WorldWideScience

Sample records for african clawed frog

  1. PHENOBARBITAL AFFECTS THYROID HISTOLOGY AND LARVAL DEVELOPMENT IN THE AFRICAN CLAWED FROG XENOPUS LAEVIS

    Science.gov (United States)

    The abstract highlights our recent study to explore endocrine disrupting effects of phenobarbital in the African clawed frog, Xenopus laevis. In mammals, this chemical is known to induce the biotransforming enzyme UDP-glucuronosyltransferase (UDPGT) resulting in increased thyroid...

  2. Evolution of advertisement calls in African clawed frogs

    Science.gov (United States)

    Tobias, Martha L.; Evans, Ben J.; Kelley, Darcy B.

    2014-01-01

    Summary For most frogs, advertisement calls are essential for reproductive success, conveying information on species identity, male quality, sexual state and location. While the evolutionary divergence of call characters has been examined in a number of species, the relative impacts of genetic drift or natural and sexual selection remain unclear. Insights into the evolutionary trajectory of vocal signals can be gained by examining how advertisement calls vary in a phylogenetic context. Evolution by genetic drift would be supported if more closely related species express more similar songs. Conversely, a poor correlation between evolutionary history and song expression would suggest evolution shaped by natural or sexual selection. Here, we measure seven song characters in 20 described and two undescribed species of African clawed frogs (genera Xenopus and Silurana) and four populations of X. laevis. We identify three call types — click, burst and trill — that can be distinguished by click number, call rate and intensity modulation. A fourth type is biphasic, consisting of two of the above. Call types vary in complexity from the simplest, a click, to the most complex, a biphasic call. Maximum parsimony analysis of variation in call type suggests that the ancestral type was of intermediate complexity. Each call type evolved independently more than once and call type is typically not shared by closely related species. These results indicate that call type is homoplasious and has low phylogenetic signal. We conclude that the evolution of call type is not due to genetic drift, but is under selective pressure. PMID:24723737

  3. Evolution of advertisement calls in African clawed frogs.

    Science.gov (United States)

    Tobias, Martha L; Evans, Ben J; Kelley, Darcy B

    2011-01-01

    For most frogs, advertisement calls are essential for reproductive success, conveying information on species identity, male quality, sexual state and location. While the evolutionary divergence of call characters has been examined in a number of species, the relative impacts of genetic drift or natural and sexual selection remain unclear. Insights into the evolutionary trajectory of vocal signals can be gained by examining how advertisement calls vary in a phylogenetic context. Evolution by genetic drift would be supported if more closely related species express more similar songs. Conversely, a poor correlation between evolutionary history and song expression would suggest evolution shaped by natural or sexual selection. Here, we measure seven song characters in 20 described and two undescribed species of African clawed frogs (genera Xenopus and Silurana) and four populations of X. laevis. We identify three call types - click, burst and trill - that can be distinguished by click number, call rate and intensity modulation. A fourth type is biphasic, consisting of two of the above. Call types vary in complexity from the simplest, a click, to the most complex, a biphasic call. Maximum parsimony analysis of variation in call type suggests that the ancestral type was of intermediate complexity. Each call type evolved independently more than once and call type is typically not shared by closely related species. These results indicate that call type is homoplasious and has low phylogenetic signal. We conclude that the evolution of call type is not due to genetic drift, but is under selective pressure. PMID:24723737

  4. CRYPTOSPORIDIOSIS ASSOCIATED WITH EMACIATION AND PROLIFERATIVE GASTRITIS IN A LABORATORY SOUTH AFRICAN CLAWED FROG

    Science.gov (United States)

    A 2-year-old emaciated female South African Clawed frog (Xenopus laevis) was euthanized due to chronic weight loss. At postmortem, there was no evidence of bacterial, fungal or viral disease, however, the histological findings indicated a proliferative gastritis and the presence of numerous Cryptosp...

  5. Inverse Effects on Growth and Development Rates by Means of Endocrine Disruptors in African Clawed Frog Tadpoles ("Xenopus Laevis")

    Science.gov (United States)

    Hackney, Zachary Carl

    2007-01-01

    Previous work on fish, frogs, and salamanders, showed the ability for estrogen (EE2) and anthropogenic endocrine disruptors to skew sex ratios and cause hermaphrodism. This study addressed the effects of estrogens on growth and development rates of African clawed frog tadpoles ("Xenopus laevis") during their gender determination stages. The…

  6. Evolution of advertisement calls in African clawed frogs

    OpenAIRE

    Tobias, Martha L.; Evans, Ben J; Kelley, Darcy B.

    2011-01-01

    For most frogs, advertisement calls are essential for reproductive success, conveying information on species identity, male quality, sexual state and location. While the evolutionary divergence of call characters has been examined in a number of species, the relative impacts of genetic drift or natural and sexual selection remain unclear. Insights into the evolutionary trajectory of vocal signals can be gained by examining how advertisement calls vary in a phylogenetic context. Evolution by g...

  7. Effects of depleted uranium on survival, growth, and metamorphosis in the african clawed frog (Xenopus laevis)

    Science.gov (United States)

    Mitchell, S.E.; Caldwell, C.A.; Gonzales, G.; Gould, W.R.; Arimoto, R.

    2005-01-01

    Embryos (stage 8-47, Nieuwkoop and Faber) of the African clawed frog (Xenopus laevis) were subjected to water-borne depleted uranium (DU) concentrations that ranged from 4.8 to 77.7 mg/Lusing an acute 96-h frog embryo teratogenesis assay-Xenopus (FETAX). In a chronic 64-d assay, X. laevis (from embryo through metamorphosis; stages 8-66) were subjected to concentrations of DU that ranged from 6.2 to 54.3 mg/L Our results indicate DU is a non teratogenic metal. No effects on mortality, malformations, or growth were observed in the 96-h FETAX with concentrations of DU that ranged from 4.8 to 77.7 mg/L From stage 8 to stage 47, X. laevis tadpoles do not actively feed and the gills are not well developed. Thus, uptake of DU was reduced despite exposure to elevated concentrations. The 64-d assay resulted in no concentration response for either mortality or malformations; however, a delay in metamorphosis was observed in tadpoles subjected to elevated DU concentrations (from 13.1 to 54.3 mg/L) compared to tadpoles in both the well-water control and reference. The delay in metamorphosis was likely due to increasing body burden of DU that ranged from 0.98 to 2.82 mg/kg. Copyright?? Taylor & Francis Inc.

  8. Immune Defenses against Batrachochytrium dendrobatidis, a Fungus Linked to Global Amphibian Declines, in the South African Clawed Frog, Xenopus laevis▿

    OpenAIRE

    Ramsey, Jeremy P.; Reinert, Laura K.; Harper, Laura K.; Douglas C Woodhams; Rollins-Smith, Louise A.

    2010-01-01

    Batrachochytrium dendrobatidis is a chytrid fungus that causes the lethal skin disease chytridiomycosis in amphibians. It is regarded as an emerging infectious disease affecting diverse amphibian populations in many parts of the world. Because there are few model amphibian species for immunological studies, little is known about immune defenses against B. dendrobatidis. We show here that the South African clawed frog, Xenopus laevis, is a suitable model for investigating immunity to this path...

  9. Sex differences and endocrine regulation of auditory-evoked, neural responses in African clawed frogs (Xenopus).

    Science.gov (United States)

    Hall, Ian C; Woolley, Sarah M N; Kwong-Brown, Ursula; Kelley, Darcy B

    2016-01-01

    Mating depends on the accurate detection of signals that convey species identity and reproductive state. In African clawed frogs, Xenopus, this information is conveyed by vocal signals that differ in temporal patterns and spectral features between sexes and across species. We characterized spectral sensitivity using auditory-evoked potentials (AEPs), commonly known as the auditory brainstem response, in males and females of four Xenopus species. In female X. amieti, X. petersii, and X. laevis, peripheral auditory sensitivity to their species own dyad-two, species-specific dominant frequencies in the male advertisement call-is enhanced relative to males. Males were most sensitive to lower frequencies including those in the male-directed release calls. Frequency sensitivity was influenced by endocrine state; ovariectomized females had male-like auditory tuning while dihydrotestosterone-treated, ovariectomized females maintained female-like tuning. Thus, adult, female Xenopus demonstrate an endocrine-dependent sensitivity to the spectral features of conspecific male advertisement calls that could facilitate mating. Xenopus AEPs resemble those of other species in stimulus and level dependence, and in sensitivity to anesthetic (MS222). AEPs were correlated with body size and sex within some species. A frequency following response, probably encoded by the amphibian papilla, might facilitate dyad source localization via interaural time differences. PMID:26572136

  10. Temperature-independent energy expenditure in early development of the African clawed frog Xenopus laevis

    International Nuclear Information System (INIS)

    The thermal dissipation of activated eggs and embryos undergoing development from cleavage to the tailbud stage of the African clawed frog Xenopus laevis was measured as a function of incubation time at temperatures ranging from T = 288.2 K to 295.2 K, using a high-precision isothermal calorimeter. A23187-mediated activation of mature eggs induced stable periodic thermal oscillations lasting for 8–34 h. The frequency agreed well with the cell cycle frequency of initial cleavages at the identical temperature. In the developing embryo, energy metabolism switches from embryonic to adult features during gastrulation. The thermal dissipation after gastrulation fit well with a single modified Avrami equation, which has been used for modeling crystal-growth. Both the oscillation frequency of the activated egg and the growth rate of the embryo strongly depend on temperature with the same apparent activation energy of approximately 87 kJ mole−1. This result suggests that early development proceeds as a single biological time, attributable to a single metabolic rate. A temperature-independent growth curve was derived by scaling the thermogram to the biological time, indicating that the amount of energy expenditure during each developmental stage is constant over the optimal temperature range. (paper)

  11. Temperature-independent energy expenditure in early development of the African clawed frog Xenopus laevis.

    Science.gov (United States)

    Nagano, Yatsuhisa; Ode, Koji L

    2014-08-01

    The thermal dissipation of activated eggs and embryos undergoing development from cleavage to the tailbud stage of the African clawed frog Xenopus laevis was measured as a function of incubation time at temperatures ranging from T = 288.2 K to 295.2 K, using a high-precision isothermal calorimeter. A23187-mediated activation of mature eggs induced stable periodic thermal oscillations lasting for 8-34 h. The frequency agreed well with the cell cycle frequency of initial cleavages at the identical temperature. In the developing embryo, energy metabolism switches from embryonic to adult features during gastrulation. The thermal dissipation after gastrulation fit well with a single modified Avrami equation, which has been used for modeling crystal-growth. Both the oscillation frequency of the activated egg and the growth rate of the embryo strongly depend on temperature with the same apparent activation energy of approximately 87 kJ mole(-1). This result suggests that early development proceeds as a single biological time, attributable to a single metabolic rate. A temperature-independent growth curve was derived by scaling the thermogram to the biological time, indicating that the amount of energy expenditure during each developmental stage is constant over the optimal temperature range. PMID:25078857

  12. Temperature-independent energy expenditure in early development of the African clawed frog Xenopus laevis

    Science.gov (United States)

    Nagano, Yatsuhisa; Ode, Koji L.

    2014-08-01

    The thermal dissipation of activated eggs and embryos undergoing development from cleavage to the tailbud stage of the African clawed frog Xenopus laevis was measured as a function of incubation time at temperatures ranging from T = 288.2 K to 295.2 K, using a high-precision isothermal calorimeter. A23187-mediated activation of mature eggs induced stable periodic thermal oscillations lasting for 8-34 h. The frequency agreed well with the cell cycle frequency of initial cleavages at the identical temperature. In the developing embryo, energy metabolism switches from embryonic to adult features during gastrulation. The thermal dissipation after gastrulation fit well with a single modified Avrami equation, which has been used for modeling crystal-growth. Both the oscillation frequency of the activated egg and the growth rate of the embryo strongly depend on temperature with the same apparent activation energy of approximately 87 kJ mole-1. This result suggests that early development proceeds as a single biological time, attributable to a single metabolic rate. A temperature-independent growth curve was derived by scaling the thermogram to the biological time, indicating that the amount of energy expenditure during each developmental stage is constant over the optimal temperature range.

  13. Impacts of Climate Change on the Global Invasion Potential of the African Clawed Frog Xenopus laevis

    Science.gov (United States)

    Ihlow, Flora; Courant, Julien; Secondi, Jean; Herrel, Anthony; Rebelo, Rui; Measey, G. John; Lillo, Francesco; De Villiers, F. André; Vogt, Solveig; De Busschere, Charlotte; Backeljau, Thierry; Rödder, Dennis

    2016-01-01

    By altering or eliminating delicate ecological relationships, non-indigenous species are considered a major threat to biodiversity, as well as a driver of environmental change. Global climate change affects ecosystems and ecological communities, leading to changes in the phenology, geographic ranges, or population abundance of several species. Thus, predicting the impacts of global climate change on the current and future distribution of invasive species is an important subject in macroecological studies. The African clawed frog (Xenopus laevis), native to South Africa, possesses a strong invasion potential and populations have become established in numerous countries across four continents. The global invasion potential of X. laevis was assessed using correlative species distribution models (SDMs). SDMs were computed based on a comprehensive set of occurrence records covering South Africa, North America, South America and Europe and a set of nine environmental predictors. Models were built using both a maximum entropy model and an ensemble approach integrating eight algorithms. The future occurrence probabilities for X. laevis were subsequently computed using bioclimatic variables for 2070 following four different IPCC scenarios. Despite minor differences between the statistical approaches, both SDMs predict the future potential distribution of X. laevis, on a global scale, to decrease across all climate change scenarios. On a continental scale, both SDMs predict decreasing potential distributions in the species’ native range in South Africa, as well as in the invaded areas in North and South America, and in Australia where the species has not been introduced. In contrast, both SDMs predict the potential range size to expand in Europe. Our results suggest that all probability classes will be equally affected by climate change. New regional conditions may promote new invasions or the spread of established invasive populations, especially in France and Great

  14. Dehydration mediated microRNA response in the African clawed frog Xenopus laevis.

    Science.gov (United States)

    Wu, Cheng-Wei; Biggar, Kyle K; Storey, Kenneth B

    2013-10-25

    Exposure to various environmental stresses induces metabolic rate depression in many animal species, an adaptation that conserves energy until the environment is again conducive to normal life. The African clawed frog, Xenopus laevis, is periodically subjected to arid summers in South Africa, and utilizes entry into the hypometabolic state of estivation as a mechanism of long term survival. During estivation, frogs must typically deal with substantial dehydration as their ponds dry out and X. laevis can endure >30% loss of its body water. We hypothesize that microRNAs play a vital role in establishing a reversible hypometabolic state and responding to dehydration stress that is associated with amphibian estivation. The present study analyzes the effects of whole body dehydration on microRNA expression in three tissues of X. laevis. Compared to controls, levels of miR-1, miR-125b, and miR-16-1 decreased to 37±6, 64±8, and 80±4% of control levels during dehydration in liver. By contrast, miR-210, miR-34a and miR-21 were significantly elevated by 3.05±0.45, 2.11±0.08, and 1.36±0.05-fold, respectively, in the liver. In kidney tissue, miR-29b, miR-21, and miR-203 were elevated by 1.40±0.09, 1.31±0.05, and 2.17±0.31-fold, respectively, in response to dehydration whereas miR-203 and miR-34a were elevated in ventral skin by 1.35±0.05 and 1.74±0.12-fold, respectively. Bioinformatic analysis of the differentially expressed microRNAs suggests that these are mainly involved in two processes: (1) expression of solute carrier proteins, and (2) regulation of mitogen-activated protein kinase signaling. This study is the first report that shows a tissue specific mode of microRNA expression during amphibian dehydration, providing evidence for microRNAs as crucial regulators of metabolic depression. PMID:23958654

  15. Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis), with the Finding of IL-19/20 Homologue in the IL-10 Locus

    OpenAIRE

    Zhitao Qi; Qihuan Zhang; Zisheng Wang; Weihong Zhao; Qian Gao

    2015-01-01

    Interleukin-10 (IL-10) is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis) was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-...

  16. Eugenol Anesthesia in African Clawed Frogs (Xenopus laevis) of Different Body Weights

    OpenAIRE

    Goulet, Félix; Hélie, Pierre; Vachon, Pascal

    2010-01-01

    The objective of this prospective study was to determine the duration of anesthesia in Xenopus laevis frogs of different body weights relative to exposure time in a eugenol (350 µL/L) bath. Two groups of 5 female frogs each weighing 7.5 ± 2.1 g (small frogs) or 29.2 ± 7.4 g (medium frogs) were used. The acetic acid test (AAT), withdrawal reflex, righting reflex, heart rate, and blood oxygen saturation were used to evaluate CNS depression after eugenol bath administration. No responses to the ...

  17. Diagnosis of Aeromonas hydrophila, Mycobacterium species, and Batrachochytrium dendrobatidis in an African Clawed Frog (Xenopus laevis)

    OpenAIRE

    Hill, William A; Newman, Shelley J; Craig, Linden; Carter, Christopher; Czarra, Jane; Brown, J Paige

    2010-01-01

    Here we describe diagnosis of concurrent infection with Aeromonas hydrophila, Mycobacterium spp., and Batrachochytrium dendrobatidis in a wild female Xenopus laevis captured in Chile and transported to the United States. After approximately 130 d in the laboratory, the frog was presented for dysecdysis and obtundation. After euthanasia, tissues were submitted for histopathologic evaluation and PCR analysis for B. dendrobatidis and Ranavirus. Clinically significant gross lesions included cutan...

  18. The Genome of the Western Clawed Frog Xenopus tropicalis

    Energy Technology Data Exchange (ETDEWEB)

    Hellsten, Uffe; Harland, Richard M.; Gilchrist, Michael J.; Hendrix, David; Jurka, Jerzy; Kapitonov, Vladimir; Ovcharenko, Ivan; Putnam, Nicholas H.; Shu, Shengqiang; Taher, Leila; Blitz, Ira L.; Blumberg, Bruce; Dichmann, Darwin S.; Dubchak, Inna; Amaya, Enrique; Detter, John C.; Fletcher, Russell; Gerhard, Daniela S.; Goodstein, David; Graves, Tina; Grigoriev, Igor V.; Grimwood, Jane; Kawashima, Takeshi; Lindquist, Erika; Lucas, Susan M.; Mead, Paul E.; Mitros, Therese; Ogino, Hajime; Ohta, Yuko; Poliakov, Alexander V.; Pollet, Nicolas; Robert, Jacques; Salamov, Asaf; Sater, Amy K.; Schmutz, Jeremy; Terry, Astrid; Vize, Peter D.; Warren, Wesley C.; Wells, Dan; Wills, Andrea; Wilson, Richard K.; Zimmerman, Lyle B.; Zorn, Aaron M.; Grainger, Robert; Grammer, Timothy; Khokha, Mustafa K.; Richardson, Paul M.; Rokhsar, Daniel S.

    2009-10-01

    The western clawed frog Xenopus tropicalis is an important model for vertebrate development that combines experimental advantages of the African clawed frog Xenopus laevis with more tractable genetics. Here we present a draft genome sequence assembly of X. tropicalis. This genome encodes over 20,000 protein-coding genes, including orthologs of at least 1,700 human disease genes. Over a million expressed sequence tags validated the annotation. More than one-third of the genome consists of transposable elements, with unusually prevalent DNA transposons. Like other tetrapods, the genome contains gene deserts enriched for conserved non-coding elements. The genome exhibits remarkable shared synteny with human and chicken over major parts of large chromosomes, broken by lineage-specific chromosome fusions and fissions, mainly in the mammalian lineage.

  19. Genetics, Morphology, Advertisement Calls, and Historical Records Distinguish Six New Polyploid Species of African Clawed Frog (Xenopus, Pipidae from West and Central Africa.

    Directory of Open Access Journals (Sweden)

    Ben J Evans

    Full Text Available African clawed frogs, genus Xenopus, are extraordinary among vertebrates in the diversity of their polyploid species and the high number of independent polyploidization events that occurred during their diversification. Here we update current understanding of the evolutionary history of this group and describe six new species from west and central sub-Saharan Africa, including four tetraploids and two dodecaploids. We provide information on molecular variation, morphology, karyotypes, vocalizations, and estimated geographic ranges, which support the distinctiveness of these new species. We resurrect Xenopus calcaratus from synonymy of Xenopus tropicalis and refer populations from Bioko Island and coastal Cameroon (near Mt. Cameroon to this species. To facilitate comparisons to the new species, we also provide comments on the type specimens, morphology, and distributions of X. epitropicalis, X. tropicalis, and X. fraseri. This includes significantly restricted application of the names X. fraseri and X. epitropicalis, the first of which we argue is known definitively only from type specimens and possibly one other specimen. Inferring the evolutionary histories of these new species allows refinement of species groups within Xenopus and leads to our recognition of two subgenera (Xenopus and Silurana and three species groups within the subgenus Xenopus (amieti, laevis, and muelleri species groups.

  20. Effects of cadmium on growth, metamorphosis and gonadal sex differentiation in tadpoles of the African clawed frog, Xenopus laevis

    Science.gov (United States)

    Sharma, Bibek; Patino, Reynaldo

    2009-01-01

    Xenopus laevis larvae were exposed to cadmium (Cd) at 0, 1, 8. 85 or 860 mu g L(-1) in FETAX medium from 0 to 86 d postfertilization. Premetamorphic tadpoles were sampled on day 3 1; pre and prometamorphic tadpoles on day 49; and frogs (NF stage 66) between days 50 and 86. Survival, snout-vent length (SVL), tail length, total length, hindlimb length (HLL), initiation of metamorphic climax, size at and completion of metamorphosis, and gonadal condition and sex ratio (assessed histologically) were determined. Survival was unaffected by Cd until day 49, but increased mortality was observed after day 49 at 860 mu g Cd L(-1). On day 31, when tadpoles were in early premetamorphosis, inhibitory effects on tadpole growth were observed only at 860 mu g Cd L(-1). On day 49, when most tadpoles where in late premetamorphosis/early prometamorphosis, reductions in SVL, HLL and total length were observed at 8 and 860 but not 85 mu g L(-1), thus creating a U-shaped size distribution at 0-85 mu g Cd L(-1). However, this U-shaped size pattern was not evident in postmetamorphic individuals. In fact, frog size at completion of metamorphosis was slightly smaller at 85 mu g Cd L(-1) relative to control animals. These observations confirmed a recent report of a Cd concentration-dependent bimodal growth pattern in late-premetamorphic Xenopus tadpoles, but also showed that growth responses to varying Cd concentrations change with development. The fraction of animals initiating or completing metamorphosis during days 50-86 was reduced in a Cd concentration-dependent manner. Testicular histology and population sex ratios were unaffected by Cd suggesting that, unlike mammals, Cd is not strongly estrogenic in Xenopus tadpoles.

  1. Connexins in the early development of the African clawed frog Xenopus laevis (Amphibia: The role of the connexin43 carboxyl terminal tail in the establishment of the dorso-ventral axis

    Directory of Open Access Journals (Sweden)

    Jaime Cofre

    2007-03-01

    Full Text Available Connexins are a family of related proteins identified in vertebrate forming gap junctions, which mediate cell-to-cell communication in early embryos, with an important role in establishing embryonic asymmetry and ‘communication compartments’. By in situ hybridization, immunocytochemistry, reverse transcriptase PCR (RT-PCR and western blotting we show that a Cx43-like molecule is present in oocytes and embryos of the African clawed frog Xenopus laevis, with specific localization in the animal-vegetal axis. This specific distribution is suggestive for an important role for this protein in the establishment of the dorso-ventral axis. Antisense RNA and antibodies directed against rat carboxyl terminal tail of the Cx43 (CT-Cx43 and injected in 1-cell stage Xenopus embryos, induced pronounced alterations in nervous system development, with a severe ventralization phenotype. Coherently, the overexpression of CT-Cx43 produced a dorsalization of the embryos. In antisense treated embryos, the expression of the beta-catenin gene is eliminated from the Nieuwkoop center, the pattern expression of the Chordin, Xnot and Xbra is modified, with no effect in expression of the Goosecoid gene. In CT-Cx43 mRNA treated embryos the pattern of expression of the beta-catenin, Chordin, Goosecoid, Xnot and engrailed-2 genes is modified. The expression of beta-catenin is increased in the Nieuwkoop center, the expression pattern of Chordin and Goosecoid is expanded to the posterior neural plate and engrailed-2 presents ectopic expression in the ventral region. Taken together our data suggest a role for CT-Cx43 as a maternal determinant with a critical function in the formation of the dorso-ventral axis in Xenopus laevis. The Cx43 may be one of the earliest markers of the dorso-ventral axis in these embryos and could possibly be acting through regionalization of factors responsible for the establishment of this axis.

  2. Evolution of vertebrate transient receptor potential vanilloid 3 channels: opposite temperature sensitivity between mammals and western clawed frogs.

    Directory of Open Access Journals (Sweden)

    Shigeru Saito

    2011-04-01

    Full Text Available Transient Receptor Potential (TRP channels serve as temperature receptors in a wide variety of animals and must have played crucial roles in thermal adaptation. The TRP vanilloid (TRPV subfamily contains several temperature receptors with different temperature sensitivities. The TRPV3 channel is known to be highly expressed in skin, where it is activated by warm temperatures and serves as a sensor to detect ambient temperatures near the body temperature of homeothermic animals such as mammals. Here we performed comprehensive comparative analyses of the TRPV subfamily in order to understand the evolutionary process; we identified novel TRPV genes and also characterized the evolutionary flexibility of TRPV3 during vertebrate evolution. We cloned the TRPV3 channel from the western clawed frog Xenopus tropicalis to understand the functional evolution of the TRPV3 channel. The amino acid sequences of the N- and C-terminal regions of the TRPV3 channel were highly diversified from those of other terrestrial vertebrate TRPV3 channels, although central portions were well conserved. In a heterologous expression system, several mammalian TRPV3 agonists did not activate the TRPV3 channel of the western clawed frog. Moreover, the frog TRPV3 channel did not respond to heat stimuli, instead it was activated by cold temperatures. Temperature thresholds for activation were about 16 °C, slightly below the lower temperature limit for the western clawed frog. Given that the TRPV3 channel is expressed in skin, its likely role is to detect noxious cold temperatures. Thus, the western clawed frog and mammals acquired opposite temperature sensitivity of the TRPV3 channel in order to detect environmental temperatures suitable for their respective species, indicating that temperature receptors can dynamically change properties to adapt to different thermal environments during evolution.

  3. Transcriptomic Responses During Early Development Following Arsenic Exposure in Western Clawed Frogs, Silurana tropicalis.

    Science.gov (United States)

    Zhang, Jing; Koch, Iris; Gibson, Laura A; Loughery, Jennifer R; Martyniuk, Christopher J; Button, Mark; Caumette, Guilhem; Reimer, Kenneth J; Cullen, William R; Langlois, Valerie S

    2015-12-01

    Arsenic compounds are widespread environmental contaminants and exposure elicits serious health issues, including early developmental anomalies. Depending on the oxidation state, the intermediates of arsenic metabolism interfere with a range of subcellular events, but the fundamental molecular events that lead to speciation-dependent arsenic toxicity are not fully elucidated. This study therefore assesses the impact of arsenic exposure on early development by measuring speciation and gene expression profiles in the developing Western clawed frog (Silurana tropicalis) larvae following the environmental relevant 0.5 and 1 ppm arsenate exposure. Using HPLC-ICP-MS, arsenate, dimethylarsenic acid, arsenobetaine, arsenocholine, and tetramethylarsonium ion were detected. Microarray and pathway analyses were utilized to characterize the comprehensive transcriptomic responses to arsenic exposure. Clustering analysis of expression data showed distinct gene expression patterns in arsenate treated groups when compared with the control. Pathway enrichment revealed common biological themes enriched in both treatments, including cell signal transduction, cell survival, and developmental pathways. Moreover, the 0.5 ppm exposure led to the enrichment of pathways and biological processes involved in arsenic intake or efflux, as well as histone remodeling. These compensatory responses are hypothesized to be responsible for maintaining an in-body arsenic level comparable to control animals. With no appreciable changes observed in malformation and mortality between control and exposed larvae, this is the first study to suggest that the underlying transcriptomic regulations related to signal transduction, cell survival, developmental pathways, and histone remodeling may contribute to maintaining ongoing development while coping with the potential arsenic toxicity in S. tropicalis during early development. PMID:26427749

  4. Taxonomy Icon Data: African clawed frog [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available g Xenopus_laevis_NL.png Xenopus_laevis_S.png Xenopus_laevis_NS.png http://biosciencedbc.jp/taxonomy_icon/ico...n.cgi?i=Xenopus+laevis&t=L http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Xenopus+laevis&t=NL http://biosciencedbc.jp/taxonomy..._icon/icon.cgi?i=Xenopus+laevis&t=S http://biosciencedbc.jp/taxonomy..._icon/icon.cgi?i=Xenopus+laevis&t=NS http://togodb.biosciencedbc.jp/togodb/view/taxonomy_icon_comment_en?species_id=11 ...

  5. Chytridiomycosis in dwarf African frogs Hymenochirus curtipes.

    Science.gov (United States)

    Murphy, B G; Hillman, C; Groff, J M

    2015-05-11

    Chytridiomycosis, resulting from an infection with the fungal agent Batrachochytrium dendrobatidis (Bd), has resulted in widespread population declines in both wild and captive amphibians. The dwarf African frog (DAF) Hymenochirus curtipes is native to central Africa and is commonly sold throughout North America as an aquarium pet species. Here we document fatal chytridiomycosis resulting from cutaneous Bd infections in DAF purchased directly from a pet store and from a historical lethal epizootic occurring at an aquaculture facility in central California, USA, more than 25 yr ago. Histological lesions and PCR-amplified sequence data were consistent with the etiology of Bd. The potential epidemiological relevance of this infection in DAF is discussed. PMID:25958807

  6. The hymenochirins: a family of host-defense peptides from the Congo dwarf clawed frog Hymenochirus boettgeri (Pipidae).

    Science.gov (United States)

    Mechkarska, Milena; Prajeep, Manju; Coquet, Laurent; Leprince, Jérôme; Jouenne, Thierry; Vaudry, Hubert; King, Jay D; Conlon, J Michael

    2012-06-01

    Skin secretions of frogs from the subfamily Xenopodinae (Xenopus+Silurana) within the family Pipidae are a rich source of antimicrobial peptides with therapeutic potential but species from the sister taxon Hymenochirus in the subfamily Pipinae (Hymenochirus+Pseudhymenochirus+Pipa) have not been investigated. Peptidomic analysis of norepinephrine-stimulated skin secretions from two distinct populations of the Congo dwarf clawed frog Hymenochirus boettgeri (Tornier, 1896) has led to identification of five structurally related peptides with broad-spectrum antimicrobial activity. Hymenochirin-1B (IKLSPETKDNLKKVLKGAIKGAIAVAKMV.NH(2)) is C-terminally α-amidated whereas hymenochirins-2B-5B have the general structure XKIPX(2)VKDTLKKVAKGX(2)SX(2)AGAX(3).COOH. Hymenochirin-3B (IKIPAVVKDTLKKVAKGVLSAVAGALTQ) was the most abundant peptide in the secretions. The hymenochirins show very low structural similarity with the antimicrobial peptides isolated from skin secretions of Silurana tropicalis and Xenopus laevis consistent with the proposed ancient divergence of the Pipinae and Xenopodinae. Synthetic replicates of hymenochirin-1B-4B inhibit the growth of Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, and Staphylococcus aureus (MIC in the range 10-40 μM) and Candida albicans (MIC=80 μM). The peptides display relatively weak hemolytic activity against human erythrocytes (LC(50) in the range 160 to >300 μM). PMID:22497805

  7. Pan-African phylogeography of a model organism, the African clawed frog "Xenopus laevis"

    Czech Academy of Sciences Publication Activity Database

    Furman, B. L. S.; Bewick, A. J.; Harrison, T. L.; Greenbaum, E.; Gvoždík, Václav; Kusamba, C.; Evans, B. J.

    2015-01-01

    Roč. 24, č. 4 (2015), s. 909-925. ISSN 0962-1083 Institutional support: RVO:68081766 Keywords : gene flow * phylogeography * population genetics * species limits Subject RIV: EG - Zoology Impact factor: 6.494, year: 2014

  8. Metabolic cost of osmoregulation in a hypertonic environment in the invasive African clawed frog Xenopus laevis.

    Science.gov (United States)

    Peña-Villalobos, Isaac; Narváez, Cristóbal; Sabat, Pablo

    2016-01-01

    Studies of aquatic invertebrates reveal that salinity affects feeding and growth rates, reproduction, survival, and diversity. Little is known, however, about how salinity impacts the energy budget of vertebrates and amphibians in particular. The few studies focused on this topic in vertebrates suggest that the ingestion of salts and the resulting osmoregulatory activity is energetically expensive. We analyzed the effect of saline acclimation on standard metabolic rates (SMR) and the activities of metabolic enzymes of internal organs and osmoregulatory variables (plasma osmolality and urea plasma level) in females of Xenopus laevis by means of acclimating individuals to an isosmotic (235 mOsm NaCl; ISO group) and hyper-osmotic (340 mOsm NaCl; HYP group) environment for 40 days. After acclimation, we found that total and mass-specific SMR was approximately 80% higher in the HYP group than those found in the ISO group. These changes were accompanied by higher citrate synthase activities in liver and heart in the HYP group than in the ISO group. Furthermore, we found a significant and positive correlation between metabolic rates and plasma urea, and citrate synthase activity in liver and heart. These results support the notion that the cost of osmoregulation is probably common in most animal species and suggest the existence of a functional association between metabolic rates and the adjustments in osmoregulatory physiology, such as blood distribution and urea synthesis. PMID:27334694

  9. Metamorphic remodeling of the olfactory organ of the African clawed frog, Xenopus laevis.

    Science.gov (United States)

    Dittrich, Katarina; Kuttler, Josua; Hassenklöver, Thomas; Manzini, Ivan

    2016-04-01

    The amphibian olfactory system undergoes massive remodeling during metamorphosis. The transition from aquatic olfaction in larvae to semiaquatic or airborne olfaction in adults requires anatomical, cellular, and molecular modifications. These changes are particularly pronounced in Pipidae, whose adults have secondarily adapted to an aquatic life style. In the fully aquatic larvae of Xenopus laevis, the main olfactory epithelium specialized for sensing water-borne odorous substances lines the principal olfactory cavity (PC), whereas a separate olfactory epithelium lies in the vomeronasal organ (VNO). During metamorphosis, the epithelium of the PC is rearranged into the adult "air nose," whereas a new olfactory epithelium, the adult "water nose," forms in the emerging middle cavity (MC). Here we performed a stage-by-stage investigation of the anatomical changes of the Xenopus olfactory organ during metamorphosis. We quantified cell death in all olfactory epithelia and found massive cell death in the PC and the VNO, suggesting that the majority of larval sensory neurons is replaced during metamorphosis in both sensory epithelia. The moderate cell death in the MC shows that during the formation of this epithelium some cells are sorted out. Our results show that during MC formation some supporting cells, but not sensory neurons, are relocated from the PC to the MC and that they are eventually eliminated during metamorphosis. Together our findings illustrate the structural and cellular changes of the Xenopus olfactory organ during metamorphosis. PMID:26294036

  10. Cat's Claw

    Science.gov (United States)

    ... R S T U V W X Y Z Cat's Claw Share: On This Page Introduction What the ... More Information Key References © Steven Foster Common Names: cat’s claw, uña de gato Latin Name: Uncaria tomentosa, ...

  11. Hermaphroditic, demasculinized frogs after exposure to the herbicide atrazine at low ecologically relevant doses

    OpenAIRE

    Hayes, Tyrone B.; Collins, Atif; Lee, Melissa; Mendoza, Magdelena; Noriega, Nigel; Stuart, A. Ali; Vonk, Aaron

    2002-01-01

    Atrazine is the most commonly used herbicide in the U.S. and probably the world. It can be present at several parts per million in agricultural runoff and can reach 40 parts per billion (ppb) in precipitation. We examined the effects of atrazine on sexual development in African clawed frogs (Xenopus laevis). Larvae were exposed to atrazine (0.01–200 ppb) by immersion throughout larval development, and we examined gonadal histology and laryngeal size at metamorphosis. Atra...

  12. Dramatic Declines of Montane Frogs in a Central African Biodiversity Hotspot

    Science.gov (United States)

    Hirschfeld, Mareike; Blackburn, David C.; Doherty-Bone, Thomas M.; Gonwouo, LeGrand Nono; Ghose, Sonia; Rödel, Mark-Oliver

    2016-01-01

    Amphibian populations are vanishing worldwide. Declines and extinctions of many populations have been attributed to chytridiomycosis, a disease induced by the pathogenic fungus Batrachochytrium dendrobatidis (Bd). In Africa, however, changes in amphibian assemblages were typically attributed to habitat change. We conducted a retrospective study utilizing field surveys from 2004–2012 of the anuran faunas on two mountains in western Cameroon, a hotspot of African amphibian diversity. The number of species detected was negatively influenced by year, habitat degradation, and elevation, and we detected a decline of certain species. Because another study in this region revealed an emergence of Bd in 2008, we screened additional recent field-collected samples and also pre-decline preserved museum specimens for the presence of Bd supporting emergence before 2008. When comparing the years before and after Bd detection, we found significantly diminished frog species richness and abundance on both mountains after Bd emergence. Our analyses suggest that this may be the first disease-driven community-level decline in anuran biodiversity in Central Africa. The disappearance of several species known to tolerate habitat degradation, and a trend of stronger declines at higher elevations, are consistent with Bd-induced declines in other regions. Not all species decreased; populations of some species remained constant, and others increased after the emergence of Bd. This variation might be explained by species-specific differences in infection probability. Increased habitat protection and Bd-mitigation strategies are needed for sustaining diverse amphibian communities such as those on Mt. Manengouba, which contains nearly half of Cameroon’s frog diversity. PMID:27149624

  13. Dramatic Declines of Montane Frogs in a Central African Biodiversity Hotspot.

    Directory of Open Access Journals (Sweden)

    Mareike Hirschfeld

    Full Text Available Amphibian populations are vanishing worldwide. Declines and extinctions of many populations have been attributed to chytridiomycosis, a disease induced by the pathogenic fungus Batrachochytrium dendrobatidis (Bd. In Africa, however, changes in amphibian assemblages were typically attributed to habitat change. We conducted a retrospective study utilizing field surveys from 2004-2012 of the anuran faunas on two mountains in western Cameroon, a hotspot of African amphibian diversity. The number of species detected was negatively influenced by year, habitat degradation, and elevation, and we detected a decline of certain species. Because another study in this region revealed an emergence of Bd in 2008, we screened additional recent field-collected samples and also pre-decline preserved museum specimens for the presence of Bd supporting emergence before 2008. When comparing the years before and after Bd detection, we found significantly diminished frog species richness and abundance on both mountains after Bd emergence. Our analyses suggest that this may be the first disease-driven community-level decline in anuran biodiversity in Central Africa. The disappearance of several species known to tolerate habitat degradation, and a trend of stronger declines at higher elevations, are consistent with Bd-induced declines in other regions. Not all species decreased; populations of some species remained constant, and others increased after the emergence of Bd. This variation might be explained by species-specific differences in infection probability. Increased habitat protection and Bd-mitigation strategies are needed for sustaining diverse amphibian communities such as those on Mt. Manengouba, which contains nearly half of Cameroon's frog diversity.

  14. Dramatic Declines of Montane Frogs in a Central African Biodiversity Hotspot.

    Science.gov (United States)

    Hirschfeld, Mareike; Blackburn, David C; Doherty-Bone, Thomas M; Gonwouo, LeGrand Nono; Ghose, Sonia; Rödel, Mark-Oliver

    2016-01-01

    Amphibian populations are vanishing worldwide. Declines and extinctions of many populations have been attributed to chytridiomycosis, a disease induced by the pathogenic fungus Batrachochytrium dendrobatidis (Bd). In Africa, however, changes in amphibian assemblages were typically attributed to habitat change. We conducted a retrospective study utilizing field surveys from 2004-2012 of the anuran faunas on two mountains in western Cameroon, a hotspot of African amphibian diversity. The number of species detected was negatively influenced by year, habitat degradation, and elevation, and we detected a decline of certain species. Because another study in this region revealed an emergence of Bd in 2008, we screened additional recent field-collected samples and also pre-decline preserved museum specimens for the presence of Bd supporting emergence before 2008. When comparing the years before and after Bd detection, we found significantly diminished frog species richness and abundance on both mountains after Bd emergence. Our analyses suggest that this may be the first disease-driven community-level decline in anuran biodiversity in Central Africa. The disappearance of several species known to tolerate habitat degradation, and a trend of stronger declines at higher elevations, are consistent with Bd-induced declines in other regions. Not all species decreased; populations of some species remained constant, and others increased after the emergence of Bd. This variation might be explained by species-specific differences in infection probability. Increased habitat protection and Bd-mitigation strategies are needed for sustaining diverse amphibian communities such as those on Mt. Manengouba, which contains nearly half of Cameroon's frog diversity. PMID:27149624

  15. Frogs and climate change in South Africa

    OpenAIRE

    Minter, Leslie Rory

    2011-01-01

    This article explores the relationship between frog declines and climate change, discusses the possible impact of climate change on the South African frog fauna, and highlights the necessity for increased research and monitoring of our frog populations.

  16. Host-defense peptides from skin secretions of Fraser's clawed frog Xenopus fraseri (Pipidae): Further insight into the evolutionary history of the Xenopodinae.

    Science.gov (United States)

    Conlon, J Michael; Mechkarska, Milena; Kolodziejek, Jolanta; Nowotny, Norbert; Coquet, Laurent; Leprince, Jérôme; Jouenne, Thierry; Vaudry, Hubert

    2014-12-01

    Peptidomic analysis of norepinephrine-stimulated skin secretions of the tetraploid frog Xenopus fraseri Boulenger, 1905 (Pipidae) led to identification of 13 host-defense peptides. The primary structures of the peptides demonstrate that they belong to the magainin (3 peptides), peptide glycine-leucine-amide, PGLa (4 peptides), and xenopsin-precursor fragment, XPF (2 peptides) families, first identified in Xenopus laevis, together with caerulein precursor fragment-related peptides, CPF-RP (4 peptides), first identified in Silurana tropicalis. In addition, the secretions contain a molecular variant of xenopsin displaying the substitution Arg(4)→Lys compared with X. laevis xenopsin and peptide glycine-tyrosine-amide (PGYa) (GRIIPIYPEFERVFA KKVYPLY.NH2) whose function is unknown. The most potent antimicrobial peptide identified is CPF-RP-F1 (GFGSVLGKALKFGANLL.NH2) with MIC=12.5μM against Staphylococcus aureus and 50μM against Escherichia coli. On the basis of similarities in morphology and advertisement calls, X. fraseri has been placed in a species group that includes the octoploids Xenopus amieti and Xenopus andrei, and the tetraploid Xenopus pygmaeus. Cladistic analyses based upon the primary structures of magainin, PGLa, and CPF-RP peptides support a close evolutionary relationship between X. fraseri, X. amieti and X. andrei but suggest a more distant relationship with X. pygmaeus. PMID:25463057

  17. Characterization of the host-defense peptides from skin secretions of Merlin's clawed frog Pseudhymenochirus merlini: insights into phylogenetic relationships among the Pipidae.

    Science.gov (United States)

    Conlon, J Michael; Prajeep, Manju; Mechkarska, Milena; Coquet, Laurent; Leprince, Jérôme; Jouenne, Thierry; Vaudry, Hubert; King, Jay D

    2013-12-01

    The family Pipidae comprises the genera Hymenochirus, Pipa, Pseudhymenochirus, Silurana, and Xenopus but phylogenetic relationships within the family are unclear. Peptidomic analysis of norepinephrine-stimulated skin secretions from Pseudhymenochirus merlini Chabanaud, 1920, the single species within the genus Pseudhymenochirus, led to identification of 13 host-defense peptides with antimicrobial activity. Two peptides (hymenochirin-1Pa and -1Pb) show structural similarity to hymenochirin-1B from Hymenochirus boettgeri and eight peptides (hymenochirin-5Pa, -5Pb, -5Pc, -5Pd, -5Pe, -5Pf, 5Pg and -5Ph) are structurally similar to each other and to hymenochirin-5B from H. boettgeri. Two peptides differing by a single amino acid (IKIPSFFRNILKKVGKEAVSLM/I AGALKQS), termed pseudhymenochirin-1Pa and -1Pb, and pseudhymenochirin-2Pa (GIFPIFAKLLGKVIKVASSLISKGRTE) do not resemble host-defense peptides previously isolated from pipid frogs. Hymenochirin-5Pe was the most abundant peptide in the secretions and hymenochirin-1Pa the most potent against Staphylococcus aureus (MIC=2.5μM) and Escherichia coli (MIC=10μM). The data support a close phylogenetic relationship between Hymenochirus and Pseudhymenochirus that is distinct from the Xenopodinae (Xenopus+Silurana) clade with Pipa sister-group to all other extant pipids. PMID:24212286

  18. Accelerated Gene Evolution and Subfunctionalization in thePseudotetraploid Frog Xenopus Laevis

    Energy Technology Data Exchange (ETDEWEB)

    Hellsten, Uffe; Khokha, Mustafa K.; Grammar, Timothy C.; Harland,Richard M.; Richardson, Paul; Rokhsar, Daniel S.

    2007-03-01

    Ancient whole genome duplications have been implicated in the vertebrate and teleost radiations, and in the emergence of diverse angiosperm lineages, but the evolutionary response to such a perturbation is still poorly understood. The African clawed frog Xenopus laevis experienced a relatively recent tetraploidization {approx} 40 million years ago. Analysis of the considerable amount of EST sequence available for this species together with the genome sequence of the related diploid Xenopus tropicalis provides a unique opportunity to study the genomic response to whole genome duplication.

  19. Effects of forest fragmentation and habitat degradation on West African leaf-litter frogs

    NARCIS (Netherlands)

    A. Hillers; M. Veith; M.-O. Rödel

    2008-01-01

    Habitat degradation alters the dynamics and composition of anuran assemblages in tropical forests. The effects of forest fragmentation on the composition of anuran assemblages are so far poorly known. We studied the joint influence of forest fragmentation and degradation on leaf-litter frogs. We spe

  20. Evolutionary history of the river frog genus Amietia (Anura: Pyxicephalidae) reveals extensive diversification in Central African highlands.

    Science.gov (United States)

    Larson, Thornton R; Castro, Delilah; Behangana, Mathias; Greenbaum, Eli

    2016-06-01

    The African river frog genus Amietia is found near rivers and other lentic water sources throughout central, eastern, and southern Africa. Because the genus includes multiple morphologically conservative species, taxonomic studies of river frogs have been relatively limited. We sampled 79 individuals of Amietia from multiple localities in and near the Albertine Rift (AR) of Burundi, Democratic Republic of the Congo, and Uganda. We utilized single-gene (16S) and concatenated (12S, 16S, cyt b and RAG1) gene-tree analyses and coalescent species-tree analyses to construct phylogenetic trees. Two divergence dating approaches were used in BEAST, including secondary calibration points with 12S, 16S, cyt b and RAG1, and a molecular clock with the 12S, 16S, and cyt b genes. All analyses recovered Amietia as monophyletic with strong support, and revealed several well-supported cryptic lineages, which is consistent with other recent phylogeography studies of AR amphibians. Dating estimates were similar, and Amietia diversification is coincident with global cooling and aridification events in the Miocene and Pliocene, respectively. Our results suggest additional taxonomic work is needed to describe multiple new species of AR Amietia, some of which have limited geographic distributions that are likely to be of conservation concern. PMID:27026115

  1. Effects of temperature, density and food quality on larval growth and metamorphosis in the north African green frog Pelophylax saharicus.

    Science.gov (United States)

    Bellakhal, Meher; Neveu, André; Fartouna-Bellakhal, Mouna; Missaoui, Hechmi; Aleya, Lotfi

    2014-10-01

    The ectodermic status of Amphibians explains their heavy dependence at ambient temperatures and thus their sensitivity to global warming. Temperature is likely the main factor regulating their physiology by acting on the endocrine system, with consequences on development, growth and size at metamorphosis. All these parameters control survival in the wild and performances in raniculture. This study is, to our knowledge, the first report on the effects of temperature, density and protein level in food on the rearing of the North African green Frog Pelophylax saharicus. Results show that a temperature of 26 °C is optimal for maximum weight gain. The maximum metamorphosis rate is obtained between 24 and 26 °C. The highest yields occur at low densities from 1 to 10 tadpolesl(-1). The best survival rate and accelerated metamorphosis are obtained at a level of 35% protein in food whose impact on food intake and weight gain is low. The maximum weight attained by tadpoles at metamorphosis, however, is obtained with a level of 40% protein. These results justify examination of this species in the light of climate change and suggest new techniques for aquaculture. PMID:25436955

  2. Karyological and morphometric variation of the North African green frog Pelophylax saharicus (Anura in north-eastern Africa

    Directory of Open Access Journals (Sweden)

    Nabil AMOR, Sarra FARJALLAH, Slim BEN-YACOUB, Paolo MERELLA, Khaled SAID

    2010-12-01

    Full Text Available Morphometric variation of Pelophylax saharicus was analysed using univariate and multivariate statistics, with both traditional and geometric morphometrics, based on 148 specimens from four different geographical localities in Tunisia and Algeria. The results show the existence of three morphotypes in Tunisia and one in Algeria, and indicate a significant degree of variation in morphometric characters between regions. Specimens from the southernmost region have the smallest body size and the greatest morphometric divergence from other populations. This pattern of morphometric variation probably results from phenotypic plasticity in response to local environmental factors. The results of our chromosomal study (C-, Ag-NOR-, endonuclease digestion, DAPI, CMA3 and Q-banding reveal this species to exhibit the plesiomorphic Pelophylax karyotype of 2n = 26 biarmed chromosomes and NORs on the eleventh pair. Similarities and differences of the North African green frog are discussed in relation to the different forms of data collected (chromosomal, morphometric, ecological [Current Zoology 56 (6: 678–686, 2010].

  3. Lobster claw deformity.

    Science.gov (United States)

    Agrawal, Ashish; Agrawal, Rahul; Singh, Rajat; Agrawal, Romi; Agrawal, Seema

    2014-01-01

    Endogenous erythroid colony (EEC) syndrome comprise of three cardinal features, i.e. ectrodactyly, ectodermal dysplasia and cleft lip. EEC itself has three different forms. Ectrodactyly (absence of one or more digits) can be present with clefting in the proximal portion of hand or foot known as split hand foot malformation (SHFM) or lobster claw deformity. SHFM can be of four types depending upon the different responsible chromosomal loci. SHFM-4 can be present as pure limb malformation (non-syndromic form). In this article, describes a rare case report of lobster claw deformity patient. PMID:24992861

  4. Lobster claw deformity

    Directory of Open Access Journals (Sweden)

    Ashish Agrawal

    2014-01-01

    Full Text Available Endogenous erythroid colony (EEC syndrome comprise of three cardinal features, i.e. ectrodactyly, ectodermal dysplasia and cleft lip. EEC itself has three different forms. Ectrodactyly (absence of one or more digits can be present with clefting in the proximal portion of hand or foot known as split hand foot malformation (SHFM or lobster claw deformity. SHFM can be of four types depending upon the different responsible chromosomal loci. SHFM-4 can be present as pure limb malformation (non-syndromic form. In this article, describes a rare case report of lobster claw deformity patient.

  5. Genetics, morphology, advertisement calls, and historical records distinguish six new polyploid species of African clawed frog (Xenopus, Pipidae) from West and Central Africa

    Czech Academy of Sciences Publication Activity Database

    Evans, B. J.; Carter, T. F.; Greenbaum, E.; Gvoždík, Václav; Kelley, D. B.; McLaughlin, P. J.; Pauwels, O. S. G.; Portik, D. M.; Stanley, E. L.; Tinsley, R. C.; Tobias, M. L.; Blackburn, D. C.

    2015-01-01

    Roč. 10, č. 12 (2015), e0142823. E-ISSN 1932-6203 R&D Projects: GA ČR GJ15-13415Y Institutional support: RVO:68081766 Keywords : host-defense peptides * genus Xenopus * skin secretions * South Africa * evolutionary relationships * model organism Subject RIV: EG - Zoology Impact factor: 3.234, year: 2014

  6. Effects of cadmium, estradiol-17β and their interaction on gonadal condition and metamorphosis of male and female African clawed frog, Xenopus laevis

    Science.gov (United States)

    Sharma, Bibek; Patino, Reynaldo

    2010-01-01

    To assess interaction effects between cadmium (Cd, a putative xenoestrogen) and estradiol-17?? (E2) on sex differentiation and metamorphosis, Xenopus laevis were exposed to solvent-control (0.005% ethanol), Cd (10 ??g L-1), E2 (1 ??g L-1), or Cd and E2 (Cd + E2) in FETAX medium from fertilization to 75 d postfertilization. Each treatment was applied to four aquaria, each with 30 fertilized eggs. Mortality was recorded and animals were sampled as they completed metamorphosis (Nieuwkoop and Faber stage 66). Gonadal sex of individuals (including tadpoles ???NF stage 55 at day 75) was determined gross-morphologically and used to compute sex ratios. Time course and percent completion of metamorphosis, snout-vent length (SVL), hindlimb length (HLL) and weight were analyzed for each gender separately. Survival rates did not differ among treatments. The E2 and Cd + E2 treatments significantly skewed sex ratios towards females; however, no sex-ratio differences were observed between the control and Cd treatments or between the E2 and Cd + E2 treatments. Time course of metamorphosis was generally delayed and percent completion of metamorphosis was generally reduced in males and females exposed to Cd, E2 or their combination compared to control animals. In males, but not females, the effect of Cd + E2 was greater than that of individual chemicals. Weight at completion of metamorphosis was reduced only in females and only by the Cd + E2 treatment. In conclusion, although Cd at an environmentally relevant concentration did not exhibit direct or indirect feminizing effects in Xenopus tadpoles, the metal and E2 both had similar inhibitory effects on metamorphosis that were of greater magnitude in males than females.

  7. Effects of cadmium, estradiol-17beta and their interaction on gonadal condition and metamorphosis of male and female African clawed frog, Xenopus laevis

    Science.gov (United States)

    Sharma, Bibek; Patino, Reynaldo

    2010-01-01

    To assess interaction effects between cadmium (Cd, a putative xenoestrogen) and estradiol-17beta (E(2)) on sex differentiation and metamorphosis, Xenopus laevis were exposed to solvent-control (0.005% ethanol), Cd (10microgL(-1)), E(2) (1microgL(-1)), or Cd and E(2) (Cd+E(2)) in FETAX medium from fertilization to 75d postfertilization. Each treatment was applied to four aquaria, each with 30 fertilized eggs. Mortality was recorded and animals were sampled as they completed metamorphosis (Nieuwkoop and Faber stage 66). Gonadal sex of individuals (including >or= tadpoles NF stage 55 at day 75) was determined gross-morphologically and used to compute sex ratios. Time course and percent completion of metamorphosis, snout-vent length (SVL), hindlimb length (HLL) and weight were analyzed for each gender separately. Survival rates did not differ among treatments. The E(2) and Cd+E(2) treatments significantly skewed sex ratios towards females; however, no sex-ratio differences were observed between the control and Cd treatments or between the E(2) and Cd+E(2) treatments. Time course of metamorphosis was generally delayed and percent completion of metamorphosis was generally reduced in males and females exposed to Cd, E(2) or their combination compared to control animals. In males, but not females, the effect of Cd+E(2) was greater than that of individual chemicals. Weight at completion of metamorphosis was reduced only in females and only by the Cd+E(2) treatment. In conclusion, although Cd at an environmentally relevant concentration did not exhibit direct or indirect feminizing effects in Xenopus tadpoles, the metal and E(2) both had similar inhibitory effects on metamorphosis that were of greater magnitude in males than females.

  8. Lobster claw deformity

    OpenAIRE

    Ashish Agrawal; Rahul Agrawal; Rajat Singh; Romi Agrawal; Seema Agrawal

    2014-01-01

    Endogenous erythroid colony (EEC) syndrome comprise of three cardinal features, i.e. ectrodactyly, ectodermal dysplasia and cleft lip. EEC itself has three different forms. Ectrodactyly (absence of one or more digits) can be present with clefting in the proximal portion of hand or foot known as split hand foot malformation (SHFM) or lobster claw deformity. SHFM can be of four types depending upon the different responsible chromosomal loci. SHFM-4 can be present as pure limb malformation (non-...

  9. Clubbed fingers: the claws we lost?

    NARCIS (Netherlands)

    Brouwers, A.A.M.; Vermeij-Keers, C.; Zoelen, E.J.J. van; Gooren, L.J.G.

    2004-01-01

    Clubbed digits resemble the human embryonic fingers and toes, which took like the digits of a claw. Clubbed digits, thus, may represent the return of the embryonic claw and may even represent the claws man has lost during evolution, if ontogenesis realty recapitulates phylogenesis. We put forward th

  10. Diagnosis and management of canine claw diseases.

    Science.gov (United States)

    Mueller, R S

    1999-11-01

    The diagnostic workup for canine claw disease consists of a good history and complete clinical examination which may provide clues for a possible underlying disorder. In dogs with claw disease but no other clinical or historical signs, further recommended diagnostic procedures include cytological evaluation of impression smears or discharge from the claw fold, bacterial culture and sensitivity testing, biopsy of the claw matrix, and an elimination diet for 6 to 8 weeks. If no underlying disease can be identified, trial treatment with essential fatty acid supplementation, vitamin E, or a combination of doxycycline hydrochloride and niacinamide may be useful. In some patients, onychectomy of all claws may be considered. PMID:10563005

  11. Reproductive Maturation of the Tropical Clawed Frog, Xenopus tropicalis

    Science.gov (United States)

    The model species Xenopus tropicalis is being widely used in developmental biology and amphibian toxicology studies. In order to increase our understanding of the role of steroid hormones in maturation in this species, we collected baseline reproductive data from metamorphosis t...

  12. What are the consequences of being left-clawed in a predominantly right-clawed fiddler crab?

    OpenAIRE

    Backwell, P.R.Y; Matsumasa, M; Double, M; Roberts, A; Murai, M; Keogh, J.S; Jennions, M. D.

    2007-01-01

    Male fiddler crabs (genus Uca) have an enlarged major claw that is used during fights. In most species, 50% of males have a major claw on the left and 50% on the right. In Uca vocans vomeris, however, less than 1.4% of males are left-clawed. Fights between opponents with claws on the same or opposite side result in different physical alignment of claws, which affects fighting tactics. Left-clawed males mainly fight opposite-clawed opponents, so we predicted that they would be better fighters ...

  13. Assessment of mutagenic damage by monofunctional alkylating agents and gamma radiation in haploid and diploid frogs, Xenopus laevis

    International Nuclear Information System (INIS)

    Adult male South African clawed frogs, Xenopus laevis, were mutagenized by 3-day immersion in aqueous solutions of ethyl methanesulfonate (EMS), diethyl nitrosamine (DEN), or ethyl nitrosourea (ENU), or by acute exposure to gamma radiation. They were then spawned repeatedly at 2-week intervals with untreated females, and embryonic survival of the progeny was used to assess genetic damage. Recessive lethal effects were assessed from reduced survival of androgenetic haploid progeny. Neither recessive nor dominant lethal effects were obtained after exposure to 100 mg/liter EMS or 2 g/liter DEN. At 250 mg/liter EMS, peak dominant lethality occurred 3-5 weeks after treatment. Most embryos hatched, but many were abnormal and died shortly after hatching. Haploid survival was significantly reduced over a broader period, from 1 to 13 weeks after mutagenesis. Treatment with 75 mg/liter ENU produced effects similar to the 250-mg/liter EMS mutagenesis. At 400 mg/liter EMS, the frequency and severity of the effects on both diploid and haploid embryos were increased over the lower dose. Gamma irradiation at 1500 R produced effects similar to the 400-mg/liter mutagenesis, except that peak dominant lethality extended from 1 to 7 weeks

  14. A method to determine integrated steroid levels in wildlife claws.

    Science.gov (United States)

    Matas, Devorah; Keren-Rotem, Tammy; Koren, Lee

    2016-05-01

    Glucocorticoids act throughout life to regulate numerous physiological and behavioral processes. Their levels are therefore highly labile, reacting to varying conditions and stressors. Hence, measuring glucocorticoids (and other steroids) in wildlife is challenging, and devising methods that are unaffected by the stress of capture and handling should be explored. Here we use the tip of free-ranging chameleons' claws that were cut to allow individual identification, and report a steroids extraction and quantification method. Claw steroids present an integrated level representing the period of claw growth. We found that we could measure corticosterone in small amounts of chameleon claw matrix using commercial EIA kits. Using this method, we learned that in wild male chameleons, claw corticosterone levels were associated with body size. We suggest that claw-testing can potentially provide an ideal matrix for wildlife biomonitoring. PMID:26993343

  15. Claw-free circular-perfect graphs

    OpenAIRE

    Pecher, Arnaud; Zhu, Xuding

    2007-01-01

    The circular chromatic number of a graph is a well studied refinement of the chromatic number. Circular perfect graphs is a superclass of perfect graphs defined by means of this more general coloring concept. This paper studies claw free circular perfect graphs. A consequence of the strong perfect graph theorem is that minimal circular perfect graphs G. In contrast to this result, it is shown in that minimal circular imperfect graphs G can have arbitrarily large independence number and arbitr...

