WorldWideScience

Sample records for afm

  1. Dicty_cDB: AFM562 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM562 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...562Z 759 - - - - Show AFM562 Library AF (Link to library) Clone ID AFM562 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM5-C/AFM...562Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...562 (AFM562Q) /CSM/AF/AFM5-C/AFM562Q.Seq.d/ XXXXXXXXXXCAATAATTGATCTTCAGGGTATTAAATCATATTCA

  2. Dicty_cDB: AFM168 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM168 (Link to dictyBase) - - - - - (Link to Original site) AFM...168F 592 - - - - - - Show AFM168 Library AF (Link to library) Clone ID AFM168 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM1-C/AFM...168Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...168 (AFM168Q) /CSM/AF/AFM1-C/AFM168Q.Seq.d/ ATTAAACTTTTTGTCACATATATAATTAAATAAAATGTCAGAAAG

  3. Dicty_cDB: AFM842 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM842 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...842Z 358 - - - - Show AFM842 Library AF (Link to library) Clone ID AFM842 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM8-B/AFM...842Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...842 (AFM842Q) /CSM/AF/AFM8-B/AFM842Q.Seq.d/ XXXXXXXXXXTGTTGGTGCTGGTCGTGTTGAACAACTCGATACTA

  4. Dicty_cDB: AFM880 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM880 (Link to dictyBase) - - - - - (Link to Original site) AFM...880F 569 - - - - - - Show AFM880 Library AF (Link to library) Clone ID AFM880 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM8-D/AFM...880Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...880 (AFM880Q) /CSM/AF/AFM8-D/AFM880Q.Seq.d/ ACTTTTACTTAAATAATTTCCAAAATGTCAGAAACTACACCAGTT

  5. Dicty_cDB: AFM685 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM685 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...685Z 532 - - - - Show AFM685 Library AF (Link to library) Clone ID AFM685 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM6-D/AFM...685Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...685 (AFM685Q) /CSM/AF/AFM6-D/AFM685Q.Seq.d/ XXXXXXXXXXATCACCACAATCANCAATATCAACAACATCAACAA

  6. Dicty_cDB: AFM307 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM307 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...307Z 314 - - - - Show AFM307 Library AF (Link to library) Clone ID AFM307 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM3-A/AFM...307Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...307 (AFM307Q) /CSM/AF/AFM3-A/AFM307Q.Seq.d/ XXXXXXXXXXCGTCATGAAAGAAGATGCCATCGTTTGTAACATTG

  7. Dicty_cDB: AFM419 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM419 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...419Z 552 - - - - Show AFM419 Library AF (Link to library) Clone ID AFM419 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM4-A/AFM...419Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...419 (AFM419Q) /CSM/AF/AFM4-A/AFM419Q.Seq.d/ XXXXXXXXXXGTGAACAAAGAACTCACATCAGACATTACAGTTTA

  8. Dicty_cDB: AFM105 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM105 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...105Z 742 - - - - Show AFM105 Library AF (Link to library) Clone ID AFM105 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM1-A/AFM...105Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...105 (AFM105Q) /CSM/AF/AFM1-A/AFM105Q.Seq.d/ XXXXXXXXXXATCAATATAGTTTATAACTCAACCCAACGTTATGA

  9. Dicty_cDB: AFM447 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM447 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...447Z 647 - - - - Show AFM447 Library AF (Link to library) Clone ID AFM447 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM4-B/AFM...447Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...447 (AFM447Q) /CSM/AF/AFM4-B/AFM447Q.Seq.d/ XXXXXXXXXXATATGCTTAATAAACCAATTGAAAATATTGTTTTC

  10. Dicty_cDB: AFM246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM246 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...246Z 559 - - - - Show AFM246 Library AF (Link to library) Clone ID AFM246 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM2-B/AFM...246Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...246 (AFM246Q) /CSM/AF/AFM2-B/AFM246Q.Seq.d/ XXXXXXXXXXAGATTAAACAATTCATTCTTGATGAATGTGATACC

  11. Dicty_cDB: AFM360 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM360 (Link to dictyBase) - - - - - (Link to Original site) AFM...360F 630 - - - - - - Show AFM360 Library AF (Link to library) Clone ID AFM360 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM3-C/AFM...360Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...360 (AFM360Q) /CSM/AF/AFM3-C/AFM360Q.Seq.d/ ATCTATAGCTTTATATTAAAAAGATAATTTAAAAATGTTTAAAAG

  12. Dicty_cDB: AFM607 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM607 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...607Z 617 - - - - Show AFM607 Library AF (Link to library) Clone ID AFM607 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM6-A/AFM...607Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...607 (AFM607Q) /CSM/AF/AFM6-A/AFM607Q.Seq.d/ XXXXXXXXXXANNACAAGAAATAAANCAAGANCAATTGAGTCNAC

  13. Dicty_cDB: AFM692 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM692 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...692Z 739 - - - - Show AFM692 Library AF (Link to library) Clone ID AFM692 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM6-D/AFM...692Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...692 (AFM692Q) /CSM/AF/AFM6-D/AFM692Q.Seq.d/ XXXXXXXXXXATGGCAAAACAGTTGGGGTTTAACCACTCGTACCA

  14. Dicty_cDB: AFM818 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM818 (Link to dictyBase) - - - - - (Link to Original site) AFM...818F 156 - - - - - - Show AFM818 Library AF (Link to library) Clone ID AFM818 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM8-A/AFM...818Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...818 (AFM818Q) /CSM/AF/AFM8-A/AFM818Q.Seq.d/ GGAAGTTAGAGCAGCAGTAGTAGTAGTAGCAGTAGTAGTAGTTAG

  15. Dicty_cDB: AFM665 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM665 (Link to dictyBase) - - - - - (Link to Original site) AFM...665F 165 - - - - - - Show AFM665 Library AF (Link to library) Clone ID AFM665 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM6-C/AFM...665Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...665 (AFM665Q) /CSM/AF/AFM6-C/AFM665Q.Seq.d/ ATTTTCAATTTTTCTAATTTTTAATTTTTTTATATATATACATAA

  16. Dicty_cDB: AFM247 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM247 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...247Z 829 - - - - Show AFM247 Library AF (Link to library) Clone ID AFM247 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM2-B/AFM...247Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...247 (AFM247Q) /CSM/AF/AFM2-B/AFM247Q.Seq.d/ XXXXXXXXXXTCCCTTTAGTCCTANATAANAGGTGGTACCAATTT

  17. Dicty_cDB: AFM190 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM190 (Link to dictyBase) - - - - - (Link to Original site) AFM...190F 158 - - - - - - Show AFM190 Library AF (Link to library) Clone ID AFM190 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM1-D/AFM...190Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...190 (AFM190Q) /CSM/AF/AFM1-D/AFM190Q.Seq.d/ ATTCAAAAAAAAAAATATTAAATCATTGTAGTATTTTGTTCNTAT

  18. Dicty_cDB: AFM579 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM579 (Link to dictyBase) - - - - - (Link to Original site) AFM...579F 522 - - - - - - Show AFM579 Library AF (Link to library) Clone ID AFM579 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM5-D/AFM...579Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...579 (AFM579Q) /CSM/AF/AFM5-D/AFM579Q.Seq.d/ ATTCATCACCCTACAATTTAATTACATACATATATATATATAAAC

  19. Dicty_cDB: AFM321 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM321 (Link to dictyBase) - - - - - (Link to Original site) AFM...321F 684 - - - - - - Show AFM321 Library AF (Link to library) Clone ID AFM321 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM3-A/AFM...321Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...321 (AFM321Q) /CSM/AF/AFM3-A/AFM321Q.Seq.d/ AATTATAACAATTATTAAAAACAAAAAGATATTTTGTTTTTTCTT

  20. Dicty_cDB: AFM503 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM503 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...503Z 790 - - - - Show AFM503 Library AF (Link to library) Clone ID AFM503 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM5-A/AFM...503Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...503 (AFM503Q) /CSM/AF/AFM5-A/AFM503Q.Seq.d/ XXXXXXXXXXGGTAAGNCTNTTNCNTNGGAGGTGAAGGTAGGGGC

  1. Dicty_cDB: AFM361 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM361 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...361Z 702 - - - - Show AFM361 Library AF (Link to library) Clone ID AFM361 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM3-C/AFM...361Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...361 (AFM361Q) /CSM/AF/AFM3-C/AFM361Q.Seq.d/ XXXXXXXXXXAGTTATCAGATTCCTGTTTTGTTATCTCTTCAACT

  2. Dicty_cDB: AFM586 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM586 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...586Z 766 - - - - Show AFM586 Library AF (Link to library) Clone ID AFM586 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM5-D/AFM...586Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...586 (AFM586Q) /CSM/AF/AFM5-D/AFM586Q.Seq.d/ XXXXXXXXXXGTCGCTTCAGATCCATTATCAAATATCACCGAACC

  3. Dicty_cDB: AFM861 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM861 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...861Z 711 - - - - Show AFM861 Library AF (Link to library) Clone ID AFM861 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM8-C/AFM...861Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...861 (AFM861Q) /CSM/AF/AFM8-C/AFM861Q.Seq.d/ XXXXXXXXXXTCGAAGATGTAAAGAAAATCGCTACCTCACAAAAA

  4. Dicty_cDB: AFM279 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM279 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...279Z 657 - - - - Show AFM279 Library AF (Link to library) Clone ID AFM279 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM2-D/AFM...279Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...279 (AFM279Q) /CSM/AF/AFM2-D/AFM279Q.Seq.d/ XXXXXXXXXXTCCAAACTATGGAAGAATTAGTACTACCAACAAGA

  5. Dicty_cDB: AFM379 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM379 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...379Z 655 - - - - Show AFM379 Library AF (Link to library) Clone ID AFM379 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM3-D/AFM...379Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...379 (AFM379Q) /CSM/AF/AFM3-D/AFM379Q.Seq.d/ XXXXXXXXXXACGTGCCGTTGGTAATATTGTCACTGGTGAATCTA

  6. Dicty_cDB: AFM642 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM642 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...642Z 645 - - - - Show AFM642 Library AF (Link to library) Clone ID AFM642 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM6-B/AFM...642Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...642 (AFM642Q) /CSM/AF/AFM6-B/AFM642Q.Seq.d/ XXXXXXXXXXAATTATGTAAGAAATATAACTGTTTATTGATGGTT

  7. Dicty_cDB: AFM517 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM517 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...517Z 684 - - - - Show AFM517 Library AF (Link to library) Clone ID AFM517 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM5-A/AFM...517Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...517 (AFM517Q) /CSM/AF/AFM5-A/AFM517Q.Seq.d/ XXXXXXXXXXCTACCTCACAAAAAGGTAATGCCGTTTTCTGTTGG

  8. Dicty_cDB: AFM359 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM359 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...359Z 711 - - - - Show AFM359 Library AF (Link to library) Clone ID AFM359 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM3-C/AFM...359Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...359 (AFM359Q) /CSM/AF/AFM3-C/AFM359Q.Seq.d/ XXXXXXXXXXGATCCAGACGTTGAAAGAGATTTACTTGATATTTT

  9. Dicty_cDB: AFM446 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM446 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...446Z 724 - - - - Show AFM446 Library AF (Link to library) Clone ID AFM446 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM4-B/AFM...446Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...446 (AFM446Q) /CSM/AF/AFM4-B/AFM446Q.Seq.d/ XXXXXXXXXXCCATTAGATGCAAGAGGTGAAGTTGATGAATGTGC

  10. Dicty_cDB: AFM504 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM504 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...504Z 623 - - - - Show AFM504 Library AF (Link to library) Clone ID AFM504 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM5-A/AFM...504Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...504 (AFM504Q) /CSM/AF/AFM5-A/AFM504Q.Seq.d/ XXXXXXXXXXTGANCAAAATTTAGTTGATTGCTCTGGTCCAGAAG

  11. Dicty_cDB: AFM826 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM826 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...826Z 165 - - - - Show AFM826 Library AF (Link to library) Clone ID AFM826 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM8-B/AFM...826Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...826 (AFM826Q) /CSM/AF/AFM8-B/AFM826Q.Seq.d/ XXXXXXXXXXTAAATCAATTCCAGATTTATTGGAATTGGATCATC

  12. Dicty_cDB: AFM474 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM474 (Link to dictyBase) - - - - AFM474P (Link to Original site) AFM474F 537 AFM...474Z 755 AFM474P 1272 - - Show AFM474 Library AF (Link to library) Clone ID AFM474 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...4-D/AFM474Q.Seq.d/ Representative seq. ID AFM474P (Link to... Original site) Representative DNA sequence >AFM474 (AFM474Q) /CSM/AF/AFM4-D/AFM474Q.Seq.d/ CAACATGTTCAAAATT

  13. Dicty_cDB: AFM220 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM220 (Link to dictyBase) - - - - AFM220P (Link to Original site) AFM220F 634 AFM...220Z 697 AFM220P 1311 - - Show AFM220 Library AF (Link to library) Clone ID AFM220 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...2-A/AFM220Q.Seq.d/ Representative seq. ID AFM220P (Link to... Original site) Representative DNA sequence >AFM220 (AFM220Q) /CSM/AF/AFM2-A/AFM220Q.Seq.d/ ATTATTTTTTATTTTA

  14. Dicty_cDB: AFM802 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM802 (Link to dictyBase) - - - - AFM802P (Link to Original site) AFM802F 128 AFM...802Z 117 AFM802P 225 - - Show AFM802 Library AF (Link to library) Clone ID AFM802 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...8-A/AFM802Q.Seq.d/ Representative seq. ID AFM802P (Link to ...Original site) Representative DNA sequence >AFM802 (AFM802Q) /CSM/AF/AFM8-A/AFM802Q.Seq.d/ ATAAATATAAATAATAA

  15. Dicty_cDB: AFM325 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM325 (Link to dictyBase) - - - - AFM325P (Link to Original site) AFM325F 457 AFM...325Z 563 AFM325P 1000 - - Show AFM325 Library AF (Link to library) Clone ID AFM325 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...3-B/AFM325Q.Seq.d/ Representative seq. ID AFM325P (Link to... Original site) Representative DNA sequence >AFM325 (AFM325Q) /CSM/AF/AFM3-B/AFM325Q.Seq.d/ CAAAAAGTTTTTTCAC

  16. Dicty_cDB: AFM694 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM694 (Link to dictyBase) - - - - AFM694P (Link to Original site) AFM694F 596 AFM...694Z 387 AFM694P 963 - - Show AFM694 Library AF (Link to library) Clone ID AFM694 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-D/AFM694Q.Seq.d/ Representative seq. ID AFM694P (Link to ...Original site) Representative DNA sequence >AFM694 (AFM694Q) /CSM/AF/AFM6-D/AFM694Q.Seq.d/ AATTTATTTATTTATTC

  17. Dicty_cDB: AFM191 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM191 (Link to dictyBase) - - - - AFM191P (Link to Original site) AFM191F 623 AFM...191Z 747 AFM191P 1350 - - Show AFM191 Library AF (Link to library) Clone ID AFM191 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-D/AFM191Q.Seq.d/ Representative seq. ID AFM191P (Link to... Original site) Representative DNA sequence >AFM191 (AFM191Q) /CSM/AF/AFM1-D/AFM191Q.Seq.d/ ATTTTCTATTTTCTTT

  18. Dicty_cDB: AFM221 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM221 (Link to dictyBase) - - - - AFM221P (Link to Original site) AFM221F 624 AFM...221Z 732 AFM221P 1336 - - Show AFM221 Library AF (Link to library) Clone ID AFM221 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...2-A/AFM221Q.Seq.d/ Representative seq. ID AFM221P (Link to... Original site) Representative DNA sequence >AFM221 (AFM221Q) /CSM/AF/AFM2-A/AFM221Q.Seq.d/ ACACAACAATTTATAA

  19. Dicty_cDB: AFM744 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM744 (Link to dictyBase) - - - - AFM744P (Link to Original site) AFM744F 591 AFM...744Z 685 AFM744P 1256 - - Show AFM744 Library AF (Link to library) Clone ID AFM744 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...7-B/AFM744Q.Seq.d/ Representative seq. ID AFM744P (Link to... Original site) Representative DNA sequence >AFM744 (AFM744Q) /CSM/AF/AFM7-B/AFM744Q.Seq.d/ ATATATATAAAAAATG

  20. Dicty_cDB: AFM772 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM772 (Link to dictyBase) - - - - AFM772P (Link to Original site) AFM772F 609 AFM...772Z 754 AFM772P 1343 - - Show AFM772 Library AF (Link to library) Clone ID AFM772 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...7-C/AFM772Q.Seq.d/ Representative seq. ID AFM772P (Link to... Original site) Representative DNA sequence >AFM772 (AFM772Q) /CSM/AF/AFM7-C/AFM772Q.Seq.d/ ATTTAATAATACACAT

  1. Dicty_cDB: AFM628 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM628 (Link to dictyBase) - - - - AFM628P (Link to Original site) AFM628F 615 AFM...628Z 714 AFM628P 1309 - - Show AFM628 Library AF (Link to library) Clone ID AFM628 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-B/AFM628Q.Seq.d/ Representative seq. ID AFM628P (Link to... Original site) Representative DNA sequence >AFM628 (AFM628Q) /CSM/AF/AFM6-B/AFM628Q.Seq.d/ ACCCAAGTGAATTCAT

  2. Dicty_cDB: AFM173 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM173 (Link to dictyBase) - - - - AFM173P (Link to Original site) AFM173F 595 AFM...173Z 662 AFM173P 1237 - - Show AFM173 Library AF (Link to library) Clone ID AFM173 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-D/AFM173Q.Seq.d/ Representative seq. ID AFM173P (Link to... Original site) Representative DNA sequence >AFM173 (AFM173Q) /CSM/AF/AFM1-D/AFM173Q.Seq.d/ ATTTTCCAATTGATAA

  3. Dicty_cDB: AFM715 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM715 (Link to dictyBase) - - - - AFM715P (Link to Original site) AFM715F 169 AFM...715Z 265 AFM715P 414 - - Show AFM715 Library AF (Link to library) Clone ID AFM715 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...7-A/AFM715Q.Seq.d/ Representative seq. ID AFM715P (Link to ...Original site) Representative DNA sequence >AFM715 (AFM715Q) /CSM/AF/AFM7-A/AFM715Q.Seq.d/ AATTTATTTTTTTTCAT

