higher a-amylase inhibitory activity than the control(Phase 2,IC50 = 0.65 μg).These common bean accessions have potential use as nutraceutical ingredients.

  19. Estudo do melhoramento do sabor de cacau (Theobroma cacao L.) utilizando polifenoloxidase extraida da pinha (Annona squamosa L.) e tratamento termico não convencional

    OpenAIRE

    Sandra Drina Fernandez Barbery

    1999-01-01

    Resumo: Existem grandes diferenças no sabor de cacau dependendo de sua origem de produção, certas regiões produzem amêndoas com excessivo sabor ácido e amargo e forte adstringência. Em geral as amêndoas de cacau produzidas no Brasil e na Malásia, têm apresentado teores excessivos de acidez comparados com amêndoas provenientes do leste africano, por este motivo estas amêndoas são utilizadas em quantidades limitadas nas formulações. A presença do ácido acético e láctico seja de forma individual...

  20. Prosavana: Instrumento de Cooperação Internacional (Norte)-Sul-Sul

    OpenAIRE

    Toledo, Andre de Paiva

    2015-01-01

    Diante da crise energético-alimentar de 2008, a África passa a ser vista pelas instituições internacionais como território de expansão da fronteira agrícola, isto é, local de inserção do agronegócio. Apesar das contestações quanto ao caráter improdutivo do modelo tradicional de produção local, diversos Estados africanos têm estabelecido acordos internacionais de investimento com vistas à modernização de sua agricultura. Nesse contexto, surge o acordo trilateral entre Japão, Brasil e Moçambiqu...

  1. Ei nós, que viemos de outras terras, de outro mar: as origens das Festas de Coroação de Rei Negro e a Congada de Santa Efigênia da Vila de São José do Tocantins

    OpenAIRE

    Talita Viana

    2011-01-01

    O trabalho trata das primeiras investigações das origens da Congada de Santa Efigênia de São José do Tocantins, atual Niquelândia – GO, no intuito de fazer uma reflexão acerca da natureza da criação de uma cultura híbrida na América Latina. Se por um lado não se entende a Congada se não se tem em mente o processo de colonização do Novo Mundo, também o entendimento da festa clareia muito sobre as implicações culturais e cotidianas desse processo. A Festa, que contém traços culturais africanos,...

  2. Devoção e identidades: significados do culto de Santo Elesbão e Santa Efigênia no Rio de Janeiro e nas Minas Gerais no Setecentos

    OpenAIRE

    Oliveira, Anderson José Machado de

    2006-01-01

    O artigo procura refletir sobre o papel do culto de Santo Elesbão e Santa Efigênia, no século XVIII, como um dos fatores de construção de identidades entre segmentos da população negra no Brasil colonial. Defendo a idéia de que o estímulo ao culto fazia parte de uma das estratégias da Igreja na conversão de africanos e seus descendentes, no entanto, a complexidade do processo caracterizado pela diáspora das culturas africanas na América deu a este projeto de conversão outras dimensões. Num pr...

  3. Guerras, normalizaciones, crisis del Estado-nación en África subsahariana

    Directory of Open Access Journals (Sweden)

    Traducción Pilar Lozano Ortiz de Zárate

    2003-10-01

    Full Text Available Los conflictos armados de ciertos países africanos en la última década son analizados como el signo de una dificultad de sus regímenes para construir la nación que dicen defender. Esta tesis se apoya sobre la crisis del Estado- Nación y la difícil gestión de la diversidad. Dos paradigmas que resultan reveladores de un divorcio entre la aspiración a la democracia y la nación. La conflictividad en estos países modifica las relaciones y creencias de los actores en la capacidad del Estado para detentar el monopolio de la violencia legítima a la vez que invierte los parámetros de una economía de paz.

  4. Huellas de las religiones tradicionales del África subsahariana en América Latina y el Caribe

    Directory of Open Access Journals (Sweden)

    Lazaro Cabrera Thompson

    2008-01-01

    Full Text Available El artículo explora las religiones tradicionales practicadas por los pueblos ewe-mina, ewe-fon, bantú y yoruba del África subsahariana, antes de abordar las formas como estas prácticas religiosas persisten en el “Nuevo Mundo” tras la llegada forzosa de aquellos esclavizados africanos. Con base en la presencia de estas religiones tradicionales africanas en distintos países latinoamericanos y caribeño, se evidencia un conjunto religioso fusionado por historias, mitos, leyendas, danza, música, etc. de ascendencia africana y se hace un llamado a los/ as investigadores/as, que desde América Latina y el Caribe, indagan sobre las religiones tradicionales yoruba, para que franqueen los límites de Nigeria con el fin de abarcar a toda la diáspora yoruba.

  5. “Huellas de africanía”: recreando áfrica en el arte visual contemporáneo

    Directory of Open Access Journals (Sweden)

    Maria Candida Ferreira de Almeida

    2011-10-01

    Full Text Available El artículo presenta el concepto huellas de africanía, creado en el campo de la antropología, para explicar la permanencia de imaginarios africanos en la diáspora americana. Los objetivos son: describir cómo este concepto configura una poiética en las artes visuales y evaluar su viabilidad en la constitución de una estética negra. Se analizan dos artistas visuales contemporáneos: Emanuel Araújo (Brasil y Mercedes Angola (Colombia, quienes buscan vincular su obra con África, en procesos que pueden caracterizarse como profundamente eruditos, pues ambos conocen aspectos históricos y filosóficos del África representada, imaginada, creada y recreada en la diáspora.

  6. "HUELLAS DE AFRICANÍA": RECREANDO ÁFRICA EN EL ARTE VISUAL CONTEMPORÁNEO

    Directory of Open Access Journals (Sweden)

    Maria Candida Ferreira de Almeida

    2011-01-01

    Full Text Available El artículo presenta el concepto huellas de africanía, creado en el campo de la antropología, para explicar la permanencia de imaginarios africanos en la diáspora americana. Los objetivos son: describir cómo este concepto configura una poiética en las artes visuales y evaluar su viabilidad en la constitución de una estética negra. Se analizan dos artistas visuales contemporáneos: Emanuel Araújo (Brasil y Mercedes Angola (Colombia, quienes buscan vincular su obra con África, en procesos que pueden caracterizarse como profundamente eruditos, pues ambos conocen aspectos históricos y filosóficos del África representada, imaginada, creada y recreada en la diáspora.

  7. Salazar e Tchombé. o apoio de Portugal ao Catanga (1961-1967)

    OpenAIRE

    Velez, Rui Manuel Proença Bonita

    2010-01-01

    Dissertação apresentada para cumprimento dos requisitos necessários à obtenção do grau de Mestre em Ciência Política e Relações Internacionais Com este trabalho, pretendemos demonstrar o envolvimento que o governo português, na altura liderado por Oliveira Salazar, teve na atitude rebelde de Moisés Tchombé, quando este proclamou a independência do Catanga, contra o Governo Central do Congo e, também, para com a missão das Nações Unidas, a operar neste território africano. Apesar da frágil ...

  8. El yeso, un material apropiado para una construcción barata

    Directory of Open Access Journals (Sweden)

    Nolhier, Marc

    1986-07-01

    Full Text Available This work presents an evaluation of the lime resistance, workability properties and low cost, applied to low cost housing in developping countries. Starting from the experiences carried out in African countries, the technical problems, labour adaptation to the construction process with gypsum prefabricated blocks and its profitability are studied.En este artículo se hace una valoración de las propiedades del yeso en cuanto a resistencia, trabajabilidad y bajo costo con el fin de aplicarlo a una construcción de viviendas baratas en países poco desarrollados. Basándose en experimentos llevados a cabo en países africanos, se estudia el problema de tecnología, de la adaptación de la mano de obra al proceso de construcción con bloques de yeso prefabricados y de su rentabilidad.

  9. Circulação atlântica: idade, tempo de trabalho e funções de escravos e libertos na marinha mercante luso-brasileira, séculos XVIII e XIX

    Directory of Open Access Journals (Sweden)

    Jaime RODRIGUES

    2015-12-01

    Full Text Available Resumo A partir de elementos de histórias de vida profissional que podem ser construídos de modo ainda fragmentário, procuro identificar as formas de engajamento na marinha mercante luso-brasileira de escravos e libertos africanos ou nascidos em Portugal e na América portuguesa. O recorte temporal vai da década de 1760 (quando os primeiros registros de matrículas de tripulantes começaram a ser feitos até os anos 1820. O texto procura inventariar as funções desempenhadas por esses homens, bem como apresentar dados de caráter censitário, tais como a idade com que se iniciavam no mundo do trabalho marítimo e o tempo de experiência deles nas profissões do mar.

  10. Building "the Yoruba truth" An afroepistemologic reading of the Ifá system

    OpenAIRE

    de Diego González, Antonio

    2012-01-01

    Este artículo propone una lectura afroepistemológica del sistema de Ifá. Las políticas de la epistemología académica europea han despreciado el conocimiento tradicional africano. Ifá no ha sido una excepción. Pero a través de este método se han configurado gran parte de las normas socio-culturales y epistemológicas de la sociedad yorùbá. Así Ifá se convierte en algo más importante que un rito de adivinación, pues representa la cohesión político-social y epistemológica de una gran parte de los...

  11. O Efeito China nas Exportações Brasileiras em Terceiros Mercados: Uma Análise do Constant Market Share

    OpenAIRE

    Lia Valls Pereira

    2014-01-01

    Estudos recentes chamam atenção que a China poderá limitar a diversificação e a escalada para produtos de maior conteúdo tecnológico das exportações de países, como o Brasil, nos seus mercados tradicionais de manufaturas. O objetivo da pesquisa é estimar o deslocamento das exportações brasileiras pela China nos mercados dos países sul-americanos, México, Estados Unidos, União Europeia e países africanos (Nigéria, África do Sul e Moçambique) entre 2002 e 2011. Foi utilizado o modelo de constan...

  12. Le genre Sivanasua (Lophocyoninae, Hyaenodontidae, Creodonta, Mammalia

    Directory of Open Access Journals (Sweden)

    Morales, J.

    1999-08-01

    Full Text Available Two upper teeth from the lower Miocene of Le Chêne de Navere (Gers, France are interpreted as MI and M2 of Sivanasua viverroides. The genus is known in Europe by two species. The origin of the Lophocyoninae is re-evaluated. We consider the group as rooted in some African Hyaenodontoid Creodonta.Dos dientes del yacimiento mioceno (MN4b de Chêne de Navere (Gers, Francia se interpretan como MI y M2 de Sivanasua viverroides. El género Sivanasua está representado en Europa por dos especies. El origen de los Lophocyoninae se reconsidera, primero atribuidos a los Ailuridae y después relacionados con los Viverridae, aquí son considerados como emparentados a los Creodontos Hyaenodontidae africanos.

  13. Les Sépharades du Maroc vus par les Espagnols: trois témoignages de l'époque du protectorat (1818, 1919, 1922)

    OpenAIRE

    Díaz-Mas, Paloma

    2012-01-01

    Analiza la imagen de los sefardíes en tres libros publicados en España durante los primeros años del Protectorado español en Marruecos: el del misionero franciscano Africano Fernández [seudónimo de Ramón Fernández Lestón], España en África y el peligro judío. Apuntes de un testigo, de 1918, profundamente antijudío; el del periodista liberal, relacionado con Ignacio Bauer y seguidor de las tesis de Ángel Pulido Manuel Ortega, Los hebreos de Marruecos, de 1919; y el del psiquiatra destinado com...

  14. Il "rex sacrorum" in Africa: testimonianze

    Directory of Open Access Journals (Sweden)

    Chantal GABRIELLI

    2010-02-01

    Full Text Available RESUMEN: Questo articolo analizza alcune epigrafi provenienti da due province romane dell'Africa (Mauretania Caesariensis e Numidia, che presentano la carica di rex sacrorum. Tale sacerdozio, creato a Roma nei primi secoli délia repubblica è presente nel contesto africano in época imperiale con una valenza precisa: il termine rex sacrorum sembra essere la traduzione in latino di una carica religiosa púnica e indicherebbe forse un'autorità religiosa locale.ABSTRACT: This paper analyses some inscriptions from two Roman provinces of Africa (Mauretania Caesariensis and Numidia, which have the title rex sacrorum. This priesthood, created at the start of the Republic, appears in the African context in the imperial age with a further value; the rex sacrorum seems to be the translation in Latin of a Neo-Punic word, that is a native priesthood, perhaps a chief religious authority.

  15. La cultura de los negros esclavizados del Brasil: Arquitectura y rito en la ciudad de Salvador, Bahía

    Directory of Open Access Journals (Sweden)

    Mônica de Souza

    2012-12-01

    Full Text Available El objetivo de este texto es presentar parte de la cultura, arquitectura, religión y modos de vida de Brasil a través de la historia de los africanos esclavizados que llegaron al país y sus descendientes. Este artículo plantea un vínculo entre arquitectura y rito, analizando los quilombos como refugio de los esclavos; el candomblé como rito de celebración y las fiestas religiosas como la de Nuestro Senhor do Bonfim. El texto se refiere asimismo a Salvador de Bahía y a su Barrio del Pelourinho, un lugar que resume y representa toda la cultura, el patrimonio físico e inmaterial de la cultura africana, hoy afro-brasileña.

  16. Retratos do Brasil na celebração dos 500 anos

    Directory of Open Access Journals (Sweden)

    Maria Nazareth Soares Fonseca

    2001-03-01

    Full Text Available Este texto discute tendências de celebração e de restauração postas emprática, na sociedade brasileira, visando a salvar do esquecimento a memória e as tradições que nos foram legadas pelos escravos africanos. Referindo-se a mostras e exposições que procuram levar ao grande público fragmentos da memória afro-brasileira, procura-se perceber nesses espaços feições híbridas da inter-relação entre veneração e espetáculo e entre devotos e consumidores.

  17. Que dizer agora sobre arte africana? A África nas exposições da virada do século XX para o XXI, no Brasil e no exterior

    OpenAIRE

    Salum, Marta Heloisa Leuba

    2014-01-01

    Este artigo trata do destaque dado à África na curadoria de mostras de alcance mundial no período que vai da década de 1980 até 2010, ano que marca o cinquentenário da descolonização e nacionalização da maioria dos países africanos. Algumas delas tocam, por sua vez, no curso de exposições sobre arte e cultura afro-brasileira desde o centenário da abolição da escravidão no Brasil. Na maioria delas, porém, observa-se certo descomprometimento com o fato colonial na África, cuja representação mai...

  18. A poética da esperança: sentidos políticos nas memórias de Nelson Mandela

    OpenAIRE

    Silva, Cristiane Mare da

    2016-01-01

    O estudo que ora apresento desenvolveu-se no Programa de Pós-Graduação em História, da Pontifícia Universidade Católica de São Paulo e tem por objeto textos biográficos e autobiográficos do sul africano Nelson Mandela, que nos permitem apreender momentos e enunciados, orientadores da luta pela igualdade, do exercício da tolerância e a defesa dos direitos humanos, não apenas na África do Sul, mas por toda parte onde existam conflitos raciais e coloniais inerentes à enxpansão do Hemisfério Ocid...

  19. Estudo de Caso de um Distúrbio Ondulatório de Leste sobre o Estado do Rio Grande do Norte - Brasil

    Directory of Open Access Journals (Sweden)

    Danielson Jorge Delgado Neves

    Full Text Available Resumo Distúrbios ondulatórios de leste (DOL são sistemas atmosféricos presentes na região tropical, preferencialmente sobre áreas dos oceanos Atlântico e Pacífico. Sobre o Atlântico são identificados, inicialmente, próximos à costa oeste do continente Africano e se propagam embebidos no fluxo dos Alíseos, em forma de ondas que se deslocam de leste para oeste. No Atlântico tropical sul, os DOL atuam, preferencialmente sobre o leste do Nordeste do Brasil (NEB contribuindo significativamente para os totais anuais de chuva. O presente trabalho analisa um caso de ocorrência de um DOL sobre o NEB, no estado do Rio Grande do Norte, no dia 13 de Junho de 2014, fazendo o uso de dados de reanálise da componente meridional do vento e vorticidade relativa nos níveis de 850 hPa, água precipitável e dados observados de chuva. Observa-se que o DOL se intensifica entre os dias 12 e 13 de Junho, com valores de vorticidade negativa e água precipitável significativos, próximo à costa do NEB, e se apresenta inicialmente como uma extensão da atividade convectiva presente na ZCIT, desde o Oeste Africano. O DOL causou valores significativos de chuva, gerando deslizamentos de terra, alagamentos e problemas no trânsito de Natal, durante copa do mundo de futebol.