  16. Morphological and functional diversity in therizinosaur claws and the implications for theropod claw evolution

    Science.gov (United States)

    Lautenschlager, Stephan

    2014-01-01

    Therizinosaurs are a group of herbivorous theropod dinosaurs from the Cretaceous of North America and Asia, best known for their iconically large and elongate manual claws. However, among Therizinosauria, ungual morphology is highly variable, reflecting a general trend found in derived theropod dinosaurs (Maniraptoriformes). A combined approach of shape analysis to characterize changes in manual ungual morphology across theropods and finite-element analysis to assess the biomechanical properties of different ungual shapes in therizinosaurs reveals a functional diversity related to ungual morphology. While some therizinosaur taxa used their claws in a generalist fashion, other taxa were functionally adapted to use the claws as grasping hooks during foraging. Results further indicate that maniraptoriform dinosaurs deviated from the plesiomorphic theropod ungual morphology resulting in increased functional diversity. This trend parallels modifications of the cranial skeleton in derived theropods in response to dietary adaptation, suggesting that dietary diversification was a major driver for morphological and functional disparity in theropod evolution. PMID:24807260

  17. Claw asymmetry in lobsters: case study in developmental neuroethology.

    Science.gov (United States)

    Govind, C K

    1992-12-01

    An enduring debate in the study of development is the relative contribution of genetic and epigenetic factors in the genesis of an organism, that is, the nature vs. nurture debate. The behavior of the paired claws in the lobster offers promising material for pursuing this debate because of the way they develop. The paired claws and their closer muscles are initially symmetrical; both are slender in appearance and have a mixture of fast and slow fibers in their closer muscles. During a critical period of development, they become determined into a major (crusher) and minor (cutter) claw and during subsequent development acquire their final form and behavior: The crusher becomes a stout, molar-toothed claw capable of closing only slowly because its closer muscle has 100% slow fibers while the cutter becomes a slender, incisor-toothed claw capable of closing rapidly because its closer muscle has 90% fast fibers. Our initial hypothesis was that the more active claw became the crusher and its less active counterpart the cutter. Presumably, nerve activity would influence muscle transformation, which in turn would influence the exoskeleton to which they attach and hence claw morphology. Curtailing nerve activity to the claw prevented crusher development, while reflex activation of a claw promoted its development; both results support the notion that nerve activity directly regulates claw form and function. This is not, however, the case, for when both claws were reflexly exercised neither formed a crusher, signifying rather that bilateral differences in predominantly mechanoreceptive input to the paired claws somehow lateralized the claw ganglion [central nervous system (CNS)] into a crusher and cutter side. The side experiencing the greater activity becomes the crusher side while the contralateral side becomes the cutter and is also inhibited from ever becoming a crusher. This initial lateralization in the CNS is expressed, via as yet unknown pathways, at the periphery in

  18. Yet More Frogs

    Science.gov (United States)

    Shutler, Paul M. E.

    2011-01-01

    Extending a recent paper by Derek Holton, we show how to represent the algorithm for the Frog Problem diagrammatically. This diagrammatic representation suggests a simpler proof of the symmetrical case (equal numbers of frogs of each colour) by allowing the even and odd cases to be treated together. It also provides a proof in the asymmetrical…

  19. El regimen alimentario de la rana verde de África del norte, Rana saharica - The food mode of north African green frog, Rana saharica - Le regime alimentaire de la grenouille verte d’afrique du nord, rana saharica

    Directory of Open Access Journals (Sweden)

    Meher BELLAKHAL

    2010-07-01

    Full Text Available ResumenPara la determinación del régimen alimentario de la rana verde de Áfricadel norte Rana (Pelophylax saharica, se recogieron 360 especímenes apartir de 2 lagos de la región Septentrional de Túnez desde el mes de abrilhasta el mes de septiembre. Constatamos que las presas pertenecenprincipalmente a los artrópodos, en particular los coleópteros (38.29% ylos dípteros (23.47%. Más de vez en cuando, algunos renacuajos yjuveniles de la misma especie así como otras presas acuáticas, se hantambién descubierto en el contenido estomacal. El número de presa máselevado (231 se observó en el mes de junio, mientras que la diversidadmás importante de las presas (3,1, se registró en el mes de mayo.SummaryFor the food mode determination of the North African green frog Rana(Pelophylax saharica, 360 specimens were collected from 2 lakes in theNorthern area of Tunisia since April until September. We noted that thepreys belong mainly to the Arthropods, particularly Coleopters (38.29%and Dipterous (23.47%. More occasionally, some tadpoles and youngfrogs belonging to the same species as well as other aquatic preys werealso discovered in the stomach contents. The highest number of prey(231 was observed in June, whereas the most important prey diversity(3,1 was recorded in May.

  20. Genetic background of claw health in dairy cattle

    NARCIS (Netherlands)

    Spek, van der D.

    2015-01-01

    Abstract Van der Spek, D. (2015). Genetic background of claw health in dairy cattle. PhD thesis, Wageningen University, the Netherlands. Claw disorders affect cow welfare and profitability of farms and as such are important traits relevant to dairy cattle breeding. Aim of this thesi

  1. NCBI nr-aa BLAST: CBRC-DDIS-04-0127 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DDIS-04-0127 ref|XP_786416.2| PREDICTED: similar to Xotch protein - African clawed frog ... [St ... EDICTED: similar to Xotch protein - African clawed frog ... [Strongylocentrotus purpuratus] XP_786416.2 1e-22 ...

  2. NCBI nr-aa BLAST: CBRC-DSIM-08-0061 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DSIM-08-0061 ref|XP_786416.2| PREDICTED: similar to Xotch protein - African clawed frog ... [St ... EDICTED: similar to Xotch protein - African clawed frog ... [Strongylocentrotus purpuratus] XP_786416.2 4e-42 ...

  3. Dicty_cDB: CFD715 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFD715 (Link to dictyBase) - - - Contig-U16419-1 CFD715F (Link to Original ... A40388 )LDL receptor 1 precursor - African clawed frog ... 34 2.5 QRXLL2( B40388 )LDL receptor 2 precursor - ... African clawed frog ... 33 3.3 CP000513_277( CP000513 |pid:none) Dicheloba ...

  4. Cas de necrose cutanée chez des grenouilles africaines à griffes Xenopus laevis suite à une application topique d'eugénol.

    OpenAIRE

    Ross, Andréanne; Guénette, Sarah Annie; Hélie, Pierre; Vachon, Pascal

    2006-01-01

    Case of cutaneous necrosis in African Clawed frogs Xenopus laevis after the topical application of eugenol. African Clawed frogs showed necrotic cutaneous lesions after a topical application of high concentrations of eugenol, an analgesic and anesthetic agent. Microscopically, ulceration of the epidermis, a loss of mucous and serous glands as well as an infiltration of inflammatory cells were observed.

  5. Utilization of frog waste

    OpenAIRE

    Lekshmy Nair, A.; Prabhu, P.V.

    1980-01-01

    Commercial frog waste samples have been converted into meals by cooking at 0.7 kg/sq. cm for 30 min, draining off the stick water and drying the press cake either in the sun, tunnel dryer under controlled conditions or hot air oven. Yield of the meal varied between 18.6 to 21.5% of the fresh frog waste. Chemical analyses of the meals have shown that the meals prepared from frog waste conform to standards prescribed for fish meal and livestock feed and can therefore be used for supplementation...

  6. Endocrine Toxicity of Trenbolone in the Western Clawed Frog, Xenopus (Silurana) tropicalis

    Science.gov (United States)

    Trenbolone is a veterinarian pharmaceutical that acts as an androgen agonist and is used extensively in the beef industry. It is excreted from cattle is an active form and has been measured in aquatic systems associated with or near concentrated animal feeding operations. In an...

  7. Biophysics of underwater hearing in the clawed frog, Xenopus laevis

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, J; Elepfandt, A

    1995-01-01

    frequency range of the mating call (main energy at 1.7-1.9 kHz) were mainly caused by pulsations of the air in the middle ear cavity; sound transmission via the lungs was more important at low frequencies (below 1 kHz). Furthermore, the low-frequency peak could be reversibly reduced in amplitude by loading...

  8. Genome-wide association study for claw disorders and trimming status in dairy cattle

    NARCIS (Netherlands)

    Spek, van der D.; Arendonk, van J.A.M.; Bovenhuis, H.

    2015-01-01

    Performing a genome-wide association study (GWAS) might add to a better understanding of the development of claw disorders and the need for trimming. Therefore, the aim of the current study was to perform a GWAS on claw disorders and trimming status and to validate the results for claw disorders bas

  9. Mosquito repellents in frog skin

    OpenAIRE

    Williams, C. R.; Smith, B.P.C; Best, S.M.; Tyler, M.J.

    2006-01-01

    The search for novel insect repellents has been driven by health concerns over established synthetic compounds such as diethyl-m-toluamide (DEET). Given the diversity of compounds known from frog skin and records of mosquito bite and ectoparasite infestation, the presence of mosquito repellents in frogs seemed plausible. We investigated frog skin secretions to confirm the existence of mosquito repellent properties. Litoria caerulea secretions were assessed for mosquito repellency by topical a...

  10. Effect of different flooring systems on claw conformation of dairy cows.

    Science.gov (United States)

    Telezhenko, E; Bergsten, C; Magnusson, M; Nilsson, C

    2009-06-01

    The effect of different flooring surfaces in walking and standing areas on claw conformation, claw horn growth, and wear was studied in 2 experiments during 2 consecutive housing seasons in a research dairy herd of 170 cows. In experiment 1, the flooring systems tested were solid rubber mats, mastic asphalt with and without rubber-matted feed-stalls, and aged concrete slats. In experiment 2, slatted concrete flooring was compared with slatted rubber flooring. The cows were introduced to the respective flooring systems in early lactation and their claws were trimmed before the exposure period. Toe length, toe angle, sole concavity, and claw width, as well as claw growth and wear rates were recorded for lateral and medial claws of the left hind limb. Claw asymmetry calculations were based on these claw measurements and on differences in sole protrusion between lateral and medial soles. Asphalt floors caused shorter toe length and steeper toe angle. They also increased wear on rear claws (5.30 +/- 0.31 and 5.95 +/- 0.33 mm/mo for lateral and medial claw, respectively; LSM +/- SE) and horn growth rate (5.12 +/- 0.36 and 5.83 +/- 0.31 mm/mo of lateral and medial claws, respectively). Rubber mats instead of asphalt in walking areas reduced wear (1.36 +/- 0.19 and 2.02 +/- 0.20 mm/mo for lateral and medial claw, respectively) and claw growth (3.83 +/- 0.23 and 3.94 +/- 0.17 mm/mo for lateral and medial claw, respectively). Rubber-matted feed-stalls together with asphalt walkways decreased claw wear (3.29 +/- 0.31 and 4.10 +/- 0.32 mm/mo for lateral and medial claw, respectively). The concavity of claw soles was reduced on asphalt, especially in the lateral rear claws. Rubber matting in feed-stalls prevented loss of sole concavity compared with asphalt. Claw asymmetry did not differ between flooring systems. While different access to abrasive flooring affected claw conformation, there was no evidence that flooring system influenced the disproportion between lateral and

  11. Ultrasonic communication in frogs.

    Science.gov (United States)

    Feng, Albert S; Narins, Peter M; Xu, Chun-He; Lin, Wen-Yu; Yu, Zu-Lin; Qiu, Qiang; Xu, Zhi-Min; Shen, Jun-Xian

    2006-03-16

    Among vertebrates, only microchiropteran bats, cetaceans and some rodents are known to produce and detect ultrasounds (frequencies greater than 20 kHz) for the purpose of communication and/or echolocation, suggesting that this capacity might be restricted to mammals. Amphibians, reptiles and most birds generally have limited hearing capacity, with the ability to detect and produce sounds below approximately 12 kHz. Here we report evidence of ultrasonic communication in an amphibian, the concave-eared torrent frog (Amolops tormotus) from Huangshan Hot Springs, China. Males of A. tormotus produce diverse bird-like melodic calls with pronounced frequency modulations that often contain spectral energy in the ultrasonic range. To determine whether A. tormotus communicates using ultrasound to avoid masking by the wideband background noise of local fast-flowing streams, or whether the ultrasound is simply a by-product of the sound-production mechanism, we conducted acoustic playback experiments in the frogs' natural habitat. We found that the audible as well as the ultrasonic components of an A. tormotus call can evoke male vocal responses. Electrophysiological recordings from the auditory midbrain confirmed the ultrasonic hearing capacity of these frogs and that of a sympatric species facing similar environmental constraints. This extraordinary upward extension into the ultrasonic range of both the harmonic content of the advertisement calls and the frog's hearing sensitivity is likely to have co-evolved in response to the intense, predominantly low-frequency ambient noise from local streams. Because amphibians are a distinct evolutionary lineage from microchiropterans and cetaceans (which have evolved ultrasonic hearing to minimize congestion in the frequency bands used for sound communication and to increase hunting efficacy in darkness), ultrasonic perception in these animals represents a new example of independent evolution. PMID:16541072

  12. Induced Disjoint Paths in Claw-Free Graphs

    CERN Document Server

    Golovach, Petr A; van Leeuwen, Erik Jan

    2012-01-01

    Paths P_1, ..., P_k in a graph G=(V, E) are said to be mutually induced if for any 1 <= i < j <= k, P_i and P_j have neither common vertices nor adjacent vertices (except perhaps their end-vertices). The Induced Disjoint Paths problem is to test whether a graph G with k pairs of specified vertices (s_i, t_i) contains k mutually induced paths P_i such that P_i connects s_i and t_i for i=1, ..., k. This problem is known to be NP-complete already for k=2, but for n-vertex claw-free graphs, Fiala et al. gave an n^O(k)-time algorithm. We improve the latter result by showing that the problem is fixed-parameter tractable for claw-free graphs when parameterized by k. Several related problems, such as the k-in-a-Path problem, are shown to be fixed-parameter tractable for claw-free graphs as well. We also show that an improvement of these results in certain directions is unlikely, for example by observing that the Induced Disjoint Paths problem cannot have a polynomial kernel for line graphs (a type of claw-fr...

  13. Cell autonomy of the mouse claw paw mutation.

    NARCIS (Netherlands)

    A. Darbas (Aysel); M.M. Jaegle (Martine); E.T. Walbeehm (Erik); H. van den Burg (Hans); L.A.M. Broos (Ludo); M. Uyl (Matthijs); P. Visser (Pim); F.G. Grosveld (Frank); D.N. Meijer (Dies); M.J.F. Driegen (Siska)

    2004-01-01

    textabstractMice homozygous for the autosomal recessive mutation claw paw (clp) are characterized by limb posture abnormalities and congenital hypomyelination, with delayed onset of myelination of the peripheral nervous system but not the central nervous system. Although this combination of limb and

  14. Single Cell Proteomics Using Frog (Xenopus laevis) Blastomeres Isolated from Early Stage Embryos, Which Form a Geometric Progression in Protein Content.

    Science.gov (United States)

    Sun, Liangliang; Dubiak, Kyle M; Peuchen, Elizabeth H; Zhang, Zhenbin; Zhu, Guijie; Huber, Paul W; Dovichi, Norman J

    2016-07-01

    Single cell analysis is required to understand cellular heterogeneity in biological systems. We propose that single cells (blastomeres) isolated from early stage invertebrate, amphibian, or fish embryos are ideal model systems for the development of technologies for single cell analysis. For these embryos, although cell cleavage is not exactly symmetric, the content per blastomere decreases roughly by half with each cell division, creating a geometric progression in cellular content. This progression forms a ladder of single-cell targets for the development of successively higher sensitivity instruments. In this manuscript, we performed bottom-up proteomics on single blastomeres isolated by microdissection from 2-, 4-, 8-, 16-, 32-, and 50-cell Xenopus laevis (African clawed frog) embryos. Over 1 400 protein groups were identified in single-run reversed-phase liquid chromatography-electrospray ionization-tandem mass spectrometry from single balstomeres isolated from a 16-cell embryo. When the mass of yolk-free proteins in single blastomeres decreased from ∼0.8 μg (16-cell embryo) to ∼0.2 μg (50-cell embryo), the number of protein group identifications declined from 1 466 to 644. Around 800 protein groups were quantified across four blastomeres isolated from a 16-cell embryo. By comparing the protein expression among different blastomeres, we observed that the blastomere-to-blastomere heterogeneity in 8-, 16-, 32-, and 50-cell embryos increases with development stage, presumably due to cellular differentiation. These results suggest that comprehensive quantitative proteomics on single blastomeres isolated from these early stage embryos can provide valuable insights into cellular differentiation and organ development. PMID:27314579

  15. Genetic correlations between claw health and feet and leg conformation in Norwegian Red cows.

    Science.gov (United States)

    Ødegård, C; Svendsen, M; Heringstad, B

    2014-07-01

    The aim of this study was to estimate genetic correlations between claw disorders and feet and leg conformation traits in Norwegian Red cows. A total of 188,928 cows with claw health status recorded at claw trimming from 2004 to September 2013 and 210,789 first-lactation cows with feet and leg conformation scores from 2001 to September 2013 were included in the analyses. Traits describing claw health were corkscrew claw, infectious claw disorders (dermatitis, heel horn erosion, and interdigital phlegmon), and laminitis-related claw disorders (sole ulcer, white line disorder, and hemorrhage of sole and white line). The feet and leg conformation traits were rear leg rear view (new and old definition), rear leg side view, foot angle, and hoof quality. Feet and leg conformation traits were scored linearly from 1 to 9, with optimum scores depending on the trait. Claw disorders were defined as binary (0/1) traits for each lactation. Threshold sire models were used to model claw disorders, whereas the feet and leg conformation traits were described by linear sire models. Three multivariate analyses were performed, each including the 5 feet and leg conformation traits and 1 of the 3 claw disorders at a time. Posterior means of heritability of liability of claw disorders ranged from 0.10 to 0.20 and heritabilities of feet and leg conformation traits ranged from 0.04 to 0.11. Posterior standard deviation of heritability was ≤0.01 for all traits. Genetic correlations between claw disorders and feet and leg conformation traits were all low or moderate, except between corkscrew claw and hoof quality (-0.86), which are supposed to measure the same trait. The genetic correlations between rear leg rear view (new) and infectious claw disorders (-0.20) and laminitis-related claw disorders (0.26), and between hoof quality and laminitis-related claw disorders (-0.33) were moderate. Eight of the 15 genetic correlations between claw disorders and feet and leg conformation traits had 0

  16. Genetic parameters for claw disorders and the effect of preselecting cows for trimming.

    Science.gov (United States)

    van der Spek, D; van Arendonk, J A M; Vallée, A A A; Bovenhuis, H

    2013-09-01

    Claw disorders are important traits relevant to dairy cattle breeding from an economical and welfare point of view. Selection for reduced claw disorders can be based on hoof trimmer records. Typically, not all cows in a herd are trimmed. Our objectives were to estimate heritabilities and genetic correlations for claw disorders and investigate the effect of selecting cows for trimming. The data set contained 50,238 cows, of which 20,474 cows had at least one claw trimming record, with a total of 29,994 records. Six claw trimmers scored 14 different claw disorders: abscess (AB), corkscrew claw (CC), (inter-)digital dermatitis or heel erosion (DER), double sole (DS), hardship groove (HG), interdigital hyperplasia (IH), interdigital phlegmon (IP), sand crack (SC), super-foul (SF), sole hemorrhage (SH), sole injury (SI), sole ulcer (SU), white line separation (WLS), yellow discoloration of the sole (YD), and a combined claw disorder trait. Frequencies of the claw disorders for trimmed cows ranged from 0.1% (CC, YD, HG) to 23.8% (DER). More than half of the cows scored had at least one claw disorder. Heritability on the observed scale ranged from 0.02 (DS, SH) to 0.14 (IH) and on the underlying scale from 0.05 to 0.43 in trimmed cows. Genetic correlations between laminitis-related claw disorders were moderate to high, and the same was found for hygiene-related claw disorders. The effect of selecting cows for trimming was first investigated by including untrimmed cows in the analyses and assuming they were not affected by claw disorders. Heritabilities on the underlying scale showed only minor changes. Second, different subsets of the data were created based on the percentage of trimmed cows in the herd. Heritabilities for IH, DER, and SU tended to decrease when a higher percentage of cows in the herd were trimmed. Finally, a bivariate model with a claw disorder and the trait "trimming status" was used, but heritabilities were similar. Heritability for trimming status was

  17. A nonlinear model and force control of a robotic claw

    Science.gov (United States)

    da Silva, Thiago Abraão dos Anjos; Meza, Magno Enrique Mendoza; Fenili, André; Balthazar, José Manoel; da Fonseca Brasil, Reyolando Manoel Lopes Rebello

    2014-12-01

    The objective of this work is to obtain and analyze a simple representative mathematical model for a robotic claw. The claw is represented here through the interaction between two simple pendulums and a sub-system composed of two masses connected by a spring and a damper. The main approach is based on obtaining the constrained mathematical model that represents the configuration of the system including impact and contact dynamics. The governing equations of motion are obtained using the Euler-Lagrange formalism. The numerical integration of the governing equations is realized using the fourth order Runge-Kutta. The explicit force control technique is used in order to maintain the contact force constant during the contact.

  18. Claw-pole Synchronous Generator for Compressed Air Energy Storage

    Directory of Open Access Journals (Sweden)

    PAVEL Valentina

    2013-05-01

    Full Text Available This paper presents a claw-poles generator for compressed air energy storage systems. It is presented the structure of such a system used for compensating of the intermittency of a small wind energy system. For equipping of this system it is chosen the permanent magnet claw pole synchronous generator obtained by using ring NdFeB permanentmagnets instead of excitation coil. In such a way the complexity of the scheme is reduced and the generator become maintenance free. The new magnetic flux density in the air-gap is calculated by magneticreluctance method and by FEM method and the results are compared with measured values in the old and new generator.

  19. Development of a superconducting claw-pole motor

    International Nuclear Information System (INIS)

    We have developed and produced a superconducting claw-pole motor for a trial purpose as a method to make the best use of the characteristic of superconductivity without collector rings or rotating superconducting coils that need to be cryocooled, and made some examinations. The unique feature in this motor is to have the mechanism that supports the reaction magnetic force generated in the axial direction

  20. Quantum Algorithms for Finding Claws, Collisions and Triangles

    CERN Document Server

    Buhrman, H; Hoyer, P; Magniez, F; Santha, M; De Wolf, R; Buhrman, Harry; Durr, Christoph; Hoyer, Peter; Magniez, Frederic; Santha, Miklos; Wolf, Ronald de

    2000-01-01

    We present several applications of quantum amplitude amplification to finding claws and collisions in ordered or unordered functions. Our algorithms generalize those of Brassard, Hoyer, and Tapp, and imply an N^{3/4} log(N) quantum upper bound for the element distinctness problem (contrasting with N\\log(N) classical complexity). We also give an algorithm to finding a triangle in a graph more efficiently than classically.

  1. THE STRUCTURE OF A FOLKLORE IMAGE OF THE FROG

    OpenAIRE

    ZHUCHKOVA A.V.; GALAY K.N.

    2014-01-01

    We consider an animalistic image of a frog in fairy tales «The Frog-Tsarevna» and «The Prince-frog». We define the typology of this image. Also we offer the psychological and philosophical interpretation of an image of a frog in fairy tales, considering the frog`s skin is a metaphor of egoism.

  2. Axially aligned organic fibers and amorphous calcium phosphate form the claws of a terrestrial isopod (Crustacea).

    Science.gov (United States)

    Vittori, Miloš; Srot, Vesna; Žagar, Kristina; Bussmann, Birgit; van Aken, Peter A; Čeh, Miran; Štrus, Jasna

    2016-08-01

    Skeletal elements that are exposed to heavy mechanical loads may provide important insights into the evolutionary solutions to mechanical challenges. We analyzed the microscopic architecture of dactylus claws in the woodlice Porcellio scaber and correlated these observations with analyses of the claws' mineral composition with energy dispersive X-ray spectrometry (EDX), electron energy loss spectroscopy (EELS) and selected area electron diffraction (SAED). Extraordinarily, amorphous calcium phosphate is the predominant mineral in the claw endocuticle. Unlike the strongly calcified exocuticle of the dactylus base, the claw exocuticle is devoid of mineral and is highly brominated. The architecture of the dactylus claw cuticle is drastically different from that of other parts of the exoskeleton. In contrast to the quasi-isotropic structure with chitin-protein fibers oriented in multiple directions, characteristic of the arthropod exoskeleton, the chitin-protein fibers and mineral components in the endocuticle of P. scaber claws are exclusively axially oriented. Taken together, these characteristics suggest that the claw cuticle is highly structurally anisotropic and fracture resistant and can be explained as adaptations to predominant axial loading of the thin, elongated claws. The nanoscale architecture of the isopod claw may inspire technological solutions in the design of durable machine elements subjected to heavy loading and wear. PMID:27320700

  3. High-speed cinematographic evaluation of claw-ground contact pattern of lactating cows.

    Science.gov (United States)

    Schmid, Tanja; Weishaupt, Michael A; Meyer, Sven W; Waldern, Nina; Peinen, Katja von; Nuss, Karl

    2009-08-01

    To evaluate the manner in which a cow's claws make contact with the ground at the walk, the gait, and in particular the claw-ground contact pattern, were studied in 12 healthy, lactating dairy cows, using high-speed cinematography (500frames/s) while the animals were walking on a treadmill. The results showed that the limbs were advanced around the contralateral limbs in a sigmoid curve. The feet contacted the ground with the foot axis and the tips of the claws rotated slightly outwards. In all cows the lateral claws contacted the ground before the medial claws in the hindlimbs, and in 10/12 cows in the forelimbs. The heel of the lateral claws was the region of initial contact with the ground in the hindlimbs of all cows and in the forelimbs in 9/12 cows. Lateral 'heel first' contact in the fore and hindlimbs appeared to be the normal gait pattern in these animals. Compared with a previous study of heifers, lactating cows had a larger step width in the hindlimbs and a smaller step width in the forelimbs. These ground contact patterns offer an explanation for the predisposition to claw disorders of the lateral claw of the hindlimb. The results of this study reinforce the suggestion that soft floor surfaces should be provided for cattle to prevent mechanical injury to the claws. PMID:18424198

  4. EST data: 7648 [RED

    Lifescience Database Archive (English)

    Full Text Available SA1525 AU057519 AU057520 S21525 10 G no DPlate 079 H08 CAATAATATAAGTGCCCGCC TCTAGTGTGCTGATTTGTTG ... 1719(S31719) proline-rich protein - African clawed frog ... &XLOOCM_1(X68249|pid:g64956) ...

  5. A Comparison of V-Frog[C] to Physical Frog Dissection

    Science.gov (United States)

    Lalley, James P.; Piotrowski, Phillip S.; Battaglia, Barbara; Brophy, Keith; Chugh, Kevin

    2010-01-01

    The purpose of the present study was to examine and compare the effectiveness of virtual frog dissection using V-Frog[C] and physical frog dissection on learning, retention, and affect. Subjects were secondary students enrolled in year-long life science classes in a suburban high school (N=102). Virtual dissections were done with V-Frog[C], a…

  6. Dicty_cDB: AFG865 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFG865 (Link to dictyBase) - - - Contig-U16419-1 AFG865F (Link to Original ... B40388 )LDL receptor 2 precursor - African clawed frog ... 34 2.5 ( Q99087 ) RecName: Full=Low-density lipopr ... A40388 )LDL receptor 1 precursor - African clawed frog ... 33 3.3 protein update 2009. 4.21 PSORT psg: 1.02 g ...

  7. Dicty_cDB: AFJ435 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFJ435 (Link to dictyBase) - - - Contig-U16419-1 AFJ435F (Link to Original ... B40388 )LDL receptor 2 precursor - African clawed frog ... 34 1.8 ( Q99087 ) RecName: Full=Low-density lipopr ... A40388 )LDL receptor 1 precursor - African clawed frog ... 34 2.4 ( Q07954 ) RecName: Full=Prolow-density lip ...

  8. Dicty_cDB: CFD730 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFD730 (Link to dictyBase) - - - Contig-U16419-1 CFD730F (Link to Original ... B40388 )LDL receptor 2 precursor - African clawed frog ... 36 0.64 ( Q99087 ) RecName: Full=Low-density lipop ... A40388 )LDL receptor 1 precursor - African clawed frog ... 35 0.84 AM494971_153( AM494971 |pid:none) Leishman ...

  9. Dicty_cDB: CFJ388 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFJ388 (Link to dictyBase) - - - Contig-U16419-1 - (Link to Original site) ... B40388 )LDL receptor 2 precursor - African clawed frog ... 35 1.1 ( Q99087 ) RecName: Full=Low-density lipopr ... A40388 )LDL receptor 1 precursor - African clawed frog ... 35 1.4 ( Q07954 ) RecName: Full=Prolow-density lip ...

  10. Dicty_cDB: SFF574 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFF574 (Link to dictyBase) - - - Contig-U16419-1 SFF574F (Link to Original ... B40388 )LDL receptor 2 precursor - African clawed frog ... 34 2.5 ( Q99087 ) RecName: Full=Low-density lipopr ... A40388 )LDL receptor 1 precursor - African clawed frog ... 33 3.2 AM494971_153( AM494971 |pid:none) Leishmani ...

  11. Dicty_cDB: SFB611 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFB611 (Link to dictyBase) - - - Contig-U16419-1 SFB611F (Link to Original ... B40388 )LDL receptor 2 precursor - African clawed frog ... 35 0.74 ( Q99087 ) RecName: Full=Low-density lipop ... A40388 )LDL receptor 1 precursor - African clawed frog ... 35 0.96 protein update 2009. 5.22 PSORT psg: 1.02 ...

  12. Spargana infection of frogs in Malaysia.

    Science.gov (United States)

    Mastura, A B; Ambu, S; Hasnah, O; Rosli, R

    1996-03-01

    Frogs caught from two States (Selangor and Langkawi) in Malaysia were examined for spargana of Spirometra sp. Infected frogs usually show no marks of infection but some had swelling and bleeding at the infection site. The size and weight of the infected frogs did not correlate with the infection status. The infection status in relation to human health is discussed. PMID:9031400

  13. Genetic parameters for claw disorders and the effect of preselecting cows for trimming

    NARCIS (Netherlands)

    Spek, van der D.; Arendonk, van J.A.M.; Vallee, A.A.A.; Bovenhuis, H.

    2013-01-01

    Abstract Claw disorders are important traits relevant to dairy cattle breeding from an economical and welfare point of view. Selection for reduced claw disorders can be based on hoof trimmer records. Typically, not all cows in a herd are trimmed. Our objectives were to estimate heritabilities and ge

  14. Genetic parameters for claw and leg health, foot and leg conformation, and locomotion in Danish Holsteins

    DEFF Research Database (Denmark)

    Laursen, M. V.; Boelling, D.; Mark, Thomas

    2009-01-01

    ,877 Danish Holstein cows in first lactation. Binary health traits were divided into 3 subcategories: claw health, leg health, and absence of all claw and leg disorders. Genetic (r(g)) and phenotypic correlations were estimated using a bivariate linear sire model and REML. Estimated heritabilities were 0...

  15. Effects of claw autotomy on green crab (Carcinus maenas) feeding rates

    Science.gov (United States)

    Tummon Flynn, Paula S.; Mellish, Cassandra L.; Pickering, Tyler R.; Quijón, Pedro A.

    2015-09-01

    The European green crab (Carcinus maenas) is a voracious non-indigenous predator and a threat to Atlantic Canada's shellfish industry. Its foraging ability, however, may be affected by the occurrence of injuries such as the loss of a cheliped (claw). Given that green crab claws are differentiated into a major crusher and a minor cutter, we argue that autotomy (the reflexive loss of a limb) affects feeding rates, and that this effect depends on which particular claw is lost. We examined the incidence of injuries in two green crab populations of the southern Gulf of St. Lawrence during July-October, 2012. Then we experimentally assessed the influence of the loss of each type of claw upon crab feeding rates over two size-classes of American oysters (Crassostrea virginica) and soft-shell clams (Mya arenaria). Field injury surveys showed that 12.4% of the green crabs collected were missing a claw (the cutter and/or crusher claw). Injury rates increased linearly with crab size, and were found to vary with location. Laboratory experiments showed that, compared to intact crabs, the loss of the crusher claw reduced oyster mortality rates by ~ 93-100%. The loss of the crusher also reduced feeding on small soft-shell clams but only temporarily. The loss of the cutter claw had little impact on green crab feeding rates on oysters and soft-shell clams of either size. Combined, these results suggest that the loss of a claw has an effect on the ability of green crabs to consume commercially important species but this effect depends on which claw is lost and which prey is targeted. It follows that injury rates should be taken into consideration when monitoring and forecasting the potential impacts of green crab populations, particularly on oyster beds.

  16. FROG: Time-series analysis

    Science.gov (United States)

    Allan, Alasdair

    2014-06-01

    FROG performs time series analysis and display. It provides a simple user interface for astronomers wanting to do time-domain astrophysics but still offers the powerful features found in packages such as PERIOD (ascl:1406.005). FROG includes a number of tools for manipulation of time series. Among other things, the user can combine individual time series, detrend series (multiple methods) and perform basic arithmetic functions. The data can also be exported directly into the TOPCAT (ascl:1101.010) application for further manipulation if needed.

  17. FROG - Fingerprinting Genomic Variation Ontology.

    Directory of Open Access Journals (Sweden)

    E Abinaya

    Full Text Available Genetic variations play a crucial role in differential phenotypic outcomes. Given the complexity in establishing this correlation and the enormous data available today, it is imperative to design machine-readable, efficient methods to store, label, search and analyze this data. A semantic approach, FROG: "FingeRprinting Ontology of Genomic variations" is implemented to label variation data, based on its location, function and interactions. FROG has six levels to describe the variation annotation, namely, chromosome, DNA, RNA, protein, variations and interactions. Each level is a conceptual aggregation of logically connected attributes each of which comprises of various properties for the variant. For example, in chromosome level, one of the attributes is location of variation and which has two properties, allosomes or autosomes. Another attribute is variation kind which has four properties, namely, indel, deletion, insertion, substitution. Likewise, there are 48 attributes and 278 properties to capture the variation annotation across six levels. Each property is then assigned a bit score which in turn leads to generation of a binary fingerprint based on the combination of these properties (mostly taken from existing variation ontologies. FROG is a novel and unique method designed for the purpose of labeling the entire variation data generated till date for efficient storage, search and analysis. A web-based platform is designed as a test case for users to navigate sample datasets and generate fingerprints. The platform is available at http://ab-openlab.csir.res.in/frog.

  18. Salmonella Infection and Water Frogs

    Centers for Disease Control (CDC) Podcasts

    2010-01-12

    This podcast, featuring lead investigator Shauna Mettee, discusses the first known outbreak of Salmonella in people due to contact with water frogs.  Created: 1/12/2010 by National Center for Zoonotic, Vector-Borne, and Enteric Diseases (NCZVED).   Date Released: 1/12/2010.

  19. Chemical camouflage--a frog's strategy to co-exist with aggressive ants.

    Directory of Open Access Journals (Sweden)

    Mark-Oliver Rödel

    Full Text Available Whereas interspecific associations receive considerable attention in evolutionary, behavioural and ecological literature, the proximate bases for these associations are usually unknown. This in particular applies to associations between vertebrates with invertebrates. The West-African savanna frog Phrynomantis microps lives in the underground nest of ponerine ants (Paltothyreus tarsatus. The ants usually react highly aggressively when disturbed by fiercely stinging, but the frog is not attacked and lives unharmed among the ants. Herein we examined the proximate mechanisms for this unusual association. Experiments with termites and mealworms covered with the skin secretion of the frog revealed that specific chemical compounds seem to prevent the ants from stinging. By HPLC-fractionation of an aqueous solution of the frogs' skin secretion, two peptides of 1,029 and 1,143 Da were isolated and found to inhibit the aggressive behaviour of the ants. By de novo sequencing using tandem mass spectrometry, the amino acid sequence of both peptides consisting of a chain of 9 and 11 residues, respectively, was elucidated. Both peptides were synthesized and tested, and exhibited the same inhibitory properties as the original frog secretions. These novel peptides most likely act as an appeasement allomone and may serve as models for taming insect aggression.

  20. CARE AND FEEDING OF FROGS

    International Nuclear Information System (INIS)

    'Propellers' are features in Saturn's A ring associated with moonlets that open partial gaps. They exhibit non-Keplerian motion (Tiscareno et al.); the longitude residuals of the best-observed propeller, 'Blériot', appear consistent with a sinusoid of period ∼4 years. Pan and Chiang proposed that propeller moonlets librate in 'frog resonances' with co-orbiting ring material. By analogy with the restricted three-body problem, they treated the co-orbital material as stationary in the rotating frame and neglected non-co-orbital material. Here we use simple numerical experiments to extend the frog model, including feedback due to the gap's motion, and drag associated with the Lindblad disk torques that cause Type I migration. Because the moonlet creates the gap, we expect the gap centroid to track the moonlet, but only after a time delay tdelay, the time for a ring particle to travel from conjunction with the moonlet to the end of the gap. We find that frog librations can persist only if tdelay exceeds the frog libration period Plib, and if damping from Lindblad torques balances driving from co-orbital torques. If tdelay ib, then the libration amplitude damps to zero. In the case of Blériot, the frog resonance model can reproduce the observed libration period Plib ≅ 4 yr. However, our simple feedback prescription suggests that Blériot's tdelay ∼ 0.01Plib, which is inconsistent with the observed libration amplitude of 260 km. We urge more accurate treatments of feedback to test the assumptions of our toy models.

  1. Geometric distance-regular graphs without 4-claws

    CERN Document Server

    Bang, Sejeong

    2011-01-01

    A non-complete \\drg $\\Gamma$ is called geometric if there exists a set $\\mathcal{C}$ of Delsarte cliques such that each edge of $\\Gamma$ lies in a unique clique in $\\mathcal{C}$. In this paper, we determine the non-complete distance-regular graphs satisfying $\\max \\{3, 8/3}(a_1+1)\\}claws that any non-complete distance-regular graph satisfying $\\max \\{3, \\8/3}(a_1+1)\\}

  2. Historical biogeography of Western Palearctic pelobatid and pelodytid frogs: a molecular phylogenetic perspective

    OpenAIRE

    Veith, M.; Fromhage, L.; Kosuch, J.; Vences, M.

    2006-01-01

    Abstract Spadefoot toads (Pelobates) and Parsley frogs (Pelodytes) are an enigmatic group of Western Palaearctic anurans. In the genus Pelobates, a fossorial lifestyle has enforced a conserved bauplan that masks their intraspecific evolutionary history. We used partial sequences of the mitochondrial 16S and 12S rRNA genes to infer a paleobiogeographic scenario of speciation events in these two anuran genera. Based on two alternative, mutually exclusive calibrations of the Iberian-African spli...

  3. PetClaw: A scalable parallel nonlinear wave propagation solver for Python

    KAUST Repository

    Alghamdi, Amal

    2011-01-01

    We present PetClaw, a scalable distributed-memory solver for time-dependent nonlinear wave propagation. PetClaw unifies two well-known scientific computing packages, Clawpack and PETSc, using Python interfaces into both. We rely on Clawpack to provide the infrastructure and kernels for time-dependent nonlinear wave propagation. Similarly, we rely on PETSc to manage distributed data arrays and the communication between them.We describe both the implementation and performance of PetClaw as well as our challenges and accomplishments in scaling a Python-based code to tens of thousands of cores on the BlueGene/P architecture. The capabilities of PetClaw are demonstrated through application to a novel problem involving elastic waves in a heterogeneous medium. Very finely resolved simulations are used to demonstrate the suppression of shock formation in this system.

  4. An active ingredient of Cat's Claw water extracts identification and efficacy of quinic acid.

    Science.gov (United States)

    Sheng, Yezhou; Akesson, Christina; Holmgren, Kristin; Bryngelsson, Carl; Giamapa, Vincent; Pero, Ronald W

    2005-01-15

    Historic medicinal practice has defined Cat's Claw, also known as Una de Gato or Uncaria tomentosa, as an effective treatment for several health disorders including chronic inflammation, gastrointestinal dysfunction such as ulcers, tumors and infections. The efficacy of Cat's Claw was originally believed, as early as the 1960s, to be due to the presence of oxindole alkaloids. However, more recently water-soluble Cat's Claw extracts were shown not to contain significant amounts of alkaloids (<0.05%), and yet still were shown to be very efficacious. Here we characterize the active ingredients of a water-soluble Cat's Claw extract called C-Med-100 as inhibiting cell growth without cell death thus providing enhanced opportunities for DNA repair, and the consequences thereof, such as immune stimulation, anti-inflammation and cancer prevention. The active ingredients were chemically defined as quinic acid esters and could also be shown to be bioactive in vivo as quinic acid. PMID:15619581

  5. Balancing tension in transferred slips in some dynamic procedures for claw finger correction

    OpenAIRE

    Malaviya G

    2005-01-01

    The adjustment of tension on the tendon slips which are being inserted to correct finger clawing, is the critical step in claw finger correction procedures. Several methods have been described in literature but ultimately every thing boils down to the experience of the operating surgeon who has to make decisions on the operating table. Attempt is being made to translate this experience (an abstract noun) in to words to help make life easier for the surgeons who are venturing into the field of...

  6. Care and feeding of frogs

    CERN Document Server

    Pan, Margaret; 10.1088/0004-6256/143/1/9

    2012-01-01

    "Propellers" are features in Saturn's A ring associated with moonlets that open partial gaps. They exhibit non-Keplerian motion (Tiscareno 2010); the longitude residuals of the best-observed propeller, "Bl\\'eriot," appear consistent with a sinusoid of period ~4 years. Pan and Chiang (2010) proposed that propeller moonlets librate in "frog resonances" with co-orbiting ring material. By analogy with the restricted three-body problem, they treated the co-orbital material as stationary in the rotating frame and neglected non-co-orbital material. Here we use simple numerical experiments to extend the frog model, including feedback due to the gap's motion, and drag associated with the Lindblad disk torques that cause Type I migration. Because the moonlet creates the gap, we expect the gap centroid to track the moonlet, but only after a time delay t_diff, the time for a ring particle to travel from conjunction with the moonlet to the end of the gap. We find that frog librations can persist only if t_diff exceeds the...

  7. Foot and leg conformation traits have a small effect on genomic predictions of claw disorders in Norwegian Red cows.

    Science.gov (United States)

    Ødegård, C; Svendsen, M; Heringstad, B

    2015-06-01

    The aim of this study was to evaluate whether the predictive correlation of genomic breeding values (GEBV) for claw disorders increased by including genetically correlated traits as additional information in the analyses. Predictive correlations of GEBV for claw disorders were calculated based on claw disorders only and by analyzing claw disorders together with genetically correlated foot and leg conformation traits. The claw disorders analyzed were corkscrew claw (CSC); infectious claw disorder, including dermatitis, heel horn erosion, and interdigital phlegmon; and laminitis-related claw disorder, including sole ulcer, white line disorder, and hemorrhage of sole and white line. The foot and leg conformation traits included were hoof quality, foot angle, rear leg rear view new, and rear leg rear view old. The data consisted of 183,728 daughters with claw health records and 421,319 daughters with foot and leg conformation scores. A 25K/54K single nucleotide polymorphism (SNP) data set containing 48,249 SNP was available for the analyses. The number of genotyped sires with daughter information in the analyses was 1,093 including claw disorders and 3,111 including claw disorders and foot and leg conformation traits. Predictive correlations of GEBV for CSC, infectious claw disorder, and laminitis-related claw disorder were calculated from a 10-fold cross-validation and from an additional validation set including the youngest sires. Only sires having daughters with claw health records were in the validation sets, thus increasing the reference population when adding foot and leg conformation traits. The results showed marginal improvement in the predictive correlation of GEBV for CSC when including hoof quality and foot angle, both in 10-fold cross-validation (from 0.35 to 0.37) and in the validation including the youngest sires (from 0.38 to 0.49). For infectious claw disorder and laminitis-related claw disorder, including foot and leg conformation traits had no effect

  8. Snoring puddle frog

    International Nuclear Information System (INIS)

    Full text: The purpose of this paper is to hold a biological mirror in front of ourselves, the nuclear energy community, and to suggest that the reflection we will see there will help us both professionally and as members of a broader society. Let us start with sex. For sex to function as a means of reproduction, a male and a female of a particular species have to recognise each other and mate. The important terms here are 'particular species' and 'recognise'. Within most species, extraordinarily precise mate recognition systems have evolved. The precise frequency of the croak of a particular species of frog; the precise seasonal coloration of a particular species of salmon; the precise length of the tail of a particular species of bird; each is recognisable instantly to a prospective mate, though not to untrained human ears or eyes. 'The Recognition Concept of Species' (1985) is a monograph that has become something of a 'classic' in annals of evolutionary biology. Its author, HEH Paterson, suggests that a species can be defined as a group of organisms that share a common mate recognition system. Mating is an exchange of genes, and creatures that do not recognise each other do not exchange genes. A mate recognition system closes off the gene pool and may increasingly isolate its participants from even their nearest relatives. Biological evolution has numerous links and parallels with the evolution of human cultures. Some of our recognition systems seem to have a knack for drawing everyone in - American popular culture, for example, is now inescapable. Other recognition systems repel all but a few - take, or rather don't take, the Hell's Angels or the Ku Klux Klan. We, as members of the nuclear energy culture, are members of a closed and even repellent gene pool. We share a recognition system by which we perpetuate ourselves from generation to generation, from Hiroshima to Chernobyl. Outsiders do not understand our language: terms like 'credit for fission products

  9. 3-D Finite Element Investigation of Flux Regulation Performance of a Novel Hybrid Excitation Brushless Claw-Pole Alternator

    OpenAIRE

    Qiao Dongwei; Li Yanhong; Shang Jianhua; Zhong Hui

    2015-01-01

    In consideration of low power density of electric excitation claw-pole synchronous alternator (EECA) and some difficulties in magnetic field regulation of permanent magnet claw-pole synchronous alternator (PMCA), a novel hybrid excitation brushless claw-pole alternator (HEBCA) is proposed in this paper. Its structure and field control principle are described. Three dimensional finite element analysis is used to obtain the no-load magnetic field distributions and field control capability under...

  10. Gait pattern of heifers before and after claw trimming: a high-speed cinematographic study on a treadmill.

    Science.gov (United States)

    Meyer, S W; Weishaupt, M A; Nuss, K A

    2007-02-01

    The manner in which the claws contacted the ground at the walk was evaluated in 18 healthy heifers. The animals were filmed before and after claw trimming while walking on a treadmill using high-speed cinematography (500 frames/s). For each limb, 4 consecutive steps were recorded from a side and a frontal plane. The objectives of the study were to evaluate 1) the order of claw contact with the treadmill surface, 2) the initial claw contact area, and 3) the effect of trimming on claw contact patterns. The heifers placed their front feet on the ground in a plane sagittal to the shoulders, whereas the hind feet were advanced more toward the median plane. Before trimming, the lateral claws contacted the ground before the medial in 83% of front and 100% of hind limbs. Trimming changed the percentage to 92% in the front and to 97% in the hind limbs. The percentage with which the heel of the lateral claws became the region of initial contact with the ground increased from 47 to 64% in the front feet and from 50 to 78% in the hind feet. In the medial claws of the forelimbs, claw trimming shifted the region of initial contact from the toe to the abaxial wall and heel. In the hind limbs, the main region of initial contact of the medial claws became the abaxial wall. Weight bearing by the medial claw became visibly apparent only during the midstance, propulsion, and push-off phases. "Heel first" contact of the lateral claws in the front and hind limbs may be the normal gait pattern in cattle. On hard surfaces, this pattern may lead to overload and predispose to disease, especially in the hind limbs. PMID:17235142

  11. Measuring Claw Conformation in Cattle: Assessing the Agreement between Manual and Digital Measurement

    Directory of Open Access Journals (Sweden)

    Linda J. Laven

    2015-08-01

    Full Text Available Five measurements of claw conformation (toe angle, claw height, claw width, toe length and abaxial groove length taken directly from the hoof were compared with the measurements taken from digital images of the same claws. Concordance correlation coefficients and limits-of-agreement analysis showed that, for four of the five measures (claw height, claw width, toe length and abaxial groove length, agreement was too poor for digital and manual measures to be used interchangeably. For all four of these measures, Liao’s modified concordance correlation coefficient (mCCC was ≤0.4, indicating poor concordance despite Pearson’s correlation being >0.6 in all cases. The worst concordance was seen for toe length (mCCC = 0.13. Limits-of-agreement analysis showed that, for all four measures, there was a large variation in the difference between the manual and digital methods, even when the effect of mean on difference was accounted for, with the 95% limits-of-agreement for the four measures being further away from the mean difference than 10% of the mean in all four cases. The only one of the five measures with an acceptable concordance between digital and manual measurement was toe angle (mCCC = 0.81. Nevertheless, the limits-of-agreement analysis showed that there was a systematic bias with, on average, the manual measure of toe angle, being 2.1° smaller than the digital. The 95% limits-of-agreement for toe angle were ±3.4°, probably at the upper limit of what is acceptable. However, the lack of data on the variability of individual measurements of claw conformation means that it is unclear how this variability compares to measurement of toe angle in the same animal using the same or a different manual technique.

  12. Synthesis and distribution of cytokeratins in healthy and ulcerated bovine claw epidermis.

    Science.gov (United States)

    Hendry, K A; MacCallum, A J; Knight, C H; Wilde, C J

    2001-11-01

    Keratinization of the epidermal cells of the bovine claw generates the horn that gives the tissue its mechanical strength. Disruption of keratinization is likely to have a detrimental effect on the strength and integrity of the horn, and could lead to solar lesions and lameness. As part of a wider investigation of the cell biological causes of lameness in dairy animals, we have compared keratin synthesis and distribution in healthy bovine claw tissue with those in hooves with solar ulcers. Protein synthesis was measured by [35S]-labelled amino acid incorporation in claw tissue explant cultures. [35S]-labelled protein synthesis was higher in tissue from diseased claws than in healthy claws, and highest at the ulcer site. The identity of proteins synthesised in vitro did not differ between healthy and diseased tissue. DNA synthesis indicative of cell proliferation was also elevated in diseased tissue. Immunoblotting after one- or two-dimensional electrophoresis showed cytokeratins (CK) 4, 5/6, 10 and 14 to be amongst those expressed in healthy claw tissue. The relative abundance of these keratins was not altered in healthy regions of ulcerated hooves, nor at the ulcer site, but CK16, not usually found in healthy tissue, was detected in the sole of diseased claws. CK5/6 and CK14 were shown by immunohistochemistry to be present in the basal epidermis of healthy tissue, whereas CK10 was found in supra-basal layers. In healthy tissue from ulcerated claws, this distribution was unaltered, but at the site of solar ulcers, CK5/6 and CK14 were each found in both basal and supra-basal epidermis. The study suggests that solar ulceration of the bovine claw is not associated with gross alteration in the keratin composition of the tissue, but causes abnormal distribution of cytokeratins, perhaps as a result of loss of positional cues from the basement membrane. Ulceration did, however, stimulate cell repair involving epidermal protein synthesis (including keratins), and

  13. GeoClaw-STRICHE: A coupled model for Sediment TRansport In Coastal Hazard Events

    CERN Document Server

    Tang, Hui

    2016-01-01

    GeoClaw-STRICHE is designed for simulating the physical impacts of tsunami as it relates to erosion, transport and deposition. GeoClaw-STRICHE comprises of three components: (1) nonlinear shallow water equations; (2) advection-diffusion equation; (3) an equation for morphology updating. Multiple grain sizes and sediment layers are added into GeoClaw-STRICHE to simulate grain-size distribution and add the capability to develop grain-size trends from bottom to the top of a simulated deposit as well as along the inundation. Unlike previous models based on empirical equations or sediment concentration gradient, the standard Van Leer method is applied to calculate sediment flux. We tested and verified GeoClaw-STRICHE with flume experiment by \\citet{johnson2016experimental} and data from the 2004 Indian Ocean tsunami in Kuala Meurisi as published in \\citet{JGRF:JGRF786}. The comparison with experimental data shows GeoClaw-STRICHE's capability to simulate sediment thickness and grain-size distribution in experimenta...

  14. A Technological Process of the Baiyun Chicken Claw%白云凤爪的生产工艺

    Institute of Scientific and Technical Information of China (English)

    杨慧玲

    2001-01-01

    本文详述了白云凤爪的加工技术、工艺配方及质量要求。%In this paper the technological process of the Baiyun ChickenClaw,formula and quality requirement for Baiyun Chicken claw are detailed.

  15. Malformed frog survey Dahomey NWR - 2001

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Report contains field data sheets assoicated with malformed frog survey on Dahomey NWR in 2001. Work was done in support of regional sampling on refuges for...

  16. Frog Call Survey Summary 2002-2006

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Since 2002, Patuxent Research Refuge has conducted frog surveys on South Tract, Central Tract, and North Tract locations. These surveys are conducted by Patuxent...

  17. Seasonal Patterns in Hydrogen Isotopes of Claws from Breeding Wood-Warblers (Parulidae: Utility for Estimating Migratory Origins

    Directory of Open Access Journals (Sweden)

    Kevin C. Fraser

    2008-06-01

    Full Text Available The global decline in many species of migratory birds has focused attention on the extent of migratory connectivity between breeding and wintering populations. Stable-hydrogen isotope (δD analysis of feathers is a useful technique for measuring connectivity, but is constrained by features of molt location and timing. Claws are metabolically inert, keratinous tissues that grow continuously and can be sampled at any point in the annual cycle, thus providing potentially useful clues about an individual's previous movements. However, variation in the rate at which claws incorporate local δD values is not well described. We measured δD values in claws of two species of Neotropical-Nearctic migrant wood-warblers (Golden-winged Warbler and Cerulean Warbler breeding in eastern Ontario, Canada to investigate the rate of δD change through the breeding season and the utility of claw δD values for estimating migratory origins. δD values of claw tips from 66 different individuals, each sampled once during the breeding season, showed an average change of -0.3‰ to -0.4‰ per day in the direction of the expected local Ontario value. There were no significant sex or species differences in the rate of change. These results suggest δD values of claw tips in Parulids may reflect those of the non-breeding area for 3–7 weeks after arrival on the breeding grounds, and are useful estimators of non-breeding migratory origin. Our results also suggest that these species may leave the breeding ground before claw tips fully incorporate a local δD signature, as claws sampled at the end of the breeding season did not match locally grown feather and claw δD values. This is the first study to examine the seasonal rate of the change in δD values of claws in long-distance, insectivorous, migratory birds.

  18. A contribution to the unbalance control of claw poles for automotive alternators

    OpenAIRE

    Boltežar, Miha; Nastran, Miha; Krušič, Vid

    2015-01-01

    The claw pole still represents the largest and the heaviest part of an alternator's rotor: and it is expected that alternators will continue to be used for electric power generation in motor vehicles for at least a decade. Due to the high speeds of the rotor during operation its mass centricity is very important for the service life of the bearings, low noise and smooth running. This paper presents the production of claw poles using cold-forming technology, and a focus on reducing the electri...

  19. Influence of inductance variation on performance of a permanent magnet claw pole soft magnetic composite motor

    Science.gov (United States)

    Guo, Youguang; Zhu, Jian Guo; Lin, Zhi Wei; Lu, Haiyan; Wang, Xiaolin; Chen, Jiaxin

    2008-04-01

    Winding inductance is an important parameter in determining the performance of electrical machines, particularly those with large inductance variation. This paper investigates the influence of winding inductance variation on the performance of a three-phase three-stack claw pole permanent magnet motor with soft magnetic composite (SMC) stator by using an improved phase variable model. The winding inductances of the machine are computed by using a modified incremental energy method, based on three-dimensional nonlinear time-stepping magnetic field finite element analyses. The inductance computation and performance simulation are verified by the experimental results of an SMC claw pole motor prototype.

  20. Storage of cut Heliconia bihai (L.) cv. Lobster Claw flowers at low temperatures Armazenamento de hastes florais de Heliconia bihai (L.) cv. Lobster Claw em baixa temperatura

    OpenAIRE

    Andreza S. Costa; Luis C. Nogueira; Venézio F. dos Santos; Terezinha R. Camara; Vivian Loges; Lilia Willadino

    2011-01-01

    The postharvest conservation of cut Heliconia flowers is an important factor to the success of commercialization, especially with regard to exportation. In the present study, the maximal storage time of cut inflorescences of Heliconia bihai cv. Lobster Claw at two different temperatures (12 and 19 °C) was evaluated and compared to laboratory conditions (25 °C, control treatment). Changes in visual quality, fresh weight and bract color (L*, a* and b*) were determined. The visual quality of the...

  1. 3-D finite element analysis of claw-poled stepping motor

    International Nuclear Information System (INIS)

    Stepping motors are widely used for various electric instruments. It is necessary for the optimum design to analyze the magnetic field accurately. The 3-D finite element method with edge elements taking into account the rotation of the rotor has been applied to analyze the magnetic field of a claw-poled stepping motor. (Author)

  2. Sow and piglet skin, claw and nipple lesions on two concrete flooring materials during lactation period

    OpenAIRE

    Norring, Marianna; Valros, Anna; Munksgaard, Lene; Saloniemi, Hannu

    2006-01-01

    The aim of the study was to investigate the skin, claw and nipple lesions of sows and their piglets while they were kept on two different flooring materials: concrete cement and concrete covered with polyurethane and graveled with sand (particles 0.5-1.2 mm).

  3. CHEMICAL COMPOSITION VARIABILITY IN THE Uncaria tomentosa (cat’s claw WILD POPULATION

    Directory of Open Access Journals (Sweden)

    Evelyn Maribel Condori Peñaloza

    2015-03-01

    Full Text Available Uncaria tomentosa (cat's claw is a vine widely distributed throughout the South-American rainforest. Many studies investigating the chemical composition of cat's claw have focused on the pentacyclic (POA and tetracyclic oxindole alkaloids (TOA, quinovic acid glycosides (QAG, and polyphenols (PPH. Nevertheless, it is still uncertain how environmental factors affect chemical groups. The aim of this work was to better understand the influence of environmental factors (geographic origin, altitude, and season on cat's claw chemical composition. Stem bark, branches and leaf samples were extracted and analyzed by HPLC-PDA. The data obtained were explored by multivariate analysis (HCA and PCA. Higher amounts of oxindole alkaloids and PPH were found in leaves, followed by stem bark and branches. No clear relationship was verified among geographic origin or altitude and chemical composition, which remained unchanged regardless of season (dry or rainy. However, three oxindole alkaloid chemotypes were clearly recognized: chemotype I (POA with cis D/E ring junction; chemotype II (POA with trans D/E ring junction; and chemotype III (TOA. Thus, environmental factors appear to have only a minor influence on the chemical heterogeneity of the cat's claw wild population. Nevertheless, the occurrence of different chemotypes based on alkaloid profiles seems to be clear.