  4. Dicty_cDB: AFM606 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM606 (Link to dictyBase) - - - - AFM606P (Link to Original site) AFM606F 607 AFM...606Z 742 AFM606P 1329 - - Show AFM606 Library AF (Link to library) Clone ID AFM606 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-A/AFM606Q.Seq.d/ Representative seq. ID AFM606P (Link to... Original site) Representative DNA sequence >AFM606 (AFM606Q) /CSM/AF/AFM6-A/AFM606Q.Seq.d/ AAGTTTAGAATTAGAA

  5. Dicty_cDB: AFM471 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM471 (Link to dictyBase) - - - - AFM471P (Link to Original site) AFM471F 537 AFM...471Z 694 AFM471P 1211 - - Show AFM471 Library AF (Link to library) Clone ID AFM471 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...4-C/AFM471Q.Seq.d/ Representative seq. ID AFM471P (Link to... Original site) Representative DNA sequence >AFM471 (AFM471Q) /CSM/AF/AFM4-C/AFM471Q.Seq.d/ ATATAAAAAATGGCAT

  6. Dicty_cDB: AFM174 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM174 (Link to dictyBase) - - - - AFM174P (Link to Original site) AFM174F 544 AFM...174Z 566 AFM174P 1090 - - Show AFM174 Library AF (Link to library) Clone ID AFM174 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-D/AFM174Q.Seq.d/ Representative seq. ID AFM174P (Link to... Original site) Representative DNA sequence >AFM174 (AFM174Q) /CSM/AF/AFM1-D/AFM174Q.Seq.d/ ATTCAATTTTGTAATT

  7. Dicty_cDB: AFM240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM240 (Link to dictyBase) - - - - AFM240P (Link to Original site) AFM240F 638 AFM...240Z 291 AFM240P 909 - - Show AFM240 Library AF (Link to library) Clone ID AFM240 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...2-B/AFM240Q.Seq.d/ Representative seq. ID AFM240P (Link to ...Original site) Representative DNA sequence >AFM240 (AFM240Q) /CSM/AF/AFM2-B/AFM240Q.Seq.d/ TATTAAAAAAATGTACT

  8. Dicty_cDB: AFM106 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM106 (Link to dictyBase) - - - - AFM106P (Link to Original site) AFM106F 527 AFM...106Z 527 AFM106P 1034 - - Show AFM106 Library AF (Link to library) Clone ID AFM106 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-A/AFM106Q.Seq.d/ Representative seq. ID AFM106P (Link to... Original site) Representative DNA sequence >AFM106 (AFM106Q) /CSM/AF/AFM1-A/AFM106Q.Seq.d/ AATTTTTTTTCTTTTC

  9. Dicty_cDB: AFM862 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM862 (Link to dictyBase) - - - - AFM862P (Link to Original site) AFM862F 837 AFM...862Z 612 AFM862P 1429 - - Show AFM862 Library AF (Link to library) Clone ID AFM862 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...8-C/AFM862Q.Seq.d/ Representative seq. ID AFM862P (Link to... Original site) Representative DNA sequence >AFM862 (AFM862Q) /CSM/AF/AFM8-C/AFM862Q.Seq.d/ AAGGTAGTGACAACAT

  10. Dicty_cDB: AFM536 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM536 (Link to dictyBase) - - - - AFM536P (Link to Original site) AFM536F 144 AFM...536Z 443 AFM536P 567 - - Show AFM536 Library AF (Link to library) Clone ID AFM536 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...5-B/AFM536Q.Seq.d/ Representative seq. ID AFM536P (Link to ...Original site) Representative DNA sequence >AFM536 (AFM536Q) /CSM/AF/AFM5-B/AFM536Q.Seq.d/ ATTTATTTATCTGTTTA

  11. Dicty_cDB: AFM659 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM659 (Link to dictyBase) - - - - AFM659P (Link to Original site) AFM659F 686 AFM...659Z 742 AFM659P 1408 - - Show AFM659 Library AF (Link to library) Clone ID AFM659 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-C/AFM659Q.Seq.d/ Representative seq. ID AFM659P (Link to... Original site) Representative DNA sequence >AFM659 (AFM659Q) /CSM/AF/AFM6-C/AFM659Q.Seq.d/ GTTAAAAAGGAAGTGA

  12. Dicty_cDB: AFM362 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM362 (Link to dictyBase) - - - - AFM362P (Link to Original site) AFM362F 524 AFM...362Z 752 AFM362P 1256 - - Show AFM362 Library AF (Link to library) Clone ID AFM362 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...3-C/AFM362Q.Seq.d/ Representative seq. ID AFM362P (Link to... Original site) Representative DNA sequence >AFM362 (AFM362Q) /CSM/AF/AFM3-C/AFM362Q.Seq.d/ TGGAATATTTTTTTTT

  13. Dicty_cDB: AFM283 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM283 (Link to dictyBase) - - - - AFM283P (Link to Original site) AFM283F 572 AFM...283Z 658 AFM283P 1210 - - Show AFM283 Library AF (Link to library) Clone ID AFM283 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...2-D/AFM283Q.Seq.d/ Representative seq. ID AFM283P (Link to... Original site) Representative DNA sequence >AFM283 (AFM283Q) /CSM/AF/AFM2-D/AFM283Q.Seq.d/ TTGCAATTGTTTCCCA

  14. Dicty_cDB: AFM817 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM817 (Link to dictyBase) - - - - AFM817P (Link to Original site) AFM817F 138 AFM...817Z 521 AFM817P 639 - - Show AFM817 Library AF (Link to library) Clone ID AFM817 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...8-A/AFM817Q.Seq.d/ Representative seq. ID AFM817P (Link to ...Original site) Representative DNA sequence >AFM817 (AFM817Q) /CSM/AF/AFM8-A/AFM817Q.Seq.d/ AATTATTTAGACCACAC

  15. Dicty_cDB: AFM691 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM691 (Link to dictyBase) - - - - AFM691P (Link to Original site) AFM691F 606 AFM...691Z 709 AFM691P 1295 - - Show AFM691 Library AF (Link to library) Clone ID AFM691 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-D/AFM691Q.Seq.d/ Representative seq. ID AFM691P (Link to... Original site) Representative DNA sequence >AFM691 (AFM691Q) /CSM/AF/AFM6-D/AFM691Q.Seq.d/ AATAATAATAATAATA

  16. Dicty_cDB: AFM166 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM166 (Link to dictyBase) - - - - AFM166P (Link to Original site) AFM166F 580 AFM...166Z 741 AFM166P 1301 - - Show AFM166 Library AF (Link to library) Clone ID AFM166 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-C/AFM166Q.Seq.d/ Representative seq. ID AFM166P (Link to... Original site) Representative DNA sequence >AFM166 (AFM166Q) /CSM/AF/AFM1-C/AFM166Q.Seq.d/ ATCACACATAAAAAAT

  17. Dicty_cDB: AFM747 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM747 (Link to dictyBase) - - - - AFM747P (Link to Original site) AFM747F 585 AFM...747Z 743 AFM747P 1308 - - Show AFM747 Library AF (Link to library) Clone ID AFM747 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...7-B/AFM747Q.Seq.d/ Representative seq. ID AFM747P (Link to... Original site) Representative DNA sequence >AFM747 (AFM747Q) /CSM/AF/AFM7-B/AFM747Q.Seq.d/ ATTTAGGTCCTATATT

  18. Dicty_cDB: AFM856 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM856 (Link to dictyBase) - - - - AFM856P (Link to Original site) AFM856F 505 AFM...856Z 554 AFM856P 1039 - - Show AFM856 Library AF (Link to library) Clone ID AFM856 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...8-C/AFM856Q.Seq.d/ Representative seq. ID AFM856P (Link to... Original site) Representative DNA sequence >AFM856 (AFM856Q) /CSM/AF/AFM8-C/AFM856Q.Seq.d/ ATTCAATTTTGTAATT

  19. Dicty_cDB: AFM712 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM712 (Link to dictyBase) - - - - AFM712P (Link to Original site) AFM712F 557 AFM...712Z 696 AFM712P 1233 - - Show AFM712 Library AF (Link to library) Clone ID AFM712 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...7-A/AFM712Q.Seq.d/ Representative seq. ID AFM712P (Link to... Original site) Representative DNA sequence >AFM712 (AFM712Q) /CSM/AF/AFM7-A/AFM712Q.Seq.d/ ATATCAGCAGCTAAAA

  20. Dicty_cDB: AFM103 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM103 (Link to dictyBase) - - - - AFM103P (Link to Original site) AFM103F 125 AFM...103Z 666 AFM103P 771 - - Show AFM103 Library AF (Link to library) Clone ID AFM103 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-A/AFM103Q.Seq.d/ Representative seq. ID AFM103P (Link to ...Original site) Representative DNA sequence >AFM103 (AFM103Q) /CSM/AF/AFM1-A/AFM103Q.Seq.d/ AATATTTTAGTTTTAGG

  1. Dicty_cDB: AFM683 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM683 (Link to dictyBase) - - - - AFM683P (Link to Original site) AFM683F 606 AFM...683Z 706 AFM683P 1292 - - Show AFM683 Library AF (Link to library) Clone ID AFM683 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-D/AFM683Q.Seq.d/ Representative seq. ID AFM683P (Link to... Original site) Representative DNA sequence >AFM683 (AFM683Q) /CSM/AF/AFM6-D/AFM683Q.Seq.d/ ATTCAATTTTGTAATT

  2. Dicty_cDB: AFM666 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM666 (Link to dictyBase) - - - - AFM666P (Link to Original site) AFM666F 624 AFM...666Z 657 AFM666P 1261 - - Show AFM666 Library AF (Link to library) Clone ID AFM666 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-C/AFM666Q.Seq.d/ Representative seq. ID AFM666P (Link to... Original site) Representative DNA sequence >AFM666 (AFM666Q) /CSM/AF/AFM6-C/AFM666Q.Seq.d/ ATAAAATATTTTAATA

  3. Dicty_cDB: AFM610 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM610 (Link to dictyBase) - - - - AFM610P (Link to Original site) AFM610F 134 AFM...610Z 234 AFM610P 348 - - Show AFM610 Library AF (Link to library) Clone ID AFM610 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-A/AFM610Q.Seq.d/ Representative seq. ID AFM610P (Link to ...Original site) Representative DNA sequence >AFM610 (AFM610Q) /CSM/AF/AFM6-A/AFM610Q.Seq.d/ ATTGTAGTATTTTGTTC

  4. Dicty_cDB: AFM843 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM843 (Link to dictyBase) - - - - AFM843P (Link to Original site) AFM843F 553 AFM...843Z 735 AFM843P 1268 - - Show AFM843 Library AF (Link to library) Clone ID AFM843 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...8-B/AFM843Q.Seq.d/ Representative seq. ID AFM843P (Link to... Original site) Representative DNA sequence >AFM843 (AFM843Q) /CSM/AF/AFM8-B/AFM843Q.Seq.d/ ATTAAACAACTCAAAA

  5. Dicty_cDB: AFM746 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM746 (Link to dictyBase) - - - - AFM746P (Link to Original site) AFM746F 621 AFM...746Z 733 AFM746P 1334 - - Show AFM746 Library AF (Link to library) Clone ID AFM746 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...7-B/AFM746Q.Seq.d/ Representative seq. ID AFM746P (Link to... Original site) Representative DNA sequence >AFM746 (AFM746Q) /CSM/AF/AFM7-B/AFM746Q.Seq.d/ ATTTACAGTTACTGAA

  6. Dicty_cDB: AFM825 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM825 (Link to dictyBase) - - - - AFM825P (Link to Original site) AFM825F 551 AFM...825Z 684 AFM825P 1215 - - Show AFM825 Library AF (Link to library) Clone ID AFM825 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...8-B/AFM825Q.Seq.d/ Representative seq. ID AFM825P (Link to... Original site) Representative DNA sequence >AFM825 (AFM825Q) /CSM/AF/AFM8-B/AFM825Q.Seq.d/ AACTAAATTAAATAAA

  7. Dicty_cDB: AFM520 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM520 (Link to dictyBase) - - - - AFM520P (Link to Original site) AFM520F 612 AFM...520Z 731 AFM520P 1323 - - Show AFM520 Library AF (Link to library) Clone ID AFM520 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...5-A/AFM520Q.Seq.d/ Representative seq. ID AFM520P (Link to... Original site) Representative DNA sequence >AFM520 (AFM520Q) /CSM/AF/AFM5-A/AFM520Q.Seq.d/ ATTCATTCAATTTTGT

  8. Dicty_cDB: AFM627 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM627 (Link to dictyBase) - - - - AFM627P (Link to Original site) AFM627F 484 AFM...627Z 523 AFM627P 987 - - Show AFM627 Library AF (Link to library) Clone ID AFM627 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-B/AFM627Q.Seq.d/ Representative seq. ID AFM627P (Link to ...Original site) Representative DNA sequence >AFM627 (AFM627Q) /CSM/AF/AFM6-B/AFM627Q.Seq.d/ TNTGGNCAAGGTTGTAG

  9. Dicty_cDB: AFM133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM133 (Link to dictyBase) - - - - AFM133P (Link to Original site) AFM133F 638 AFM...133Z 647 AFM133P 1265 - - Show AFM133 Library AF (Link to library) Clone ID AFM133 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-B/AFM133Q.Seq.d/ Representative seq. ID AFM133P (Link to... Original site) Representative DNA sequence >AFM133 (AFM133Q) /CSM/AF/AFM1-B/AFM133Q.Seq.d/ AAAACATCTCTATTTT

  10. Dicty_cDB: AFM426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM426 (Link to dictyBase) - - - - AFM426P (Link to Original site) AFM426F 579 AFM...426Z 658 AFM426P 1217 - - Show AFM426 Library AF (Link to library) Clone ID AFM426 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...4-B/AFM426Q.Seq.d/ Representative seq. ID AFM426P (Link to... Original site) Representative DNA sequence >AFM426 (AFM426Q) /CSM/AF/AFM4-B/AFM426Q.Seq.d/ GAAAAATAAATTTATT

  11. Dicty_cDB: AFM537 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM537 (Link to dictyBase) - - - - AFM537P (Link to Original site) AFM537F 220 AFM...537Z 668 AFM537P 868 - - Show AFM537 Library AF (Link to library) Clone ID AFM537 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...5-B/AFM537Q.Seq.d/ Representative seq. ID AFM537P (Link to ...Original site) Representative DNA sequence >AFM537 (AFM537Q) /CSM/AF/AFM5-B/AFM537Q.Seq.d/ ATTAAATTCCATCATTG

  12. Dicty_cDB: AFM134 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM134 (Link to dictyBase) - - - - AFM134P (Link to Original site) AFM134F 542 AFM...134Z 759 AFM134P 1281 - - Show AFM134 Library AF (Link to library) Clone ID AFM134 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-B/AFM134Q.Seq.d/ Representative seq. ID AFM134P (Link to... Original site) Representative DNA sequence >AFM134 (AFM134Q) /CSM/AF/AFM1-B/AFM134Q.Seq.d/ AATTTTATTTTTAATC

  13. Dicty_cDB: AFM881 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM881 (Link to dictyBase) - - - - AFM881P (Link to Original site) AFM881F 604 AFM...881Z 557 AFM881P 1141 - - Show AFM881 Library AF (Link to library) Clone ID AFM881 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...8-D/AFM881Q.Seq.d/ Representative seq. ID AFM881P (Link to... Original site) Representative DNA sequence >AFM881 (AFM881Q) /CSM/AF/AFM8-D/AFM881Q.Seq.d/ ATTTTCTCCATCATCA

  14. Dicty_cDB: AFM713 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM713 (Link to dictyBase) - - - - AFM713P (Link to Original site) AFM713F 511 AFM...713Z 676 AFM713P 1167 - - Show AFM713 Library AF (Link to library) Clone ID AFM713 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...7-A/AFM713Q.Seq.d/ Representative seq. ID AFM713P (Link to... Original site) Representative DNA sequence >AFM713 (AFM713Q) /CSM/AF/AFM7-A/AFM713Q.Seq.d/ TCAATATTGCGAGACG

  15. Dicty_cDB: AFM453 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM453 (Link to dictyBase) - - - - AFM453P (Link to Original site) AFM453F 422 AFM...453Z 720 AFM453P 1122 - - Show AFM453 Library AF (Link to library) Clone ID AFM453 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...4-C/AFM453Q.Seq.d/ Representative seq. ID AFM453P (Link to... Original site) Representative DNA sequence >AFM453 (AFM453Q) /CSM/AF/AFM4-C/AFM453Q.Seq.d/ AAATTAAAAAAATAAA

  16. Dicty_cDB: AFM148 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM148 (Link to dictyBase) - - - - AFM148P (Link to Original site) AFM148F 586 AFM...148Z 765 AFM148P 1331 - - Show AFM148 Library AF (Link to library) Clone ID AFM148 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-B/AFM148Q.Seq.d/ Representative seq. ID AFM148P (Link to... Original site) Representative DNA sequence >AFM148 (AFM148Q) /CSM/AF/AFM1-B/AFM148Q.Seq.d/ AAATTAATTTTGTGTG

  17. Dicty_cDB: AFM472 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM472 (Link to dictyBase) - - - - AFM472P (Link to Original site) AFM472F 693 AFM...472Z 695 AFM472P 1368 - - Show AFM472 Library AF (Link to library) Clone ID AFM472 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...4-C/AFM472Q.Seq.d/ Representative seq. ID AFM472P (Link to... Original site) Representative DNA sequence >AFM472 (AFM472Q) /CSM/AF/AFM4-C/AFM472Q.Seq.d/ ATTTCAAGTTTAACTA

  18. Dicty_cDB: AFM686 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM686 (Link to dictyBase) - - - - AFM686P (Link to Original site) AFM686F 655 AFM...686Z 688 AFM686P 1323 - - Show AFM686 Library AF (Link to library) Clone ID AFM686 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-D/AFM686Q.Seq.d/ Representative seq. ID AFM686P (Link to... Original site) Representative DNA sequence >AFM686 (AFM686Q) /CSM/AF/AFM6-D/AFM686Q.Seq.d/ ACACCTTATTTATTAT