  20. Nouveaux Acteurs Sociaux, Permanence et Renouvellement du Clientélisme Politique en Afrique Sub-saharienne New social actors, continuity and renewal of political clientelism in Sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Jean-François Médard

    2012-02-01

    Full Text Available O objecto de análise deste artigo são as dinâmicas e reconfigurações do clientelismo político, um dos traços centrais do funcionamento dos sistemas políticos africanos. As recomposições e adaptações dos sistemas políticos africanos na fase das «transições» para as democracias multipartidárias, em África, face às crises políticas, sociais e económicas e o surgimento subsequente de novos actores sociais nas estruturas de poder (político africanas são o centro de análise deste texto. O artigo sustenta que a «democracia» e o multipartidarismo não contribuíram para a erradicação ou mitigação das práticas clien­telares. O máximo que se conseguiu, até ao momento, foi a criação de condições para a renegociação destas mesmas relações clientelares.The object of this article is to examine the dynamics and reconfigurations of political clientelism, one of the major characteristics of African political systems. The analysis focuses on the restructuring and adapting of African political systems during the «tran­sitional phase» to multi-party democracies in reaction to the political, social and economic crises and the subsequent emergence of new social actors in the African (political power structures. The article argues that «democracy» and multipartyism have not contributed to eradicate or mitigate clientelist practices and that most achieved, until now, has been the creation of conditions that favor the renegotiation of clientelist relationships.

  1. Há salvação para a África? Thabo Mbeki e seu New Partnership for African development

    Directory of Open Access Journals (Sweden)

    Wolfgang Döpcke

    2002-06-01

    Full Text Available O NEPAD - New Partnership for African Development - tem seus primórdios em 1996, proposto pelo atual presidente da África do Sul, Thabo Mbeki e outros líderes africanos, para erradicar a marginalização e o subdesenvolvimento africanos e promover o crescimento econômico, através da integração continental. Seus objetivos, inseridos no contexto da globalização e do African Renaissance, incorpora valores da luta antiapartheid sul-africana, restauração da auto-estima e resgate de valores pré-coloniais. O que o difere de outros planos que não deram certo na África é o vínculo inseparável entre democracia, direitos humanos, paz, governabilidade e o desenvolvimento econômico, as responsabilidades assumidas pelos participantes e a propriedade africana do plano.NEPAD - New Partnership for African Development - was originated in 1996, proposed by the current South African president, Thabo Mbeki and other African leaders, to eradicate the African exclusion and underdevelopment and to promote the economical growth, through the continental integration. It's objectives, in the context of globalization and African Renaissance, incorporates values of the fight against apartheid in South Africa, restoration of the self-esteem and recovering pre-colonial values. What differs this from other plans that did not work is the inseparable entail among democracy, human rights, peace, governability and the economical development, the responsibilities assumed by the participants and the African property of the plan.

  2. Inauguralidade ancestral: a oratura de transformar palavra em OURO! OBA!

    Directory of Open Access Journals (Sweden)

    Toni Edson Costa Santos (UFAL

    2014-07-01

    Full Text Available Toni Edson Costa Santos é ator negro sergipano que sobe aos palcos aos 11 anos de idade. Torna-se dramaturgo, diretor, compositor e ator de forma auto-didata e a partir de 1998 inicia sua formação através de cursos. Desde 1999 é contador de histórias e em 2006 passa a ser formador de contadores, tem sua pesquisa direcionada para contos africanos e contos populares do Brasil. É licenciado em artes cênicas (UDESC, Mestre em Literatura Brasileira (UFSC e em 2004, 2007,2008 e 2009 foi professor universitário de Prática Teatral (UDESC. De 2009 a 2010 foi professor do curso de Artes Cênicas da UFSC. Ator profissional desde 2000, trabalhando com teatro de rua a partir de 2003, modalidade teatral em que concentra sua pesquisa de forma mais efetiva. Fez parte do Grupo A de Teatro, que depois se torna Africatarina, compôs o quadro do grupo Cachola no Caixote e atualmente é membro fundador da Trupe Popular Parrua (SC e do Grupo Iwá (BA. É doutorando do Programa de Pós Graduação em Artes Cênicas da Universidade federal da Bahia (PPGAC/UFBA, estudando procedimentos e tradição oral de contadores de história africanos como inspiração para rodas de história como arte pública com contos brasileiros, e professor de Encenação e Teatro de Rua da Escola Técnica da Universidade Federal de Alagoas (ETA/UFAL.

  3. De amores y seducciones. El mestizaje en la Audiencia del Nuevo Reino de Granada en el siglo XVII

    Directory of Open Access Journals (Sweden)

    María Cristina Navarrete

    2003-12-01

    Full Text Available Racial mixture replayed an important role in the creation of a population of castes in Spanish America. The efforts on behalf of the Crown and Church to avoid race mixture had no effect. The Spaniards, the Indians and the Africans interacted sexually throughout the years which resulted in a variety of racial mixture; this development strengthened the formation o f numerous classes of free persons of African ancestry. The inter-racial links during the colonial period were constant. If the slave owners did not legitimate their relations with the female slaves and free women, blacks and mulattas, they maintained ties of "concubine" some of which were quite strong and long-lasting.//La mezcla entre razas jugó un papel importante en la creación de una población de castas en la América española. Los esfuerzos de la Corona y de la Iglesia para evitar dicha mezcla no surtieron efecto. Los españoles, los indígenas y los africanos interactuaron sexualmente a lo largo del tiempo, lo cual dio como resultado una variedad de razas. Esto fortaleció la formación de numerosas clases de personas libres con ancestros africanos. Sus lazos inter-raciales durante la Colonia fueron constantes, si los dueños de esclavos no legitimaban las relaciones con sus esclavas, con mujeres libres, negras y mulatas, mantenían lazos de “concubinato”, algunos de los cuales eran bastante fuertes y duraderos.

  4. MOÇAMBIQUE: compulsando as migrações internas e internacionais

    Directory of Open Access Journals (Sweden)

    Gonçalves Patrício

    2016-08-01

    Los estudios sobre las migraciones se han llevado a cabo principalmente en el contexto Norte-Sur, como si se tratara de un movimiento unidireccional, cuando la realidad muestra que estos flujos se producen también en el plano horizontal, es decir, dentro de las regiones del Sur, como se puede observar en el continente africano. Mediante este artículo se pretende hacer una reflexión sobre las migraciones internas e internacionales, en lo cual hacemos hincapié la entrada de extranjeros sea en forma regular e principalmente irregular cada vez más pronunciada en Mozambique. El procedimiento de recolección y procesamiento de datos fueron basados principalmente en la investigación bibliográfica, revisión de documentos y el análisis de los datos estadísticos disponibles sobre la migración en Mozambique. Los resultados de la investigación sugieren que la migración y la movilidad en Mozambique varían según la ubicación, perfil histórico, económico y ambiental de las regiones. Continúa la tendencia de la migración a los países vecinos, especialmente a Sudáfrica, al mismo tiempo que se observa la entrada de inmigrantes de diversas partes del mundo, provenientes en su mayoría de países africanos, que atraídos por la relativa estabilidad socioeconómica y política del país, buscan seguridad y mejores condiciones de vida. Palabras clave: Mozambique; Inmigrantes; Migraciones Internas; Migraciones Internacionales.

  5. Distribución de tres polimorfismos del gen TSLP en población afrodescendiente de San Basilio de Palenque, Colombia

    Directory of Open Access Journals (Sweden)

    Luis Fang

    2013-06-01

    Full Text Available Introducción. La linfopoyetina tímica del estroma (Thymic Stromal Lymphopoietin, TSLP se ha vinculado como un gen de propensión al desarrollo de enfermedades alérgicas. Se sabe que la población de Cartagena es una mezcla triétnica, en la cual el componente de herencia africana se asoció con el riesgo de asma y altos niveles séricos de IgE total. Este componente provino de esclavos africanos que lograron organizarse en “palenques”, uno de ellos es San Basilio de Palenque, en la Costa Caribe colombiana. Objetivo. Determinar la distribución de los polimorfismos de nucleótido simple (Single Nucleotide Polymorphism, SNP rs1837253, rs17551370 y rs2289276 del gen TSLP en individuos afrodescendientes de San Basilio de Palenque. Materiales y métodos. Mediante PCR en tiempo real y sondas TaqMan SNP Genotyping™ segenotipificaron estos SNP en 80 individuos afrodescendientes entre los 5 y 18 años de edad. Resultados. El alelo de menor frecuencia para el polimorfismo rs1837253 fue el alelo T (41,9 %, para el rs17551370, el alelo A (14,3 %, y para el rs2289276, el alelo T (22,5 %. La distribución de los polimorfismos rs17551370 y rs2289276 se mantuvo en equilibrio genético de Hardy-Weinberg. Las frecuencias alélicas de cada SNP no mostraron diferencias significativas con las reportadas para poblaciones africanas. Conclusiones. Los tres polimorfismos analizados en el gen TSLP estuvieron presentes en la muestra de población de San Basilio de Palenque y su distribución es similar a la reportada para poblaciones africanas y para poblaciones americanas de ancestro africano. doi: http://dx.doi.org/10.7705/biomedica.v33i2.655

  6. Diversidade na sala de aula: Representação da cultura afro-brasileira

    Directory of Open Access Journals (Sweden)

    Flávia Brocchetto Ramos

    2015-08-01

    Full Text Available After the implementation of the Elementary School in nine years, the Ministry of Education (MEC, by means of the Programa Nacional do Livro Didático (PNLD – The National Coursebook Program, distributed, in 2010, collections formed by supplementary teaching materials to Elementary School classrooms of the 1st and 2nd years. In this study, we analyze the book “Seis pequenos contos africanos sobre a criação do mundo e do homem” (“Six African short stories about the creation of the world and the man, by Raul Lody. The article discusses the representation of African culture in children’s literature, presents the object of analysis and, finally, discusses ethnic issues in the book, which is designed for young readers. Thus, the paper aims to contribute for the consideration of the young reader as an individual who has the right to live with cultural diversity, present in Brazil and conveyed in the literature. A partir da implantação do Ensino Fundamental de nove anos, o MEC (Ministério da Educação, pelo Programa Nacional do Livro Didático (PNLD, distribuiu, em 2010, às salas de aula do 1º e 2º anos do Ensino Fundamental, acervos formados por obras paradidáticas. Neste estudo, analisaremos o título Seis pequenos contos africanos sobre a criação do mundo e do homem, de Raul Lody. O artigo discute a representação da cultura africana na literatura infantil, apresenta a obra objeto de análise e, por fim, discute questões étnicas na obra destinada ao leitor criança. Assim, o artigo pretende contribuir para pensar a criança leitora como um sujeito que tem direito a conviver com a diversidade cultural, presente no Brasil e veiculada na literatura.

  7. Studies on the Elemental and Chemical Constituent of Some Myanmar Indigenous Medicinal Plants used for the Treatment of Hypertension

    International Nuclear Information System (INIS)

    Myatt Hla Wai; Kyaw Naing; Hla Ngwe; Hnin Pwint Aung; Myint U; Maung Maung Htay

    2004-06-01

    Study of Myanmar indigenous medicinal plants used for the treatment of hypertension was conducted. The samples studied were Gant-ka-lar (Gisekia pharnaceoides), Dan-da-lun (Moringa oleifera), Egayit (Millingtonia hortensis), Sue-pan (Carthumas tinctarius), Kauk-yoe-new (Oxystelma esculentum), Shauk (Citrus medica), Kyet-lei-san (Vitex glabrata), Sin-ngo-myet (Eleusine indica). In all these samples, qualitative determination of potassium had been determined by High Purity Germanium gamma counter and quantitative determination had been accomplished by NaI (Tl) gamma scintillation counting and ''Aloka'' gross gamma counting methods. In addition, quantitative determination of the elements in these samples was carried out by Atomic Absorption Spectrophotometry and Flame photometry. Relative quantitative elemental analysis of these samples was carried out by using Energy Dispersive X-ray Fluorescence (EDXRF) spectrometry

  8. Avaliação de herbicidas de pós-emergência na cultura da cebola Evaluation of herbicides on post emergent weed control in onion crop

    Directory of Open Access Journals (Sweden)

    Jeferson Zagonel

    2000-11-01

    Full Text Available O objetivo deste trabalho foi avaliar a eficiência e a seletividade do herbicida clethodim, em duas formulações (120 e 240 g/l, no controle de plantas daninhas na cultura da cebola. O experimento foi instalado na Fazenda Escola da UEPG, em Ponta Grossa (PR, no ano de 1998. O delineamento experimental utilizado foi blocos ao acaso com quatro repetições, constando dos tratamentos: clethodim (120 g/l + óleo mineral nas doses de 72, 84 e 96 g i.a./ha; clethodim (240 g/l na dose de 84 g i.a./ha adicionado de 1,0 l/ha de óleo mineral (Assist; testemunha capinada e testemunha sem capina. A cultivar de cebola utilizada foi Baia Periforme e as plantas daninhas predominantes no experimento foram Brachiaria plantaginea (capim-papuã, Digitaria horizontalis (capim-milhã e Eleusine indica (capim pé-de-galinha. As avaliações de controle e de fitotoxicidade foram efetuadas aos 7, 14, 28 e 42 dias após a aplicação dos tratamentos (DAA onde verificou-se que o clethodim (120 g/l nas doses de 84 e 96 g i.a./ha foi igualmente eficiente ao clethodim (240 g/l no controle sobre Brachiaria plantaginea, Digitaria horizontalis e Eleusine indica; esses tratamentos mostraram produção similar e superior à verificada para a testemunha sem capina e causaram leve redução no porte das plantas de cebola aos 7 dias após sua aplicação, o que não foi mais observado nas avaliações posteriores.This study had the purpose of evaluating the efficiency and selectivity of the herbicide clethodim, in two formulations (120 and 240 g/l for weed control in onion crop. The experiment was realized at the University of Ponta Grossa, in Brazil, in 1998. The experimental design was of randomized blocks with four replicates. The following treatments were evaluated: clethodim (120 g/L + mineral oil using doses of 72, 84 and 96 g i.a./ha; clethodim (240 g/L with 84 g i.a./ha added with 1.0 L/ha of mineral oil; weed free and weedy. The onion cultivar used was Baia Periforme

  9. Phytoremediation in the tropics--influence of heavy crude oil on root morphological characteristics of graminoids.

    Science.gov (United States)

    Merkl, Nicole; Schultze-Kraft, Rainer; Infante, Carmen

    2005-11-01

    When studying species for phytoremediation of petroleum-contaminated soils, one of the main traits is the root zone where enhanced petroleum degradation takes place. Root morphological characteristics of three tropical graminoids were studied. Specific root length (SRL), surface area, volume and average root diameter (ARD) of plants grown in crude oil-contaminated and uncontaminated soil were compared. Brachiaria brizantha and Cyperus aggregatus showed coarser roots in polluted soil compared to the control as expressed in an increased ARD. B. brizantha had a significantly larger specific root surface area in contaminated soil. Additionally, a shift of SRL and surface area per diameter class towards higher diameters was found. Oil contamination also caused a significantly smaller SRL and surface area in the finest diameter class of C. aggregatus. The root structure of Eleusine indica was not significantly affected by crude oil. Higher specific root surface area was related to higher degradation of petroleum hydrocarbons found in previous studies.

  10. Reconnaissance On Chi-Square Test Procedure For Determining Two Species Association

    Science.gov (United States)

    Marisa, Hanifa

    2008-01-01

    Determining the assosiation of two species by using chi-square test has been published. Utility of this procedure to plants species at certain location, shows that the procedure could not find "ecologically" association. Tens sampling units have been made to record some weeds species in Indralaya, South Sumatera. Chi square test; Xt2 = N[|(ad)-(bc)|-(N/2)]2/mnrs (Eq:1) on two species (Cleome sp and Eleusine indica) of the weeds shows positive assosiation; while ecologically in nature, there is no relationship between them. Some alternatives are proposed to this problem; simplified chi-square test steps, make further study to find out ecologically association, or at last, ignore it.

  11. Dinitroaniline herbicide resistance and the microtubule cytoskeleton.

    Science.gov (United States)

    Anthony; Hussey

    1999-03-01

    Dinitroaniline herbicides have been used for pre-emergence weed control for the past 25 years in cotton, soybean, wheat and oilseed crops. Considering their long persistence and extensive use, resistance to dinitroanilines is fairly rare. However, the most widespread dinitroaniline-resistant weeds, the highly resistant (R) and the intermediate (I) biotypes of the invasive goosegrass Eleusine indica, are now infesting more than 1000 cotton fields in the southern states of the USA. The molecular basis of this resistance has been identified, and found to be a point mutation in a major microtubule cytoskeletal protein, alpha-tubulin. These studies have served both to explain the establishment of resistance and to reveal fundamental properties of tubulin gene expression and microtubule structure.

  12. Host Status of Seven Weed Species and Their Effects on Ditylenchus destructor Infestation of Peanut.

    Science.gov (United States)

    De Waele, D; Jordaan, E M; Basson, S

    1990-07-01

    The host suitability to Ditylenchus destructor of seven common weed species in peanut (Arachis hypogaea) fields in South Africa was determined. Based on the number of nematodes per root unit, white goosefoot (Chenopodium album), feathertop chloris (Chloris virgata), purple nutsedge (Cyperus rotundus), jimson weed (Datura stramonium), goose grass (Eleusine indica), khaki weed (Tagetes minuta), and cocklebur (Xanthium strumarium) were poor hosts. Ditylenchus destructor survived on all weed species; population densities increased in peanut hulls and caused severe damage to seeds of peanut grown after weeds. Roots of purple nutsedge left in the soil suppressed populations of D. destructor and root and pod development in peanut grown after the weed. However, nematode populations in peanut hulls and seeds were not suppressed. Some weed species, especially purple nutsedge which is common in peanut fields, can be used to indicate the presence of D. destructor in the absence of peanut.