  4. Analysis of factors affecting milking claw vacuum levels using a simulated milking device.

    Science.gov (United States)

    Enokidani, Masafumi; Kuruhara, Kana; Kawai, Kazuhiro

    2016-06-01

    Bovine mastitis is typically caused by microbial infection of the udder, but the factors responsible for this condition are varied. One potential cause is the milking system, and although previous studies have investigated various methods for inspecting these devices, most have not assessed methods for evaluating the milking units. With this in mind, we analyzed the factors that affect the vacuum inside the milking claw by using a simulated milking device and by measuring milking claw vacuum when adjusting the flow rate in five stages. The factors analyzed in each milking system were the vacuum pressure settings (high and low line system) , milk tube length (200-328 cm), aperture diameter (14-22.2 mm), constricted aperture diameter (12 mm), tubing configurations, lift formation (0-80 cm), claw type (bottom and top flow) and use or non-use of a milk sampler. The study findings demonstrated that all of these variables had a significant impact on claw vacuum and suggest that a diagnostic method using a simulated milking device should be considered when inspecting modern milking systems. PMID:26336796

  5. PyClaw: Accessible, Extensible, Scalable Tools for Wave Propagation Problems

    KAUST Repository

    Ketcheson, David I.

    2012-08-15

    Development of scientific software involves tradeoffs between ease of use, generality, and performance. We describe the design of a general hyperbolic PDE solver that can be operated with the convenience of MATLAB yet achieves efficiency near that of hand-coded Fortran and scales to the largest supercomputers. This is achieved by using Python for most of the code while employing automatically wrapped Fortran kernels for computationally intensive routines, and using Python bindings to interface with a parallel computing library and other numerical packages. The software described here is PyClaw, a Python-based structured grid solver for general systems of hyperbolic PDEs [K. T. Mandli et al., PyClaw Software, Version 1.0, http://numerics.kaust.edu.sa/pyclaw/ (2011)]. PyClaw provides a powerful and intuitive interface to the algorithms of the existing Fortran codes Clawpack and SharpClaw, simplifying code development and use while providing massive parallelism and scalable solvers via the PETSc library. The package is further augmented by use of PyWENO for generation of efficient high-order weighted essentially nonoscillatory reconstruction code. The simplicity, capability, and performance of this approach are demonstrated through application to example problems in shallow water flow, compressible flow, and elasticity.

  6. Do culverts impact the movements of the endangered white-clawed crayfish?

    Directory of Open Access Journals (Sweden)

    Louca V.

    2014-01-01

    Full Text Available Culverts can impact the migration and dispersal of aquatic animals and result in population fragmentation, increasing the risk of local extinction for endangered species such as the white-clawed crayfish Austropotamobius pallipes. This study used radio telemetry and passive integrated transponder (PIT telemetry to determine whether existing and experimental covered culverts affect the upstream and downstream movements of adult white-clawed crayfish. Daily crayfish movement rates did not differ significantly between an unlit 363-m long culvert and open stream channel sections. Crayfish moved into dark, covered sections volitionally. However, limited upstream movement occurred at sudden transitions of bed height or smooth-concrete box culvert sections with fast flow, suggesting partial barrier effects. In the 20-m long experimental in-stream culvert, also dark, but with natural stream bed, 70% of radio-tagged crayfish released downstream entered the culvert, as did 60% of those released upstream. Overall 35% passed through, with similar numbers in each direction. We conclude that dark culverts up to several hundred metres do not inhibit dispersal of white-clawed crayfish, provided stream slope, bed type and water velocity are amenable for movement and refuge. Care is required to ensure that culverts are bioengineered to ensure that average water velocity is sufficiently low and local hydraulic variation high, the bed and/or sidewalls contain refuge structures, and there are no cross-channel steps in bed level. Smooth-bedded box culverts are unlikely to be suitable for white-clawed crayfish.

  7. Inadequate thickness of the weight-bearing surface of claws in ruminants : clinical review

    Directory of Open Access Journals (Sweden)

    A.S. Shakespeare

    2009-05-01

    Full Text Available The term 'thin soles' refers to the suboptimal thickness of the weight-bearing surface of claws in ruminants. These palmar / plantar surfaces of the claws support the weight of the animal and consist of the distal wall horn, the sole proper, the heel and the minute white line area. The sole should normally only bear weight on uneven or undulating surfaces. A decrease in the thickness of the weight-bearing claw surface will decrease the protective function of this structure and may alter the proportion of weight-bearing by each section with possible detrimental effects on hoof function. Horn tissue readily absorbs water and becomes softer which can lead to increased wear rates. Growth rates normally match wear rates but, unlike the latter, time is needed for the growth rate response to adapt to changes in wear rate. Concrete surfaces can be abrasive and dairy cows that spend their lactation cycle on these floors should be let out to pasture in the dry period so that their claws can recoup lost horn. Frictional coefficient is a measure of the 'slipperiness' of hooves on various surfaces. Newly laid or fresh concrete is not only abrasive but the thin surface suspension of calcium hydroxide that forms has a very alkaline pH which causes keratin degradation and is mostly responsible for the excessive claw wear that occurs. Four case studies are used to illustrate the importance of the distal wall horn, the dangers of over-trimming and the effects of disease and concrete on horn growth and wear rates.

  8. 3-D Finite Element Investigation of Flux Regulation Performance of a Novel Hybrid Excitation Brushless Claw-Pole Alternator

    Directory of Open Access Journals (Sweden)

    Qiao Dongwei

    2015-01-01

    Full Text Available In consideration of low power density of electric excitation claw-pole synchronous alternator (EECA and some difficulties in magnetic field regulation of permanent magnet claw-pole synchronous alternator (PMCA, a novel hybrid excitation brushless claw-pole alternator (HEBCA is proposed in this paper. Its structure and field control principle are described. Three dimensional finite element analysis is used to obtain the no-load magnetic field distributions and field control capability under different field currents. The result shows that the flux of the prototype machine can be adjusted over a wide range with a relatively low field current.

  9. The propeller and the frog

    CERN Document Server

    Pan, Margaret

    2010-01-01

    "Propellers" in planetary rings are disturbances in ring material excited by moonlets that open only partial gaps. We describe a new type of co-orbital resonance that can explain the observed non-Keplerian motions of propellers. The resonance is between the moonlet underlying the propeller, and co-orbiting ring particles downstream of the moonlet where the gap closes. The moonlet librates within the gap about an equilibrium point established by co-orbiting material and stabilized by the Coriolis force. In the limit of small libration amplitude, the libration period scales linearly with the gap azimuthal width and inversely as the square root of the co-orbital mass. The new resonance recalls but is distinct from conventional horseshoe and tadpole orbits; we call it the "frog" resonance, after the relevant term in equine hoof anatomy. For a ring surface density and gap geometry appropriate for the propeller Bl\\'eriot in Saturn's A ring, our theory predicts a libration period of ~4 years, similar to the ~3.7 yea...

  10. FROG: The Fast & Realistic OPENGL Displayer

    CERN Document Server

    Quertenmont, Loic

    2009-01-01

    FROG is a generic framework dedicated to visualisation of events in high energy experiment. It is suitable to any particular physics experiment or detector design. The code is light (<3 MB) and fast (browsing time ~20 events per second for a large High Energy Physics experiment) and can run on various operating systems, as its object-oriented structure (C++) relies on the cross-platform OPENGL and GLUT libraries. Moreover, FROG does not require installation of third party libraries for the visualisation. This document describes the features and principles of FROG version 1.106, its working scheme and numerous functionalities such as: 3D and 2D visualisations, graphical user interface, mouse interface, configuration files, production of pictures of various format, integration of personal objects, etc. Finally, several examples of its current applications are presented for illustration.

  11. FROG The Fast and Realistic OPENGL Displayer

    CERN Document Server

    Quertenmont, Loic

    2009-01-01

    FROG is a generic framework dedicated to visualisation of events in high energy experiment. It is suitable to any particular physics experiment or detector design. The code is light ($<3\\textrm{MB}$) and fast (browsing time ~20 events per second for a large High Energy Physics experiment) and can run on various operating systems, as its object-oriented structure (C++) relies on the cross-platform OPENGL and GLUT libraries. Moreover, FROG does not require installation of third party libraries for the visualisation. This document describes the features and principles of FROG version 1.106, its working scheme and numerous functionalities such as: 3D and 2D visualisations, graphical user interface, mouse interface, configuration files, production of pictures of various format, integration of personal objects, etc. Finally, several examples of its current applications are presented for illustration.

  12. Use of the modified Stainsby procedure in correcting severe claw toe deformity in the rheumatoid foot: a retrospective review.

    LENUS (Irish Health Repository)

    Queally, Joseph M

    2009-06-01

    In claw toe deformity, the plantar plate of the metarsophalangeal joint becomes displaced onto the dorsal aspect of the metatarsal head. The Stainsby procedure replaces the displaced plantar plate to its correct position beneath the metatarsal head.

  13. Birds and frogs in mathematics and physics

    International Nuclear Information System (INIS)

    Some scientists are birds, others are frogs. Birds fly high in the air and survey broad vistas of mathematics out to the far horizon. They delight in concepts that unify our thinking and bring together diverse problems from different parts of the landscape. Frogs live in the mud below and see only the flowers that grow nearby. They delight in the details of particular objects, and they solve problems one at a time. A brief history of mathematics and its applications in physics is presented in this article. (from the history of physics)

  14. F.R.O.G. - Abstracts

    OpenAIRE

    2008-01-01

    From October 17th to 19th the international Games Conference "Future and Reality of Gaming" (F.R.O.G. 08) took place in Vienna as part of the Game City. The three days of the conference offered a large variety of international keynote speakers as well as a broad review on the cutting edge research on the topic of gaming. The presentations at F.R.O.G. 08 covered topics such as theory of gaming, culture of gaming, future perspectives of the games industry, game design as well as various pedagog...

  15. F.R.O.G. - Abstracts Keynotes

    OpenAIRE

    2008-01-01

    From October 17th to 19th the international Games Conference "Future and Reality of Gaming" (F.R.O.G. 08) took place in Vienna as part of the Game City. The three days of the conference offered a large variety of international keynote speakers as well as a broad review on the cutting edge research on the topic of gaming. The presentations at F.R.O.G. 08 covered topics such as theory of gaming, culture of gaming, future perspectives of the games industry, game design as well as various pedagog...

  16. On the Erdős-Gyárfás Conjecture in Claw-Free Graphs

    Directory of Open Access Journals (Sweden)

    Nowbandegani Pouria Salehi

    2014-08-01

    Full Text Available The Erdős-Gyárfás conjecture states that every graph with minimum degree at least three has a cycle whose length is a power of 2. Since this conjecture has proven to be far from reach, Hobbs asked if the Erdős-Gyárfás conjecture holds in claw-free graphs. In this paper, we obtain some results on this question, in particular for cubic claw-free graphs

  17. Microhabitat use by foraging white-clawed crayfish (Austropotamobius pallipes) in stream pools in the NE Iberian Peninsula

    OpenAIRE

    Clavero, Miguel; Benejam, L.; Seglar, A.

    2009-01-01

    The white-clawed crayfish (Austropotamobius pallipes) is an endangered species across most of its distribution range, and information on its ecological requirements is needed to implement effective conser- vation measures. Its habitat use has been studied in different areas and at various spatial scales. However, being a nocturnal species, there is scarce information on its habitat selection during foraging periods. In this work we analyse nocturnal habitat use of white-clawed crayfish...

  18. Conservation Aspects of the Ecology of Asian Small-Clawed and Smooth Otters on the Malay Peninsula

    OpenAIRE

    Foster-Turley P.

    1992-01-01

    Between April 1989 and June 1990 I made four six-week study visits to Tanjong Piandang, Perak, Malaysia where I studied otters in collaboration with Mr Burhannudin ("Bond") Mohd of the Department of National parks and Wildlife of Peninsular Malaysia. We mostly studied field signs and collected scats of both smooth (Lutra perspicillata) and small clawed otters (Aonyx cinerea) inhabiting the rice fields and fringing mangroves of the study site. With experience, smooth and small-clawed otters si...

  19. The Observation of Frog Species at State University of Malang as a Preliminary Effort on Frog Conservation

    OpenAIRE

    Dian Ratri Wulandari; Muhammad Habibi; Dwi Listyorini

    2013-01-01

    Frog is an amphibian which is widely spread around the world. Indonesia houses 450 species which represent 11% of frog species in the world. In Java Island alone, there live 42 species of frogs and toads. Frogs can be used as an environment indicator in that the presence of frog in a particular place indicates that the place stays natural and unpolluted. The 1st Campus of State University of Malang, which is located in the heart of Malang District, has been developing rapidly currently. Thus,...

  20. Storage of cut Heliconia bihai (L. cv. Lobster Claw flowers at low temperatures Armazenamento de hastes florais de Heliconia bihai (L. cv. Lobster Claw em baixa temperatura

    Directory of Open Access Journals (Sweden)

    Andreza S. Costa

    2011-09-01

    Full Text Available The postharvest conservation of cut Heliconia flowers is an important factor to the success of commercialization, especially with regard to exportation. In the present study, the maximal storage time of cut inflorescences of Heliconia bihai cv. Lobster Claw at two different temperatures (12 and 19 °C was evaluated and compared to laboratory conditions (25 °C, control treatment. Changes in visual quality, fresh weight and bract color (L*, a* and b* were determined. The visual quality of the inflorescences and fresh weight decreased with time in all treatments. Symptoms of chilling injury were observed on the inflorescences stored at 12 °C for six and eight days. Bract color was not affected by temperature, storage time or the senescence process. The results indicate that a temperature of 12 °C is not recommended for a storage time longer than four days, whereas 19 °C can be used for a storage time of up to eight days for cut inflorescences of H. bihai cv. Lobster Claw.A conservação pós-colheita de flores de corte de Heliconia é fator relevante para o sucesso da comercialização, principalmente para a exportação. Neste estudo, o período máximo de armazenamento de hastes florais de Heliconia bihai cv. Lobster Claw, foi avaliado em duas diferentes temperaturas (12 e 19 °C e comparado com as condições de laboratório (25 °C, tratamento controle. As variáveis avaliadas foram: qualidade visual, massa de matéria fresca e a coloração das inflorescências (L*, a* e b*. A qualidade visual das inflorescências e a massa de matéria fresca de todos os tratamentos reduziram ao longo do tempo. Sintomas de injúria por frio foram observados nas inflorescências armazenadas a 12 °C, durante seis e oito dias. A coloração das brácteas não foi afetada pela temperatura, período de armazenamento nem pelo processo de senescência. Os resultados indicam que a temperatura de 12 °C não é recomendada para armazenar hastes florais de

  1. The synergy between the insect-inspired claws and adhesive pads increases the attachment ability on various rough surfaces.

    Science.gov (United States)

    Song, Yi; Dai, Zhendong; Wang, Zhouyi; Ji, Aihong; Gorb, Stanislav N

    2016-01-01

    To attach reliably on various inclined rough surfaces, many insects have evolved both claws and adhesive pads on their feet. However, the interaction between these organs still remains unclear. Here we designed an artificial attachment device, which mimics the structure and function of claws and adhesive pads, and tested it on stiff spheres of different dimensions. The results show that the attachment forces of claws decrease with an increase of the sphere radius. The forces may become very strong, when the sphere radius is smaller or comparable to the claw radius, because of the frictional self-lock. On the other hand, adhesive pads generate considerable adhesion on large sphere diameter due to large contact areas. The synergy effect between the claws and adhesive pads leads to much stronger attachment forces, if compared to the action of claw or adhesive pads independently (or even to the sum of both). The results carried out by our insect-inspired artificial attachment device clearly demonstrate why biological evolution employed two attachment organs working in concert. The results may greatly inspire the robot design, to obtain reliable attachment forces on various substrates. PMID:27198650

  2. Benefiting Africans

    Institute of Scientific and Technical Information of China (English)

    ZHANG ZHIPING

    2011-01-01

    Along with thriving Sino-African economic and trade ties,Chinese companies have attached greater importance to their social responsibility to Africans.More than 2,000 sweaters woven by Chinese mothers were sent to orphans and disabled children in Kenya and four other African countries in September.This activity was launched by Hengyuanxiang,a leading Chinese wool manufacturer.

  3. Benefiting Africans

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    Along with thriving Sino-African economic and trade ties,Chinese companies have attached greater importance to their social responsibility to Africans.More than 2,000 sweaters woven by Chinese mothers were sent to orphans and disabled children in Kenya and four other African countries in September. This activity was launched by Hengyuanxiang,aleading Chinese wool manufacturer.

  4. Behaviour of the Pleistocene marsupial lion deduced from claw marks in a southwestern Australian cave

    Science.gov (United States)

    Arman, Samuel D.; Prideaux, Gavin J.

    2016-01-01

    The marsupial lion, Thylacoleo carnifex, was the largest-ever marsupial carnivore, and is one of the most iconic extinct Australian vertebrates. With a highly-specialised dentition, powerful forelimbs and a robust build, its overall morphology is not approached by any other mammal. However, despite >150 years of attention, fundamental aspects of its biology remain unresolved. Here we analyse an assemblage of claw marks preserved on surfaces in a cave and deduce that they were generated by marsupial lions. The distribution and skewed size range of claw marks within the cave elucidate two key aspects of marsupial lion biology: they were excellent climbers and reared young in caves. Scrutiny of >10,000 co-located Pleistocene bones reveals few if any marsupial lion tooth marks, which dovetails with the morphology-based interpretation of the species as a flesh specialist. PMID:26876952

  5. Behaviour of the Pleistocene marsupial lion deduced from claw marks in a southwestern Australian cave.

    Science.gov (United States)

    Arman, Samuel D; Prideaux, Gavin J

    2016-01-01

    The marsupial lion, Thylacoleo carnifex, was the largest-ever marsupial carnivore, and is one of the most iconic extinct Australian vertebrates. With a highly-specialised dentition, powerful forelimbs and a robust build, its overall morphology is not approached by any other mammal. However, despite >150 years of attention, fundamental aspects of its biology remain unresolved. Here we analyse an assemblage of claw marks preserved on surfaces in a cave and deduce that they were generated by marsupial lions. The distribution and skewed size range of claw marks within the cave elucidate two key aspects of marsupial lion biology: they were excellent climbers and reared young in caves. Scrutiny of >10,000 co-located Pleistocene bones reveals few if any marsupial lion tooth marks, which dovetails with the morphology-based interpretation of the species as a flesh specialist. PMID:26876952

  6. Pars plana vitrectomy with posterior iris claw implantation for posteriorly dislocated nucleus and intraocular lens

    Directory of Open Access Journals (Sweden)

    Kishor B Patil

    2011-01-01

    Full Text Available We evaluated the safety and efficacy of pars plana vitrectomy (PPV with primary posterior iris claw intraocular lens (IOL implantation in cases of posterior dislocation of nucleus and IOL without capsular support. This was a retrospective interventional case series. Fifteen eyes underwent PPV with primary posterior iris claw IOL implantation performed by a single vitreoretinal surgeon. The main outcome measures were changes in best corrected visual acuity and anterior and posterior segment complications. A total of 15 eyes were included in this study. Eight had nucleus drop, three had IOL drop during cataract surgery and four had traumatic posterior dislocation of lens. The final postoperative best corrected visual acuity was 20/60 or better in 11 patients. This procedure is a viable option in achieving good functional visual acuity in eyes without capsular support.

  7. Variability of a dynamic visual signal: the fiddler crab claw-waving display.

    Science.gov (United States)

    How, Martin J; Zeil, Jochen; Hemmi, Jan M

    2009-01-01

    Fiddler crabs use elaborate, species-specific claw-waving displays to communicate with rivals and mates. However, detailed comparative studies of fiddler crab signal structure and structural variations are lacking. This paper provides an analysis of the claw-waving displays of seven Australian species of fiddler crab, Uca mjoebergi, U. perplexa, U. polita, U. seismella, U. signata, U. elegans and U. vomeris. We used digital video to record and analyse the fine-scale spatiotemporal properties of these movement-based visual signals. We found that the structure and timing of the displays is species-specific, exhibiting inter-specific differences that follow phylogenetic relationships. The displays showed intra-specific variation according to individual identity, geographic location and fine-scale behavioural context. The observed differences and variations are discussed in the light of the evolutionary forces that may shape their design. PMID:19002693

  8. Devil's claw (Harpagophytum procumbens in a Brahman's preputial sheath : a case report from Botswana : case report

    Directory of Open Access Journals (Sweden)

    J.F.W. Isa

    2001-07-01

    Full Text Available Failure of penile protrusion during attempted service of a cow on heat was investigated in a 3-year-old Brahman bull at Kwakwadi cattle-post in the Kgalahadi sandveld, Kweneng District, Botswana. The investigation revealed that penile protrusion was obstructed by a devil's claw (grapple thorn, a dry fruit of the plant Harpagophytum procumbens, which had lodged in the cavum preputiale. The thorn, which was removed almost completely manually with minimal tissue dissection, had also caused minor lacerations and puncture wounds on the lamina interna pars parietalis. The wounds healed well following treatment with antiseptics and antibiotics and subsequently the bull regained full penile protrusion and served the cows well. This report describes the first case of lodgement of a devil's claw fruit in, and its extraction from, the cavum preputiale of a Brahman.

  9. Frog egg growth, experiment S003

    Science.gov (United States)

    Young, R. S.; Tremor, J. W.

    1971-01-01

    The objective of experiment was to determine the effect of weightlessness on the ability of a fertilized frog egg to divide normally and to differentiate and form a normal embryo. This experiment was first attempted on the Gemini 8 mission and was completed only partially because of the early termination of that mission.

  10. Venomous Frogs Use Heads as Weapons.

    Science.gov (United States)

    Jared, Carlos; Mailho-Fontana, Pedro Luiz; Antoniazzi, Marta Maria; Mendes, Vanessa Aparecida; Barbaro, Katia Cristina; Rodrigues, Miguel Trefaut; Brodie, Edmund D

    2015-08-17

    Venomous animals have toxins associated with delivery mechanisms that can introduce the toxins into another animal. Although most amphibian species produce or sequester noxious or toxic secretions in the granular glands of the skin to use as antipredator mechanisms, amphibians have been considered poisonous rather than venomous because delivery mechanisms are absent. The skin secretions of two Brazilian hylid frogs (Corythomantis greening and Aparasphenodon brunoi) are more toxic than the venoms of deadly venomous Brazilian pitvipers, genus Bothrops; C. greeningi secretion is 2-fold and A. brunoi secretion is 25-fold as lethal as Bothrops venom. Like the venoms of other animals, the skin secretions of these frogs show proteolytic and fibrinolytic activity and have hyaluronidase, which is nontoxic and nonproteolytic but promotes diffusion of toxins. These frogs have well-developed delivery mechanisms, utilizing bony spines on the skull that pierce the skin in areas with concentrations of skin glands. C. greeningi has greater development of head spines and enlarged skin glands producing a greater volume of secretion, while A. brunoi has more lethal venom. C. greeningi and A. brunoi have highly toxic skin secretions and an associated delivery mechanism; they are therefore venomous. Because even tiny amounts of these secretions introduced into a wound caused by the head spines could be dangerous, these frogs are capable of using their skin toxins as venoms against would-be predators. PMID:26255851

  11. Water Frogs, Aquariums, and Salmonella -- Oh My!

    Centers for Disease Control (CDC) Podcasts

    2009-12-09

    This CDC Kidtastics podcast discusses how people can get Salmonella from water frogs and aquariums.  Created: 12/9/2009 by National Center for Zoonotic, Vector-Borne, and Enteric Diseases (NCZVED).   Date Released: 12/9/2009.

  12. Frog Swarms: Earthquake Precursors or False Alarms?

    Science.gov (United States)

    Grant, Rachel A; Conlan, Hilary

    2013-01-01

    In short-term earthquake risk forecasting, the avoidance of false alarms is of utmost importance to preclude the possibility of unnecessary panic among populations in seismic hazard areas. Unusual animal behaviour prior to earthquakes has been reported for millennia but has rarely been scientifically documented. Recently large migrations or unusual behaviour of amphibians have been linked to large earthquakes, and media reports of large frog and toad migrations in areas of high seismic risk such as Greece and China have led to fears of a subsequent large earthquake. However, at certain times of year large migrations are part of the normal behavioural repertoire of amphibians. News reports of "frog swarms" from 1850 to the present day were examined for evidence that this behaviour is a precursor to large earthquakes. It was found that only two of 28 reported frog swarms preceded large earthquakes (Sichuan province, China in 2008 and 2010). All of the reported mass migrations of amphibians occurred in late spring, summer and autumn and appeared to relate to small juvenile anurans (frogs and toads). It was concluded that most reported "frog swarms" are actually normal behaviour, probably caused by juvenile animals migrating away from their breeding pond, after a fruitful reproductive season. As amphibian populations undergo large fluctuations in numbers from year to year, this phenomenon will not occur on a yearly basis but will depend on successful reproduction, which is related to numerous climatic and geophysical factors. Hence, most large swarms of amphibians, particularly those involving very small frogs and occurring in late spring or summer, are not unusual and should not be considered earthquake precursors. In addition, it is likely that reports of several mass migration of small toads prior to the Great Sichuan Earthquake in 2008 were not linked to the subsequent M = 7.9 event (some occurred at a great distance from the epicentre), and were probably co

  13. Development of Alternative Crab Claw Processing Systems to Minimize Environmental Impact

    OpenAIRE

    Benning, Jennifer Lyn

    1997-01-01

    Development of Alternative Crab Claw Processing Systems to Minimize Environmental Impact by Jennifer Lyn Benning Chair: Dr. Gregory Boardman Environemental Engineering (ABSTRACT) In the recent years, environmental regulations enforced by federal,state, and local agencies have increasingly addressed water quality issues through progressively more stringent regulations. These regulations have raised concerns in the blue crab industry because processors are now subject to regulations u...

  14. A Record of Small-Clawed Otters (Aonyx cinereus) Foraging on an Invasive Pest Species, Golden Apple Snails (Pomacea canaliculata) in a West Sumatra Rice Field

    OpenAIRE

    Jabang; Wilson Novarino; Aadrean

    2011-01-01

    A small-clawed otter (Aonyx cinereus) survey in West Sumatran rice fields was conducted from April to September 2010. During this survey, golden apple snail (Pomacea canaliculata) shell remains were found on a rice field bank as suspected prey remains of small-clawed otters. This suspicion was later proved by the occurrence of snail material (pieces of operculum and shell) in otter spraints. This is the first evidence of small-clawed otters foraging on this invasive pest species. Characterist...

  15. Prenatal Diagnosis of EEC Syndrome with "Lobster Claw" Anomaly by 3D Ultrasound

    Directory of Open Access Journals (Sweden)

    Livia T Rios

    2012-01-01

    Full Text Available The EEC syndrome is a genetic anomaly characterized by the triad: ectodermal dysplasia (development of anomalies of the structures derived from the embryonic ectodermal layer, ectrodactyly (extremities, hands and feet malformations and cleft lip and/or palate; these malformations can be seen together or in isolation. The prenatal diagnosis can be made by two-dimensional ultrasonography (2DUS that identifies the facial and/or limb anomalies, most characteristic being the "lobster-claw" hands. The three-dimensional ultrasonography (3DUS provides a better analysis of the malformations than the 2DUS. A 25-year-old primigravida, had her first transvaginal ultrasonography that showed an unique fetus with crow-rump length of 47 mm with poorly defined hands and feet,. She was suspected of having sporadic form of EEC syndrome. The 2DUS performed at 19 weeks confirmed the EEC syndrome, showing a fetus with lobster-claw hands (absence of the 2 nd and 3 rd fingers, left foot with the absence of the 3rd toe and the right foot with syndactyly, and presence of cleft lip/palate. The 3DUS defined the anomalies much better than 2DUS including the lobster-claw hands.

  16. Retropupillary Fixation of Iris-Claw Intraocular Lens for Aphakic Eyes in Children.

    Directory of Open Access Journals (Sweden)

    Martina Brandner

    Full Text Available To report outcome, complications and safety of retropupillary fixated iris-claw intraocular lenses in a pediatric population.Retrospective study.Ten consecutive pediatric patients (15 eyes underwent placement of retropupillary fixated iris-claw intraocular lenses between October 2007 and July 2013 at the Department of Ophthalmology, Medical University Graz and General Hospital Klagenfurt, Austria. Postoperative visual acuity and complications were analyzed.Median final best-corrected visual acuity improved by 0.12 logMAR from preoperative baseline. Mean postoperative spherical equivalent was -0.05 ± 1.76 D. No serious complications were observed intra- or postoperatively during the entire follow-up period of up to 40 months. One patient experienced a haptic disenclavation with IOL subluxation immediately after a car accident.Our study demonstrates that iris-claw intraocular lens implantation behind the iris is safe in children with lack of capsular support and yields excellent visual outcome with low complication rate.

  17. Optimization Design and Performance Analysis of a PM Brushless Rotor Claw Pole Motor with FEM

    Directory of Open Access Journals (Sweden)

    Zhenyang Zhang

    2016-07-01

    Full Text Available A new type of permanent magnet (PM brushless claw pole motor (CPM with soft magnetic composite (SMC core is designed and analyzed in this paper. The PMs are mounted on the claw pole surface, and the three-phase stator windings are fed by variable-frequency three-phase AC currents. The advantages of the proposed CPM are that the slip rings on the rotor are cast off and it can achieve the efficiency improvement and higher power density. The effects of the claw-pole structure parameters, the air-gap length, and the PM thinner parameter of the proposed CPM on the output torque are investigated by using three-dimensional time-stepping finite element method (3D TS-FEM. The optimal rotor structure of the proposed CPM is obtained by using the response surface methodology (RSM and the particle swarm optimization (PSO method and the comparison of full-load performances of the proposed CPM with different material cores (SMC and silicon steel is analyzed.

  18. Sand Floor for Farmed Blue Foxes: Effects on Claws, Adrenal Cortex Function, Growth and Fur Properties

    Directory of Open Access Journals (Sweden)

    Leena Ahola

    2009-01-01

    Full Text Available Farmed blue foxes (Vulpes lagopus are traditionally housed on mesh floors where they are unable to perform certain species-specific behaviours, such as digging, which may compromise the animals' welfare. This study describes how a possibility to use in-cage sand floor affects welfare-related variables like growth of the claws, adrenal cortex function, and fur properties in juvenile blue foxes. The foxes (N=32 were housed in male-female sibling pairs in an outdoor fur animal shed in cage systems consisting of two traditional fox cages. For the eight male-female sibling pairs of the Control group, there was a mesh floor in both cages of each cage system, whereas for the eight pairs of the Sand group there was a mesh floor in one cage and a 30–40 cm deep earth floor in the other cage. The results show that sand floor is beneficial for the wearing of the claws of foxes. Furthermore, an early experience of sand floor may have positive effects on the foxes' fur development. The results, however, also suggest that there might appear welfare problems observed as disturbed claw growth and increased adrenal cortex activation if foxes that are once provided with clean and unfrozen sand floor are not allowed to enjoy this floor all the time.

  19. Peptidomic analysis of the extensive array of host-defense peptides in skin secretions of the dodecaploid frog Xenopus ruwenzoriensis (Pipidae).

    Science.gov (United States)

    Coquet, Laurent; Kolodziejek, Jolanta; Jouenne, Thierry; Nowotny, Norbert; King, Jay D; Conlon, J Michael

    2016-09-01

    The Uganda clawed frog Xenopus ruwenzoriensis with a karyotype of 2n=108 is one of the very few vertebrates with dodecaploid status. Peptidomic analysis of norepinephrine-stimulated skin secretions from this species led to the isolation and structural characterization of 23 host-defense peptides belonging to the following families: magainin (3 peptides), peptide glycine-leucine-amide (PGLa; 6 peptides), xenopsin precursor fragment (XPF; 3 peptides), caerulein precursor fragment (CPF; 8 peptides), and caerulein precursor fragment-related peptide (CPF-RP; 3 peptides). In addition, the secretions contained caerulein, identical to the peptide from Xenopus laevis, and two peptides that were identified as members of the trefoil factor family (TFF). The data indicate that silencing of the host-defense peptide genes following polyploidization has been appreciable and non-uniform. Consistent with data derived from comparison of nucleotide sequences of mitochrondrial and nuclear genes, cladistic analyses based upon the primary structures of the host-defense peptides provide support for an evolutionary scenario in which X. ruwenzoriensis arose from an allopolyploidization event involving an octoploid ancestor of the present-day frogs belonging to the Xenopus amieti species group and a tetraploid ancestor of Xenopus pygmaeus. PMID:27290612

  20. Frog value chain case study in Ho Chi Minh City Vietnam

    OpenAIRE

    Le, Minh Quoc

    2012-01-01

    Frog is valuable product in Vietnam but the natural frogs are overexploited thus, the new model to raising frog is desired. Many species of frogs are cultured in Vietnam, especially in Ho Chi Minh City, for trial of the adaptive ability of exotic species in Vietnam condition. Recently, the frogs’ species from Thailand and Taiwan are prepotent and spread out Vietnam. Nowadays, frog culture becomes one of the newest industries in Vietnam. With a short life cycle, frog culture is farming as econ...

  1. The checklist of protozoan and acanthocephalan from frogs in China

    OpenAIRE

    XIA Weili; Huang, Bing; Zhu, Shunhai; Men Qifei; Han, Hongyu; Dong, Hui; Zhao, Qiping

    2015-01-01

    In order to understand the species of protozoan and acanthocephalan from frogs and their geographic distributions in China.Relevant literatures that reported protozoan and acanthocephalan in frogs of China were collected and a checklist was provided according to newer classification system on protozoan and acanthocephalan based on these literatures.In summary,61 species of protozoan and 8 species of acanthocephalan have been recorded in 31 species of frogs in China.Among them,the species of p...

  2. PetClaw: Parallelization and Performance Optimization of a Python-Based Nonlinear Wave Propagation Solver Using PETSc

    KAUST Repository

    Alghamdi, Amal Mohammed

    2012-04-01

    Clawpack, a conservation laws package implemented in Fortran, and its Python-based version, PyClaw, are existing tools providing nonlinear wave propagation solvers that use state of the art finite volume methods. Simulations using those tools can have extensive computational requirements to provide accurate results. Therefore, a number of tools, such as BearClaw and MPIClaw, have been developed based on Clawpack to achieve significant speedup by exploiting parallel architectures. However, none of them has been shown to scale on a large number of cores. Furthermore, these tools, implemented in Fortran, achieve parallelization by inserting parallelization logic and MPI standard routines throughout the serial code in a non modular manner. Our contribution in this thesis research is three-fold. First, we demonstrate an advantageous use case of Python in implementing easy-to-use modular extensible scalable scientific software tools by developing an implementation of a parallelization framework, PetClaw, for PyClaw using the well-known Portable Extensible Toolkit for Scientific Computation, PETSc, through its Python wrapper petsc4py. Second, we demonstrate the possibility of getting acceptable Python code performance when compared to Fortran performance after introducing a number of serial optimizations to the Python code including integrating Clawpack Fortran kernels into PyClaw for low-level computationally intensive parts of the code. As a result of those optimizations, the Python overhead in PetClaw for a shallow water application is only 12 percent when compared to the corresponding Fortran Clawpack application. Third, we provide a demonstration of PetClaw scalability on up to the entirety of Shaheen; a 16-rack Blue Gene/P IBM supercomputer that comprises 65,536 cores and located at King Abdullah University of Science and Technology (KAUST). The PetClaw solver achieved above 0.98 weak scaling efficiency for an Euler application on the whole machine excluding the

  3. Parallelization of GeoClaw code for modeling geophysical flows with adaptive mesh refinement on many-core systems

    Science.gov (United States)

    Zhang, S.; Yuen, D.A.; Zhu, A.; Song, S.; George, D.L.

    2011-01-01

    We parallelized the GeoClaw code on one-level grid using OpenMP in March, 2011 to meet the urgent need of simulating tsunami waves at near-shore from Tohoku 2011 and achieved over 75% of the potential speed-up on an eight core Dell Precision T7500 workstation [1]. After submitting that work to SC11 - the International Conference for High Performance Computing, we obtained an unreleased OpenMP version of GeoClaw from David George, who developed the GeoClaw code as part of his PH.D thesis. In this paper, we will show the complementary characteristics of the two approaches used in parallelizing GeoClaw and the speed-up obtained by combining the advantage of each of the two individual approaches with adaptive mesh refinement (AMR), demonstrating the capabilities of running GeoClaw efficiently on many-core systems. We will also show a novel simulation of the Tohoku 2011 Tsunami waves inundating the Sendai airport and Fukushima Nuclear Power Plants, over which the finest grid distance of 20 meters is achieved through a 4-level AMR. This simulation yields quite good predictions about the wave-heights and travel time of the tsunami waves. ?? 2011 IEEE.

  4. Reducing outage times: a FROG perspective

    International Nuclear Information System (INIS)

    In 1992, the Framatome Owners Group (FROG) was set up. It provides a forum for the members, who are all users of Framatome nuclear steam supply systems, to share and benefit from each others experience. Joint activities have been focused on safety and economic performance. Through effective control of outage duration, the average capability factor for the 60 plus nuclear units operated by the members rose from 74% in 1992 to 81.5% in 1993, while the average unplanned capability loss factor reduced from 9% to 3.5%. The specific measures now being taken by three FROG members to improve these results still further are described. The members concerned are Electrabel of Belgium, Electrite de France and the Korea Electric Power Co. (UK)

  5. Faint Infrared-Excess Field Galaxies FROGs

    CERN Document Server

    Moustakas, L A; Zepf, S E; Bunker, A J

    1997-01-01

    Deep near-infrared and optical imaging surveys in the field reveal a curious population of galaxies that are infrared-bright (I-K>4), yet with relatively blue optical colors (V-I20, is high enough that if placed at z>1 as our models suggest, their space densities are about one-tenth of phi-*. The colors of these ``faint red outlier galaxies'' (fROGs) may derive from exceedingly old underlying stellar populations, a dust-embedded starburst or AGN, or a combination thereof. Determining the nature of these fROGs, and their relation with the I-K>6 ``extremely red objects,'' has implications for our understanding of the processes that give rise to infrared-excess galaxies in general. We report on an ongoing study of several targets with HST & Keck imaging and Keck/LRIS multislit spectroscopy.

  6. Frogs of the Magela Creek system

    International Nuclear Information System (INIS)

    Facets of the reproductive biology of 24 species of frogs from the Magela Creek system were examined over two Wet seasons. Data are presented for the onset, duration and termination of activity, calling and breeding, and are correlated with temperature and relative humidity. Most species breed at the onset of the Wet season before the flood plain is completely inundated. For each species the eggs and form of the spawn clump are described

  7. Frog skin epithelium: electrolyte transport and chytridiomycosis

    OpenAIRE

    Campbell, Craig R.; Voyles, Jamie; Cook, David I.; Dinudom, Anuwat

    2011-01-01

    One unique physiological characteristic of frogs is that their main route for intake of water is across the skin. In these animals, the skin acts in concert with the kidney and urinary bladder to maintain electrolyte homeostasis. Water absorption across the skin is driven by the osmotic gradient that develops as a consequence of solute transport. Our recent study demonstrated that chytridiomycosis, an infection of amphibian skin by the fungal pathogen, Batrachochytrium dendrobatidis, inhibits...

  8. Vocal competition in male Xenopus laevis frogs

    OpenAIRE

    Tobias, Martha L.; Corke, Anna; Korsh, Jeremy; Yin, David; Kelley, Darcy B.

    2010-01-01

    Male Xenopus laevis frogs produce underwater advertisement calls that attract gravid females and suppress calling by male competitors. Here we explore whether groups of males establish vocal ranks and whether auditory cues alone suffice for vocal suppression. Tests of male–male pairs within assigned groups reveal linear vocal dominance relations, in which each male has a defined rank. Both the duration over which males interact, as well as the number of competitive opportunities, affect linea...

  9. Cellular mechanisms of nociception in the frog

    Czech Academy of Sciences Publication Activity Database

    Kuffler, D. P.; Lyfenko, Alla; Vyklický st., Ladislav; Vlachová, Viktorie

    2002-01-01

    Roč. 88, č. 4 (2002), s. 1843-1850. ISSN 0022-3077 R&D Projects: GA ČR GA305/00/1639; GA MŠk LN00B122 Grant ostatní: NATO(XX) Grant 977062 Institutional research plan: CEZ:AV0Z5011922 Keywords : cellular mechanisms of nociception * frog Subject RIV: FH - Neurology Impact factor: 3.743, year: 2002

  10. Biogeographic patterns of Colombian frogs and toads

    International Nuclear Information System (INIS)

    Using the data provided in Ruiz-Carranza et al. (1996) the distributions of the 540 species of frogs and toads are partitioned among ten ecogeographic units of Colombia defined on the basis of precipitation and elevation. Some lowlands areas (pacific lowlands, Amazonian) exhibit high diversity (85-94 species) but lowlands areas in general are impoverished (30-52 species), especially when contrasted with upland areas. The three Andean cordilleras harbor between 87 and 121 species of frogs and toads, demonstrating that the biodiversity of Colombia resides primarily in its montane components, not in its lowland rain forests. When biological endemicity is separated from political endemicity, five areas of high endemicity remain (the three Andean cordilleras, the Sierra Nevada de Santa Marta, and the pacific lowlands). We endeavor to explain this description by recourse to cladistic analyses of several groups of leptodactylid frogs where we find that the general pattern of diversification is by means of horizontal diversification (allopatric speciation) with a minor contribution from vertical diversification

  11. Experimental Study and Numerical Simulation of the Casting-Forging Complex Near Net Forming of Alternator Claw-pole

    Institute of Scientific and Technical Information of China (English)

    J.L.Song; D.J.Hu; Q.C.Wang; H.Q.Chen; H.G.Guo

    2004-01-01

    As a newly developed precision technology, casting-forging complex near net forming process is utilized to produce complex components with a short lead time, low cost and high precision, thus to accelerate the response speed of the market and enhance the competitive power of products. In this paper, the casting-forging complex near net forming process of alternator claw pole was developed and investigated with a combination of experimental and numerical simulation method. Qualified near net workpiece was manufactured, mechanical parameter and relative field information during the forming process was also obtained. While the alternator claw-pole is processed with this technology, the forming force is small, the process is short and the quality of forgings is perfect. Therefore, the complex casting-forging near net forming process of claw-pole is an energy and material saving technology, which will have a vast developing and application prospect in the future.

  12. Short term effect of treating claw horn lesions in dairy cattle on their locomotion, activity and milk yield

    Directory of Open Access Journals (Sweden)

    Jane A. Montgomery

    2012-03-01

    Full Text Available The immediate effect on dairy cow mobility, daily activity and milk yield following treatment for claw horn disease was examined in 306 lame cows located on four Cheshire dairy farms over twelve months. The daily activity and milk yield of all cows in these herds was recorded on computer using pedometers and in-parlour milk flow meters. Lame cows identified by stockmen were assessed subjectively by locomotion score, then restrained and their claws examined to identify the predominant lesion present. Those with locomotion scores > 2.5 that presented with sole ulcer, haemorrhage and bruising, or white line disease were studied. Claws of the affected limb were trimmed by one paraprofessional claw trimmer using the five-step Dutch method and the affected claw unloaded either by trimming or application of a block to the healthy digit: those on the contra-lateral limb were trimmed similarly. The same observer repeated the locomotion score assessment seven days later: trimming reduced the proportion of lame cows (score >3 by 55% and those with poor gait (score <3>2.5 by 49%, and the proportion of all cows not lame after trimming was 51% (χ2 4.94: P≤0.001. Night time activity levels increased from 76 to 81 steps/hour on day 2 after treatment (P<0.05 but this was not maintained: daily milk yields fell by 2%. Using univariate mixed models, year and season, parity and farm all had significant effects on locomotion and activity levels. This treatment for claw horn disease in lame dairy cows improved their immediate health and welfare.

  13. Development of a superconducting claw-pole linear test-rig

    Science.gov (United States)

    Radyjowski, Patryk; Keysan, Ozan; Burchell, Joseph; Mueller, Markus

    2016-04-01

    Superconducting generators can help to reduce the cost of energy for large offshore wind turbines, where the size and mass of the generator have a direct effect on the installation cost. However, existing superconducting generators are not as reliable as the alternative technologies. In this paper, a linear test prototype for a novel superconducting claw-pole topology, which has a stationary superconducting coil that eliminates the cryocooler coupler will be presented. The issues related to mechanical, electromagnetic and thermal aspects of the prototype will be presented.

  14. Using a Phototransduction System to Monitor the Isolated Frog Heart

    Science.gov (United States)

    Stephens, Philip J.

    2015-01-01

    A simple and inexpensive method of monitoring the movement of an isolated frog heart provides comparable results to those obtained with a force transducer. A commercially available photoresistor is integrated into a Wheatstone bridge circuit, and the output signal is interfaced directly with a recording device. An excised, beating frog heart is…

  15. Coleman Revisited: School Segregation, Peers, and Frog Ponds

    Science.gov (United States)

    Goldsmith, Pat Rubio

    2011-01-01

    Students from minority segregated schools tend to achieve and attain less than similar students from White segregated schools. This study examines whether peer effects can explain this relationship using normative models and frog-pond models. Normative models (where peers become alike) suggest that minority schoolmates are a liability. Frog-pond…

  16. Lameness and Claw Lesions of the Norwegian Red Dairy Cattle Housed in Free Stalls in Relation to Environment, Parity and Stage of Lactation

    Directory of Open Access Journals (Sweden)

    Østerås O

    2005-12-01

    Full Text Available Approximately 88% of Norwegian dairy cattle are housed in tie stalls. Free stall housing for all dairy cattle will be implemented within 20 years. This means that the majority of existing stalls will be rebuilt in the near future. Fifty-seven free stall herds of the Norwegian Red breed were randomly selected and 1547 cows and 403 heifers were trimmed by 13 claw trimmers during the late winter and spring of 2002. The claw trimmers had been taught diagnosing and recording of claw lesions. Environment, management- and feeding routines were also recorded. Fifty-three herds had concrete slatted alleys while 4 had solid concrete. Thirty-five herds had concrete as a stall base, while 17 had rubber mats, 2 had wood and 3 had deep litter straw beds. The prevalence of lameness was 1.6% in hind claws. Models for lameness and claw lesions were designed to estimate the influence of different risk factors and to account for the cluster effects within herd and claw trimmer. Detected risk factors for lameness were: parity three and above and narrow cubicles; for heel horn erosions: lactation stage around 5–7 months after calving and solid concrete alleys; for haemorrhages of the white line: lactation stage around 3–5 months after calving and solid concrete alleys; for haemorrhages of the sole: parity one, lactation stage around 5–7 months after calving and short cubicles, for white line fissures: slatted concrete alleys; for asymmetrical claws: parities two and above and for corkscrewed claws: solid concrete alleys. The prevalence of lameness in heifers was low, however 29% had one or more claw lesions. Heifers that were housed in pens or free stalls had more heel-horn erosions, haemorrhages of the sole and white-line fissures than heifers in tie stalls. As new free stalls are being built, it is important to optimise the conditions for claw health.

  17. Lameness and Claw Lesions of the Norwegian Red Dairy Cattle Housed in Free Stalls in Relation to Environment, Parity and Stage of Lactation

    Directory of Open Access Journals (Sweden)

    Sogstad ÅM

    2006-12-01

    Full Text Available Approximately 88% of Norwegian dairy cattle are housed in tie stalls. Free stall housing for all dairy cattle will be implemented within 20 years. This means that the majority of existing stalls will be rebuilt in the near future. Fifty-seven free stall herds of the Norwegian Red breed were randomly selected and 1547 cows and 403 heifers were trimmed by 13 claw trimmers during the late winter and spring of 2002. The claw trimmers had been taught diagnosing and recording of claw lesions. Environment, management- and feeding routines were also recorded. Fifty-three herds had concrete slatted alleys while 4 had solid concrete. Thirty-five herds had concrete as a stall base, while 17 had rubber mats, 2 had wood and 3 had deep litter straw beds. The prevalence of lameness was 1.6% in hind claws. Models for lameness and claw lesions were designed to estimate the influence of different risk factors and to account for the cluster effects within herd and claw trimmer. Detected risk factors for lameness were: parity three and above and narrow cubicles; for heel horn erosions: lactation stage around 5–7 months after calving and solid concrete alleys; for haemorrhages of the white line: lactation stage around 3–5 months after calving and solid concrete alleys; for haemorrhages of the sole: parity one, lactation stage around 5–7 months after calving and short cubicles, for white line fissures: slatted concrete alleys; for asymmetrical claws: parities two and above and for corkscrewed claws: solid concrete alleys. The prevalence of lameness in heifers was low, however 29% had one or more claw lesions. Heifers that were housed in pens or free stalls had more heel-horn erosions, haemorrhages of the sole and white-line fissures than heifers in tie stalls. As new free stalls are being built, it is important to optimise the conditions for claw health.

  18. Tongue adhesion in the horned frog Ceratophrys sp.

    Science.gov (United States)

    Kleinteich, Thomas; Gorb, Stanislav N.

    2014-06-01

    Frogs are well-known to capture elusive prey with their protrusible and adhesive tongues. However, the adhesive performance of frog tongues and the mechanism of the contact formation with the prey item remain unknown. Here we measured for the first time adhesive forces and tongue contact areas in living individuals of a horned frog (Ceratophrys sp.) against glass. We found that Ceratophrys sp. generates adhesive forces well beyond its own body weight. Surprisingly, we found that the tongues adhered stronger in feeding trials in which the coverage of the tongue contact area with mucus was relatively low. Thus, besides the presence of mucus, other features of the frog tongue (surface profile, material properties) are important to generate sufficient adhesive forces. Overall, the experimental data shows that frog tongues can be best compared to pressure sensitive adhesives (PSAs) that are of common technical use as adhesive tapes or labels.

  19. 49 CFR 213.355 - Frog guard rails and guard faces; gage.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Frog guard rails and guard faces; gage. 213.355... Higher § 213.355 Frog guard rails and guard faces; gage. The guard check and guard face gages in frogs... distance between the gage line of a frog to the guard line 1 of its guard rail or guarding face,...

  20. Molecular footprinting of skeletal tissues in the catshark Scyliorhinus canicula and the clawed frog Xenopus tropicalis identifies conserved and derived features of vertebrate calcification

    OpenAIRE

    Enault, Sébastien; Muñoz, David N.; Silva, Willian T. A. F.; Borday-Birraux, Véronique; Bonade, Morgane; Oulion, Silvan; Ventéo, Stéphanie; Marcellini, Sylvain; Debiais-Thibaud, Mélanie

    2015-01-01

    Understanding the evolutionary emergence and subsequent diversification of the vertebrate skeleton requires a comprehensive view of the diverse skeletal cell types found in distinct developmental contexts, tissues, and species. To date, our knowledge of the molecular nature of the shark calcified extracellular matrix, and its relationships with osteichthyan skeletal tissues, remain scarce. Here, based on specific combinations of expression patterns of the Col1a1, Col1a2, and Col2a1 fibrillar ...

  1. Antimutagenic and antiherpetic activities of different preparations from Uncaria tomentosa (cat's claw).

    Science.gov (United States)

    Caon, Thiago; Kaiser, Samuel; Feltrin, Clarissa; de Carvalho, Annelise; Sincero, Thaís Cristine Marques; Ortega, George González; Simões, Cláudia Maria Oliveira

    2014-04-01

    Uncaria tomentosa have been used to treat viral diseases such as herpes due to multiple pharmacological effects, but its therapeutic efficacy against this virus have not been reported yet. Thus, in vitro antiherpetic activity of hydroethanolic extract from barks, purified fractions of quinovic acid glycosides and oxindole alkaloids was evaluated by plaque reduction assay, including mechanistic studies (virucidal, attachment and penetration action). Once exposure to physical agents might lead to reactivation of the herpetic infection, antimutagenic effect (pre-, simultaneous and post-treatment protocols) was also evaluated by Comet assay. The antiherpetic activity from the samples under investigation seemed to be associated with the presence of polyphenols or their synergistic effect with oxindole alkaloids or quinovic acid glycosides, once both purified fractions did not present activity when evaluated alone. Inhibition of viral attachment in the host cells was the main mechanism of antiviral activity. Although both purified fractions displayed the lowest antimutagenic activity in pre and simultaneous treatment, they provided a similar effect to that of cat's claw hydroethanolic extract in post-treatment. Given that purified fractions may result in a reduced antiherpetic activity, the use of cat's claw hydroethanolic extract from barks should be prioritized in order to obtain a synergistic effect. PMID:24447975

  2. Analysis of Torque Ripple Caused by Three-Phase Unbalance in Claw Teeth Motors

    Science.gov (United States)

    Koyama, Takayuki; Nakatsugawa, Junnosuke; Enomoto, Yuji

    A soft magnetic composite (SMC) has some advantages, namely, three-dimensional magnetic isotropy and low eddy current loss. Thus, it can be used to build a new type of motor with a three-dimensional structure, improved space factor of winding improved the power density. A claw teeth motor is one of the motors that have three-dimensional structure, and it is made of an SMC. Due to its structure, the claw teeth motor has an unbalanced three-phase magnetic circuit, which leads to low-order harmonic components in the torque waveform. For reducing the torque ripple, it is important to estimate the magnetic torque and the cogging torque because the total torque is the sum of these torques. In this study a method for decomposing the total torque under the load condition into the magnetic torque and cogging torque is presented. The proposed method can quantitatively estimate low-order harmonic components of the magnetic torque and cogging torque caused by an unbalanced three-phase magnetic circuit for each phase.

  3. Modelling habitat requirements of white-clawed crayfish (Austropotamobius pallipes using support vector machines

    Directory of Open Access Journals (Sweden)

    Favaro L.

    2011-07-01

    Full Text Available The white-clawed crayfish’s habitat has been profoundly modified in Piedmont (NW Italy due to environmental changes caused by human impact. Consequently, native populations have decreased markedly. In this research project, support vector machines were tested as possible tools for evaluating the ecological factors that determine the presence of white-clawed crayfish. A system of 175 sites was investigated, 98 of which recorded the presence of Austropotamobius pallipes. At each site 27 physical-chemical, environmental and climatic variables were measured according to their importance to A. pallipes. Various feature selection methods were employed. These yielded three subsets of variables that helped build three different types of models: (1 models with no variable selection; (2 models built by applying Goldberg’s genetic algorithm after variable selection; (3 models built by using a combination of four supervised-filter evaluators after variable selection. These different model types helped us realise how important it was to select the right features if we wanted to build support vector machines that perform as well as possible. In addition, support vector machines have a high potential for predicting indigenous crayfish occurrence, according to our findings. Therefore, they are valuable tools for freshwater management, tools that may prove to be much more promising than traditional and other machine-learning techniques.

  4. Biodiversity of frog haemoparasites from sub-tropical northern KwaZulu-Natal, South Africa

    OpenAIRE

    Netherlands, Edward C; Cook, Courtney A.; Donnavan J.D. Kruger; Du Preez, Louis H.; Smit, Nico J.

    2015-01-01

    Since South Africa boasts a high biodiversity of frog species, a multispecies haemoparasite survey was conducted by screening the blood from 29 species and 436 individual frogs. Frogs were collected at three localities in sub-tropical KwaZulu-Natal, a hotspot for frog diversity. Twenty per cent of the frogs were infected with at least one of five groups of parasites recorded. Intraerythrocytic parasites comprising Hepatozoon, Dactylosoma, and viral or bacterial organisms, as well as extracell...

  5. The Observation of Frog Species at State University of Malang as a Preliminary Effort on Frog Conservation

    Directory of Open Access Journals (Sweden)

    Dian Ratri Wulandari

    2013-04-01

    Full Text Available Frog is an amphibian which is widely spread around the world. Indonesia houses 450 species which represent 11% of frog species in the world. In Java Island alone, there live 42 species of frogs and toads. Frogs can be used as an environment indicator in that the presence of frog in a particular place indicates that the place stays natural and unpolluted. The 1st Campus of State University of Malang, which is located in the heart of Malang District, has been developing rapidly currently. Thus, it requires the construction of new various facilities to support its huge activities. Extensive construction can be destructive even damaging to the habitat of frog, which potentially threats the frog’s life, if it does not take the environmental impact into careful consideration. This study is aimed to identify the species of frog which survives at State University of Malang with, particularly the frog species found in 1995. Species identification was conducted by observing the morphological character. This study found that there were four species with three species remained survived in 1995; those were Duttaphrynus melanostictus, Polypedates leucomystax, and Kaloula baleta; and one new species called Rana chalconota. This study also revealed that there were four species which were extinct; those were Fejervarya cancrivora, Fejervarya limnocharis, Ingerophrynus biporcatus, and Occidoziga lima. This situation shows the decreasing amount of species from 7 to 4 within the last 17 years. This result indicates that there is a serious environmental degradation which causes the losing of frog habitats. Further research is needed to study the ecological condition changing in order to save the frog species.

  6. The phylogenetic position and diversity of the enigmatic mongrel frog Nothophryne Poynton, 1963 (Amphibia, Anura).

    Science.gov (United States)

    Bittencourt-Silva, Gabriela B; Conradie, Werner; Siu-Ting, Karen; Tolley, Krystal A; Channing, Alan; Cunningham, Michael; Farooq, Harith M; Menegon, Michele; Loader, Simon P

    2016-06-01

    The phylogenetic relationships of the African mongrel frog genus Nothophryne are poorly understood. We provide the first molecular assessment of the phylogenetic position of, and diversity within, this monotypic genus from across its range-the Afromontane regions of Malawi and Mozambique. Our analysis using a two-tiered phylogenetic approach allowed us to place the genus in Pyxicephalidae. Within the family, Nothophryne grouped with Tomopterna, a hypothesis judged significantly better than alternative hypotheses proposed based on morphology. Our analyses of populations across the range of Nothophryne suggest the presence of several cryptic species, at least one species per mountain. Formal recognition of these species is pending but there is a major conservation concern for these narrowly distributed populations in an area impacted by major habitat change. The phylogenetic tree of pyxicephalids is used to examine evolution of life history, ancestral habitat, and biogeography of this group. PMID:27001603

  7. Reversal to air-driven sound production revealed by a molecular phylogeny of tongueless frogs, family Pipidae

    Directory of Open Access Journals (Sweden)

    Glaw Frank

    2011-04-01

    Full Text Available Abstract Background Evolutionary novelties often appear by conferring completely new functions to pre-existing structures or by innovating the mechanism through which a particular function is performed. Sound production plays a central role in the behavior of frogs, which use their calls to delimit territories and attract mates. Therefore, frogs have evolved complex vocal structures capable of producing a wide variety of advertising sounds. It is generally acknowledged that most frogs call by moving an air column from the lungs through the glottis with the remarkable exception of the family Pipidae, whose members share a highly specialized sound production mechanism independent of air movement. Results Here, we performed behavioral observations in the poorly known African pipid genus Pseudhymenochirus and document that the sound production in this aquatic frog is almost certainly air-driven. However, morphological comparisons revealed an indisputable pipid nature of Pseudhymenochirus larynx. To place this paradoxical pattern into an evolutionary framework, we reconstructed robust molecular phylogenies of pipids based on complete mitochondrial genomes and nine nuclear protein-coding genes that coincided in placing Pseudhymenochirus nested among other pipids. Conclusions We conclude that although Pseudhymenochirus probably has evolved a reversal to the ancestral non-pipid condition of air-driven sound production, the mechanism through which it occurs is an evolutionary innovation based on the derived larynx of pipids. This strengthens the idea that evolutionary solutions to functional problems often emerge based on previous structures, and for this reason, innovations largely depend on possibilities and constraints predefined by the particular history of each lineage.