  19. Dicty_cDB: AFM815 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM815 (Link to dictyBase) - - - - AFM815P (Link to Original site) AFM815F 649 AFM...815Z 685 AFM815P 1314 - - Show AFM815 Library AF (Link to library) Clone ID AFM815 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...8-A/AFM815Q.Seq.d/ Representative seq. ID AFM815P (Link to... Original site) Representative DNA sequence >AFM815 (AFM815Q) /CSM/AF/AFM8-A/AFM815Q.Seq.d/ AAACACACTAACACAT

  20. Dicty_cDB: AFM425 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM425 (Link to dictyBase) - - - - AFM425P (Link to Original site) AFM425F 539 AFM...425Z 724 AFM425P 1243 - - Show AFM425 Library AF (Link to library) Clone ID AFM425 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...4-B/AFM425Q.Seq.d/ Representative seq. ID AFM425P (Link to... Original site) Representative DNA sequence >AFM425 (AFM425Q) /CSM/AF/AFM4-B/AFM425Q.Seq.d/ AAAAAAATAATGATCA

  1. Dicty_cDB: AFM388 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM388 (Link to dictyBase) - - - - AFM388P (Link to Original site) AFM388F 137 AFM...388Z 260 AFM388P 377 - - Show AFM388 Library AF (Link to library) Clone ID AFM388 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...3-D/AFM388Q.Seq.d/ Representative seq. ID AFM388P (Link to ...Original site) Representative DNA sequence >AFM388 (AFM388Q) /CSM/AF/AFM3-D/AFM388Q.Seq.d/ ATTTTTTTTTTCCTAAC

  2. Dicty_cDB: AFM855 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM855 (Link to dictyBase) - - - - AFM855P (Link to Original site) AFM855F 541 AFM...855Z 649 AFM855P 1170 - - Show AFM855 Library AF (Link to library) Clone ID AFM855 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...8-C/AFM855Q.Seq.d/ Representative seq. ID AFM855P (Link to... Original site) Representative DNA sequence >AFM855 (AFM855Q) /CSM/AF/AFM8-C/AFM855Q.Seq.d/ ANATTAAAAGTTAACT

  3. Dicty_cDB: AFM609 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM609 (Link to dictyBase) - - - - AFM609P (Link to Original site) AFM609F 641 AFM...609Z 705 AFM609P 1326 - - Show AFM609 Library AF (Link to library) Clone ID AFM609 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-A/AFM609Q.Seq.d/ Representative seq. ID AFM609P (Link to... Original site) Representative DNA sequence >AFM609 (AFM609Q) /CSM/AF/AFM6-A/AFM609Q.Seq.d/ CAGATGTAATACCAAC

  4. Dicty_cDB: AFM558 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM558 (Link to dictyBase) - - - - AFM558P (Link to Original site) AFM558F 578 AFM...558Z 737 AFM558P 1295 - - Show AFM558 Library AF (Link to library) Clone ID AFM558 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...5-C/AFM558Q.Seq.d/ Representative seq. ID AFM558P (Link to... Original site) Representative DNA sequence >AFM558 (AFM558Q) /CSM/AF/AFM5-C/AFM558Q.Seq.d/ GCATATACATATACAT

  5. Dicty_cDB: AFM252 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM252 (Link to dictyBase) - - - - AFM252P (Link to Original site) AFM252F 544 AFM...252Z 683 AFM252P 1207 - - Show AFM252 Library AF (Link to library) Clone ID AFM252 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...2-C/AFM252Q.Seq.d/ Representative seq. ID AFM252P (Link to... Original site) Representative DNA sequence >AFM252 (AFM252Q) /CSM/AF/AFM2-C/AFM252Q.Seq.d/ AAAAAAATGCAAGATA

  6. Dicty_cDB: AFM118 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM118 (Link to dictyBase) - - - - AFM118P (Link to Original site) AFM118F 573 AFM...118Z 730 AFM118P 1283 - - Show AFM118 Library AF (Link to library) Clone ID AFM118 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-A/AFM118Q.Seq.d/ Representative seq. ID AFM118P (Link to... Original site) Representative DNA sequence >AFM118 (AFM118Q) /CSM/AF/AFM1-A/AFM118Q.Seq.d/ AACCAAATCAAGAAAA

  7. Dicty_cDB: AFM452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM452 (Link to dictyBase) - - - - AFM452P (Link to Original site) AFM452F 126 AFM...452Z 412 AFM452P 518 - - Show AFM452 Library AF (Link to library) Clone ID AFM452 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...4-C/AFM452Q.Seq.d/ Representative seq. ID AFM452P (Link to ...Original site) Representative DNA sequence >AFM452 (AFM452Q) /CSM/AF/AFM4-C/AFM452Q.Seq.d/ AATAAACAATCAAATAA

  8. Dicty_cDB: AFM302 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM302 (Link to dictyBase) - - - - AFM302P (Link to Original site) AFM302F 518 AFM...302Z 768 AFM302P 1266 - - Show AFM302 Library AF (Link to library) Clone ID AFM302 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...3-A/AFM302Q.Seq.d/ Representative seq. ID AFM302P (Link to... Original site) Representative DNA sequence >AFM302 (AFM302Q) /CSM/AF/AFM3-A/AFM302Q.Seq.d/ AATTGATAAAATTAAA

  9. Dicty_cDB: AFM794 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM794 (Link to dictyBase) - - - - AFM794P (Link to Original site) AFM794F 623 AFM...794Z 698 AFM794P 1301 - - Show AFM794 Library AF (Link to library) Clone ID AFM794 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...7-D/AFM794Q.Seq.d/ Representative seq. ID AFM794P (Link to... Original site) Representative DNA sequence >AFM794 (AFM794Q) /CSM/AF/AFM7-D/AFM794Q.Seq.d/ TAATAATAATTATTAT

  10. Dicty_cDB: AFM380 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM380 (Link to dictyBase) - - - - AFM380P (Link to Original site) AFM380F 573 AFM...380Z 180 AFM380P 733 - - Show AFM380 Library AF (Link to library) Clone ID AFM380 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...3-D/AFM380Q.Seq.d/ Representative seq. ID AFM380P (Link to ...Original site) Representative DNA sequence >AFM380 (AFM380Q) /CSM/AF/AFM3-D/AFM380Q.Seq.d/ AAAATTATTTCCCACCC

  11. Dicty_cDB: AFM386 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM386 (Link to dictyBase) - - - - AFM386P (Link to Original site) AFM386F 618 AFM...386Z 757 AFM386P 1355 - - Show AFM386 Library AF (Link to library) Clone ID AFM386 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...3-D/AFM386Q.Seq.d/ Representative seq. ID AFM386P (Link to... Original site) Representative DNA sequence >AFM386 (AFM386Q) /CSM/AF/AFM3-D/AFM386Q.Seq.d/ AGAACTGTTACAGCAG

  12. Dicty_cDB: AFM585 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM585 (Link to dictyBase) - - - - AFM585P (Link to Original site) AFM585F 600 AFM...585Z 768 AFM585P 1348 - - Show AFM585 Library AF (Link to library) Clone ID AFM585 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...5-D/AFM585Q.Seq.d/ Representative seq. ID AFM585P (Link to... Original site) Representative DNA sequence >AFM585 (AFM585Q) /CSM/AF/AFM5-D/AFM585Q.Seq.d/ AATTTTGTAATTATAA

  13. Dicty_cDB: AFM578 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM578 (Link to dictyBase) - - - - AFM578P (Link to Original site) AFM578F 727 AFM...578Z 447 AFM578P 1154 - - Show AFM578 Library AF (Link to library) Clone ID AFM578 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...5-D/AFM578Q.Seq.d/ Representative seq. ID AFM578P (Link to... Original site) Representative DNA sequence >AFM578 (AFM578Q) /CSM/AF/AFM5-D/AFM578Q.Seq.d/ ATCGCCTCACTTTTTA

  14. Dicty_cDB: AFM377 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM377 (Link to dictyBase) - - - - AFM377P (Link to Original site) AFM377F 559 AFM...377Z 215 AFM377P 754 - - Show AFM377 Library AF (Link to library) Clone ID AFM377 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...3-D/AFM377Q.Seq.d/ Representative seq. ID AFM377P (Link to ...Original site) Representative DNA sequence >AFM377 (AFM377Q) /CSM/AF/AFM3-D/AFM377Q.Seq.d/ ATATAAAAAATGGCATC

  15. Dicty_cDB: AFM409 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM409 (Link to dictyBase) - - - - AFM409P (Link to Original site) AFM409F 553 AFM...409Z 724 AFM409P 1257 - - Show AFM409 Library AF (Link to library) Clone ID AFM409 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...4-A/AFM409Q.Seq.d/ Representative seq. ID AFM409P (Link to... Original site) Representative DNA sequence >AFM409 (AFM409Q) /CSM/AF/AFM4-A/AFM409Q.Seq.d/ ATTTTGTATTATATAT

  16. Dicty_cDB: AFM241 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM241 (Link to dictyBase) - - - - AFM241P (Link to Original site) AFM241F 620 AFM...241Z 717 AFM241P 1317 - - Show AFM241 Library AF (Link to library) Clone ID AFM241 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...2-B/AFM241Q.Seq.d/ Representative seq. ID AFM241P (Link to... Original site) Representative DNA sequence >AFM241 (AFM241Q) /CSM/AF/AFM2-B/AFM241Q.Seq.d/ ATTGTCATAATAATAT

  17. Dicty_cDB: AFM194 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM194 (Link to dictyBase) - - - - AFM194P (Link to Original site) AFM194F 623 AFM...194Z 703 AFM194P 1306 - - Show AFM194 Library AF (Link to library) Clone ID AFM194 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-D/AFM194Q.Seq.d/ Representative seq. ID AFM194P (Link to... Original site) Representative DNA sequence >AFM194 (AFM194Q) /CSM/AF/AFM1-D/AFM194Q.Seq.d/ ATTTTATAATCACTGT

  18. Dicty_cDB: AFM771 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM771 (Link to dictyBase) - - - - AFM771P (Link to Original site) AFM771F 695 AFM...771Z 862 AFM771P 1537 - - Show AFM771 Library AF (Link to library) Clone ID AFM771 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...7-C/AFM771Q.Seq.d/ Representative seq. ID AFM771P (Link to... Original site) Representative DNA sequence >AFM771 (AFM771Q) /CSM/AF/AFM7-C/AFM771Q.Seq.d/ GAGGGCAACGGGATAT

  19. Dicty_cDB: AFM643 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM643 (Link to dictyBase) - - - - AFM643P (Link to Original site) AFM643F 581 AFM...643Z 599 AFM643P 1160 - - Show AFM643 Library AF (Link to library) Clone ID AFM643 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...6-B/AFM643Q.Seq.d/ Representative seq. ID AFM643P (Link to... Original site) Representative DNA sequence >AFM643 (AFM643Q) /CSM/AF/AFM6-B/AFM643Q.Seq.d/ ATAGTAATTATTTTTT

  20. Single ricin detection by AFM chemomechanical mapping

    Science.gov (United States)

    This research reports a method of detecting ricin molecules immobilized on chemically modified gold (Au;111) surface by chemomechanically mapping the molecular interactions with a chemically modified Atomic Force Microscope (AFM) tip. AFM images resolved the different fold-up conformations of single...

  1. Surface analysis with STM and AFM

    CERN Document Server

    Magonov, Sergi N

    1996-01-01

    Scanning tunneling microscopy (STM) and atomic force microscopy (AFM) are powerful tools for surface examination. In the past, many STM and AFM studies led to erroneous conclusions due to lack of proper theoretical considerations and of an understanding of how image patterns are affected by measurement conditions. For this book, two world experts, one on theoretical analysis and the other on experimental characterization, have joined forces to bring together essential components of STM and AFM studies: The practical aspects of STM, the image simulation by surface electron density plot calculat

  2. An AFM Observation on Fossil Cytoplasm

    Institute of Scientific and Technical Information of China (English)

    WANG Xin; YU Junping; FANG Xiaohong

    2008-01-01

    Fossil cytoplasm is a new research topic of interest in paleobotany. Atomic force microscope (AFM) is a new technology applied widely in physics and biology; however, it is rarely used in paleontology. Here we applied AFM for the first time to study fossil cytoplasm. The results indicate that the fossil cytoplasm is heterogeneous and full of ultrastructures, just like extant cytoplasm, and that the application of AFM, especially in combination with other techniques, can reveal the subcellular details of fossil plants with more confidence.

  3. Robust Repetitive Controller for Fast AFM Imaging

    CERN Document Server

    Necipoglu, Serkan; Has, Yunus; Guvenc, Levent; Basdogan, Cagatay

    2012-01-01

    Currently, Atomic Force Microscopy (AFM) is the most preferred Scanning Probe Microscopy (SPM) method due to its numerous advantages. However, increasing the scanning speed and reducing the interaction forces between the probe's tip and the sample surface are still the two main challenges in AFM. To meet these challenges, we take advantage of the fact that the lateral movements performed during an AFM scan is a repetitive motion and propose a Repetitive Controller (RC) for the z-axis movements of the piezo-scanner. The RC utilizes the profile of the previous scan line while scanning the current line to achieve a better scan performance. The results of the scanning experiments performed with our AFM set-up show that the proposed RC significantly outperforms a conventional PI controller that is typically used for the same task. The scan error and the average tapping forces are reduced by 66% and 58%, respectively when the scan speed is increased by 7-fold.

  4. Reconstruction Algorithms in Undersampled AFM Imaging

    DEFF Research Database (Denmark)

    Arildsen, Thomas; Oxvig, Christian Schou; Pedersen, Patrick Steffen;

    2016-01-01

    This paper provides a study of spatial undersampling in atomic force microscopy (AFM) imaging followed by different image reconstruction techniques based on sparse approximation as well as interpolation. The main reasons for using undersampling is that it reduces the path length and thereby the s...

  5. AFM-CMM integrated instrument user manual

    DEFF Research Database (Denmark)

    Marinello, Francesco; Bariani, Paolo

    This manual gives general important guidelines for a proper use of the integrated AFM-CMM instrument. More information can be collected reading: • N. Kofod Ph.D thesis [1]; • P. Bariani Ph.D thesis [2]; • Dualscope DME 95-200 operation manuals [3]; • SPIP help [4] • Stitching software user manual...

  6. Dicty_cDB: AFM873 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available uences producing significant alignments: (bits) Value AFM873 (AFM873Q) /CSM/AF/AFM8-D/AFM873Q.Seq.d/ 258 2e-...49 own update 2009. 4. 3 Homology vs DNA Score E Sequences producing significant alignments: (bits) Value... update 2009. 4.15 Homology vs Protein Score E Sequences producing significant alignments: (bits) Value ( P5

  7. A microfluidic AFM cantilever based dispensing and aspiration platform

    NARCIS (Netherlands)

    Van Oorschot, R.; Perez Garza, H.H.; Derks, R.J.S.; Staufer, U.; Ghatkesar, M.K.

    2015-01-01

    We present the development of a microfluidic AFM (atomic force microscope) cantilever-based platform to enable the local dispensing and aspiration of liquid with volumes in the pico-to-femtoliter range. The platform consists of a basic AFM measurement system, microfluidic AFM chip, fluidic interface

  8. [AFM fishing of proteins under impulse electric field].

    Science.gov (United States)

    Ivanov, Yu D; Pleshakova, T O; Malsagova, K A; Kaysheva, A L; Kopylov, A T; Izotov, A A; Tatur, V Yu; Vesnin, S G; Ivanova, N D; Ziborov, V S; Archakov, A I

    2016-05-01

    A combination of (atomic force microscopy)-based fishing (AFM-fishing) and mass spectrometry allows to capture protein molecules from solutions, concentrate and visualize them on an atomically flat surface of the AFM chip and identify by subsequent mass spectrometric analysis. In order to increase the AFM-fishing efficiency we have applied pulsed voltage with the rise time of the front of about 1 ns to the AFM chip. The AFM-chip was made using a conductive material, highly oriented pyrolytic graphite (HOPG). The increased efficiency of AFM-fishing has been demonstrated using detection of cytochrome b5 protein. Selection of the stimulating pulse with a rise time of 1 ns, corresponding to the GHz frequency range, by the effect of intrinsic emission from water observed in this frequency range during water injection into the cell. PMID:27562998

  9. AFM 4.0: a toolbox for DNA microarray analysis

    OpenAIRE

    Breitkreutz, Bobby-Joe; Jorgensen, Paul; Breitkreutz, Ashton; Tyers, Mike

    2001-01-01

    We have developed a series of programs, collectively packaged as Array File Maker 4.0 (AFM), that manipulate and manage DNA microarray data. AFM 4.0 is simple to use, applicable to any organism or microarray, and operates within the familiar confines of Microsoft Excel. Given a database of expression ratios, AFM 4.0 generates input files for clustering, helps prepare colored figures and Venn diagrams, and can uncover aneuploidy in yeast microarray data. AFM 4.0 should be especially useful to ...

  10. Mapping of enzyme activity by detection of enzymatic products during AFM imaging with integrated SECM-AFM probes

    Energy Technology Data Exchange (ETDEWEB)

    Kranz, C.; Kueng, A; Lugstein, A.; Bertagnolli, E.; Mizaikoff, B

    2004-08-15

    With the integration of submicro- and nanoelectrodes into atomic force microscopy (AFM) probes using microfabrication techniques, an elegant approach combining scanning electrochemical microscopy (SECM) with AFM has recently been introduced. Simultaneous contact mode imaging of a micropatterned sample with immobilized enzyme spots and imaging of enzyme activity is shown. In contrast to force spectroscopy the conversion of an enzymatic byproduct is directly detected during AFM imaging and correlated to the activity of the enzyme.