  13. EFEITO DE CYNAZINE E LINURON NO CONTROLE DE PLANTAS DANINHAS E NA PRODUTIVIDADE DA CEBOLA (Allium cepa L.d EFFECT OF CYANAZINE AND LINURON ON WEEDS AND PRODUCTIVITY IN ONION CROP (Allium cepa L.

    Directory of Open Access Journals (Sweden)

    Natan Fontoura da Silva

    2007-09-01

    Full Text Available

    Foi realizado um experimento com cebola (Allium cepa L. cv . Texas Early Grano - 502, transplantada em Goiânia, Goiás, no período de junho a novembro de 1988, visando ao controle de plantas daninhas com cyanazine e linuron aplicados após o transplante da cultura. Nas condições em que o ensaio foi realizado, concluiu-se que cyanazine e linuron provocaram fitotoxicidade na cultura da cebola, causando redução na produção em relação à testemunha. Cyanazine controlou Portulaca oleracea e Amaranthus spp. até 45 dias e Commelina virginica, Eleusine indica e Brachiaria plantaginea até 30 dias após a aplicação. Linuron controlou P. oleracea, Amaranthus spp. e B. plantaginea até 45 dias após a aplicação, mas não controlou eficientemente C. virginica, E. indica e Digitaria horizontalis.

    This work presents the results of a field experiment carried out in Goiânia, State of Goiás, Brazil, to estimate the efficiency of herbicides in controlling weeds in onion crop of Texas Early Grano 502. Cyanazine controlled Portulaca oleracea, Amaranthus spp. till 45 days, and Commelina virginica. Eleusine indica and Brachiaria plantaginea till 30 days after application. Linuron controlled P. oleracea, Amaranthus spp. and B. plantaginea during 45 days. Both herbicides showed phytotoxicity decreasing the onion productivity.

  14. Interferência entre espécies de planta daninha e duas cultivares de feijoeiro em duas épocas de semeadura Interference between weed species and two bean cultivars in two times of sowing

    Directory of Open Access Journals (Sweden)

    Arthur Arrobas Martins Barroso

    2010-01-01

    Full Text Available O Brasil é o maior produtor mundial de feijão, mas a interferência das plantas daninhas pode causar reduções de produtividade entre 15% e 80%, devido a fatores como cultivar de feijoeiro e espécies de plantas daninhas presentes na área. Objetivou-se com este trabalho avaliar os efeitos de seis espécies de plantas daninhas sobre o crescimento e a produtividade de duas cultivares de feijoeiro, em duas safras. Observou-se que as plantas eudicotiledôneas causam maior interferência na cultura, principalmente Amaranthus viridis e Raphanus raphanistrum. Todas causam perdas na produção do feijoeiro, exceto Eleusine indica, a menos competitiva. A cultivar ´Rubi´ é mais produtiva e mais competitiva que a ´Carioca´, e a maior produtividade é atingida na safra da seca. A escolha da cultivar e da data correta para a semeadura podem ser estratégias de manejo no controle de invasoras.Brazil is the world's largest producer of bean, but weed interference can cause yield losses between 15 to 80% due several factors such as bean cultivar and weed species in the area. The objective of this study was to evaluate the effects of six weed species on growth and productivity of two bean cultivars, in two sowing seasons. It was observed that the dicot plants cause more interference in the crop, especially Amaranthus viridis and Raphanus raphanistrum. All cause losses in bean yield except Eleusine indica that was less competitive. The ´Rubi´ bean cultivar is more productive and competitive than ´Carioca´, and the higher production is achieved during the drought sowing season. The choice of cultivar and correct season for sowing may be management strategy as in weeds control.

  15. CIDADES NEGRAS – PETRÓPOLIS IMPERIAL

    Directory of Open Access Journals (Sweden)

    Renata Aquino

    2014-12-01

    Full Text Available Cidade negra e população negra são o enfoque deste artigo sobre a cidade de Petrópolis na Região Serrana do estado do Rio de Janeiro, visando estabelecer novos parâmetros para discussão do espaço geográfico da região da cidade de Petrópolis por meio de outras explicações sobre o povoamento e desenvolvimento desta localidade. Cidade que a história oficial consagrou como cidade imperial e de colonização alemã, negando de forma ideológica as atividades econômicas da cidade e da região e tornando invisível a existência de população de maioria afrodescendente. Apresentamos neste artigo uma discussão sobre a ideologia da colonização alemã como solução para o Brasil, o que explica a imigração alemã para a localidade e também permite compreender a formação da ideologia sobre as origens populacionais e econômicas deste lugar. Argumentamos contra tal ideologia, reafirmando e investigando a existência de colonizadores africanos a partir das diversas fontes que podem levar ao encontro das inscrições afro, materiais e imateriais, na história e na cultura da região. Partimos da ideia da constituição de um território no período colonial que se deu devido ao fluxo de populações dos arredores, não somente devido à Estrada do Ouro. A base do povoamento da região veio das fazendas que exploravam o trabalho escravizado. Do território ocupado por africanos e afrodescendentes, nasceu a cidade que, posteriormente, instalou alguns grupos de alemães e, nesta fusão populacional, constituiu-se a forte presença de populações negra e mesmo branca, de outra origem que não a alemã. Local que devido à existência da Estrada do Ouro, ligando cidades mineiras ao porto do Rio de Janeiro, recebeu as inscrições de povoamento de africanos e afrodescendente pelos dois séculos antes da fundação oficial da cidade. O artigo se concentra nos documentos que demonstram a existência de população negra na localidade.

  16. Avaliaçao de híbridos de coqueiro (Cocos nucifera L. para produção de frutos e de albúmen sólido fresco Performance of hybrids of coconut palm for production of fruits and solid fresh albumen

    Directory of Open Access Journals (Sweden)

    Paulo Manoel Pontes Lins

    2003-12-01

    Full Text Available Avaliou-se o desempenho de seis híbridos de coqueiro para produção de frutos e de albúmen sólido fresco no Município de Moju, PA. Os híbridos avaliados foram: PB 121 (Anão-amarelo da Malásia x Gigante Oeste Africano; PB 111 (Anão-vermelho de Camarões x Gigante Oeste Africano; PB 141 (Anão-verde do Brasil x Gigante Oeste Africano; PB 123 (Anão-amarelo da Malásia x Gigante de Renel; PB 132 (Anão-vermelho da Malásia x Gigante da Polinésia e PB 113 (Anão-vermelho de Camarões x Gigante de Renel, em delineamento em blocos casualizados com seis repetições. Verificou-se, pela análise de variância, diferença significativa para tratamentos, resultante da heterogeneidade do material genético estudado. As fontes de variação ano e a interação anos x tratamentos foram também altamente significativas, evidenciando que o comportamento dos híbridos foi induzido por aquelas fontes de variação. Considerando o desempenho dos híbridos no período de 9 anos de avaliação para produção de frutos e de albúmen fresco, pode-se recomendar para plantio os híbridos PB 111, PB 113, PB 141 nas condições do Estado do Pará, com vistas a atender às indústrias (albúmen sólido, quanto à venda de cocos "in natura" para consumo de água.The performance of six hybrids of coconut palm were evaluated for fruit and solid fresh albumen production in Moju, State of Pará. The evaluated hybrids were: PB 121 (Dwarf Yellow of Malaysia x West African Giant; PB 111 (Dwarf Red of Cameron x West Afican Giant; PB 141 (Dwarf Green of Brazil x West Aficam Giant; PB 123 (Dwarf Yellow of Malaysia x Renel's Giant; PB 132 (Red Dwarf of Malaysia x (Giant from Polynesia; PB 113 (Dwarf Red of Cameron x Renel's Giant in hazard blocks and six repetitions. It was verified through variance analysis, significancy difference between treatments, as result of the heterogeneity of the studied genetic material. The sources of variation year and the interaction years x

  17. Origen y composición genética de la población cubana Origin and genetic composition of the Cuban population

    Directory of Open Access Journals (Sweden)

    Catalino R Ustáriz García

    2011-09-01

    Full Text Available Se hace una revisión a partir de la aparición del Homo sapiens en el continente africano y el comienzo de las migraciones hacia diferentes regiones geográficas, que condujeron después a la llegada del hombre primitivo a América y su desplazamiento a través de América del Norte hasta llegar a Sudamérica, y desde aquí a las islas del Caribe. Se comenta cómo influyó la llegada de los españoles sobre las poblaciones indígenas caribeñas y su contribución a la introducción de negros provenientes de las colonias africanas en esta región del mundo. Se analizan diversos trabajos científicos realizados fundamentalmente en Cuba, que demuestran, mediante diferentes marcadores bioquímicos y moleculares, la gran mezcla étnica de la población cubana, constituida sobre todo por blancos caucasoides, negros africanos y mulatos resultantes de la mezcla de ambas poblaciones y, en menor proporción y sin significación evidente, de otras poblaciones como son la china y la indoamericana.A literature review was made on the emergence of Homo sapiens in the African continent and the beginning of migration towards different geographic regions; this led to the arrival of the primitive man to the America and his movement through the North America to South America, and from this place to the Caribbean Islands. The impact of the arrival of Spaniards on the Caribbean native populations and their contribution to the introduction of Black people from the Arican colonies located in this region of the world were also commented on. Likewise, several scientific works mainly carried out in Cuba were analyzed, since they prove the great ethnic admixture of the Cuban population basically made up of Caucasians, African blacks and mulattos; being the latter the result of the mixture of the first two population groups and to a lesser extent of other populations like Chinese and IndoAmerican, but without evident significance.

  18. Pós-Antropologia: as críticas de Archie Mafeje ao conceito de alteridade e sua proposta de uma ontologia combativa

    Directory of Open Access Journals (Sweden)

    Antonádia Borges

    2015-08-01

    Full Text Available ResumoNosso texto se debruça sobre os escritos etnológicos de Archie Mafeje. Este autor sul-africano que viveu boa parte de sua carreira acadêmica no exílio, formulou críticas contundentes às ciências sociais em geral e à antropologia em particular. Para ele, formações sociais que desafiam nossas abordagens taxonômicas e dualistas, continuam sendo encarceradas em escaninhos estreitos e claustrofóbicos, em abordagens voltadas para a classificação e a interpretação do Outro. Esta ideia de alteridade baseia-se em uma leitura teórica que segrega o sujeito do objeto de escrutínio, da análise social. Em trabalhos que apontam os equívocos de estudos antropológicos, históricos e de sociologia urbana no continente africano, Mafeje demonstra como as apostas epistemológicas das ciências sociais legitimaram ideias e ideais de sociedades imóveis, circunscritas a limites territoriais demarcados no período colonial. Em suma, temos confinados o Outro, ao mesmo tempo em que temos nos satisfeito com modelos analíticos que perversamente permitiram o avanço da expropriação de terras e seus efeitos: xenofobia, êxodo, intolerância e racismo. A saída para Mafeje estaria no estabelecimento de uma interlocução autêntica, fundada não numa divisão entre o Eu e o Outro, mas no que ele chama de ontologia combativa. Segundo o autor, ao fazer etnografia, estaríamos recompondo o mundo para além dos dualismos e das cisões. Com tal proposta, Mafeje defende um projeto pós-antropológico de produção de conhecimento.

  19. Caracterización del ambiente atmosférico en Las Palmas de Gran Canaria y Santa Cruz de Tenerife. 2000 a 2004

    Directory of Open Access Journals (Sweden)

    Elena López Villarrubia

    2008-01-01

    Full Text Available Fundamento: El carácter insular de las ciudades de Las Palmas de Gran Canaria y Santa Cruz de Tenerife, su meteorología y la proximidad del continente africano que favorece la llegada de material particulado de origen natural sobre las islas, determinan unas especificidades en su calidad del aire. El objetivo de este artículo es la caracterización de la contaminación atmosférica durante los años 2000 a 2004 como indicador de exposición de los habitantes de estas dos ciudades. Métodos: Se elaboraron los siguientes indicadores de contaminación: promedios de 24 horas de PM10, PM2,5, NO2, SO2 y O3; máximo de las 17 medias móviles octohorarias diarias de O3 y CO; máximo horario diario de SO2, NO2, O3, CO, PM10 y PM2,5. También se calcularon los niveles de la moda gruesa de partículas, como la diferencia entre los valores de PM10 y PM2,5 (PM10-2,5. Se identificaron episodios de intrusión africana. Resultados: En Sta Cruz de TF los promedios de SO2 (14ug/m3N y de O3 (44,4 ug/m3N fueron superiores respecto a los de Las Palmas de GC (8 y 28,3 ug/m3N. Los promedios de NO2 en Las Palmas de GC: 45,8 ug/m3N fueron superiores a los de Sta. Cruz de TF: 30,3 ug/m3N. Debido a las intrusiones africanas, algunos días superaron los 600 ug/m3 de PM10 y los 200 de PM2.5 en ambas ciudades. Conclusiones: Se identifica un patrón de calidad del aire con episodios de polvo mineral africano que en superficie afecta a todas las fracciones granulométricas, una estacionalidad diferente a las ciudades europeas respecto al ozono, así como un patrón de contaminación urbano-industrial en Sta. Cruz de Tf y netamente urbano en Las Palmas de GC. Se hace necesario tener en cuenta estos resultados para analizar su posible impacto sobre la salud de los ciudadanos de las Islas Canarias y establecer sistemas adecuados de vigilancia.

  20. O Gabinete de Urbanização Colonial e o traçado das cidades luso-africanas na última fase do período colonial português The Colonial Planning Office and the layout of Luso-African cities in the last stage of the Portuguese colonial time

    Directory of Open Access Journals (Sweden)

    Ana Cristina Fernandes Vaz Milheiro

    2012-12-01

    Full Text Available Em 1944, antes mesmo do fim da Segunda Grande Guerra, o regime político de António Oliveira Salazar(1889-1970 cria, por meio do Ministério das Colónias, uma estrutura oficial de projectos de arquitectura e de engenharia, sediada em Lisboa, com o objectivo de traçar novos planos urbanos para as colónias portuguesas, designada Gabinete de Urbanização Colonial (GUC. Com sua fundação pretende-se igualmente concentrar o know-how dos técnicos portugueses no que diz respeito à abordagem à cidade tropical.Genericamente, o Estado Novo (1933-1974 de Oliveira Salazar irá servir-se do GUC como veículo de modernizaçãoe, simultaneamente, de homogeneização da paisagem construida nos diversos territórios coloniais,com especial destaque para áfrica e para os actuais países africanos de língua oficial portuguesa. O programa seguido alicerça-se num forte impulso de urbanização que se reflecte na consolidação das estruturas urbanas herdadas da primeira República (1910-1926 e na padronização dos edifícios públicos que representam a presença colonial portuguesa desde o continente africano até a índia, então chamada “índia Portuguesa”, Timor e Macau. Apesar da importância do mundo rural na caracterização do regime ditatorial português, as intervenções desencadeadas nesses lugares sob administração colonial definem-se, a partir da segunda metade do século, por um forte sentido desenvolvimentista de perfil urbano, como se pretende demonstrar por meio de casos de estudo localizados na Guiné-Bissau, em Angola e em São Tomé e Príncipe.

  1. La Representación del Otro en las elites intelectuales europeas y latinoamericanas: Un siglo de pensamiento racialista 1830-1930

    Directory of Open Access Journals (Sweden)

    Marta Elena Casaús Arzú

    2011-12-01

    Full Text Available Objetivo general de éste artículo es analizar – durante cien años, a partir de las Independencias aproximadamente 1830 – las profundas imbricaciones entre el positivismo y el liberalismo, en las elites europeas y latinoamericanas, en relación a los indígenas y a los africanos en la América ibérica. Nos centraremos en aquellos debates que se producían por parte de las elites intelectuales europeas y americanas en donde se debatía acerca del ‘problema racial del indio y del negro’. Para ello haremos un breve repaso de las teorías raciales europeas que surgen a raíz del darwinismo social, la eugenesia y el degeneracionsmo y su influencia en las elites intelectuales americanas en la construcción de las nuevas naciones, haciendo referencia a las diferentes imaginarios que se buscan para integrar, asimilar o fusionar a los indígenas y a los africanos al proyecto de nación homogénea. Haremos énfasis en aquellos tópicos que elaboran las élites intelectuales para imaginar al Otro y que inciden no solo en la construcción de su propia identidad socio-racial, como blancos, criollos, mestizos, mulatos o ladinos sino también de su identidad regional como hispano/latinoamericanos. English: This article covers one hundred years, starting with the years of independence approximately 1830. Its main purpose is to analyse the profound interdependency of positivism and liberalism within the European and Latin American elites in relation to the indigenous peoples and Africans in Iberoamerica. The article focuses on the debates where the intellectual European and American elites discussed ‘the Indian and Negro racial problem’. A short review is made of the European racial theories that emerged from social Darwinism – eugeneism (racial hygiene and degenerationism – and their influences on the American intellectual elites in the construction of new nations. References are made to the different imaginaries that were used to integrate

  2. Origin of hominids: European or African origin, neither or both?

    Directory of Open Access Journals (Sweden)

    Senut, B.