  8. Landing on branches in the frog Trachycephalus resinifictrix (Anura: Hylidae).

    Science.gov (United States)

    Bijma, Nienke N; Gorb, Stanislav N; Kleinteich, Thomas

    2016-04-01

    Frogs (Lissamphibia: Anura) are famous for their saltatory or hopping locomotion, which is related to numerous anatomical specialisations that are characteristic for the group. However, while the biomechanics of take-off in frogs have been studied in detail, much less is known on how frogs land after a jump. Besides terrestrial and aquatic species, several lineages of frogs adopted an arboreal lifestyle and especially the biomechanics of landing on challenging, small, and unpredictable substrates, such as leaves or branches, are virtually unknown. Here we studied the landing kinematics of the arboreal frog Trachycephalus resinifictrix (Hylidae) on a wooden stick that was used to mimic a small tree branch. We observed two different landing behaviours: (1) landing on the abdomen and (2) attachment with the toes of either the forelimb or the hindlimb. In the latter case, the frogs performed a cartwheel around the stick, while they were only attached by their adhesive toe pads. We estimated the forces that act on the toes during this behaviour to be up to fourteen times the body weight of the animals. This behaviour demonstrates the remarkable adhesive capabilities of the toe pads and the body control of the frogs. PMID:26803830

  9. Frog community responses to recent American bullfrog invasions

    Institute of Scientific and Technical Information of China (English)

    Yiming LI; Zhunwei KE; Yihua WANG; Tim M. BLACKBURN

    2011-01-01

    Native species may decline quickly when confronted with an exotic species to which they are not adapted. The extent of decline may depend on the abundance of an invader and the length of time since it first arrived in the community (residence time), and the interaction between these two variables. We tested these effects using data on the effects of American bullfrog Lithobates catesbeianus invasion on native frog communities in 65 permanent lentic waters on islands in the Zhoushan Archipelago, China. We examined variation in native frog abundance and species richness in relation to features of the American bullfrog invasion, habitat disturbance, characteristics of the water body and fish communities and the presence of red swamp crayfish.Bullfrog invaded sites had lower native frog density and species richness, higher submerged vegetation cover and greater frequency of repairs to the water body than did non-invaded sites. The minimum adequate general linear mixed models showed that both native frog density and species richness were negatively related to post-metamorphosis bullfrog density, and that native frog species richness was also positively related to the vegetation cover. There was no effect on either native frog density or species richness of residence time or its interaction with bullfrog density, or of the abundance of bullfrog tadpoles. The results suggested that post-metamorphosis bullfrogs had impacts on native frog communities in the islands, and that the extents of these impacts are proportional to post-metamorphosis bullfrog density.

  10. Unigene BLAST: CBRC-PMAR-01-0433 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0433 gnl|UG|Pma#S35051446 PMAD-aap78e15.b1 Lamprey_WGS_pCMV-sport6 Petromyzon marin ... 1193 creatine kinase (EC 2.7.3.2) - African clawed frog ... (fragment), mRNA sequence /clone_end=3' /gb=DW0204 ...

  11. Gene : CBRC-PMAR-01-0107 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0107 Novel UN A Family fz/smo receptors FZD2_MOUSE 0.0 78% ref|XP_001375019.1| PRED ... e protein precursor (clone X0286) - African clawed frog , mRNA sequence /clone_end=3' /gb=DW020364 /gi=8366 ...

  12. Gene : CBRC-OANA-01-0995 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0995 pseudo Novel UN A Pheromone receptors V2R1B_MOUSE 4e-73 49% ref|XP_001520642.1 ... n 1 pir|FRXL ferritin heavy chain - African clawed frog ... gb|AAA49708.1| ferritin heavy chain gb|AAH44961.1| ...

  13. Gene : CBRC-OANA-01-2268 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-2268 pseudo Novel UN A Pheromone receptors V2R1B_MOUSE 2e-86 55% ref|XP_001520642.1 ... n 1 pir|FRXL ferritin heavy chain - African clawed frog ... gb|AAA49708.1| ferritin heavy chain gb|AAH44961.1| ...

  14. Gene : CBRC-DDIS-02-0170 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DDIS-02-0170 Novel 2 C UNKNOWN KCC1D_MOUSE 6e-45 40% ref|XP_643776.1| putative protein seri ... 52341.1| similar to Xenopus laevis (African clawed frog ). Calcium/calmodulin-dependent protein kinase I al ...

  15. Gene : CBRC-DDIS-02-0021 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DDIS-02-0021 2 D UNKNOWN VHS3_YEAST 6e-32 70% ref|XP_645491.1| hypothetical protein DDBDRAF ... 38907.1| similar to Xenopus laevis (African clawed frog ). Protein kinase C and casein kinase substrate in ...

  16. Unigene BLAST: CBRC-OLAT-20-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-20-0023 gnl|UG|Ola#S14467333 AU177041 Sugano-Kawakami 5' end enriched cDNA library (OL ... pir|A28172| spasmolysin precursor - African clawed frog , mRNA sequence /clone=OLa24.11c /clone_end=5' /gb= ...

  17. Unigene BLAST: CBRC-OANA-01-0218 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0218 gnl|UG|Oan#S36549892 KAAN-aaa65f06.b1 Platypus_EST_Cell_line_1.0-4.0kb Ornitho ... e protein precursor (clone X0286) - African clawed frog , mRNA sequence /gb=EH003490 /gi=118079919 /ug=Oan. ...

  18. Unigene BLAST: CBRC-PMAR-01-0107 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0107 gnl|UG|Pma#S35051349 PMAD-aap76d05.b1 Lamprey_WGS_pCMV-sport6 Petromyzon marin ... e protein precursor (clone X0286) - African clawed frog , mRNA sequence /clone_end=3' /gb=DW020364 /gi=8366 ...

  19. Unigene BLAST: CBRC-OANA-01-0680 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0680 gnl|UG|Oan#S36549892 KAAN-aaa65f06.b1 Platypus_EST_Cell_line_1.0-4.0kb Ornitho ... e protein precursor (clone X0286) - African clawed frog , mRNA sequence /gb=EH003490 /gi=118079919 /ug=Oan. ...

  20. Gene : CBRC-OANA-01-1551 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-1551 pseudo Novel UN A Pheromone receptors V2R1B_MOUSE 2e-59 44% ref|XP_001520690.1 ... n 1 pir|FRXL ferritin heavy chain - African clawed frog ... gb|AAA49708.1| ferritin heavy chain gb|AAH44961.1| ...

  1. Unigene BLAST: CBRC-OLAT-20-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-20-0023 gnl|UG|Ola#S14467278 AU176944 Sugano-Kawakami 5' end enriched cDNA library (OL ... pir|A28172| spasmolysin precursor - African clawed frog , mRNA sequence /clone=OLa23.05c /clone_end=5' /gb= ...

  2. Unigene BLAST: CBRC-OANA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0195 gnl|UG|Oan#S36549892 KAAN-aaa65f06.b1 Platypus_EST_Cell_line_1.0-4.0kb Ornitho ... e protein precursor (clone X0286) - African clawed frog , mRNA sequence /gb=EH003490 /gi=118079919 /ug=Oan. ...

  3. Gene : CBRC-OANA-01-0430 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0430 Novel UN B Family 2 (B) receptors CALRL_RAT 5e-35 93% ref|NP_001080206.1| calc ... pir|R3XL3A ribosomal protein S3a - African clawed frog ... emb|CAA40592.1| ribosomal protein S1a [Xenopus lae ...

  4. Cancer and African Americans

    Science.gov (United States)

    ... Population Profiles > Black/African American > Cancer Cancer and African Americans African Americans have the highest mortality rate ... 65MB] At a glance – Top Cancer Sites for African Americans (2008-2012) Cancer Incidence Rates per 100, ...

  5. Amphibian pathogens in Southeast Asian frog trade.

    Science.gov (United States)

    Gilbert, Martin; Bickford, David; Clark, Leanne; Johnson, Arlyne; Joyner, Priscilla H; Ogg Keatts, Lucy; Khammavong, Kongsy; Nguyễn Văn, Long; Newton, Alisa; Seow, Tiffany P W; Roberton, Scott; Silithammavong, Soubanh; Singhalath, Sinpakhone; Yang, Angela; Seimon, Tracie A

    2012-12-01

    Amphibian trade is known to facilitate the geographic spread of pathogens. Here we assess the health of amphibians traded in Southeast Asia for food or as pets, focusing on Batrachochytrium dendrobatidis (Bd), ranavirus and general clinical condition. Samples were collected from 2,389 individual animals at 51 sites in Lao PDR, Cambodia, Vietnam and Singapore for Bd screening, and 74 animals in Cambodia and Vietnam for ranavirus screening. Bd was found in one frog (n = 347) in Cambodia and 13 in Singapore (n = 419). No Bd was found in Lao PDR (n = 1,126) or Vietnam (n = 497), and no ranavirus was found in Cambodia (n = 70) or Vietnam (n = 4). Mild to severe dermatological lesions were observed in all East Asian bullfrogs Hoplobatrachus rugolosus (n = 497) sampled in farms in Vietnam. Histologic lesions consistent with sepsis were found within the lesions of three frogs and bacterial sepsis in two (n = 4); one had Gram-negative bacilli and one had acid-fast organisms consistent with mycobacterium sp. These results confirm that Bd is currently rare in amphibian trade in Southeast Asia. The presence of Mycobacterium-associated disease in farmed H. rugolosus is a cause for concern, as it may have public health implications and indicates the need for improved biosecurity in amphibian farming and trade. PMID:23404036

  6. Autometallographic tracing of mercury in frog liver

    International Nuclear Information System (INIS)

    The distribution of mercury in the liver of the frog Rana ridibunda with the autometallographic method was investigated. The mercury specific autometallographic (HgS/SeAMG) technique is a sensitive histochemical approach for tracing mercury in tissues from mercury-exposed organisms. Mercury accumulates in vivo as mercury sulphur/mercury selenium nanocrystals that can be silver-enhanced. Thus, only a fraction of the Hg can be visualized. Six animals were exposed for one day and another group of six animals for 6 days in 1 ppm mercury (as HgCI2 ) dissolved in fresh water. A third group of six animals, served as controls, were sacrificed the day of arrival at the laboratory. First, mercury appears in the blood plasma and erythrocytes. Next, mercury moves to hepatocytes and in the apical part of the cells, that facing bile canaliculi. In a next step, mercury appears in the endothelial and Kupffer cells. It seems likely that, the mercury of hepatocytes moves through bile canaliculi to the gut, most probably bound to glutathione and/or other similar ligands. Most probably, the endothelial and Kupffer cells comprise the first line of defense against metal toxicity. - Frogs can be good bioindicators of mercury

  7. A Record of Small-Clawed Otters (Aonyx cinereus Foraging on an Invasive Pest Species, Golden Apple Snails (Pomacea canaliculata in a West Sumatra Rice Field

    Directory of Open Access Journals (Sweden)

    Jabang

    2011-01-01

    Full Text Available A small-clawed otter (Aonyx cinereus survey in West Sumatran rice fields was conducted from April to September 2010. During this survey, golden apple snail (Pomacea canaliculata shell remains were found on a rice field bank as suspected prey remains of small-clawed otters. This suspicion was later proved by the occurrence of snail material (pieces of operculum and shell in otter spraints. This is the first evidence of small-clawed otters foraging on this invasive pest species. Characteristics of the shell remains and spraints are described.

  8. Elastic modulus of tree frog adhesive toe pads

    OpenAIRE

    Barnes, W. Jon. P.; Goodwyn, Pablo J. Perez; Nokhbatolfoghahai, Mohsen; Gorb, Stanislav N.

    2011-01-01

    Previous work using an atomic force microscope in nanoindenter mode indicated that the outer, 10- to 15-μm thick, keratinised layer of tree frog toe pads has a modulus of elasticity equivalent to silicone rubber (5–15 MPa) (Scholz et al. 2009), but gave no information on the physical properties of deeper structures. In this study, micro-indentation is used to measure the stiffness of whole toe pads of the tree frog, Litoria caerulea. We show here that tree frog toe pads are amongst the softes...

  9. Analysis of behavioral changes in dairy cows associated with claw horn lesions.

    Science.gov (United States)

    Nechanitzky, K; Starke, A; Vidondo, B; Müller, H; Reckardt, M; Friedli, K; Steiner, A

    2016-04-01

    Detecting lame cows is important in improving animal welfare. Automated tools are potentially useful to enable identification and monitoring of lame cows. The goals of this study were to evaluate the suitability of various physiological and behavioral parameters to automatically detect lameness in dairy cows housed in a cubicle barn. Lame cows suffering from a claw horn lesion (sole ulcer or white line disease) of one claw of the same hind limb (n=32; group L) and 10 nonlame healthy cows (group C) were included in this study. Lying and standing behavior at night by tridimensional accelerometers, weight distribution between hind limbs by the 4-scale weighing platform, feeding behavior at night by the nose band sensor, and heart activity by the Polar device (Polar Electro Oy, Kempele, Finland) were assessed. Either the entire data set or parts of the data collected over a 48-h period were used for statistical analysis, depending upon the parameter in question. The standing time at night over 12 h and the limb weight ratio (LWR) were significantly higher in group C as compared with group L, whereas the lying time at night over 12 h, the mean limb difference (△weight), and the standard deviation (SD) of the weight applied on the limb taking less weight were significantly lower in group C as compared with group L. No significant difference was noted between the groups for the parameters of heart activity and feeding behavior at night. The locomotion score of cows in group L was positively correlated with the lying time and △weight, whereas it was negatively correlated with LWR and SD. The highest sensitivity (0.97) for lameness detection was found for the parameter SD [specificity of 0.80 and an area under the curve (AUC) of 0.84]. The highest specificity (0.90) for lameness detection was present for Δweight (sensitivity=0.78; AUC=0.88) and LWR (sensitivity=0.81; AUC=0.87). The model considering the data of SD together with lying time at night was the best

  10. Aphakia correction with retropupillary fixated iris-claw lens (Artisan – long-term results

    Directory of Open Access Journals (Sweden)

    Schallenberg M

    2013-12-01

    Full Text Available Maurice Schallenberg,1,2 Dirk Dekowski,1 Angela Hahn,1 Thomas Laube,1,3 Klaus-Peter Steuhl,1 Daniel Meller11Department of Ophthalmology, University Hospital Essen, University of Duisburg-Essen, Essen, Germany; 2HELIOS Klinikum Wuppertal, Wuppertal, Germany; 3Zentrum für Augenheilkunde PD Dr Laube, Düsseldorf, GermanyPurpose: To evaluate the technique, safety, and efficacy of the retropupillary implantation of iris-claw intraocular lenses in a long-term follow-up study.Patients and methods: This retrospective study included 31 eyes of 31 patients who underwent an Artisan aphakic intraocular lens implantation between January 2006 and February 2011 at the University Hospital Essen, Essen, Germany and at the Zentrum für Augenheilkunde PD Dr Laube, Düsseldorf, Germany. Preoperative data collected included demographics, etiology of aphakia, previous surgeries, preoperative eye pathology, intraocular pressure, clinical signs of endothelial cell loss, and best corrected visual acuity. Operative data and postoperative outcomes included the best corrected visual acuity, lens position, intraocular pressure, pigment dispersion, clinical signs of endothelial cell loss, development of macular edema, and other complications.Results: Thirty-one patients were included. The mean follow-up was 25.2 months (range: 4–48 months. The mean best corrected visual acuity postoperatively was 0.64 logarithm of the minimum angle of resolution (logMAR and varied from 0 logMAR to 3 logMAR. Some patients had a low visual acuity preoperatively because of preoperative eye pathologies. In 22 patients the visual acuity improved, in two patients the visual acuity remained unchanged, and seven patients showed a decreased visual acuity. Complications were peaked pupils (n=10 and retinal detachment in one case. Four patients showed an iris atrophy and high intraocular pressure was observed only in one patient. Subluxation of the intraocular lens, endothelial cell loss, and

  11. Claws Out

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    In its November 2007 issue,U.S.magazine Science published a photo named"flat cat?"and a column titled"Rare-Tiger Photo Flap Makes Fur Fly in China."The article dealt with the claimed discovery of the South China tiger,which had been believed extinct in the wild.The photo as well as the article stirred up the already heated controversy in China as to whether the photo was a fake or not.

  12. Performance Measurements of a Low Specific Speed TurboClaw® Compressor

    Science.gov (United States)

    Parra, J.; Cattell, R.; Etemad, S.; Pullen, K. R.

    2015-08-01

    Low specific speed compressors have been historically based on positive displacement machines. Attempts to bring advantages of turbomachinery such as oil free, low parts counts, low cost of manufacture, and reliability to low flow rate applications have not been sparse, but the principle difficulty has always been that the conventional turbomachine design operates at ultra-high speed to deliver low volume flow rates. This is synonymous with low efficiency due to higher losses (windage, surface finish, and tip clearances). The innovative TurboClaw® design is a low specific speed turbomachinery with forward swept impeller geometry. It owes its high efficiency and operational stability to careful design of its nearly tangential forward swept blading and diffuser geometry.

  13. Social partner discrimination based on sounds and scents in Asian small-clawed otters ( Aonyx cinereus)

    Science.gov (United States)

    Lemasson, A.; Mikus, M.-A.; Blois-Heulin, C.; Lodé, T.

    2013-03-01

    Ability to discriminate familiar conspecifics is an essential competence in any group-living species, ensuring socio-spatial cohesion, but in many animals, such as mustelids, the relative importance of the different communicative modalities for discrimination is poorly understood. In otters, there is evidence of intra-specific variation in physical appearance and in feces chemical profile, but the potential for acoustic identity coding as well as for identity decoding in visual, acoustic and olfactive domains remains unexplored. We investigated the acoustic structure of contact calls in five captive groups of small-clawed otters and found that it is possible to reliably assign one particular call to a given adult male caller. Females discriminated between familiar and unfamiliar adult males based on their sound (playback) and smell (feces) but not based on their picture, suggesting abilities to memorize and use acoustic and olfactive signatures in their daily social life.

  14. Implantation of iris-claw Artisan intraocular lens for aphakia in Fuchs′ heterochromic iridocyclitis

    Directory of Open Access Journals (Sweden)

    Ahmad Kheirkhah

    2014-01-01

    Full Text Available Implantation of iris-claw Artisan intraocular lens (IOL is a surgical option for correction of aphakia; however, these IOLs have not been used in eyes with uveitis including Fuchs′ heterochromic iridocyclitis (FHI due to possible risk of severe postoperative intraocular inflammation. In the case reported here, we secondarily implanted an Artisan IOL in a 28-year-old man with FHI who had aphakia with no capsular support due to a previous complicated cataract surgery. Enclavation was easily performed and no intraoperative complication was noted. Postoperative course was uneventful with no significant anterior chamber inflammation during 12 months of follow-up. Although there were few deposits on the IOL surface, the patient achieved a best-corrected visual acuity of 20/20 without developing glaucoma or other complications. Therefore, Artisan IOL may be considered for correction of aphakia in patients with FHI. However, studies on large number of patients are required to evaluate safety of the procedure.

  15. The GeoClaw software for depth-averaged flows with adaptive refinement

    Science.gov (United States)

    Berger, Marsha J.; George, David L.; LeVeque, Randall J.; Mandli, Kyle T.

    2011-09-01

    Many geophysical flow or wave propagation problems can be modeled with two-dimensional depth-averaged equations, of which the shallow water equations are the simplest example. We describe the GeoClaw software that has been designed to solve problems of this nature, consisting of open source Fortran programs together with Python tools for the user interface and flow visualization. This software uses high-resolution shock-capturing finite volume methods on logically rectangular grids, including latitude-longitude grids on the sphere. Dry states are handled automatically to model inundation. The code incorporates adaptive mesh refinement to allow the efficient solution of large-scale geophysical problems. Examples are given illustrating its use for modeling tsunamis and dam-break flooding problems. Documentation and download information is available at www.clawpack.org/geoclaw.

  16. The GeoClaw software for depth-averaged flows with adaptive refinement

    CERN Document Server

    Berger, Marsha J; LeVeque, Randall J; Mandli, Kyle

    2010-01-01

    Many geophysical flow or wave propagation problems can be modeled with two-dimensional depth-averaged equations, of which the shallow water equations are the simplest example. We describe the GeoClaw software that has been designed to solve problems of this nature, consisting of open source Fortran programs together with Python tools for the user interface and flow visualization. This software uses high-resolution shock-capturing finite volume methods on logically rectangular grids, including latitude--longitude grids on the sphere. Dry states are handled automatically to model inundation. The code incorporates adaptive mesh refinement to allow the efficient solution of large-scale geophysical problems. Examples are given illustrating its use for modeling tsunamis, dam break problems, and storm surge. Documentation and download information is available at www.clawpack.org/geoclaw

  17. Bovine tuberculosis in an Asian small-clawed otter (Aonyx cinerea) in the Republic of Korea.

    Science.gov (United States)

    Lee, Hyunkyoung; Kim, Jae-Myung; Jang, Yunho; Lee, Kyunghyun; Baek, Kanghyun; Lee, Boram; Kim, Ha-Young; Lee, Myoung-Heon; Ryoo, Soyoon; Bae, You-Chan; Choi, Eun-Jin; So, ByungJae

    2015-09-01

    Bovine tuberculosis caused by Mycobacterium bovis has a wide range of hosts including cattle and humans, but its incidence in otters is very rare. Our report describes a case of bovine tuberculosis in an Asian small-clawed otter (Aonyx cinerea). A deceased female otter ~2-3 years of age that was raised in an aquarium was submitted to the Animal and Plant Quarantine Agency (Anyang, Republic of Korea) for autopsy in June 2013. Following gross pathological examination, many white nodules were observed in the lungs and mesentery. The nodules showed central necrosis infiltrated with lymphocytes and macrophages and surrounded by fibrous tissue. Acid-fast bacteria were detected in the necrotic foci, but no fungi were observed. Molecular analysis led to the detection of M. bovis, which is identified in otters in some European countries such as Spain and France. PMID:26289719

  18. WHITE-CLAWED CRAYFISH IN MUDDY HABITATS: MONITORING THE POPULATION IN THE RIVER IVEL, BEDFORDSHIRE, UK

    Directory of Open Access Journals (Sweden)

    PEAY S.

    2006-01-01

    Full Text Available White-clawed crayfish Austropotamobius pallipes are usually associated with stony substrates, tree roots, or refuges in submerged banks. The River Ivel has the last known population of white-clawed crayfish in Bedfordshire. Prior to 2005, much of the bed comprised uniform silt, plus leaf-litter. Stands of reedmace Typha latifolia and other emergent vegetation were localised in less shaded areas. Initial survey results suggested a population at low abundance. A low-cost monitoring strategy was started in 2001 and continued three times a year to 2005, using engineering bricks, which offer artificial refuges. Crayfish are counted when bricks are lifted periodically. De-silting of c. 430 m river was carried out in February 2005, to improve habitat and to maintain the flood capacity in the channel upstream of a mill weir. Additional bricks were deployed a few weeks in advance of de-silting, then bricks and crayfish were lifted prior to dredging and were returned the next day. Starting upstream, soft, wet mud was dredged out, placed on the bank and searched manually for crayfish. Banks, tree roots and shallow margins were left undisturbed. In all, 4,142 crayfish were found in dredgings from a 430 m length of the mid channel. Crayfish were strongly associated with emergent vegetation, but many were present below the surface of the silt. Crayfish released in the dredged channel immediately burrowed into the silt retained on the channel margins. Monitoring after dredging showed no change in abundance in the main area with in-bank refuges and lots of bricks, but there was an increase in occupancy of bricks in an area where most crayfish had been in emergent vegetation.

  19. Asian small-clawed otters (Amblonyx cinerea): resting and swimming metabolic rates.

    Science.gov (United States)

    Borgwardt, N; Culik, B M

    1999-03-01

    Open-flow oxygen and carbon dioxide respirometry was used in Neumünster Zoo (Germany) to examine the energy requirements of six Asian small-clawed otters (Amblonyx cinerea) at rest and swimming voluntarily under water. Our aim was to compare their energy requirements with those of other warm-blooded species to elucidate scale effects and to test whether the least aquatic of the three otter species differs markedly from these and its larger relatives. While at rest on land (16 degrees C, n = 26), otters (n = 6, mean body mass 3.1 +/- 0.4 kg) had a respiratory quotient of 0.77 and a resting metabolic rate of 5.0 +/- 0.8 Wkg-1(SD). This increased to 9.1 +/- 0.8 Wkg-1 during rest in water (11-15 degrees C, n = 4) and to 17.6 +/- 1.4 Wkg-1 during foraging and feeding activities in a channel (12 degrees C, n = 5). While swimming under water (n = 620 measurements) in an 11-m long channel, otters preferred a speed range between 0.7 ms-1 and 1.2 ms-1. Transport costs were minimal at 1 ms-1 and amounted to 1.47 +/- 0.24 JN-1 m-1 (n = 213). Metabolic rates of small-clawed otters in air were similar to those of larger otter species, and about double those of terrestrial mammals of comparable size. In water, metabolic rates during rest and swimming were larger than those extrapolated from larger otter species and submerged swimming homeotherms. This is attributed to high thermoregulatory costs, and high body drag at low Reynolds numbers. PMID:10227184

  20. Coldwater NWR Malformed Frog Survey Data 2008-2010

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Data set contains information concerning surveys for malformed frog collections on Coldwater NWR and the Harris Tract, in MS from 20082010. Data were collected as...

  1. Frog: The fast and realistic OpenGL event displayer

    International Nuclear Information System (INIS)

    FROG is a generic framework dedicated to visualisation of events in high energy physics experiment. It is suitable to any particular physics experiment or detector design. The code is light (< 3 MB) and fast (browsing time ∼ 20 events per second for a large High Energy Physics experiment) and can run on various operating systems, as its object-oriented structure (C++) relies on the cross-platform OpenGL and Glut libraries. Moreover, Frog does not require installation of heavy third party libraries for the visualisation. This documents describes the features and principles of Frog version 1.106, its working scheme and numerous functionalities such as: 3D and 2D visualisation, graphical user interface, mouse interface, configuration files, production of pictures of various format, integration of personal objects, etc. Finally the application of FROG for physic experiment/environement, such as Gastof, CMS, ILD, Delphes will be presented for illustration.

  2. FROG: The Fast And Realistic OpenGL Event Displayer

    CERN Document Server

    Quertenmont, Loic

    2009-01-01

    FROG [1] [2] is a generic framework dedicated to visualisation of events in high energy experiment. It is suitable to any particular physics experiment or detector design. The code is light (< 3 MB) and fast (browsing time 20 events per second for a large High Energy Physics experiment) and can run on various operating systems, as its object-oriented structure (C++) relies on the cross-platform OPENGL [3] and GLUT [4] libraries. Moreover, FROG does not require installation of third party libraries for the visualisation. This documents describes the features and principles of FROG version 1.106, its working scheme and numerous functionalities such as: 3D and 2D visualisation, graphical user interface, mouse interface, configuration files, production of pictures of various format, integration of personal objects, etc. Finally the application of FROG for physic experiment/environement, such as Gastof, CMS, ILD, Delphes will be presented for illustration.

  3. Unscheduled DNA synthesis in frog lens at 50C

    International Nuclear Information System (INIS)

    Unscheduled DNA labeling occurs in the frog even at low temperatures. It is concluded tentatively that UV-induced labeling observed in cold incubated lenses represents repair synthesis of DNA. (author)

  4. 10 years of activities for the Framatome Owners Group (FROG)

    International Nuclear Information System (INIS)

    FROG (Framatome owners group) was created in 1991 by 5 electricity producers Electrabel (Belgium), EDF (France), ESKOM (South-Africa), GNPJVC (Daya bay China) and KEPCO (South-Korea), since then 2 other members joined the group Vattenfall (Sweden) and LANPC ( Ling-Ao China). All the members agree to share their experience in operating nuclear reactors designed by Framatome, FROG members represent more than 80 nuclear units. FROG wants to promote the exchange of information between its members in order to improve performances in a broad sense (safety, techniques, costs and management). The FROG committee opened its 20. meeting last year in Lyon (France), among the different topics that were discussed we have: -) a review of the main events that occurred in nuclear power plants, -) actions to reduce the stress on reactor staff, -) the shortening of downtimes, -) the comparison of production costs, and -) the in-line 3-dimensional monitoring of the nuclear core. (A.C.)

  5. Dahomey NWR Malformed Frog Survey Data 2003-2004

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Data set contains information concerning surveys for malformed frog collections on Dahomey NWR in MS from 20032004. Data were collected as part of the national...

  6. Final Critical Habitat for Oregon Spotted Frog (Rana pretiosa)

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — These data identify, in general, the areas of FINAL critical habitat for Rana pretiosa (Oregon Spotted Frog). Maps published in the Federal Register 2016.

  7. Endangered Frogs Coexist with Fungus Once Thought Fatal

    OpenAIRE

    Retallick, Richard W. R; Hamish McCallum; Rick Speare

    2004-01-01

    The chytrid fungus Batrachochytrium dendrobatidis has been implicated in the decline and extinction of numerous frog species worldwide. In Queensland, Australia, it has been proposed as the cause of the decline or apparent extinction of at least 14 high-elevation rainforest frog species. One of these, Taudactylus eungellensis, disappeared from rainforest streams in Eungella National Park in 1985-1986, but a few remnant populations were subsequently discovered. Here, we report the analysis of ...

  8. Cross-modal integration in a dart-poison frog

    OpenAIRE

    Narins, Peter M.; Grabul, Daniela S.; Soma, Kiran K.; Gaucher, Philippe; Hödl, Walter

    2005-01-01

    The mechanisms by which the brain binds together inputs from separate sensory modalities to effect a unified percept of events are poorly understood. This phenomenon was studied in males of the dart-poison frog Epipedobates femoralis. These animals physically and vigorously defend their territories against conspecific calling intruders. In prior field studies with an electromechanical model frog, we were able to experimentally evoke this aggressive behavior only when an auditory cue (advertis...

  9. Sophisticated Communication in the Brazilian Torrent Frog Hylodes japi

    OpenAIRE

    Fábio P de Sá; Juliana Zina; Célio F. B. Haddad

    2016-01-01

    Intraspecific communication in frogs plays an important role in the recognition of conspecifics in general and of potential rivals or mates in particular and therefore with relevant consequences for pre-zygotic reproductive isolation. We investigate intraspecific communication in Hylodes japi, an endemic Brazilian torrent frog with territorial males and an elaborate courtship behavior. We describe its repertoire of acoustic signals as well as one of the most complex repertoires of visual disp...

  10. Phosphonoacetic Acid Inhibition of Frog Virus 3 Replication

    OpenAIRE

    Elliott, R. M.; Bateson, A.; Kelly, D C

    1980-01-01

    Phosphonoacetic acid at concentrations above 200 μg/ml inhibited the replication of frog virus 3 in BHK cells. The inhibition of viral DNA replication observed in these cells was reversible and correlated with the inhibition of the virus-induced DNA polymerase activity in an in vitro assay. The synthesis of frog virus 3-induced late or γ polypeptides was also inhibited by phosphonoacetic acid, although the early (α and β) polypeptides were unaffected.

  11. A Method for Mechanism Analysis of Frog Swimming Based on Motion Observation Experiments

    OpenAIRE

    , Wei Zhang; Jizhuang Fan; Yanhe Zhu; Yulong Qiu; Jie Zhao

    2014-01-01

    For understanding the mechanism of frog swimming under water and designing a frog-inspired swimming robot, kinematics of the frog body and trajectories of joints should be obtained. In this paper, an aquatic frog, Xenopus laevis, was chosen for analysis of swimming motions which were recorded by a high speed camera, and kinematic data were processed in a swimming data extraction platform. According to the shape features of the frog, we propose a method that the frog eyes are set as the natura...

  12. Frogs Communicate by Means of Ultrasonic Sounds

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    @@ People are always fascinated by ways that some members of mammalian species (such as dolphins, bats and some rodents) communicate using sounds that we cannot hear. But think twice if you say the capacity of producing and detecting ultrasounds (frequencies greater than 20kHz) is limited to mammalians. A study implemented by Prof. SHEN Junxian from the CAS Institute of Biophysics (IBP) and colleagues in CAS and abroad showed that a rare frog species in China should also be added to that list. It is the first documented case of a non-mammalian species being able to use ultrasonic communication. Their work was reported in the March 16 issue of the journal Nature.

  13. Reproductive ecology of Sichuan digging frogs (Microhylidae: Kaloula rugifera

    Directory of Open Access Journals (Sweden)

    Wei Chen

    2015-06-01

    Full Text Available Abstract. We investigated the reproductive ecology of Sichuan digging frogs (Microhylidae: Kaloula rugifera in Mianyang, China during the wet season of 2013. Male Sichuan digging frogs first appear at temporary ponds following the first heavy rain of the wet season and initiate calling. Females arrive at ponds shortly after males. Male frogs chorus extensively throughout the wet season during the evenings and nights following rainstorms. Female frogs leave the pond after laying eggs, and likely only lay one clutch annually. Amplexus lasted up to three hours. Females were larger than males in terms of body size, but we found no evidence of size-assortative mating. Clutch size varied from 920 to 2200 eggs, with egg diameter ranging from 1.33 to 1.93 mm. Larger female frogs laid more eggs, and there was no correlation between egg number and egg size. Tadpoles hatched from eggs within 18-20 hours of oviposition, and grew for 30-40 days before complete metamorphosis occurred. The initial body length of tadpoles ranged from 3-5 mm snout-vent length. Growth was fastest immediately after hatching, and declined asymptotically with increasing tadpole body size. Overall, Sichuan digging frogs have a breeding biology characterized by strong male-male competition with prolonged breeding coinciding with the annual wet season. Keywords. Breeding ecology; Kaloula rugifera; life history; mating system

  14. African dance

    OpenAIRE

    Mumberson, Stephen

    2012-01-01

    The RE Open will be shown at the Mall Gallery London and the international section was judged by major practitioners and educators, print dealers and collectors, President of RE and Keeper of the Ashmolean Museum Dr Bren Unwin, John Purcell, Deborah Roslund, Colin Harrison, Dave Ferry, and Mark Hampson. Piece selected "African Dance" print.

  15. Granulocytes of the red claw crayfish Cherax quadricarinatus can endocytose beads, E. coli and WSSV, but in different ways.

    Science.gov (United States)

    Duan, Hu; Jin, Songjun; Zhang, Yan; Li, Fuhua; Xiang, Jianhai

    2014-10-01

    The hemocytes of the red claw crayfish Cherax quadricarinatus are classified by morphologic observation into the following types: hyalinocytes (H), semi-granulocytes (SG) and granulocytes (G). Density gradient centrifugation with Percoll was developed to separate these three subpopulations of hemocytes. Beads, Escherichia coli, and FITC labeling WSSV were used to investigate the characteristics of granulocytes by using scanning electron microscope, transmission electron microscope, and laser scan confocal microscope. Results showed that granulocytes could phagocytose beads and E. coli by endocytic pathways. WSSV could rely on caveolae-mediated endocytosis to mainly enter into granulocytes. These results could elucidate the mechanism of the innate immunity function of granulocytes, and it also showed the mechanism by which WSSV invaded granulocytes in the red claw crayfish. PMID:24747430

  16. Clinical canine parvovirus type 2C infection in a group of Asian small-clawed otters (Aonyx cinerea).

    Science.gov (United States)

    Gjeltema, Jenessa; Murphy, Hayley; Rivera, Sam

    2015-03-01

    Despite the occurrence of clinical disease in a wide range of carnivore hosts, only vague accounts of clinical canine parvovirus type 2 (CPV-2) in any otter species have been reported in the literature. Over the course of 25 days, nine Asian small-clawed otters (Aonyx cinerea) presented for evaluation of inappetence, lethargy, vomiting, and diarrhea. A diagnosis of canine parvovirus type 2c was made based on electron microscopy, polymerase chain reaction, and DNA sequencing of group fecal samples. Supportive care was provided based on individual clinical assessment and included subcutaneous crystalline fluid therapy, antiemetics, antibiotics, appetite stimulants, and a neuraminidase inhibitor. Five of the nine otters exhibited moderate to severe disease requiring treatment, and one case was fatal despite supportive efforts. In light of this case report, CPV-2 should be recognized as a potential cause of gastrointestinal disease in Asian small-clawed otters. PMID:25831584

  17. EXTRACORPOREAL SHOCK WAVE LITHOTRIPSY AND ENDOSCOPIC URETERAL STENT PLACEMENT IN AN ASIAN SMALL-CLAWED OTTER (AONYX CINEREA) WITH NEPHROLITHIASIS.

    Science.gov (United States)

    Wojick, Kimberlee B; Berent, Allyson C; Weisse, Chick W; Gamble, Kathryn C

    2015-06-01

    Urolithiasis is a significant disease concern in Asian small-clawed otters (Aonyx cinerea), with over 60% of captive animals affected. Bilateral ureteral stent placement, using endoscopic and fluoroscopic guidance, and extracorporeal shock wave lithotripsy (ESWL) were performed as salvage procedures in a 13-yr-old intact female Asian small-clawed otter following a 7-yr history of nephrolithiasis and progressive renal insufficiency. Following the procedure, radiographs revealed a slight shifting of urolith position, although a decrease in urolith mass was not observed. As a result of declining quality of life related to severe osteoarthritis, the otter was euthanized 5 wk after the procedure. While this treatment approach was unsuccessful in this case, the technique was clinically feasible, so ESWL and ureteral stent placement may remain a consideration for other individuals of this species presented earlier in the course of this disease. PMID:26056891

  18. Flesh fly myiasis (Diptera, Sarcophagidae) in Peruvian poison frogs genus Epipedobates (Anura, Dendrobatidae)

    OpenAIRE

    Mattias Hagman; Thomas Pape; Rainer Schulte

    2005-01-01

    In this note we review records of myiasis in poison frogs collected in various locations in Peru during 1982-2005 and present evidence that larger and medium-sized poison frogs (Epipedobates) are infected with sarcophagid fly larvae.

  19. Prostaglandin E2 release from dermis regulates sodium permeability of frog skin epithelium

    DEFF Research Database (Denmark)

    Rytved, Klaus A.; Brodin, Birger; Nielsen, Robert

    1995-01-01

    Arachidonic acid, cAMP, epithelium, frog skin, intracellular calcium, prostaglandin E*U2, sodium transport, tight epithelium.......Arachidonic acid, cAMP, epithelium, frog skin, intracellular calcium, prostaglandin E*U2, sodium transport, tight epithelium....

  20. Resurrecting an Extinct Species: Archival DNA, Taxonomy, and Conservation of the Vegas Valley Leopard Frog

    Science.gov (United States)

    Suggestions that the extinct Vegas Valley leopard frog (Rana fisheri = Lithobates fisheri) may have been synonymous with one of several declining species has complicated recovery planning for imperiled leopard frogs in southwestern North America. To address this concern, we recon...

  1. What Is The Proximate Cause Of Begging Behaviour In A Group Of Captive Asian Short-Clawed Otters?

    OpenAIRE

    Gothard Nicola

    2007-01-01

    The study aimed to ascertain the proximate cause of ‘begging’ behaviour in a group of captive Asian short-clawed otters (Aonyx cinereus). Two alternative hypotheses were tested by manipulating aspects of husbandry in three experimental conditions. Condition 1 served as a baseline for comparison. In Condition 2 meal worms and crickets were provided every hour to stimulate natural foraging and hunting behaviour and alleviate boredom. During Condition 3 the food allowance was increased by 7.5% o...

  2. Assessing The Welfare Of Captive Asian Small-Clawed Otters (Amblonyx cinereus): Can Inductive Methods Play A Part?

    OpenAIRE

    Wright L.C.

    2003-01-01

    A large number of factors need to be taken into account when assessing an animal's welfare under field conditions. Grounded Theory, an inductive method, might be of use in correlating these factors with the results of scientific studies to produce a freely available IT tool that could be used by relatively untrained persons to assess the welfare of animals. This ongoing work is intended to establish whether inductive techniques can contribute to welfare assessment of captive Asian Small-Clawe...

  3. Cystic urolithiasis in captive waxy monkey frogs (Phyllomedusa sauvagii).

    Science.gov (United States)

    Archibald, Kate E; Minter, Larry J; Dombrowski, Daniel S; O'Brien, Jodi L; Lewbart, Gregory A

    2015-03-01

    The waxy monkey frog (Phyllomedusa sauvagii) is an arboreal amphibian native to arid regions of South America, and it has developed behavioral and physiologic adaptations to permit survival in dry environments. These adaptations include a uricotelic nitrogen metabolism and unique cutaneous lipid excretions to prevent evaporative water loss. Uroliths are a rare finding in amphibians. Six adult, presumed wild-caught waxy monkey frogs housed in a museum animal collection were diagnosed with cystic urolithiasis over a 7-yr period, and a single animal was diagnosed with four recurrent cases. Six cases were identified incidentally at routine physical or postmortem examination and four cases were identified during veterinary evaluation for coelomic distension, lethargy, anorexia, and increased soaking behavior. Calculi were surgically removed from three frogs via cystotomy, and a single frog underwent three cystotomies and two cloacotomies for recurrent urolithiasis. Two frogs died within the 24-hr postoperative period. Two representative calculi from a single frog were submitted for component analysis and found to consist of 100% ammonium urate. In the present report, cystic calculi are proposed to be the result of a high-protein diet based on a single invertebrate source, coupled with uricotelism, dehydration, increased cutaneous water loss, body temperature fluctuations facilitating supersaturation of urine, and subsequent accumulation and precipitation of urogenous wastes within the urinary bladder. Surgical cystotomy represents a short-term treatment strategy for this condition. Preventative measures, such as supplying a diversified and balanced diet in addition to environmental manipulation aimed at promoting adequate hydration, are anticipated to be more-rewarding management tools for cystic urolithiasis in the waxy monkey frog. PMID:25831582

  4. Panamanian frog species host unique skin bacterial communities.

    Science.gov (United States)

    Belden, Lisa K; Hughey, Myra C; Rebollar, Eria A; Umile, Thomas P; Loftus, Stephen C; Burzynski, Elizabeth A; Minbiole, Kevin P C; House, Leanna L; Jensen, Roderick V; Becker, Matthew H; Walke, Jenifer B; Medina, Daniel; Ibáñez, Roberto; Harris, Reid N

    2015-01-01

    Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd), that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species) community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26%) were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in these skin symbiont

  5. DNA barcode based wildlife forensics for resolving the origin of claw samples using a novel primer cocktail.

    Science.gov (United States)

    Khedkar, Gulab D; Abhayankar, Shil Bapurao; Nalage, Dinesh; Ahmed, Shaikh Nadeem; Khedkar, Chandraprakash D

    2014-12-10

    Abstract Excessive wildlife hunting for commercial purposes can have negative impacts on biodiversity and may result in species extinction. To ensure compliance with legal statutes, forensic identification approaches relying on molecular markers may be used to identify the species of origin of animal material from hairs, claw, blood, bone, or meat. Using this approach, DNA sequences from the COI "barcoding" gene have been used to identify material from a number of domesticated animal species. However, many wild species of carnivores still present great challenges in generating COI barcodes using standard "universal" primer pairs. In the work presented here, the mitochondrial COI gene was successfully amplified using a novel primer cocktail, and the products were sequenced to determine the species of twenty one unknown samples of claw material collected as part of forensic wildlife case investigations. Sixteen of the unknown samples were recognized to have originated from either Panthera leo or P. pardus individuals. The remaining five samples could be identified only to the family level due to the absence of reference animal sequences. This is the first report on the use of COI sequences for the identification of P. pardus and P. leo from claw samples as part of forensic investigations in India. The study also highlights the need for adequate reference material to aid in the resolution of suspected cases of illegal wildlife harvesting. PMID:25492536

  6. Assigning king eiders to wintering regions in the Bering Sea using stable isotopes of feathers and claws

    Science.gov (United States)

    Oppel, S.; Powell, A.N.

    2008-01-01

    Identification of wintering regions for birds sampled during the breeding season is crucial to understanding how events outside the breeding season may affect populations. We assigned king eiders captured on breeding grounds in northern Alaska to 3 broad geographic wintering regions in the Bering Sea using stable carbon and nitrogen isotopes obtained from head feathers. Using a discriminant function analysis of feathers obtained from birds tracked with satellite transmitters, we estimated that 88 % of feathers were assigned to the region in which they were grown. We then assigned 84 birds of unknown origin to wintering regions based on their head feather isotope ratios, and tested the utility of claws for geographic assignment. Based on the feather results, we estimated that similar proportions of birds in our study area use each of the 3 wintering regions in the Bering Sea. These results are in close agreement with estimates from satellite telemetry and show the usefulness of stable isotope signatures of feathers in assigning marine birds to geographic regions. The use of claws is currently limited by incomplete understanding of claw growth rates. Data presented here will allow managers of eiders, other marine birds, and marine mammals to assign animals to regions in the Bering Sea based on stable isotope signatures of body tissues. ?? Inter-Research 2008.

  7. Suzaku X-ray Observations of the Fermi Bubbles: Northernmost Cap and Southeast Claw Discovered with MAXI-SSC

    CERN Document Server

    Tahara, Masaya

    2015-01-01

    We report on Suzaku observations of large-scale X-ray structures possibly related with the Fermi Bubbles obtained in 2013 with a total duration of ~ 80 ks. The observed regions were the: (i) northern cap (N-cap; l ~ 0 deg, 45 deg < b < 55 deg) seen in the Mid-band (1.7-4.0 keV) map recently provided by MAXI-SSC and (ii) southeast claw (SE-claw; l ~ 10 deg, -20 deg < b < -10 deg) seen in the ROSAT all-sky map and MAXI-SSC Low-band (0.7-1.7 keV) map. In each region, we detected diffuse X-ray emissions which are represented by a three component plasma model consisting of an unabsorbed thermal component (kT ~ 0.1 keV) from the Local Bubble, absorbed kT = 0.30+/-0.05 keV emission representing the Galactic Halo, and a power-law component due to the isotropic cosmic X-ray background radiation. The emission measure of the GH component in the SE-claw shows an excess by a factor of ~ 2.5 over the surrounding emission at 2 deg away. We also found a broad excess in the 1.7-4.0 keV count rates across the N-cap...

  8. The first see-through frog created by breeding: description, inheritance patterns, and dermal chromatophore structure

    OpenAIRE

    Masayuki Sumida; Mohammed Mafizul Islam; Takeshi Igawa; Atsushi Kurabayashi; Yukari Furukawa; Naomi Sano; Tamotsu Fujii; Norio Yoshizaki

    2016-01-01

    We have succeeded in creating see-through frogs from natural color mutants of the Japanese brown frog Rana japonica, which usually possesses an ochre or brown back; this coloration enables the organs, blood vessels, and eggs to be observed through the skin without performing dissection. We crossed two kinds of recessive color mutant (black-eyed and gray-eyed) frogs through artificial insemination, and F2 offspring produced frogs whose skin is translucent throughout the life cycle. Three kinds...

  9. Complete mitochondrial genome of the Greek marsh frog Pelophylax cretensis (Anura, Ranidae).

    Science.gov (United States)

    Hofman, Sebastian; Pabijan, Maciej; Osikowski, Artur; Szymura, Jacek M

    2016-05-01

    We sequenced the complete mitochondrial genome of the Greek marsh frog Pelophylax cretensis, a water frog species endemic to the island of Crete. The genome sequence was 17,829 bp in size, and the gene order and contents were identical to those of previously reported mitochondrial genomes of other water frog species. This is the first complete mitogenome (i.e. including control region) described for western Palaearctic water frogs. PMID:25329260

  10. Evaluation of Antimicrobial and Healing Activities of Frog Skin on Guinea Pigs Wounds

    OpenAIRE

    2015-01-01

    Background: Frog skin secretions have potentials against a wide spectrum of bacteria. Also, frog skin compositions have healing properties. Objectives: The aim of this study was to investigate the antibacterial potentials along with healing properties of frog skin Rana ridibunda, a species which thoroughly lives in Iran marshes, as a biological dressing on wounds. Materials and Methods: In this study, excisional wounds, dressed with frog skin, were compared between experimental and control gr...

  11. Reproductive ecology of Sichuan digging frogs (Microhylidae: Kaloula rugifera)

    OpenAIRE

    Wei Chen; Lina Ren; Dujuan He; Ying Wang; David Pike

    2015-01-01

    Abstract. We investigated the reproductive ecology of Sichuan digging frogs (Microhylidae: Kaloula rugifera) in Mianyang, China during the wet season of 2013. Male Sichuan digging frogs first appear at temporary ponds following the first heavy rain of the wet season and initiate calling. Females arrive at ponds shortly after males. Male frogs chorus extensively throughout the wet season during the evenings and nights following rainstorms. Female frogs leave the pond after laying eggs, and lik...

  12. Specialist or generalist? Feeding ecology of the Malagasy poison frog Mantella aurantiaca

    OpenAIRE

    Woodhead, Cindy; Vences, Miguel; Vieites, David R.; Gamboni, Ilona; Brian L Fisher; Griffiths, Richard A.

    2007-01-01

    We studied the diet of a population of free-ranging Mantella aurantiaca, an alkaloid-containing poison frog from Madagascar. As in other poison frogs, this species is thought to sequester alkaloids from arthropod prey. Among prey, mites and ants are known to regularly contain alkaloids and mites appear to be a major source of dietary alkaloids in poison frogs. We predicted that mites and ants would constitute the most important prey item for these frogs. Prey inventories were obtained during ...

  13. Obesity and African Americans

    Science.gov (United States)

    ... Data > Minority Population Profiles > Black/African American > Obesity Obesity and African Americans African American women have the ... ss6304.pdf [PDF | 3.38MB] HEALTH IMPACT OF OBESITY More than 80 percent of people with type ...

  14. 49 CFR 213.143 - Frog guard rails and guard faces; gage.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Frog guard rails and guard faces; gage. 213.143... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION TRACK SAFETY STANDARDS Track Structure § 213.143 Frog guard rails and guard faces; gage. The guard check and guard face gages in frogs shall be within the...

  15. 49 CFR 236.327 - Switch, movable-point frog or split-point derail.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Switch, movable-point frog or split-point derail..., AND APPLIANCES Interlocking Rules and Instructions § 236.327 Switch, movable-point frog or split-point derail. Switch, movable-point frog, or split-point derail equipped with lock rod shall be maintained...

  16. 75 FR 8733 - Least Chub and Columbia Spotted Frog Candidate Conservation Agreement With Assurances; Receipt of...

    Science.gov (United States)

    2010-02-25

    ... Fish and Wildlife Service Least Chub and Columbia Spotted Frog Candidate Conservation Agreement With... (CCAA) for the least chub (Iotichthys phlegethontis) and Columbia spotted frog (Rana lutreiventris..., least chub and Columbia spotted frog inhabited a variety of aquatic habitat types throughout...

  17. Radioimmunoassay of plasma corticotropin in the edible Frog Rana esculenta L

    International Nuclear Information System (INIS)

    In the green Frog (Rana esculenta) the plasma contains a polypeptide immunologically related to human and porcine corticotropins. A radioimmunoassay capable of detecting 4.10-12 g hog ACTH has been used for a direct plasma ACTH assay in the Frog. Using this method the ACTH rate was determined both in untreated frogs and in animals under various experimental conditions

  18. The biology, economy, hunting and legislation of edible Frogs (Ranidae Intended for Export in Turkey

    Directory of Open Access Journals (Sweden)

    Hülya Şereflişan

    2016-07-01

    Full Text Available The frogs production is done on the basis of fully hunting, an important export product in Turkey. The frogs are almost no domestic consumption. The frogs are exported to France, Italy, Switzerland, Lebanon, Greece and Spain by five companies a processed form as live frog, frozen frog legs and chilled frog legs. In Turkey, some regulations related to hunting frogs and exports are prepared by under the Ministry of Agriculture and Rural Affairs General Directorate of Protection and Control. The hunting frogs is banned by 3/1 the Commercial Fisheries regulating the hunting notification. These prohibitions are designed to be different for each province. The provinces are permitted for frogs hunting by the legislation in Adana, Afyonkarahisar, Balıkesir, Bingöl, Bursa, Edirne, Bursa, Istanbul and Yalova. Frogs were exported in different amounts (kg with different price in every year during the last ten years. The highest amounts of the frogs with the lowest of price were exported in 2013. Prey weight is shrinking due to overfishing. In this case, the price of export materials has got significantly negative effects. As a result, the ban on hunting and restrictive measures for protection should be taken seriously in some of the provinces. Hunting ban is absolutely necessary in Turkey. In many countries including Turkey, in order to ensure sustainability, it is important to do the frog breeding.

  19. Sophisticated Communication in the Brazilian Torrent Frog Hylodes japi.

    Science.gov (United States)

    de Sá, Fábio P; Zina, Juliana; Haddad, Célio F B

    2016-01-01

    Intraspecific communication in frogs plays an important role in the recognition of conspecifics in general and of potential rivals or mates in particular and therefore with relevant consequences for pre-zygotic reproductive isolation. We investigate intraspecific communication in Hylodes japi, an endemic Brazilian torrent frog with territorial males and an elaborate courtship behavior. We describe its repertoire of acoustic signals as well as one of the most complex repertoires of visual displays known in anurans, including five new visual displays. Previously unknown in frogs, we also describe a bimodal inter-sexual communication system where the female stimulates the male to emit a courtship call. As another novelty for frogs, we show that in addition to choosing which limb to signal with, males choose which of their two vocal sacs will be used for visual signaling. We explain how and why this is accomplished. Control of inflation also provides additional evidence that vocal sac movement and color must be important for visual communication, even while producing sound. Through the current knowledge on visual signaling in Neotropical torrent frogs (i.e. hylodids), we discuss and highlight the behavioral diversity in the family Hylodidae. Our findings indicate that communication in species of Hylodes is undoubtedly more sophisticated than we expected and that visual communication in anurans is more widespread than previously thought. This is especially true in tropical regions, most likely due to the higher number of species and phylogenetic groups and/or to ecological factors, such as higher microhabitat diversity. PMID:26760304

  20. Sophisticated Communication in the Brazilian Torrent Frog Hylodes japi.

    Directory of Open Access Journals (Sweden)

    Fábio P de Sá

    Full Text Available Intraspecific communication in frogs plays an important role in the recognition of conspecifics in general and of potential rivals or mates in particular and therefore with relevant consequences for pre-zygotic reproductive isolation. We investigate intraspecific communication in Hylodes japi, an endemic Brazilian torrent frog with territorial males and an elaborate courtship behavior. We describe its repertoire of acoustic signals as well as one of the most complex repertoires of visual displays known in anurans, including five new visual displays. Previously unknown in frogs, we also describe a bimodal inter-sexual communication system where the female stimulates the male to emit a courtship call. As another novelty for frogs, we show that in addition to choosing which limb to signal with, males choose which of their two vocal sacs will be used for visual signaling. We explain how and why this is accomplished. Control of inflation also provides additional evidence that vocal sac movement and color must be important for visual communication, even while producing sound. Through the current knowledge on visual signaling in Neotropical torrent frogs (i.e. hylodids, we discuss and highlight the behavioral diversity in the family Hylodidae. Our findings indicate that communication in species of Hylodes is undoubtedly more sophisticated than we expected and that visual communication in anurans is more widespread than previously thought. This is especially true in tropical regions, most likely due to the higher number of species and phylogenetic groups and/or to ecological factors, such as higher microhabitat diversity.

  1. Tourism and the Conservation of Critically Endangered Frogs

    Science.gov (United States)

    Morrison, Clare; Simpkins, Clay; Castley, J. Guy; Buckley, Ralf C.

    2012-01-01

    Protected areas are critical for the conservation of many threatened species. Despite this, many protected areas are acutely underfunded, which reduces their effectiveness significantly. Tourism is one mechanism to promote and fund conservation in protected areas, but there are few studies analyzing its tangible conservation outcomes for threatened species. This study uses the 415 IUCN critically endangered frog species to evaluate the contribution of protected area tourism revenue to conservation. Contributions were calculated for each species as the proportion of geographic range inside protected areas multiplied by the proportion of protected area revenues derived from tourism. Geographic ranges were determined from IUCN Extent of Occurrence maps. Almost 60% (239) of critically endangered frog species occur in protected areas. Higher proportions of total range are protected in Nearctic, Australasian and Afrotopical regions. Tourism contributions to protected area budgets ranged from 5–100%. These financial contributions are highest for developing countries in the Afrotropical, Indomalayan and Neotropical regions. Data for both geographic range and budget are available for 201 critically endangered frog species with proportional contributions from tourism to species protection ranging from 0.8–99%. Tourism's financial contributions to critically endangered frog species protection are highest in the Afrotropical region. This study uses a coarse measure but at the global scale it demonstrates that tourism has significant potential to contribute to global frog conservation efforts. PMID:22984440

  2. Function after correction of a clawed great toe by a modified Robert Jones transfer.

    Science.gov (United States)

    Breusch, S J; Wenz, W; Döderlein, L

    2000-03-01

    We carried out a cross-sectional study in 51 patients (81 feet) with a clawed hallux in association with a cavus foot after a modified Robert Jones tendon transfer. The mean follow-up was 42 months (9 to 88). In all feet, concomitant procedures had been undertaken, such as extension osteotomy of the first metatarsal and transfer of the tendon of the peroneus longus to peroneus brevis, to correct the underlying foot deformity. All patients were evaluated clinically and radiologically. The overall rate of patient satisfaction was 86%. The deformity of the hallux was corrected in 80 feet. Catching of the big toe when walking barefoot, transfer lesions and metatarsalgia, hallux flexus, hallux limitus and asymptomatic nonunion of the interphalangeal joint were the most frequent complications. Hallux limitus was more likely when elevation of the first ray occurred (p = 0.012). Additional transfer of the tendon of peroneus longus to peroneus brevis was a significant risk factor for elevation of the first metatarsal (p hallux. PMID:10755436

  3. Insights into the molecular phylogeny and historical biogeography of the white-clawed crayfish (Decapoda, Astacidae).

    Science.gov (United States)

    Jelić, Mišel; Klobučar, Göran I V; Grandjean, Frédéric; Puillandre, Nicolas; Franjević, Damjan; Futo, Momir; Amouret, Julien; Maguire, Ivana

    2016-10-01

    In this study, the evolutionary history of the white-clawed crayfish (WCC) was evaluated using large-scale datasets comprising >1350 specimens from the entire distribution range. Using species delimitation methods on mitochondrial DNA (mtDNA) sequences, we propose four primary species hypotheses for WCC. Sequences for several nuclear regions were screened but none showed significant variation within WCC. This result favours a single secondary species hypothesis and indicates the existence of a mito-nuclear discordance in WCC. Therefore, mtDNA groups were considered only as genetic units that carry information about ancient divergences within WCC and not as taxonomic units. The reconstruction of ancestral ranges and divergence time estimates were used to link the current genetic structure with paleogeographic processes. These results showed that the emergence of mtDNA groups in WCC could be related to the Messinian Salinity Crisis, the climate cooling during the Pliocene and Pleistocene, and (paleo)shifting of the Adriatic Sea coastline in the Padanovenezian Plain. The most recent common ancestor of the mtDNA groups most likely originated from Dalmatia (eastern Adriatic coast) as indicated by the reconstruction of ancestral ranges. This ecoregion, along with the Gulf of Venice Drainages, harbours a high genetic diversity and should be emphasised as an area of the highest conservation priority. PMID:27404041

  4. Histological analysis of thelohaniasis in white-clawed crayfish Austropotamobius pallipes complex

    Directory of Open Access Journals (Sweden)

    Quaglio F.

    2011-09-01

    Full Text Available From 2004 to 2006, a parasitological survey aimed at the detection of the microsporidian parasite Thelohania contejeani Henneguy was carried out on 177 wild white-clawed crayfish (Austropotamobius pallipes complex captured in six streams and rivers of the province of Belluno in north-eastern Italy. Microscopical examination of the skeletal muscles, and histological analysis applying different histochemical stains to full transverse and sagittal sections of the cephalothorax and abdomen were carried out. Transmission electron microscopy (TEM was also conducted on the parasites recovered during the survey. Out of 177 crayfish examined, Thelohania contejeani (Microsporidia, Thelohaniidae was present in only one crayfish from the Vena d’oro creek. The parasite was detected in the skeletal muscles in several developmental stages, including mature spores, which represented the most common stage recovered. Sporophorous vesicles were also present. Histological examination revealed that the fibres of the skeletal, cardiac and intestinal muscles were filled with spores. Melanin infiltrations were focally present in the infected striated muscles. The gill phagocytic nephrocytes were engulfed by small masses of spores. Among the staining techniques applied, Crossman’s trichrome stain represented the most effective method of detecting T. contejeani.