  11. Spin-3/2 Ising model AFM/AFM two-layer lattice with crystal field

    Institute of Scientific and Technical Information of China (English)

    Erhan Albayrak; Ali Yigit

    2009-01-01

    The spin-3/2 Ising model is investigated for the case of antiferromagnetic (AFM/AFM) interactions on the two-layer Bethe lattice by using the exact recursion relations in the pairwise approach for given coordination numbers q = 3, 4 and 6 when the layers are under the influences of equal external magnetic and equal crystal fields. The ground state, (GS) phase diagrams are obtained on the different planes in detail and then the temperature-dependent phase diagrams of the system are calculated accordingly. It is observed that the system presents both second- and first-order phase transitions for all q, therefore, tricritical points. It is also found that the system exhibits double-critical end points and isolated points. The model aiso presents two Néel temperatures, T_N, and the existence of which leads to the reentrant behaviour.

  12. Simultaneous AFM nano-patterning and imaging for photomask repair

    NARCIS (Netherlands)

    Keyvani, A.; Tamer, M.S.; Es, M.H. van; Sadeghian Marnani, H.

    2016-01-01

    In this paper we present a new AFM based nano-patterning technique that can be used for fast defect repairing of high resolution photomasks and possibly other high-speed nano-patterning applications. The proposed method works based on hammering the sample with tapping mode AFM followed by wet cleani

  13. Structure Assisted Compressed Sensing Reconstruction of Undersampled AFM Images

    DEFF Research Database (Denmark)

    Oxvig, Christian Schou; Arildsen, Thomas; Larsen, Torben

    2017-01-01

    The use of compressed sensing in atomic force microscopy (AFM) can potentially speed-up image acquisition, lower probe-specimen interaction, or enable super resolution imaging. The idea in compressed sensing for AFM is to spatially undersample the specimen, i.e. only acquire a small fraction...

  14. Helium ion beam induced growth of hammerhead AFM probes

    NARCIS (Netherlands)

    Nanda, G.; Van Veldhoven, E.; Maas, D.; Sadeghian, H.; Alkemade, P.F.A.

    2015-01-01

    The authors report the direct-write growth of hammerhead atomic force microscope(AFM) probes by He+beam induced deposition of platinum-carbon. In order to grow a thin nanoneedle on top of a conventional AFM probe, the authors move a focused He+beam during exposure to a PtC precursor gas. In the fina

  15. Helium ion beam induced growth of hammerhead AFM probes

    NARCIS (Netherlands)

    Nanda, G.; Veldhoven, E. van; Maas, D.J.; Sadeghian Marnani, H.; Alkemade, P.F.A.

    2015-01-01

    The authors report the direct-write growth of hammerhead atomic force microscope (AFM) probes by He+ beam induced deposition of platinum-carbon. In order to grow a thin nanoneedle on top of a conventional AFM probe, the authors move a focused He+ beam during exposure to a PtC precursor gas. In the f

  16. Fabrication and analysis of cylindrical resin AFM microcantilevers

    Energy Technology Data Exchange (ETDEWEB)

    Cheneler, D., E-mail: D.Cheneler@bham.ac.uk [School of Mechanical Engineering, The University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Bowen, J. [School of Chemical Engineering, The University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Leigh, S.J.; Purssell, C.P.; Billson, D.R.; Hutchins, D.A. [School of Engineering, University of Warwick, Coventry CV4 7AL (United Kingdom); Ward, M.C.L. [School of Mechanical Engineering, The University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom)

    2011-07-15

    In this paper a new method of fabricating cylindrical resin microcantilevers using the Direct Digital Manufacturing (DDM) technique of Micro-stereolithography (MSL) is described. The method is rapid and commercially viable, allowing the fabrication of atomic force microscope (AFM) cantilevers which exhibit much larger spring constants than those currently commercial available. This allows for experimentation in a force regime orders of magnitude higher than currently possible using the AFM. This makes these cantilevers ideally suited for AFM-based depth sensing indentation. Due to their geometry, the assumptions used in the standard Euler-Bernoulli beam theory usually used to analyse AFM cantilevers may no longer be valid. Therefore approximate analytical solutions based on Timoshenko beam theory have been derived for the stiffness and resonant frequency of these cantilevers. Prototypes of the cantilevers have been fabricated and tested. Results show good agreement between experiment and theory. -- Highlights: {yields} Direct Digital Manufacturing (DDM) has been used to make commercially viable AFM cantilevers. {yields} Analytical expressions for resonant frequency of Timoshenko beams has been derived. {yields} Dynamics of cylindrical AFM cantilevers has been discussed. {yields} Expressions for dynamic properties of conical AFM cantilevers has been derived. {yields} Effect of metallisation of cylindrical AFM cantilevers has been discussed.

  17. Microrheology using a custom-made AFM

    Science.gov (United States)

    Kosgodagan Acharige, Sebastien; Benzaquen, Michael; Steinberger, Audrey

    In the past few years, a new method was developed to measure local properties of liquids (X. Xiong et al., Phys. Rev. E 80, 2009). This method consists of gluing a micron-sized glass fiber at the tip of an AFM cantilever and probing the liquid with it. In ENS Lyon, this method was perfected (C. Devailly et al., EPL, 106 5, 2014) with the help of an interferometer developped in the same laboratory (L. Bellon et al., Opt. Commun. 207 49, 2002 and P. Paolino et al., Rev. Sci. Instrum. 84, 2013), which background noise can reach 10-14 m /√{ Hz } . This method allows us to measure a wide range of viscosities (1 mPa . s to 500 mPa . s) of transparent and opaque fluids using a small sample volume ( 5 mL). In this presentation, I will briefly describe the interferometer developped in ENS Lyon, then explain precisely the microrheology measurements and then compare the experimental results to a model developped by M. Benzaquen. This work is supported financially by the ANR project NANOFLUIDYN (Grant Number ANR-13-BS10-0009).

  18. Nonlinear Dynamical analysis of an AFM tapping mode microcantilever beam

    Directory of Open Access Journals (Sweden)

    Choura S.

    2012-07-01

    Full Text Available We focus in this paper on the modeling and dynamical analysis of a tapping mode atomic force microscopy (AFM microcantilever beam. This latter is subjected to a harmonic excitation of its base displacement and to Van der Waals and DMT contact forces at its free end. For AFM design purposes, we derive a mathematical model for accurate description of the AFM microbeam dynamics. We solve the resulting equations of motions and associated boundary conditions using the Galerkin method. We find that using one-mode approximation in tapping mode operating in the neighborhood of the contact region one-mode approximation may lead to erroneous results.

  19. Ability of Lactobacillus rhamnosus GAF01 to remove AFM1 in vitro and to counteract AFM1 immunotoxicity in vivo.

    Science.gov (United States)

    Abbès, Samir; Salah-Abbès, Jalila Ben; Sharafi, Hakimeh; Jebali, Rania; Noghabi, Kambiz Akbari; Oueslati, Ridha

    2013-01-01

    Aflatoxin M1 (AFM1) has been detected in many parts of the world both in raw milk and many dairy products, causing great economic losses and human disease. Unfortunately, there are few studies dealing with AFM1 immunotoxicity/interactions with lactic acid bacteria for potential application as a natural preventive agent. The aim of this study was to isolate (from dairy products) food-grade probiotic bacteria able to degrade/bind AFM1 in vitro and evaluate whether the same organism(s) could impart a protective role against AFM1-induced immunotoxicity in exposed Balb/c mice. Bacteria (Lactobacillus plantarum MON03 and L. rhamnosus GAF01) were isolated from Tunisian artisanal butter and then tested for abilities to eliminate AFM1 from phosphate-buffered saline (PBS) and reconstituted milk (containing 0.05, 0.10, and 0.20 µg AFM1/ml) after 0, 6, and 24 h at 37°C. Results showed that the selected bacteria could 'remove' AFM1 both in PBS and skimmed milk. The binding abilities of AFM1 by L. plantarum MON03 and L. rhamnosus GAF01 strains (at 10(8) CFU/ml) in PBS and reconstituted milk ranged, respectively, from 16.1-78.6% and 15.3-95.1%; overall, L. rhamnosus showed a better potential for removal than L. plantarum. 'Removal' appeared to be by simple binding; the bacteria/AFM1 complex was stable and only a very small proportion of mycotoxin was released back into the solution. L. rhamnosus GAF01 had the highest binding capacity and was selected for use in the in vivo study. Those results indicated that use of the organism prevented AFM1-induced effects on total white and red blood cells, and lymphocyte subtypes, after 15 days of host treatment. These studies clearly indicated that L. rhamnosus GAF01 was able to bind AFM1 in vitro and-by mechanisms that might also be related to a binding effect-counteract AFM1-induced immunotoxicity. Moreover, by itself, this bacterium was not toxic and could potentially be used as an additive in dairy products and in biotechnology for

  20. Nanotribological surface characterization by frequency modulated torsional resonance mode AFM

    OpenAIRE

    Yurtsever, Ayhan

    2008-01-01

    The aim of this work is to develop an experimental method to measure in-plane surface properties on the nanometer scale by torsional resonance mode atomic force microscopy and to understand the underlying system dynamics. The invention of the atomic force microscope (AFM) and the advances in development of new AFM based techniques have significantly enhanced the capability to probe surface properties with nanometer resolution. However, most of these techniques are based on a flexural oscillat...

  1. Optimization of phase contrast in bimodal amplitude modulation AFM

    OpenAIRE

    Mehrnoosh Damircheli; Amir F. Payam; Ricardo Garcia

    2015-01-01

    Bimodal force microscopy has expanded the capabilities of atomic force microscopy (AFM) by providing high spatial resolution images, compositional contrast and quantitative mapping of material properties without compromising the data acquisition speed. In the first bimodal AFM configuration, an amplitude feedback loop keeps constant the amplitude of the first mode while the observables of the second mode have not feedback restrictions (bimodal AM). Here we study the conditions to enhance the ...

  2. Characterisation of tissue factor-bearing extracellular vesicles with AFM: comparison of air-tapping-mode AFM and liquid Peak Force AFM

    Directory of Open Access Journals (Sweden)

    Julie Hardij

    2013-08-01

    Full Text Available Introduction: Extracellular vesicles (EVs are shed from cells and carry markers of the parent cells. Vesicles derived from cancer cells reach the bloodstream and locally influence important physiological processes. It has been previously shown that procoagulant vesicles are circulating in patients’ fluids. These EVs are therefore considered as promising biomarkers for the thrombotic risk. Because of their small size, classical methods such as flow cytometry suffer from limitation for their characterisation. Atomic force microscopy (AFM has been proposed as a promising complementary method for the characterisation of EVs. Objectives: The objectives of this study are: (a to develop and validate AFM with specific antibodies (anti-TF and (b to compare air and liquid modes for EVs’ size and number determination as potential biomarkers of the prothrombotic risk. Methods: AFM multimode nanoscope III was used for air tapping mode (TM. AFM catalyst was used for liquid Peak Force Tapping (PFT mode. Vesicles are generated according to Davila et al.'s protocol. Substrates are coated with various concentrations of antibodies, thanks to ethanolamine and glutaraldehyde. Results: Vesicles were immobilised on antibody-coated surfaces to select tissue factor (TF-positive vesicles. The size range of vesicles observed in liquid PFT mode is 6–10 times higher than in air mode. This corresponds to the data found in the literature. Conclusion: We recommend liquid PFT mode to analyse vesicles on 5 µg/ml antibody-coated substrates.

  3. Force spectroscopy on DNA by FM-AFM

    CERN Document Server

    Di Santo, Giovanni; Adamcik, Jozef; Dietler, Giovanni

    2007-01-01

    We present imaging and force spectroscopy measurements of DNA molecules adsorbed on functionalized mica. By means of Non-Contact mode AFM (NC-AFM) in Ultra High Vacuum (UHV), the frequency shift (\\Delta f) versus separation (z) curves were measured providing a quantitative measurement of both force and energy of the tip-DNA interaction. Similarly, topographic images of the adsorbed DNA molecules in constant frequency shift mode were collected. The high resolution force measurements confirm the imaging contrast difference between the substrate and DNA. The force curves measured along the DNA molecule can be divided into two classes showing marked differences in the minimum of the interaction force and energy, indicating that NC-AFM could deliver chemical contrast along the DNA molecule.

  4. Improvement in metrology on new 3D-AFM platform

    Science.gov (United States)

    Schmitz, Ingo; Osborn, Marc; Hand, Sean; Chen, Qi

    2008-10-01

    According to the 2007 edition of the ITRS roadmap, the requirement for CD uniformity of isolated lines on a binary or attenuated phase shift mask is 2.1nm (3σ) in 2008 and requires improvement to1.3 nm (3σ) in 2010. In order to meet the increasing demand for CD uniformity on photo masks, improved CD metrology is required. A next generation AFM, InSightTM 3DAFM, has been developed to meet these increased requirements for advanced photo mask metrology. The new system achieves 2X improvement in CD and depth precision on advanced photo masks features over the previous generation 3D-AFM. This paper provides measurement data including depth, CD, and sidewall angle metrology. In addition the unique capabilities of damage-free defect inspection and Nanoimprint characterization by 3D AFM are presented.

  5. Multiple regimes of operation in bimodal AFM: understanding the energy of cantilever eigenmodes

    OpenAIRE

    Daniel Kiracofe; Arvind Raman; Dalia Yablon

    2013-01-01

    One of the key goals in atomic force microscopy (AFM) imaging is to enhance material property contrast with high resolution. Bimodal AFM, where two eigenmodes are simultaneously excited, confers significant advantages over conventional single-frequency tapping mode AFM due to its ability to provide contrast between regions with different material properties under gentle imaging conditions. Bimodal AFM traditionally uses the first two eigenmodes of the AFM cantilever. In this work, the authors...

  6. Control Issues in High-speed AFM for Biological Applications: Collagen Imaging Example 1

    OpenAIRE

    Zou, Q; Leang, KK; Sadoun, E; Reed, MJ; Devasia, S

    2004-01-01

    This article considers the precision positioning problem associated with high-speed operation of the Atomic Force Microscope (AFM), and presents an inversion-based control approach to achieve precision positioning. Although AFMs have high (nanoscale) spatial resolution, a problem with current AFM systems is that they have low temporal resolution, i.e., AFM imaging is slow. In particular, current AFM imaging cannot be used to provide three-dimensional, time-lapse images of fast processes when ...

  7. Resonant Response of Rectangular AFM Cantilever in Liquid

    Institute of Scientific and Technical Information of China (English)

    CHEN Yu-Hang; HUANG Wen-Hao

    2007-01-01

    Dynamic characteristics of atomic force microscopy (AFM) cantilevers can be influenced by their working media.We perform an experimental study on the resonant responses of rectangular AFM cantilevers with different sizes immersed in various viscous fluids. The measured resonance frequencies in liquids are used to validate several theoretical models. Comparison shows the analytical model proposed by Sader [J. Appl. Phys. 84 (1998) 64] can give the best agreement with the experimental results with the maximum relative error nearly 16% for all the cantilevers in different liquids. The ratio between the resonant frequencies in air and water is almost independent of the cantilever length, which is consistent with the theoretical analyses.

  8. AFM reconstruction of complex-shaped chiral plasmonic nanostructures

    CERN Document Server

    Kondratov, Alexey V; Gainutdinov, Radmir V

    2016-01-01

    A significant part of the optical metamaterial phenomena has the plasmonic nature and their investigation requires very accurate knowledge of the fabricated structures shape with a focus on the periodical features. We describe a consistent approach to the shape reconstruction of the plasmonic nanostructures. This includes vertical and tilted spike AFM probes fabrication, AFM imaging and specific post-processing. We studied a complex-shaped chiral metamaterial and conclude that the described post-processing routine extends possibilities of the existing deconvolution algorithms in the case of periodical structures with known rotational symmetry, by providing valuable information about periodical features.

  9. AFM Study of Structure Influence on Butterfly Wings Coloration

    Directory of Open Access Journals (Sweden)

    Dinara Sultanovna Dallaeva

    2012-01-01

    Full Text Available This study describes the structural coloration of the butterfly Vanessa Atalanta wings and shows how the atomic force microscopy (AFM can be applied to the study of wings morphology and wings surface behavior under the temperature. The role of the wings morphology in colors was investigated. Different colors of wings have different topology and can be identified by them. AFM in semi-contact mode was used to study the wings surface. The wing surface area, which is close to the butterfly body, has shiny brown color and the peak of surface roughness is about 600 nm. The changing of morphology at different temperatures is shown.

  10. Weibull analyses of bacterial interaction forces measured using AFM

    NARCIS (Netherlands)

    van der Mei, Henderina; de Vries, Jacob; Busscher, Hendrik

    2010-01-01

    Statistically significant conclusions from interaction forces obtained by AFM are difficult to draw because of large data spreads. Weibull analysis, common in macroscopic bond-strength analyses, takes advantage of this spread to derive a Weibull distribution, yielding the probability of occurrence o

  11. 3D Color Digital Elevation Map of AFM Sample

    Science.gov (United States)

    2008-01-01

    This color image is a three dimensional (3D) view of a digital elevation map of a sample collected by NASA's Phoenix Mars Lander's Atomic Force Microscope (AFM). The image shows four round pits, only 5 microns in depth, that were micromachined into the silicon substrate, which is the background plane shown in red. This image has been processed to reflect the levelness of the substrate. A Martian particle only one micrometer, or one millionth of a meter, across is held in the upper left pit. The rounded particle shown at the highest magnification ever seen from another world is a particle of the dust that cloaks Mars. Such dust particles color the Martian sky pink, feed storms that regularly envelop the planet and produce Mars' distinctive red soil. The particle was part of a sample informally called 'Sorceress' delivered to the AFM on the 38th Martian day, or sol, of the mission (July 2, 2008). The AFM is part of Phoenix's microscopic station called MECA, or the Microscopy, Electrochemistry, and Conductivity Analyzer. The AFM was developed by a Swiss-led consortium, with Imperial College London producing the silicon substrate that holds sampled particles. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  12. Photonic wires sidewall roughness measures using AFM capabilities

    DEFF Research Database (Denmark)

    Malureanu, Radu; Frandsen, Lars Hagedorn

    2008-01-01

    roughness leads to loss increase thus limiting the propagation length and postponing the commercialization of such structures. In this paper we present a new algorithm for measuring the sidewall roughness of our devices based on atomic force microscope (AFM) approach. Using this algorithm, the roughness can...