    2011-12-01

    Full Text Available For the last twenty years, some scientists have suggested that the African ape and humans lineages emerged in Europe, a scenario known as the “Back to Africa Hypothesis”. Even though hominoids were widespread in Eurasia during the Middle and Upper Miocene due to the tropical conditions which prevailed in this region, we cannot dismiss the fact that they were present in Africa (contra some authors. Actually, they were highly diverse at that same time (at least 10 lineages represented even if the fossil record is less complete than in Eurasia. Postcranial elements from African species suggest that some features of modern hominoids were already present in the Lower and Middle Miocene of Africa and were not restricted to European ones. Considering the available evidence, it is not possible at this stage to favour a European origin over an African one. Hominoids were living in the tropical areas of Northern Africa and Southern Eurasia and faunal exchanges between the two continents occurred throughout the Middle and Upper Miocene, as the Tethys did not act as an effective barrier to interchanges between Europe and Asia.

    Durante los últimos veinte años, algunos científicos han sugerido que los grandes monos africanos y los linajes humanos surgieron en Europa, un escenario conocido como la “ Hipótesis de la vuelta a Africa”. A pesar de que los homínidos se extendieron en Eurasia durante el Mioceno Medio y Superior debido a las condiciones tropicales que prevalecian en esta region, no podemos descartar el hecho de que ellos estuvieron presentes en Africa (contra algunos autores. En realidad, ellos tuvieron una alta diversidad al mismo tiempo (al menos 10 líneas representadas, incluso si el registro fosil es menos completo que el de Eurasia. Elementos postcraneales de especies africanas sugieren que en algunos carácteres los homínidos modernos estaban ya presentes en el Mioceno Inferior y Medio de Africa, no sólo restringidos a

  3. Veinte años de migraciones españolas: 1982-2002. Cambio de signo e intensidad

    Directory of Open Access Journals (Sweden)

    Cebrián, Juan Antonio

    2004-09-01

    Full Text Available This paper deals with the changes in migration that have taken place recently in Spain. After joining the EC in 1986, the new socioeconomic and political standards of Spain have attracted many labor migrants from the Third World. African immigrants, 77% of whom are Moroccan, represent the largest segment among them. Africans find ready employment in commercial agriculture, construction, and services on the Iberian Peninsula. Besides, Latin America and Southeast Asia are sending greater and greater numbers of workers to Spain. Since the passing of the first Alien Law in 1985, Spanish legislation has been subjected to continuous reform. This has achieved three underlying goals: improvement of administrative procedures and the working conditions for immigrants, as well as the overcoming of many obstacles to their integration to society.

    Coincidiendo con su entrada en el Mercado Común Europeo en 1986, España se ha convertido en un foco de atracción de inmigrantes laborales del Tercer Mundo. Por continentes, [Según datos del Ministerio del Interior (Anuario Estadístico de Extranjería, 2002, los 380.343 inmigrantes procedentes de América superan en la actualidad a los 366.518 inmigrantes africanos. Pero si dividimos, como es práctica habitual, el continente americano en dos grandes conjuntos: América del Norte (con 15.774 inmigrantes e Iberoamérica (con 364.569, Africa continúa siendo la procedencia más frecuente de inmigrantes laborales en España.] el grupo más numeroso es el africano, marroquí en un 77%, que se emplea, fundamentalmente, en la agricultura intensiva, en la construcción y en los servicios. Muy numerosos también, y cada vez más, son los inmigrantes laborales procedentes de Latinoamérica y del Sudeste asiático. Desde la aprobación de la primera Ley de Extranjería en 1985, la legislación española ha experimentado continuas reformas, para la consecución de tres objetivos fundamentales: la mejora de los

  4. Culturas y género: prácticas lesivas, intervenciones feministas y derechos de las mujeres

    Directory of Open Access Journals (Sweden)

    Guerra Palermo, María José

    2008-06-01

    Full Text Available The aim of this paper is to analyse the phenomenon of the making of reactive cultural identities in a particular and sensitive case: the female genital mutilation (FGM in an African context. This case is framed in the debate between feminism and multiculturalism and in the controversies about the feminist transnational interventions to defend women’s human rights. Alice Walker, the Afro-American writer and activist promoted an international campaign against FGM that was strongly contested by African activists. There has been a main criticism against sensationalism in the media that reduces Africa as alterity to a barbarian and uncivilised rite. We try to analyse all this in relation to the need of promoting an intercultural feminist ethics in order to fostering the process of empowerment of local women. Contexts and means are relevant if we try, first, to eradicate cultural practices that damage women’s lives and rights and, also, to consolidate a transnational and intercultural feminism.

    El objetivo de este artículo, en el contexto del debate entre feminismo y multiculturalismo, es analizar el fenómeno de identidades culturales reactivas que ha operado en el caso de la interpelada práctica de la mutilación genital femenina en algunos enclaves africanos. Para ello seguiremos la peripecia de Alice Walker, la escritora y activista afroamericana, en su denuncia de esta dañina práctica cultural que atenta contra los derechos a la integridad corporal y psíquica de las mujeres. Queremos dejar de lado el sensacionalismo con que suele ser tratado en muchos medios de opinión este asunto y que contribuye a construir la alteridad de lo africano como mera barbarie y carencia de civilización. Tratamos, aquí, de analizar lo anterior en relación a la necesidad de ir construyendo una ética intercultural feminista que promueva el empoderamiento de las mujeres locales. Los contextos y los medios de intervención son relevantes para el empe

  5. Mestizaje en el sur de la Región Pampeana (Argentina

    Directory of Open Access Journals (Sweden)

    Avena, Sergio Alejandro

    2007-01-01

    Full Text Available Nuestro objetivo fue estimar la composición genética de la población de Bahía Blanca (BB y comparar los datos obtenidos con investigaciones previas realizadas en el Area Metropolitana de Buenos Aires (AMBA. Se estudiaron 183 muestras de donantes no emparentados. Fueron analizados 5 sistemas eritrocitarios, alotipos Gm, haplogrupos mitocondriales y el locus DYS199 del cromosoma Y. Se realizó una encuesta con la finalidad de obtener información sobre lugar de nacimiento, residencia actual y datos genealógicos de los mismos. Las frecuencias génicas se calcularon aplicando métodos de máxima verosimilitud y para los haplogrupos mitocondriales y DYS199 se empleó el conteo directo. La mezcla génica se estimó mediante el Programa ADMIX. Los marcadores proteicos arrojaron 19.5% de componente indígena y 3.6% de africano. El aporte amerindio de los linajes mitocondriales constituyó el 46.7% y el 1.5% subsahariano. Un 3.8% de los varones analizados poseen la variante aborigen DYS199*T. Esa diferencia en la contribución genética sexo-específica revelaría un aporte asimétrico por género en la historia de esta población. Al comparar estos datos con los del AMBA se constataron, en esa región, similares valores del componente africano (3.8% y de la transición DYS199*T (2.2% y menores porcentajes de mezcla génica con indígenas (15.3% y de los haplogrupos mitocondriales amerindios (43.6%, aunque estas diferencias fueron no significativas. Sin embargo, se observó significancia al interior de los linajes mitocondriales aborígenes, pues C y D sumados representaron en BB un 74% de los haplogrupos indígenas vs. 52% en el AMBA. Este hecho se condice con la distinta proveniencia de los inmigrantes hacia estas ciudades

  6. Eficácia de herbicidas no controle de plantas daninhas na cultura da cebola em semeadura direta Efficacy of herbicides on weed control in onion direct sowing

    Directory of Open Access Journals (Sweden)

    Lino R. Ferreira

    1999-04-01

    Full Text Available As plantas de cebola provenientes da semeadura direta no campo são mais danificadas pelo cultivo mecânico e são mais sensíveis aos herbicidas, principalmente os latifolicidas, do que quando transplantadas. Com o objetivo de avaliar a eficácia dos herbicidas oxyfluorfen, ioxynil-octanoato e fluazifop-p-butil, aplicados em pós-emergência, isoladamente ou em mistura no tanque, com ou sem aplicação de paraquat, antes da emergência das plantas de cebola, conduziu-se este trabalho no município de Monte Alto, SP. Nenhum dos herbicidas aplicados isoladamente foi eficiente no controle de todas as espécies daninhas presentes na área experimental. As misturas no tanque de fluazifop-p-butil com oxyfluorfen ou ioxynil-octanoato, independente da aplicação ou não de paraquat aos cinco dias após a semeadura, controlaram eficientemente Portulaca oleracea, Amaranthus lividus, Echinochloa crusgalli, Eragrostis pilosa, Digitaria horizontalis, Eleusine indica e Brachiaria plantaginea, com produção de bulbos semelhante à da testemunha capinada.Onion plants, from direct sowing to the field, are more damaged by mechanical cultivation and more sensitive to herbicides, especially to broadleaf herbicides, than transplanted onions. With the purpose of evaluating the efficacy of the herbicides oxyfluorfen, ioxynyl-octanoato and fluazifop-p-butyl, applied in post-emergence, alone or tank mix, with or without paraquat application, before onion plants emergence, this investigation was carried out at Monte Alto County, São Paulo State, Brazil. None of the herbicides sprayed alone were efficient in the control of all the weeds present in the experimental area. The tank mix of fluazifop-p-butyl plus oxyfluorfen or ioxynyl-octanoato, regardless of paraquat application, at five days after sowing, controlled efficiently Portulaca oleracea, Amaranthus lividus, Echinoclhoa crusgalli, Eragrostis pilosa, Digitaria horizontalis, Eleusine indica and Brachiaria

  7. Seleção de plantas com potencial para fitorremediação de solos contaminados com o herbicida trifloxysulfuron sodium Plant selection with potential for phytoremediation of soils contaminated with trifloxysulfuron sodium

    Directory of Open Access Journals (Sweden)

    S.O. Procópio

    2004-06-01

    Full Text Available Este trabalho teve como objetivo identificar plantas tolerantes ao trifloxysulfuron sodium, visando utilizá-las em programas de fitorremediação. Foram avaliadas dez espécies: Medicago sativa, Avena strigosa, Crotalaria juncea, Canavalia ensiformis, Helianthus annus, Dolichus lablab, Stylosantes guianensis, Mucuna deeringiana, Raphanus sativus e Eleusine indica. O delineamento experimental empregado foi o de blocos ao acaso, com parcelas subdivididas, sendo utilizadas três repetições. O fator aplicado na parcela principal foram as doses de trifloxysulfuron sodium (0,00; 3,75; 7,50; e 15,00 g ha-1 e, na subparcela, as épocas de avaliação [15, 30, 45 e 60 dias após a semeadura (DAS]. Foram avaliados a altura de plantas, os sintomas de toxicidade e, aos 60 DAS, também a biomassa seca da parte aérea, das raízes e total das plantas. Verificou-se que todas as espécies sobreviveram à presença do trifloxysulfuron sodium no solo, mesmo quando aplicado em dose duas vezes maior que a recomendada (15,00 g ha-1, porém M. deeringiana, D. lablab, C. juncea e S. guianenesis foram as espécies que apresentaram maior tolerância ao herbicida, indicando potencial para uso em programas de fitorremediação de trifloxysulfuron sodium em solos.This study aimed to identify trifloxysulfuron sodium-selective plants to be used in phytoremediation programs for this herbicide in soil. Ten plants were evaluated: Medicago sativa, Avena strigosa, Crotalaria juncea, Canavalia ensiformis, Helianthus annus, Dolichus lablab, Stylosantes guianensis, Mucuna deeringiana, Raphanus sativus and Eleusine indica. A randomized block design with split-plots and three replications was used, with the plots being the doses of trifloxysulfuron sodium (0.00; 3.75; 7.50; and 15.00 g ha-1 and the splitplots the evaluation times [15, 30, 45, and 60 days after sowing (DAS]. Plant height and phytotoxicity visual symptoms were evaluated, and, at 60 DAS, dry biomass yield was recorded

  8. Distribuição mensal da emergência de seis ervas daninhas em solos com e sem cultivos Monthly emergence of six weeds in cultived and undisturbed soil

    Directory of Open Access Journals (Sweden)

    Hélio G. Blanco

    1994-01-01

    Full Text Available Foram realizados no período de 14 meses, com início em outubro de 1988, levantamentos demográficos mensais para registro da dinâmica de emergência de seis espécies de ervas daninhas anuais, submetidas mensalmente a um dos seguintes sistemas de manejo da população: grade de disco, grade de disco seguida de rolo compactador do solo, enxada rotativa, e herbicida de contato. Os resultados mostraram que a distribuição mensal da emergência de Digitaria horizontalis Willd. (capim-colchão, Brachiaria plantaginea (Link Hitch. (capim-marmelada, Bidens pilosa L. (picão-preto, e Amaranthus viridis L. (caruru-de-mancha, se configurou com um pico de emergência muito alto em outubro (acima de 80% do total emergido no período, com reinfestações pouco significativas nos meses seguintes, e que o manejo através do cultivo do solo favoreceu a emergência dessas espécies. O modelo de emergência de Eleusine indica (L. Gaertn. (capim-pé-de-galinha, e Eragrostis pilosa (L. Beauv. (capim-barba-de-alemão, por outro lado, apresentou um grau de emergência baixo em outubro, elevando-se até janeiro quando ocorreu o fluxo de maior pico. O manejo sem revolvimento do solo dessas duas espécies incrementou a geminação dos propágulos do banco de sementes. De um modo geral, quando não se permitiu a multiplicação sexuada, a taxa de população foi extremamente reduzida no ciclo seguinte.In lhe period of October/l988 to December/1989 a research was carried out to study lhe emergence dynamics of six weeds through monthly samplings under four weed managements: destruction of lhe former flora by cultivation with harrow, harrow following compaction by soil roller, rotary harrow and use of a contact herbicide without soil disturbance. The results showed that lhe initial emergence in October is very high for Digitaria horizontalis, Brachiaria plantaginea, Bidens pilosa and Amaranthus viridis compared with lhe emergence in lhe following months and that

  9. Competição entre feijoeiros e plantas daninhas em função do tipo de crescimento dos cultivares Competition between the common bean and weed in function of cultivar growth type

    Directory of Open Access Journals (Sweden)

    I.R. Teixeira

    2009-06-01

    Full Text Available Objetivou-se com este trabalho avaliar a capacidade competitiva de genótipos de feijão de diferentes tipos de crescimento sob presença e ausência de comunidade infestante de plantas daninhas, em duas safras de cultivo ("águas'' de 2006/07 e "seca'' de 2007. Foi utilizado o delineamento de blocos casualizados, em esquema fatorial 3 x 2, com quatro repetições. Os tratamentos foram constituídos de três cultivares de feijão com diferentes tipos de crescimento (Pérola: tipo III/II; Aporé: tipo III; e BRS Radiante: tipo I, em combinação com dois tipos de manejo de plantas daninhas: área capinada manualmente e área não capinada. Conclui-se que no cerrado brasileiro, na safra das "águas'', os problemas da cultura do feijão com as plantas daninhas foram agravados, especialmente com Brachiaria ssp., Cenchrus echinatus, Digitaria horizontalis e Eleusine indica. Os cultivares de feijão com hábitos de crescimento semiereto (Pérola e prostrado (Aporé foram mais competitivos com a comunidade infestante de plantas daninhas.This work aimed to evaluate the competitive capacity of common bean cultivars of different growth types under the presence and absence of weed species communities during two crop seasons(rainy 2006/2007 and dry 2007. The experiment was arranged in a randomized block design, in a factorial scheme with four replications. The treatments consisted of three bean cultivars with different types of growth ("Pérola'': type III/II, "Aporé'': type III and "BRS Radiante'': type I in combination with two types of management of weed species: cultivated with and without weed. It was concluded that in the "cerrado'' during the rainy season, the problems of the common bean with the weed species aggravated, especially in relation to Brachiaria ssp., Cenchrus echinatus, Digitaria horizontalis and Eleusine indica. The common bean genotypes with semi-erect ("Pérola'' and prostrated ("Aporé' growth habits were more competitive against

  10. Períodos de interferência das plantas daninhas na cultura do arroz de terras altas. II - cultivar Caiapó Interference periods of weeds in the upland rice - Caiapó variety

    Directory of Open Access Journals (Sweden)

    Maria Rosangela Malheiros Silva

    2009-01-01

    Full Text Available Os experimentos foram desenvolvidos nos anos agrícolas 2003/2004 e 2004/2005, em área experimental da Universidade Estadual Paulista, Campus de Jaboticabal (SP, com o objetivo de se determinarem os períodos de interferência das plantas daninhas na cultura do arroz de terras altas, cultivar Caiapó. O delineamento experimental foi em blocos ao acaso com quatro repetições e 16 tratamentos. Os tratamentos foram constituídos por períodos crescentes de controle ou de convivência das plantas daninhas após a emergência da cultura: 0-10, 0-20, 0-30, 0-40, 0-50, 0-60, 0-70 dias e 0-colheita. Nos dois anos, as famílias predominantes eram Poaceae, Asteraceae, Amaranthaceae e Malvaceae e as principais plantas daninhas presentes foram: Cyperus rotundus L., Cenchrus echinatus L., Digitaria spp Heist., Echinochloa crus-galli (L. P. Beauv., Brachiaria decumbens Stapf., Eleusine indica Gaertn e Alternanthera tenella Colla. A cultivar de arroz de terras altas Caiapó deve ser mantida sem plantas daninhas nos 30 dias após a emergência.The experiments were carried out in two growing seasons (2003/04 and 2004/05 in an experimental area at São Paulo State University - UNESP, Jaboticabal Campus, to evaluate the weed interference periods on the upland Caiapó rice variety. The experimental design was randomized blocks with 4 replicates and 16 treatments. The treatments consisted of increasing periods of control or coexistence after emergence of the culture: 0-10; 0-20; 0-30; 0-40; 0-50; 0-60; 0-70 days; 0-harvest. The predominant families were Poaceae, Asteraceae, Amaranthaceae and Malvaceae, and the main weeds present were Cyperus rotundus L., Cenchrus echinatus L., Digitaria spp Heist., Echinochloa crus-galli (L. P. Beauv., Brachiaria decumbens Stapf., Eleusine indica Gaertn e Alternanthera tenella Colla for both years. The upland rice cultivar Caiapó is to be kept free of weeds for 30 days after emergence.