  5. Span programs and quantum algorithms for st-connectivity and claw detection

    CERN Document Server

    Belovs, Aleksandrs

    2012-01-01

    We introduce a span program that decides st-connectivity, and generalize the span program to develop quantum algorithms for several graph problems. First, we give an algorithm for st-connectivity that uses O(n d^{1/2}) quantum queries to the n x n adjacency matrix to decide if vertices s and t are connected, under the promise that they either are connected by a path of length at most d, or are disconnected. We also show that if T is a path, a star with two subdivided legs, or a subdivision of a claw, its presence as a subgraph in the input graph G can be detected with O(n) quantum queries to the adjacency matrix. Under the promise that G either contains T as a subgraph or does not contain T as a minor, we give O(n)-query quantum algorithms for detecting T either a triangle or a subdivision of a star. All these algorithms can be implemented time efficiently and, except for the triangle-detection algorithm, in logarithmic space. One of the main techniques is to modify the st-connectivity span program to drop al...

  6. Prevalence and intensity of Alaria alata (Goeze, 1792) in water frogs and brown frogs in natural conditions.

    Science.gov (United States)

    Patrelle, Cécile; Portier, Julien; Jouet, Damien; Delorme, Daniel; Ferté, Hubert

    2015-12-01

    In the last 15 years, the mesocercariae of Alaria alata have frequently been reported in the wild boar during routine Trichinella inspections made compulsory for the trade of venison meat in Europe. If these studies have focused primarily on mesocercariae isolated from meat, few works have been done so far to understand the circulation of the parasite in natural conditions especially in the intermediate hosts. This study focuses on the second intermediate hosts of this parasite assessing the suitability of two amphibian groups-brown frogs and water frogs sensu lato-for mesocercarial infection on an area where A. alata has already been identified in water snails and wild boars. During this study, both groups showed to be suitable for mesocercarial infection, with high prevalence and parasite burdens. Prevalence was higher in the brown frog group (56.9 versus 11.54 % for water frogs) which would indicate that it is a preferential group for infection on the study area, though reasons for this remain to be investigated. No significant difference among prevalences was observed between tadpoles and frogs. This study, the first focusing on A. alata in these amphibians in Europe, provides further information on circulation of this parasite in natura. PMID:26319522

  7. Voxel-based frog phantom for internal dose evaluation

    International Nuclear Information System (INIS)

    A voxel-based frog phantom has been developed for radiation protection of the environment. The voxel-based frog phantom was applied to evaluating self-absorbed fractions (self-AFs), which are defined as the fraction of energy emitted by a radiation source that is absorbed within the source organ. The self-AFs were evaluated for both photons and electrons in the spleen, kidneys, and liver using Monte Carlo simulations. Furthermore, self-S values (μGy/MBq·s) for 18F and 90Y in the organs were calculated using the results of the self-AFs. Consequently, the voxel-based frog phantom was found to be useful for the organ dose evaluations, which have not been proposed by the International Commission on Radiological Protection (ICRP). It was also confirmed that the self-AFs and self-S values are largely dependent on the mass of the source organ. (author)

  8. Radiation processing for the control of Salmonella in frog legs

    International Nuclear Information System (INIS)

    Large consignments of frogs legs are exported annually from India. Failure to satisfy some of the strict microbiological standards, especially in relating to Salmonellae contamination, has resulted in the rejection of large quantities of the product in recent years. This has emphasised the need for better and more effective methods than those currently in use for the elimination of Salmonellae. With a view to developing an irradiation process for the control of this public health problem, commercial samples of frog legs have been screened to assess the incidence of Salmonella. The various serotypes have been identified and their radiation sensitivities determined. Based on these data, a radiation treatment of frozen frog legs for the elimination of Salmonella has been developed. (author)

  9. Frog: The Fast & Realistic OpenGL Event Displayer

    CERN Document Server

    Quertenmont, Loic

    2009-01-01

    FROG [1] is a generic framework dedicated to visualisation of events in high energy experiment. It is suitable for any particular physics experiment or detector design. The code is light ($<3~\\textrm{MB}$) and fast (browsing time $\\sim20$ events per second for a large High Energy Physics experiment) and can run on various operating systems, as its object-oriented structure (C++) relies on the cross-platform OpenGL[2] and GLUT [3] libraries. Moreover, \\textsc{Frog} does not require installation of third party libraries for the visualisation. This documents describes the features and principles of FROG version 1.106, its working scheme and numerous functionalities such as: 3D and 2D visualisation, graphical user interface, mouse interface, configuration files, production of pictures of various format, integration of personal objects, etc. Finally, several examples of its current applications are presented for illustration.

  10. ’He descended legs-upwards‘: Position and motion in Tzeltal frog stories

    OpenAIRE

    P Brown

    2000-01-01

    How are events framed in narrative? Speakers of English (a 'satellite-framed' language), when 'reading' Mercer Mayer's wordless picture book 'Frog, Where Are You?', find the story self-evident: a boy has a dog and a pet frog; the frog escapes and runs away; the boy and dog look for it across hill and dale, through woods and over a cliff, until they find it and return home with a baby frog child of the original pet frog. In Tzeltal, as spoken in a Mayan community in southern Mexico, the story ...

  11. Position and motion in Tzeltal frog stories: The acquisition of narrative style

    OpenAIRE

    P Brown

    2004-01-01

    How are events framed in narrative? Speakers of English (a 'satellite-framed' language), when 'reading' Mercer Mayer's wordless picture book 'Frog, Where Are You?', find the story self-evident: a boy has a dog and a pet frog; the frog escapes and runs away; the boy and dog look for it across hill and dale, through woods and over a cliff, until they find it and return home with a baby frog child of the original pet frog. In Tzeltal, as spoken in a Mayan community in southern Mexico, the story ...

  12. Lizard and frog prestin: evolutionary insight into functional changes.

    Directory of Open Access Journals (Sweden)

    Jie Tang

    Full Text Available The plasma membrane of mammalian cochlear outer hair cells contains prestin, a unique motor protein. Prestin is the fifth member of the solute carrier protein 26A family. Orthologs of prestin are also found in the ear of non-mammalian vertebrates such as zebrafish and chicken. However, these orthologs are electrogenic anion exchangers/transporters with no motor function. Amphibian and reptilian lineages represent phylogenic branches in the evolution of tetrapods and subsequent amniotes. Comparison of the peptide sequences and functional properties of these prestin orthologs offer new insights into prestin evolution. With the recent availability of the lizard and frog genome sequences, we examined amino acid sequence and function of lizard and frog prestins to determine how they are functionally and structurally different from prestins of mammals and other non-mammals. Somatic motility, voltage-dependent nonlinear capacitance (NLC, the two hallmarks of prestin function, and transport capability were measured in transfected human embryonic kidney cells using voltage-clamp and radioisotope techniques. We demonstrated that while the transport capability of lizard and frog prestin was compatible to that of chicken prestin, the NLC of lizard prestin was more robust than that of chicken's and was close to that of platypus. However, unlike platypus prestin which has acquired motor capability, lizard or frog prestin did not demonstrate motor capability. Lizard and frog prestins do not possess the same 11-amino-acid motif that is likely the structural adaptation for motor function in mammals. Thus, lizard and frog prestins appear to be functionally more advanced than that of chicken prestin, although motor capability is not yet acquired.

  13. Lizard and frog prestin: evolutionary insight into functional changes.

    Science.gov (United States)

    Tang, Jie; Pecka, Jason L; Fritzsch, Bernd; Beisel, Kirk W; He, David Z Z

    2013-01-01

    The plasma membrane of mammalian cochlear outer hair cells contains prestin, a unique motor protein. Prestin is the fifth member of the solute carrier protein 26A family. Orthologs of prestin are also found in the ear of non-mammalian vertebrates such as zebrafish and chicken. However, these orthologs are electrogenic anion exchangers/transporters with no motor function. Amphibian and reptilian lineages represent phylogenic branches in the evolution of tetrapods and subsequent amniotes. Comparison of the peptide sequences and functional properties of these prestin orthologs offer new insights into prestin evolution. With the recent availability of the lizard and frog genome sequences, we examined amino acid sequence and function of lizard and frog prestins to determine how they are functionally and structurally different from prestins of mammals and other non-mammals. Somatic motility, voltage-dependent nonlinear capacitance (NLC), the two hallmarks of prestin function, and transport capability were measured in transfected human embryonic kidney cells using voltage-clamp and radioisotope techniques. We demonstrated that while the transport capability of lizard and frog prestin was compatible to that of chicken prestin, the NLC of lizard prestin was more robust than that of chicken's and was close to that of platypus. However, unlike platypus prestin which has acquired motor capability, lizard or frog prestin did not demonstrate motor capability. Lizard and frog prestins do not possess the same 11-amino-acid motif that is likely the structural adaptation for motor function in mammals. Thus, lizard and frog prestins appear to be functionally more advanced than that of chicken prestin, although motor capability is not yet acquired. PMID:23342145

  14. Effect of ionizing radiation on cell death in frog spleen

    International Nuclear Information System (INIS)

    It was studied the number of dead cells in frog spleen by means of coloration with trypan blue which allowed to estimate last stage of apoptosis dead of cells.The investigated frogs (Rana arvalis) were caught in september 1997 at radionuclide contamination territory (the Gomel Region, the Khojniki District). Control animals were caught in village Ratamka of the Minsk District. The percent of dead cells was less in control group in 1,5 times. Under additional irradiation (2 Gy) the number of dead cells in spleen also differs significantly in the investigated and control groups

  15. Determination of age, longevity and age at reproduction of the frog Microhyla ornata by skeletochronology

    Indian Academy of Sciences (India)

    Suresh M Kumbar; Katti Pancharatna

    2001-06-01

    Skeletochronological estimation of age, longevity, age at sexual maturity and breeding of Microhyla ornata was done. Frogs ( = 62) were collected locally in August (rainy season) 1997 and brought to the laboratory. Body mass and snout-vent-length (SVL) of each frog was recorded; the 4th toe of both the hind limbs was clipped under anaesthesia, fixed in 10% formalin, demineralized in 5% nitric acid and processed for histology. Limb bones (femur, humerus, tibiofibula and radioulna) of 6 large sized frogs were also processed for skeletochronology in order to study the rate of resorption. Gonads of 25 frogs (belonging to different body size ranges) were processed for histology in order to ascertain the gametogenic status of individual frogs. One to four growth rings consisting of growth zones and lines of arrested growth (LAGs) were noticed in frogs of different body sizes; the number of LAGs remained identical in all the limb bones and phalanges in 5 out of 6 frogs. Back calculation indicated that the resorption rate is very low in this frog. Male frogs possessed sperm bundles in seminiferous tubules in the 1st year, while females showed yolky follicles in the ovary in the 2nd year. Frogs found in amplexus were 3–5 years old. The results suggest that this frog may live for a maximum of 5 years in the natural population.

  16. Landscape genetics of high mountain frog metapopulations.

    Science.gov (United States)

    Murphy, Melanie A; Dezzani, R; Pilliod, D S; Storfer, A

    2010-09-01

    Explaining functional connectivity among occupied habitats is crucial for understanding metapopulation dynamics and species ecology. Landscape genetics has primarily focused on elucidating how ecological features between observations influence gene flow. Functional connectivity, however, may be the result of both these between-site (landscape resistance) landscape characteristics and at-site (patch quality) landscape processes that can be captured using network based models. We test hypotheses of functional connectivity that include both between-site and at-site landscape processes in metapopulations of Columbia spotted frogs (Rana luteiventris) by employing a novel justification of gravity models for landscape genetics (eight microsatellite loci, 37 sites, n = 441). Primarily used in transportation and economic geography, gravity models are a unique approach as flow (e.g. gene flow) is explained as a function of three basic components: distance between sites, production/attraction (e.g. at-site landscape process) and resistance (e.g. between-site landscape process). The study system contains a network of nutrient poor high mountain lakes where we hypothesized a short growing season and complex topography between sites limit R. luteiventris gene flow. In addition, we hypothesized production of offspring is limited by breeding site characteristics such as the introduction of predatory fish and inherent site productivity. We found that R. luteiventris connectivity was negatively correlated with distance between sites, presence of predatory fish (at-site) and topographic complexity (between-site). Conversely, site productivity (as measured by heat load index, at-site) and growing season (as measured by frost-free period between-sites) were positively correlated with gene flow. The negative effect of predation and positive effect of site productivity, in concert with bottleneck tests, support the presence of source-sink dynamics. In conclusion, gravity models provide a

  17. Somaclonal variation in micropropagated Heliconia bihai cv. Lobster Claw I plantlets (Heliconiaceae) Variação somaclonal em mudas micropropagadas de Helicônia, Heliconia Bihai cv. Lobster Claw I (Heliconiaceae)

    OpenAIRE

    Paulo Hercílio Viegas Rodrigues

    2008-01-01

    The occurrence of somaclonal variation is described in various cultures of agronomic interest. Such variation can be of benefit in the development of new flower varieties. In this study, the occurrence of somaclonal variation in micropropagated changes of Heliconia bihai cv. Lobster Claw I was investigated. Stem apexes were introduced in MS culture media with the addition of 2.5 mg L-1 of benzylaminopure (BAP) and 500 mg L-1 of sodium cefotaxime. After selecting the apex stem, it was sub-cult...

  18. Toxicological aspects of the South American herbs cat's claw (Uncaria tomentosa) and Maca (Lepidium meyenii) : a critical synopsis.

    Science.gov (United States)

    Valerio, Luis G; Gonzales, Gustavo F

    2005-01-01

    Recent exceptional growth in human exposure to natural products known to originate from traditional medicine has lead to a resurgence of scientific interest in their biological effects. As a strategy for improvement of the assessment of their pharmacological and toxicological profile, scientific evidence-based approaches are being employed to appropriately evaluate composition, quality, potential medicinal activity and safety of these natural products. Using this approach, we comprehensively reviewed existing scientific evidence for known composition, medicinal uses (past and present), and documented biological effects with emphasis on clinical pharmacology and toxicology of two commonly used medicinal plants from South America with substantial human exposure from historical and current global use: Uncaria tomentosa (common name: cat's claw, and Spanish: uña de gato), and Lepidium meyenii (common name: maca). Despite the geographic sourcing from remote regions of the tropical Amazon and high altitude Andean mountains, cat's claw and maca are widely available commercially in industrialised countries. Analytical characterisations of their active constituents have identified a variety of classes of compounds of toxicological, pharmacological and even nutritional interest including oxindole and indole alkaloids, flavonoids, glucosinolates, sterols, polyunsaturated fatty acids, carbolines and other compounds. The oxindole alkaloids from the root bark of cat's claw are thought to invoke its most widely sought-after medicinal effects as a herbal remedy against inflammation. We find the scientific evidence supporting this claim is not conclusive and although there exists a base of information addressing this medicinal use, it is limited in scope with some evidence accumulated from in vitro studies towards understanding possible mechanisms of action by specific oxindole alkaloids through inhibition of nuclear factor (NF)-kappaB activation. Although controlled clinical

  19. The superoxide dismutase from red claw crayfish, Cherax quadricarinatus: molecular cloning and characterization analysis.

    Science.gov (United States)

    Gu, Wei; Chen, Jing; Hou, Libo; Huang, Yanqing; Xia, Siyao; Meng, Qingguo; Wang, Wen

    2014-11-01

    In the present study, an extracellular copper-zinc superoxide dismutase (ecCuZnSOD) gene and a mitochondrial manganese superoxide dismutase (mtMnSOD) gene were cloned from hemocytes of red claw crayfish, Cherax quadricarinatus. The open reading frame (ORF) of ecCuZnSOD is 498 bp and encodes a 166 amino acids (aa) protein, whereas the ORF of mtMnSOD is 654 bp and encodes a 218 aa protein. The amino acid sequences of C. quadricarinatus ecCuZnSOD and mtMnSOD showed high similarities with those of ecCuZnSODs and mtMnSODs of other crustaceans, respectively. Both ecCuZnSOD and mtMnSOD of C. quadricarinatus were highly expressed in hepatopancreas, hemocytes, intestine, and gill; low transcript levels were seen in other tissues (heart, muscle, and nerve). The immune responses of ecCuZnSOD and mtMnSOD were studied following inoculation with Spiroplasma eriocheiris and Aeromonas hydrophila. After S. eriocheiris or A. hydrophila challenge, mRNA transcription of ecCuZnSOD and mtMnSOD in hemocytes and gill was upregulated. mRNA transcription of ecCuZnSOD in the hepatopancreas was also upregulated after S. eriocheiris or A. hydrophila inoculation. mtMnSOD in hepatopancreas was upregulated after A. hydrophila inoculation, whereas this was down-regulated after S. eriocheiris challenge. After S. eriocheiris and A. hydrophila challenge, total SOD activity and CuZnSOD activity both increased compared to control group. The results showed that these SODs from C. quadricarinatus likely play an important role in protecting some tissues from reactive oxygen intermediates produced during challenge from S. eriocheiris and A. hydrophila. PMID:25366155

  20. Devil's Claw to suppress appetite--ghrelin receptor modulation potential of a Harpagophytum procumbens root extract.

    Directory of Open Access Journals (Sweden)

    Cristina Torres-Fuentes

    Full Text Available Ghrelin is a stomach-derived peptide that has been identified as the only circulating hunger hormone that exerts a potent orexigenic effect via activation of its receptor, the growth hormone secretagogue receptor (GHS-R1a. Hence, the ghrelinergic system represents a promising target to treat obesity and obesity-related diseases. In this study we analysed the GHS-R1a receptor activating potential of Harpagophytum procumbens, popularly known as Devil's Claw, and its effect on food intake in vivo. H. procumbens is an important traditional medicinal plant from Southern Africa with potent anti-inflammatory and analgesic effects. This plant has been also used as an appetite modulator but most evidences are anecdotal and to our knowledge, no clear scientific studies relating to appetite modulation have been done to this date. The ghrelin receptor activation potential of an extract derived from the dried tuberous roots of H. procumbens was analysed by calcium mobilization and receptor internalization assays in human embryonic kidney cells (Hek stably expressing the GHS-R1a receptor. Food intake was investigated in male C57BL/6 mice following intraperitoneal administration of H. procumbens root extract in ad libitum and food restricted conditions. Exposure to H. procumbens extract demonstrated a significant increased cellular calcium influx but did not induce subsequent GHS-R1a receptor internalization, which is a characteristic for full receptor activation. A significant anorexigenic effect was observed in male C57BL/6 mice following peripheral administration of H. procumbens extract. We conclude that H. procumbens root extract is a potential novel source for potent anti-obesity bioactives. These results reinforce the promising potential of natural bioactives to be developed into functional foods with weight-loss and weight maintenance benefits.

  1. Iris Claw versus Scleral Fixation Intraocular Lens Implantation during Pars Plana Vitrectomy

    Directory of Open Access Journals (Sweden)

    Fereydoun Farrahi

    2012-01-01

    Full Text Available Purpose: To compare the outcomes of iris claw anterior chamber intraocular lens (ICACIOL with that of scleral fixation posterior chamber intraocular lens (SF-PCIOL implantation during pars plana vitrectomy (PPV as initial surgery to correct aphakia. Methods: Twelve patients with complicated cataract surgery or trauma who had suffered nucleus, whole crystalline lens or intraocular lens (IOL drop into the vitreous cavity, and undergone PPV with IC-ACIOL implantation over a period of one year were evaluated for the purpose of this study. Uncorrected visual acuity (UCVA, best corrected visual acuity (BCVA, central corneal thickness (CCT, spherical equivalent (SE refractive error, astigmatism and complications were recorded. The results were compared to outcomes of another group of 13 patients who had previously undergone PPV with SF-PCIOL implantation. Results: Mean improvement of UCVA was greater in IC-ACIOL eyes as compared to the SF-PCIOL group (-1.17±0.28 versus -0.89±0.21 logMAR, P=0.01, corresponding values for postoperative BCVA were 0.24±0.17 and 0.44±0.22 logMAR (P=0.041, respectively. Average postoperative SE was comparable in the IC-ACIOL and SFPCIOL groups at 0.6±1.03 and 0.56±1.23 diopters, respectively (P=0.290. However, 10 (83.3% IC-ACIOL eyes versus 6 (46.1% SF-PCIOL eyes had SE within 1 diopter of emmetropia (P=0.048. Mean postoperative increase in CCT was comaparble between the study groups (P=0.126. Conclusion: In the absence of sufficient capsular support, the use of an IC-ACIOL for correction of aphakia during PPV can be a good alternative and seems to entail better visual outcomes as compared to SF-PCIOL.

  2. One-tone suppression in the frog auditory nerve

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, J; Jørgensen, M B

    1996-01-01

    frequencies ranged from 700 to 1200 Hz. Spontaneous activities for the fibers showing one-tone suppression ranged from 3 to 75 spikes/s. Spontaneous activities above 40 spikes/s and the phenomenon of one-tone suppression itself has not been reported previously for frogs. The population of fibers showing one...

  3. Research on moving object detection based on frog's eyes

    Science.gov (United States)

    Fu, Hongwei; Li, Dongguang; Zhang, Xinyuan

    2008-12-01

    On the basis of object's information processing mechanism with frog's eyes, this paper discussed a bionic detection technology which suitable for object's information processing based on frog's vision. First, the bionics detection theory by imitating frog vision is established, it is an parallel processing mechanism which including pick-up and pretreatment of object's information, parallel separating of digital image, parallel processing, and information synthesis. The computer vision detection system is described to detect moving objects which has special color, special shape, the experiment indicates that it can scheme out the detecting result in the certain interfered background can be detected. A moving objects detection electro-model by imitating biologic vision based on frog's eyes is established, the video simulative signal is digital firstly in this system, then the digital signal is parallel separated by FPGA. IN the parallel processing, the video information can be caught, processed and displayed in the same time, the information fusion is taken by DSP HPI ports, in order to transmit the data which processed by DSP. This system can watch the bigger visual field and get higher image resolution than ordinary monitor systems. In summary, simulative experiments for edge detection of moving object with canny algorithm based on this system indicate that this system can detect the edge of moving objects in real time, the feasibility of bionic model was fully demonstrated in the engineering system, and it laid a solid foundation for the future study of detection technology by imitating biologic vision.

  4. Natural disturbance reduces disease risk in endangered rainforest frog populations.

    Science.gov (United States)

    Roznik, Elizabeth A; Sapsford, Sarah J; Pike, David A; Schwarzkopf, Lin; Alford, Ross A

    2015-01-01

    Natural disturbances can drive disease dynamics in animal populations by altering the microclimates experienced by hosts and their pathogens. Many pathogens are highly sensitive to temperature and moisture, and therefore small changes in habitat structure can alter the microclimate in ways that increase or decrease infection prevalence and intensity in host populations. Here we show that a reduction of rainforest canopy cover caused by a severe tropical cyclone decreased the risk of endangered rainforest frogs (Litoria rheocola) becoming infected by a fungal pathogen (Batrachochytrium dendrobatidis). Reductions in canopy cover increased the temperatures and rates of evaporative water loss in frog microhabitats, which reduced B. dendrobatidis infection risk in frogs by an average of 11-28% in cyclone-damaged areas, relative to unaffected areas. Natural disturbances to the rainforest canopy can therefore provide an immediate benefit to frogs by altering the microclimate in ways that reduce infection risk. This could increase host survival and reduce the probability of epidemic disease outbreaks. For amphibian populations under immediate threat from this pathogen, targeted manipulation of canopy cover could increase the availability of warmer, drier microclimates and therefore tip the balance from host extinction to coexistence. PMID:26294048

  5. Antimicrobial peptides from frog skin: biodiversity and therapeutic promises.

    Science.gov (United States)

    Ladram, Ali; Nicolas, Pierre

    2016-01-01

    More than a thousand antimicrobial peptides (AMPs) have been reported in the last decades arising from the skin secretion of amphibian species. Generally, each frog species can express its own repertoire of AMPs (typically, 10-20 peptides) with differing sequences, sizes, and spectrum of action, which implies very rapid divergence, even between closely related species. Frog skin AMPs are highly potent against antibiotic-resistant bacteria, protozoa, yeasts, and fungi by permeating and destroying their plasma membrane and/or inactivating intracellular targets. These peptides have attracted considerable interest as a therapeutic alternative to conventional anti-infective agents. However, efforts to obtain a new generation of drugs using these peptides are still challenging because of high associated R&D costs due to their large size (up to 46 residues) and cytotoxicity. This review deals with the biodiversity of frog skin AMPs and assesses the therapeutic possibilities of temporins, the shortest AMPs found in the frog skin, with 8-17 residues. Such short sequences are easily amenable to optimization of the structure and to solution-phase synthesis that offer reduced costs over solid-phase chemistry. PMID:27100511

  6. AIRBORNE PESTICIDES AND POPULATION DECLINES OF A CALIFORNIA ALPINE FROG

    Science.gov (United States)

    The mountain yellow-legged frog (Rana muscosa) has disappeared from most of its historic localities in the Sierra Nevada of California, and airborne pesticides from the Central Valley have been implicated as a causal agent. To determine the distribution and temporal variation of ...

  7. Tetrodotoxin: Occurrence in atelopid frogs of Costa Rica.

    Science.gov (United States)

    Kim, Y H; Brown, G B; Mosher, F A

    1975-07-11

    The potent neurotoxin tetrodotoxin, which has previously been found in puffer fish of the order Tetraordontiformes, a goby (Gobius criniger), and the California newt (Taricha torosa), has now been identified in the skins of frogs of the genus Atelopus from Costa Rica. PMID:1138374

  8. Occurrence of tetrodotoxin in the frog Atelopus oxyrhynchus.

    Science.gov (United States)

    Mebs, D; Schmidt, K

    1989-01-01

    Alcohol extracts from the frog Atelopus oxyrhynchus were toxic to mice when injected intraperitoneally. The toxin was purified by gel filtration on a Sephadex G-15 column, and was identified as tetrodotoxin by thin-layer chromatography and GC-MS analysis of the alkali-hydrolyzed and trimethylsilylated derivative giving the same pattern as the C9-base of tetrodotoxin. PMID:2781581

  9. Measurement and Evaluation of Wear Frogs Switches ŽSR

    Directory of Open Access Journals (Sweden)

    Urda Ján

    2014-05-01

    Full Text Available This paper deals with the measurement and evaluation of wear frogs switches ZSR. One of the main problems is the oversize wear. The possibilities analysis of this problem is offered through a set of switches and monitoring of selected parameters. One of these parameters is also monitoring the vertical wear

  10. Habitat use and spatial structure of a barking frog (Eleutherodactylus augusti) population in southeastern Arizona

    Science.gov (United States)

    Goldberg, C.S.; Schwalbe, C.R.

    2004-01-01

    Barking Frogs (Eleutherodactylus augusti) are the northernmost ranging member of the large tropical family Leptodactylidae. We investigated the ecology of this saxicolous species at the northern edge of its range in a canyon in southern Arizona. We captured 54 frogs on discontinuous rock outcrops; eight of nine females and 39 of 45 males were on limestone outcrops. The remaining frogs were closer to limestone outcrops by more than 200 m than would be expected if they were distributed randomly with respect to limestone formations. Seven of 10 frogs radio-tracked had core home ranges (50% fixed kernel) from 94 to 100% on limestone; the other three frogs did not have any part of their home range on limestone outcrops. During five years of mark-recapture efforts, no frogs were found on a different outcrop from the one where they were originally captured; no radio-tracked frogs moved between outcrops during the breeding season. We estimated that four to 20 Barking Frogs occupied each outcrop; these groups probably are connected primarily by juvenile dispersal. As an organism living at the edge of its range, Barking Frogs in Arizona may rely heavily on extensive underground areas such as those found in limestone to protect them from a physiologically challenging environment. To manage for the persistence of Barking Frogs in southern Arizona, we must identify and protect habitat patches and movement pathways among them.

  11. Heart Disease and African Americans

    Science.gov (United States)

    ... Minority Population Profiles > Black/African American > Heart Disease Heart Disease and African Americans Although African American adults are ... were 30 percent more likely to die from heart disease than non-Hispanic whites. African American women are ...

  12. Infant Mortality and African Americans

    Science.gov (United States)

    ... African American > Infant Heath & Mortality Infant Mortality and African Americans African Americans have 2.2 times the infant mortality rate ... birthweight as compared to non-Hispanic white infants. African Americans had almost twice the sudden infant death syndrome ...

  13. The first record of translocated white-clawed crayfish from the Austropotamobius pallipes complex in Sardinia (Italy

    Directory of Open Access Journals (Sweden)

    Julien Amouret

    2015-03-01

    Full Text Available The white-clawed crayfish Austropotamobius pallipes complex is native to Europe, being present in 18 European countries, Italy included. However, the number and abundance of its populations are today restricted and it has been recently classified as “endangered” by IUCN (International Union for Conservation of Nature. Here, we report the first record of this freshwater crayfish in Sardinia Island (Italy. Using a fragment of the mitochondrial DNA 16S rRNA gene, we identified three haplotypes that correspond to the A. italicus meridionalis subclade. We provide information about the sampling area, population density and finally discuss hypotheses about the occurrence of this population in Sardinia, comparing it with other Mediterranean populations. Our results improve the existing knowledge about the phylogeography of the taxon across Italy, confirming its complex pattern of distribution. In addition to the non-native status of the Sardinian A. i. meridionalis crayfish, we showed that the most proximal Mediterranean population of white-clawed crayfish existing in Corsica belongs to A. pallipes from Southern France.

  14. Assessment of radiocesium contamination in frogs 18 months after the Fukushima Daiichi nuclear disaster

    Science.gov (United States)

    Matsushima, Noe; Ihara, Sadao; Takase, Minoru; Horiguchi, Toshihiro

    2015-04-01

    We investigated the accumulation of radionuclides in frogs inhabiting radioactively contaminated areas around Fukushima Daiichi Nuclear Power Plant (FDNPP) to search for possible adverse effects due to radionuclides. We collected 5 frog species and soil samples in areas within and outside a 20-km radius from FDNPP in August and September 2012 and determined their radiocesium concentrations (134Cs and 137Cs). There was a positive correlation between radiocesium concentrations in the soil samples and frogs, and the highest concentration in frogs was 47,278.53 Bq/kg-wet. Although we conducted a histological examination of frog ovaries and testes by light microscopy to detect possible effects of radionuclides on the morphology of germ cells, there were no clear abnormalities in the gonadal tissues of frogs collected from sites with different contamination levels.

  15. Assessment of radiocesium contamination in frogs 18 months after the Fukushima Daiichi nuclear disaster.

    Science.gov (United States)

    Matsushima, Noe; Ihara, Sadao; Takase, Minoru; Horiguchi, Toshihiro

    2015-01-01

    We investigated the accumulation of radionuclides in frogs inhabiting radioactively contaminated areas around Fukushima Daiichi Nuclear Power Plant (FDNPP) to search for possible adverse effects due to radionuclides. We collected 5 frog species and soil samples in areas within and outside a 20-km radius from FDNPP in August and September 2012 and determined their radiocesium concentrations ((134)Cs and (137)Cs). There was a positive correlation between radiocesium concentrations in the soil samples and frogs, and the highest concentration in frogs was 47,278.53 Bq/kg-wet. Although we conducted a histological examination of frog ovaries and testes by light microscopy to detect possible effects of radionuclides on the morphology of germ cells, there were no clear abnormalities in the gonadal tissues of frogs collected from sites with different contamination levels. PMID:25857262

  16. Adaptive response in frogs chronically exposed to low doses of ionizing radiation in the environment

    International Nuclear Information System (INIS)

    Using the micronucleus assay, decreased levels of DNA damage were found after high dose ionizing radiation exposure of liver cells taken from frogs inhabiting a natural environment with above-background levels of ionizing radiation, compared to cells taken from frogs inhabiting background areas. The data obtained from a small number of animals suggest that stress present in the above-background environment could induce an adaptive response to ionizing radiation. This study did not reveal harmful effects of exposure to low levels of radioactivity. On the contrary, stress present in the above-background area may serve to enhance cellular defense mechanisms. - Highlights: → Frogs were collected from background and higher tritium level habitats. → The micronucleus assay was conducted on liver cells obtained from the frogs. → No detrimental effects were noted in frogs exposed to elevated tritium. → Adaptive responses were observed in frogs exposed to elevated tritium.

  17. Retropupillary iris-claw intraocular lens in ectopia lentis in Marfan syndrome

    Science.gov (United States)

    Faria, Mun Yueh; Ferreira, Nuno; Neto, Eliana

    2016-01-01

    Objective To report visual outcomes, complication rate, and safety of retropupillary iris-claw intraocular lens (ICIOL) in ectopia lentis in Marfan syndrome (MFS). Design Retrospective study. Methods Six eyes of three MFS patients with ectopia lentis underwent surgery for subluxation lens and retropupillary ICIOL implantation from October 2014 to October 2015 at the Department of Ophthalmology, Santa Maria Hospital in Lisbon, Portugal. Demographics, preoperative and postoperative best-corrected visual acuity (BCVA), and intraocular pressure were evaluated. Endothelium cell count was assessed using specular microscopy; anterior chamber depth was measured using Pentacam postoperatively; and intraocular lens position was viewed by ultrasound biomicroscopy. All patients were female; mean age was 20±14.264 years (range: 7–38 years). Results The average follow-up period was 6.66 months (range: 4–16 months). Preoperative BCVA was 0.568±0.149 logMAR units, and postoperative BCVA was 0.066±0.121 logMAR units. The mean BCVA gain was −0.502±0.221 on the logMAR scale. Postoperative average astigmatism and intraocular pressure were 1.292±0.697 mmHg (range: 0.5–2.25 mmHg) and 16 mmHg (range: 12–18 mmHg), respectively. The average endothelial cell density decreased from 3,121±178 cells/mm2 before surgery to 2,835±533 cells/mm2 after surgery (measured at last follow-up visit) and in the last follow-up, representing an average endothelial cell loss of 9.16%. Mean anterior chamber depth was 4.01 mm (±0.77 mm), as measured by Pentacam. No complications were found intra- or postoperatively in any of the six studied eyes. Conclusion Retropupillary ICIOL implantation is a safe and effective procedure in the treatment of aphakia in MFS eyes, without capsular support after surgery for ectopia lens. The six eyes that underwent lensectomy and retropupillary ICIOL implantation have had excellent visual outcomes with no complications so far. PMID:27382335

  18. Itraconazole treatment reduces Batrachochytrium dendrobatidis prevalence and increases overwinter field survival in juvenile Cascades frogs.

    Science.gov (United States)

    Hardy, Bennett M; Pope, Karen L; Piovia-Scott, Jonah; Brown, Richard N; Foley, Janet E

    2015-01-15

    The global spread of the fungal pathogen Batrachochytrium dendrobatidis (Bd) has led to widespread extirpation of amphibian populations. During an intervention aimed at stabilizing at-risk populations, we treated wild-caught Cascades frogs Rana cascadae with the antifungal drug itraconazole. In fall 2012, we collected 60 recently metamorphosed R. cascadae from 1 of the 11 remnant populations in the Cascades Mountains (CA, USA). Of these, 30 randomly selected frogs were treated with itraconazole and the other 30 frogs served as experimental controls; all were released at the capture site. Bd prevalence was low at the time of treatment and did not differ between treated frogs and controls immediately following treatment. Following release, Bd prevalence gradually increased in controls but not in treated frogs, with noticeable (but still non-significant) differences 3 wk after treatment (27% [4/15] vs. 0% [0/13]) and strong differences 5 wk after treatment (67% [8/12] vs. 13% [1/8]). We did not detect any differences in Bd prevalence and load between experimental controls and untreated wild frogs during this time period. In spring 2013, we recaptured 7 treated frogs but none of the experimental control frogs, suggesting that over-winter survival was higher for treated frogs. The itraconazole treatment did appear to reduce growth rates: treated frogs weighed 22% less than control frogs 3 wk after treatment (0.7 vs. 0.9 g) and were 9% shorter than control frogs 5 wk after treatment (18.4 vs. 20.2 mm). However, for critically small populations, increased survival of the most at-risk life stage could prevent or delay extinction. Our results show that itraconazole treatment can be effective against Bd infection in wild amphibians, and therefore the beneficial effects on survivorship may outweigh the detrimental effects on growth. PMID:25590775

  19. Food Composition of the Marsh Frog, Rana ridibunda Pallas, 1771, in Thrace

    OpenAIRE

    Kerim ÇİÇEK; Ahmet MERMER

    2007-01-01

    The purpose of this investigation was to determine the feeding habits of the marsh frog, Rana ridibunda, populations inhabiting Turkish Thrace. Analysis of the stomach contents of 53 (19 males, 34 females) adult individuals was performed. The frog diet consisted of a wide variety of arthropods; Diptera (42.62%) and Coleoptera (21.84%) were especially prominent. Aquatic forms did not contribute much to the frog diet. The prey items identified indicate that individuals of this species, like oth...

  20. African Americans and Glaucoma

    Science.gov (United States)

    ... Involved News About Us Donate In This Section African Americans and Glaucoma email Send this article to ... glaucoma is the leading cause of blindness in African Americans. Half of those with glaucoma don't ...

  1. Diabetes in African Americans

    OpenAIRE

    Marshall, M.

    2005-01-01

    African Americans have a high risk for type 2 diabetes. Genetic traits, the prevalence of obesity, and insulin resistance all contribute to the risk of diabetes in the African American community. African Americans have a high rate of diabetic complications, because of poor glycaemic control and racial disparities in health care in the USA. African Americans with diabetes may have an atypical presentation that simulates type 1 diabetes, but then their subsequent clinical course is typical of t...

  2. A zero-one law for recurrence and transience of frog processes

    OpenAIRE

    Kosygina, Elena; Zerner, Martin P. W.

    2015-01-01

    We provide sufficient conditions for the validity of a dichotomy, i.e. zero-one law, between recurrence and transience of general frog models. In particular, the results cover frog models with i.i.d. numbers of frogs per site where the frog dynamics are given by quasi-transitive Markov chains or by random walks in a common random environment including super-critical percolation clusters on $\\mathbb{Z}^d$. We also give a sufficient and almost sharp condition for recurrence of uniformly ellipti...

  3. Food habits and ontogenetic diet shifts of the litter dwelling frog proceratophrys boiei (wied)

    OpenAIRE

    Ariovaldo A. Giaretta; Márcio S. Araújo; Hermes F. de Medeiros; Katia G. Facure

    1998-01-01

    Here is described the diet of Proceratophrys boiei (Wied, 1825), a leaf litter frog of the Atlantic Forest, and test for relationships between frog size and prey size and type. The diet was determined by stomach content analysis. In 38 frogs, was found 76 prey items belonging to 23 taxa. Insects predominate in the diet and the most frequent categories were coleopterans (39.4% of total volume) and orthopterans (25.0%). There was a positive correlation between frog size and volume of prey taken...

  4. Abundance of Green Tree Frogs and Insects in Artificial Canopy Gaps in a Bottomland Hardwood Forest.

    Energy Technology Data Exchange (ETDEWEB)

    Horn, Scott; Hanula, James, L.; Ulyshen, Michael D.; Kilgo, John, C.

    2005-04-01

    ABSTRACT - We found more green tree frogs ( Hyla cinerea) n canopv gaps than in closed canopy forest. Of the 331 green tree frogs observed, 88% were in canopv gaps. Likewise, higher numbers and biomasses of insects were captured in the open gap habitat Flies were the most commonlv collected insect group accounting for 54% of the total capture. These data suggest that one reason green tree frogs were more abundant in canopy gaps was the increased availability of prey and that small canopy gaps provide early successional habitats that are beneficial to green tree frog populations.

  5. First isolation and identification of Elizabethkingia meningoseptica from cultured tiger frog, Rana tigerina rugulosa.

    Science.gov (United States)

    Xie, Zhen-Yu; Zhou, Yong-Can; Wang, Shi-Feng; Mei, Bing; Xu, Xian-Dong; Wen, Wan-Yao; Feng, Yong-Qin

    2009-07-01

    Elizabethkingia meningoseptica has been recognised as an occasional but serious opportunistic bacterial pathogen to human beings. Recently, it was frequently isolated from tiger frog, Rana tigerina rugulosa, with cataract disease, which is the most common disease of unknown aetiology of frogs in Hainan, China. The purpose of this study was to identify and characterise the bacterial strains isolated from the recent outbreaks of cataract disease in farmed tiger frog in Hainan, China, and to evaluate their pathogenicity to the frog and their sensitivity to 20 chemotherapeutic agents. The 16S rRNA gene sequences of strains W0701 (1478bp), W0702 (1477bp) and W0703 (1478bp) showed 98.6-98.7% similarity with the sequence of E. meningoseptica type strain (ATCC 13253) and 99.9-100% similarity with that of E. meningoseptica NTU 870424-IL. Six strains (W0701-W0706) were selected to represent 24 isolates retrieved from six moribund frogs. The morphological, physiological and biochemical characteristics of the six representative isolates were consistent with those of E. meningoseptica strains. The organisms were only susceptible to vancomycin and moderately susceptible to cefoperazone among the 20 investigated chemotherapeutic agents. Virulence test with strain W0702 was conducted and pathogenicity (by intramuscular injection) was demonstrated in the tiger frog. In conclusion, 24 isolates obtained from frogs with cataract disease were the E. meningoseptica strains highly pathogenic to tiger frog, and this is the first report of E. meningoseptica as a pathogen for tiger frog. PMID:19327918

  6. African American Suicide

    Science.gov (United States)

    African American Suicide Fact Sheet Based on 2012 Data (2014) Overview • In 2012, 2,357 African Americans completed suicide in the U.S. Of these, ... 46 per 100,000. • The suicide rate for African Americans ages 10-19 was 2.98 per ...

  7. Contractile reaction of isolated frog aorta after X-irradiation

    International Nuclear Information System (INIS)

    The action of X-rays (50 kV, filtered by 0.3 mm Al) on helical strip of frog aorta (rana esculenta) has been investigated. The isolated preparations have a stable basal tone and are radio-sensitive to X-rays which induce reversible, dose-dependent, contractile responses. After repeated irradiational tachyphylaxis appears. The threshold doses are about 250 R at 3 to 6 kR/min, antiadrenergic (phentolamine, propranolol), anticholinergic (atropin), antihistaminic (Neo-Bridal) and serotoninergic (Deseril) drugs have no visible influence on the X-ray induced reaction, i.e. these action mechanisms of the irradiation-induced contraction do not seem probable. Theophylline and cAMP inhibit the X-ray contraction probably non-specifically. Indometacin also inhibits the X-ray contraction: this suggests participation of prostaglandin-mechanism on the contraction of frog aorta after irradiation. (orig.)

  8. Nanoscale friction and adhesion of tree frog toe pads.

    Science.gov (United States)

    Kappl, Michael; Kaveh, Farzaneh; Barnes, W Jon P

    2016-01-01

    Tree frogs have become an object of interest in biomimetics due to their ability to cling to wet and slippery surfaces. In this study, we have investigated the adhesion and friction behavior of toe pads of White's tree frog (Litoria caerulea) using atomic force microscopy (AFM) in an aqueous medium. Facilitating special types of AFM probes with radii of ∼400 nm and ∼13 μm, we were able to sense the frictional response without damaging the delicate nanopillar structures of the epithelial cells. While we observed no significant adhesion between both types of probes and toe pads in wet conditions, frictional forces under such conditions were very pronounced and friction coefficients amounted between 0.3 and 1.1 for the sliding friction between probes and the epithelial cell surfaces. PMID:27165465

  9. Sperm competitiveness in frogs: slow and steady wins the race.

    Science.gov (United States)

    Dziminski, Martin A; Roberts, J Dale; Beveridge, Maxine; Simmons, Leigh W

    2009-11-22

    When sperm compete to fertilize available ova, selection is expected to favour ejaculate traits that contribute to a male's fertilization success. While there is much evidence to show that selection favours increased numbers of sperm, only a handful of empirical studies have examined how variation in sperm form and function contributes to competitive fertilization success. Here, we examine selection acting on sperm form and function in the externally fertilizing myobatrachid frog, Crinia georgiana. Using in vitro fertilization techniques and controlling for variation in the number of sperm contributed by males in competitive situations, we show that males with a greater proportion of motile sperm, and motile sperm with slower swimming velocities, have an advantage when competing for fertilizations. Sperm morphology and the degree of genetic similarity between putative sires and the female had no influence on competitive fertilization success. These unusual patterns of selection might explain why frog sperm typically exhibit relatively slow swimming speeds and sustained longevity. PMID:19710059

  10. Ten microsatellite loci for the strawberry poison frog (Oophaga pumilio)

    OpenAIRE

    Hauswaldt, J.; Ludewig, A.; Hagemann, S.; Pröhl, H.; Vences, M

    2009-01-01

    We describe primers and PCR conditions to amplify nine new tetranucleotide loci and one new dinucleotide locus isolated from the strawberry poison frog (Oophaga pumilio). In 21 individuals from Costa Rica, the number of alleles ranged from 4 to 16, observed heterozygosities from 40 to 100%, and polymorphic information content ranged from 0.60 to 0.90 per locus. Evidence for linkage disequilibrium was found only between two loci, but this pattern was not found in other populations tested. All ...

  11. Population genetics of the frog-killing fungus Batrachochytrium dendrobatidis

    OpenAIRE

    Morgan, Jess A T; Vance T Vredenburg; Rachowicz, Lara J.; Knapp, Roland A; Stice, Mary J.; Tunstall, Tate; Bingham, Rob E.; Parker, John M.; Longcore, Joyce E.; Moritz, Craig; Briggs, Cheryl J.; Taylor, John W.

    2007-01-01

    Global amphibian decline by chytridiomycosis is a major environmental disaster that has been attributed to either recent fungal spread or environmental change that promotes disease. Here, we present a population genetic comparison of Batrachochytrium dendrobatidis isolates from an intensively studied region of frog decline, the Sierra Nevada of California. In support of a novel pathogen, we find low diversity, no amphibian-host specificity, little correlation between fungal genotype and geogr...

  12. Intercultural education: the project frog and the stranger

    OpenAIRE

    Bernik, Sonja

    2015-01-01

    This diploma thesis was written based on a project of intercultural education Frog and the Stranger in kindergarten, which is based on the eponymous book by Max Velthuijs. The purpose of this project is to provide children with positive experiences associated with the identification of similarities and differences between them. Namely, children were put into situations where they experienced diversity as an advantage and this way the bases of cultural tolerance can be formed. The project of i...

  13. ESR analysis of irradiated frogs' legs and fishes

    International Nuclear Information System (INIS)

    Electron spin resonance (ESR) spectral analysis of different parts (bones, scales, jaw, etc.) from ionized (irradiated) frozen frogs' legs and fishes (brown trout and sardine) were recorded. There is always present, after treatment, a signal due to the irradiation. ESR and ENDOR experiments lead us to assign it to h1 centers from hydroxyapatite, as in the case of other irradiated meat bones. The use of ESR to prove whether one of these foods has been irradiated or not is discussed. (author)

  14. Two Types of Assays for Detecting Frog Sperm Chemoattraction

    OpenAIRE

    Burnett, Lindsey A.; Tholl, Nathan; Chandler, Douglas E.

    2011-01-01

    Sperm chemoattraction in invertebrates can be sufficiently robust that one can place a pipette containing the attractive peptide into a sperm suspension and microscopically visualize sperm accumulation around the pipette1. Sperm chemoattraction in vertebrates such as frogs, rodents and humans is more difficult to detect and requires quantitative assays. Such assays are of two major types - assays that quantitate sperm movement to a source of chemoattractant, so-called sperm accumulation assay...

  15. Sperm competitiveness in frogs: slow and steady wins the race

    OpenAIRE

    Dziminski, Martin A.; Roberts, J. Dale; Beveridge, Maxine; Leigh W. Simmons

    2009-01-01

    When sperm compete to fertilize available ova, selection is expected to favour ejaculate traits that contribute to a male's fertilization success. While there is much evidence to show that selection favours increased numbers of sperm, only a handful of empirical studies have examined how variation in sperm form and function contributes to competitive fertilization success. Here, we examine selection acting on sperm form and function in the externally fertilizing myobatrachid frog, Crinia geor...

  16. Coat and claws as new matrices for noninvasive long-term cortisol assessment in dogs from birth up to 30 days of age.

    Science.gov (United States)

    Veronesi, M C; Comin, A; Meloni, T; Faustini, M; Rota, A; Prandi, A

    2015-09-15

    The last stage of fetal development and the neonatal period represent the most critical phases for the mammals' offspring. In the dog, the knowledge about the final intrauterine fetal development and biology, as well as about the neonatal physiology, remains scarce. Hormonal changes occurring in the last intrauterine fetal phase and during the early neonatal age are still not completely clear, probably because of the invasiveness related to the collection of the more common biological matrix, represented by circulating blood. Toward term of pregnancy, during parturition, and after birth, the hypothalamic-pituitary-adrenal axis is a key system regulating several physiological processes, and its activity was previously investigated by blood analysis, considered an invasive procedure providing a single-point measurement. In respect to animal welfare, and for a more correct long-term retrospective investigation, noninvasive hormonal studies were performed firstly on the hair of humans and coat of animals and, more recently, in the nails of human beings. This study was aimed to assess cortisol (COR) in coat and claws of newborn puppies and to evaluate the possible influence of the newborn gender, breed body size, and age on coat and claws COR concentrations. The results obtained from 165 newborn puppies evidenced that coat and claws COR levels were highly correlated each other (P < 0.0001), although the COR accumulation in the two matrices was different in relation to the class of age. Moreover, the puppies age influenced both coat and claws COR concentrations (P < 0.05), with premature puppies showing higher values when compared to term born-dead puppies or puppies dead between 1 and 30 days of age. The present study reported that COR is quantifiable in coat and claws of newborn dogs. Moreover, both matrices appear as useful tools for new, noninvasive, long-term perinatal and neonatal researches also in canine species. PMID:26081135

  17. Light shines through the spindrift – Phylogeny of African torrent frogs (Amphibia, Anura, Petropedetidae)

    Czech Academy of Sciences Publication Activity Database

    Barej, M. F.; Rödel, M.-O.; Loader, S. P.; Menegon, M.; Gonwouo, N.L.; Penner, J.; Gvoždík, Václav; Günther, R.; Bell, R. C.; Nagel, B.; Schmitz, A.

    2014-01-01

    Roč. 71, č. 2 (2014), s. 261-273. ISSN 1055-7903 Institutional support: RVO:68081766 Keywords : Africa * Amphibians * Taxonomy * Arthroleptides * Petropedetes * Odontobatrachus gen. nov Subject RIV: EG - Zoology Impact factor: 3.916, year: 2014

  18. Embryonic and larval respiration in the arboreal foam nests of the African frog Chiromantis xerampelina.

    Science.gov (United States)

    Seymour, R S; Loveridge, J P

    1994-12-01

    In Zimbabwe, female Chiromantis xerampelina construct spherical foam nests that are suspended above temporary water. The nests average 624 ml in volume and contain 854 eggs. The 1.7 mm ova have exceptionally thin jelly capsules and are dispersed in the foamy core of the nest, which is surrounded by a layer of eggless foam. At 25 degrees C, each embryo requires 3.5 days to reach hatching at developmental stage 22, during which it consumes 30 microliters of oxygen. After hatching, each larva remains in the nest for 2 more days and consumes a further 123 microliters of oxygen. The fresh foam contains 77% air, which is sufficient to supply all of the oxygen requirements of the embryos until well after they hatch. Therefore, the size of the egg mass is not limited by oxygen availability as it is in many other anurans. Oxygen also diffuses into the nest from the atmosphere, but the rate is severely restricted by the wet foam, despite the presence of bubbles. Drying of the outer layer of foam greatly increases its oxygen conductance, but the larvae remain in the inner core of wet foam, where they compete for oxygen at the periphery. With further drying of the nest, the wet foam diminishes in volume and concentrates the larvae at a time when their oxygen demands are approaching the maximum. Oxygen pressures within the wet foam drop below 10 kPa and oxygen uptake by the larvae becomes progressively limited, possibly stimulating their emergence from the nest. The delay between hatching and escape from the nest permits the larvae to grow and mature to a stage at which all of the clutch can emerge simultaneously. PMID:7852908

  19. Frog meat microbiota (Lithobates catesbeianus used in infant food

    Directory of Open Access Journals (Sweden)

    Eliane Rodrigues

    2014-03-01

    Full Text Available Captive breeding of bullfrog (Lithobates catesbeianus is of great economic potential, mainly for its thighs and leather. The nutritional quality of frog meat includes properly balanced amino acids with a protein profile of high biological value, low fat and low cholesterol, and high digestibility due to its short chain molecule structure. It is recommended by doctors and nutritionists, especially for protein restricted children or malnourished children. Aiming to aggregate value to the segment and offer a product with nutritional properties that meet the need of children aged six months and above, a meat product based on the composition of frog meat was developed experimentally. To ensure raw material quality after bleaching and deboning, the microbiota present in the frog meat was determined. The analyses were performed according to Brazilian laws. It was observed that the resident and transient microbiota met the standards set by regulations. The results found were: mesophyll 4.5 x 10(4 CFU/g; Staphylococcus coagulase positive 2.0 x 10² CFU/g; negative for Salmonella sp. and Aeromonas spp. The findings indicate that the raw material showed satisfactory sanitation even in terms of family industry.

  20. Polyandry, Predation, and the Evolution of Frog Reproductive Modes.

    Science.gov (United States)

    Zamudio, Kelly R; Bell, Rayna C; Nali, Renato C; Haddad, Célio F B; Prado, Cynthia P A

    2016-09-01

    Frog reproductive modes are complex phenotypes that include egg/clutch characteristics, oviposition site, larval development, and sometimes, parental care. Two evident patterns in the evolution of these traits are the higher diversity of reproductive modes in the tropics and the apparent progression from aquatic to terrestrial reproduction, often attributed to higher fitness resulting from decreased predation on terrestrial eggs and tadpoles. Here, we propose that sexual selection-and not only natural selection due to predation-favors terrestrial breeding by reducing the loss of fitness due to polyandry. To examine this novel selective mechanism, we reconstructed the evolution of reproductive diversity in two frog families (Hylidae and Leptodactylidae) and tested for concerted evolution of egg and tadpole development sites with specific mating behaviors. We found that oviposition and tadpole development sites are evolving independently, do not show the same diversity and/or directionality in terms of terrestriality, and thus may be diversifying due to different selective mechanisms. In both families, terrestrial egg deposition is correlated with amplexus that is hidden from competing males, and in hylids, testes mass was significantly larger and more variable in males with exposed amplexus that are vulnerable to polyandry. Our results indicate that intrasexual selection has been an underappreciated mechanism promoting diversification of frog reproductive modes. PMID:27513910

  1. Reflex Marine celebrates 10. anniversary of FROG crew transfer device

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    2010-07-15

    Reflex Marine developed the initial 3-person FROG crew transfer device in response to the main risks identified from incidents involving traditional rope baskets for personnel transfer: falling, collisions, hard landings, and immersion. To address these issues, the FROG was developed with 4-point harnesses, a protective shell, shock-absorbing landing feet, and self-righting capability. As a result of industry demand for a higher capacity transfer device, the company introduced 6- and 9-man versions of the FROG. The perceptions and reality of marine transfers have changed greatly over the past decade, from the design of the device to vessel specifications and increased focus on crane operations. Marine transfers offer a low-risk alternative to helicopter transfers. The TORO, a low-cost crew transfer capsule launched in February 2009, fits into a standard shipping container, providing significant logistical advantages. The TORO can carry 4 passengers, offer protection from side impacts and hard landings, and is buoyant and self-righting. Most of the units are being used by major oil and gas companies, but offshore wind turbines are an emerging source of demand for the crew transfer system. 3 figs.

  2. Radioimmunoassay for plasma corticotropin in frogs (Rana esculenta L.)

    International Nuclear Information System (INIS)

    A radioimmunoassay technique has been developed for measuring frog plasma corticotropin (ACTH) without prior extraction. Using synthetic porcine ACTH as a reference standard, 131I-labeled synthetic human ACTH (sp act greater than 500 mCi/mg) as tracer and rabbit anti-porcine ACTH serum, the lower measurable value was estimated at about 4 pg ACTH. Only human and porcine ACTH, ACTH, and frog pituitary ACTH reacted with the rabbit anti-porcine ACTH serum. No cross-reactivity has been found with synthetic ACTH, αMSH, and bovine βMSH. Appearance of damaged 131I-h ACTH components after storage in plasma solutions was followed for 7 days. The conditions making it possible to reduce ACTH damage have been ascertained. The average plasma corticotropin level (+- CI) was found to be 38.8 +- 7.8 pg/ml without any significant difference between males and females. These results suggest that frog ACTH secretion has much in common with mammalian secretions

  3. Develop Inventory Protocols for frogs within the Region 1 Great Northern and Great Basin LCC, Protocol Development & Remote Audial Inventory

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Many refuges lack basic information on distribution of frogs, but conducting inventory surveys for frogs can be problematic. Different species breed at different...

  4. Electrophysiological evidence for an ATP-gated ion channel in the principal cells of the frog skin epithelium

    DEFF Research Database (Denmark)

    Brodin, Birger; Nielsen, Robert

    P2X receptor, Na+ absorption, Short circuit current, Cell potential, Microelectrodes, Frog skin, Cytosolic Ca2+......P2X receptor, Na+ absorption, Short circuit current, Cell potential, Microelectrodes, Frog skin, Cytosolic Ca2+...

  5. Correlation between chloride flux via the mitochondria-rich cells and transepithelial water movement in isolated frog skin (Rana esculenta)

    DEFF Research Database (Denmark)

    Nielsen, Robert

    Antidiuretic hormone; chloride transport; electroosmosis; Frog skin; Intercalated cells; Local osmosis; Mitochondria-rich cells.......Antidiuretic hormone; chloride transport; electroosmosis; Frog skin; Intercalated cells; Local osmosis; Mitochondria-rich cells....

  6. Differential gene expression profile from haematopoietic tissue stem cells of red claw crayfish, Cherax quadricarinatus, in response to WSSV infection.

    Science.gov (United States)

    Liu, Hai-peng; Chen, Rong-yuan; Zhang, Qiu-xia; Peng, Hui; Wang, Ke-jian

    2011-07-01

    White spot syndrome virus (WSSV) is one of the most important viral pathogens in crustaceans. During WSSV infection, multiple cell signaling cascades are activated, leading to the generation of antiviral molecules and initiation of programmed cell death of the virus infected cells. To gain novel insight into cell signaling mechanisms employed in WSSV infection, we have used suppression subtractive hybridization (SSH) to elucidate the cellular response to WSSV challenge at the gene level in red claw crayfish haematopoietic tissue (Hpt) stem cell cultures. Red claw crayfish Hpt cells were infected with WSSV for 1h (L1 library) and 12h (L12 library), respectively, after which the cell RNA was prepared for SSH using uninfected cells as drivers. By screening the L1 and L12 forward libraries, we have isolated the differentially expressed genes of crayfish Hpt cells upon WSSV infection. Among these genes, the level of many key molecules showed clearly up-regulated expression, including the genes involved in immune responses, cytoskeletal system, signal transduction molecules, stress, metabolism and homestasis related genes, and unknown genes in both L1 and L12 libraries. Importantly, of the 2123 clones screened, 176 novel genes were found the first time to be up-regulated in WSSV infection in crustaceans. To further confirm the up-regulation of differentially expressed genes, the semi-quantitative RT-PCR were performed to test twenty randomly selected genes, in which eight of the selected genes exhibited clear up-regulation upon WSSV infection in red claw crayfish Hpt cells, including DNA helicase B-like, multiprotein bridging factor 1, apoptosis-linked gene 2 and an unknown gene-L1635 from L1 library; coatomer gamma subunit, gabarap protein gene, tripartite motif-containing 32 and an unknown gene-L12-254 from L2 library, respectively. Taken together, as well as in immune and stress responses are regulated during WSSV infection of crayfish Hpt cells, our results also

  7. The taxonomic status of two West African Leptopelis species: L. macrotis Schiøtz, 1967 and L. spiritusnoctis Rödel, 2007 (Amphibia: Anura: Arthroleptidae

    Directory of Open Access Journals (Sweden)

    Mark-Oliver Roedel

    2014-03-01

    Full Text Available We herein examine the taxonomic status of two West African forest-dwelling Leptopelis species. The small L. spiritusnoctis, described from the Upper Guinean forests of West Africa, was recently synonymized with L. aubryi, described from Gabon. The large L. macrotis, known from Ghana to Sierra Leone, was downgraded to a subspecies of L. millsoni, ranging from the Niger Delta to eastern Democratic Republic of Congo. These taxonomic decisions are in contrast to the general biogeographic pattern of African forest anurans and we consequently tested if the morphologically similar taxon pairs are indeed conspecifics by applying acoustic and molecular techniques. Both techniques confirmed that populations from West Africa differ significantly from their Central African morphological equivalents. Consequently, we herein resurrect L. spiritusnoctis as a valid species. The acoustic data indicate that L. aubryi may comprise a complex of cryptic species. We further advocate using the name L. macrotis for West African and L. millsoni for Central African populations of these larger arboreal frogs. However, we had neither genetic nor acoustic data from the type locality of L. millsoni available and could not clarify if these frogs belong to the more western or eastern taxon or even represent a Nigerian endemic. Thus, it is possible that West African populations need to be termed L. millsoni in the future. For populations east of the Cross River, Nigeria, the name L. guineensis would be available.