  13. AFM lithography of aluminum for fabrication of nanomechanical systems

    DEFF Research Database (Denmark)

    Davis, Zachary James; Abadal, G.; Hansen, Ole;

    2003-01-01

    Nanolithography by local anodic oxidation of surfaces using atomic force microscopy (AFM) has proven to be more reproducible when using dynamic, non-contact mode. Hereby, the tip/sample interaction forces are reduced dramatically compared to contact mode, and thus tip wear is greatly reduced. Ano...

  14. Dicty_cDB: AFM127 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available qrfpxxksixxxf Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value AFM127 (...ducing significant alignments: (bits) Value N ( BJ346853 ) Dictyostelium discoide...cing significant alignments: (bits) Value (Q54HY4) RecName: Full=Putative uncharacterized protein DDB_G028..

  15. Roughness measurements with an AFM-CMM instrument

    DEFF Research Database (Denmark)

    Marinello, Francesco; Bariani, Paolo; De Chiffre, Leonardo;

    2005-01-01

    In this paper, application of a Large Range AFM to roughness analyses is presented: measurements on different calibration standards covering a range of 4.8×0.1 mm2 were performed. Upon extraction of single profiles from the three-dimensional data set, roughness can be evaluated in compliance...

  16. AFM Structural Characterization of Drinking Water Biofilm under Physiological Conditions

    Science.gov (United States)

    Due to the complexity of mixed culture drinking water biofilm, direct visual observation under in situ conditions has been challenging. In this study, atomic force microscopy (AFM) revealed the three dimensional morphology and arrangement of drinking water relevant biofilm in air...

  17. Vergelijkend AFM Onderzoek: microstructuur van bitumen in relatie tot healing

    NARCIS (Netherlands)

    Schmets, A.J.M.; Nahar, S.N.; Dillingh, B.; Fischer, H.; Scarpas, A.; Erkens, S.

    2012-01-01

    In this report we present the background, the scientific and experimental approach and the results of AFM experiments performed on two different batches of bitumen. The specific bitumen researched in this project has also been studied in the context of the InfraQuest project ‘Pragmatisch Healing On

  18. Modular design of AFM probe with sputtered silicon tip

    DEFF Research Database (Denmark)

    Rasmussen, Peter; Thaysen, Jacob; Bouwstra, Siebe;

    2001-01-01

    of the thin films constituting the cantilever. The AFM probe has an integrated tip made of a thick sputtered silicon layer, which is deposited after the probe has been defined and just before the cantilevers are released. The tips are so-called rocket tips made by reactive ion etching. We present probes...

  19. Introduction to Atomic Force Microscopy (AFM) in Biology.

    Science.gov (United States)

    Kreplak, Laurent

    2016-01-01

    The atomic force microscope (AFM) has the unique capability of imaging biological samples with molecular resolution in buffer solution over a wide range of time scales from milliseconds to hours. In addition to providing topographical images of surfaces with nanometer- to angstrom-scale resolution, forces between single molecules and mechanical properties of biological samples can be investigated from the nano-scale to the micro-scale. Importantly, the measurements are made in buffer solutions, allowing biological samples to "stay alive" within a physiological-like environment while temporal changes in structure are measured-e.g., before and after addition of chemical reagents. These qualities distinguish AFM from conventional imaging techniques of comparable resolution, e.g., electron microscopy (EM). This unit provides an introduction to AFM on biological systems and describes specific examples of AFM on proteins, cells, and tissues. The physical principles of the technique and methodological aspects of its practical use and applications are also described. © 2016 by John Wiley & Sons, Inc. PMID:27479503

  20. Characterization of large area nanostructured surfaces using AFM measurements

    DEFF Research Database (Denmark)

    Calaon, Matteo; Hansen, Hans Nørgaard; Tosello, Guido;

    2012-01-01

    A surface characterisation study has been developed to validate an innovative tool making solution for nano patterning large areas via anodizing of aluminium (Al) and subsequent nickel electroforming. A surface topography characterization through atomic force microscopy (AFM) indicated a decrease...... relative to an average plane and the coefficient of variation of the fitted features curvature radius....

  1. AFM study of polymer lubricants on hard disk surfaces

    Science.gov (United States)

    Bao, G. W.; Troemel, M.; Li, S. F. Y.

    Thin liquid films of PFPE (perfluoropolyether) lubricants dip-coated on hard disk surfaces were imaged with non-contact mode AFM. Demnum lubricants with phosphazene additives exhibited strong interactions with a silicon tip due to the formation of liquid bridges between the lubricants and the tip, as indicated by a remarkable hysteresis loop between approach and retraction curves in force vs. distance measurements. Features resulting from capillary forces due to tip tapping to the lubricants were revealed, which demonstrated that the capillary forces could be used to lock the non-contacting tip at a certain separation from the substrate surface to obtain AFM images. Force vs. distance curves for Fomblin Z-dol lubricants showed negligible hysteresis effects and features corresponding to lateral distortion of the tip by the lubricants only were observed. In both cases, only when the tip was positioned far above the surfaces could the natural distributions of the lubricants be imaged.

  2. Nano-Bio-Mechanics of Neuroblastoma Cells Using AFM

    Science.gov (United States)

    Bastatas, Lyndon; Matthews, James; Kang, Min; Park, Soyeun

    2011-10-01

    We have conducted an in vitro study to determine the elastic moduli of neurobalstoma cell lines using atomic force microscopy. Using a panel of cell lines established from neuroblastoma patients at different stages of disease progress and treatment, we have investigated the differences in elastic moduli during a course of cancer progression and chemotherapy. The cells were grown on the hard substrates that are chemically functionalized to enhance adhesion. We have performed the AFM indentation experiments with different applied forces from the AFM probe. For the purpose of the comparison between cell lines, the indentations were performed only on cell centers. The obtained force-distance curves were analyzed using the Hertz model in order to extract the elastic moduli. We have found that the elastic moduli of human neuroblastoma cells significantly varied during the disease progression. We postulate that the observed difference might be affected by the treatment and chemotherapy.

  3. AFM-based mechanical characterization of single nanofibres

    Science.gov (United States)

    Neugirg, Benedikt R.; Koebley, Sean R.; Schniepp, Hannes C.; Fery, Andreas

    2016-04-01

    Nanofibres are found in a broad variety of hierarchical biological systems as fundamental structural units, and nanofibrillar components are playing an increasing role in the development of advanced functional materials. Accurate determination of the mechanical properties of single nanofibres is thus of great interest, yet measurement of these properties is challenging due to the intricate specimen handling and the exceptional force and deformation resolution that is required. The atomic force microscope (AFM) has emerged as an effective, reliable tool in the investigation of nanofibrillar mechanics, with the three most popular approaches--AFM-based tensile testing, three-point deformation testing, and nanoindentation--proving preferable to conventional tensile testing in many (but not all) cases. Here, we review the capabilities and limitations of each of these methods and give a comprehensive overview of the recent advances in this field.

  4. Vacuolar structures can be identified by AFM elasticity mapping

    Energy Technology Data Exchange (ETDEWEB)

    Riethmueller, Christoph [Institute of Physiology II, University of Muenster, Muenster (Germany)], E-mail: chrth@uni-muenster.de; Schaeffer, Tilman E. [Institute of Physics, University of Muenster, Muenster (Germany); Kienberger, Ferry [Institute of Biophysics, University of Linz, Linz (Austria); Stracke, Werner [Institute of Medical Physics and Biophysics, University of Muenster, Muenster (Germany); Oberleithner, Hans [Institute of Physiology II, University of Muenster, Muenster (Germany)

    2007-10-15

    Fluid-filled organelles like vesicles, endosomes and pinosomes are inevitable parts of cellular signalling and transport. Endothelial cells, building a barrier between blood and tissue, can form vacuolar organelles. These structures are implicated in upregulated fluid transport across the endothelium under inflammatory conditions. Vacuolar organelles have been described by transmission electron microscopy so far. Here, we present a method that images and mechanically characterizes intracellular structures in whole cells by atomic force microscopy (AFM). After crosslinking the cellular proteins with the fixative glutaraldehyde, plasma membrane depressions become observable, which are scattered around the cell nucleus. Nanomechanical analysis identifies them as spots of reduced stiffness. Scanning electron microscopy confirms their pit-like appearance. In addition, fluorescence microscopy detects an analogous pattern of protein-poor spots, thereby confirming mechanical rigidity to arise from crosslinked proteins. This AFM application opens up a mechanical dimension for the investigation of intracellular organelles.

  5. Insights into Epoxy Network Nanostructural Heterogeneity Using AFM-IR.

    Science.gov (United States)

    Morsch, Suzanne; Liu, Yanwen; Lyon, Stuart B; Gibbon, Simon R

    2016-01-13

    The first direct observation of a chemically heterogeneous nanostructure within an epoxy resin is reported. Epoxy resins comprise the matrix component of many high performance composites, coatings and adhesives, yet the molecular network structure that underpins the performance of these industrially essential materials is not well understood. Internal nodular morphologies have repeatedly been reported for epoxy resins analyzed using SEM or AFM, yet the origin of these features remains a contentious subject, and epoxies are still commonly assumed to be chemically homogeneous. Uniquely, in this contribution we use the recently developed AFM-IR technique to eliminate previous differences in interpretation, and establish that nodule features correspond to heterogeneous network connectivity within an epoxy phenolic formulation.

  6. AFM STUDY ON THE MORPHOLOGICAL CHANGE OF Zn ELECTRODEPOSIT

    Institute of Scientific and Technical Information of China (English)

    A.L. Fan; W.H. Tian; M. Kurosaki

    2003-01-01

    Nano-sized growth of zinc electrodeposit on the ferrite substrate has been studied by means of in situ scanning tunnel microscopy (STM) and atomic force micoscopy (AFM). It is found that the morphology of zinc electrodeposit varies from initial about 30nm granular crystals to layered platelet crystals with increasing deposition time by using in situ STM. With AFM, the results show that the platelet crystals ave hexagonal in shape and the hexagonal platelet crystals form steps perpendicular to the growth direction by side-by-side stacking along the (0001), surface. The mechanism of morphological change is discussed in details. It is proposed that these steps grow laterally as a result of the embedment of zinc ion clusters.

  7. Measuring radial Young's modulus of DNA by tapping mode AFM

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Based on tapping mode AFM imaging, a method was demonstrated to evaluate compression elasticity of single double-stranded DNA (dsDNA) molecules in the force region. With images under ambient conditions, Young's moduli of dsDNA in compression were calculated. Results demonstrated that Young's moduli of dsDNA can be simply deduced according to the proposed model. The method can also be used to evaluate the compression elasticity of similar soft nanomaterials.

  8. AFM studies of nonspecific binding of enzyme on DNA

    Institute of Scientific and Technical Information of China (English)

    张益; 谢恒月; 等

    1996-01-01

    Atomic force microscope(AFM) is used to study restriction endonuclease digestion of plasmid DNA,pWRr plasmid DNA is digested by Hind Ⅲ,and the specific and the nonspecific binding of the restriction endonuclease are imaged,and the biological function of the enzyme binding to nonspecific sites is discussed.In addition,it is found that nonspecific binding of Hind ǚ could not induce the DNA characteristic bending angle.

  9. Investigation of the Mechanoelectrical Transduction at Single Stereocilia by Afm

    Science.gov (United States)

    Langer, M. G.; Fink, S.; Löffler, K.; Koitschev, A.; Zenner, H.-P.

    2003-02-01

    The transduction of sound into an electrical signal in the inner ear is closely related to the mechanical properties of the hair bundles cytoskeleton and cross-linkage. In this study the effect of lateral cross-links on hair bundle mechanics and the transduction current response is demonstrated on the level of individual stereocilia. For experiments stereocilia of outer hair cells of postnatal rats (P3 - P8) were scanned with a sharp AFM tip at nanometerscale. Transduction currents were simultaneously recorded in the whole-cell-recording mode with patch clamp. AFM was used as a nanotool for local mechanical stimulation and force measurement at stereocilia whereas patch clamp serves as a detector for the electrical response of the cell. In a first experiment force transmission between adjacent stereocilia of the V- and W- shaped hair bundles of outer hair cells was investigated. Results showed that a force exerted to a single stereocilium declined to 36 % at the nearest adjacent stereocilium of the same row. This result supposes AFM to be convenient for local displacement of single stereocilia. For control, the local response of transduction channels was measured at single stereocilia of the same hair bundle. Measured transduction current amplitudes ranged from 9 to 49 pA supposing an opening of one to five transduction channels. Both, weak force transmission by lateral cross-links and small transduction current amplitudes indicate a weak mechanical interaction between individual stereocilia of the tallest row of stereocilia of outer hair cells from postnatal rats.

  10. Characterization of spin crossover crystal surface by AFM

    Energy Technology Data Exchange (ETDEWEB)

    Chong, C.; Berini, B.; Boukheddaden, K.; Codjovi, E.; Linares, J.; Varret, F. [GEMAC, CNRS, Universite de Versailles, 45 avenue des Etats-Unis, 78035 Versailles cedex (France); Garcia, Y.; Naik, A.D. [Unite de Chimie des Materiaux Inorganiques et Organiques, Departement de Chimie, Faculte des Sciences, Universite Catholique de Louvain, Place L. Pasteur 1, 1348 Louvain-la-Neuve (Belgium)

    2010-05-15

    Imaging nano-domains in spin crossover (SCO) compounds remains so far an unreached goal. We report on the first AFM tapping-mode investigation of SCO single crystals, performed at room temperature with the well known mononuclear compound [Fe(ptz){sub 6}](BF{sub 4}){sub 2} (ptz = 1-propyl-tetrazole) and the trinuclear supramolecular compound [Fe{sub 3}(hyetrz){sub 6}(H{sub 2}O){sub 6}](CF{sub 3}SO{sub 3}){sub 6} (hyetrz = 4-(2{sup '}-hydroxyethyl)-1,2,4-triazole) which shows a gradual spin conversion centred at room temperature. The natural surface of the former crystal revealed a volatile coating of the scanned area attributed to the transport of adsorbed water under the effect of interaction with the AFM tip. The second one showed astonishing leopard-skin patterns assigned to the effect of atmospheric humidity on this hygroscopic compound. Their origin is discussed. We suggest the use of fluid coating layers as a general method for revealing the nano-patterning of physical properties (e.g. like-spin domains) at the surface of dielectric materials. AFM-tapping images of [Fe{sub 3}(hyetrz){sub 6}(H{sub 2}O){sub 6}](CF{sub 3}SO{sub 3}){sub 6} at room temperature and ambient atmosphere. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  11. Confocal Raman-AFM, A New Tool for Materials Research

    Science.gov (United States)

    Schmidt, Ute

    2005-03-01

    Characterization of heterogeneous systems, e.g. polymers, on the nanometer scale continues to grow in importance and to impact key applications in the field of materials science, nanotechnology and catalysis. The development of advanced polymeric materials for such applications requires detailed information about the physical and chemical properties of these materials on the nanometer scale. However, some details about the phase-separation process in polymers are difficult to study with conventional characterization techniques due to the inability of these methods to chemically differentiate materials with good spatial resolution, without damage, staining or preferential solvent washing. The CR-AFM is a breakthrough in microscopy. It combines three measuring techniques in one instrument: a high resolution confocal optical microscope, an extremely sensitive Raman spectroscopy system, and an Atomic Force Microscope. Using this instrument, the high spatial and topographical resolution obtained with an AFM can be directly linked to the chemical information gained by Confocal Raman spectroscopy. To demonstrate the capabilities of this unique combination of measuring techniques, polymer blend films, spin coated on glass substrates, have been characterized. AFM measurements reveal the structural and mechanical properties of the films, whereas Raman spectral images show the chemical composition of the blends.

  12. Temperature-dependent imaging of living cells by AFM

    International Nuclear Information System (INIS)

    Characterization of lateral organization of plasma membranes is a prerequisite to the understanding of membrane structure-function relationships in living cells. Lipid-lipid and lipid-protein interactions are responsible for the existence of various membrane microdomains involved in cell signalization and in numerous pathologies. Developing approaches for characterizing microdomains associate identification tools like recognition imaging with high-resolution topographical imaging. Membrane properties are markedly dependent on temperature. However, mesoscopic scale topographical information of cell surface in a temperature range covering most of cell biology experimentation is still lacking. In this work we have examined the possibility of imaging the temperature-dependent behavior of eukaryotic cells by atomic force microscopy (AFM). Our results establish that the surface of living CV1 kidney cells can be imaged by AFM, between 5 and 37 deg. C, both in contact and tapping modes. These first temperature-dependent data show that large cell structures appeared essentially stable at a microscopic scale. On the other hand, as shown by contact mode AFM, the surface was highly dynamic at a mesoscopic scale, with marked changes in apparent topography, friction, and deflection signals. When keeping the scanning conditions constant, a progressive loss in the image contrast was however observed, using tapping mode, on decreasing the temperature

  13. A review of the application of atomic force microscopy (AFM) in food science and technology.

    Science.gov (United States)

    Liu, Shaoyang; Wang, Yifen

    2011-01-01

    Atomic force microscopy (AFM) is a powerful nanoscale analysis technique used in food area. This versatile technique can be used to acquire high-resolution sample images and investigate local interactions in air or liquid surroundings. In this chapter, we explain the principles of AFM and review representative applications of AFM in gelatin, casein micelle, carrageenan, gellan gum, starch, and interface. We elucidate new knowledge revealed with AFM as well as ways to use AFM to obtain morphology and rheology information in different food fields.

  14. Noncontact AFM Imaging of Atomic Defects on the Rutile TiO2 (110) Surface

    DEFF Research Database (Denmark)

    Lauritsen, Jeppe Vang

    2015-01-01

    The atomic force microscope (AFM) operated in the noncontact mode (nc-AFM) offers a unique tool for real space, atomic-scale characterisation of point defects and molecules on surfaces, irrespective of the substrate being electrically conducting or non-conducting. The nc-AFM has therefore in recent...... years become an important tool for fundamental analysis of defects at the atomic scale on metal oxide systems. Here the principles of the nc-AFM technique are presented and I review the recent interplay between atom-resolved nc-AFM experiments and atomistic nc-AFM simulations of the predominant defects...... on the rutile TiO2(110) surface. The present Chapter continues the review of nc-AFM initiated in Chap. 7 by Barth....