  11. Controle das plantas daninhas na cultura de alface transplantada com o herbicida oxadiazom Weed control in transplanted lettuce by oxadiazon

    Directory of Open Access Journals (Sweden)

    Edison Martins Paulo

    1990-01-01

    Full Text Available Efetuou-se um experimento com o herbicida oxadiazom, objetivando estudar o efeito do seu uso no controle das plantas daninhas e na, produção da cultura da alface transplantada. Os tratamentos, em número de sete, consistiram em três doses de oxadiazom formulado em grânulos, 1,0,1,5 e 2,0kg/ha, aplicadas após o transplante da alface, dois fratamentos de 1,0kg/ha do herbicida formulado em concentrado emulsionável, um pulverizado antes e, outro, após o transplante, em área total, e duas testemunhas, uma capinada e outra mantida com o mato até a colheita. As principais plantas daninhas que infestaram o experimento foram: beldroega (Portulacca oleracea L., picão-branco (Galinsoga parvifiora Cav., caruru (Amaranthus hibridus L., capim-colchão (Digitaria sanguinalis (L. Scop. e capim-pé-de-galinha (Eleusine indica (L. Gaertn.. Constatou-se o controle dessas espécies pelo oxadiazom, 51 dias após a aplicação, até que se mostrou seletivo à cultura, exceto na sua formulação concentrado emulsionável pulverizada após o transplante, quando reduziu o número e o peso das alfaces colhidas.A trial was carried out in order to study the performance of oxadiazon on yield of transplanted lettuce. The treatments were: oxadiazon granular formulation at rates of 1.0,1.5 and 2.0 kg/ha applied after transplanting and pre emergence of weeds; oxadiazom emulsifiable concentrate at 1.0 kg/ha applied before and after transplanting both as preemergence of weeds. Two controls were used: one without any control of weeds and another free from weeds 33 days after transplanting. Oxadiazon gave good control of Portulacca oleracea L, Galinsoga parviflora Cav., Amaranthus hibridus L, Digitaria sanguinalis (L. Scop, and Eleusine indica (L. Gaertn. up to 51 days after application. Except for oxadiazon emulsifiable formulation, when applied after transplanting, no phototoxicity to lettuce was observed with the herbicide whether applied at preemergence or before

  12. Controle de plantas daninhas na cultura do milho (Zea mays L. por meio de herbicidas Weed control in maize (Zea mays L. with herbicides

    Directory of Open Access Journals (Sweden)

    C. A. L. dos Santos

    1979-12-01

    Full Text Available Com o objetivo de se verificar a ação do butylate, aplicado isoladamente e em mistura com atrazine, no controle de plantas daninhas da cultura do milho, foi instalado um experimento de campo em solo fino areno-argiloso. Foram utilizados os seguintes tratamentos: butylate a 2,80; 3,60 e 4,32 kg/ha (p.p.i.; butylate + atrazine a 3,24 + 0,80; 3,24 + 1,20 e 3,60 + 0,96 kg/ha (p.p.i.; atrazine a 3,00 kg/ha e atrazine + metolachlor a 1,40 + 2,10 kg/ha, ambos aplicados em pré-emergência e empregados como herbicidas padrão para a cultura. As plantas daninhas encontradas foram: tiririca - Cyperus rotundus L., carurú comum - .:maranthus viridis L., capim de colchão - Digitaria sanguinalis (L. Scop. e capim pé-de-galinha Eleusine indica (L. Gaertn. Butylate nas três doses apresentou-se bem contra C. rotundus e E. indica; nas doses de 3,60 e 4,32 kg foram obtidos bons resultados sobre D. sanguinalis. Butylate + atrazine controlou, nas três doses, todas as espécies incidentes, o mesmo ocorrendo com a mistura atrazine + metolachlor. Atrazine foi mais eficiente para A. viridis e E. indica. Nas condições em que foi conduzido o experimento nenhum dos herbicidas foi prejudicial para a cultura.Butylate at 2.80; 3.60 and 4.32 kg/ha and butylate + atrazine at. 3.24 + 0.80; 3.24 + 1.20 and 3.60 + 0.96 kg, were applied in preplant incorporated; atrazine at 3.00 kg and atrazine + metolachlor at 1.40 + 2.10 kg were applied in preemergence on corn. The weeds were represented by Cyperus rotundus L., Amaranthus viridis L., Digitaria sanguinalis (L. Scop. and Eleusine indica (L. Gaertn. Butylate + atrazine, in all rates, atrazine + metolachlor and atrazine gave good control of the weeds in general. Butylate, in the three rates, controlled C. rotundus and E. indica; at 3.60 and 4.32 kg/ha controlled well D. sanguinalis. The herbicides did not cause injuries to the crop.

  13. Períodos de interferência de plantas daninhas na cultura do quiabo Periods of weed interference in okra crop

    Directory of Open Access Journals (Sweden)

    L.P.S Bachega

    2013-03-01

    Full Text Available Poucas pesquisas têm sido realizadas sobre interferência de plantas daninhas na cultura do quiabo. Objetivou-se com este trabalho estimar os períodos de interferência da comunidade infestante no quiabeiro. Um experimento de campo foi conduzido sob dois grupos de tratamentos, mantendo períodos crescentes de 0 (testemunha, 7, 21, 28, 35, 42, 49, 63, 77, 91 e 105 dias após a emergência da cultura (DAE, com e sem controle das plantas daninhas. As plantas daninhas com maior importância relativa foram Portulaca oleracea, Nicandra physaloides e Eleusine indica. A convivência do quiabeiro com as plantas daninhas por todo o ciclo de cultivo reduziu a produtividade da cultura em 95%. O período anterior à interferência foi de 57 DAE, enquanto o período total de prevenção à interferência foi de 14 DAE. Não houve período crítico de prevenção à interferência, sendo um único controle das plantas daninhas entre 14 e 57 DAE suficiente para prevenir a interferência na cultura do quiabo.Few research works have been carried out on weed interference in okra crop. The aim of this study was to estimate the periods of weed interference in okra crop. Thus, a field trial was carried out under two groups of treatments, using increased periods of 0 (check, 7, 21, 28, 35, 42, 49, 63, 77, 91, and 105 days after crop emergence (DAE with weed control and without weed control. Weeds with highest relative importance were Portulaca oleracea, Nicandra physaloides, and Eleusine indica. Coexistence of okra crop and weeds throughout the season reduced crop yield by 95%. The period before interference was 57 DAE, while total period of interference prevention was 14 DAE. There was no critical period of interference prevention, with a single weed control between 14 and 57 DAE being sufficient for interference prevention in okra crop.

  14. Adubação e o período anterior à interferência das plantas daninhas na cultura do amendoim Effect of fertilization on weeds and on the period before weed interference in the peanut culture

    Directory of Open Access Journals (Sweden)

    M.S. Yamauti

    2010-01-01

    Full Text Available O presente trabalho teve como objetivo determinar o efeito da adubação sobre a comunidade infestante e sobre o período anterior à interferência (PAI das plantas daninhas na cultura do amendoim, cv. IAC Runner 886, em sistema convencional. Os períodos de convivência estudados foram: 0, 7, 15, 20, 30, 45, 55 e 126 dias após a emergência (DAE, totalizando oito tratamentos, dispostos em blocos casualizados, com quatro repetições, em dois níveis de adubação: 0 e 150 kg ha-1 da formulação 00-20-20 (N-P-K. A adubação não alterou a composição da comunidade infestante, destacando-se Cyperus rotundus, Eleusine indica, Indigofera hirsuta, Portulaca oleraceae e Sida rhombifolia como as espécies de maior importância relativa. Contudo, a densidade de plantas daninhas foi maior na área não adubada, mas sem afetar de modo diferenciado a massa seca acumulada por elas. O cultivar de amendoim IAC Runner 886 pode conviver com essa comunidade com e sem adubação por até 15 e 17 DAE (PAI, respectivamente, sem sofrer perdas significativas na produção. A interferência das plantas daninhas reduziu entre 31 e 34% a produtividade do amendoim para as áreas sem adubação e com adubação, respectivamente.This experiment was carried out to study the effect of fertilization on weed community and on the period before weed interference (PBI in peanut culture, IAC Runner 886, under a conventional till system. The weed control periods studied were: 0, 7, 15, 20, 30, 45, 55, and 126 days after emergence (DAE, totaling eight treatments, arranged in a randomized block design, with four replications and two levels of fertilization (0 and 150 kg ha-1 of formulation 00-20-20 (N-P-K. Fertilization did not affect the weed community, with the species Cyperus rotundus, Eleusine indica, Indigofera hirsuta, Portulaca oleracea and Sida rhombifolia being the most prominent at all levels of fertilization. However, weed density was higher in the non- fertilized

  15. Interferência de plantas daninhas na cultura da cenoura (Daucus carota Weed interference on carrot crop (Daucus carota

    Directory of Open Access Journals (Sweden)

    M Coelho

    2009-12-01

    Full Text Available A cenoura é uma importante hortaliça no Brasil, cuja produtividade pode ser muito reduzida devido à interferência de plantas daninhas. O objetivo desta pesquisa foi avaliar efeitos de períodos de convivência das plantas daninhas na produtividade da cenoura cultivar "Brasília" e na comunidade de plantas daninhas. Os tratamentos foram constituídos de períodos crescentes de convivência ou controle das plantas daninhas. A comunidade de plantas daninhas foi avaliada quanto a número de indivíduos, matéria seca acumulada e frequência de ocorrência das espécies, e a cultura, quanto à produtividade comercial. As principais plantas daninhas foram Ageratum conyzoides, Digitaria nuda, Eleusine indica e Lepidium virginicum. A presença da comunidade de plantas daninhas durante todo o ciclo da cultura pode acarretar perdas de 94% na produtividade, evidenciando alta suscetibilidade da cenoura à interferência das plantas daninhas. Contudo, não houve período crítico de prevenção à interferência, e um único controle das plantas daninhas, entre 22 e 31 dias após a semeadura, foi suficiente para garantir a produção da cultura.Carrot is an important horticultural crop in Brazil, and its productivity may be highly reduced due to weed interference. This study evaluated the effects of weed coexistence periods on carrot cultivar 'Brasilia' yield and on the weed community. The treatments were constituted of increasing weed coexistence periods or weed-free periods. The weed community was evaluated based on number of individuals, dry matter accumulation, and frequency of occurrence; while the crop was evaluated based on marketable productivity. The main weeds were Ageratum conyzoides, Digitaria nuda, Eleusine indica, and Lepidium virginicum. The presence of the weed community throughout the crop season can cause yield losses of 94%, showing high susceptibility of the carrot crop to weed interference. However, there was no critical period for

  16. Competição entre quatro herbicidas indicados para o controle de plantas daninhas em cana-de-açucar (Saccharum sp Competition on four herbicides for controling weeds in sugarcane (Saccharum sp

    Directory of Open Access Journals (Sweden)

    L.S.P. Cruz

    1978-09-01

    Full Text Available Com a finalidade de estudar a ação dos herbicidas oxadiazon, napropamide, methazole e A-3587 na cultura de cana -de-açúcar (Saccharum sp, foram conduzidos em 1971/72 dois ensaios de campo nos municípios paulistas de Capivari e Leme. Os herbicidas acima citados foram comparados, em trés doses, com 2,4-D anina e atrazine, aplicados em pré -emergência. Oxadiazon a 2,0 kg/ha e A-3587 a 3,0 kg e 4,0 kg/ha foram eficientes no controle das principais plantas daninhas que apareceram nos experimentos: capim-marmelada, Brachiaria plantaginea (Link Hitch; capim-de-colchão, Digitaria sanguinalis (L. Scop; capim-pé-degalinha, Eleusine indica (L. Gaertn.; beldroega, Portulacca oleracea L e guanxumas, Sida spp. Napropamide a 3,0 kg/ha e methazole a 3,5 kg e 4,0 kg/ha só não con trolaram as guanxumas. Nas doses empregadas, nenhum dos herbicidas mostrou-se prejudicial às plantas e à produção de cana-de-açúcar.This paper reports on two field trials carried out during 1971/72, in Capivari and Leme, with the herbicides oxadiazon, napropamide, methazole and A-3587, in sugar-cane crops. In these experiments the four herbicides, in three doses, were compared, in preemergence, with 2,4-D amine and atrazine. Oxadiazon at 2.0 kg/ha and A-3587 at 3.0 kg and 4,0 kg/ha gave good control against Brachiaria plantaginea, Digitaria sanguinalis, Eleusine indica, Portulacca oleracea and Sida spp, wich were found in the trials. Napropamide at 3.0 kg/ha and methazole at 3.5 kg and 4.0 kg/ha gave good control against those weeds but except Sida spp. None of the herbicides caused injuries to the crop or reduced yield.

  17. Effect of dietary curries on the glycaemic index.

    Science.gov (United States)

    Pirasath, S; Thayaananthan, K; Balakumar, S; Arasaratnam, V

    2010-12-01

    Determination of the glycaemic index (GI) of different basic foods in combination with different curries. METHODS; Healthy volunteers (n = 20) of 21.05 (+/- 0.92) years old, 53.90 (+/- 9.36) kg in body weight, 153.92 (+/- 9.15) cm in height and 20.55 (+/- 2.22) kgm(-2) of body mass index were included. After overnight fasting, 75g of glucose and each test food containing 75g of digestible carbohydrate were administered and blood glucose level measured half hourly for two hours. The GI was calculated and analysed by randomised complete block design using SAS analytical package. The mean GI values of parboiled rice ('Mottaikarupan') either with green leaf curry (Amaranthus) or gravy (soya meat) or green leaf curry and gravy were 47.47 (+/- 11.21), 56.30 (+/- 9.31) and 54.67 (+/- 10.03) % respectively. The mean GI of 'kurakkan pittu' (Eleucine coracana) with the above curries were 57.51 (+/- 5.52), 63.25 (+/- 8.86) and 59.25 (+/- 5.49) % respectively. The mean GI of 'atta pittu' (whole wheat grain flour) with the above curries were 44.40 (+/-14.27), 50.80 (+/- 9.35) and 46.29 (+/- 8.90) % respectively. The GI of parboiled rice or 'kurakkan pittu' or 'atta pittu' with green leaf curry differed significantly (p gravy or green leaf curry and gravy did not differ significantly (p > 0.05) among them. 'Kurakkan pittu' is inferior to 'atta pittu' and parboiled rice. Including curries to basic foods altered the GI. Therefore, when dietary advice is given to diabetic patients, not only the basic foods, but also the curries to be consumed have to be considered.