  8. Somaclonal variation in micropropagated Heliconia bihai cv. Lobster Claw I plantlets (Heliconiaceae Variação somaclonal em mudas micropropagadas de Helicônia, Heliconia Bihai cv. Lobster Claw I (Heliconiaceae

    Directory of Open Access Journals (Sweden)

    Paulo Hercílio Viegas Rodrigues

    2008-12-01

    Full Text Available The occurrence of somaclonal variation is described in various cultures of agronomic interest. Such variation can be of benefit in the development of new flower varieties. In this study, the occurrence of somaclonal variation in micropropagated changes of Heliconia bihai cv. Lobster Claw I was investigated. Stem apexes were introduced in MS culture media with the addition of 2.5 mg L-1 of benzylaminopure (BAP and 500 mg L-1 of sodium cefotaxime. After selecting the apex stem, it was sub-cultivated in MS media and supplemented with 4.0 mg L-1 of BAP to induce side buds. To conduct the trial, 2,000 plants were selected and compared with plants originated from rhizomes. To calculate the percentage of the variants, the plant stature, the form and color of leaves and pseudostem were evaluated. The plants with buds presenting the same type of variation were considered as variants. The occurrence of three types of somaclonal variants was observed: Variation of the Chlorophyll in the Leaf, Low Stature Variant and Pseudostem and Petiole Color Variant, the latter with ornamental potential. The somaclonal variation rate for Heliconia bihai cv Lobster Claw I, under the proposed conditions, was 61.40%.A ocorrência de variação somaclonal é descrita em diversas culturas de interesse agronômico. A floricultura pode beneficiar-se dessa variabilidade, com a obtenção de novas variedades. Nesse trabalho, estudou-se a ocorrência de variação somaclonal em mudas micropropagadas de Heliconia bihai cv. Lobster Claw I. Ápices caulinares foram introduzidos em meio de cultivo MS com adição de 2,5 mg L-1 de benzilaminopurina (BAP e 500 mg L-1 de cefotaxima sódica. Após a seleção do ápice caulinar, o explante foi subcultivado em meio MS suplementado com 4,0 mg L-1 de BAP para indução de brotações. Foram selecionadas, ao acaso, 2.000 mudas e comparadas com mudas originadas de rizomas, para compor o ensaio. No cálculo da porcentagem dos variantes

  9. Snow cover and late fall movement influence wood frog survival during an unusually cold winter.

    Science.gov (United States)

    O'Connor, Jason H; Rittenhouse, Tracy A G

    2016-07-01

    Understanding how organisms will respond to altered winter conditions is hampered by a paucity of information on the winter ecology for many species. Amphibians are sensitive to environmental temperature and moisture conditions and may be vulnerable to changes in winter climate. We used a combination of radio telemetry and field enclosures to monitor survival of the freeze-tolerant wood frog (Lithobates sylvaticus) during the unusually cold winter of 2013-2014. We experimentally manipulated snow cover to determine the effect of snow removal on winter survival. In addition, we placed a group of untracked frogs at locations used by tracked frogs prior to long-distance late fall movement to investigate whether late fall movement entailed survival consequences. Winter survival was highest (75.3 %) among frogs at post-movement locations that received natural snow cover. The odds of surviving the winter for frogs in the snow removal treatment was only 21.6 % that of frogs in the natural snow treatment. Likewise, paired frogs placed at pre-fall movement locations had only 35.1 % the odds of surviving as tracked frogs at post-fall movement locations. A comparison of a priori models that included microhabitat conditions measured at wood frog overwintering locations revealed that the minimum temperature experienced and the depth of the frog in the substrate explained additional variation in winter survival. Our results suggest that acute exposure to lethal temperature conditions is the most likely cause of mortality during this study, rather than energy exhaustion or desiccation. They also demonstrate the importance of snow cover to the winter survival of wood frogs. PMID:26497126

  10. An Effective Hybrid Cuckoo Search Algorithm with Improved Shuffled Frog Leaping Algorithm for 0-1 Knapsack Problems

    OpenAIRE

    Yanhong Feng; Gai-Ge Wang; Qingjiang Feng; Xiang-Jun Zhao

    2014-01-01

    An effective hybrid cuckoo search algorithm (CS) with improved shuffled frog-leaping algorithm (ISFLA) is put forward for solving 0-1 knapsack problem. First of all, with the framework of SFLA, an improved frog-leap operator is designed with the effect of the global optimal information on the frog leaping and information exchange between frog individuals combined with genetic mutation with a small probability. Subsequently, in order to improve the convergence speed and enhance the exploitatio...

  11. Evaluating Group Housing Strategies for the Ex-Situ Conservation of Harlequin Frogs (Atelopus spp.) Using Behavioral and Physiological Indicators

    OpenAIRE

    Cikanek, Shawna J.; Simon Nockold; Brown, Janine L.; James W Carpenter; Angie Estrada; Jorge Guerrel; Katharine Hope; Roberto Ibáñez; Sarah B Putman; Brian Gratwicke

    2014-01-01

    We have established ex situ assurance colonies of two endangered Panamanian harlequin frogs, Atelopus certus and Atelopus glyphus, but observed that males fought with each other when housed as a group. Housing frogs individually eliminated this problem, but created space constraints. To evaluate the potential stress effects from aggressive interactions when grouping frogs, we housed male frogs in replicated groups of one, two, and eight. We measured aggressive behavioral interactions and feca...

  12. Differentiation of frog fats from vegetable and marine oils by Fourier Transform Infrared Spectroscopy and chemometric analysis

    OpenAIRE

    M. E. Ali; Nina Naquiah, A. N.; Mustafa, S; S. B. A. Hamid

    2015-01-01

    The agro-based production and consumption of frogs coupled with world-wide trading have been increased in the recent years giving rise to the risk of frog fat adulteration in expensive vegetable and marine oils. For the first time, we profiled here frog fats using Fourier Transform Infrared (FTIR) Spectroscopy coupled with multivariate principal component analysis (PCA). The comparison of the FTIR spectral absorbance intensities demonstrated linkage of frog fats to other edible fats and oils....

  13. An Effective Hybrid Cuckoo Search Algorithm with Improved Shuffled Frog Leaping Algorithm for 0-1 Knapsack Problems

    OpenAIRE

    Yanhong Feng; Gai-Ge Wang; Qingjiang Feng; Xiang-Jun Zhao

    2014-01-01

    An effective hybrid cuckoo search algorithm (CS) with improved shuffled frog-leaping algorithm (ISFLA) is put forward for solving 0-1 knapsack problem. First of all, with the framework of SFLA, an improved frog-leap operator is designed with the effect of the global optimal information on the frog leaping and information exchange between frog individuals combined with genetic mutation with a small probability. Subsequently, in order to improve the ...

  14. An addition to the diversity of dendrobatid frogs in Venezuela: description of three new collared frogs (Anura: Dendrobatidae: Mannophryne

    Directory of Open Access Journals (Sweden)

    César Luis Barrio-Amorós

    2010-07-01

    Full Text Available Three new species of collared frogs of the genus Mannophryne are described from Venezuela. Two are newly discovered taxa from the Venezuelan Andes, whereas the third species, previously confused with M. trinitatis, is from the Caracas area in the Cordillera de la Costa. The call of the three new species and that of Mannophryne collaris are described. Taxonomic, zoogeographic, and conservation issues are discussed.

  15. Integration of FULLSWOF2D and PeanoClaw: Adaptivity and Local Time-Stepping for Complex Overland Flows

    KAUST Repository

    Unterweger, K.

    2015-01-01

    © Springer International Publishing Switzerland 2015. We propose to couple our adaptive mesh refinement software PeanoClaw with existing solvers for complex overland flows that are tailored to regular Cartesian meshes. This allows us to augment them with spatial adaptivity and local time-stepping without altering the computational kernels. FullSWOF2D—Full Shallow Water Overland Flows—here is our software of choice though all paradigms hold for other solvers as well.We validate our hybrid simulation software in an artificial test scenario before we provide results for a large-scale flooding scenario of the Mecca region. The latter demonstrates that our coupling approach enables the simulation of complex “real-world” scenarios.

  16. Characteristics of Cyclin B and its potential role in regulating oogenesis in the red claw crayfish (Cherax quadricarinatus).

    Science.gov (United States)

    Wang, L M; Lv, W W; Zuo, D; Dong, Z J; Zhao, Y L

    2015-01-01

    Cyclin B is a regulatory subunit of maturation-promoting factor (MPF), which has a key role in the induction of meiotic maturation of oocytes. MPF has been studied in a wide variety of animal species; however, its expression in crustaceans is poorly characterized. In this study, the complete cDNA sequence of Cyclin B was cloned from the red claw crayfish, Cherax quadricarinatus, and its spatiotemporal expression profiles were analyzed. Cyclin B cDNA (1779 bp) encoded a 401 amino acid protein with a calculated molecular weight of 45.1 kDa. Quantitative real-time PCR demonstrated that Cyclin B mRNA was expressed mainly in the ovarian tissue and that the expression decreased as the ovaries developed. Immunofluorescence analysis revealed that the Cyclin B protein relocated from the cytoplasm to the nucleus during oogenesis. These findings suggest that Cyclin B plays an important role in gametogenesis and gonad development in C. quadricarinatus. PMID:26400307

  17. Ca2+-dependent proteolytic activity in crab claw muscle: effects of inhibitors and specificity for myofibrillar proteins

    International Nuclear Information System (INIS)

    The claw closer muscle of the Bermuda land crab, Gecarcinus lateralis, undergoes a sequential atrophy and restoration during each molting cycle. The role of Ca2+-dependent proteinases in the turn-over of myofibrillar protein in normal anecdysial (intermolt) claw muscle is described. Crab Ca2+-dependent proteinase degrades the myofibrillar proteins actin, myosin heavy and light chains, paramyosin, tropomyosin, and troponin-T and -I. Ca2+-dependent proteinase activity in whole homogenates and 90,000 x g supernatant fractions from muscle homogenates has been characterized with respect to Ca2+ requirement, substrate specificity, and effects of proteinase inhibitors. The enzyme is inhibited by antipain, leupeptin, E-64, and iodoacetamide; it is insensitive to pepstatin A. The specificity of crab Ca2+-dependent proteinase was examined with native myosin with normal ATPase activity as well as with radioiodinated myosin and radioiodinated hemolymph proteins. Hydrolysis of 125I-myosin occurs in two phases, both Ca2+-dependent: (1) heavy chain (M/sub r/ = 200,000) is cleaved into four large fragments (M/sub r/ = 160,000, 110,000, 73,000, 60,000) and numerous smaller fragments; light chain (M/sub r/ = 18,000) is cleaved to a 15,000-Da fragment; (2) the fragments produced in the first phase are hydrolyzed to acid-soluble material. Although radioiodinated native hemolymph proteins are not susceptible to the Ca2+-dependent proteinase, those denatured by carboxymethylation are degraded. These data suggest that crab Ca2+-dependent proteinase is involved in turnover of myofibrillar protein in normal muscle and muscle undergoing proecdysial atrophy

  18. Monitoring of white-clawed crayfish (Austropotamobius pallipes population during a crayfish plague outbreak followed by rescue

    Directory of Open Access Journals (Sweden)

    Collas M.

    2016-01-01

    Full Text Available A mass mortality was detected in the downstream section of one of the most extensive French populations of the endangered white-clawed crayfish, Austropotamobius pallipes, on June 26, 2013. This population occupied a 12 km stretch of the La Lucelle brook, with an estimated size of around 150 000 individuals. The presence of the crayfish plague pathogen was quickly diagnosed as the cause of the mortality, and monitoring was carried out to follow the spread of the disease from 15 July 2013 for one year. Results showed that after a fast spread between 15 and 25 July 2013 (upstream progression of mortality for about 4 km, the mortality front was limited to a stretch of a few hundred meters from August until December 2013. During winter, mortality was always observed, confirming that disease remained active. In April 2014, the mortality front was halted by a large dam in the brook (2 m high, 0.56 km from brook source. Two months later, 30 live crayfish were observed above the dam. On the 30 August 2014, no crayfish were found above the dam. Infected individuals analysed for microsatellite markers confirmed the Pacifastacus leniusculus strain of Aphanomyces astaci at the origin of this outbreak. Before the crayfish plague spread upstream of the large dam, a sample of 576 individuals was collected from upstream of the dam and translocated to another stream in the same French department. In July 2014, observations by night confirmed the presence of translocated white-clawed crayfish in the receiving brook.

  19. The toxicity of Poison Dart Frog alkaloids against the Fire Ant (Solenopsis invicta)

    Science.gov (United States)

    Hundreds of alkaloids, representing over 20 structural classes, have been identified from the skin of neotropical poison frogs (Dendrobatidae). These alkaloids are derived from arthropod prey of the frogs, and are generally are believed to deter vertebrate predators. We developed a method to put ind...

  20. Sexual differences in prevalence of a new species of trypanosome infecting túngara frogs.

    Science.gov (United States)

    Bernal, Ximena E; Pinto, C Miguel

    2016-04-01

    Trypanosomes are a diverse group of protozoan parasites of vertebrates transmitted by a variety of hematophagous invertebrate vectors. Anuran trypanosomes and their vectors have received relatively little attention even though these parasites have been reported from frog and toad species worldwide. Blood samples collected from túngara frogs (Engystomops pustulosus), a Neotropical anuran species heavily preyed upon by eavesdropping frog-biting midges (Corethrella spp.), were examined for trypanosomes. Our results revealed sexual differences in trypanosome prevalence with female frogs being rarely infected (frog-biting midges that find their host using the mating calls produced by male frogs. Following previous anuran trypanosome studies, we examined 18S ribosomal RNA gene to characterize and establish the phylogenetic relationship of the trypanosome species found in túngara frogs. A new species of giant trypanosome, Trypanosoma tungarae n. sp., is described in this study. Overall the morphometric data revealed that the trypomastigotes of T. tungarae n. sp. are similar to other giant trypanosomes such as Trypanosoma rotatorium and Trypanosoma ranarum. Despite its slender and long cell shape, however, 18S rRNA gene sequences revealed that T. tungarae n. sp. is sister to the rounded-bodied giant trypanosome, Trypanosoma chattoni. Therefore, morphological convergence explains similar morphology among members of two non-closely related groups of trypanosomes infecting frogs. The results from this study underscore the value of coupling morphological identification with molecular characterization of anuran trypanosomes. PMID:26977404

  1. Cues used in host-seeking behavior by frog-biting midges (Corethrella spp. Coquillet).

    Science.gov (United States)

    Bernal, Ximena E; de Silva, Priyanka

    2015-06-01

    We investigated the role of carbon dioxide and host temperature in host attraction in frog-biting midges (Corethrella spp). In these midges, females are known to use frog calls to localize their host, but the role of other host-emitted cues has yet not been investigated. We hypothesized that carbon dioxide acts as a supplemental cue to frog calls. To test this hypothesis, we determined the responses of the midges to carbon dioxide, frog calls, and both cues. A significantly lower number of midges are attracted to carbon dioxide and silent traps than to traps broadcasting frog calls. Adding carbon dioxide to the calls does not increase the attractiveness to the midges. Instead, carbon dioxide can have deterrent effects on frog-biting midges. Temperature of calling frogs is not a cue potentially available to the midges. Contrary to our hypothesis, there was no supplemental effect of carbon dioxide when presented in conjunction to calls. Midge host-seeking behavior strongly depends on the mating calls emitted by their anuran host. Overall, non-acoustic cues such as host body temperature and carbon dioxide are not important in long-distance host location by frog-biting midges. PMID:26047192

  2. Condition-dependent reproductive effort in frogs infected by a widespread pathogen.

    Science.gov (United States)

    Roznik, Elizabeth A; Sapsford, Sarah J; Pike, David A; Schwarzkopf, Lin; Alford, Ross A

    2015-07-01

    To minimize the negative effects of an infection on fitness, hosts can respond adaptively by altering their reproductive effort or by adjusting their timing of reproduction. We studied effects of the pathogenic fungus Batrachochytrium dendrobatidis on the probability of calling in a stream-breeding rainforest frog (Litoria rheocola). In uninfected frogs, calling probability was relatively constant across seasons and body conditions, but in infected frogs, calling probability differed among seasons (lowest in winter, highest in summer) and was strongly and positively related to body condition. Infected frogs in poor condition were up to 40% less likely to call than uninfected frogs, whereas infected frogs in good condition were up to 30% more likely to call than uninfected frogs. Our results suggest that frogs employed a pre-existing, plastic, life-history strategy in response to infection, which may have complex evolutionary implications. If infected males in good condition reproduce at rates equal to or greater than those of uninfected males, selection on factors affecting disease susceptibility may be minimal. However, because reproductive effort in infected males is positively related to body condition, there may be selection on mechanisms that limit the negative effects of infections on hosts. PMID:26063847

  3. Recurrence for the frog model with drift on $\\mathbb{Z}^d$

    OpenAIRE

    Döbler, Christian; Pfeifroth, Lorenz

    2014-01-01

    In this paper we present a recurrence criterion for the frog model on $\\mathbb{Z}^d$ with an i.i.d. initial configuration of sleeping frogs and such that the underlying random walk has a drift to the right.

  4. The critical probability for the frog model is not a monotonic function of the graph

    OpenAIRE

    Fontes, L. R.; Machado, F. P.; Sarkar, A.

    2004-01-01

    We show that the critical probability for the frog model on a graph is not a monotonic function of the graph. This answers a question of Alves, Machado and Popov. The nonmonotonicity is unexpected as the frog model is a percolation model.

  5. Comparison of RABITT and FROG measurements in the temporal characterization of attosecond pulse trains

    CERN Document Server

    Kim, Kyung Taec; Park, Mi Na; Imran, Tayyab; Umesh, G; Nam, Chang Hee

    2007-01-01

    The attosecond high harmonic pulses obtained from a long Ar-filled gas cell were characterized by two techniques - the reconstruction of attosecond beating by interference of two-photon transition (RABITT) and frequency-resolved optical gating (FROG) methods. The pulse durations obtained by RABITT and FROG methods agreed within 10 %.

  6. Flesh fly myiasis (Diptera, Sarcophagidae in Peruvian poison frogs genus Epipedobates (Anura, Dendrobatidae

    Directory of Open Access Journals (Sweden)

    Mattias Hagman

    2005-10-01

    Full Text Available In this note we review records of myiasis in poison frogs collected in various locations in Peru during 1982-2005 and present evidence that larger and medium-sized poison frogs (Epipedobates are infected with sarcophagid fly larvae.

  7. Radioautographic and histologic investigation of skin in young and old frogs

    International Nuclear Information System (INIS)

    Age differences in the skin structure have been studied in young (one year-old) and aged (five and a half year- old) frogs, Xenopus laevis. The epidermis in young frogs is made up of an average of 6.3 and 4.7 layers of epithelial cells at abdominal and dorsal surfaces, respectively. In aged frogs, the number of respective cell layers at abdominal and dorsal surfaces increases to 8.8 and 5.6. The thickness of the dermis (spongiosum) in aged frogs is decrease d 25% on the abdominal side (from 267 μm to 207 μm) but is increased by 11% on the dorsal side (from 275 μm to 305 μm). The nucleolar index and 3H-uridine incorporation, as judged by radioautography, by epithelial cells are drastically reduced in aged frogs.

  8. Absence of tetrodotoxins in a captive-raised riparian frog, Atelopus varius.

    Science.gov (United States)

    Daly, J W; Padgett, W L; Saunders, R L; Cover, J F

    1997-05-01

    Bufonid frogs of the genus Atelopus contain two classes of skin toxins, namely the steroidal bufadienolides and the water-soluble tetrodotoxins. Frogs of the Panamanian species Atelopus varius have now been raised in captivity and levels in skin extracts of bufadienolides and of tetrodotoxin-like compounds assessed, using inhibition of [3H]ouabain binding and inhibition of [3H]saxitoxin binding, respectively. Levels of ouabain equivalents, corresponding to bufadienolides, were comparable to those found in wild-caught frogs from the same population in Panama, while tetrodotoxin-like activity was undetectable. The results strongly implicate environmental factors, perhaps symbiotic microorganisms, in the genesis of tetrodotoxins in the skin of frogs of the genus Atelopus, while indicating that the frog itself produces the skin bufadienolides. PMID:9203295

  9. Abundance of green tree frogs and insects in artificial canopy gaps in a bottomland hardwood forest.

    Energy Technology Data Exchange (ETDEWEB)

    Horn, Scott; Hanula, James L.; Ulyshen, Michael D.; Kilgo, John C.

    2005-01-01

    Horn, Scott, James L. Hanula, Michael D. Ulyshen, and John C. Kilgo. 2005. Abundance of green tree frogs and insects in artificial canopy gaps in a bottomland hardwood forest. Am. Midl. Nat. 153:321-326. Abstract: We found more green tree frogs (Hyla cinerea) in canopy gaps than in closed canopy forest. Of the 331 green tree frogs observed, 88% were in canopy gaps. Likewise, higher numbers and biomasses of insects were captured in the open gap habitat. Flies were the most commonly collected insect group accounting for 54% of the total capture. These data suggest that one reason green tree frogs were more abundant in canopy gaps was the increased availability of prey and that small canopy gaps provide early successional habitats that are beneficial to green tree frog populations.

  10. Response of the Italian agile frog (Rana latastei) to a Ranavirus, frog virus 3: a model for viral emergence in naïve populations.

    OpenAIRE

    Pearman, P. B.; Garner, T. W. J.; Straub, M.; Greber, U F

    2004-01-01

    Ranavirus (family Iridoviridae) is a genus of pathogens of poikilotherms, and some ranaviruses may play a role in widespread mortality of amphibians. Ecology of viral transmission in amphibians is poorly known but can be addressed through experimentation in the laboratory. In this study, we use the Ranavirus frog virus 3 (FV3) as an experimental model for pathogen emergence in naive populations of tadpoles. We simulated emerging disease by exposing tadpoles of the Italian agile frog (Rana lat...

  11. Behavioral Responses of Northern Leopard Frogs (Rana pipiens to Roads and Traffic: Implications for Population Persistence

    Directory of Open Access Journals (Sweden)

    Lenore Fahrig

    2009-12-01

    Full Text Available A key goal in road ecology is to determine which species are most vulnerable to the negative effects of roads on population persistence. Theory suggests that species that avoid roads are less likely to be negatively affected by roads than those that do not avoid roads. The goal of this study was to take a step toward testing this prediction by evaluating the behavioral response to roads and traffic of a species whose populations are known to be negatively affected by roads and traffic, the northern leopard frog (Rana pipiens. We studied the movement patterns of northern leopard frogs during their spring migration from overwintering sites in a river to various breeding ponds that were disconnected from the river by roads. We performed short-distance translocations of migrating frogs, followed them visually, and documented their movement coordinates following each hop, both near the roads and in non-roaded areas. We found that frogs took longer to move near roads with more traffic and that their movement was quickest in areas without roads nearby. Frogs tended to deviate more from a straight-line course when they were released near roads than compared with control areas, but this response was independent of traffic volume. All frogs released near roads attempted to cross the road. On very low traffic roads (10.86 mean vehicles per hour, 94% of frogs crossed the road successfully, whereas at higher traffic roads (58.29 mean vehicles per hour 72% were successful. Our results suggest that frog's inability to avoid going onto roads and their slow movement combine to make them particularly vulnerable to road mortality, which likely explains the strong negative effects of roads on frog population abundance. Conservation efforts should focus on preventing frogs from accessing the road surface through the use of drift fencing and culverts.

  12. Xenopus: An Emerging Model for Studying Congenital Heart Disease

    OpenAIRE

    Kaltenbrun, Erin; Tandon, Panna; Amin, Nirav M.; Waldron, Lauren; Showell, Chris; Conlon, Frank L

    2011-01-01

    Congenital heart defects affect nearly 1% of all newborns and are a significant cause of infant death. Clinical studies have identified a number of congenital heart syndromes associated with mutations in genes that are involved in the complex process of cardiogenesis. The African clawed frog, Xenopus, has been instrumental in studies of vertebrate heart development and provides a valuable tool to investigate the molecular mechanisms underlying human congenital heart diseases. In this review, ...

  13. Sterility and Gene Expression in Hybrid Males of Xenopus laevis and X. muelleri

    OpenAIRE

    John H Malone; Chrzanowski, Thomas H.; Pawel Michalak

    2007-01-01

    BACKGROUND: Reproductive isolation is a defining characteristic of populations that represent unique biological species, yet we know very little about the gene expression basis for reproductive isolation. The advent of powerful molecular biology tools provides the ability to identify genes involved in reproductive isolation and focuses attention on the molecular mechanisms that separate biological species. Herein we quantify the sterility pattern of hybrid males in African Clawed Frogs (Xenop...

  14. Xenopus Vocalizations Are Controlled by a Sexually Differentiated Hindbrain Central Pattern Generator

    OpenAIRE

    Rhodes, Heather J.; Yu, Heather J.; YAMAGUCHI, ayako

    2007-01-01

    Male and female African clawed frogs (Xenopus laevis) produce rhythmic, sexually distinct vocalizations as part of courtship and mating. We found that Xenopus vocal behavior is governed by a sexually dimorphic central pattern generator (CPG) and that fictive vocalizations can be elicited from an in vitro brain preparation by application of serotonin or by electrical stimulation of a premotor nucleus. Male brains produced fictive vocal patterns representing two calls commonly produced by males...

  15. Phylogenetic and structural analysis of the phospholipase A2 gene family in vertebrates

    OpenAIRE

    Huang, Qi; Wu, Yuan; Qin, Chao; HE, WENWU; Wei, Xing

    2014-01-01

    The phospholipase A (PLA)2 family is the most complex gene family of phospholipases and plays a crucial role in a number of physiological activities. However, the phylogenetic background of the PLA2 gene family and the amino acid residues of the PLA2G7 gene following positive selection gene remain undetermined. In this study, we downloaded 49 genomic data sets of PLA from different species, including the human, house mouse, Norway rat, pig, dog, chicken, cattle, African clawed frog, Sumatran ...

  16. African Otter Workshop

    OpenAIRE

    Jan Reed-Smith; Hughes Akpona; Grace Yoxon

    2016-01-01

    All concerned thought this was an excellent workshop with important progress made towards creating a viable beginning of an African Otter Network. There is a long road ahead but the 2015 African Otter Workshop is a start on developing range country partners, activists and researchers as well as collaborating on issue identification and resolution which will assist in preserving at least some refugia for Africa’s otters. A list of actions was agreed on, including the creation of an African Ott...

  17. African and non-African admixture components in African Americans and an African Caribbean population.

    Science.gov (United States)

    Murray, Tanda; Beaty, Terri H; Mathias, Rasika A; Rafaels, Nicholas; Grant, Audrey Virginia; Faruque, Mezbah U; Watson, Harold R; Ruczinski, Ingo; Dunston, Georgia M; Barnes, Kathleen C

    2010-09-01

    Admixture is a potential source of confounding in genetic association studies, so it becomes important to detect and estimate admixture in a sample of unrelated individuals. Populations of African descent in the US and the Caribbean share similar historical backgrounds but the distributions of African admixture may differ. We selected 416 ancestry informative markers (AIMs) to estimate and compare admixture proportions using STRUCTURE in 906 unrelated African Americans (AAs) and 294 Barbadians (ACs) from a study of asthma. This analysis showed AAs on average were 72.5% African, 19.6% European and 8% Asian, while ACs were 77.4% African, 15.9% European, and 6.7% Asian which were significantly different. A principal components analysis based on these AIMs yielded one primary eigenvector that explained 54.04% of the variation and captured a gradient from West African to European admixture. This principal component was highly correlated with African vs. European ancestry as estimated by STRUCTURE (r(2)=0.992, r(2)=0.912, respectively). To investigate other African contributions to African American and Barbadian admixture, we performed PCA on approximately 14,000 (14k) genome-wide SNPs in AAs, ACs, Yorubans, Luhya and Maasai African groups, and estimated genetic distances (F(ST)). We found AAs and ACs were closest genetically (F(ST)=0.008), and both were closer to the Yorubans than the other East African populations. In our sample of individuals of African descent, approximately 400 well-defined AIMs were just as good for detecting substructure as approximately 14,000 random SNPs drawn from a genome-wide panel of markers. PMID:20717976

  18. 论莫言小说《蛙》中的“蛙”意象%The Frog Image in the Novel Frog by Mo Yan

    Institute of Scientific and Technical Information of China (English)

    蒋卉

    2012-01-01

    从远古神话到到当代小说,从考古、民俗到文学想象,“蛙”意象的产生与发展经历了一个漫长而富有变化的过程。文章结合文学人类学的理论对莫言长篇小说《蛙》中的“蛙”意象进行深度分析,追溯到“蛙”原型中的“蛙女神”,将其与小说中突出的人物“姑姑”进行对比,揭示这一原型意象的运用对小说文化蕴涵的提升作用。%The image of frog has a long history since its creation and differs quite well in different texts like ancient mythology,contemporary novels,archeology,folklore and literary i- maginations. This paper analyzes the image of frog from the perspective of literary anthropolo- gy in the novel Frog by Mo Yan. A comparative, study of the protagonist,the aunt of the nar- rator in the novel,and the frog goddess,the prototype frog, will be conducted,which indicates that the archetypal image of frog helps to enrich cultural connotations of the novel.

  19. Periodic Solutions of a Model of Mitosis in Frog Eggs

    Institute of Scientific and Technical Information of China (English)

    Bei-ye Feng; Zuo-huan Zheng

    2002-01-01

    In this paper,we discuss a simplified model of mitosis in frog eggs proposed by M.T. Borisuk and J.J.Tyson in [1]. By using rigorous qualitative analysis, we prove the existence of the periodic solutions on a large scale and present the space region of the periodic solutions and the parameter region coresponding to the periodic solution. We also present the space region and the parameter region where there are no periodic solutions. The results are in accordance with the numerical results in [1] up to the qualitative property.

  20. Plasma membrane electron transport in frog blood vessels

    Indian Academy of Sciences (India)

    Rashmi P Rao; K Nalini; J Prakasa Rao

    2009-12-01

    In an attempt to see if frog blood vessels possess a plasma membrane electron transport system, the postcaval vein and aorta isolated from Rana tigrina were tested for their ability to reduce ferricyanide, methylene blue, and 2,6-dichloroindophenol. While the dyes remained unchanged, ferricyanide was reduced to ferrocyanide. This reduction was resistant to inhibition by cyanide and azide. Heptane extraction or formalin fixation of the tissues markedly reduced the capability to reduce ferricyanide. Denuded aortas retained only 30% of the activity of intact tissue. Our results indicate that the amphibian postcaval vein and aorta exhibit plasma membrane electron transport

  1. From transience to recurrence with Poisson tree frogs

    OpenAIRE

    Hoffman, Christopher; Johnson, Tobias; Junge, Matthew

    2016-01-01

    Consider the following interacting particle system on the $d$-ary tree, known as the frog model: Initially, one particle is awake at the root and i.i.d. Poisson many particles are sleeping at every other vertex. Particles that are awake perform simple random walks, awakening any sleeping particles they encounter. We prove that there is a phase transition between transience and recurrence as the initial density of particles increases, and we give the order of the transition up to a logarithmic...

  2. Ranavirus in wild edible frogs Pelophylax kl. esculentus in Denmark

    DEFF Research Database (Denmark)

    Ariel, Ellen; Kielgast, Jos; Svart, Hans Erik;

    2009-01-01

    A survey for the amphibian pathogens ranavirus and Batrachochytrium dendrobatidis (Bd) was conducted in Denmark during August and September 2008. The public was encouraged via the media to register unusual mortalities in a web-based survey. All members of the public that registered cases were...... interviewed by phone and 10 cases were examined on suspicion of diseaseinduced mortality. All samples were negative for Bd. Ranavirus was isolated from 2 samples of recently dead frogs collected during a mass mortality event in an artificial pond near Slagelse, Denmark. The identity of the virus was confirmed...

  3. Impact of Chinese mitten crab Eriocheir sinensis on blue mussel Mytilus edulis trossulus – laboratory studies of claw strength, handling behavior, consumption rate, and size selective predation

    Directory of Open Access Journals (Sweden)

    Dagmara Wójcik

    2015-07-01

    E. sinensis can also harm blue mussel shells by crushing them without further consumption. The mean daily damage, and not consumption, by a single crab was 0.9 ± 1.4 of 11–40 mm mussels. The claw strength of E. sinensis ranged from 1.50 to 20.43 N (mean 8.51 ± 5.93 N and was significantly correlated (P < 0.05 with sex and both claw size and carapace size. The study showed that E. sinensis may be able to impact the native M. edulis trossulus population abundance in the coastal Baltic waters either through direct predation or indirect mortality by damaging (crushing the shell.

  4. Water chemistry and endangered white-clawed Crayfish: a literature review and field study of water chemistry association in Austropotamobius pallipes

    Directory of Open Access Journals (Sweden)

    Haddaway N.R.

    2015-01-01

    Full Text Available Populations of the endangered white-clawed crayfish (Austropotamobius pallipes have rapidly declined in distribution and density in recent decades as a result of invasive crayfish, disease and habitat degradation. The species is thought to be particularly sensitive to water chemistry, and has been proposed as a bio-indicator of water quality. Here we detail the results of a systematic review of the literature regarding the chemistry of waterbodies inhabited by white-clawed crayfish, along with a wide-scale field study of the chemistry of crayfish-inhabited waterbodies in the UK. We use these data to examine potentially significant variables influencing crayfish distribution. Several variables appear to have thresholds that affect crayfish distribution; crayfish presence was associated with high dissolved oxygen, low conductivity, ammonium, sodium, and phosphate, and to a lesser extent low sulphate, nitrate, and total suspended solids. Some variables (magnesium, potassium, sodium, sulphate, nitrate, and total suspended solids may be tolerated at moderate to high concentrations in isolation (indicated by the presence of some populations in high levels of these variables, but suites of chemical conditions may act synergistically in situ and must be considered together. Recent efforts to conserve white-clawed crayfish have included relocations to Ark Sites; novel protected habitats with reduced risk of the introduction of disease, invasive crayfish and habitat degradation. We use our findings to propose the first detailed guidelines for common water chemistry variables of potential Ark Sites for the conservation of the species throughout its European range.

  5. [The "necktie lasso": a new technique for the simultaneous treatment of Wartenberg's sign and claw deformities in the hand due to ulnar nerve palsy].

    Science.gov (United States)

    Belmahi, A M; Gharib, N E; El Mazouz, S

    2004-08-01

    The "necktie lasso" is a new technique that allows the simultaneous active treatment, of both Wartenberg's sign and claw deformity of the fifth and the fourth digits in the hand with ulnar nerve palsy. The flexor sublimis of the fourth digit is taken by a palmar approach. It is then divided into two strips up to the proximal part of the palm; The radial strip is used as a classical "direct lasso" to treat the claw deformity of the fourth digit; The ulnar strip is wound around the base of the fifth digit by a palmar and dorsal approaches at the level of the proximal phalanx, like a necktie, being medial to its radial pedicle, dorsal and superficial to its extensor apparatus, then lateral to its ulnar pedicle; It is then recovered in the palm and sutured to itself. From September 1998 to April 2003, this technique has been used in eight patients aged between 21 and 35 years old and suffering from post traumatic low ulnar nerve palsy. It was always very effective in dealing with Wartenberg's sign: the active adduction of the fifth digit appearing at the start of flexion. The claw deformity of the fourth and fifth digits was equally actively corrected. No complications are reported in this series. With a mean follow-up of 3 years there was no recurrence of any of the deformities. PMID:15484679

  6. EFFECTS OF SOYBEAN MEAL BASED DIET ON GROWTH PERFORMANCE AND HEMOLYMPH BIOCHEMICAL PARAMETERS OF NARROW-CLAWED CRAYFISH (ASTACUS LEPTODACYLUS ESCHSCHOLTZ, 1823

    Directory of Open Access Journals (Sweden)

    Mahdi Banaee

    2013-01-01

    Full Text Available Like other crustaceans, narrow-clawed crayfish (Astacus leptodacylus Eschscholtz, 1823 can change its diet to the available food during varied life cycles. Diet alteration can affect different biological indices of this species, therefore this study aims at studying changes in growth indices, hemolymph biochemical parameters and biochemical quality of its carcasses, which might occur during diet change of crayfish. The purpose of this experiment was to evaluate the effects of partial replacement of fish meal with soybean meal on growth performance, carcass quality and hemolymph biochemical parameters of narrow-clawed crayfish. 90 healthy adult narrow-clawed crayfish (W=35.50±4.05 g; TL=16.96±1.92 cm were randomly distributed into 9 fiberglass tanks (200 L and were fed for 45 days with three varied diets including: commercial shrimp diet, fishmeal-based diet (A and soybean meal-based diet (B. The results show that changing the diet from animal protein to plant protein caused a significant decrease in the cholesterol and triglyceride levels in hemolymph, as well as carcass fat of the crayfish nourished with B diet when compared with the crayfish fed with A diet. No significant changes of hemolymph levels of glucose, AST and ALT were found between different treatments during this experimental period. In conclusion, it was found that though growth performance reduced, the increased rate of soybean meal in diet from 0.0% to 76% had no adverse effects on biochemical parameters.

  7. The first see-through frog created by breeding: description, inheritance patterns, and dermal chromatophore structure.

    Science.gov (United States)

    Sumida, Masayuki; Islam, Mohammed Mafizul; Igawa, Takeshi; Kurabayashi, Atsushi; Furukawa, Yukari; Sano, Naomi; Fujii, Tamotsu; Yoshizaki, Norio

    2016-01-01

    We have succeeded in creating see-through frogs from natural color mutants of the Japanese brown frog Rana japonica, which usually possesses an ochre or brown back; this coloration enables the organs, blood vessels, and eggs to be observed through the skin without performing dissection. We crossed two kinds of recessive color mutant (black-eyed and gray-eyed) frogs through artificial insemination, and F2 offspring produced frogs whose skin is translucent throughout the life cycle. Three kinds of dermal chromatophores-xanthophores, iridophores, and melanophores-are observed in a layered arrangement in the skin of wild-type frogs, but few chromatophores were present in the skin of the see-through frogs. The translucent skin enables observation of organ growth and cancer formation and progression in the animal, which can be monitored over its entire life without the need for dissection. See-through frogs thus provide a useful animal model for environmental, medical, and biological research. PMID:27080918

  8. Landing in basal frogs: evidence of saltational patterns in the evolution of anuran locomotion

    Science.gov (United States)

    Essner, Richard L.; Suffian, Daniel J.; Bishop, Phillip J.; Reilly, Stephen M.

    2010-10-01

    All frogs are assumed to jump in a similar manner by rapidly extending hindlimbs during the propulsive phase and rotating the limbs forward during flight in order to land forelimbs first. However, studies of jumping behavior are lacking in the most primitive living frogs of the family Leiopelmatidae. These semi-aquatic or terrestrial anurans retain a suite of plesiomorphic morphological features and are unique in using an asynchronous (trot-like) rather than synchronous “frog-kick” swimming gait of other frogs. We compared jumping behavior in leiopelmatids to more derived frogs and found that leiopelmatids maintain extended hindlimbs throughout flight and landing phases and do not land on adducted forelimbs. These “belly-flop” landings limit the ability for repeated jumps and are consistent with a riparian origin of jumping in frogs. The unique behavior of leiopelmatids shows that frogs evolved jumping before they perfected landing. Moreover, an inability to rapidly cycle the limbs may provide a functional explanation for the absence of synchronous swimming in leiopelmatids.

  9. Data on the isolation of immunoglobulin from the serum of the green frog: Rana esculenta

    Directory of Open Access Journals (Sweden)

    Stošić Svetlana

    2006-01-01

    Full Text Available Even though the green frog (Rana esculenta is often used as an experimental model for further studies of physiological laws, little is still known about its serum proteins and their role in immunity. Its serum proteins have been studied quite extensively, as when they are taken up into the organism of another animal they represent antigens themselves. In this work, an attempt was made to isolate some frog serum proteins and to investigate the electrophoretic qualities of the isolated components (electrophoresis on agar gel and immunoelectrophoresis. IgG was isolated using the same procedure applied for human sera and one of the components found in the beta globulin zone was isolated from frog serum by the same procedure. Immunoelectrophoretic analysis, carried out with the full antiserum of a rabbit, obtained by immunization of the rabbit with the frog serum, showed that the isolated component was pure. The obtained results confirm the fact that there are no slow gamma globulins in the frog serum and point out that this procedure, used for isolating human IgG class, is also suitable for isolating one protein component from the serum of the frog, which has the electrophoretic speed of beta globulin and which may represent one category of frog immunoglobulins.

  10. Prevalence of malformed frogs in Kaoping and Tungkang river basins of southern Taiwan.

    Science.gov (United States)

    Huang, Da-Ji; Chiu, Yuh-Wen; Chen, Chien-Min; Huang, Kai-Hsiang; Wang, Shu-Yin

    2010-05-01

    In this study we found many amphibians with bizarre appearances, known as malformations in Pingtung County southern Taiwan. For this investigation we collected frogs inhabiting the Kaoping and Tungkang river watersheds between February 2006 and June 2007. Among the total number of 10,909 normal frogs (i.e., anurans) collected during the investigation period, the Indian rice frogs (Rana limnocharis) account for the greatest number next is the Chinese bullfrog (Rana rugulosa). Of all the 244 captured malformed frogs, the Indian rice frog account for the greatest proportion. These malformed frogs have their main distribution in upstream areas of these two rivers. Our result indicates that the appearance rate of malformed frogs is 1.8% in the upstream reaches of the Kaoping River and 2.6%, and 0.8%, respectively in the upstream and midstream reaches of the Tungkang river. The most-commonly-found malformation is the lack of palms, followed by the lack of appendages, exostosis, and a malformed appendicular. It is, therefore, reasonable to speculate that the causes for the malformation may be related to the increased organic pollutants and agricultural chemicals used in the upstream reaches of these two rivers. PMID:21047008

  11. Keeping African Masks Real

    Science.gov (United States)

    Waddington, Susan

    2012-01-01

    Art is a good place to learn about our multicultural planet, and African masks are prized throughout the world as powerfully expressive artistic images. Unfortunately, multicultural education, especially for young children, can perpetuate stereotypes. Masks taken out of context lose their meaning and the term "African masks" suggests that there is…

  12. Empowering African States

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    China helps bring lasting peace and stability to Africa African think tanks expressed a high opinion of China’s role in helping build African peace and security at the first meeting of the China-Africa Think Tanks Forum. The

  13. African Literature as Celebration.

    Science.gov (United States)

    Achebe, Chinua

    1989-01-01

    Describes the Igbo tradition of "Mbari," a communal creative enterprise that celebrates the world and the life lived in it through art. Contrasts the cooperative, social dimension of pre-colonial African culture with the exclusion and denial of European colonialism, and sees new African literature again celebrating human presence and dignity. (AF)

  14. Octylphenol induced gene expression in testes of Frog, Rana chensinensis.

    Science.gov (United States)

    Li, Xinyi; Liu, Jia; Zhang, Yuhui

    2016-06-01

    Octylphenol (OP) is an endocrine-disrupting chemical (EDC), which can disrupt the reproductive system. To understand the effect of OP, a subtractive cDNA library was constructed using suppression subtractive hybridization (SSH) to identify alterations of gene transcription in the testes of the frog Rana chensinensis after OP exposure. Two hundred positive clones were selected and 134 sequences of gene fragments were produced from the subtractive library randomly. These genes were identified to be involved in metabolic process, cellular process, biological regulation, stimulus, immune system and female pregnancy process. In order to verify the efficiency of the subtractive cDNA library, PSG9 and PAPP-A were analyzed further as two representatives of differentially expressed transcription genes using semi-quantitative RT-PCR. Our result was the first successful construction of the subtractive cDNA library in frog testes after OP treatment. Based on this cDNA library, OP was shown to affect multiple physiological processes including inducing immune response, disrupting the steroid hormone synthesis and influencing spermatogenesis in the testis by up-regulation of specific genes. PMID:26896894

  15. The regulation of volume and ion composition in frog skin.

    Science.gov (United States)

    Ferreira, K T; Ferreira, H G

    1981-08-20

    1. Chemical determinations of Cl- in frog skin indicate that the intracellular concentration of this ion is above that corresponding to an equilibrium distribution. 2. Published data on Na+ efflux from the cell compartments into the two external bathing solutions, and on unidirectional fluxes across the whole preparation suggest that there are large unidirectional fluxes across the basolateral membranes. 3. Cl- uptake from the mucosal barrier is very small, and the removal of Cl- from the mucosal bathing solution does not affect the intracellular Cl- concentration. 4. Removal of Cl- from the serosal bathing solution produces a drastic decrease in cell Cl- together with a loss of water. 5. This is accompanied by a less marked effect on Na+ and K+ content of the cells. 6. The removal of Na+ from the serosal bathing solution produces also a decrease in Cl-, Na+ and K+ content of the cells with a marked loss of water. 7. It is suggested that the basolateral membrane of the frog skin is the site of mechanisms able to regulate volume and ion composition of the epithelial cells and that part of these mechanisms consists of a coupling between the movements of Na+ and Cl-. PMID:7295713

  16. Epigenetic silencers are enriched in dormant desert frog muscle.

    Science.gov (United States)

    Hudson, Nicholas J; Lonhienne, T G A; Franklin, Craig E; Harper, Gregory S; Lehnert, S A

    2008-08-01

    Green-striped burrowing frogs, Cyclorana alboguttata, survive droughts by entering a metabolic depression called aestivation, characterised by a reduction in resting oxygen consumption by 80%. Aestivation in C. alboguttata is manifest by transcriptional silencing of skeletal muscle bioenergetic genes, such as NADH ubiquinone oxidoreductase 1, ATP synthase and superoxide dismutase 2. In this study, we hypothesised that aestivation is associated with epigenetic change in frog muscle. We assessed mRNA transcript abundance of seven genes that code for proteins with established roles in epigenetically-mediated gene silencing [transcriptional co-repressor SIN3A, DNA (cytosine-5-) methyltransferase 1, methyl CpG binding protein 2, chromodomain helicase DNA binding protein 4, histone binding protein rbbp4, histone deacetylase 1 and nuclear receptor co-repressor 2] using qRT-PCR. These seven genes showed a modest (1.1-3.5-fold) but coordinated upregulation in 6-month aestivating muscle. This reached significance for SIN3A and DNA cytosine-5-methyltransferase 1 in standard pair-wise comparisons (p < 0.05), and the candidates as a whole when analysed by Fisher's combined probability test (p < 0.01). These data are consistent with the hypothesis that the transcriptional silencing and metabolic depression that occurs during seasonal dormancy are associated with chromatin remodelling, and present a novel example of an environmentally induced epigenetic modification in an adult vertebrate. PMID:18369641

  17. Frog2: Efficient 3D conformation ensemble generator for small compounds

    OpenAIRE

    Miteva, Maria A; Guyon, Frederic; Tufféry, Pierre

    2010-01-01

    Frog is a web tool dedicated to small compound 3D generation. Here we present the new version, Frog2, which allows the generation of conformation ensembles of small molecules starting from either 1D, 2D or 3D description of the compounds. From a compound description in one of the SMILES, SDF or mol2 formats, the server will return an ensemble of diverse conformers generated using a two stage Monte Carlo approach in the dihedral space. When starting from 1D or 2D description of compounds, Frog...

  18. A field evaluation of frogs as a potential source of secondary organophosphorus insecticide poisoning

    Science.gov (United States)

    Powell, G.V.N.; DeWeese, L.R.; Lamont, T.G.

    1982-01-01

    Because amphibians are relatively resistant to organophosphorus insecticides and can bioaccumulate residues to high levels, they may be a source of secondary poisoning for vertebrates that feed on them. This hypothesis was tested by determining residues in breeding upland chorus frogs Pseudacris triseriata, that were collected from ponds treated with the organophosphorus insecticide fenthion. Frogs were collected up to 3-days posttreatment in four areas that were treated with fenthion formulated in either diesel oil or water. No residues of fenthion were detected above the 0.01 ppm level of analytical sensitivity. These results indicate that the frogs were not a likely source of secondary poisoning for predatory vertebrates.

  19. Effects of predatory fish on survival and behavior of larval gopher frogs (Rana capito) and Southern Leopard Frogs (Rana sphenocephala)

    Science.gov (United States)

    Gregoire, D.R.; Gunzburger, M.S.

    2008-01-01

    Southern Leopard Frogs, Rana sphenocephala, are habitat generalists occurring in virtually all freshwater habitats within their geographic range, whereas Gopher Frogs, Rana capito, typically breed in ponds that do not normally contain fish. To evaluate the potential for predation by fish to influence the distribution of these species, we conducted a randomized factorial experiment. We examined the survival rate and behavior of tadpoles when exposed to Warmouth Sunfish, Lepomis gulosus, Banded Sunfish, Enneacanthus obesus, and Eastern Mosquitofish, Gambusia holbrooki. We also conducted a choice experiment to examine the survival rate of the two species of tadpoles when a predator is given a choice of both species simultaneously. Lepomis gulosus consumed the most tadpoles and ate significantly more tadpoles of R. capito than R. sphenocephala. Gambusia holbrooki injured the most tadpoles, especially R. capito. Enneacanthus obesus did not have an effect on behavior or survival of either anuran species. Tadpoles of both anurans increased hiding when in the presence of L. gulosus and G. holbrooki, but a greater proportion of R. capito hid than did R. sphenocephala. Our results suggest that R. capito are more vulnerable to predation by fish than are R. sphenocephala. The introduction of fish may play a role in population declines of certain anurans breeding in normally fish-free wetlands, and even small fish, such as mosquitofish, may have significant negative effects on the tadpoles of R. capito. Copyright 2008 Society for the Study or Amphibians and Reptiles.

  20. Characterization of heat shock protein 70 in the red claw crayfish (Cherax quadricarinatus): evidence for its role in regulating spermatogenesis.

    Science.gov (United States)

    Fang, Di-An; Wang, Qun; He, Lin; Wang, Juan; Wang, Yang

    2012-01-15

    Heat shock protein 70 (HSP70) is a member of molecular chaperones and is important for reproductive biological processes in eukaryotes. In this regard, a full length HSP70 comprised of 2366 nucleotides from the red claw crayfish Cherax quadricarinatus (CqHSP70) was characterized, which with an open-reading frame of 1959 bp encoded 652 amino acid residues. Its mRNA transcript expression in the testes was measured by real-time quantitative PCR. CqHSP70 mRNA transcripts were detected in all organs especially high in the testes. Furthermore, the greatest transcript levels were found during the spermatogonial preparation phase, while the lowest levels were found during the resting stage of the reproductive cycle. In addition, its distribution in the testes was determined by Western blot and immunohistochemistry. Western blot results revealed a single immunoreactive band with an estimated molecular mass of 70 kDa in different phases of testes development. The strongest immunolabeling positive signal was found in spermatogonia, with lower positive staining in secondary spermatocytes, and weak or absent level in the mature sperm. Interestingly, CqHSP70 was mainly located in the cytoplasm of sperm cells. Thus, our results indicate that CqHSP70 is an essential protein in spermatogenesis, with a crucial reproductive function during sperm maturation in invertebrates. PMID:22037606

  1. Characterization of Cdc2 kinase in the red claw crayfish (Cherax quadricarinatus): evidence for its role in regulating oogenesis.

    Science.gov (United States)

    Wang, Lan-Mei; Zuo, Di; Lv, Wei-Wei; Wang, Dan-Li; Liu, A-Jing; Zhao, Yunlong

    2013-02-25

    Cdc2 kinase is a catalytic subunit of the maturation-promoting factor (MPF), a central factor for inducing the meiotic maturation of oocytes. MPF has been studied in a wide variety of animal species; however, its expression in crustaceans is poorly characterized. In this study, a complete cDNA sequence of Cdc2 kinase was cloned from the red claw crayfish, Cherax quadricarinatus, and its spatiotemporal expression profiles were analyzed. The Cdc2 cDNA (1,769 bp) encodes for a 299 amino acid protein with a calculated molecular weight of 34.7 kDa. Quantitative real-time PCR demonstrated that Cdc2 mRNA was expressed mainly in the ovary tissue and the expression decreased as the ovaries developed. Immunohistochemistry analysis revealed that the Cdc2 protein relocated from the cytoplasm to the nucleus during oogenesis. These findings suggest that Cdc2 kinase may play an important role in the gametogenesis and gonad development in C. quadricarinatus. PMID:23266620

  2. What Is The Proximate Cause Of Begging Behaviour In A Group Of Captive Asian Short-Clawed Otters?

    Directory of Open Access Journals (Sweden)

    Gothard Nicola

    2007-04-01

    Full Text Available The study aimed to ascertain the proximate cause of ‘begging’ behaviour in a group of captive Asian short-clawed otters (Aonyx cinereus. Two alternative hypotheses were tested by manipulating aspects of husbandry in three experimental conditions. Condition 1 served as a baseline for comparison. In Condition 2 meal worms and crickets were provided every hour to stimulate natural foraging and hunting behaviour and alleviate boredom. During Condition 3 the food allowance was increased by 7.5% of the otters’ body weight and they were fed every hour to more accurately represent their natural foraging ecology. The results show that both Condition 2 and Condition 3 reduced ‘begging’ behaviour, however the reduction was significantly greater in Condition 3. Thus indicating that the main cause of ‘begging’ behaviour was hunger, however lack of stimulation is also likely to be a contributing factor. Inconsistency in feeding times might have contributed to the ‘begging’ problem as well, although a further long-term study is needed to determine the extent to which this is a factor. Some recommendations for changing aspects of husbandry and diet are provided

  3. African Peacekeepers in Africa

    DEFF Research Database (Denmark)

    Emmanuel, Nikolas G.

    2015-01-01

    peacekeeping operations in the region. It is important to add that the international community has frequently tried to facilitate the deployment of African armed forces with aid and training. From this reality, the following study goes beyond the current literature by focusing on the international factors...... behind African participation in United Nations (UN) peacekeeping operations in Africa. In doing so, this research focuses on US military aid and foreign troop training from 2002 to 2012, and its impact on African deployments into UN peacekeeping missions in Africa. As can be expected, such third...

  4. Reading the African context

    OpenAIRE

    Musonda Bwalya

    2012-01-01

    There is so much alienation, pain and suffering in our today�s world. In this vein, African Christianity, a voice amongst many voices, should seek to be a transformational religion for the whole of life, affecting all facets of human life towards a fuller life of all in Africa. This article sought to highlight and point to some of the major societal challenges in the African context which African Christianity, as a life-affirming religion, should continue to embrace, re-embrace and engag...

  5. Instruction Manual and Frog Survey Protocols for Region 1 National Wildlife Refuges, East-side Zone

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This manual is intended to assist biologists wishing to conduct surveys for frogs and toads. The document includes detailed information on how to conduct surveys,...

  6. Western spotted frog (Rana pretiosa) distribution in the Bonneville Basin of western Utah: Research in progress

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report provides information on the western spotted frog Rana pretiosa which occurs in Tule Valley, Utah. The following topics are discussed; general...

  7. Effects of oxymorphazone in frogs: long lasting antinociception in vivo, and apparently irreversible binding in vitro

    International Nuclear Information System (INIS)

    Oxymorphazone was found to be a relatively weak antinociceptive drug in intact frog (Rana esculenta) when acetic acid was used as pain stimulus. Frogs remained analgesic for at least 48 hrs following oxymorphazone administration. The ligand increased the latency of wiping reflex in spinal frogs too. There effects were blocked by naloxone. In equilibrium binding studies (3H)oxymorphazone had high affinity to the opioid receptors of frog brain and spinal cord as well. Kinetic experiments show that only 25% of the bound (3H)oxymorphazone is readily dissociable. Preincubation of the membranes with labeled oxymorphazone results in a washing resistant inhibition of the opioid binding sites. At least 70% of the (3H)oxymorphazone specific binding is apparently irreversible after reaction at 5 nM ligand concentration, and this can be enhanced by a higher concentration of tritiated ligand

  8. The Developmental Effects Of A Municipal Wastewater Effluent On The Northern Leopard Frog, Rana pipiens

    Science.gov (United States)

    Wastewater effluents are complex mixtures containing a variety of anthropogenic compounds, many of which are known endocrine disruptors. In order to characterize the development and behavorial effects of such a complex mixture, northern leopard frogs, Rana pipiens, were e...

  9. Exploratory evaluation of nutrient enrichment and frog response at Conboy Lake National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — We sampled nutrient and water quality parameters and surveyed Oregon spotted frogs (Rana pretiosa) life stages (eggs, larvae and recently metamorphosed juveniles)...

  10. Report on Oregon Spotted Frog Egg Mass Surveys 2013-2015

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Oregon spotted frogs (Rana pretiosa) were once common across wetlands throughout western Washington and Oregon and were found in northern California and southern...

  11. Adaptive Grouping Cloud Model Shuffled Frog Leaping Algorithm for Solving Continuous Optimization Problems.

    Science.gov (United States)

    Liu, Haorui; Yi, Fengyan; Yang, Heli

    2016-01-01

    The shuffled frog leaping algorithm (SFLA) easily falls into local optimum when it solves multioptimum function optimization problem, which impacts the accuracy and convergence speed. Therefore this paper presents grouped SFLA for solving continuous optimization problems combined with the excellent characteristics of cloud model transformation between qualitative and quantitative research. The algorithm divides the definition domain into several groups and gives each group a set of frogs. Frogs of each region search in their memeplex, and in the search process the algorithm uses the "elite strategy" to update the location information of existing elite frogs through cloud model algorithm. This method narrows the searching space and it can effectively improve the situation of a local optimum; thus convergence speed and accuracy can be significantly improved. The results of computer simulation confirm this conclusion. PMID:26819584

  12. Semaphoring in an earless frog: the origin of a novel visual signal.

    Science.gov (United States)

    Lindquist, E D; Hetherington, T E

    1998-10-01

    Social communication in anuran amphibians (frogs and toads) is mediated predominantly by acoustic signals. Unlike most anurans, the Panamanian golden frog, Atelopus zeteki, lacks a standard tympanic middle ear and appears to have augmented its communicatory repertoire to include rotational limb motions as visual signals, referred to here as semaphores. The communicatory nature of semaphoring was inferred from experimental manipulations using mirrored self-image presentations and nonresident introductions. Male frogs semaphored significantly more when presented with a mirrored self-image than with a nonreflective control. Novel encounters between resident males and nonresident frogs demonstrated that semaphores were used directionally and were displayed toward target individuals. Females semaphored frequently and this observation represents a rare case of signaling by females in a typically male-biased communicatory regime. Semaphore actions were clearly linked to a locomotory gait pattern and appear to have originated as an elaboration of a standard stepping motion. PMID:24399272

  13. Okefenokee and Banks Lake National Wildlife Refuge 2009 Frog Abnormality Survey Summary

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Summary of frog observations for abnormal conditions at select sites on both Okefenokee and Banks Lake NWRs. During the 2009 summer, STEP students Zach Carter along...

  14. Effects of oxymorphazone in frogs: long lasting antinociception in vivo, and apparently irreversible binding in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Benyhe, S.; Hoffman, G.; Varga, E.; Hosztafi, S.; Toth, G.; Borsodi, A.; Wollemann, M.