  15. Single microparticles mass measurement using an AFM cantilever resonator

    CERN Document Server

    Mauro, Marco; Ferrini, Gianluca; Puglisi, Roberto; Balduzzi, Donatella; Galli, Andrea

    2014-01-01

    In this work is presented a microbalance for single microparticle sensing based on resonating AFM cantilever. The variation of the resonator eigenfrequency is related to the particle mass positioned at the free apex of the cantilever. An all-digital phase locked loop (PLL) control system is developed to detect the variations in cantilever eigenfrequency. Two particle populations of different materials are used in the experimental test, demonstrating a mass sensitivity of 15 Hz/pg in ambient conditions. Thereby it is validated the possibility of developing an inexpensive, portable and sensitive microbalance for point-mass sensing.

  16. AFM characterization of protein net formation on a fibrous medium

    Directory of Open Access Journals (Sweden)

    Assis O.B.G.

    2000-01-01

    Full Text Available Lysozyme protein net is set on a glass fiber support using the self-assembly technique. Enzymatic film formation is followed by surface imaging via atomic force microscopy (AFM. Change in roughness as a function of deposition time is used as an indirect indicator of film formation. The objective was to form a protein film that would have no effect on the permeability of the medium, aiming at its application as a bioactive membrane or reactor suitable for bacteria and chemical interactions in aqueous media.

  17. Adhesion experiments using an AFM-Parameters of influence

    International Nuclear Information System (INIS)

    Adhesion measurements were performed by AFM (Atomic Force Microscopy). It was shown that many parameters need to be controlled in order to provide reproducible and quantitative results. Adhesion forces were shown to depend on combination of materials characteristics and testing geometry as well as experimental protocol (contact time, contact force and contact area). This contact area was modified by means of FIB (Focused Ion Beam) milling and deliberate abrasion. As a result, a drastic change in adhesion could be observed. Still, those are problems connected to adjustment of interacting surfaces.

  18. An AFM study of the interactions between colloidal particles

    OpenAIRE

    Lüderitz, Liset

    2012-01-01

    Im vorliegenden Forschungsprojekt werden die Wechselwirkungskräfte zwischen zwei Kolloidteilchen untersucht. Die Wechselwirkungen zwischen kolloidalen Teilchen können sich von denen zwischen makroskopischen Körpern unterscheiden. Die Wechselwirkungen wurden mit einem „Colloidal Probe Atomic Force Microscope“ (CP-AFM) in verschiedenen Elektrolyten gemessen: CsCl, KCl, NaCl und LiCl. Die resultierenden Kräfte können sich je nach verwendeter Elektrolytlösung unterscheiden, was als Ionenspezifitä...

  19. SU-8 hollow cantilevers for AFM cell adhesion studies

    International Nuclear Information System (INIS)

    A novel fabrication method was established to produce flexible, transparent, and robust tipless hollow atomic force microscopy (AFM) cantilevers made entirely from SU-8. Channels of 3 μm thickness and several millimeters length were integrated into 12 μm thick and 40 μm wide cantilevers. Connected to a pressure controller, the devices showed high sealing performance with no leakage up to 6 bars. Changing the cantilever lengths from 100 μm to 500 μm among the same wafer allowed the targeting of various spring constants ranging from 0.5 to 80 N m−1 within a single fabrication run. These hollow polymeric AFM cantilevers were operated in the optical beam deflection configuration. To demonstrate the performance of the device, single-cell force spectroscopy experiments were performed with a single probe detaching in a serial protocol more than 100 Saccharomyces cerevisiae yeast cells from plain glass and glass coated with polydopamine while measuring adhesion forces in the sub-nanoNewton range. SU-8 now offers a new alternative to conventional silicon-based hollow cantilevers with more flexibility in terms of complex geometric design and surface chemistry modification. (paper)

  20. AFM investigation of kraft pulp ber swelling in controlled humidity

    International Nuclear Information System (INIS)

    Full text: Kraft pulp fibers are wood fibers from softwood, typically spruce and pine, which are the main constituent for so called kraft paper. Kraft paper is used mainly for packaging applications, where a high strength is required. In this work, the swelling behavior of spruce kraft pulp fibers is investigated by atomic force microscopy (AFM). To perform this task, the AFM was equipped with a fluid cell and a setup where the relative humidity inside the fluid cell can be controlled. The setup enables to select any humidity value between approximately 5% and 80% relative humidity. With this setup, a change in surface morphology of the scanned area could be observed. Furthermore, the evolution of the characteristic surface wrinkles of dried pulp fibers with increasing humidity was quantified in two different ways. One way is to measure the distance between the surface wrinkles, the other to determine their height. It could be shown that the distance between the wrinkles is increasing, whereas the height is decreasing. This means that the surface is becoming smoother when the ber is swelling, which is best observed on a completely wet fiber. (author)

  1. AFM analysis of bleaching effects on dental enamel microtopography

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira de Freitas, Ana Carolina, E-mail: anacarolfreitas@usp.br [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Cardoso Espejo, Luciana, E-mail: luespejo@hotmail.com [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Brossi Botta, Sergio, E-mail: sbbotta@usp.br [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Sa Teixeira, Fernanda de, E-mail: nandast@if.usp.br [Laboratorio de Filmes Finos, Instituto de Fisica da Universidade de Sao Paulo, Rua do Matao, Travessa R, 187 - Cidade Universitaria, CEP 05314-970, Sao Paulo (Brazil); Cerqueira, Luz Maria Aparecida A., E-mail: maacluz@usp.br [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Garone-Netto, Narciso, E-mail: ngarone@usp.br [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Bona Matos, Adriana, E-mail: bona@usp.br [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Barbosa da Silveira Salvadori, Maria Cecilia, E-mail: mcsalva@if.usp.br [Laboratorio de Filmes Finos, Instituto de Fisica da Universidade de Sao Paulo, Rua do Matao, Travessa R, 187 - Cidade Universitaria, CEP 05314-970, Sao Paulo (Brazil)

    2010-02-15

    The purpose of this in vitro study was to test a new methodology to evaluate the effects of 35% hydrogen peroxide agent on the microtopography of sound enamel using an atomic force microscope (AFM). The buccal sound surfaces of three extracted human lower incisors were used, without polishing the surfaces to maintain them with natural morphology. These unpolished surfaces were subjected to bleaching procedure with 35% hydrogen peroxide that consisted of 4 applications of the bleaching agent on enamel surfaces for 10 min each application. Surface images were obtained in a 15 {mu}m x 15 {mu}m area using an AFM. The roughness (Ra and RMS) and the power spectral density (PSD) were obtained before and after the bleaching treatment. As results we could inquire that the PSD analyses were very suitable to identifying the morphological changes on the surfaces, while the Ra and RMS parameters were insufficient to represent the morphological alterations promoted by bleaching procedure on enamel. The morphological wavelength in the range of visible light spectrum (380-750 nm) was analyzed, showing a considerable increase of the PSD with the bleaching treatment.

  2. AFM analysis of bleaching effects on dental enamel microtopography

    Science.gov (United States)

    Pedreira de Freitas, Ana Carolina; Espejo, Luciana Cardoso; Botta, Sergio Brossi; Teixeira, Fernanda de Sa; Luz, Maria Aparecida A. Cerqueira; Garone-Netto, Narciso; Matos, Adriana Bona; Salvadori, Maria Cecilia Barbosa da Silveira

    2010-02-01

    The purpose of this in vitro study was to test a new methodology to evaluate the effects of 35% hydrogen peroxide agent on the microtopography of sound enamel using an atomic force microscope (AFM). The buccal sound surfaces of three extracted human lower incisors were used, without polishing the surfaces to maintain them with natural morphology. These unpolished surfaces were subjected to bleaching procedure with 35% hydrogen peroxide that consisted of 4 applications of the bleaching agent on enamel surfaces for 10 min each application. Surface images were obtained in a 15 μm × 15 μm area using an AFM. The roughness (Ra and RMS) and the power spectral density (PSD) were obtained before and after the bleaching treatment. As results we could inquire that the PSD analyses were very suitable to identifying the morphological changes on the surfaces, while the Ra and RMS parameters were insufficient to represent the morphological alterations promoted by bleaching procedure on enamel. The morphological wavelength in the range of visible light spectrum (380-750 nm) was analyzed, showing a considerable increase of the PSD with the bleaching treatment.

  3. AFM analysis of bleaching effects on dental enamel microtopography

    International Nuclear Information System (INIS)

    The purpose of this in vitro study was to test a new methodology to evaluate the effects of 35% hydrogen peroxide agent on the microtopography of sound enamel using an atomic force microscope (AFM). The buccal sound surfaces of three extracted human lower incisors were used, without polishing the surfaces to maintain them with natural morphology. These unpolished surfaces were subjected to bleaching procedure with 35% hydrogen peroxide that consisted of 4 applications of the bleaching agent on enamel surfaces for 10 min each application. Surface images were obtained in a 15 μm x 15 μm area using an AFM. The roughness (Ra and RMS) and the power spectral density (PSD) were obtained before and after the bleaching treatment. As results we could inquire that the PSD analyses were very suitable to identifying the morphological changes on the surfaces, while the Ra and RMS parameters were insufficient to represent the morphological alterations promoted by bleaching procedure on enamel. The morphological wavelength in the range of visible light spectrum (380-750 nm) was analyzed, showing a considerable increase of the PSD with the bleaching treatment.

  4. Preparation of cell membranes for high resolution imaging by AFM

    International Nuclear Information System (INIS)

    Studies of cell membrane structure by atomic force microscopy (AFM) have been limited because of the softness of cell membranes. Here, we utilize a new technique of sample preparation to lay red blood cell membranes on the top of a mica surface to obtain high resolution images by in-situ AFM on both sides of cell membranes. Our results indicate that the location of oligosaccharides and proteins in red blood cell membranes might be different from the current membrane model. The inner membrane leaflet is covered by dense proteins with fewer free lipids than expected. In contrast, the outer membrane leaflet is quite smooth; oligosaccharides and peptides supposed to protrude out of the outer membrane leaflet surface might be actually hidden in the middle of hydrophilic lipid heads; transmembrane proteins might form domains in the membranes revealed by PNGase F and trypsin digestion. Our result could be significant to interpret some functions about red blood cell membranes and guide to heal the blood diseases related to cell membranes.

  5. Interactions between chitosan and cells measured by AFM

    Energy Technology Data Exchange (ETDEWEB)

    Hsiao, Sheng-Wen; Thien, Doan Van Hong; Ho, Ming-Hua [Department of Chemical Engineering, National Taiwan University of Science and Technology, Taipei 10617, Taiwan (China); Hsieh, Hsyue-Jen [Department of Chemical Engineering, National Taiwan University, Taipei 10617, Taiwan (China); Li, Chung-Hsing [Division of Orthodontics and Pediatric Dentistry, Department of Dentistry, Tri-Service General Hospital, Taipei, Taiwan (China); Hung, Chang-Hsiang [Department of Dentistry, Kinmen Hospital Department of Health, Taiwan (China); Li, Hsi-Hsin, E-mail: mhho@mail.ntust.edu.t [Deputy Superintendent, Kinmen Hospital Department of Health, Taiwan (China)

    2010-10-01

    Chitosan, a biocompatible material that has been widely used in bone tissue engineering, is believed to have a high affinity to osteoblastic cells. This research is the first to prove this hypothesis. By using atomic force microscopy (AFM) with a chitosan-modified cantilever, quantitative evaluation of the interforce between chitosan and cells was carried out. A chitosan tip functionalized with Arg-Gly-Asp (RGD) was also used to measure the interforce between RGD-chitosan and osteoblastic cells. This research concluded by examining cell adhesion and spreading of chitosan substrates as further characterization of the interactions between cells and chitosan. The force measured by AFM showed that the interforce between chitosan and osteoblasts was the highest (209 nN). The smallest adhesion force (61.8 nN) appeared between chitosan and muscle fibroblasts, which did not demonstrate any osteoblastic properties. This result proved that there was a significant interaction between chitosan and bone cells, and correlated with the observations of cell attachment and spreading. The technique developed in this research directly quantified the adhesion between chitosan and cells. This is the first study to demonstrate that specific interaction exists between chitosan and osteoblasts.

  6. Interactions between chitosan and cells measured by AFM

    International Nuclear Information System (INIS)

    Chitosan, a biocompatible material that has been widely used in bone tissue engineering, is believed to have a high affinity to osteoblastic cells. This research is the first to prove this hypothesis. By using atomic force microscopy (AFM) with a chitosan-modified cantilever, quantitative evaluation of the interforce between chitosan and cells was carried out. A chitosan tip functionalized with Arg-Gly-Asp (RGD) was also used to measure the interforce between RGD-chitosan and osteoblastic cells. This research concluded by examining cell adhesion and spreading of chitosan substrates as further characterization of the interactions between cells and chitosan. The force measured by AFM showed that the interforce between chitosan and osteoblasts was the highest (209 nN). The smallest adhesion force (61.8 nN) appeared between chitosan and muscle fibroblasts, which did not demonstrate any osteoblastic properties. This result proved that there was a significant interaction between chitosan and bone cells, and correlated with the observations of cell attachment and spreading. The technique developed in this research directly quantified the adhesion between chitosan and cells. This is the first study to demonstrate that specific interaction exists between chitosan and osteoblasts.

  7. A Multifunctional Frontloading Approach for Repeated Recycling of a Pressure-Controlled AFM Micropipette

    OpenAIRE

    Phillip Roder; Carsten Hille

    2015-01-01

    Fluid force microscopy combines the positional accuracy and force sensitivity of an atomic force microscope (AFM) with nanofluidics via a microchanneled cantilever. However, adequate loading and cleaning procedures for such AFM micropipettes are required for various application situations. Here, a new frontloading procedure is described for an AFM micropipette functioning as a force- and pressure-controlled microscale liquid dispenser. This frontloading procedure seems especially attractive w...

  8. AFM research on Fe-based nanocrystal crystallization mechanism

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The cross-section pattern of Fe-based alloy ribbon (Fe73.5Cu1Nb3Si13.5B9) annealed at different temperatures was investigated by AFM (atomic force microscope), and the effect mechanism of Nb and Cu in Fe-based alloy ribbon annealing was analyzed with XRD diffraction crystal analysis technique and other research results. New concepts of encapsulated grain, Nb vacancy cluster, Nb-B atom cluster and so on were proposed and used to describe the formation mechanism of α-Fe (Si) nanocrystal. Finally, a three-phase (separation phase, encapsulated phase and nanocrystalline phase) interconnected structure model in Fe-based nanocrystalline alloy was established.

  9. AFM, SEM and TEM Studies on Porous Anodic Alumina

    Directory of Open Access Journals (Sweden)

    Zhu YuanYuan

    2010-01-01

    Full Text Available Abstract Porous anodic alumina (PAA has been intensively studied in past decade due to its applications for fabricating nanostructured materials. Since PAA’s pore diameter, thickness and shape vary too much, a systematical study on the methods of morphology characterization is meaningful and essential for its proper development and utilization. In this paper, we present detailed AFM, SEM and TEM studies on PAA and its evolvements with abundant microstructures, and discuss the advantages and disadvantages of each method. The sample preparation, testing skills and morphology analysis are discussed, especially on the differentiation during characterizing complex cross-sections and ultrasmall nanopores. The versatility of PAAs is also demonstrated by the diversity of PAAs’ microstructure.

  10. AFM study of steel corrosion in aqueous solutions in concrete

    Directory of Open Access Journals (Sweden)

    Díaz-Benito, B.

    2011-03-01

    Full Text Available Early corrosion stages are studied in carbon steel by means of a solution simulating that contained in concrete pores. Non-carbonated solution contains 5% NaCl. The atomic force microscopy (AFM technique is used to study material performance after different immersion times (up to 48 h. Obtained data are compared to electrochemical ones (corrosion potential and polarization resistance. Analysis of images and roughness evolution along time shows that steel initially tends to reach passivity, although the passive layer rapidly loses its protective character due to chloride attack.

    Este trabajo estudia los primeros estados de la corrosión de un acero al carbono en una disolución que simula la existente en los poros del hormigón, sin carbonatar, con un 5% de NaCl. Para ello, se ha empleado la técnica de microscopía de fuerza atómica (AFM, estudiando el comportamiento del material tras diferentes tiempos de inmersión, hasta 48 h, en la disolución. Estos datos se comparan con datos electroquímicos (potencial de corrosión y resistencia de polarización. El análisis de las imágenes y la evolución de la rugosidad con el tiempo muestran que el acero tiende inicialmente a pasivarse, pero la capa pasiva pierde rápidamente su carácter protector debido al ataque de los cloruros.

  11. Modelling and Measurement Uncertainty Estimation for Integrated AFM-CMM Instrument

    DEFF Research Database (Denmark)

    Hansen, Hans Nørgaard; Bariani, Paolo; De Chiffre, Leonardo

    2005-01-01

    This paper describes modelling of an integrated AFM - CMM instrument, its calibration, and estimation of measurement uncertainty. Positioning errors were seen to limit the instrument performance. Software for off-line stitching of single AFM scans was developed and verified, which allows...... compensation of such errors. A geometrical model of the instrument was produced, describing the interaction between AFM and CMM systematic errors. The model parameters were quantified through calibration, and the model used for establishing an optimised measurement procedure for surface mapping. A maximum...... uncertainty of 0.8% was achieved for the case of surface mapping of 1.2*1.2 mm2 consisting of 49 single AFM scanned areas....

  12. Investigation of Amyloid Structures at Nanoscale via AFM based Dynamic Nanomechncial Microscopy

    DEFF Research Database (Denmark)

    Zhang, Shuai

    2014-01-01

    material research. Among kinds of techniques, Atomic force microscopy (AFM) has the advantages in amyloid study, due to the real-space nano-resolution, the possibilities to characterize in physiological condition, and easy operation without staining requirement. The recent developed AFM based dynamic...