  18. SOME ETHNO-ARCHAEOLOGICAL OBSERVATIONS ON THE SUBSISTENCE STRATEGIES OF THE VEDDAS IN SRI LANKA

    Directory of Open Access Journals (Sweden)

    R.M.M. Chandraratne

    2016-04-01

    Full Text Available Veddas are considered to be the indigenous people of Sri Lanka. A century ago, the Veddas were scattered across the Eastern Province, and some parts of the North-Central and Uva Provinces, although at present they are confined to Bintanne that stretches to some parts of the Uva and Eastern provinces. This paper explores the subsistence pattern of the Veddas in Sri Lanka in relation to their old equipment and practices. It builds on ethno-archaeological interpretations drawing from archaeological evidence from Prehistoric to Historical periods. Evidence of interaction of humans, technology,faunal and floral resources found from archaeological sites in relation to subsistence was interpreted through the method of ethnographic analogy. Evidence suggests that during the historical period, the Veddas lived in various parts of Sri Lanka including Anuradhapura, Polonnaruwa, Ratnapura, Buttala, Tambalagam pattu, Kattakulam pattu, Bintannae, Nilgala and Batticaloa. They bartered deer hide, dried flesh, cotton and honey for rice, Kurrakkan (Elusine coracana , tobacco, salt, clothes and iron arrow heads a century ago. The existence of charred bones and arrow head type of bone tools shows the practice of hunting during the protohistoric and early historic periods. The Veddas did not adopt Sinhalese mode of life up till the 19th century. However, acculturation is gradually taking place at least in the lifestyle of Veddas in Dambana at present. Especially the Anuradhapura Veddas who lived outside the Bintanne area do not seem to possess traditional Vedda livelihoods, and maintain a lifestyle comparable with the Sinhalese Buddhist culture. Based on the above evidence, the paper concludes that the subsistence patterns of Veddas prior to the last century are quite comparable with similar evidence found from the Mesolithic, Proto and the Early Historic periods in Sri Lanka, though a certain decline in the distinction between Vedda culture and the dominant culture

  19. Migraciones, subjetividades y contextos de investigación

    Directory of Open Access Journals (Sweden)

    Pilar Uriarte Bálsamo

    2011-10-01

    Full Text Available Los trabajos sobre dinámicas migratorias en África Occidental señalan una importante presencia del fenómeno entre la población de la mayoría de los países. En una variedad de contextos, la idea de que la migración es el camino preferencial para la mejora de las condiciones de vida está ampliamente difundida. Simultáneamente, los caminos para la realización de ese proyecto migratorio son difíciles y lindan con diversas formas de irregularidad o ilegalidad. La presencia de extranjeros, caracterizados como no africanos y blancos en el cotidiano de muchas personas en África Occidental, despierta de diversas formas la sensación de proximidad a la migración. Al realizar trabajo de campo en la región me enfrenté en reiteradas ocasiones con esa situación. En este artículo me propongo analizar las particularidades de un campo en que la presencia de la investigadora generó por sí misma y de forma casi mágica la aparición del propio fenómeno que se buscaba investigar

  20. Diâmetro dos grãos de pólen e tamanho dos estômatos em acessos diplóides e tetraplóides de Hemarthria altissima (Poiret Stapf & Hubbard (Gramineae Pollen grain diameter and stomatal size in diploid and tetraploid accessions of Hemarthria altissima (Poiret Stapf & Hubbard (Gramineae

    Directory of Open Access Journals (Sweden)

    Solange Bosio Tedesco

    1999-06-01

    Full Text Available Sete acessos da gramínea forrageira Hemarthria altissima, diplóides e tetraplóides africanos e tetraplóides brasileiros, foram analisados com fins de caracterizar, nos diferentes níveis de ploidia, os parâmetros diâmetro dos grãos de pólen e tamanho dos estômatos, com o objetivo de utilizar esses critérios para inferência de níveis de ploidia nessa espécie. As medidas foram feitas com o auxílio de um microscópio com ocular micrométrica. Os resultados demostraram que o diâmetro dos grãos de pólen podem ser utilizados para caracterizar diferentes níveis de ploidia, enquanto que o tamanho dos estômatos não é um critério seguro nessa espécie.Seven accessions of african diploid and tetraploid and brazilian tetraploid plants of Hemarthria altissima were studied to distinguish, in each ploidy level, the characters of pollen grain diameter and stomatal size. Measurements were performed with ocular micrometer microscope. Results demonstrated that pollen grain diameter can be used to characterize different ploidy levels, but the stomatal size is not a reliable criterion in this species.

  1. A África carioca em lentes européias: corpos, sinais e expressões

    Directory of Open Access Journals (Sweden)

    Eneida Maria Mercadante Sela

    2006-12-01

    Full Text Available A proposta deste artigo é examinar as maneiras pelas quais alguns viajantes europeus que estiveram no Rio de Janeiro durante a primeira metade do século XIX diferenciaram os africanos na experiência da escravidão, tratando de um viés temático específico: os registros produzidos pela literatura de viagem oitocentista a respeito de suas belezas físicas, sinais corporais e expressões de cantos e danças. A convergência temática e valorativa desses relatos permite-nos observar a reiteração de certas tópicas que cristalizaram os significados mais comuns atribuídos pelos olhares estrangeiros aos africanismos com que depararam na cidade que continha, à época, a maior população escrava das Américas.The proposal of this article is to investigate the ways some European travellers, who have came to the city of Rio de Janeiro during the first half of the 19th century, registered Africans in the slavery experience. Foreigners who visited Brazilian Court until 1850 faced the biggest African slave population of the Americas, and the set of their literature, which describes such cultural and social counterpose, reveals conceptual reiterations of a whole lot of physical and behavioural characteristics given to Africans in captivity.

  2. A estrutura do conhecimento nas universidades ocidentalizadas: racismo/sexismo epistêmico e os quatro genocídios/epistemicídios do longo século XVI

    Directory of Open Access Journals (Sweden)

    Ramón Grosfoguel

    2016-04-01

    Full Text Available Este artigo discute a estrutura epistêmica do mundo moderno em relação aos quatro genocídios/epistemicídios do longo século XVI (1450-1650. Argumenta-se que o privilégio epistêmico do homem ocidental foi construído às custas do genocídio/epistemicídios dos sujeitos coloniais. O artigo relaciona o racismo/sexismo epistêmico da estrutura das universidades ocidentalizadas e do mundo moderno ao genocídio/epistemicídio contra muçulmanos e judeus na conquista de Al-Andalus, contra povos nativos na conquista das Américas, contra povos africanos na conquista da África e a escravização dos mesmos nas Américas e, finalmente, contra as mulheres europeias queimadas vivas acusadas de bruxaria. Esses quatro genocídios/epistemicídios são fundantes da estrutura epistêmica moderno-colonial e das universidades ocidentalizadas. A tese principal deste artigo é que a condição de possibilidade para o cartesianismo idolátrico dos anos 1640 que assume o olho de Deus e arroga-se o direito de dizer "penso, logo existo" é o "extermino, logo existo".

  3. SAIR DA ÁFRICA PARA ESTUDAR NO BRASIL: FLUXOS EM DISCUSSÃO

    Directory of Open Access Journals (Sweden)

    Luciana de Sousa Lima

    2017-08-01

    Full Text Available Resumo Trata-se de um estudo exploratório de natureza qualitativa, orientado pelo construcionismo social e pela psicologia social discursiva. Teve como principal objetivo analisar os significados que circunscrevem a experiência migratória para fins de estudo através dos relatos de africanos(as vinculados(as ao Programa de Convênio Estudantil- PEC-G numa universidade localizada no interior do Nordeste brasileiro. Foi realizada observação participante durante seis meses e entrevistas semiestruturadas com oito acadêmicos. As construções discursivas sinalizaram que a migração era uma forma de adquirir formação acadêmica em outro país; nesse sentido, o PEC-G facilitava a concretização desse projeto migratório, além de ser vantajoso por possibilitar o acesso ao ensino superior gratuito, também representava possibilidade de promoção social. Nesse deslocamento, em que há um projeto individual e familiar evidente, os estudantes tiveram contato com outras visões de mundo e comportamentos que lhes permitiram elaborar novos significados, colaborando assim no processo de adaptação.

  4. La catégorisation de la musique « noire » présente dans le langage courant de l’esthétique musicale afro-américaine.

    Directory of Open Access Journals (Sweden)

    Leonardo Henrique Da Cruz

    2016-12-01

    Full Text Available O presente artigo interroga algumas referências e definições dadas à estética musical herdada do continente africano, em especial à música afro-americana. Após quatro séculos de servidão ligada a uma tragédia humana, o terror racial dará lugar à uma enorme explosão de criatividade e de liberdade, onde o resultado agitará grande parte do planeta com o pseudônimo de « Black Music ». De conteúdo efêmero, ora contraditório, popularmente reconhecida pelo aspecto groove, hot, música do corpo, música de preto, ainda que possamos rejeitar ou idealizar certos termos (jargões, eles fazem parte da pauta de debate interdisciplinar de pesquisadores que discutem, entre outras características, sua(s realidade(s científica(s. Diversos artigos tratam sobre a complexa estética musical afro-americana no âmbito do sensível, politico, e discutem o uso dos mais variados rótulos. Entretanto, poderíamos falar de « Black Music »? À partir da análise de alguns textos, em particular de uma certa "carta aberta", objetiva-se pesquisar o desenvolvimento da musica afro-americana , cujo o conteúdo alimenta diversas pesquisas e discussões teóricas.

  5. The Perpetuation of a System of Conflicts in Darfur: Caught Between Local Violence and Regional Disorder

    Directory of Open Access Journals (Sweden)

    Amandine Gnanguênon

    2013-10-01

    Full Text Available En muchos casos en África, los conflictos locales armados y no armados, considerados por separado, interactúan hasta el punto de crear lo que puede llamarse "complejos" o "sistemas". Si bien algunos de los conceptos nos pueden ayudar a definir la dimensión regional de los conflictos locales, no nos proporcionan una mejor comprensión acerca de la superposición de varios conflictos. Tomando el ejemplo de Darfur en el periodo entre 2003 y 2011, este artículo contribuye a aclarar cómo la violencia y el desorden surgieron y se desarrollaron, tanto a nivel local como nacional y regional. El artículo propone una demostración empírica de la originalidad y la pertinencia del concepto de sistema de conflictos, con el objetivo de abrir un debate en la investigación actual sobre las definiciones de conflicto y guerra desde un prisma africano.

  6. 'Nada se pierde' en "El cielo protector" y "Cita en Tombuctú"

    Directory of Open Access Journals (Sweden)

    Santiago Martín

    2003-12-01

    Full Text Available El presente trabajo pretende comparar dos novelas distantes en el tiempo y en el espacio, a saber, The Protecting Sky (1949, de Paul Bowles, y Cita en Tombuctú (1996, de Joseph Subirós. La novela espaúola remite en más de una ocasión a la obra americana. Varios temas, presentes en ambas obras, que quisiéramos destacar: La fascinación por el continente africano; el desierto como telón de fondo; el viaje (especialmente interior como formación del hombre civilizado en un entorno hostil; el amor carnal entre la mujer civilizada y el hombre salvaje; la huída del hombre civilizado de su habitat en busca de otros valores; y, la derrota, debida al desequilibrio (físico, mental y temporal del hombre civilizado. Así, comparando las obras y mediante una frase ('Nada se pierde en el desierto' que Cita en Tombuctú presta de The Protecting Sky, la novela espaúola ofrece alternativas a los problemas planteados en la novela americana. Si en Bowles hay resignación, en Subirós hay esperanza.

  7. Factors related to the development of stress and burnout among nursing professionals who work in the care of people living with HIV/aids / Fatores relacionados ao desenvolvimento de estresse e burnout entre profissionais de enfermagem que atuam na assistência a pessoas vivendo com HIV/aids

    Directory of Open Access Journals (Sweden)

    Roberta Seron Sanches

    2018-01-01

    Full Text Available Objetivo: Identificar quais os fatores relacionados ao desenvolvimento de desgaste emocional, estresse e burnout estão presentes na assistência de enfermagem às pessoas vivendo com HIV/aids. Método: Revisão integrativa de literatura, com busca eletrônica de publicações nas bases de dados MEDLINE e LILACS, utilizando-se os descritores: esgotamento profissional, enfermagem, infecções por HIV em português e/ou em suas variações na língua inglesa. Resultados: Somente 9 artigos foram incluídos na seleção por se enquadrarem nos critérios de inclusão e atender a questão norteadora. Ressalta-se que 100% destes artigos são originários de periódicos internacionais, assim como desenvolvidos no continente africano. Conclusão: Estressores como falta de recursos, dificuldades para atender às expectativas da clientela, sobrecarga de trabalho, necessidade de lidar com a morte dos clientes e medo de contaminação estão presentes no cotidiano desses profissionais, podendo culminar na ocorrência de estresse e burnout, e comprometer a assistência prestada.

  8. La inmigración latinoamericana en los contenidos informativos. Un estudio sobre las noticias de prensa y televisión españolas

    Directory of Open Access Journals (Sweden)

    Carlos Muñiz Muriel

    2007-01-01

    Full Text Available La inmigración latinoamericana en España ha aumentado durante los últimos años, siendo ya el colectivo con mayor presencia. La imagen que los medios de comunicación plasman de los inmigrantes puede afectar la creación, el mantenimiento o el aumento de ciertos estereotipos de esos colectivos. Para conocer el tratamiento (framing que las noticias dan a la inmigración y a los inmigrantes latinoamericanos, se realizó un análisis de contenido de los principales periódicos y televisiones españolas del año 2004. Los resultados reflejan que el grupo latinoamericano está subrepresentado en las noticias respecto a la realidad. Además, sus retratos mediáticos son más favorables que los de otros grupos como el africano o el asiático. A partir de los datos obtenidos se reflexiona sobre los efectos que este tipo de cobertura puede producir sobre la población española.

  9. Tem um queniano correndo entre nós: atletismo e migração no Brasil

    Directory of Open Access Journals (Sweden)

    Carlos Ribeiro

    2013-09-01

    Full Text Available O objetivo da pesquisa foi analisar a movimentação migratória de esportistas estrangeiros do atletismo, sobretudo os de nacionalidades africanas, face ao seu sucesso em corridas de rua disputadas nas grandes cidades brasileiras. Focamos nossas análises na fala dos técnicos brasileiros de nível internacional que trabalham ou não com este grupo. Os resultados demonstram que os técnicos que treinam os atletas estrangeiros são contrários as normas reguladoras em vigor e que limitam a participação destes. Os técnicos centrados em atletas nacionais defendem as normas estabelecidas pela entidade responsável pelo esporte no país. Como conclusão, consideramos que um esporte individual como o atletismo que se estrutura à margem da identidade clubística, parece estar operando por parte de seus protagonistas sob o guarda chuva protetor do nacionalismo em que o atleta local deve ser defendido mediante reserva do mercado, contra a participação de atletas estrangeiros, sobretudo, na figura dos africanos.

  10. Moral transgression, disease and holistic health in the Livingstonia Mission in late nineteenth and early twenttieth-century Malawi

    Directory of Open Access Journals (Sweden)

    Hokkanen, Markku

    2009-06-01

    Full Text Available This article examines ideas of morality and health, and connections between moral transgression and disease in both Scottish missionary and Central African thought in the context of the Livingstonia Mission of the Presbyterian Free Church of Scotland in Malawi during the late nineteenth and early twentieth centuries.2 By concentrating on debates, conflicts and co-operation between missionaries and Africans over the key issues of beer drinking and sexual morality, this article explores the emergence of a new ‘moral hygiene’ among African Christian communities in Northern Malawi.

    Este artículo analiza las ideas sobre moralidad y salud, así como las relaciones entre transgresión moral y enfermedad, tanto en el pensamiento misionero escocés como en el pensamiento del África central, en el contexto de la Misión de Livingstonia de la Iglesia Libre Presbiteriana de Escocia en Malawi entre finales del siglo XIX y principios del XX. Centrándose en las conversaciones, los conflictos y la colaboración entre los misioneros y los africanos sobre cuestiones clave como el consumo de cerveza y la moralidad sexual, este artículo estudia la aparición de una nueva «higiene moral» entre las comunidades cristianas africanas en Malawi del norte.

  11. Análise da variabilidade genética de Alphitobius diaperinus utilizando marcadores moleculares de DNA - doi: 10.5102/ucs.v8i2.1141

    Directory of Open Access Journals (Sweden)

    Paulo Roberto Queiroz Silva

    2011-04-01

    Full Text Available Alphitobius diaperinus (Panzer, 1797 é uma espécie cosmopolita originária do continente africano encontrada em grande quantidade em cama de frango causando problemas sanitários e econômicos, afetando a saúde e o crescimento das aves e atuando também como transmissor de doenças. Indivíduos A. diaperinus originários de três localidades da região sul do Brasil foram analisados molecularmente por meio da técnica de RAPD. Para isso foi adaptada uma metodologia para extração de DNA e testados os iniciadores decaméricos OPA-03, OPA-04, OPA-10, OPA-11 e OPA-13. O protocolo de extração de DNA que foi adaptado produziu fragmentos de DNA para a análise das populações de cascudinho originárias da região sul do Brasil por RAPD. Foi encontrada alta variabilidade genética entre as populações de cascudinho. Além disso, sugere-se que indivíduos de A. diaperinus ocorrendo no Paraná possam ter se deslocado para os estados de Santa Catarina e Rio Grande do Sul.

  12. Un escarpado camino hacia la paz

    Directory of Open Access Journals (Sweden)

    Jennie Patricia Flechas Manosalva

    2013-01-01

    Full Text Available Esta reflexión es un llamado a reconocer la historia, para generar el compromiso de participar en su construcción, de transformarla, a través de un camino de paulatina humanización en la búsqueda de la anhelada paz. La historia universal ha estado siempre envuelta por hechos de barbarie que generan cuestionamientos acerca de la verdadera “humanidad” de quienes conforman la especie dominante del mundo. La barbarie implica desconocer al otro en su dignidad, no reconocerlo como igual; es una falta de conciencia que conduce a sucesos tan lamentables y atroces como el exterminio de los indígenas americanos, la trata de negros africanos o el holocausto nazi, que tienen en común la negación de las víctimas. Pero a la par de estas situaciones de barbarie, se encuentran, en la historia de la humanidad, movimientos sociales fuertes y proyectos de emancipación que permiten seguir creyendo y mirar con esperanza hacia soluciones más humanas.