    1989-01-01

    Oxymorphazone was found to be a relatively weak antinociceptive drug in intact frog (Rana esculenta) when acetic acid was used as pain stimulus. Frogs remained analgesic for at least 48 hrs following oxymorphazone administration. The ligand increased the latency of wiping reflex in spinal frogs too. There effects were blocked by naloxone. In equilibrium binding studies (/sup 3/H)oxymorphazone had high affinity to the opioid receptors of frog brain and spinal cord as well. Kinetic experiments show that only 25% of the bound (/sup 3/H)oxymorphazone is readily dissociable. Preincubation of the membranes with labeled oxymorphazone results in a washing resistant inhibition of the opioid binding sites. At least 70% of the (/sup 3/H)oxymorphazone specific binding is apparently irreversible after reaction at 5 nM ligand concentration, and this can be enhanced by a higher concentration of tritiated ligand.

  15. Capitalism and African business cultures

    OpenAIRE

    Taylor, Scott D.

    2014-01-01

    Scholars and practitioners once commonly linked 'African culture' to a distinctive 'African capitalism', at odds with genuine capitalism and the demands of modern business. Yet contemporary African business cultures reveal that a capitalist ethos has taken hold within both state and society. The success and visibility of an emergent, and celebrated, class of African big business reveals that business and profit are culturally acceptable. Existing theories of African capitalism are ill-equippe...

  16. Museum material reveals a frog parasite emergence after the invasion of the cane toad in Australia

    Directory of Open Access Journals (Sweden)

    Phalen David N

    2010-06-01

    Full Text Available Abstract Background A parasite morphologically indistinguishable from Myxidium immersum (Myxozoa: Myxosporea found in gallbladders of the invasive cane toad (Bufo marinus was identified in Australian frogs. Because no written record exists for such a parasite in Australian endemic frogs in 19th and early 20th century, it was assumed that the cane toad introduced this parasite. While we cannot go back in time ourselves, we investigated whether material at the museum of natural history could be used to retrieve parasites, and whether they were infected at the time of their collection (specifically prior to and after the cane toad translocation to Australia in 1935. Results Using the herpetological collection at the Australian Museum we showed that no myxospores were found in any animals (n = 115 prior to the cane toad invasion (1879-1935. The green and golden bell frog (Litoria aurea, the Peron's tree frog (Litoria peronii, the green tree frog (Litoria caerulea and the striped marsh frog (Limnodynastes peronii were all negative for the presence of the parasite using microscopy of the gallbladder content and its histology. These results were sufficient to conclude that the population was free from this disease (at the expected minimum prevalence of 5% at 99.7% confidence level using the 115 voucher specimens in the Australian Museum. Similarly, museum specimens (n = 29 of the green and golden bell frog from New Caledonia, where it was introduced in 19th century, did not show the presence of myxospores. The earliest specimen positive for myxospores in a gallbladder was a green tree frog from 1966. Myxospores were found in eight (7.1%, n = 112 frogs in the post cane toad introduction period. Conclusion Australian wildlife is increasingly under threat, and amphibian decline is one of the most dramatic examples. The museum material proved essential to directly support the evidence of parasite emergence in Australian native frogs. This parasite can be

  17. Pathological Study of Blood Parasites in Rice Field Frogs, Hoplobatrachus rugulosus (Wiegmann, 1834)

    OpenAIRE

    Malinee Chutmongkonkul; Achariya Sailasuta; Jetjun Satetasit

    2011-01-01

    One hundred and forty adult rice field frogs, Hoplobatrachus rugulosus (Wiegmann, 1834), were collected in Srakaew province, Thailand. For blood parasite examination, thin blood smears were made and routinely stained with Giemsa. The results showed that 70% of the frogs (98/140) were infected with 5 species of blood parasites, including a Trypanosoma rotatorium-like organism, Trypanosoma chattoni, Hepatozoon sp. a, Hepatozoon sp. b, and Lankesterella minima. Pathological examination of the li...

  18. Strategies for assessing the implications of malformed frogs for environmental health.

    OpenAIRE

    Burkhart, J G; Ankley, G; Bell, H; Carpenter, H.; Fort, D.; Gardiner, D; Gardner, H; Hale, R; Helgen, J C; Jepson, P.; Johnson, D.; Lannoo, M.; Lee, D; Lary, J; Levey, R

    2000-01-01

    The recent increase in the incidence of deformities among natural frog populations has raised concern about the state of the environment and the possible impact of unidentified causative agents on the health of wildlife and human populations. An open workshop on Strategies for Assessing the Implications of Malformed Frogs for Environmental Health was convened on 4-5 December 1997 at the National Institute of Environmental Health Sciences in Research Triangle Park, North Carolina. The purpose ...

  19. On possibility of use of lake frog (Rana ridibunda as a raw material

    Directory of Open Access Journals (Sweden)

    Dinh Van Hai

    2013-04-01

    Full Text Available The technological properties such as physical and chemical compositions, energy value of the muscle tissue of the lake frog(Rana ridibunda have been studied. They have been compared with the indicators of the objects usual to their use in food. Studies have shown the value of the species of amphibians that have not found wide application in the food industry in Russia. It is shown that the lake frog can be used in the specific products.

  20. Reduced immune function predicts disease susceptibility in frogs infected with a deadly fungal pathogen.

    Science.gov (United States)

    Savage, Anna E; Terrell, Kimberly A; Gratwicke, Brian; Mattheus, Nichole M; Augustine, Lauren; Fleischer, Robert C

    2016-01-01

    The relationship between amphibian immune function and disease susceptibility is of primary concern given current worldwide declines linked to the pathogenic fungus Batrachochytrium dendrobatidis (Bd). We experimentally infected lowland leopard frogs (Lithobates yavapaiensis) with Bd to test the hypothesis that infection causes physiological stress and stimulates humoral and cell-mediated immune function in the blood. We measured body mass, the ratio of circulating neutrophils to lymphocytes (a known indicator of physiological stress) and plasma bacterial killing ability (BKA; a measure of innate immune function). In early exposure (1-15 days post-infection), stress was elevated in Bd-positive vs. Bd-negative frogs, whereas other metrics were similar between the groups. At later stages (29-55 days post-infection), stress was increased in Bd-positive frogs with signs of chytridiomycosis compared with both Bd-positive frogs without disease signs and uninfected control frogs, which were similar to each other. Infection decreased growth during the same period, demonstrating that sustained resistance to Bd is energetically costly. Importantly, BKA was lower in Bd-positive frogs with disease than in those without signs of chytridiomycosis. However, neither group differed from Bd-negative control frogs. The low BKA values in dying frogs compared with infected individuals without disease signs suggests that complement activity might signify different immunogenetic backgrounds or gene-by-environment interactions between the host, Bd and abiotic factors. We conclude that protein complement activity might be a useful predictor of Bd susceptibility and might help to explain differential disease outcomes in natural amphibian populations. PMID:27293759

  1. The use of singleplex and nested PCR to detect Batrachochytrium dendrobatidis in free-living frogs

    OpenAIRE

    Selene Dall'Acqua Coutinho; Julieta Catarina Burke; Catia Dejuste de Paula; Miguel Trefaut Rodrigues; José Luiz Catão-Dias

    2015-01-01

    Many microorganisms are able to cause diseases in amphibians, and in the past few years one of the most reported has been Batrachochytrium dendrobatidis. This fungus was first reported in Brazil in 2005; following this, other reports were made in specimens deposited in museum collections, captive and free-living frogs. The aim of this study was to compare singleplex and nested-PCR techniques to detect B. dendrobatidis in free-living and apparently healthy adult frogs from the Brazilian Atlant...

  2. Data on the isolation of immunoglobulin from the serum of the green frog: Rana esculenta

    OpenAIRE

    Stošić Svetlana; Divjak Isidora; Ješić Snežana; Nešić V.; Račić A.; Popović Nada

    2006-01-01

    Even though the green frog (Rana esculenta) is often used as an experimental model for further studies of physiological laws, little is still known about its serum proteins and their role in immunity. Its serum proteins have been studied quite extensively, as when they are taken up into the organism of another animal they represent antigens themselves. In this work, an attempt was made to isolate some frog serum proteins and to investigate the electrophoretic qualities of the isolated compone...

  3. Effects of X-irradiation on some aspects of protein metabolism in the frog, Rana hexadactyla

    International Nuclear Information System (INIS)

    Changes in the level of total proteins and protease in brain, muscle and liver tissues of normal and X-irradiated frogs were determined. Low doses of radiation produced an increment in protein level while high doses produced decrement. However, protease activity at all doses exhibited an elevatory trend. Exposure of frogs to lethal doses resulted in increased protease activity and decreased protein content during post-irradiation periods. The results are discussed on the basis of protein destruction and lysosomal damage. (auth.)

  4. Sexual differences in prevalence of a new species of trypanosome infecting túngara frogs

    Directory of Open Access Journals (Sweden)

    Ximena E. Bernal

    2016-04-01

    Full Text Available Trypanosomes are a diverse group of protozoan parasites of vertebrates transmitted by a variety of hematophagous invertebrate vectors. Anuran trypanosomes and their vectors have received relatively little attention even though these parasites have been reported from frog and toad species worldwide. Blood samples collected from túngara frogs (Engystomops pustulosus, a Neotropical anuran species heavily preyed upon by eavesdropping frog-biting midges (Corethrella spp., were examined for trypanosomes. Our results revealed sexual differences in trypanosome prevalence with female frogs being rarely infected (<1%. This finding suggests this protozoan parasite may be transmitted by frog-biting midges that find their host using the mating calls produced by male frogs. Following previous anuran trypanosome studies, we examined 18S ribosomal RNA gene to characterize and establish the phylogenetic relationship of the trypanosome species found in túngara frogs. A new species of giant trypanosome, Trypanosoma tungarae n. sp., is described in this study. Overall the morphometric data revealed that the trypomastigotes of T. tungarae n. sp. are similar to other giant trypanosomes such as Trypanosoma rotatorium and Trypanosoma ranarum. Despite its slender and long cell shape, however, 18S rRNA gene sequences revealed that T. tungarae n. sp. is sister to the rounded-bodied giant trypanosome, Trypanosoma chattoni. Therefore, morphological convergence explains similar morphology among members of two non-closely related groups of trypanosomes infecting frogs. The results from this study underscore the value of coupling morphological identification with molecular characterization of anuran trypanosomes.

  5. Glycogen accumulation in normal and irradiated minced muscle autografts on frog gastrocnemius

    International Nuclear Information System (INIS)

    Alterations induced in glycogen content and phosphorylase activity have been studied in normal and irradiated minced muscle autografts on frog gastrocnemius at days 1, 3, 5, 7, 10, 15 and 30 postgrafting. The changes observed in the glycogen content and phosphorylase activity conform to the degeneration and regeneration phases of muscle repair. An attempt has been made to explain the altered glycogen utilizing capacities of the frog skeletal muscle during its repair and regeneration. (author)

  6. Checklist and Simple Identification Key for Frogs and Toads from District IV of The MADA Scheme, Kedah, Malaysia.

    Science.gov (United States)

    Jaafar, Ibrahim; Chai, Teoh Chia; Sah, Shahrul Anuar Mohd; Akil, Mohd Abdul Muin Md

    2009-12-01

    A survey was conducted to catalogue the diversity of anurans in District IV of the Muda Agriculture Development Authority Scheme (MADA) in Kedah Darul Aman, Malaysia, from July 1996 to January 1997. Eight species of anurans from three families were present in the study area. Of these, the Common Grass Frog (Fejevarya limnocharis) was the most abundant, followed by Mangrove Frog (Fejevarya cancrivora), Long-legged Frog (Hylarana macrodactyla), and Common Toad (Duttaphrynus melanostictus). Puddle Frog (Occidozyga lima), Taiwanese Giant Frog (Hoplobatrachus rugulosus), and Banded Bullfrog (Kaluola pulchra) were rare during the sampling period, and only one Paddy Frog (Hylarana erythraea) was captured. A simple identification key for the anurans of this area is included for use by scientists and laymen alike. PMID:24575178

  7. Evaluating group housing strategies for the ex-situ conservation of harlequin frogs (Atelopus spp.) using behavioral and physiological indicators.

    Science.gov (United States)

    Cikanek, Shawna J; Nockold, Simon; Brown, Janine L; Carpenter, James W; Estrada, Angie; Guerrel, Jorge; Hope, Katharine; Ibáñez, Roberto; Putman, Sarah B; Gratwicke, Brian

    2014-01-01

    We have established ex situ assurance colonies of two endangered Panamanian harlequin frogs, Atelopus certus and Atelopus glyphus, but observed that males fought with each other when housed as a group. Housing frogs individually eliminated this problem, but created space constraints. To evaluate the potential stress effects from aggressive interactions when grouping frogs, we housed male frogs in replicated groups of one, two, and eight. We measured aggressive behavioral interactions and fecal glucocorticoid metabolite (GC) concentrations as indicators of stress in each tank. In both small and large groups, frogs initially interacted aggressively, but aggressive interactions and fecal GCs declined significantly after the first 2 weeks of being housed together, reaching the lowest levels by week 4. We conclude that aggressive interactions in same-sex groups of captive Atelopus may initially cause stress, but the frogs become habituated within a few weeks and they can safely be housed in same-sex groups for longer periods of time. PMID:24587290

  8. Evaluating group housing strategies for the ex-situ conservation of harlequin frogs (Atelopus spp. using behavioral and physiological indicators.

    Directory of Open Access Journals (Sweden)

    Shawna J Cikanek

    Full Text Available We have established ex situ assurance colonies of two endangered Panamanian harlequin frogs, Atelopus certus and Atelopus glyphus, but observed that males fought with each other when housed as a group. Housing frogs individually eliminated this problem, but created space constraints. To evaluate the potential stress effects from aggressive interactions when grouping frogs, we housed male frogs in replicated groups of one, two, and eight. We measured aggressive behavioral interactions and fecal glucocorticoid metabolite (GC concentrations as indicators of stress in each tank. In both small and large groups, frogs initially interacted aggressively, but aggressive interactions and fecal GCs declined significantly after the first 2 weeks of being housed together, reaching the lowest levels by week 4. We conclude that aggressive interactions in same-sex groups of captive Atelopus may initially cause stress, but the frogs become habituated within a few weeks and they can safely be housed in same-sex groups for longer periods of time.

  9. Chytridiomycosis in wild frogs from southern Costa Rica

    Science.gov (United States)

    Lips, Karen R.; Green, D.E.; Papendick, R.

    2003-01-01

    In 1993, the amphibian fauna of Las Tablas, Costa Rica, began to decline, and by 1998 approximately 50% of the species formerly present could no longer be found. Three years later, at the Reserva Forestal Fortuna, in western Panama, a site approximately 75 km east southeast of Las Tablas, KRL encountered a mass die-off of amphibians and a subsequent decline in abundance and species richness. The epidemiological features of the anuran population declines and die-offs at both sites were similar, suggesting a similar cause. Herein we document the presence of the fungus, Batrachochytrium dendrobatidis, in dead and dying wild frogs collected at Las Tablas just prior to population declines of several anuran species.

  10. Percutaneous absorption of chemicals: developing an understanding for the treatment of disease in frogs.

    Science.gov (United States)

    Llewelyn, V K; Berger, L; Glass, B D

    2016-04-01

    The permeable nature of frog skin presents an alternative route for the delivery of therapeutic chemicals to treat disease in frogs. However, although therapeutic chemicals are often topically applied to the skin of frogs, their pharmacokinetics have rarely been reported. To provide evidence to guide both candidate drug and formulation selection, we highlight factors expected to influence percutaneous absorption through frog skin, including the anatomy and physiology of the skin and the physicochemical properties of applied therapeutic chemicals. Importantly, we also highlight the effects of the formulation on percutaneous absorption, especially the inclusion of potential penetration enhancers as excipients. Finally, we collate empirical data on the topical application of various therapeutic chemicals in postmetamorphic frogs and show that, in contrast to mammalian species, even large chemicals (i.e. >500 Da) and those with a wide range of log P values (-4 through +6) are likely to be absorbed percutaneously. Topical application in frogs thus promises a convenient and effective method for delivering systemic treatments of a diverse range of chemicals; however, further experimental quantification is required to ensure optimal outcomes. PMID:26456710

  11. Gas chromatographic and electron spin resonance investigations of gamma-irradiated frog legs

    Science.gov (United States)

    Morehouse, Kim M.; Ku, Yuoh; Albrecht, Heidi L.; George C., Yang

    Several very sensitive techniques to measure radiation-induced products in frog legs were investigated. Presented here are results from the use of electron spin resonance (ESR) spectroscopy and capillary gas chromatography (GC) to measure radiolysis products in γ-irradiated frog legs. When bone is irradiated, a characteristic ESR signal develops and is easily measured. The intensity of the ESR signal is dose-dependent and stable for several months at room temperature. When triglycerides or fatty acids are irradiated, some of the major stable products formed are hydrocarbons with one less carbon than the precursor fatty acids. These hydrocarbons are formed as the result of the loss of CO 2 during various free radical reactions. A capillary GC procedure was developed to monitor the formation of these hydrocarbons in γ-irradiated frog legs. Since frog legs contain large amounts of palmitic, stearic, oleic, and linoleic acids, the formation of the hydrocarbons (pentadecane, heptadecane, 8-heptadecene, and 6,9-heptadecadiene, respectively) from the decarboxylation of these fatty acids was monitored. The yields of these hydrocarbons were found to be linear with applied dose. A sample from a lot of imported frog legs that were believed to have been treated with ionizing radiation was also analyzed. The ESR technique, in conjunction with the GC data on the hydrocarbons, appears to be a useful approach for identifying and monitoring frog legs that have been treated with ionizing radiation.

  12. California red-legged frog (Rana draytonii) movement and habitat use: Implications for conservation

    Science.gov (United States)

    Fellers, G.M.; Kleeman, P.M.

    2007-01-01

    Nonbreeding habitats are critically important for Rana draytonii, especially for individuals that breed in temporary bodies of water. We radiotracked 123 frogs to evaluate seasonal habitat use. Individual frogs were continuously tracked for up to 16 months. Some individuals remained at breeding ponds all year, but 66% of female and 25% of male frogs moved to nonbreeding areas, even when the breeding site retained water. Frogs at our main study site moved 150 m (median), roughly the distance to the nearest suitable nonbreeding area. The greatest straight-line distance traveled was 1.4 km, although the presumed distance traveled was 2.8 km. Females were more likely than males to move from permanent ponds (38% of females, 16% of males), but among dispersing frogs, males and females did not differ in distance moved. Some frogs left breeding sites shortly after oviposition (median = 12 days for females, 42.5 days for males), but many individuals remained until the site was nearly dry. Fog provided moisture for dispersal or migration throughout the summer. Our data demonstrate that maintaining populations of pond-breeding amphibians requires that all essential habitat components be protected; these include (1) breeding habitat, (2) nonbreeding habitat, and (3) migration corridors. In addition, a buffer is needed around all three areas to ensure that outside activities do not degrade any of the three habitat components. Copyright 2007 Society for the Study of Amphibians and Reptiles.

  13. Effects of acute exposure to magnetic field on ionic composition of frog sciatic nerve

    International Nuclear Information System (INIS)

    Objective: To evaluate the possible interaction between magnetic field and cadmium on ionic composition of frog sciatic nerve. Design: The combined effect of magnetic field and cadmium (1.5mg/kg; in lymphatic sac) were studied in frog sciatic nerves (Rana Esculenta). Sciatic nerve samples were extracted, weighed and mixed in bidistilled water in order to analyze by inductively coupled plasma (ICP) ionic composition. Setting: Frogs (Rana Esculenta) were reared in swimming-pool (Faculte des Sciences de Bizerte, Tunisia). Frogs were cared for under the Tunisian Code of Practice for the Care and Use of Animals for Scientific purpose and the Experimental Protocols were approved by the Ethics Committee. Subjects: Treated and control groups (n=6) weighing 50-100g at the time of experiments were housed in the same condition three weeks before the beginning of the experiments. Results: Acute exposure to magnetic field increased significantly the calcium (+298%, p<0.05) and iron (+50%, p<0.05) contents of frog sciatic nerve, whereas magnesium and copper contents remained unchanged. The association between magnetic field and cadmium, induced marked increase of calcium (+360%, p<0.05), whereas magnesium content remained stable. Conclusions: Magnetic field exposure alters the ionic composition in the frog sciatic nerve, especially calcium and iron. Magnetic field magnifies the effect of cadmium on calcium homeostasis. (author)

  14. Gas chromatographic and electron spin resonance investigations of gamma-irradiated frog legs

    International Nuclear Information System (INIS)

    Several very sensitive techniques to measure radiation-induced products in frog legs were investigated. Presented here are results from the use of electron spin resonance (ESR) spectroscopy and capillary gas chromatography (GC) to measure radiolysis products in γ-irradiated frog legs. When bone is irradiated, a characteristic ESR signal develops and is easily measured. The intensity of the ESR signal is dose-dependent and stable for several months at room temperature. When triglycerides or fatty acids are irradiated, some of the major stable products formed are hydrocarbons with one less carbon than the precursor fatty acids. These hydrocarbons are formed as the result of the loss of CO2 during various free radical reactions. A capillary GC procedure was developed to monitor the formation of these hydrocarbons in γ-irradiated frog legs. Since frog legs contain large amounts of palmitic, stearic, oleic, and linoleic acids, the formation of the hydrocarbons (pentadecane, heptadecane, 8-heptadecene, and 6,9-heptadecadiene, respectively) from the decarboxylation of these fatty acids was monitored. The yields of these hydrocarbons were found to be linear with applied dose. A sample from a lot of imported frog legs that were believed to have been treated with ionizing radiation was also analyzed. The ESR technique, in conjunction with the GC data on the hydrocarbons, appears to be a useful approach for identifying and monitoring frog legs that have been treated with ionizing radiation. (author)

  15. Biodiversity of frog haemoparasites from sub-tropical northern KwaZulu-Natal, South Africa.

    Science.gov (United States)

    Netherlands, Edward C; Cook, Courtney A; Kruger, Donnavan J D; du Preez, Louis H; Smit, Nico J

    2015-04-01

    Since South Africa boasts a high biodiversity of frog species, a multispecies haemoparasite survey was conducted by screening the blood from 29 species and 436 individual frogs. Frogs were collected at three localities in sub-tropical KwaZulu-Natal, a hotspot for frog diversity. Twenty per cent of the frogs were infected with at least one of five groups of parasites recorded. Intraerythrocytic parasites comprising Hepatozoon, Dactylosoma, and viral or bacterial organisms, as well as extracellular parasites including trypanosomes and microfilarid nematodes were found. A significant difference (P biodiversity of haemoparasite infections, with all five groups of parasites recorded. The other two sites, that is the area bordering the reserve and the Kwa Nyamazane Conservancy, had a lower diversity with no parasite infections recorded and only Hepatozoon species recorded respectively. Such findings could be ascribed to the anthropogenic impact on the latter two sites, the first by the rural village activities, and the second by the bordering commercial sugar cane agriculture. Future studies should include both morphological and molecular descriptions of the above parasites, as well as the identification of potential vectors, possibly clarifying the effects human activities may have on frog haemoparasite life cycles and as such their biodiversity. PMID:25830113

  16. Towards a better understanding of the use of probiotics for preventing chytridiomycosis in Panamanian golden frogs.

    Science.gov (United States)

    Becker, Matthew H; Harris, Reid N; Minbiole, Kevin P C; Schwantes, Christian R; Rollins-Smith, Louise A; Reinert, Laura K; Brucker, Robert M; Domangue, Rickie J; Gratwicke, Brian

    2011-12-01

    Populations of native Panamanian golden frogs (Atelopus zeteki) have collapsed due to a recent chytridiomycosis epidemic. Reintroduction efforts from captive assurance colonies are unlikely to be successful without the development of methods to control chytridiomycosis in the wild. In an effort to develop a protective treatment regimen, we treated golden frogs with Janthinobacterium lividum, a skin bacterium that has been used to experimentally prevent chytridiomycosis in North American amphibians. Although J. lividum appeared to colonize A. zeteki skin temporarily, it did not prevent or delay mortality in A. zeteki exposed to Batrachochytrium dendrobatidis, the causative agent of chytridiomycosis. After introduction of J. lividum, average bacterial cell counts reached a peak of 1.7 × 10(6) cells per frog ~2 weeks after treatment but declined steadily after that. When J. lividum numbers declined to ~2.8 × 10(5) cells per frog, B. dendrobatidis infection intensity increased to greater than 13,000 zoospore equivalents per frog. At this point, frogs began to die of chytridiomycosis. Future research will concentrate on isolating and testing antifungal bacterial species from Panama that may be more compatible with Atelopus skin. PMID:22328095

  17. Preferred Feeding Sites and Prey of the Adult Gold-spotted Pond Frog, Rana plancyi chosenica

    Directory of Open Access Journals (Sweden)

    Eom, Junho1

    2007-11-01

    Full Text Available To determine the feeding sites preferred by adult gold-spotted pond frogs, Rana plancyi chosenica,and the foods that induce favorable growth of the frogs in the laboratory, we conducted two separate experimentsbetween 27 May and 12 July 2007 in a vivarium. In the first experiment, we counted the number of cricketseaten by four gold-spotted pond frogs in a 60 min period at four different feeding sites within the experimentalarenas: on the water surface, at the edge of a pond, and at two terrestrial sites. Adult gold-spotted pond frogsate more crickets on the water surface and at the edge of the pond than the terrestrial sites. In the secondexperiment, we measured the growth of SVL (snout-vent length and body mass of adult gold-spotted pond frogsfed crickets, mealworms, maggots, or earthworms in individual experimental boxes over a one month period. TheSVL and body mass of the adult gold-spotted pond frogs fed crickets, mealworms, or maggots were greater thanthose of the frogs that were fed earthworms. These results indicate that providing crickets, mealworms, ormaggots on the water or at the edge of a pond should induce favorable growth of captive-reared adult goldspottedpond frogs.

  18. Apical Na+ permeability of frog skin during serosal Cl- replacement.

    Science.gov (United States)

    Leibowich, S; DeLong, J; Civan, M M

    1988-05-01

    Gluconate substitution for serosal Cl- reduces the transepithelial short-circuit current (Isc) and depolarizes short-circuited frog skins. These effects could result either from inhibition of basolateral K+ conductance, or from two actions to inhibit both apical Na+ permeability (PapNa) and basolateral pump activity. We have addressed this question by studying whole-and split-thickness frog skins. Intracellular Na+ concentration (CcNa) and PapNa have been monitored by measuring the current-voltage relationship for apical Na+ entry. This analysis was conducted by applying trains of voltage pulses, with pulse durations of 16 to 32 msec. Estimates of PapNa and CcNa were not detectably dependent on pulse duration over the range 16 to 80 msec. Serosal Cl- replacement uniformly depolarized short-circuited tissues. The depolarization was associated with inhibition of Isc across each split skin, but only occasionally across the whole-thickness preparations. This difference may reflect the better ionic exchange between the bulk medium and the extracellular fluid in contact with the basolateral membranes, following removal of the underlying dermis in the split-skin preparations. PapNa was either unchanged or increased, and CcNa either unchanged or reduced after the anionic replacement. These data are incompatible with the concept that serosal Cl- replacement inhibits PapNa and Na,K-pump activity. Gluconate substitution likely reduces cell volume, triggering inhibition of the basolateral K+ channels, consistent with the data and conclusions of S.A. Lewis, A.G. Butt, M.J. Bowler, J.P. Leader and A.D.C. Macknight (J. Membrane Biol. 83:119-137, 1985) for toad bladder. The resulting depolarization reduces the electrical force favoring apical Na+ entry. The volume-conductance coupling serves to conserve volume by reducing K+ solute loss. Its molecular basis remains to be identified. PMID:2458472

  19. Checklist and Simple Identification Key for Frogs and Toads from District IV of The MADA Scheme, Kedah, Malaysia

    OpenAIRE

    Jaafar, Ibrahim; Chai, Teoh Chia; Sah, Shahrul Anuar Mohd; Akil, Mohd Abdul Muin Md.

    2009-01-01

    A survey was conducted to catalogue the diversity of anurans in District IV of the Muda Agriculture Development Authority Scheme (MADA) in Kedah Darul Aman, Malaysia, from July 1996 to January 1997. Eight species of anurans from three families were present in the study area. Of these, the Common Grass Frog (Fejevarya limnocharis) was the most abundant, followed by Mangrove Frog (Fejevarya cancrivora), Long-legged Frog (Hylarana macrodactyla), and Common Toad (Duttaphrynus melanostictus). Pudd...

  20. Diet, Density, and Distribution of the Introduced Greenhouse Frog, Eleutherodactylus planirostris, on the Island of Hawaii

    OpenAIRE

    Olson, Christina A.

    2011-01-01

    The greenhouse frog, Eleutherodactylus planirostris, native to Cuba and the Bahamas, was recently introduced to Hawaii. Studies from other invaded habitats suggest that it may impact Hawaiian ecosystems by consuming and potentially reducing endemic invertebrates. However, there have been no studies on the greenhouse frog in Hawaii. The first component of this study was to conduct a diet analysis. We conducted a stomach content analysis of 427 frogs from 10 study sites on the island of Hawa...

  1. Characterisation of a novel Type I crustin involved in antibacterial and antifungal responses in the red claw crayfish, Cherax quadricarinatus.

    Science.gov (United States)

    Yu, Ai-Qing; Shi, Yong-Hai; Wang, Qun

    2016-01-01

    Antimicrobial peptides are important immune effectors involved in mediating innate immune responses against intruding pathogens. Here, we successfully isolated and characterized a novel Type I crustin from the red claw crayfish Cherax quadricarinatus. The full-length cDNA encoded by this gene, designated CqCrs, comprised 608 bp, containing a 5'-untranslated region (UTR) of 55 bp, a 3'-UTR of 229 bp with a poly (A) tail, and an open reading frame (ORF) of 324 bp encoding a polypeptide of 107 amino acids. The deduced amino acid sequence of CqCrs exhibited a configuration typical of other crustacean Type I crustin orthologs, including one signal peptide region at the N-terminus between residues 1 and 16 and a long whey acidic protein (WAP) domain at the C-terminus between residues 60 and 107, along with a WAP-type "four-disulfide core" motif. Phylogenetic analysis showed that CqCrs was clustered first with other crustacean Type I crustins, then with other crustacean Type II crustins, and finally with other crustacean Type III crustins. Transcription of CqCrs was detected in all tissues, especially in immune tissues and was differentially induced in hemocytes post-stimulation with β-1, 3-glucan, lipopolysaccharides (LPS) and peptidoglycans (PG) at selected time-points. To clarify the biological activity of CqCrs, the recombinant CqCrs protein (rCqCrs) was constructed and expressed in Escherichia coli BL21 (DE3). Purified rCqCrs bound to diverse bacteria and inhibited the growth of different microbes to varying degrees. These findings suggest that CqCrs is involved in a specific innate immune recognition and defense mechanisms against bacterial and fungal in C. quadricarinatus. PMID:26584757

  2. 可分离式髌骨爪治疗髌骨下极骨折%Treatment of splintered anus perineum patella fractures with the separability patella claw

    Institute of Scientific and Technical Information of China (English)

    许安平

    2011-01-01

    目的 探讨可分离式髌骨爪治疗髌骨下极粉碎性骨折的临床应用和效果.方法 采用可分离式髌骨爪固定治疗髌骨粉碎性骨折45例,前正中切口、复位用可分离式髌骨爪固定及膝关节加压包扎3 d后行膝关节被动屈伸锻练.结果 随访10~37月平均20月,骨折愈合时间8~12周临床疗效优40例,良4例,中1例,功能恢复优良率97.8%疗效满意.结论 可分离式髌骨爪是治疗髌骨下极粉碎性骨折一种良好的固定方法.%Aim To observe the clinical curative effec:t of separability patella claw in treatment of splintered anus perineum patella fractures. Methods 45 cases of splintered anus perineuru patella fracture patients werer treated with median incision , reset, separability patella claw ,pressure dressing and passive flexion and extension ac:tivity after 3 days. Results 45 cases were followed up, of which 40 patients were excellent, better in 4 cases,medium in lcase , with the total effective rate of 97% . Conclusion It is a good way in treatment of splintered anus perineum patella fractures with separability patella claw.

  3. 烧伤后爪形手畸形的整复%Repair of claw hand deformity after burn

    Institute of Scientific and Technical Information of China (English)

    张丕红; 黄晓元; 范鹏举; 任利成; 龙剑虹

    2008-01-01

    Objective To summarize methods for repair of claw hand deformity after burn. Methods Ninety-seven patients with 136 claw hands after burn hospitalized from May 1992 to May 2007 were repaired with skin grafting( 104 hands) and transposition of skin flap (32 hands) ,among which 21 hands were minor- grade,92 hands moderate,23 hands severe. The metacarpophalangeal joint was repaired after scar release in dorsum of hand with manual extraction reduction, release of collateral ligament and joint capsula, separation of adhesion in joint, tendon lengthening for obvious contracture. Restitution of finger flexion deformity, lysis of adhesion and grafting among first web and finger webs, repair of central slip extensor tendon or phalangeal arthrodesis were performed according to the abnormal condition after lysis of dorsal scar of hand. The meta- carpophalangeal joint from 31 patients were not repaired with above methods for severe finger flexion deformi- ty ,their palmar scar were loosened and transplanted firstly, then scar in dorsum of hand were loosened, metacarpophalangeal joint were repaired, flap or skin were transferred or transplanted. General rehabilitation were performed routinely after operation. Results The ending of flaps(4 hands) due to the scar were nec- rosis after transposition and healed through dressing change, other skins or flaps all survived. Most articular deformities were corrected completely or basically. Functions including palmar opposition , grasp were also recovered with satisfactory results. Conclusion Skin transplantation and transfering of skin flap with over- all planning and individual isation are the key points for repair of claw hand after burn.%目的 探讨烧伤后爪形手畸形的整复方法. 方法 1992年5月-2007年5月,笔者对97例(136只患手)烧伤后爪形手畸形患者进行手术整复,患手中,轻度畸形21只、中度92只、重度23只;手背创面植皮修复104只患手,皮瓣转移修复32只患手.掌

  4. Convergent Substitutions in a Sodium Channel Suggest Multiple Origins of Toxin Resistance in Poison Frogs.

    Science.gov (United States)

    Tarvin, Rebecca D; Santos, Juan C; O'Connell, Lauren A; Zakon, Harold H; Cannatella, David C

    2016-04-01

    Complex phenotypes typically have a correspondingly multifaceted genetic component. However, the genotype-phenotype association between chemical defense and resistance is often simple: genetic changes in the binding site of a toxin alter how it affects its target. Some toxic organisms, such as poison frogs (Anura: Dendrobatidae), have defensive alkaloids that disrupt the function of ion channels, proteins that are crucial for nerve and muscle activity. Using protein-docking models, we predict that three major classes of poison frog alkaloids (histrionicotoxins, pumiliotoxins, and batrachotoxins) bind to similar sites in the highly conserved inner pore of the muscle voltage-gated sodium channel, Nav1.4. We predict that poison frogs are somewhat resistant to these compounds because they have six types of amino acid replacements in the Nav1.4 inner pore that are absent in all other frogs except for a distantly related alkaloid-defended frog from Madagascar, Mantella aurantiaca. Protein-docking models and comparative phylogenetics support the role of these replacements in alkaloid resistance. Taking into account the four independent origins of chemical defense in Dendrobatidae, phylogenetic patterns of the amino acid replacements suggest that 1) alkaloid resistance in Nav1.4 evolved independently at least seven times in these frogs, 2) variation in resistance-conferring replacements is likely a result of differences in alkaloid exposure across species, and 3) functional constraint shapes the evolution of the Nav1.4 inner pore. Our study is the first to demonstrate the genetic basis of autoresistance in frogs with alkaloid defenses. PMID:26782998

  5. Biomarkers of oxidative stress and metal accumulation in marsh frog (Pelophylax ridibundus).

    Science.gov (United States)

    Borković-Mitić, Slavica S; Prokić, Marko D; Krizmanić, Imre I; Mutić, Jelena; Trifković, Jelena; Gavrić, Jelena; Despotović, Svetlana G; Gavrilović, Branka R; Radovanović, Tijana B; Pavlović, Slađan Z; Saičić, Zorica S

    2016-05-01

    To understand the effect of metals on the marsh frog Pelophylax ridibundus and the possible environment-induced changes in oxidative stress enzymes, we determined the concentrations of 18 metals: Al, As, Ba, Ca, Cd, Co, Cr, Cu, Fe, Ga, Hg, In, Li, Mn, Ni, Pb, Sr, and Zn, in the tissues (liver, skin, and muscle) and water samples collected from different locations in Serbia. The activities of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH-Px), glutathione reductase (GR), glutathione S-transferase (GST), acetylcholinesterase (AChE), and changes in concentrations of reduced glutathione (GSH) and sulfhydryl groups (SH) were analyzed in the tissues of the sampled frogs. The concentrations of Al, Cd, Co, Cr, Cu, Fe, Ga, Hg, and Ni were highest in the liver, whereas those of Ba, Ca, Li, Mn, Pb, Sr, and Zn were highest in the skin. Hg correlated positively with liver SOD (in frogs from Danube-Tisza-Danube Canal (DTD)), muscle CAT (DTD), and muscle GST Ponjavica River (PO); Pb demonstrated a strong positive correlation with liver GR in frogs from Mt. Fruška Gora (FG); Cd only exhibited a positive correlation with AChE in the skin of frogs from DTD. In the skin, Zn correlated positively with AChE (DTD), SH groups (PO), and CAT (FG), and negatively with CAT, GST, and SH in the liver of frogs from DTD. Examination of these oxidative stress biomarkers, together with analysis of metal accumulation in the liver and skin of marsh frogs, provides a powerful tool for the assessment of metal pollution. PMID:26846240

  6. Cryoprotectants and extreme freeze tolerance in a subarctic population of the wood frog.

    Science.gov (United States)

    Costanzo, Jon P; Reynolds, Alice M; do Amaral, M Clara F; Rosendale, Andrew J; Lee, Richard E

    2015-01-01

    Wood frogs (Rana sylvatica) exhibit marked geographic variation in freeze tolerance, with subarctic populations tolerating experimental freezing to temperatures at least 10-13 degrees Celsius below the lethal limits for conspecifics from more temperate locales. We determined how seasonal responses enhance the cryoprotectant system in these northern frogs, and also investigated their physiological responses to somatic freezing at extreme temperatures. Alaskan frogs collected in late summer had plasma urea levels near 10 μmol ml-1, but this level rose during preparation for winter to 85.5 ± 2.9 μmol ml-1 (mean ± SEM) in frogs that remained fully hydrated, and to 186.9 ± 12.4 μmol ml-1 in frogs held under a restricted moisture regime. An osmolality gap indicated that the plasma of winter-conditioned frogs contained an as yet unidentified osmolyte(s) that contributed about 75 mOsmol kg-1 to total osmotic pressure. Experimental freezing to -8°C, either directly or following three cycles of freezing/thawing between -4 and 0°C, or -16°C increased the liver's synthesis of glucose and, to a lesser extent, urea. Concomitantly, organs shed up to one-half (skeletal muscle) or two-thirds (liver) of their water, with cryoprotectant in the remaining fluid reaching concentrations as high as 0.2 and 2.1 M, respectively. Freeze/thaw cycling, which was readily survived by winter-conditioned frogs, greatly increased hepatic glycogenolysis and delivery of glucose (but not urea) to skeletal muscle. We conclude that cryoprotectant accrual in anticipation of and in response to freezing have been greatly enhanced and contribute to extreme freeze tolerance in northern R. sylvatica. PMID:25688861

  7. Defects in host immune function in tree frogs with chronic chytridiomycosis.

    Directory of Open Access Journals (Sweden)

    Sam Young

    Full Text Available The amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd has caused mass mortality leading to population declines and extinctions in many frog species worldwide. The lack of host resistance may be due to fungal immunosuppressive effects that have been observed when Bd is incubated with cultured lymphocytes, but whether in vivo host immunosuppression occurs is unknown. We used a broad range of hematologic and protein electrophoresis biomarkers, along with various functional tests, to assess immune competence in common green (Litoria caerulea and white-lipped (L. infrafrenata tree frogs experimentally infected with Bd. Compared with uninfected frogs, Bd infection in L. caerulea caused a reduction in immunoglobulin and splenic lymphocyte responses to antigenic stimulation with sheep red blood cells, along with decreased white blood cell and serum protein concentrations, indicating possible impaired immune response capability of Bd-infected frogs. This is the first in vivo study suggesting that infection with Bd causes multiple defects in systemic host immune function, and this may contribute to disease development in susceptible host species. Although L. infrafrenata failed to maintain Bd infection after exposure, white blood cell and serum globulin concentrations were lower in recovered frogs compared with unexposed frogs, but antigen-specific serum and splenic antibody, and splenic cellular, responses were similar in both recovered and unexposed frogs. This may indicate potential systemic costs associated with infection clearance and/or redirection of host resources towards more effective mechanisms to overcome infection. No clear mechanism for resistance was identified in L. infrafrenata, suggesting that localized and/or innate immune defense mechanisms may be important factors involved in disease resistance in this species.

  8. Biodiversity of frog haemoparasites from sub-tropical northern KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Edward C. Netherlands

    2015-04-01

    Full Text Available Since South Africa boasts a high biodiversity of frog species, a multispecies haemoparasite survey was conducted by screening the blood from 29 species and 436 individual frogs. Frogs were collected at three localities in sub-tropical KwaZulu-Natal, a hotspot for frog diversity. Twenty per cent of the frogs were infected with at least one of five groups of parasites recorded. Intraerythrocytic parasites comprising Hepatozoon, Dactylosoma, and viral or bacterial organisms, as well as extracellular parasites including trypanosomes and microfilarid nematodes were found. A significant difference (P < 0.01 in the prevalence of parasitaemia was found across species, those semi-aquatic species demonstrating the highest, followed by semi-terrestrial frog species. None of those species described as purely terrestrial and aquatic were infected. Hepatozoon and Trypanosoma species accounted for most of the infections, the former demonstrating significant differences in intensity of infection across species, families and habitat types (P = 0.028; P = 0.006; P = 0.007 respectively. Per locality, the first, the formally protected Ndumo Game Reserve, had the highest biodiversity of haemoparasite infections, with all five groups of parasites recorded. The other two sites, that is the area bordering the reserve and the Kwa Nyamazane Conservancy, had a lower diversity with no parasite infections recorded and only Hepatozoon species recorded respectively. Such findings could be ascribed to the anthropogenic impact on the latter two sites, the first by the rural village activities, and the second by the bordering commercial sugar cane agriculture. Future studies should include both morphological and molecular descriptions of the above parasites, as well as the identification of potential vectors, possibly clarifying the effects human activities may have on frog haemoparasite life cycles and as such their biodiversity.

  9. An Analysis of Predator Selection to Affect Aposematic Coloration in a Poison Frog Species.

    Directory of Open Access Journals (Sweden)

    Corinna E Dreher

    Full Text Available Natural selection is widely noted to drive divergence of phenotypic traits. Predation pressure can facilitate morphological divergence, for example the evolution of both cryptic and conspicuous coloration in animals. In this context Dendrobatid frogs have been used to study evolutionary forces inducing diversity in protective coloration. The polytypic strawberry poison frog (Oophaga pumilio shows strong divergence in aposematic coloration among populations. To investigate whether predation pressure is important for color divergence among populations of O. pumilio we selected four mainland populations and two island populations from Costa Rica and Panama. Spectrometric measurements of body coloration were used to calculate color and brightness contrasts of frogs as an indicator of conspicuousness for the visual systems of several potential predators (avian, crab and snake and a conspecific observer. Additionally, we conducted experiments using clay model frogs of different coloration to investigate whether the local coloration of frogs is better protected than non-local color morphs, and if predator communities vary among populations. Overall predation risk differed strongly among populations and interestingly was higher on the two island populations. Imprints on clay models indicated that birds are the main predators while attacks of other predators were rare. Furthermore, clay models of local coloration were equally likely to be attacked as those of non-local coloration. Overall conspicuousness (and brightness contrast of local frogs was positively correlated with attack rates by birds across populations. Together with results from earlier studies we conclude that conspicuousness honestly indicates toxicity to avian predators. The different coloration patterns among populations of strawberry poison frogs in combination with behavior and toxicity might integrate into equally efficient anti-predator strategies depending on local predation and

  10. Characterizing the admixed African ancestry of African Americans

    OpenAIRE

    Zakharia, Fouad; Basu, Analabha; Absher, Devin; Assimes, Themistocles L.; Go, Alan S.; Hlatky, Mark A.; Iribarren, Carlos; Knowles, Joshua W.; Li, Jun; Narasimhan, Balasubramanian; Sidney, Steven; Southwick, Audrey; Myers, Richard M.; Quertermous, Thomas; Risch, Neil

    2009-01-01

    Abstract Background Accurate, high-throughput genotyping allows the fine characterization of genetic ancestry. Here we applied recently developed statistical and computational techniques to the question of African ancestry in African Americans by using data on more than 450,000 single-nucleotide polymorphisms (SNPs) genotyped in 94 Africans of diverse geographic origins included in the...

  11. Enzymatic regulation of glycogenolysis in a subarctic population of the wood frog: implications for extreme freeze tolerance.

    Directory of Open Access Journals (Sweden)

    M Clara F do Amaral

    Full Text Available The wood frog, Rana sylvatica, from Interior Alaska survives freezing at -16°C, a temperature 10-13°C below that tolerated by its southern conspecifics. We investigated the hepatic freezing response in this northern phenotype to determine if its profound freeze tolerance is associated with an enhanced glucosic cryoprotectant system. Alaskan frogs had a larger liver glycogen reserve that was mobilized faster during early freezing as compared to conspecifics from a cool-temperate region (southern Ohio, USA. In Alaskan frogs the rapid glucose production in the first hours of freezing was associated with a 7-fold increase in glycogen phosphorylase activity above unfrozen frog levels, and the activity of this enzyme was higher than that of frozen Ohioan frogs. Freezing of Ohioan frogs induced a more modest (4-fold increase in glycogen phosphorylase activity above unfrozen frog values. Relative to the Ohioan frogs, Alaskan frogs maintained a higher total protein kinase A activity throughout an experimental freezing/thawing time course, and this may have potentiated glycogenolysis during early freezing. We found populational variation in the activity and protein level of protein kinase A which suggested that the Alaskan population had a more efficient form of this enzyme. Alaskan frogs modulated their glycogenolytic response by decreasing the activity of glycogen phosphorylase after cryoprotectant mobilization was well under way, thereby conserving their hepatic glycogen reserve. Ohioan frogs, however, sustained high glycogen phosphorylase activity until early thawing and consumed nearly all their liver glycogen. These unique hepatic responses of Alaskan R. sylvatica likely contribute to this phenotype's exceptional freeze tolerance, which is necessary for their survival in a subarctic climate.

  12. African-Americans and Alzheimer's

    Science.gov (United States)

    ... Share Plus on Google Plus African-Americans and Alzheimer's alz.org | IHaveAlz Introduction 10 Warning Signs Brain ... African-Americans are at a higher risk for Alzheimer's disease. Many Americans dismiss the warning signs of ...

  13. African Cultural Astronomy

    CERN Document Server

    Holbrook, Jarita C; Medupe, R. Thebe; Current Archaeoastronomy and Ethnoastronomy research in Africa

    2008-01-01

    Astronomy is the science of studying the sky using telescopes and light collectors such as photographic plates or CCD detectors. However, people have always studied the sky and continue to study the sky without the aid of instruments this is the realm of cultural astronomy. This is the first scholarly collection of articles focused on the cultural astronomy of Africans. It weaves together astronomy, anthropology, and Africa. The volume includes African myths and legends about the sky, alignments to celestial bodies found at archaeological sites and at places of worship, rock art with celestial imagery, and scientific thinking revealed in local astronomy traditions including ethnomathematics and the creation of calendars. Authors include astronomers Kim Malville, Johnson Urama, and Thebe Medupe; archaeologist Felix Chami, and geographer Michael Bonine, and many new authors. As an emerging subfield of cultural astronomy, African cultural astronomy researchers are focused on training students specifically for do...

  14. African names for American plants

    NARCIS (Netherlands)

    Andel, van T.R.

    2015-01-01

    African slaves brought plant knowledge to the New World, sometimes applying it to related plants they found there and sometimes bringing Old World plants with them. By tracing the linguistic parallels between names for plants in African languages and in communities descended from African slaves, pie

  15. The Struggles over African Languages

    Science.gov (United States)

    Maseko, Pam; Vale, Peter

    2016-01-01

    In this interview, African Language expert Pam Maseko speaks of her own background and her first encounter with culture outside of her mother tongue, isiXhosa. A statistical breakdown of South African languages is provided as background. She discusses Western (originally missionary) codification of African languages and suggests that this approach…

  16. African agricultural trade

    DEFF Research Database (Denmark)

    Jensen, Hans Grinsted; Sandrey, Ron

    2015-01-01

    This article starts with a profile of African agricultural trade. Using the pre-release version 9.2 of the GTAP database, we then show that the results for tariff elimination on intra-African trade are promising, but these tariff barriers are not as significant as the various trade-related barriers...... elimination, non-tariff barrier reductions and time in transit cost reductions are likely to be cumulative and would generate very large gains to Africa. The policy implications are clear: while cooperation will enhance the gains, much of the benefits will result from unilateral actions and regional...

  17. Frog: a FRee Online druG 3D conformation generator.

    Science.gov (United States)

    Leite, T Bohme; Gomes, D; Miteva, M A; Chomilier, J; Villoutreix, B O; Tufféry, P

    2007-07-01

    In silico screening methods based on the 3D structures of the ligands or of the proteins have become an essential tool to facilitate the drug discovery process. To achieve such process, the 3D structures of the small chemical compounds have to be generated. In addition, for ligand-based screening computations or hierarchical structure-based screening projects involving a rigid-body docking step, it is necessary to generate multi-conformer 3D models for each input ligand to increase the efficiency of the search. However, most academic or commercial compound collections are delivered in 1D SMILES (simplified molecular input line entry system) format or in 2D SDF (structure data file), highlighting the need for free 1D/2D to 3D structure generators. Frog is an on-line service aimed at generating 3D conformations for drug-like compounds starting from their 1D or 2D descriptions. Given the atomic constitution of the molecules and connectivity information, Frog can identify the different unambiguous isomers corresponding to each compound, and generate single or multiple low-to-medium energy 3D conformations, using an assembly process that does not presently consider ring flexibility. Tests show that Frog is able to generate bioactive conformations close to those observed in crystallographic complexes. Frog can be accessed at http://bioserv.rpbs.jussieu.fr/Frog.html. PMID:17485475

  18. DNA repair and resistance to UV-B radiation in western spotted frogs

    Science.gov (United States)

    Blaustein, A.R.; Hays, J.B.; Hoffman, P.D.; Chivers, D.P.; Kiesecker, J.M.; Leonard, W.P.; Marco, A.; Olson, D.H.; Reaser, J.K.; Anthony, R.G.

    1999-01-01

    We assessed DNA repair and resistance to solar radiation in eggs of members of the western spotted frog complex (Rana pretiosa and R. luteiventris), species whose populations are suffering severe range reductions and declines. Specifically, we measured the activity of photoreactivating enzyme (photolyase) in oocytes of spotted frogs. In some species, photoreactivation is the most important mechanism for repair of UV-damaged DNA. Using field experiments, we also compared the hatching success of spotted frog embryos at natural oviposition sites at three elevations, where some embryos were subjected to ambient levels of UV-B radiation and others were shielded from UV-B radiation. Compared with other amphibians, photolyase activities in spotted frogs were relatively high. At all sites, hatching success was unaffected by UV-B. Our data support the interpretation that amphibian embryos with relatively high levels of photolyase are more resistant to UV-B radiation than those with lower levels of photolyase. At the embryonic stage, UV-B radiation does not presently seem to be contributing to the population declines of spotted frogs.

  19. Take the long way home: Behaviour of a neotropical frog, Allobates femoralis, in a detour task.

    Science.gov (United States)

    Munteanu, Alexandru Marian; Starnberger, Iris; Pašukonis, Andrius; Bugnyar, Thomas; Hödl, Walter; Fitch, William Tecumseh

    2016-05-01

    Detour behaviour, an individual's ability to reach its goal by taking an indirect route, has been used to test spatial cognitive abilities across a variety of taxa. Although many amphibians show a strong homing ability, there is currently little evidence of amphibian spatial cognitive flexibility. We tested whether a territorial frog, Allobates femoralis, can flexibly adjust its homing path when faced with an obstacle. We displaced male frogs from their calling sites into the centre of circular arenas and recorded their escape routes. In the first experiment we provided an arena with equally high walls. In the second experiment we doubled the height of the homeward facing wall. Finally, we provided a tube as a shortcut through the high wall. In the equal-height arena, most frogs chose to escape via the quadrant facing their former calling site. However, when challenged with different heights, nearly all frogs chose the low wall, directing their movements away from the calling site. In the "escape tunnel" experiment most frogs still chose the low wall. Our results show that displaced A. femoralis males can flexibly adjust their homing path and avoid (presumably energetically costly) obstacles, providing experimental evidence of spatial cognitive flexibility in an amphibian. PMID:26997105

  20. HABITAT CHARACTERISTICS AND SOME BIOLOGICAL ASPECTS OF GIANT FROG (LIMNONECTES CF. GRUNNIENS

    Directory of Open Access Journals (Sweden)

    Nasaruddin -

    2008-12-01

    Full Text Available The objectives of the research was to described habitat charateristics and reproduction aspects of giant frog (Limnonectes cf. grunniens. Some physico-chemical parameters that characteristic for giant frog habitat i.e. air and water temperatur, relative humidity, dissolved oxygen, free CO2 and NH3 in water were measured. Moreover, the reproduction aspects being observed were gonad characteristics, egg size and form, and sperm density. The results indicated that the giant frog habitat was river stream with physical characteristics as following air temperature : 27o–28oC, water temperature : 24o-26 oC, relative humidity : 83%–87%, water turbidity : 1,2–11,6 nephelometric turbidity unit (NTU, and altitude : 20-40 m above sea level. Furthermore, the suitable water characteristics for the habitat were dissolved oxygen : 7.78.2 ppm, free CO2 concentration = 6.6–8.1 ppm, and free NH3 concentration : 0.5–0.6 ppm. The adult giant frog female generally carried 1461.82 eggs in average per individu with diameter ranging from 1.70–3.10 mm. On the other hand, the sperm density of adult male giant frog was found to be 1,614,898 per mm3 with motility rate of 81.23%.

  1. Treatment trial of clinically ill corroboree frogs with chytridiomycosis with two triazole antifungals and electrolyte therapy.

    Science.gov (United States)

    Brannelly, Laura A; Skerratt, Lee F; Berger, Lee

    2015-09-01

    Chytridiomycosis caused by the pathogen Batrachochytrium dendrobatidis is an important cause of amphibian declines globally, and is the worst pathogen on record for causing biodiversity loss. The critically endangered southern corroboree frog, Pseudophryne corroboree, is functionally extinct in the wild and is surviving in captive assurance colonies. These captive colonies must remain disease free, and there is no known treatment for corroboree frogs with terminal chytridiomycosis. In this study we tested two triazole antifungals (itraconazole and voriconazole) coupled with aggressive electrolyte therapy on moribund corroboree frogs with severe chytridiomycosis. Six moribund frogs were given 20 mL baths of 0.5 μg/mL itraconazole for 5 min/day for 5 days coupled with electrolyte injections every 8 h for 3 days followed by every 12 h for 3 days. Six other moribund frogs were given 1 mL drops of 1.25 μg/mL voriconazole daily for 7 days coupled with the aggressive electrolyte therapy. While only one animal survived this treatment regime, time until death was extended for all animals by at least 3 days and infection load decreased by an average of 89.3%. Our results suggest there is potential for recovery of terminally ill P. corroboree, and we suggest further trials include antibiotics as well as exploring variations on the above treatment regime with other antifungals. PMID:26246159

  2. Citizen Science Program Shows Urban Areas Have Lower Occurrence of Frog Species, but Not Accelerated Declines.

    Directory of Open Access Journals (Sweden)

    Martin J Westgate

    Full Text Available Understanding the influence of landscape change on animal populations is critical to inform biodiversity conservation efforts. A particularly important goal is to understand how urban density affects the persistence of animal populations through time, and how these impacts can be mediated by habitat provision; but data on this question are limited for some taxa. Here, we use data from a citizen science monitoring program to investigate the effect of urbanization on patterns of frog species richness and occurrence over 13 years. Sites surrounded by a high proportion of bare ground (a proxy for urbanization had consistently lower frog occurrence, but we found no evidence that declines were restricted to urban areas. Instead, several frog species showed declines in rural wetlands with low-quality habitat. Our analysis shows that urban wetlands had low but stable species richness; but also that population trajectories are strongly influenced by vegetation provision in both the riparian zone and the wider landscape. Future increases in the extent of urban environments in our study area are likely to negatively impact populations of several frog species. However, existing urban areas are unlikely to lose further frog species in the medium term. We recommend that landscape planning and management focus on the conservation and restoration of rural wetlands to arrest current declines, and the revegetation of urban wetlands to facilitate the re-expansion of urban-sensitive species.

  3. Asplenium bird’s nest ferns in rainforest canopies are climate-contingent refuges for frogs

    Directory of Open Access Journals (Sweden)

    Brett R. Scheffers

    2014-12-01

    Full Text Available Epiphytes are important for canopy dwelling organisms because they provide a cool and moist microhabitat in the relatively hot and dry canopy. Here we examine whether epiphytic Asplenium ferns act as important habitats for arboreal frogs. We conducted extensive fern and habitat surveys for frogs in the Philippines, and complimented these surveys with roaming day and night canopy surveys to identify the full extent of habitat use across the vertical strata. We artificially dried ferns of various sizes to identify relationships between water and temperature buffering. Ferns are the preferred diurnal microhabitat and breeding habitat for arboreal frogs. A strong positive relationship exists between fern size and frog usage and abundance. Our drying experiments show that large ferns buffer maximum temperatures and reduce variability in temperatures, and buffering is directly linked to their hydration. Frogs are likely using large ferns for their moist, cool, environments for breeding and daytime retreat, which supports the buffered microhabitat hypothesis—these plants promote species coexistence through habitat creation and amelioration of physical stress. However, drying experiments suggest that this buffering is contingent on regular rainfall. Altered rainfall regimes could lead to the unexpected loss of the functional capacity of these important fern habitats.

  4. THE MOCHE BOTANICAL FROG (La rana botánica mochica

    Directory of Open Access Journals (Sweden)

    Donna McClelland †

    2011-06-01

    Full Text Available Plants and animals with features which identify them as supernaturals characterize the art of the Precolumbian Moche culture of northern Peru. Among these animals is a frog with feline attributes and a consistent association with manioc tubers, stalks, and plants, the Botanical Frog. The Botanical Frog appears to have been patterned on Leptodactylus pentadactylus. It is shown copulating with felines. Fine line painted vessels and ones with low relief decoration show the Botanical Frog performing as part of a ritual involving other animals and cultivated crops, suggesting that the Botanical Frog was associated with agriculture. ESPAÑOL: El arte de la cultura mochica de la costa norte del Perú presenta plantas y animales mostrando rasgos sobrenaturales. Uno de los animales es una rana con elementos felinos y asociada con tubérculos, ramas y plantas de yuca. La Rana Botánica probablemente tiene su origen en Leptodactylus pentadactylus, una rana carnívora de la selva amazónica. La Rana Botánica copula con felinos y, en vasijas pintadas con líneas finas o con escenarios representados en bajorrelieve, toma parte en ceremonias involucrando a otros animales y cosechas domésticas. Parece ser que la Rana Botánica era un ser sobrenatural asociado con la agricultura.

  5. 76 FR 45602 - Proposed Safe Harbor Agreement for California Red-Legged Frog, at Swallow Creek Ranch, San Luis...

    Science.gov (United States)

    2011-07-29

    ... Service's Safe Harbor Policy published in the Federal Register on June 17, 1999 (64 FR 32717), the Service... Fish and Wildlife Service Proposed Safe Harbor Agreement for California Red-Legged Frog, at Swallow... the Federally threatened California red-legged frog (Rana draytonii), under the Endangered Species...