  13. Nano-Wilhelmy investigation of dynamic wetting properties of AFM tips through tip-nanobubble interaction

    Science.gov (United States)

    Wang, Yuliang; Wang, Huimin; Bi, Shusheng; Guo, Bin

    2016-01-01

    The dynamic wetting properties of atomic force microscopy (AFM) tips are of much concern in many AFM-related measurement, fabrication, and manipulation applications. In this study, the wetting properties of silicon and silicon nitride AFM tips are investigated through dynamic contact angle measurement using a nano-Wilhelmy balance based method. This is done by capillary force measurement during extension and retraction motion of AFM tips relative to interfacial nanobubbles. The working principle of the proposed method and mathematic models for dynamic contact angle measurement are presented. Geometric models of AFM tips were constructed using scanning electronic microscopy (SEM) images taken from different view directions. The detailed process of tip-nanobubble interaction was investigated using force-distance curves of AFM on nanobubbles. Several parameters including nanobubble height, adhesion and capillary force between tip and nanobubbles are extracted. The variation of these parameters was studied over nanobubble surfaces. The dynamic contact angles of the AFM tips were calculated from the capillary force measurements. The proposed method provides direct measurement of dynamic contact angles for AFM tips and can also be taken as a general approach for nanoscale dynamic wetting property investigation. PMID:27452115

  14. Direct manipulation of intracellular stress fibres using a hook-shaped AFM probe

    Energy Technology Data Exchange (ETDEWEB)

    Machida, Shinichi; Watanabe-Nakayama, Takahiro; Harada, Ichiro; Afrin, Rehana [Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259-S2-8, Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8503 (Japan); Nakayama, Tomonobu [International Center for Materials Nanoarchitectonics (MANA), National Institute for Materials Science (NIMS), 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan); Ikai, Atsushi, E-mail: smachida@bio.titech.ac.jp [Innovation Laboratory, Tokyo Institute of Technology, 4259-S2-8, Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8503 (Japan)

    2010-09-24

    Atomic force microscopy (AFM) is a highly successful technique for imaging nanometre-sized samples and measuring pico- to nano-newton forces acting between atoms and molecules. When it comes to the manipulation of larger samples with forces of tens and hundreds of nano-newtons, however, the present chemistry-based modification protocols for functionalizing AFM cantilevers to achieve the formation of covalent/non-covalent linkages between the AFM probe and the sample surface do not produce strong enough bonds. For the purpose of measuring the fracture strength and other mechanical properties of stress fibres (SFs) in living as well as semi-intact fibroblast cells, we fabricated an AFM probe with a hooking function by focused ion beam technology and used the AFM probe hook to capture, pull and eventually sever a chosen SF labelled with green or red fluorescent protein.

  15. Investigation of pyrite surface state by DFT and AFM

    Institute of Scientific and Technical Information of China (English)

    先永骏; 聂琪; 文书明; 刘建; 邓久帅

    2015-01-01

    The surface states of pyrite (FeS2) were theoretically investigated using first principle calculation based on the density functional theory (DFT). The results indicate that both the (200) and (311) surfaces of pyrite undergo significant surface atom relaxation after geometry optimization, which results in a considerable distortion of the surface region. In the normal direction, i.e., perpendicular to the surface, S atoms in the first surface layer move outward from the bulk, while Fe atoms move toward the bulk, forming an S-rich surface. The surface relaxation processes are driven by electrostatic interaction, which is evidenced by a relative decrease in the surface energy after surface relaxation. Such a relaxation process is visually interpreted through the qualitative analysis of molecular mechanics. Atomic force microscopy (AFM) analysis reveals that only sulfur atom is visible on the pyrite surface. This result is consistent with the DFT data. Such S-rich surface has important influence on the flotation properties of pyrite.

  16. AFM-based force microsensor for a microrobot

    Science.gov (United States)

    Fatikow, Sergej; Fahlbusch, Stephan

    2001-10-01

    Microrobots are the result of increasing research activities at the border between microsystem technology and robotics. Today already, robots with dimensions of a few cubic- centimeters can be developed. Like conventional robots, microrobots represent a complex system that usually contains several different types of actuators and sensors. The measurement of gripping forces is the most important sensor application in micromanipulation besides visual servoing to protect the parts from too high surface pressures and thereby damage during the assembly process. Very small forces in the range of 200 (mu) N down to 0.1 (mu) N or even less have to be sensed. Thus, the aim of our current research activities is the development of a high-resolution integrated force microsensor for measuring gripping forces in a microhandling robot. On the one hand, the sensor should be a device for teleoperated manipulation tasks in a flexible microhandling station. On the other hand, typical microhandling operations should to a large extend be automated with the aid of computer-based signal processing of sensor information. The user should be provided with an interface for teleoperated manipulation and an interface for partially automated manipulation of microobjects. In this paper, a concept for the measurement of gripping forces in microrobotics using piezoresistive AFM (atomic force microscope) cantilevers is introduced. Further on, the concept of a microrobot-based SEM station and its applications are presented.

  17. Quantitative Assessment of Aflatoxin (AFM1) in Milk Collected from Dairy Farms in Faisalabad, Pakistan

    International Nuclear Information System (INIS)

    Milk contamination with aflatoxin (AFM1) is an issue of great concern in developing countries like Pakistan which demands a great attention. Milk constitutes an important part of human diet, particularly for the youngs. So, it is our utmost need to assess the presence of AFM1 in milk. In the present study assessment of AFM1 in milk collected from different dairy farms of Faisalabad was carried out using High Performance Liquid Chromatography (HPLC) equipped with Fluorescence detector. The results were compared with pre-established maximum residual limit (MRL) in order to evaluate the safety of milk for human consumption. The study revealed that all the 50 tested samples were found positive for AFM1 contamination at various levels. Among buffalo dairy farms concentration of AFM1 ranged between 0.0513 λg L-1 and 0.1006 μg L-1. From the cow dairy farms, the AFM1 contamination level was found lowest with a mean of 0.0397 μg L-1 and the highest AFM1 contamination level was with a mean of 0.1143 μg L-1. Overall percentage of AFM1 contamination and concentration levels were found higher in the milk collected from buffalo dairy farms as compared to cow dairy farms. 21 out of 25 (84 percentage) buffalo and 18 out of 25 (72 percentage) cow milk samples were exceeded the European Commission MRL of 0.050 mu g L-1. The results of the present study will be helpful for regulations implementation in order to minimize or avoid the AFM1 contamination in milk from the farms in the study area. (author)

  18. The formation of liquid bridge in different operating modes of AFM

    Science.gov (United States)

    Wei, Zheng; Sun, Yan; Ding, WenXuan; Wang, ZaiRan

    2016-09-01

    The liquid bridge is one of the principal factors that cause artifacts in ambient-pressure atomic force microscope (AFM) images. Additionally, it is the main component of the adhesion force in ambient conditions. To understand the AFM imaging mechanism and the sample characteristics, it is essential to study the liquid bridge. This study interprets the physical mechanism involved in liquid bridge formation, which is composed of three different physical processes: the squeezing process, capillary condensation, and liquid film flow. We discuss the contributions of these three mechanisms to the volume and the capillary force of the liquid bridge in different AFM operation modes.

  19. Tuning the resonance of a photonic crystal microcavity with an AFM probe.

    Science.gov (United States)

    Märki, Iwan; Salt, Martin; Herzig, Hans Peter

    2006-04-01

    We present theoretical and experimental results on switching and tuning of a two-dimensional photonic crystal resonant microcavity by means of a silicon AFM tip, probing the highly localized optical field in the vicinity of the cavity. On-off switching and modulation of the transmission signal in the kHz range is achieved by bringing an AFM tip onto the center of the microcavity, inducing a damping effect on the transmission resonance. Tuning of the resonant wavelength in the order of several nanometers becomes possible by inserting the AFM tip into one of the holes of the Bragg mirror forming the microcavity in the propagation direction. PMID:19516436

  20. Implementing atomic force microscopy (AFM) for studying kinetics of gold nanoparticle's growth

    DEFF Research Database (Denmark)

    Georgiev, P.; Bojinova, A.; Kostova, B.;

    2013-01-01

    In a novel experimental approach Atomic Force Microscopy (AFM) was applied as a tool for studying the kinetics of gold nanoparticle growth. The gold nanoparticles were obtained by classical Turkevich citrate synthesis at two different temperatures. From the analysis of AFM images during the...... synthesis process the nanoparticle s' sizes were obtained. To demonstrate the applicability and the reliability of the proposed experimental approach we studied the nanoparticles growth at two different temperatures by spectrophotometric measurements and compared them with the results from AFM experimental...

  1. Ultra thin films of nanocrystalline Ge studied by AFM and interference enhanced Raman scattering

    OpenAIRE

    Balaji, S.; S. Mohan; Muthu, DVS; Sood, AK

    2003-01-01

    Initial growth stages of the ultra thin films of germanium (Ge) prepared by ion beam sputter deposition have been studied using atomic force microscope (AFM) and interference enhanced Raman scattering. The growth of the films follows Volmer–Weber growth mechanism. Analysis of the AFM images shows that Ostwald ripening of the grains occurs as the thickness of the film increases. Raman spectra of the Ge films reveal phonon confinement along the growth direction and show that the misfit str...

  2. Integrated AFM-Raman for molecular characterization of peptide nano- and micro-tubes

    OpenAIRE

    Sinjab, Faris

    2015-01-01

    This work is focused on exploring a unique integration of techniques, Raman micro-spectroscopy and atomic force microscopy (AFM), which when combined offer more than the sum of their respective parts. The non-invasive chemical specificity afforded by Raman spectroscopy, combined with the nanoscale-resolution topographic imaging of AFM offer much individually. The physics underlying the practical application of each technique is very general; Raman spectroscopy detects molecular vibrational...

  3. Graphite–castor oil polyurethane composite electrode surfaces – AFM morphological and electrochemical characterisation

    OpenAIRE

    Chiorcea-Paquim, Ana-Maria; Diculescu, Victor Constantin; Cervini, Priscila; Cavalheiro, Eder Tadeu Gomes; Brett, Ana Maria Oliveira

    2014-01-01

    Graphite–castor oil polyurethane composite electrodes with different graphite weight percentages, 30–70% graphite–polyurethane w w−1, were morphologically studied by atomic force microscopy (AFM) and voltammetry. AFM images and r.m.s. roughness measurements demonstrated that the polyurethane roughness decreased with increasing the graphite content, composites of 50% and 60% graphite–polyurethane w w−1 showing the smother electrode surface. The electrochemical characterisation was performed in...

  4. Morphological analysis of polymers on hair fibers by SEM and AFM

    OpenAIRE

    Valéria Fernandes Monteiro; Aline Martins Duboc Natal; Luís Edmundo Bastos Soledade; Elson Longo

    2003-01-01

    The polyquaternium 7® polymer is widely used in cosmetic formulations. Morphologic alterations in hair fibers were observed after the application of the polyquaternium 7® polymer, using SEM and AFM. Continuous applications of this product indicated that it accumulates on the fibers, improving the aspect of the hair surface. Quantitative analysis of the images obtained by AFM was undertaken. The data obtained for the hair surface roughness indicates that the fibers treated with the polymer pre...

  5. Characterization of the Polycaprolactone Melt Crystallization: Complementary Optical Microscopy, DSC, and AFM Studies

    OpenAIRE

    Speranza, V; Sorrentino, A; F. De Santis; Pantani, R.

    2014-01-01

    The first stages of the crystallization of polycaprolactone (PCL) were studied using several techniques. The crystallization exotherms measured by differential scanning calorimetry (DSC) were analyzed and compared with results obtained by polarized optical microscopy (POM), rheology, and atomic force microscope (AFM). The experimental results suggest a strong influence of the observation scale. In particular, the AFM, even if limited on time scale, appears to be the most sensitive technique t...

  6. A Multifunctional Frontloading Approach for Repeated Recycling of a Pressure-Controlled AFM Micropipette.

    Directory of Open Access Journals (Sweden)

    Phillip Roder

    Full Text Available Fluid force microscopy combines the positional accuracy and force sensitivity of an atomic force microscope (AFM with nanofluidics via a microchanneled cantilever. However, adequate loading and cleaning procedures for such AFM micropipettes are required for various application situations. Here, a new frontloading procedure is described for an AFM micropipette functioning as a force- and pressure-controlled microscale liquid dispenser. This frontloading procedure seems especially attractive when using target substances featuring high costs or low available amounts. Here, the AFM micropipette could be filled from the tip side with liquid from a previously applied droplet with a volume of only a few μL using a short low-pressure pulse. The liquid-loaded AFM micropipettes could be then applied for experiments in air or liquid environments. AFM micropipette frontloading was evaluated with the well-known organic fluorescent dye rhodamine 6G and the AlexaFluor647-labeled antibody goat anti-rat IgG as an example of a larger biological compound. After micropipette usage, specific cleaning procedures were tested. Furthermore, a storage method is described, at which the AFM micropipettes could be stored for a few hours up to several days without drying out or clogging of the microchannel. In summary, the rapid, versatile and cost-efficient frontloading and cleaning procedure for the repeated usage of a single AFM micropipette is beneficial for various application situations from specific surface modifications through to local manipulation of living cells, and provides a simplified and faster handling for already known experiments with fluid force microscopy.

  7. Exploring the complex mechanical properties of xanthan scaffolds by AFM-based force spectroscopy

    OpenAIRE

    Hao Liang; Guanghong Zeng; Yinli Li; Shuai Zhang; Huiling Zhao; Lijun Guo; Bo Liu; Mingdong Dong

    2014-01-01

    The polysaccharide xanthan has been extensively studied owing to its potential application in tissue engineering. In this paper, xanthan scaffold structures were investigated by atomic force microscope (AFM) in liquid, and the mechanical properties of the complex xanthan structures were investigated by using AFM-based force spectroscopy (FS). In this work, three types of structures in the xanthan scaffold were identified based on three types of FS stretching events. The fact that the complex ...

  8. Insight into mechanics of AFM tip-based nanomachining: bending of cantilevers and machined grooves

    Science.gov (United States)

    Al-Musawi, R. S. J.; Brousseau, E. B.; Geng, Y.; Borodich, F. M.

    2016-09-01

    Atomic force microscope (AFM) tip-based nanomachining is currently the object of intense research investigations. Values of the load applied to the tip at the free end of the AFM cantilever probe used for nanomachining are always large enough to induce plastic deformation on the specimen surface contrary to the small load values used for the conventional contact mode AFM imaging. This study describes an important phenomenon specific for AFM nanomachining in the forward direction: under certain processing conditions, the deformed shape of the cantilever probe may change from a convex to a concave orientation. The phenomenon can principally change the depth and width of grooves machined, e.g. the grooves machined on a single crystal copper specimen may increase by 50% on average following such a change in the deformed shape of the cantilever. It is argued that this phenomenon can take place even when the AFM-based tool is operated in the so-called force-controlled mode. The study involves the refined theoretical analysis of cantilever probe bending, the analysis of experimental signals monitored during the backward and forward AFM tip-based machining and the inspection of the topography of produced grooves.

  9. A rapid and automated relocation method of an AFM probe for high-resolution imaging

    Science.gov (United States)

    Zhou, Peilin; Yu, Haibo; Shi, Jialin; Jiao, Niandong; Wang, Zhidong; Wang, Yuechao; Liu, Lianqing

    2016-09-01

    The atomic force microscope (AFM) is one of the most powerful tools for high-resolution imaging and high-precision positioning for nanomanipulation. The selection of the scanning area of the AFM depends on the use of the optical microscope. However, the resolution of an optical microscope is generally no larger than 200 nm owing to wavelength limitations of visible light. Taking into consideration the two determinants of relocation—relative angular rotation and positional offset between the AFM probe and nano target—it is therefore extremely challenging to precisely relocate the AFM probe to the initial scan/manipulation area for the same nano target after the AFM probe has been replaced, or after the sample has been moved. In this paper, we investigate a rapid automated relocation method for the nano target of an AFM using a coordinate transformation. The relocation process is both simple and rapid; moreover, multiple nano targets can be relocated by only identifying a pair of reference points. It possesses a centimeter-scale location range and nano-scale precision. The main advantages of this method are that it overcomes the limitations associated with the resolution of optical microscopes, and that it is label-free on the target areas, which means that it does not require the use of special artificial markers on the target sample areas. Relocation experiments using nanospheres, DNA, SWCNTs, and nano patterns amply demonstrate the practicality and efficiency of the proposed method, which provides technical support for mass nanomanipulation and detection based on AFM for multiple nano targets that are widely distributed in a large area.

  10. AFM Bio-Mechanical Investigation of the Taxol Treatment of Breast Cancer Cells

    Science.gov (United States)

    Smith, Dylan; Patel, Dipika; Monjaraz, Fernando; Park, Soyeun

    2009-10-01

    Cancerous cells are known to be softer and easier to deform than normal cells. Changes in mechanical properties originate from the alteration of the actin cytoskeleton. The mechanism of cancer treatment using Taxol is related to the stabilization of microtubules. It has been shown that Taxol binds to polymerized tublin, stabilizes it against disassembly, and consequently inhibits cell division. An accurate quantitative study still lacks to relate the microtubule stabilizing effect with the cellular mechanical properties. We utilized our AFM to study changes in elastic properties of treated breast cancer cells. The AFM has several advantages for precise force measurements on a localized region with nanometer lateral dimension. In previous AFM studies, measurable contributions from the underlying hard substrate have been an obstacle to accurately determine the properties on thin samples. We modified our AFM tip to obtain the exact deformation profile as well as reducing the high stresses produced. We have probed depth profiles of mechanical properties of the taxol-treated and untreated cells by varying the indentation depth of the AFM-nanoindenting experiments.

  11. Fractal analysis of AFM images of the surface of Bowman's membrane of the human cornea.

    Science.gov (United States)

    Ţălu, Ştefan; Stach, Sebastian; Sueiras, Vivian; Ziebarth, Noël Marysa

    2015-04-01

    The objective of this study is to further investigate the ultrastructural details of the surface of Bowman's membrane of the human cornea, using atomic force microscopy (AFM) images. One representative image acquired of Bowman's membrane of a human cornea was investigated. The three-dimensional (3-D) surface of the sample was imaged using AFM in contact mode, while the sample was completely submerged in optisol solution. Height and deflection images were acquired at multiple scan lengths using the MFP-3D AFM system software (Asylum Research, Santa Barbara, CA), based in IGOR Pro (WaveMetrics, Lake Oswego, OR). A novel approach, based on computational algorithms for fractal analysis of surfaces applied for AFM data, was utilized to analyze the surface structure. The surfaces revealed a fractal structure at the nanometer scale. The fractal dimension, D, provided quantitative values that characterize the scale properties of surface geometry. Detailed characterization of the surface topography was obtained using statistical parameters, in accordance with ISO 25178-2: 2012. Results obtained by fractal analysis confirm the relationship between the value of the fractal dimension and the statistical surface roughness parameters. The surface structure of Bowman's membrane of the human cornea is complex. The analyzed AFM images confirm a fractal nature of the surface, which is not taken into account by classical surface statistical parameters. Surface fractal dimension could be useful in ophthalmology to quantify corneal architectural changes associated with different disease states to further our understanding of disease evolution.