  13. A importancia das contas longas de vidro de origem mediterrânica recolhidas na "Baixa Pombalina" de Lisboa (Contribuição para o estudo de contas tipo "Nueva Cadiz"

    Directory of Open Access Journals (Sweden)

    M. Conceição RODRIGUES

    2009-12-01

    Full Text Available RESUMO: Pretendemos com este trabalho dar a nossa contribuição para o estudo das contas de vidro e introduzir novos dados e valores no estudo do comercio entre Portugal e o mundo africano, nomeadamente com a costa Ocidental da África , onde a permuta de pessoas, bens e ideias foi em parte determinante. Estes contactos permitiram alargar os horizontes socio-culturais entre diferentes povos e simultaneamente entre dois continentes para onde as contas de vidro foram levadas, permutadas e usadas. As contas documentam a vivência social de quem as usa, sendo a expansão ultramarina, a principal responsável por todo este intercâmbio, tendo o Tejo como ponto de partida para o que foi uma das maiores aventuras do "Homem", dando simultaneamente início a uma das grandes épocas da expansão socio-cultural no mundo, que viria a modificar o modo de viver e sentir.ABSTRACT: With this work we aim to contribute to the study of the introduction of new methods and values in the trade between Portugal and African countries, specially with the West coast of Africa. This trade allowed an exchange of goods, ideas and people which widened the social and cultural horizons between two people and simultaneously between two continents, where glass beads were taken, exchanged and used.

  14. Polimorfismos del cromosoma Y humano en poblaciones de la región norte del Perú

    Directory of Open Access Journals (Sweden)

    Néstor Carbajal-Caballero

    2013-05-01

    Full Text Available Se evaluaron los loci Y-específicos DYS287, DYS199 y DYS390 en un total de 105 individuos, en cuatro poblaciones del norte del Perú. Sólo un individuo presentó el linaje YAP+ /C, de probable origen africano. La frecuencia de cromosomas Y Amerindios, indicado por el linaje YAP- /T, fue mayor en la población Aguaruna de Yamayakat (97%, disminuyendo en mestizos de Moche (73%, Santiago de Chuco (53% y Trujillo (33%; por otro lado, el grado de mestizaje fue mayor en las poblaciones nor-occidentales. Los haplótipos más frecuentes fueron YAP- /C/24 en Trujillo (47% y YAP- /T/24 en Santiago de Chuco (23%. La diversidad haplotípica en Santiago de Chuco (0,881 fue mayor que en Trujillo (0,752. Es de resaltar la considerable proporción de cromosomas Y Amerindios en las poblaciones peruanas a pesar de más de 500 años de influencia hispánica y otras culturas.

  15. La contribución de los inmigrantes en Uruguay

    Directory of Open Access Journals (Sweden)

    Felipe Arocena

    2009-01-01

    Full Text Available Este es un estudio comparativo acerca de cómo nueve comunidades inmigrantes y los afrodescendientes fueron conformando la cultura de Uruguay, un pequeño país en América del Sur. La imagen más común de este país, tanto a nivel nacional como internacional, es la de una sociedad homogénea y europeizada, construida sobre la base de inmigrantes provenientes de España e Italia, con una escasa población afro y sin nativos. Este panorama es cierto sólo a medias ya que también han sido fundamentales las contribuciones de inmigrantes provenientes de Asia, Rusia, otros países europeos y de esclavos africanos y sus descendientes libres. En particular analizaré cómo las personas de ascendencia africana, vascos, italianos, suizos, rusos, armenios, libaneses, judíos, musulmanes y peruanos, han contribuido en la construcción de la nación uruguaya. Este artículo presenta las conclusiones más relevantes de una investigación basada en casi un centenar de entrevistas en profundidad con integrantes de estas comunidades.

  16. El deporte en el campo diplomático: el caso de la Copa Mundial de la FIFA Sudáfrica 2010

    Directory of Open Access Journals (Sweden)

    Eduardo Carreño Lara

    2012-01-01

    Full Text Available Por más de cuarenta años, el fútbol fue considerado en Sudáfrica un importante escenario en la lucha por la libertad. Así, el movimiento anti-apartheid obtuvo simbólicos y cruciales logros en este campo cuando la federación local fue suspendida por la Federación Internacional de Fútbol Asociado (FIFA de todas las competencias internacionales hasta 1992. Ya en democracia, el fútbol -como otras disciplinas deportivas- ha sido considerado una instancia de encuentro y reconciliación en una sociedad marcada por clivajes raciales, por lo cual la adjudicación de la Copa Mundial de la FIFA fue aclamada por los sudafricanos y por todo el continente africano como una gran victoria que hacía crecer las expectativas en torno a los beneficios de este evento para mejorar la calidad de vida de millones de personas. El objetivo principal de este artículo es analizar las motivaciones políticas, económicas y sociales tras la organización de la Copa Mundial de la FIFA Sudáfrica 2010. Es un estudio explicativo sustentado en la revisión de fuentes secundarias e información oficial entregada por el gobierno de Sudáfrica tendiente a estimar las implicancias diplomáticas de un evento que claramente sobrepasó lo netamente deportivo.

  17. The Need to Help. The Domestic Arts of International Humanitarism, de Liisa H. Malkki

    Directory of Open Access Journals (Sweden)

    Ignacio Fradejas-García

    2016-05-01

    Full Text Available La literatura crítica con el humanitarismo ha emergido en el ámbito político internacional para quedarse. Renombrados científicos sociales como Didier Fassin (2012 o Thomas G. Weiss (2016, entre otros, han trabajado sobre los efectos de las intervenciones humanitarias desde diferentes ángulos. Cambiando el clásico enfoque en los beneficiarios, las políticas y los programas para pasar a indagar sobre las organizaciones y los trabajadores humanitarios, Liisa Malkki ha hecho una gran contribución a esta literatura profundizando en el porqué y el cómo de las acciones humanitarias. La autora es conocida por sus reflexiones etnográficas sobre las situaciones de exilio y refugio causadas por las sucesivas guerras y genocidios que asolaron en el último cuarto del siglo XX la zona de los grandes lagos africanos. Durante el genocidio ruandés de 1994, Malkki estaba finalizando un libro sobre un conflicto previo y olvidado en Burundi que provocó la llegada de refugiados hutus a Tanzania. La etnografía resultante, Purity and Exile (1995, explora cómo la violencia política y la cotidianeidad del exilio transforman la identidad y la conciencia histórica de los refugiados.

  18. Entre la retórica legal y eclesiástica:una misión antiesclavista en el siglo XVII

    Directory of Open Access Journals (Sweden)

    Rebeca Moreno Orama

    2015-06-01

    Full Text Available En 1537 la Iglesia prohibió la esclavitud de los amerindios, y no sería sino hasta 1839 que hiciera lo mismo con la esclavitud africana. Entre los siglos entre una postura a la otra, la impugnación religiosa de la esclavitud africana estuvo en manos de unos cuantos misioneros. Este trabajo discute cómo a través del empleo de la retórica legal y eclesiástica, el capuchino Francisco José de Jaca construye en su Resolución (La Habana, 1681un proyecto misionero alterno, centrado en la denuncia del cuerpo católico envuelto en la esclavitud y no en la evangelización de los africanos. In 1537 the Catholic Church prohibited Amerindian slavery, but not until 1839 would they do the same with African slavery. Between the centuries that span from one position to the other, religious condemnation of African slavery was in the hands of but a few missionaries. This work discusses how, through the employment of legal and ecclesiastic rhetoric, the Capuchin monk Francisco José de Jaca constructs in his Resolución (Havana, 1681 an alternative missionary project, focused on the denunciation of the Catholic body involved in the slavery institution and not on the evangelization of Africans.

  19. Abuso científico do termo 'caboclo'? Dúvidas de representação e autoridade

    Directory of Open Access Journals (Sweden)

    Richard Pace

    Full Text Available Os 'caboclos' da Amazônia brasileira estão classificados variavelmente como camponeses, extratores, povo rústico e descendentes miscigenados de europeus, indígenas e africanos. Em quase todos os usos se reconhece um tom pejorativo e raramente usado para chamar uma pessoa do mesmo nível social. As poucas pessoas que se identificam como 'caboclo' usam a palavra para referir-se a si mesmos, a não ser em condições especiais. Aceita-se que uma das finalidades das ciências sociais, particularmente a antropologia, é entender todas as culturas no mesmo nível e dar-lhes a mesma integridade que damos a nossa. Por que, então, insistimos em usar este termo? Esta pesquisa examina esta dúvida através da discussão sobre a representação e o uso de autoridade na documentação etnográfica

  20. Prosavana: Instrumento de Cooperação Internacional (Norte-Sul-Sul

    Directory of Open Access Journals (Sweden)

    Andre de Paiva Toledo

    2016-06-01

    Full Text Available Diante da crise energético-alimentar de 2008, a África passa a ser vista pelas instituições internacionais como território de expansão da fronteira agrícola, isto é, local de inserção do agronegócio. Apesar das contestações quanto ao caráter improdutivo do modelo tradicional de produção local, diversos Estados africanos têm estabelecido acordos internacionais de investimento com vistas à modernização de sua agricultura. Nesse contexto, surge o acordo trilateral entre Japão, Brasil e Moçambique, que possibilitará a implementação neste país do Prosavana, o programa de desenvolvimento agrícola da Savana moçambicana. Justificado como resultado da cooperação internacional Sul-Sul em contraposição ao tradicional mecanismo Norte-Sul, verificar-se-á que, na realidade, o Prosavana é um instrumento de cooperação (Norte-Sul-Sul, pelo qual são garantidos determinados interesses incompatíveis com a horizontalidade da cooperação Sul-Sul.

  1. Política, agricultura e a reconversão do capital do tráfico transatlântico de escravos para as finanças brasileiras na década de 1850 Politics, agriculture and the reconversion of the transatlantic slave trade capital to Brazilian finances in 1850'

    Directory of Open Access Journals (Sweden)

    Artur Vitorino

    2008-12-01

    Full Text Available O artigo enfoca como, após 1850, com a cessação do tráfico transatlântico de africanos escravos, o capital, antes engatado nesse negócio, passou a irrigar o meio circulante (a moeda e o crédito, reforçando, assim, a economia de mercado já existente na Corte Imperial, mas, a partir de então, com força para configurar nesta cidade uma economia urbana de profundas conseqüências para os agricultores escravistas do Vale do Paraíba ligados ao comércio exterior, e dependentes do crédito e da moeda ali alocados. O assentamento urbano do capital dos mercadores negreiros foi deliberado pelo Partido Conservador.The article emphasizes how, after 1850, with the cessation of the transatlantic African slave trade, the capital, rather linked in this business, passed to irrigate the finance capital (the coin and the credit, reinforcing, then, the trade economy also extant in the Imperial Court but, hereafter, stronger enough to build in this city a urban economy with profoundest consequences to the farms of the Vale do Paraíba who used slaves, were linked in the foreign trade, and were dependent of the credit and of the coin allocated there. The urban settlement of the black slave trade capital was deliberate by the Conservative Party.

  2. The Dom Feliciano belt and its relations with the craton of the Rio de la Plata and Punta del Este ground-Geology and geochronology

    International Nuclear Information System (INIS)

    Preciozzi, F.; Peel, E.; Sanchez, L.; Basei, M.; Ledesma, J.; Muzio, R.

    2005-01-01

    This research was framed in an interdisciplinary project, whose main objective was to make an approach to the geological, tectonic and geochronological evolution of Dom Feliciano Belt and adjacent land partners, especially the Río de la Plata Craton and Land Punta del Este. As was proposed in the project, special attention to geochronological studies from geological transects lent controlled. This yielded the expected level major step forward, not only with regard to the age of different units, but what makes the establishment of an adequate stratigraphy of them. Similarly, geochemical, petrographic and geochronological studies allowed essentially make geotectonic and geologic correlations with the southern portion of Brazil and the western portion of the land I africanos.lo expand involving more project goals in si.En effect began to manifest as a need to know the evolution of equivalent units both in the southern portion of Brazil and Africa Occidental.Estos fundamentalmnete work with West Africa were made with contributions from CONICYT Project 6009 under Projects Geological Correlation 438, 450 and 478 .this pertimitio exchange ideas with leading scientists worldwide many of whom ended up collaborating with it

  3. Aproximaciones teóricas para repensar el diálogo África, América Latina y el Caribe

    Directory of Open Access Journals (Sweden)

    Maguemati Wabgou

    2007-07-01

    Full Text Available La exploración de las teorías de la autonomía, el realismo periférico, inversión extranjera directa (ied y su aplicación junto con la de triangulación, ofrecen fundamentos para aprehender el diálogo horizontal entre África, América Latina y el Caribe. La pretensión de las dos primeras teorías de índole esencialmente política –conllevando lo económico y lo cultural– es concientizar a los países latinoamericanos, caribeños y africanos acerca de su situación de subordinación y dependencia frente a las potencias mundiales, situación que les impide elaborar y poner en marcha proyectos comunes como bloque. De hecho, para la realización de estos proyectos es posible recurrir a la teoría de ied y el método de la triangulación como herramientas de consolidación de alianzas horizontales.

  4. Propuesta metodológica para la gestión formativa socio-cultural profesional en las universidades africanas

    Directory of Open Access Journals (Sweden)

    MsC. Moussa Moustapha

    2015-10-01

    Full Text Available En la actualidad, para un desarrollo económico, social, cultural, político y profesional sustentable en los países subdesarrollados, es imprescindible que sus instituciones de la educación superior, como entidades sociales, tengan sus propios modelos pedagógicos y metodológicos, conforme a las realidades de sus contextos. Ello le permite no solamente jugar su rol social, involucrándose más en el desarrollo y transformación de su contexto, sino encausar una formación de profesionales que trascienden su tiempo, comprometidos, auténticos, flexibles, competitivos y orgullosos de sus tradiciones y costumbres.En el presente trabajo, proponemos una metodología de gestión formativa socio-cultural profesional para las universidades africanas, cuyo objetivo es contextualizar los procesos universitarios africanos. Ella es premisa de una valoración científica de los realidades socio-culturales contextuales, que desde sus raíces humanistas, ancestrales, milenarias y sus riquezas como potencialidades socio-culturales asienten el desarrollo de una identidad y autenticidad formativa profesional y un desarrollo cultural universitaria para el empoderamiento del proceso.

  5. No baú de Augusto Mina: o micro e o global na história do trabalho

    Directory of Open Access Journals (Sweden)

    Henrique Espada Lima

    Full Text Available RESUMO Este artigo discute as relações entre a micro-história e o recente debate sobre a história global no campo dos estudos sobre o trabalho. O texto se desdobra em uma discussão historiográfica e uma análise empírica de um documento, o inventário judicial dos bens deixados por um africano livre de nome Augusto Mina, um marinheiro e trabalhador portuário, que morreu na cidade do Desterro, na Ilha de Santa Catarina, em 1861. O artigo discute o modo pelo qual a análise dos fatos que se conhece da vida de Augusto pode ilustrar as potencialidades e os limites de uma investigação histórica que tente integrar as sugestões teóricas e metodológicas da micro-história aos desafios intelectuais propostos pela história global do trabalho.

  6. Recepción de estereotipos de la serie norteamericana Lost entre jóvenes que habitan en Monterrey, México

    Directory of Open Access Journals (Sweden)

    Beatriz Elena Inzunza Acedo

    2013-01-01

    Full Text Available El objetivo del estudio consistió en el análisis de recepción de los personajes de la serie estadounidense Lost, cuyas representaciones variaron entre norteamericanos, latinos, europeos, coreanos, rusos, árabes, australianos y africanos; hombres y mujeres; niños, jóvenes, adultos y ancianos. Se llevaron a cabo cinco grupos de discusión con 29 jóvenes que habitaban en Monterrey, México. Para la interpretación de resultados, se utilizó el modelo de Palmer y Hafen, en la versión ampliada de Inzunza Acedo, y los tipos de empatía de Igartua y Muñiz. Las conclusiones apuntan a una tendencia de aceptación o rechazo de tipo ingenuo de los personajes, puesto que no hay una reflexión crítica respecto a los estereotipos, debido al apego emocional por parte de los espectadores o a elementos humorísticos del guion.

  7. Reflexões sobre uma nova historiografia literária na América LatinaDOI:10.5007/2175-8026.2010n59p113

    Directory of Open Access Journals (Sweden)

    Eduardo Faria Coutinho

    2010-03-01

    Full Text Available Com a contribuição de correntes do pensamento como a Desconstrução, a Nova História e os chamados Estudos Culturais e Pós-Coloniais, a Historiografia Literária vem sofrendo, nas últimas décadas, considerável transformação, que se faz sentir pelo questionamento de alguns de seus pilares tradicionais, como as noções de “progressão linear”, “nação”, “idioma” e “literariedade”. Na América Latina, onde a historiografia literária sempre tomou por base os modelos europeus, e deixou de lado a produção de grande parte da população, como os indígenas e africanos, a questão vem inquietando diversos estudiosos, e já deu margem à criação de Histórias Literárias de alto teor inovativo, que dão voz a esses grupos, até então silenciados. Este trabalho consiste numa reflexão sobre esta nova historiografia literária na América Latina, e sobre o papel que ela vem desempenhando no campo dos estudos latino-americanos e de Literatura Comparada de maneira geral.