  6. 76 FR 55413 - Proposed Safe Harbor Agreement for California Red-legged Frog, California Tiger Salamander, Smith...

    Science.gov (United States)

    2011-09-07

    ... Register on June 17, 1999 (64 FR 32717), the Service would issue a permit to the Applicant authorizing take... Fish and Wildlife Service Proposed Safe Harbor Agreement for California Red-legged Frog, California... federally threatened California red-legged frog (Rana draytonii) and California tiger salamander...

  7. Diet of introduced bullfrogs (Rana catesbeiana): Predation on and diet overlap with native frogs on Daishan Island, China

    Science.gov (United States)

    Wu, Zhengjun; Li, Y.; Wang, Y.; Adams, Michael J.

    2005-01-01

    We examined diet of introduced Bullfrogs (Rana catesbeiana) and three native frog species (Rana limnocharis, Rana nigromaculata, and Bufo bufo gargarizans) co-occurring at a group of ponds on Daishan Island, east of China, to gain insight into the nature of potential interactions between Bullfrogs and native frog species. For postmetamorphic Bullfrogs, aquatic prey items dominated volumetrically. Prey size, diet volume and volumetric percentage of native frogs in diet increased with Bullfrog body size. The number and volumetric percentage of native frogs in the diet were not different for female and male Bullfrogs, and both were higher for adults than for juveniles. Diet overlap between males and juveniles was higher than that between males and females and between females and juveniles. Diet overlap with each native frog species of male Bullfrogs was lower than that of female Bullfrogs and juvenile Bullfrogs. We did not exam effects of Bullfrogs on native frogs but our results suggest that the primary threat posed by juvenile Bullfrogs to native frogs on Daishan Island is competition for food, whereas the primary threat posed by male Bullfrogs is direct predation. Female Bullfrogs may threaten native frogs by both competition and predation. These differences among Bullfrog groups may be attributed to differences in body size and microhabitat use.

  8. Viability of Vibrio cholerae 01 on frog legs under frozen and refrigerated conditions and low dose radiation treatment

    International Nuclear Information System (INIS)

    Frog legs were contaminated with Vibrio cholerae 01, Inaba serotype, EITor biotype. The organism remained viable for more than 28 and 2 d when stored at -20°C and 4°C, respectively. Exposure to a multicuries 60Cobalt source of 50 and 100 kilorads eliminated V. cholerae from both the frozen and fresh frog legs

  9. Role of cutaneous surface fluid in frog osmoregulation

    DEFF Research Database (Denmark)

    Larsen, Erik Hviid; Ramløv, Hans

    2013-01-01

    The study investigated whether evaporative water loss (EWL) in frogs stems from water diffusing through the skin or fluid secreted by mucous glands. Osmolality of cutaneous surface fluid (CSF) of Rana esculenta (Pelophylax kl. esculentus) subjected to isoproterenol or 30 °C–34 °C was 191 ± 9.......3 and 181 ± 7.5 mosm/kg, respectively, as compared to lymph osmolality of, 249 ± 10 mosm/kg. Cation concentrations of CSF were likewise independent of pre-treatment with averages of, [Na+] = 65.5 ± 5.1 and [K+] = 14.9 ± 1.6 mmol/L, and lymph concentrations of 116 mmol Na+/L and 5.1 mmol K+/L. The relatively...... high [K+] confirms that CSF is produced by submucosal glands. Since the chemical energy of water of CSF was always higher than that of body fluids, diffusion of water would be from CSF to the interstitial fluid and not in the opposite direction. It is concluded that volume and composition of CSF...

  10. Sexual selection drives speciation in an Amazonian frog

    Science.gov (United States)

    Boul, K.E.; Funk, W.C.; Darst, C.R.; Cannatella, D.C.; Ryan, M.J.

    2007-01-01

    One proposed mechanism of speciation is divergent sexual selection, whereby divergence in female preferences and male signals results in behavioural isolation. Despite the appeal of this hypothesis, evidence for it remains inconclusive. Here, we present several lines of evidence that sexual selection is driving behavioural isolation and speciation among populations of an Amazonian frog (Physalaemus petersi). First, sexual selection has promoted divergence in male mating calls and female preferences for calls between neighbouring populations, resulting in strong behavioural isolation. Second, phylogenetic analysis indicates that populations have become fixed for alternative call types several times throughout the species' range, and coalescent analysis rejects genetic drift as a cause for this pattern, suggesting that this divergence is due to selection. Finally, gene flow estimated with microsatellite loci is an average of 30 times lower between populations with different call types than between populations separated by a similar geographical distance with the same call type, demonstrating genetic divergence and incipient speciation. Taken together, these data provide strong evidence that sexual selection is driving behavioural isolation and speciation, supporting sexual selection as a cause for speciation in the wild. ?? 2006 The Royal Society.

  11. Characterization of UV radiation sensitive frog cell lines

    International Nuclear Information System (INIS)

    Twenty-one subclones of nine frog cell isolates were tested for sensitivity to a panel of DNA damaging agents. Two clones were identified which had a greater than wild type level of sensitivity to UV radiation but had a wild type level of sensitivity to the other agents. These clones were the haploid RRP602-7 and the diploid RRP802-1. RRP802-1 was found to be unstable with respect to UV sensitivity. The line was cloned in order to isolate stable sensitive and wild type derivatives. RRP802-1-16, a UV sensitive clone and RRP802-1-13, a clone with a wild type level of sensitivity to UV radiation, were isolated. The UV radiation sensitivity of RRP602-7, RRP802-1 and RRP802-1-16 did not correlate with cell size, cell shape, cell cycle distribution or ploidy. The cell cycle distribution after UV irradiation, the rate of DNA synthesis after UV-irradiation, the DNA polymerase α activity and the sister chromatid exchange frequency were all measured in RRP602-7, RRP802-1 and RRP802-1-16 in order to examine the DNA repair capacity. The presence of DNA repair pathways was examined directly in RRP602-7, RRP802-1 and RRP802-1-16. All were found to be proficient in photo-reactivation repair and postreplication repair of UV elicited DNA damage

  12. Antibody dependent enhancement of frog virus 3 infection

    Directory of Open Access Journals (Sweden)

    Penny Emily

    2010-02-01

    Full Text Available Abstract Background Viruses included in the family Iridoviridae are large, icosahedral, dsDNA viruses that are subdivided into 5 genera. Frog virus 3 (FV3 is the type species of the genus Ranavirus and the best studied iridovirus at the molecular level. Typically, antibodies directed against a virus act to neutralize the virus and limit infection. Antibody dependent enhancement occurs when viral antibodies enhance infectivity of the virus rather than neutralize it. Results Here we show that anti-FV3 serum present at the time of FV3 infection enhances infectivity of the virus in two non-immune teleost cell lines. We found that antibody dependent enhancement of FV3 was dependent on the Fc portion of anti-FV3 antibodies but not related to complement. Furthermore, the presence of anti-FV3 serum during an FV3 infection in a non-immune mammalian cell line resulted in neutralization of the virus. Our results suggest that a cell surface receptor specific to teleost cell lines is responsible for the enhancement. Conclusions This report represents the first evidence of antibody dependent enhancement in iridoviruses. The data suggests that anti-FV3 serum can either neutralize or enhance viral infection and that enhancement is related to a novel antibody dependent enhancement pathway found in teleosts that is Fc dependent.

  13. Calcium diffusion through perineurium of frog sciatic nerve

    International Nuclear Information System (INIS)

    Calcium and sucrose permeabilities (PCa or Psucrose) were calculated from the fluxes of 45Ca and [3H]sucrose across perfused everted and normal configurations of the perineurial cylinder isolated from the frog sciatic nerve and from fluxes into an intact nerve segment bathed in Ringer. Mean PCa for influx across the isolated perineurium equaled 10.2 ± 0.6 x 10-7 cm/s compared with Psucrose = 7.4 ± 0.4 x 10-7 cm/s. For efflux, PCa = 27.5 ± 5.0 x 10-7 cm/s and Psucrose = 23.2 ± 4.7 x 10-7 cm/s. The mean ratio of PCa for efflux to PCa for influx was not significantly different from the flux ratio for sucrose. Asymmetrical fluxes across the perineurial cylinder were due presumably to bulk flow and resultant solvent drag out of the lumen caused by perfusion pressure. Calcium accumulated in the perineurial tissue in a saturable manner with a Km of 80 μM and a Bmax of 0.22 μmol/g wet wt. The half time for calcium exchange from the external medium to the nerve was calculated as 3 h. This long half time and the calcium-sequestering ability of the perineurium suggest that the perineurium can stabilize endoneurial calcium during transient changes in the calcium concentration of plasma

  14. Birds and frogs selected papers, 1990-2014

    CERN Document Server

    Dyson, Freeman J

    2015-01-01

    This book is a sequel to the volume of selected papers of Dyson up to 1990 that was published by the American Mathematical Society in 1996. The present edition comprises a collection of the most interesting writings of Freeman Dyson, all personally selected by the author, from the period 1990–2014. The five sections start off with an Introduction, followed by Talks about Science, Memoirs, Politics and History, and some Technical Papers. The most noteworthy is a lecture entitled Birds and Frogs to the American Mathematical Society that describes two kinds of mathematicians with examples from real life. Other invaluable contributions include an important tribute to C. N. Yang written for his retirement banquet at Stony Brook University, as well as a historical account of the Operational Research at RAF Bomber Command in World War II provocatively titled A Failure of Intelligence. The final section carries the open-ended question of whether any conceivable experiment could detect single gravitons to provide d...

  15. Role of cutaneous surface fluid in frog osmoregulation.

    Science.gov (United States)

    Larsen, Erik Hviid; Ramløv, Hans

    2013-07-01

    The study investigated whether evaporative water loss (EWL) in frogs stems from water diffusing through the skin or fluid secreted by mucous glands. Osmolality of cutaneous surface fluid (CSF) of Rana esculenta (Pelophylax kl. esculentus) subjected to isoproterenol or 30°C-34°C was 191±9.3 and 181±7.5 mosm/kg, respectively, as compared to lymph osmolality of, 249±10 mosm/kg. Cation concentrations of CSF were likewise independent of pre-treatment with averages of, [Na(+)]=65.5±5.1 and [K(+)]=14.9±1.6 mmol/L, and lymph concentrations of 116 mmol Na(+)/L and 5.1 mmol K(+)/L. The relatively high [K(+)] confirms that CSF is produced by submucosal glands. Since the chemical energy of water of CSF was always higher than that of body fluids, diffusion of water would be from CSF to the interstitial fluid and not in the opposite direction. It is concluded that volume and composition of CSF are regulated by subepidermal exocrine gland secretion balanced by EWL into the atmosphere and ion reuptake by the epidermal epithelium. Previously discovered regulatory mechanisms of epithelial ion absorption, hitherto not ascribed a body function, fit well with a role in regulating turnover of CSF. As a regulated external physiological compartment, CSF would be of importance for the immune defenses that amphibians employ in protecting their skin. PMID:23587876

  16. A multigene species tree for Western Mediterranean painted frogs (Discoglossus).

    Science.gov (United States)

    Pabijan, Maciej; Crottini, Angelica; Reckwell, Dennis; Irisarri, Iker; Hauswaldt, J Susanne; Vences, Miguel

    2012-09-01

    Painted frogs (Discoglossus) are an anuran clade that originated in the Upper Miocene. Extant species are morphologically similar and have a circum-Mediterranean distribution. We assembled a multilocus dataset from seven nuclear and four mitochondrial genes for several individuals of all but one of the extant species and reconstructed a robust phylogeny by applying a coalescent-based species-tree method and a concatenation approach, both of which gave congruent results. The earliest phylogenetic split within Discoglossus separates D. montalentii from a clade comprising all other species. Discoglossus montalentii is monophyletic for haplotype variation at all loci and has distinct morphological, bioacoustic and karyotypic characters. We find moderate support for a sister-group relationship between the Iberian taxa and the Moroccan D. scovazzi, and high support for a D. pictus -D. sardus clade distributed around the Tyrrhenian basin. Topological discordance among gene trees during the speciation of D. galganoi, D. scovazzi, D. pictus and D. sardus is interpreted as the consequence of nearly simultaneous, vicariant diversification. The timing of these events is unclear, but possibly coincided with the final geotectonic rearrangement of the Western Mediterranean in the Middle Miocene or later during the Messinian salinity crisis. The Iberian taxa D. galganoi galganoi and D. g. jeanneae are reciprocally monophyletic in mitochondrial DNA but not in nuclear gene trees, and are therefore treated as subspecies of D. galganoi. PMID:22641173

  17. Environmental constraints and call evolution in torrent-dwelling frogs.

    Science.gov (United States)

    Goutte, Sandra; Dubois, Alain; Howard, Samuel D; Marquez, Rafael; Rowley, Jodi J L; Dehling, J Maximilian; Grandcolas, Philippe; Rongchuan, Xiong; Legendre, Frédéric

    2016-04-01

    Although acoustic signals are important for communication in many taxa, signal propagation is affected by environmental properties. Strong environmental constraints should drive call evolution, favoring signals with greater transmission distance and content integrity in a given calling habitat. Yet, few empirical studies have verified this prediction, possibly due to a shortcoming in habitat characterization, which is often too broad. Here we assess the potential impact of environmental constraints on the evolution of advertisement call in four groups of torrent-dwelling frogs in the family Ranidae. We reconstruct the evolution of calling site preferences, both broadly categorized and at a finer scale, onto a phylogenetic tree for 148 species with five markers (∼3600 bp). We test models of evolution for six call traits for 79 species with regard to the reconstructed history of calling site preferences and estimate their ancestral states. We find that in spite of existing morphological constraints, vocalizations of torrent-dwelling species are most probably constrained by the acoustic specificities of torrent habitats and particularly their high level of ambient noise. We also show that a fine-scale characterization of calling sites allows a better perception of the impact of environmental constraints on call evolution. PMID:26960074

  18. Synthesis of nanoparticles with frog foam nest proteins

    International Nuclear Information System (INIS)

    Microemulsions provide an efficient means of synthesizing monodispersed nanoparticles. Recent studies have demonstrated potential problems of surfactant due to the interaction with nanoparticles/precursors. To solve the problems, various types of chemical surfactants have been tested, but natural biosurfactants have not received a great deal of attention in engineering application. Here, we report the formation of microemulsions using frog foam nest protein, ranaspumin-2 (RSN-2), based on the hypothesis that RSN-2 assembles at the water–oil interface as a result of conformational change into an extended form. Fluorescence spectroscopic studies showed that RSN-2 undergoes a reversible transition between extended and globular conformation in foams/microemulsions and aqueous solution, respectively. Microemulsions were formulated with RSN-2 to synthesize 8–10 nm superparamagnetic iron oxide nanoparticles by mixing precursor-containing microemulsions with base-containing microemulsions. RSN-2 proteins were recovered from microemulsions and found to be recycled to make foams and microemulsions. Fluorescence spectroscopic analyses showed that RSN-2 maintained its mechanical agitation-induced amphiphilicity throughout multiple foaming/defoaming processes. These results suggest that conformational flexibility and structural stability of RSN-2 in aggressive environments enable the recycled use of RSN-2, elucidating the cost-effective advantage.

  19. Synthesis of nanoparticles with frog foam nest proteins

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hyo-Jick, E-mail: choihc@ucmail.uc.edu; Ebersbacher, Charles F. [University of Cincinnati, School of Energy, Environmental, Biological and Medical Engineering (United States); Myung, Nosang V. [University of California, Riverside, Department of Chemical and Environmental Engineering (United States); Montemagno, Carlo D., E-mail: montemcd@ucmail.uc.edu [University of Cincinnati, School of Energy, Environmental, Biological and Medical Engineering (United States)

    2012-09-15

    Microemulsions provide an efficient means of synthesizing monodispersed nanoparticles. Recent studies have demonstrated potential problems of surfactant due to the interaction with nanoparticles/precursors. To solve the problems, various types of chemical surfactants have been tested, but natural biosurfactants have not received a great deal of attention in engineering application. Here, we report the formation of microemulsions using frog foam nest protein, ranaspumin-2 (RSN-2), based on the hypothesis that RSN-2 assembles at the water-oil interface as a result of conformational change into an extended form. Fluorescence spectroscopic studies showed that RSN-2 undergoes a reversible transition between extended and globular conformation in foams/microemulsions and aqueous solution, respectively. Microemulsions were formulated with RSN-2 to synthesize 8-10 nm superparamagnetic iron oxide nanoparticles by mixing precursor-containing microemulsions with base-containing microemulsions. RSN-2 proteins were recovered from microemulsions and found to be recycled to make foams and microemulsions. Fluorescence spectroscopic analyses showed that RSN-2 maintained its mechanical agitation-induced amphiphilicity throughout multiple foaming/defoaming processes. These results suggest that conformational flexibility and structural stability of RSN-2 in aggressive environments enable the recycled use of RSN-2, elucidating the cost-effective advantage.

  20. Deepening African Ties

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Chinese President Hu Jintao has just embarked on his state visits to eight African countries that will take him to both the northern and southern tips of the continent. This is his first trip abroad this year, and also his third visit to Africa

  1. East African institutions

    DEFF Research Database (Denmark)

    Nordby, Johannes Riber; Jacobsen, Katja

    For the past decade security in East Africa has gained focus internationally. However there is a growing ambition among African states to handle such issues by themselves, sometimes through regional institutions. This has been supported by many Western states but potential risks are often forgotten....

  2. African Women Writing Resistance

    Institute of Scientific and Technical Information of China (English)

    Jennifer Browdy de Hernandez; Pauline Dongala; Omotayo; Jolaosho; Anne Serafin

    2011-01-01

    AFRICAN Women Writing Resistance is the first transnational anthology to focus on women's strategies of resistance to the challenges they face in Africa today.The anthology brings together personal narratives,testimony,interviews,short stories,poetry,performance scripts,folktales and lyrics.

  3. African Women Writing Resistance

    Institute of Scientific and Technical Information of China (English)

    Jennifer; Browdy; de; Hernandez; Pauline; Dongala; Omotayo; Jolaosho; Anne; Serafin

    2011-01-01

    An Anthology of Contemporary Voices AFRICAN Women Writing Resistance is the first transnational anthology to focus on women’s strategies of resistance to the challenges they face in Africa today.The anthology brings together personal narratives,testimony,interviews, short stories,po-

  4. West African Antislavery Movements

    DEFF Research Database (Denmark)

    Hahonou, Eric Komlavi; Pelckmans, Lotte

    2011-01-01

    In the context of liberalization of West African political regimes, the upsurge of audacious political entrepreneurs who want to end chattel slavery in their nation-state, resulted in the legal criminalisation of slavery in both Mauritania (2007) and Niger (2003) and in a proposal to revise the...... cultures (or ‘mentalities’) go hand in hand....

  5. Immunizations and African Americans

    Science.gov (United States)

    ... Program Grants Other Grants Planning and Evaluation Grantee Best Practices Black/African American Asthma Cancer Chronic Liver Disease ... 13 to 17 years who ever received the human papillomavirus (HPV) vaccination, 2014 - Males # doses ... 240-453-2882 Office of Minority Health Resource Center Toll Free: 1-800-444-6472 / Fax: ...

  6. The African Union

    DEFF Research Database (Denmark)

    Mandrup, Thomas; Mandrup, Bjørn

    2009-01-01

    . Moreover, the ‘African Security Architecture’, of which it is the central component, also includes sub-regional organisations to which responsibility is to be devolved for dealing with armed confl ict and other matters. These so-called Regional Economic Communities (RECs) are, likewise, constantly changing...

  7. African tick bite fever

    DEFF Research Database (Denmark)

    Johansen, Jakob Aaquist; Thybo, Søren

    2011-01-01

    The incident of spotted fever imported to Denmark is unknown. We present a classic case of African Tick Bite Fever (ATBF) to highlight a disease, which frequently infects wildlife enthusiasts and hunters on vacation in South Africa. ATBF has a good prognosis and is easily treated with doxycyclin...

  8. Spatio-Temporal Dynamics in Collective Frog Choruses Examined by Mathematical Modeling and Field Observations

    Science.gov (United States)

    Aihara, Ikkyu; Mizumoto, Takeshi; Otsuka, Takuma; Awano, Hiromitsu; Nagira, Kohei; Okuno, Hiroshi G.; Aihara, Kazuyuki

    2014-01-01

    This paper reports theoretical and experimental studies on spatio-temporal dynamics in the choruses of male Japanese tree frogs. First, we theoretically model their calling times and positions as a system of coupled mobile oscillators. Numerical simulation of the model as well as calculation of the order parameters show that the spatio-temporal dynamics exhibits bistability between two-cluster antisynchronization and wavy antisynchronization, by assuming that the frogs are attracted to the edge of a simple circular breeding site. Second, we change the shape of the breeding site from the circle to rectangles including a straight line, and evaluate the stability of two-cluster and wavy antisynchronization. Numerical simulation shows that two-cluster antisynchronization is more frequently observed than wavy antisynchronization. Finally, we recorded frog choruses at an actual paddy field using our sound-imaging method. Analysis of the video demonstrated a consistent result with the aforementioned simulation: namely, two-cluster antisynchronization was more frequently realized.

  9. Columbia spotted frog (Rana luteiventris) in southeastern Oregon: A survey of historical localities, 2009

    Science.gov (United States)

    Pearl, Chistopher A.; Galvan, Stephanie K.; Adams, Michael J.; McCreary, Brome

    2010-01-01

    The Columbia spotted frog (Rana luteiventris) occupies a large range in western North America and is comprised of at least three genetic units. Concern exists regarding the status of the Great Basin populations in Oregon, Idaho, and Nevada. We surveyed target and nearby alternate sites on public lands in southeastern Oregon where there was evidence that Columbia spotted frogs were historically present. We found the species at 59.5 percent (25 of 42) of target or nearby alternate sites. They were in 15 of 23 permanent streams and 8 of 13 intermittent streams. Our surveys do not provide evidence of widespread population losses in our sites. Interpretation of status of Columbia spotted frogs in this study is limited by a lack of precision in some of the historical locations and by our inability to determine if locations where only adults were indicated in the historical record once had breeding populations. Our results support the need for continued investigation of these populations.

  10. Estimation of radiation doses from 137Cs to frogs in a wetland ecosystem

    International Nuclear Information System (INIS)

    Currently, there is no established methodology to estimate radiation doses to non-human biota. Therefore, in this study, various dose models were used to estimate radiation doses to moor frogs (Rana arvalis) in a wetland ecosystem contaminated with 137Cs. External dose estimations were based on activity concentrations of 137Cs in soil and water, considering changes in habitat over a life-cycle. Internal doses were calculated from the activity concentrations of 137Cs measured in moor frogs. Depending on the dose model used, the results varied substantially. External dose rates ranged from 21 to 160 mGy/y, and internal dose rates varied between 1 and 14 mGy/y. Maximum total dose rates to frogs were below the expected safe level for terrestrial populations, but close to the suggested critical dose rate for amphibians. The results show that realistic assumptions in dose models are particularly important at high levels of contamination

  11. The Australasian frog family Ceratobatrachidae in China, Myanmar and Thailand: discovery of a new Himalayan forest frog clade

    Science.gov (United States)

    YAN, Fang; JIANG, Ke; WANG, Kai; JIN, Jie-Qiong; SUWANNAPOOM, Chatmongkon; LI, Cheng; Jens, V. VINDUM; Rafe, M. BROWN; CHE, Jing

    2016-01-01

    In an effort to study the systematic affinities and specieslevel phylogenetic relationships of the enigmatic anurans variably assigned to the genera Ingerana or Limnonectes (family Dicroglossidae), we collected new molecular sequence data for five species including four Himalayan taxa, Limnonectes xizangensis, Lim. medogensis, Lim. alpine, Ingerana borealis and one southeast Asian species, I. tasanae, and analyzed these together with data from previous studies involving other ostensibly related taxa. Our surprising results demonstrate unequivocally that Lim. xizangensis, Lim. medogensis and Lim. alpine form a strongly supported clade, the sister-group of the family Australasian forest frog family Ceratobatrachidae. This discovery requires an expansion of the definition of Ceratobatrachidae and represents the first record of this family in China. These three species are distinguished from the species of Ingerana and Limnonectes by the: (1) absence of interdigital webbing of the foot, (2) absence of terminal discs on fingers and toes, (3) absence of circumarginal grooves on the fingers and toes, and (4) absence of tarsal folds. Given their phylogenetic and morphological distinctiveness, we assign them to the oldest available generic name for this clade, Liurana Dubois 1987, and transfer Liurana from Dicroglossidae to the family Ceratobatrachidae. In contrast, Ingerana tasanae was found to be clustered with strong support with the recently described genus Alcalus (Ceratobatrachidae), a small clade of otherwise Sundaic species; this constitutes a new record of the family Ceratobatrachidae for Myanmar and Thailand. Finally, Ingerana borealis clustered with the "true" Ingerana (family Dicroglossidae), for which the type species is I. tenasserimensis. PMID:26828029

  12. The potential effects of climate change on the status of Seychelles frogs (Anura: Sooglossidae

    Directory of Open Access Journals (Sweden)

    J. Gerlach

    2011-11-01

    Full Text Available The status of the Seychelles frogs of the family Sooglossidae was investigated, using monitoring data from 1993-2010, climate data from 1998-2010 and studies of populations and local climate effects. Climate monitoring at each plot covered rainfall and temperature, with leaf wetness and soil moisture being monitored additionally at one site. Analysis of the data and ecological modelling of the distribution identify geographical patterns in climate which explain the present distribution of the different sooglossid species. In addition it identifies a drying trend in the first quarter of the year which corresponds to frog population declines in mid-altitude forests. This is interpreted as evidence of an ongoing deterioration in the suitability of habitats for the frogs, with declines recorded in areas of marginal suitability. By extension it is assumed that currently optimal frog habitat is also undergoing a decline in suitability, due to early year decreases in moisture. Projected changes in climate were used to predict changes in ranges of the sooglossids over the next 90 years. This predicts significant declines, with the possible extinction of the palm frog Sooglossus pipilodryas by 2100. Accordingly all four sooglossid species should be categorised as Endangered, rather than their current status of Vulnerable. Captive assurance colonies have not been successfully established to date. Captive groups have been maintained with a high degree of success but breeding has not been recorded so far. Further work needed for the conservation of the frogs is outlined: development of a reliable method of monitoring the cryptic S. thomasseti and development of captive breeding techniques.

  13. Cadmium-induced oxidative stress and apoptosis in the testes of frog Rana limnocharis

    International Nuclear Information System (INIS)

    Highlights: ► Cd can cause vacuoles and deformity of the spermatogenic cells in the frog testes. ► Cd can result in oxidative stress in the frog testes. ► Cd can induce significantly increase of ROS contents triggered DNA damages in the frog testes. ► Cd can cause apoptosis in the testes of male R. limnocharis. ► Apoptosis by Cd in the frog testes is related to Caspase-3, Bax and Bcl-2 genes. - Abstract: This study explored the genetic damage induced by cadmium exposure in the testes of Rana limnocharis. Healthy adult frogs were exposed to 2.5, 5, 7.5, or 10 mg/L of cadmium solution for 14 days. The results showed that exposure to these concentrations increased the levels of reactive oxygen species and malondialdehyde content in the testes, clearly indicating a dose–effect relationship. Moreover, the same dosages of Cd2+ solution increased glutathione (reduced) content, with the values being significantly different from those observed in the control group (P < 0.01). The comet assay results demonstrated that the DNA damage rate, tail length, and tail moment of samples obtained from frogs exposed to 2.5–7.5 mg/L of cadmium solution significantly increased compared with those of samples obtained from the control group (P < 0.01). These findings suggest that cadmium can induce free radical generation, followed by lipid peroxidation and DNA damage. Ultrastructural observation revealed vacuoles in the spermatogenic cells, cell dispersion, incomplete cell structures, and deformed nucleoli. Moreover, cadmium exposure induced significant down-regulation of Bcl-2 expression and up-regulation of Bax and caspase-3 expressions. Taken together, these data indicate that cadmium can induce testicular cell apoptosis in R. limnocharis. Exploring the effects of cadmium on the mechanism of reproductive toxicity in amphibians will help provide a scientific basis accounting for the global population decline in amphibian species.

  14. Female genital mutilation in African and African American women's literature

    Directory of Open Access Journals (Sweden)

    Darja Marinšek

    2007-12-01

    Full Text Available The article builds on the existing dispute between African and African American women writers on the competence of writing about female genital mutilation (FGM, and tries to determine the existence and nature of the differences between the writings of these two groups. The author uses comparative analysis of two popular African and African American novels, comparing their ways of describing FGM, its causes and consequences, the level ob objectivity and the style of the narrations.This is followed by a discussion on the reasons for such differences, incorporating a larger circle of both African and African American women authors, at the same time analysing the deviance within the two groups. While the differences between African American writers are not that great, as they mostly fail to present the issue from different points of view, which is often the result of their lack of direct knowledge of the topic, African authors' writing is in itself discovered to be ambivalent and not at all invariable. The reasons for such ambivalence are then discussed in greater context, focusing on the effect of the authors' personal contact with circumcision as well as their knowledge and acceptance of Western values. The author concludes by establishing the African ambivalent attitude towards FGM, which includes different aspects of the issue, as the most significant difference between their and African American writers' description of this practice.

  15. Shuffled Frog Leaping Algorithm for minimizing total holding cost with tardy jobs in Job shop scheduling

    Directory of Open Access Journals (Sweden)

    G. Ramya

    2013-08-01

    Full Text Available In job shop scheduling problems, n jobs have to be processed on m different machines. Each job consists of a sequence of tasks that have to be processed during an uninterrupted time period of a fixed length on a given machine. This paper deals with the job shop scheduling problem (JSP of minimizing the total holding cost with consideration of tardy jobs using Shuffled Frog Leaping Algorithm. Research results from several benchmark problems with different sizes, which are commonly used for optimizing the scheduling objectives, solved by the proposed algorithms are reported. Shuffled Frog Leaping Algorithm gives better results compared with literature results in terms of total holding cost.

  16. Regulation of 5'-adenosine monophosphate deaminase in the freeze tolerant wood frog, Rana sylvatica

    Directory of Open Access Journals (Sweden)

    Storey Kenneth B

    2008-04-01

    Full Text Available Abstract Background The wood frog, Rana sylvatica, is one of a few vertebrate species that have developed natural freeze tolerance, surviving days or weeks with 65–70% of its total body water frozen in extracellular ice masses. Frozen frogs exhibit no vital signs and their organs must endure multiple stresses, particularly long term anoxia and ischemia. Maintenance of cellular energy supply is critical to viability in the frozen state and in skeletal muscle, AMP deaminase (AMPD plays a key role in stabilizing cellular energetics. The present study investigated AMPD control in wood frog muscle. Results Wood frog AMPD was subject to multiple regulatory controls: binding to subcellular structures, protein phosphorylation, and effects of allosteric effectors, cryoprotectants and temperature. The percentage of bound AMPD activity increased from 20 to 35% with the transition to the frozen state. Bound AMPD showed altered kinetic parameters compared with the free enzyme (S0.5 AMP was reduced, Hill coefficient fell to ~1.0 and the transition to the frozen state led to a 3-fold increase in S0.5 AMP of the bound enzyme. AMPD was a target of protein phosphorylation. Bound AMPD from control frogs proved to be a low phosphate form with a low S0.5 AMP and was phosphorylated in incubations that stimulated PKA, PKC, CaMK, or AMPK. Bound AMPD from frozen frogs was a high phosphate form with a high S0.5 AMP that was reduced under incubation conditions that stimulated protein phosphatases. Frog muscle AMPD was activated by Mg·ATP and Mg·ADP and inhibited by Mg·GTP, KCl, NaCl and NH4Cl. The enzyme product, IMP, uniquely inhibited only the bound (phosphorylated enzyme from muscle of frozen frogs. Activators and inhibitors differentially affected the free versus bound enzyme. S0.5 AMP of bound AMPD was also differentially affected by high versus low assay temperature (25 vs 5°C and by the presence/absence of the natural cryoprotectant (250 mM glucose that

  17. Changes in body fluids of the cocooning fossorial frog Cyclorana australis in a seasonally dry environment.

    Science.gov (United States)

    Reynolds, Stephen J; Christian, Keith A; Tracy, Christopher R; Hutley, Lindsay B

    2011-11-01

    We investigated changes in the lymph (equivalent to plasma) and urine of the cocooning frog Cyclorana australis during the dry season in monsoonal northern Australia. Frogs in moist soil for two days were fully hydrated (lymph 220 mOsm kg(-1), urine 49 mOsm kg(-1)). From five weeks onwards the soil was dry (matric potential soil, osmolality increase in C. australis was not severe. Aestivation in a cocoon facilitates survival in shallow burrows, but such a strategy may only be effective in environments with seasonally reliable rainfall. PMID:21777688

  18. Acute effects of inhalable particles on the frog palate mucociliary epithelium.

    OpenAIRE

    M. Macchione; Oliveira, A. P.; Gallafrio, C T; Muchão, F P; Obara, M T; Guimarães, E T; Artaxo, P.; King, M.; G. Lorenzi-Filho; Junqueira, V C; Saldiva, P H

    1999-01-01

    This work was designed to evaluate the toxicity of inhalable particles [less than/equal to] 10 microm in aerodynamic diameter (PM(10)) collected from the urban air in São Paulo, Brazil, to the mucociliary apparatus using the frog palate preparation. Seven groups of frog palates were immersed in different concentrations of PM(10) diluted in Ringer's solution during 120 min: 0 (control, n = 31); 50 (n = 10); 100 (n = 9); 500 (n = 28); 1,000 (n = 10); 5,000 (n = 11); and 10,000 microg/m(3) (n = ...

  19. Introducing the Forensic Research/Reference on Genetics knowledge base, FROG-kb

    Directory of Open Access Journals (Sweden)

    Rajeevan Haseena

    2012-09-01

    Full Text Available Abstract Background Online tools and databases based on multi-allelic short tandem repeat polymorphisms (STRPs are actively used in forensic teaching, research, and investigations. The Fst value of each CODIS marker tends to be low across the populations of the world and most populations typically have all the common STRP alleles present diminishing the ability of these systems to discriminate ethnicity. Recently, considerable research is being conducted on single nucleotide polymorphisms (SNPs to be considered for human identification and description. However, online tools and databases that can be used for forensic research and investigation are limited. Methods The back end DBMS (Database Management System for FROG-kb is Oracle version 10. The front end is implemented with specific code using technologies such as Java, Java Servlet, JSP, JQuery, and GoogleCharts. Results We present an open access web application, FROG-kb (Forensic Research/Reference on Genetics-knowledge base, http://frog.med.yale.edu, that is useful for teaching and research relevant to forensics and can serve as a tool facilitating forensic practice. The underlying data for FROG-kb are provided by the already extensively used and referenced ALlele FREquency Database, ALFRED (http://alfred.med.yale.edu. In addition to displaying data in an organized manner, computational tools that use the underlying allele frequencies with user-provided data are implemented in FROG-kb. These tools are organized by the different published SNP/marker panels available. This web tool currently has implemented general functions possible for two types of SNP panels, individual identification and ancestry inference, and a prediction function specific to a phenotype informative panel for eye color. Conclusion The current online version of FROG-kb already provides new and useful functionality. We expect FROG-kb to grow and expand in capabilities and welcome input from the forensic community in

  20. Oviposition and development in the glass frog Hyalinobatrachium orientale (Anura: Centrolenidae)

    OpenAIRE

    Nokhbatolfoghahai, Mohsen; Christopher J. Pollock; Downie, J. Roger

    2015-01-01

    Oviposition and development in the glass frog Hyalinobatrachium orientale (Anura: Centrolenidae). Oviposition and external embryonic developmental features are described in the Tobago glass frog, Hyalinobatrachium orientale. Egg clutches are nearly always laid on the undersides of leaves (one exception); usually leaves of Heliconia sp. are used, but Philodendron and palms may be used in the absence of Heliconia. Clutches contain 28.0 ± 5.3 eggs (mean ± SD) and eggs are 1.86 ± 0.11 mm in diame...

  1. Extinction of montane populations of the northern leopard frog (Rana pippins) in Colorado

    Science.gov (United States)

    Corn, Paul Stephen; Fogleman, James C.

    1984-01-01

    Between 1973 and 1982 nine populations of the northern leopard frog in the Red Feather Lakes region of Larimer County, Colorado, failed in reproduce. These failures all resulted in extinction of the populations. One area formerly supporting a population was recolonized in 1980, but no frogs were observed at any of the nine sites in 1981 or 1982. Six of the populations went extinct because the breeding ponds dried up. The remaining populations were small enough to be susceptible to random events, but the nature of these events is unknown.

  2. A new Gephyromantis (Phylacomantis frog species from the pinnacle karst of Bemaraha, western Madagascar

    Directory of Open Access Journals (Sweden)

    Angelica Crottini

    2011-02-01

    Full Text Available We describe a new mantellid frog of the subfamily Mantellinae from the karstic Bemaraha Plateau, western Madagascar. The new species belongs to the genus Gephyromantis, subgenus Phylacomantis, which previously included G. azzurrae, G. corvus and G. pseudoasper. Gephyromantis atsingy sp. n. has a snout-vent length of 35–43 mm and is a scansorial frog living among the Tsingy de Bemaraha pinnacles and inside the caves present in the area. A morphological analysis and biomolecular comparison revealed the degree of differentiation between these four species of the Phylacomantis subgenus. The new species seems to be endemic to Tsingy de Bemaraha.

  3. Ion secretion and isotonic transport in frog skin glands.

    Science.gov (United States)

    Ussing, H H; Lind, F; Larsen, E H

    1996-07-01

    The aim of this study was to clarify the mechanism of isotonic fluid transport in frog skin glands. Stationary ion secretion by the glands was studied by measuring unidirectional fluxes of 24Na+, 42K+, and carrier-free 134Cs+ in paired frog skins bathed on both sides with Ringer's solution, and with 10(-5) M noradrenaline on the inside and 10(-4) M amiloride on the outside. At transepithelial thermodynamic equilibrium conditions, the 134Cs+ flux ratio, JoutCs/JinCs, varied in seven pairs of preparations from 6 to 36. Since carrier-free 134Cs+ entering the cells is irreversibly trapped in the cellular compartment (Ussing & Lind, 1996), the transepithelial net flux of 134Cs+ indicates that a paracellular flow of water is dragging 134Cs+ in the direction from the serosal- to outside solution. From the measured flux ratios it was calculated that the force driving the secretory flux of Cs+ varied from 30 to 61 mV among preparations. In the same experiments unidirectional Na+ fluxes were measured as well, and it was found that also Na+ was subjected to secretion. The ratio of unidirectional Na+ fluxes, however, was significantly smaller than would be predicted if the two ions were both flowing along the paracellular route dragged by the flow of water. This result indicates that Na+ and Cs+ do not take the same pathway through the glands. The flux ratio of unidirectional K+ fluxes indicated active secretion of K+. The time it takes for steady-state K+ fluxes to be established was significantly longer than that of the simultaneously measured Cs+ fluxes. These results allow the conclusion that - in addition to being transported between cells - K+ is submitted to active transport along a cellular pathway. Based on the recirculation theory, we propose a new model which accounts for stationary Na+, K+, Cl- and water secretion under thermodynamic equilibrium conditions. The new features of the model, as compared to the classical Silva-model for the shark-rectal gland, are: (i

  4. Leadership in the African context

    Directory of Open Access Journals (Sweden)

    M. Masango

    2002-08-01

    Full Text Available The Western world has always viewed the African continent as plagued by corruption; dictatorship; military coups; rebellious leaders; greediness; misuse of power; and incompetent, politically unstable leaders - in effect, suspicious leaders who undermine their own democracies. This paper analyzes African leadership and its impact by concentrating on three historical eras, namely; the African Religious era; the Christian era, and the era of Globalization. These affected African leadership. In addition, many brilliant minds left the continent in search of greener pastures. A review of these three eras will help us understand how leadership shifted from African values into Western concepts. The role of missionaries lead African people to live with both an African and a Western concept of life. In spite of the above problems, our past leaders did their best in addressing the difficulties they faced during the three eras. African concepts of leadership were often regarded as barbaric and uncultured. Structures were evaluated by Western standards. Due to globalisation, African leaders, through programmes like NEPAD, are going back to basics, drawing on African concepts of unity among its leadership. Effectiveness or life-giving leadership is emerging and empowering villagers/communities in the continent. This type of leadership is innovative and has brought new hope for the continent.

  5. Light-dependent magnetic compass in Iberian green frog tadpoles

    Science.gov (United States)

    Diego-Rasilla, Francisco Javier; Luengo, Rosa Milagros; Phillips, John B.

    2010-12-01

    Here, we provide evidence for a wavelength-dependent effect of light on magnetic compass orientation in Pelophylax perezi (order Anura), similar to that observed in Rana catesbeiana (order Anura) and Notophthalmus viridescens (order Urodela), and confirm for the first time in an anuran amphibian that a 90° shift in the direction of magnetic compass orientation under long-wavelength light (≥500 nm) is due to a direct effect of light on the underlying magnetoreception mechanism. Although magnetic compass orientation in other animals (e.g., birds and some insects) has been shown to be influenced by the wavelength and/or intensity of light, these two amphibian orders are the only taxa for which there is direct evidence that the magnetic compass is light-dependent. The remarkable similarities in the light-dependent magnetic compasses of anurans and urodeles, which have evolved as separate clades for at least 250 million years, suggest that the light-dependent magnetoreception mechanism is likely to have evolved in the common ancestor of the Lissamphibia (Early Permian, ~294 million years) and, possibly, much earlier. Also, we discuss a number of similarities between the functional properties of the light-dependent magnetic compass in amphibians and blue light-dependent responses to magnetic stimuli in Drosophila melanogaster, which suggest that the wavelength-dependent 90° shift in amphibians may be due to light activation of different redox forms of a cryptochrome photopigment. Finally, we relate these findings to earlier studies showing that the pineal organ of newts is the site of the light-dependent magnetic compass and recent neurophysiological evidence showing magnetic field sensitivity in the frog frontal organ (an outgrowth of the pineal).

  6. Induction of apoptosis in frog virus 3-infected cells.

    Science.gov (United States)

    Chinchar, V G; Bryan, Locke; Wang, J; Long, Scott; Chinchar, G D

    2003-02-15

    The ability of frog virus 3 (FV3), the type species of the family Iridoviridae, to induce apoptosis was examined by monitoring DNA cleavage, chromatin condensation, and cell-surface expression of phosphotidylserine (PS) in fathead minnow (FHM) and baby hamster kidney (BHK) cells. In productively infected FHM cells, DNA fragmentation was first noted at 6-7 h postinfection and was clearly seen by 17 h postinfection, while chromatin condensation was detected at 8.5 h postinfection. As with some other viruses, FV3-induced apoptosis did not require de novo viral gene expression as both heat-inactivated and UV-inactivated virus readily triggered DNA fragmentation in FHM cells. Moreover, FV3-induced apoptosis was blocked in FHM cells by the pan-caspase inhibitor Z-VAD-FMK, suggesting that virus infection triggers programmed cell death through activation of the caspase cascade. FV3 infection also triggered apoptosis in BHK cells as monitored by TUNEL and annexin V binding assays. To determine whether FV3, similar to other large DNA viruses, encoded proteins that block or delay apoptosis, mock- and FV3-infected FHM cells were osmotically shocked and assayed for DNA fragmentation 3 hours later. DNA fragmentation was clearly seen whether or not shocked cells were previously infected with FV3, indicating that infection with FV3 did not block apoptosis induced by osmotic shock in FHM cells. The above results demonstrate that iridoviruses triggered apoptosis and that the induction of programmed cell death did not require viral gene expression. However, it remains to be determined if virion attachment to target cells is sufficient to induce cell death, or if apoptosis is triggered directly or indirectly by one or more virion-associated proteins. PMID:12642103

  7. A tree of tree frogs around the Black Sea.

    Science.gov (United States)

    Irwin, Darren E

    2016-09-01

    Speciation, the process by which one species evolves into two or more, is a major focus of ongoing debate, particularly regarding the geographic context in which it occurs. Geographic models of speciation tend to fall into discrete categories, typically referred to as allopatric, parapatric and sympatric speciation, according to whether two groups evolve reproductive isolation while geographically isolated, differentiated but connected by gene flow, or completely co-occurring. Yet molecular studies indicate that full development of reproductive isolation can take very long compared with the timescale at which climatic oscillations occur, such that the geographic context of differentiating forms might change often during the long process to full species. Studies of genetic relationships across the ranges of organisms with low-dispersal distances have the potential to reveal these complex histories. In a particularly elegant example in this issue, Dufresnes et al. () use genetic variation and ecological niche modelling to show that a ring of populations of the eastern tree frog (Hyla orientalis) surrounding the Black Sea had a complex history of geographic differentiation. Alternating phases of geographic fragmentation and phases of gene flow between neighbouring populations have produced a pattern of gradual genetic change connecting the western, southern and eastern sides of the ring, with the northwestern and northeastern forms being most differentiated. In the north, a population in Crimea appears to have been produced through mixture of the two extreme forms. The overall genetic relationships are reminiscent of those found in ring species, which have been used as prime demonstrations of the process of speciation. The difference, however, is that the terminal forms appear to have mixed rather than be reproductively isolated, although more research is needed to infer whether there might be some reproductive isolation on the northern side of the ring. PMID

  8. Does multiple paternity improve fitness of the frog Crinia georgiana?

    Science.gov (United States)

    Byrne, P G; Roberts, J D

    2000-06-01

    In the Australian myobatrachid frog Crinia georgiana simultaneous polyandry occurs in about half of all matings, which leads to multiple paternity, but reduced fertilization success and occasional female mortality. Multiple paternity may provide benefits to females that compensate for these costs, for example, through enhanced genetic diversity of a clutch. In nature, embryos and tadpoles of C. georgiana develop in shallow, temporary pools and may be exposed to fluctuating water levels and the risk of desiccation between rain events. Fertilization by genetically diverse sires may act as a bet hedge against these conditions. To evaluate this hypothesis, females were artificially mated with one or two males in the field and eggs and larvae reared in the laboratory under constant or fluctuating developmental conditions. Experiment 1 exposed embryos from single- and multiple-paternity clutches to conditions where eggs were completely covered during development or eggs sat in air on a moist substrate. Experiment 2 exposed freshly hatched larvae from single- and multiple-paternity clutches to constant wet conditions, where larvae were completely covered, or fluctuating wet conditions, where larvae ranged from being completely submersed to partially exposed over a 13-day cycle. We measured mean performance and best performance as alternate measures of genetic benefits. There were no effects of paternity on percent survival to hatching, time to hatching, body size at hatching, percent survival to metamorphosis, time to metamorphosis, or body size at metamorphosis. We also analyzed variance within clutches as a measure of genetic diversity. Again there were no predictable effects of multiple paternity. Polyandry does not appear to provide any genetic benefits that compensate for the high costs of polyandry in this species. PMID:10937269

  9. Cost-effective conservation of an endangered frog under uncertainty.

    Science.gov (United States)

    Rose, Lucy E; Heard, Geoffrey W; Chee, Yung En; Wintle, Brendan A

    2016-04-01

    How should managers choose among conservation options when resources are scarce and there is uncertainty regarding the effectiveness of actions? Well-developed tools exist for prioritizing areas for one-time and binary actions (e.g., protect vs. not protect), but methods for prioritizing incremental or ongoing actions (such as habitat creation and maintenance) remain uncommon. We devised an approach that combines metapopulation viability and cost-effectiveness analyses to select among alternative conservation actions while accounting for uncertainty. In our study, cost-effectiveness is the ratio between the benefit of an action and its economic cost, where benefit is the change in metapopulation viability. We applied the approach to the case of the endangered growling grass frog (Litoria raniformis), which is threatened by urban development. We extended a Bayesian model to predict metapopulation viability under 9 urbanization and management scenarios and incorporated the full probability distribution of possible outcomes for each scenario into the cost-effectiveness analysis. This allowed us to discern between cost-effective alternatives that were robust to uncertainty and those with a relatively high risk of failure. We found a relatively high risk of extinction following urbanization if the only action was reservation of core habitat; habitat creation actions performed better than enhancement actions; and cost-effectiveness ranking changed depending on the consideration of uncertainty. Our results suggest that creation and maintenance of wetlands dedicated to L. raniformis is the only cost-effective action likely to result in a sufficiently low risk of extinction. To our knowledge we are the first study to use Bayesian metapopulation viability analysis to explicitly incorporate parametric and demographic uncertainty into a cost-effective evaluation of conservation actions. The approach offers guidance to decision makers aiming to achieve cost

  10. The genetic structure and history of Africans and African Americans

    OpenAIRE

    Tishkoff, Sarah A; Reed, Floyd A; Friedlaender, Françoise R; Ehret, Christopher; Ranciaro, Alessia; Froment, Alain; Hirbo, Jibril B.; Awomoyi, Agnes A; Bodo, Jean-Marie; Doumbo, Ogobara; Ibrahim, Muntaser; Juma, Abdalla T; Kotze, Maritha J.; Lema, Godfrey; Moore, Jason H.

    2009-01-01

    Africa is the source of all modern humans, but characterization of genetic variation and of relationships among populations across the continent has been enigmatic. We studied 121 African populations, four African American populations, and 60 non-African populations for patterns of variation at 1327 nuclear microsatellite and insertion/deletion markers. We identified 14 ancestral population clusters in Africa that correlate with self-described ethnicity and shared cultural and/or linguistic p...

  11. Response of the Italian agile frog (Rana latastei) to a Ranavirus, frog virus 3: a model for viral emergence in naïve populations.

    Science.gov (United States)

    Pearman, Peter B; Garner, Trenton W J; Straub, Monika; Greber, Urs F

    2004-10-01

    Ranavirus (family Iridoviridae) is a genus of pathogens of poikilotherms, and some ranaviruses may play a role in widespread mortality of amphibians. Ecology of viral transmission in amphibians is poorly known but can be addressed through experimentation in the laboratory. In this study, we use the Ranavirus frog virus 3 (FV3) as an experimental model for pathogen emergence in naive populations of tadpoles. We simulated emerging disease by exposing tadpoles of the Italian agile frog (Rana latastei), to the North American Ranavirus FV3. We demonstrated that mortality occurred due to viral exposure, exposure of tadpoles to decreasing concentrations of FV3 in the laboratory produced dose-dependent survival rates, and cannibalism of virus-carrying carcasses increased mortality due to FV3. These experiments suggest the potential for ecological mechanisms to affect the level of exposure of tadpoles to Ranavirus and to impact transmission of viral pathogens in aquatic systems. PMID:15650083

  12. Steps to African Development

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    The development of Africa is vital to the world’s sustainable development.However,African countries still face key challenges in achieving the meaningful expansion of their economies.At the High-Level Symposium on China-Africa Investment Cooperation in Xiamen,southeast China’s Fujian Province,held from September 8 to 10,Chen Deming,Minister of Commerce of China,elaborates on these challenges and sees

  13. Biofuels: The African experience

    Energy Technology Data Exchange (ETDEWEB)

    Carrillo, L.A.; Nkolo, M. [German Agency for Technical Cooperation GTZ, Delegation Regionale des Eaux et Forets, Bertoua (Cameroon)

    2009-07-01

    In July 2006, the African Non-Petroleum Producers Association was formed in Senegal, Africa to develop alternative energy sources. It involved 13 of Africa's poorest nations, who joined forces to become global suppliers of biofuels, and some have set mandatory mixing of ethanol into gasoline. Although several biofuel production projects have been launched in western Africa, many of the new projects and plantations have not yet reached maturity due to the time lag between plantation and full-scale production, which is about 6 years. Major projects that could be producing significant quantities of biofuels in the next few years are not yet reflected in production statistics. Although ethanol is not yet being produced in large quantities in Africa, short-term opportunities exist. Countries in the South African Development Community are using molasses from the sugar can industry to produce ethanol. Biodiesel is also not currently produced on a significant scale in western Africa, but several other countries are gaining experience with cotton and palm oil resources, and Jatropha. Biomass residue also represents a large potential for all African countries involved in timber production. Unlike biodiesel production, land use conflicts are not an issue with biomass residue production.

  14. Diversity among African pygmies.

    Directory of Open Access Journals (Sweden)

    Fernando V Ramírez Rozzi

    Full Text Available Although dissimilarities in cranial and post-cranial morphology among African pygmies groups have been recognized, comparative studies on skull morphology usually pull all pygmies together assuming that morphological characters are similar among them and different with respect to other populations. The main aim of this study is to compare cranial morphology between African pygmies and non-pygmies populations from Equatorial Africa derived from both the Eastern and the Western regions in order to test if the greatest morphological difference is obtained in the comparison between pygmies and non-pygmies. Thirty three-dimensional (3D landmarks registered with Microscribe in four cranial samples (Western and Eastern pygmies and non-pygmies were obtained. Multivariate analysis (generalized Procrustes analysis, Mahalanobis distances, multivariate regression and complementary dimensions of size were evaluated with ANOVA and post hoc LSD. Results suggest that important cranial shape differentiation does occur between pygmies and non-pygmies but also between Eastern and Western populations and that size changes and allometries do not affect similarly Eastern and Western pygmies. Therefore, our findings raise serious doubt about the fact to consider African pygmies as a homogenous group in studies on skull morphology. Differences in cranial morphology among pygmies would suggest differentiation after divergence. Although not directly related to skull differentiation, the diversity among pygmies would probably suggest that the process responsible for reduced stature occurred after the split of the ancestors of modern Eastern and Western pygmies.

  15. Medicinal use of secretions (“the frog vaccine” from the kambô frog (Phyllomedusa bicolor by non-indigenous peoples in Rondônia, Brazil

    Directory of Open Access Journals (Sweden)

    Paulo Sérgio Bernarde

    2009-09-01

    Full Text Available Amphibians have pharmaceutically active skin secretions that protect against infections and predation. Some indigenous people in southwestern Amazonia use these secretions from P. bicolor for medicinal purposes. While the use of these secretions by indigenous people is relatively well-known, the use by non-indigenous peoples is very poorly studied. Here we describe the use of the “frog vaccine” by non-indigenous populations in the Brazilian state of Rondônia. Thirty-one people who had received this “vaccine” were interviewed. The use of this vaccine is not typical or habitual in this region, and the person who administers the vaccine must travel from another part of Amazonia. Users of the vaccine come from middle and upper social classes with reasonable levels of education (primary, secondary and university. Approximately half the people vaccinated felt that their health had improved after vaccination and if need be, they would take the vaccination again. Most of the people do not know the frog species from which the secretions are taken. While the people who use this treatment believe that it is good for any infirmity, the medicinal properties, if any, of the “frog vaccine” are under study and are still unknown.

  16. Frogs in the spotlight: a 16-year survey of native frogs and invasive toads on a floodplain in tropical Australia.

    Science.gov (United States)

    Brown, Gregory P; Shine, Richard

    2016-07-01

    Although widespread declines in anuran populations have attracted considerable concern, the stochastic demographics of these animals make it difficult to detect consistent trends against a background of spatial and temporal variation. To identify long-term trends, we need datasets gathered over long time periods, especially from tropical areas where anuran biodiversity is highest. We conducted road surveys of four anurans in the Australian wet-dry tropics on 4637 nights over a 16-year period. Our surveys spanned the arrival of invasive cane toads (Rhinella marina), allowing us to assess the invader's impact on native anuran populations. Our counts demonstrate abrupt and asynchronous shifts in abundance and species composition from one year to the next, not clearly linked to rainfall patterns. Typically, periods of decline in numbers of a species were limited to 1-2 years and were followed by 1- to 2-year periods of increase. No taxa showed consistent declines over time, although trajectories for some species showed significant perturbations coincident with the arrival of toads. None of the four focal frog species was less common at the end of the study than at the beginning, and three of the species reached peak abundances after toad arrival. Survey counts of cane toads increased rapidly during the initial stage of invasion but have subsequently declined and fluctuated. Distinguishing consistent declines versus stochastic fluctuations in anuran populations requires extensive time-series analysis, coupled with an understanding of the shifts expected under local climatic conditions. This is especially pertinent when assessing impacts of specific perturbations such as invasive species. PMID:27386087

  17. Chilled frogs are hot: hibernation and reproduction of the Endangered mountain yellow-legged frog Rana muscosa

    Science.gov (United States)

    Santana, Frank E.; Swaisgood, Ronald R.; Lemm, Jeffrey M.; Fisher, Robert N.; Clark, Rulon W.

    2015-01-01

    In the face of the sixth great extinction crisis, it is imperative to establish effective breeding protocols for amphibian conservation breeding programs. Captive efforts should not proceed by trial and error, nor should they jump prematurely to assisted reproduction techniques, which can be invasive, difficult, costly, and, at times, counterproductive. Instead, conservation practitioners should first look to nature for guidance, and replicate key conditions found in nature in the captive environment, according to the ecological and behavioral requirements of the species. We tested the effect of a natural hibernation regime on reproductive behaviors and body condition in the Endangered mountain yellow-legged frog Rana muscosa. Hibernation had a clear positive effect on reproductive behavior, manifesting in vocal advertisement signaling, female receptivity, amplexus, and oviposition. These behaviors are critical components of courtship that lead to successful reproduction. Our main finding was that captive R. muscosa require a hibernation period for successful reproduction, as only hibernated females produced eggs and only hibernated males successfully fertilized eggs. Although hibernation also resulted in a reduced body condition, the reduction appeared to be minimal with no associated mortality. The importance of hibernation for reproduction is not surprising, since it is a major component of the conditions that R. muscosa experiences in the wild. Other amphibian conservation breeding programs can also benefit from a scientific approach that tests the effect of natural ecological conditions on reproduction. This will ensure that captive colonies maximize their role in providing genetic reservoirs for assurance and reintroduction efforts.

  18. Institution Building for African Regionalism

    OpenAIRE

    Khadiagala, Gilbert M.

    2011-01-01

    Since the 1960s, African states have embraced regional integration as a vital mechanism for political cooperation and for pooling resources to overcome problems of small and fragmented economies. In building meaningful institutions for regionalism, however, Africans have faced the challenges of reconciling the diversities of culture, geography, and politics. As a result, African regional institutions are characterized by multiple and competing mandates and weak institutionalization. This stud...

  19. Optimization of the analysis by means of liquid chromatography of metabolites of the Uncaria Tomentosa plant (cat's claw) using the sequential simplex method

    International Nuclear Information System (INIS)

    A new method was developed for the analysis using liquid chromatography of the metabolites present in extracts of root bark of Uncaria Tomentosa (cat's claw) by applying the simplex sequential technique to determine the magnitude of the chromatographic variables; i.e. flow, temperature and stationary-phase composition, which allowed the optimizing the elusion time and the resolution of the chromatographic separation. The chromatographic analysis was performed in isocratic mode using a C12 (-urea) column of 15 cm in length and 4,6 mm of diameter and a UV detector. The magnitude of the chromatographic variables that optimized the separation turned out to be: flow of 1.80 mL/min, temperature of 27.5 centigrade and a mobile phase composition of 22:78 (Methanol: to butter). (Author)

  20. DISTRIBUTION AND HABITAT REQUIREMENTS OF THE WHITE-CLAWED CRAYFISH, AUSTROPOTAMOBIUS PALLIPES, IN A STREAM FROM THE PAYS DE LOIRE REGION, FRANCE: AN EXPERIMENTAL AND DESCRIPTIVE STUDY

    Directory of Open Access Journals (Sweden)

    BROQUET T.

    2002-07-01

    Full Text Available A population of white-clawed crayfish (Austropotamobius pallipes was studied from January to October 2000 in a stream from the Pays de Loire region (Western France. An experimental modification of habitat was performed in four stream sections by providing refuges for crayfish, followed by a regular survey of population dynamics in these areas. The crayfish distribution along the brook was studied in relation to several parameters, including water quality, current speed, brook depth and presence of refuges for crayfish. Presence of hiding places was the only habitat parameter correlated with crayfish distribution along the stream whereas colonization process in modified sections was determined by sun exposure and current speed conditions. Despite a presumably high growth rate and its ability to reach locally important densities, the population appeared to be fragmented.