  8. Lithic technology of the “St Site Complex” from Peninj (Lake Natron, Tanzania: Analysis of an African Oldowan assemblage

    Directory of Open Access Journals (Sweden)

    de la Torre Sáinz, Ignacio

    2004-06-01

    Full Text Available In this work a sistematic analysis of the lithic materials from the ST Site Complex (Lake Natron, Tanzania is presented. This complex is composed of a cluster of eleven archaeological sites, which share a topographic proximity and the same stratigraphic position. They are located above Tuff 1 in the Upper Sandy Clays of the Humbu Formation of Peninj, dated around 1,6-1,4 ma. Lithic artefacts from each archaeological site will be analysed together from a technological perspective, focusing on the relevance of the conclusions obtained for knowledge of the African Oldowan.

    En este trabajo se presenta un análisis sistemático de los materiales líticos hasta ahora estudiados en el Complejo ST de Peninj, en el lago Natron (Tanzania. Este complejo está constituido por un grupo de 11 yacimientos arqueológicos muy próximos topográficamente y situados en la misma posición estratigráfica, por encima de la Toba 1 en las Upper Sandy Cáliz (Arcillas Arenosas Superiores de la Formación Humbu de Peninj, cuya cronología se estima entre los 1,6-1,4 ma. Desde una perspectiva tecnológica, se estudiarán conjuntamente los objetos líticos recuperados en cada uno de estos yacimientos, incidiendo en la relevancia de las conclusiones obtenidas para el conocimiento del Olduvayense africano.

  9. A antroponímia dos matriculados na sociedade protetora dos desvalidos durante a segunda década do século XX

    Directory of Open Access Journals (Sweden)

    Victor Cavalcanti Mariano

    2013-05-01

    Full Text Available O presente trabalho traz à baila a discussão sobre a antroponímia de uma parcela da população afrodescendente do Brasil. O texto tenta mostrar, relacionando a história da Bahia e do Brasil, o porquê de os nomes próprios africanos terem praticamente se extinguido no país, revelando possíveis fatores que levaram os negros a adotar nomes de origem europeia. Para tanto, faz-se uso do livro de matrícula da Sociedade Protetora dos Desvalidos (SPD, uma irmandade negra de Salvador que existe desde 1832, quando ainda havia o regime escravocrata no Brasil. Analisam-se aqui os nomes presentes no livro a partir da segunda década do século XX. A partir da leitura de textos que tratam da antroponímia no Brasil e em Portugal, bem como de textos que traçam a história da escravidão brasileira e da SPD, além da análise dos nomes presentes no livro de matrícula, confirma-se a hipótese do uso de nomes de origem europeia pelos negros brasileiros e procura-se criar hipóteses para a explicação de tal fato.

  10. DENGUE, CHIKUNGUNYA E EBOLA: VIROSES AMBIENTAIS

    Directory of Open Access Journals (Sweden)

    Thereza Cristina Ferreira Camello

    2014-12-01

    Full Text Available DOI: 10.12957/sustinere.2014.14122Várias viroses emergentes ou reemergentes podem ser veiculadas por mosquitos. Aedes aegypti e Aedes albopictus, os mesmos que transmitem o vírus da dengue e da febre amarela, podem disseminar o vírus Chikungunya que este ano no Brasil já fez cerca de 1000 casos confirmados. A doença tem parâmetros semelhantes aos da Dengue, e embora a taxa de letalidade seja muito baixa, sequelas podem permanecer no individuo por um ano. Em 2014 a partir de setembro o mundo observou perplexo a ressurgência de um vírus hemorrágico letal, em uma das piores epidemias já ocorridas no continente africano. O vírus Ebola atingiu mais de 6000 pessoas. Estudos no sentido de melhorar as estratégias de contenção da disseminação de vetores e dos vírus devem ser estabelecidas, enquanto aguardamos a produção de vacinas eficazes. O mundo não é imune a uma infecção endêmica, localizada no interior de um continente e não estamos preparados para atender uma demanda deste porte.

  11. Anatomía visceral de Feylinia grandisquamis (Squamata: Scincidae. Comparaciones con otros escamados de patrón corporal semejante

    Directory of Open Access Journals (Sweden)

    Díaz Gómez, Juan Manuel

    2003-07-01

    Full Text Available Feylinia grandisquamis es un síncido africano caracterizado por contar con el cuerpo alargado y las extremidades ausentes. En el presente trabajo se describe en detalle la anatomía de las vísceras de Feylinia grandisquamis, y algunos aspectos de su variación intraespecífica. Los resultados se comparan con otro género de Scincidae (Anomalopus y representantes de grandes grupos de escamados que exhiben patrones corporales semejantes (Lialis burtonis, Amphisbaena darwinii, Boa constrictor, Ophiodes striatus, Anguis fragilis. Los objetivos de este trabajo fueron: a determinar la morfología de las vísceras de Feylinia; b los aspectos de su variación intraespecífica; c discutir convergencias y paralelismos con Saurios, Anfisbénidos y Ofidios. Feylinia grandisquamis is an African Scincid characterized for a snakeshaped body and total absence of limbs. In this work the visceral anatomy of Feylinia grandisquamis is described, as well as aspects of its intraspecific variation. The results are compared with another scincid (Anomalopus and representatives of other Squamate groups with similar body plans (Lialis burtonis, Amphisbaena darwinii, Boa constrictor, Ophiodes striatus, Anguis fragilis. The objectives were: a To determine the visceral anatomy of Feylinia; b The aspects of its intraespecific variation; and c Discuss convergences and parallelisms with possible occurrence in Lizards, Amphisbaenids and Ophidia.

  12. CONFLICTOS EN ÁFRICA: EL CASO DE LA REGIÓN DE LOS GRANDES LAGOS Y DE SUDÁN

    Directory of Open Access Journals (Sweden)

    Mbuyi Kabunda

    2011-01-01

    Full Text Available Los conflictos africanos tienen cada uno su especificidad e idiosincracia, pero encontrando todos un denominador común en las luchas manipuladas entre las nacionalidades, por una parte, y los nacionalismos estatales, por otra, y últimamente por el afán por el acceso a los recursos naturales. En los casos particulares de los Grandes Lagos, abordados en el presente análisis, es preciso subrayar que los conflictos nacen de la instauración de un "etnicismo científico" (Jean-Pierre Chrétien, junto a la desaparición del aparato del Estado en la RDC dando lugar a un saqueo de recursos naturales en este país, y en Sudán fundamentalmente de las desigualdades de toda índole entre el centro y las periferias de este país (el Sur de Sudán y el Darfur. La solución en ambos casos pasa por la creación de Estados de derecho (el fin de la cultura de la impunidad y la descentralización (federalismo.

  13. DÁVILA, Jerry. Hotel Trópico: o Brasil e o desafio da descolonização africana (1950-1980. Tradução de Vera Lúcia Mello Joscelyne. Rio de Janeiro: Paz e Terra, 2011.

    Directory of Open Access Journals (Sweden)

    Jefferson José Queler

    2014-06-01

    Full Text Available (primeiro parágrafo do texto Compreender acontecimentos na sociedade brasileira em sua fase republicana de uma forma desterritorializada, eis um dos desafios de um presente marcado amplamente por uma lógica globalizada. É o que se propõe a fazer o historiador norte-americano Jerry Dávila, professor da Universidade da Carolina do Norte. Em seu estudo, ele é bem-sucedido ao demonstrar como determinados movimentos sociais e orientações políticas atuantes no Brasil entre 1950 e 1980 devem ser compreendidos à luz de trocas culturais, políticas e econômicas ocorridas no âmbito do oceano Atlântico, especialmente aquelas efetuadas com países africanos em processo de emancipação ou recém-egressos de anos de colonização europeia. O autor não explicita suas balizas teórico-metodológicas, mas sua bibliografia sugere os trabalhos de Paul Gilroy e de Luiz Felipe de Alencastro – estudiosos do tráfico de escravos e das relações por ele engendradas no universo do Atlântico – como fontes de inspiração.

  14. Do recado da terra aos sinais das estrelas: as lendas e mitos como marcas identitárias em Mia Couto

    Directory of Open Access Journals (Sweden)

    Tatiana Alves Soares Caldas

    2015-06-01

    Full Text Available http://dx.doi.org/10.5007/2176-8552.2016n20p185 Estórias Abensonhadas, livro de contos publicado em 1994, é marcado pela recuperação de valores e por um traço característico de praticamente todos os contos que o integram, e que se faz presente em muitas narrativas do período pós-colonial: a perspectiva do sonho em meio à violência e à guerra. Por meio de histórias que remetem a mitos e lendas do imaginário africano, ocorre o resgate de traços soterrados por um passado colonial e por guerras civis. O emergir da ancestralidade e das tradições locais surge como algo fundamental à construção de uma identidade moçambicana, numa proposta que se faz a partir dos valores da terra. Os contos que integram a obra traduzem a perspectiva do sonho em uma terra que aos poucos se reconstrói. Vendo em tais narrativas uma tentativa simultânea de resistência aos valores pragmáticos impostos pelo colonizador e de resgate de uma identidade calcada na oralidade e nos mitos de origem, nosso estudo busca analisar tais manifestações nos referidos contos como mecanismos de afirmação e de reconstrução de uma identidade nacional.

  15. Relações comerciais e diplomáticas Anglo-africanas durante a expedição ao Níger de 1854

    Directory of Open Access Journals (Sweden)

    Alexsander Lemos de Almeida Gebara

    2016-08-01

    Full Text Available Resumo O artigo procura compreender a expedição britânica nos rios Niger e Benue em 1854 num contexto de transformação nas relações políticas e econômicas da Grã Bretanha com o interior da África Ocidental. Tal empreendimento ficou marcado pela ausência de mortes por febres tropicais e deixou vários registros, dentre eles relatos de viagem e a correspondência entre seus agentes e o Foreign Office e o Colonial Office que compõe o corpo de fontes deste artigo. Especial atenção é dedicada aos termos e formas das trocas comerciais realizadas com os africanos diretamente ao longo da viagem e às condições nas quais estes relacionamentos foram estabelecidos. Assim, procura-se por um lado, compreender a expedição como parte de um de um processo de ampliação da presença europeia no interior e, por outro lado, refletir sobre as estratégias africanas em diálogo com as transformações econômicas na bacia Atlântica em meados do século XIX.

  16. El proyecto político afroperuano: ¿La reivindicación de una diáspora africana sin África?; O projeto político afro-peruano: A reivindicação de uma diáspora africana sem África?; The Afro-Peruvian Political Project: The claim of an African diaspora without Africa?

    Directory of Open Access Journals (Sweden)

    Juan Enrique Pozada Pineda

    2015-07-01

    Full Text Available Resumen: Cuando nos referimos a los términos “diáspora africana”, “afrodescendencia” o “afrodescendientes”, inevitablemente debemos hacer referencia a África. En función a ello, África, podría entenderse como la raíz y el origen de estas tres dimensiones identitarias. En el caso del Perú, específicamente con el proyecto político étnico enarbolado por las organizaciones de derechos civiles afroperuanas y por algunas entidades del Estado especializadas en “lo afroperuano”, las reivindicaciones de una afrodescendencia o pertenencia a una diáspora africana, no suelen dirigirse a África, sino a sus pares afrodescendientes más próximos. Esto como si el Océano Atlántico fuese un gran abismo entre dos mundos muy distintos: el afrodescendiente y el africano. El presente trabajo pretende dar un acercamiento a esta realidad, en donde las luchas por la reivindicación de una diáspora africana se presentan sin África, sin lo africano, desarraigadas de su raíz, aunque sí, con un “África” imaginada, más “cercana” y menos “extraña”.   Palabras clave: Afroperuanos, diáspora, africanidades, proyectos identitarios, afrodescendencia.       Resumo: Quando nos referimos     aos termos "diáspora africana", "afrodescendência" ou "afrodescendentes", inevitavelmente devemos fazer referência à África. Em função disso, se podia entender a África como a raiz e origem destas três dimensões identitárias. No caso do Perú, especificamente com o projeto étnico-político elaborado pelas organizações de direitos civis afro- peruanas e por algumas entidades do Estado especializadas no "afroperuano", as reivindicações de uma afrodescendência ou pertença a uma diáspora africana, normalmente não para dirigir-se a África, se não a seus pares afrodescendentes     mais próximos. Isto como se o oceano Atlântico fosse um grande abismo entre dois mundos distintos: o do afrodescendente e o do africano. O

  17. Re-escribiendo la historia del modernismo en África

    Directory of Open Access Journals (Sweden)

    Lucrezia Cippitelli

    2018-01-01

    Full Text Available En este artículo la autora se propone hacer visible la clara intención de una generación de productores culturales africanos empeñados en modelar la historia moderna de sus países y de reescribir la Historia del Modernismo artístico en África, desde una perspectiva no eurocéntrica; intención que se caracteriza por la apropiación de la heterogénea experiencia de los procesos de descolonización. Para tal fin, se realiza el análisis de dos importantes proyectos expositivos y académicos: Khartoum School: The Making of Modern Art Movement in Sudan (desde 1945 hasta el presente co-curada por Hoor Al-Qasimi y Salah M. Hassan y When Arts Become Liberty: The Egyptian Surrealists (1938- 1965 comisariada por Hoor Al-Qasimi y Salah Has-san.

  18. As interrogativas de conteúdo nas variedades do português falado

    Directory of Open Access Journals (Sweden)

    Erotilde Goreti PEZATTI

    2013-10-01

    Full Text Available Este estudo trata dos Atos Interrogativos de conteúdo, comumente denominados interrogativas-Q. Adotando a perspectiva funcional da linguagem e os pressupostos teórico-metodológicos da Gramática Discursivo-Funcional, procura-se explicar as diferentes formas assumidas pelas interrogativas-Q com base no alinhamento entre a codificação dessa estrutura nos níveis Morfossintático e Fonológico e as formulações ocorridas nos níveis Interpessoal e Representacional, centrando-se na questão da ordenação de elementos-Q. Como universo de pesquisa, tomam-se ocorrências reais de uso extraídas do corpus oral organizado pelo Centro de Linguística da Universidade de Lisboa, em parceria com a Universidade de Toulouse-le-Mirail e a Universidade de Provença-Aix-Marselha, que dispõe de amostragens das variedades do português falado em Portugal, no Brasil, nos países africanos de língua oficial portuguesa, no Timor Leste e em Macau.

  19. Para além de Salvador e do Recôncavo baiano: o culto aos santos na América Portuguesa Beyond Salvador and the Recôncavo baiano: cult to the saints in Portuguese America

    Directory of Open Access Journals (Sweden)

    Tânia Maria Pinto de Santana

    2010-01-01

    Full Text Available Este texto pretende discutir alguns aspectos ligados à questão dos poucos avanços da catequese católica entre os negros, proposta pelo Clero na América - tomando como referência a cidade de Salvador e seu Recôncavo. Esses estariam ligados à sobrevivência de práticas pré-cristãs entre os africanos e seus descendentes. Marcados pela presença dos elementos cósmicos em suas concepções religiosas, esses priorizaram em suas crenças, a relação com os elementos da natureza, fazendo prevalecer uma experiência religiosa que colocava à margem conteúdos básicos transmitidos através da doutrina e dos ritos instituídos pela Igreja Católica.This text intends to discuss some aspects referent to the few advances of the Catholic catechism among the blacks, proposed by the Clergy in America - taking as reference the city of Salvador and its Recôncavo. These would be linked to the survival of pre-Christian practices among the Africans and their descendants. Marked by the presence of the cosmic elements in their religious concepts, these prioritized in their beliefs, the relation with the elements from the nature, prevailing a religious experience that laid aside basic contents transmitted through the doctrine and the rites established by the Catholic Church.

  20. O FIM DO ÚLTIMO GRANDE IMPÉRIO COLONIAL: LEMBRANÇAS DE UMA REPORTAGEM HISTÓRICA

    Directory of Open Access Journals (Sweden)

    Beatriz Bissio

    2016-05-01

    Full Text Available Em 2015 completaram-se 40 anos do fim do último grande império colonial, que fora iniciado no século XV quando os navegantes portugueses dominavam os mares. Um império derrotado no século XX em território angolano, num dos últimos e mais dolorosos episódios do processo de emancipação do continente africano. A América Latina esteve presente nesse processo através de dois protagonistas com papeis diferentes, porém igualmente determinantes: um no plano diplomático e o outro no terreno militar, Brasil e Cuba. A data suscita uma reflexão sobre o custo em vidas humanas e em sacrifícios que alicerçou o caminho para a Angola do século XXI. Esta matéria reflete as lembranças de uma cobertura jornalística desse momento histórico.