  12. Micro contact and stick-slip number between AFM probe tip and sample surface

    Institute of Scientific and Technical Information of China (English)

    ZHANG; Xiangjun; (张向军); MENG; Yonggang; (孟永钢); WEN; Shizhu; (温诗铸)

    2003-01-01

    In an atomic force microscope (AFM), the cantilever probe, probe tip and sample surface form a micro system in which micro contact, elastic deformation, relative sliding and friction occur during scanning with the contact mode. In this paper, the energy conversion and dissipation during scanning process in the micro system is investigated based on the Mauges-Daules contact model. A dimensionless stick-slip number(η=( )) is defined to describe the micro stick-slip behavior under AFM. Through numerical simulation of the dynamics of the probe tip, it is shown that AFM lateral force is dependent on the defined stick-slip number. If η 1, the tip moves off the sticking points with an adhesion hysteresis, resulting in an energy dissipation. Therefore, the stick-slip number can serve as a characteristic parameter. Numerical simulation of AFM lateral force with different stick-slip numbers is in agreement with experimental results. Finally a method to extract frictional force from the AFM lateral force signal is proposed.

  13. AFM as an analysis tool for high-capacity sulfur cathodes for Li–S batteries

    Directory of Open Access Journals (Sweden)

    Renate Hiesgen

    2013-10-01

    Full Text Available In this work, material-sensitive atomic force microscopy (AFM techniques were used to analyse the cathodes of lithium–sulfur batteries. A comparison of their nanoscale electrical, electrochemical, and morphological properties was performed with samples prepared by either suspension-spraying or doctor-blade coating with different binders. Morphological studies of the cathodes before and after the electrochemical tests were performed by using AFM and scanning electron microscopy (SEM. The cathodes that contained polyvinylidene fluoride (PVDF and were prepared by spray-coating exhibited a superior stability of the morphology and the electric network associated with the capacity and cycling stability of these batteries. A reduction of the conductive area determined by conductive AFM was found to correlate to the battery capacity loss for all cathodes. X-ray diffraction (XRD measurements of Li2S exposed to ambient air showed that insulating Li2S hydrolyses to insulating LiOH. This validates the significance of electrical ex-situ AFM analysis after cycling. Conductive tapping mode AFM indicated the existence of large carbon-coated sulfur particles. Based on the analytical findings, the first results of an optimized cathode showed a much improved discharge capacity of 800 mA·g(sulfur−1 after 43 cycles.

  14. Multiparametric high-resolution imaging of native proteins by force-distance curve-based AFM.

    Science.gov (United States)

    Pfreundschuh, Moritz; Martinez-Martin, David; Mulvihill, Estefania; Wegmann, Susanne; Muller, Daniel J

    2014-05-01

    A current challenge in the life sciences is to understand how the properties of individual molecular machines adjust in order to meet the functional requirements of the cell. Recent developments in force-distance (FD) curve-based atomic force microscopy (FD-based AFM) enable researchers to combine sub-nanometer imaging with quantitative mapping of physical, chemical and biological properties. Here we present a protocol to apply FD-based AFM to the multiparametric imaging of native proteins under physiological conditions. We describe procedures for experimental FD-based AFM setup, high-resolution imaging of proteins in the native unperturbed state with simultaneous quantitative mapping of multiple parameters, and data interpretation and analysis. The protocol, which can be completed in 1-3 d, enables researchers to image proteins and protein complexes in the native unperturbed state and to simultaneously map their biophysical and biochemical properties at sub-nanometer resolution. PMID:24743419

  15. Accuracy optimization of high-speed AFM measurements using Design of Experiments

    DEFF Research Database (Denmark)

    Tosello, Guido; Marinello, F.; Hansen, Hans Nørgaard;

    2010-01-01

    Atomic Force Microscopy (AFM) is being increasingly employed in industrial micro/nano manufacturing applications and integrated into production lines. In order to achieve reliable process and product control at high measuring speed, instrument optimization is needed. Quantitative AFM measurement......, the estimated dimensions of measured features. The definition of scan settings is based on a comprehensive optimization that targets maximization of information from collected data and minimization of measurement uncertainty and scan time. The Design of Experiments (DOE) technique is proposed and applied...... to perform the optimization of AFM measurements on calibrated one-dimensional silicon grating featuring a triangular periodical profile (slopes of 54.7 degrees, period of 3 μm)....

  16. AFM-based force spectroscopy measurements of mature amyloid fibrils of the peptide glucagon

    Energy Technology Data Exchange (ETDEWEB)

    Dong Mingdong; Hovgaard, Mads Bruun; Mamdouh, Wael; Xu Sailong; Otzen, Daniel Erik; Besenbacher, Flemming [Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, DK-8000 Aarhus C (Denmark)], E-mail: dao@inano.dk, E-mail: fbe@inano.dk

    2008-09-24

    We report on the mechanical characterization of individual mature amyloid fibrils by atomic force microscopy (AFM) and AFM-based single-molecule force spectroscopy (SMFS). These self-assembling materials, formed from the 29-residue amphiphatic peptide hormone glucagon, were found to display a reversible elastic behaviour. Based on AFM morphology and SMFS studies, we suggest that the observed elasticity is due to a force-induced conformational transition which is reversible due to the {beta}-helical conformation of protofibrils, allowing a high degree of extension. The elastic properties of such mature fibrils contribute to their high stability, suggesting that the internal hydrophobic interactions of amyloid fibrils are likely to be of fundamental importance in the assembly of amyloid fibrils and therefore for the understanding of the progression of their associated pathogenic disorders. In addition, such biological amyloid fibril structures with highly stable mechanical properties can potentially be used to produce nanofibres (nanowires) that may be suitable for nanotechnological applications.

  17. Custom AFM for X-ray beamlines: in situ biological investigations under physiological conditions.

    Science.gov (United States)

    Gumí-Audenis, B; Carlà, F; Vitorino, M V; Panzarella, A; Porcar, L; Boilot, M; Guerber, S; Bernard, P; Rodrigues, M S; Sanz, F; Giannotti, M I; Costa, L

    2015-11-01

    A fast atomic force microscope (AFM) has been developed that can be installed as a sample holder for grazing-incidence X-ray experiments at solid/gas or solid/liquid interfaces. It allows a wide range of possible investigations, including soft and biological samples under physiological conditions (hydrated specimens). The structural information obtained using the X-rays is combined with the data gathered with the AFM (morphology and mechanical properties), providing a unique characterization of the specimen and its dynamics in situ during an experiment. In this work, lipid monolayers and bilayers in air or liquid environment have been investigated by means of AFM, both with imaging and force spectroscopy, and X-ray reflectivity. In addition, this combination allows the radiation damage induced by the beam on the sample to be studied, as has been observed on DOPC and DPPC supported lipid bilayers under physiological conditions. PMID:26524300

  18. Influence of atomic force microscope (AFM) probe shape on adhesion force measured in humidity environment

    Institute of Scientific and Technical Information of China (English)

    阳丽; 涂育松; 谭惠丽

    2014-01-01

    In micro-manipulation, the adhesion force has very important influence on behaviors of micro-objects. Here, a theoretical study on the effects of humidity on the adhesion force is presented between atomic force microscope (AFM) tips and substrate. The analysis shows that the precise tip geometry plays a critical role on humidity depen-dence of the adhesion force, which is the dominant factor in manipulating micro-objects in AFM experiments. For a blunt (paraboloid) tip, the adhesion force versus humidity curves tends to the apparent contrast (peak-to-valley corrugation) with a broad range. This paper demonstrates that the abrupt change of the adhesion force has high correla-tion with probe curvatures, which is mediated by coordinates of solid-liquid-vapor contact lines (triple point) on the probe profiles. The study provides insights for further under-standing nanoscale adhesion forces and the way to choose probe shapes in manipulating micro-objects in AFM experiments.

  19. Fabrication of gold nanoelectrodes based on nanolithography electrochemically through a conductive AFM tip

    Institute of Scientific and Technical Information of China (English)

    LI Tianfeng; ZHANG Xingtang; JIANG Xiaohong; LI Yuncai; DU Zuliang

    2005-01-01

    Gold nanoelectrodes were fabricated by approach of combining surface self-assembly with nanolithography electrochemically through a conductive AFM tip. The controllable structure with width and distance in nanometer as a template was constructed by nanolithography patterning process, which was accomplished by a conductive AFM tip on certain highly ordered long-tail organosilane monolayers. Then through adsorption of Cd2+ and exposure of the Cd2+-loaded surface to gaseous H2S, CdS nanowires were generated in a template-controlled self-assembly process. Finally, metallic gold nanowires were conversed from CdS nanowires by treatment with the aqueous solution of HAuCl4 via a redox chemical process, which had good conductivity proved by C-AFM.

  20. Ultra thin films of nanocrystalline Ge studied by AFM and interference enhanced Raman scattering

    Indian Academy of Sciences (India)

    S Balaji; S Mohan; D V S Muthu; A K Sood

    2003-10-01

    Initial growth stages of the ultra thin films of germanium (Ge) prepared by ion beam sputter deposition have been studied using atomic force microscope (AFM) and interference enhanced Raman scattering. The growth of the films follows Volmer-Weber growth mechanism. Analysis of the AFM images shows that Ostwald ripening of the grains occurs as the thickness of the film increases. Raman spectra of the Ge films reveal phonon confinement along the growth direction and show that the misfit strain is relieved for film thickness greater than 4 nm.

  1. Coexistence of orbital and CE-AFM orders in colossal magnetoresistance manganites: A symmetry perspective

    Science.gov (United States)

    Ribeiro, J. L.

    2016-07-01

    The complex interplay between order parameters of different nature that dominates the physics of colossal magnetoresistance manganites is analysed from a symmetry based perspective. Phenomenological energies are given for the different competing phases. It is shown that the general trends observed in different systems, such as the mutual exclusion of orbital order and A-AFM order and the related stabilization of the CE-AFM order, stem to large extend from the symmetry of the parameters involved. The possible stabilization of complex phases where charge and orbital order coexist with magnetic and ferroelectric states is also anticipated.

  2. Multiparametric imaging of biological systems by force-distance curve-based AFM.

    Science.gov (United States)

    Dufrêne, Yves F; Martínez-Martín, David; Medalsy, Izhar; Alsteens, David; Müller, Daniel J

    2013-09-01

    A current challenge in the life sciences is to understand how biological systems change their structural, biophysical and chemical properties to adjust functionality. Addressing this issue has been severely hampered by the lack of methods capable of imaging biosystems at high resolution while simultaneously mapping their multiple properties. Recent developments in force-distance (FD) curve-based atomic force microscopy (AFM) now enable researchers to combine (sub)molecular imaging with quantitative mapping of physical, chemical and biological interactions. Here we discuss the principles and applications of advanced FD-based AFM tools for the quantitative multiparametric characterization of complex cellular and biomolecular systems under physiological conditions. PMID:23985731

  3. Modeling peak interaction forces of soft matter with dynamic AFM in liquid

    OpenAIRE

    Vargas Guzman, Horacio Andres

    2014-01-01

    Tesis doctoral inédita leída en la Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Física Teórica de la Materia Condensada. Fecha de lectura: 23-10-2014 The atomic force microscope (AFM) is an instrument that has revolutionized the field of nanoscience and nanotechnology by enabling the characterization and manipulation of materials with nanometer (one billionth of a meter), molecular and atomic resolution. In the last 28 years a variety of experimental AFM t...

  4. Sharing my fifteen years experiences in the research field of Atomic Force Microscopy (AFM

    Directory of Open Access Journals (Sweden)

    Guha T

    2014-03-01

    Full Text Available Atomic Force Microscope (AFM was developed by Binnig and his coworkers in the year 1986. He was awarded Nobel Prize in physics for this work in 1986 in sharing with Rohrer and Ruska. Rationale to develop AFM: Scanning Tunneling Microscope (STM, the precursor to AFM is efficient in imaging electrically conducting specimen at atomic resolution. The impetus for development of AFM came to Binnig’s mind because of relatively poor efficiency of STM to image electrically non-conducting biological samples. He wondered why the surfaces be always imaged with a current but not with a force. He thought if small forces of interactions between a probe tip atoms and specimen surface atoms could be detected and amplified then imaging of biological specimen would be possible at a very high resolution. AFM working Principle: AFM is a Scanning Probe Microscopy (SPM by which imaging is realized by interaction of a probe with sample surface without any beam (light, electron and lens system. The probe is attached to a soft and sensitive cantilever and either specimen is scanned by probe or specimen scans itself under a stationary probe. Probe’s spring constant must be small and the deflection must be measurable along with high resonance frequency. The most commonly associated force with AFM is called Vander Waals force. Three modes of working are contact mode, non contact mode and tapping mode. In contact zone, the probe tip attached with cantilever is held less than a few A˚ from the sample surface and the inter-atomic force between the atoms of probe tip and sample surface is repulsive. In non-contact zone, the probe tip is held at a distance of 100s of A˚ from the sample surface and the inter-atomic force here is long range Vander Waals interaction and is attractive in nature. AFM is also called Scanning Force Microscope because the force of interaction between probe tip atoms and surface atoms is amplified to generate a signal voltage which modulates video

  5. Studying post-etching silicon crystal defects on 300mm wafer by automatic defect review AFM

    Science.gov (United States)

    Zandiatashbar, Ardavan; Taylor, Patrick A.; Kim, Byong; Yoo, Young-kook; Lee, Keibock; Jo, Ahjin; Lee, Ju Suk; Cho, Sang-Joon; Park, Sang-il

    2016-03-01

    Single crystal silicon wafers are the fundamental elements of semiconductor manufacturing industry. The wafers produced by Czochralski (CZ) process are very high quality single crystalline materials with known defects that are formed during the crystal growth or modified by further processing. While defects can be unfavorable for yield for some manufactured electrical devices, a group of defects like oxide precipitates can have both positive and negative impacts on the final device. The spatial distribution of these defects may be found by scattering techniques. However, due to limitations of scattering (i.e. light wavelength), many crystal defects are either poorly classified or not detected. Therefore a high throughput and accurate characterization of their shape and dimension is essential for reviewing the defects and proper classification. While scanning electron microscopy (SEM) can provide high resolution twodimensional images, atomic force microscopy (AFM) is essential for obtaining three-dimensional information of the defects of interest (DOI) as it is known to provide the highest vertical resolution among all techniques [1]. However AFM's low throughput, limited tip life, and laborious efforts for locating the DOI have been the limitations of this technique for defect review for 300 mm wafers. To address these limitations of AFM, automatic defect review AFM has been introduced recently [2], and is utilized in this work for studying DOI on 300 mm silicon wafer. In this work, we carefully etched a 300 mm silicon wafer with a gaseous acid in a reducing atmosphere at a temperature and for a sufficient duration to decorate and grow the crystal defects to a size capable of being detected as light scattering defects [3]. The etched defects form a shallow structure and their distribution and relative size are inspected by laser light scattering (LLS). However, several groups of defects couldn't be properly sized by the LLS due to the very shallow depth and low

  6. Probing the PEDOT:PSS/cell interface with conductive colloidal probe AFM-SECM

    Science.gov (United States)

    Knittel, P.; Zhang, H.; Kranz, C.; Wallace, G. G.; Higgins, M. J.

    2016-02-01

    Conductive colloidal probe Atomic Force-Scanning Electrochemical Microscopy (AFM-SECM) is a new approach, which employs electrically insulated AFM probes except for a gold-coated colloid located at the end of the cantilever. Hence, force measurements can be performed while biasing the conductive colloid under physiological conditions. Moreover, such colloids can be modified by electrochemical polymerization resulting, e.g. in conductive polymer-coated spheres, which in addition may be loaded with specific dopants. In contrast to other AFM-based single cell force spectroscopy measurements, these probes allow adhesion measurements at the cell-biomaterial interface on multiple cells in a rapid manner while the properties of the polymer can be changed by applying a bias. In addition, spatially resolved electrochemical information e.g., oxygen reduction can be obtained simultaneously. Conductive colloid AFM-SECM probes modified with poly(3,4-ethylenedioxythiophene) doped with polystyrene sulfonate (PEDOT:PSS) are used for single cell force measurements in mouse fibroblasts and single cell interactions are investigated as a function of the applied potential.Conductive colloidal probe Atomic Force-Scanning Electrochemical Microscopy (AFM-SECM) is a new approach, which employs electrically insulated AFM probes except for a gold-coated colloid located at the end of the cantilever. Hence, force measurements can be performed while biasing the conductive colloid under physiological conditions. Moreover, such colloids can be modified by electrochemical polymerization resulting, e.g. in conductive polymer-coated spheres, which in addition may be loaded with specific dopants. In contrast to other AFM-based single cell force spectroscopy measurements, these probes allow adhesion measurements at the cell-biomaterial interface on multiple cells in a rapid manner while the properties of the polymer can be changed by applying a bias. In addition, spatially resolved electrochemical

  7. FRAME (Force Review Automation Environment): MATLAB-based AFM data processor.

    Science.gov (United States)

    Partola, Kostyantyn R; Lykotrafitis, George

    2016-05-01

    Data processing of force-displacement curves generated by atomic force microscopes (AFMs) for elastic moduli and unbinding event measurements is very time consuming and susceptible to user error or bias. There is an evident need for consistent, dependable, and easy-to-use AFM data processing software. We have developed an open-source software application, the force review automation environment (or FRAME), that provides users with an intuitive graphical user interface, automating data processing, and tools for expediting manual processing. We did not observe a significant difference between manually processed and automatically processed results from the same data sets. PMID:26972765

  8. AFM based anodic oxidation and its application to oxidative cutting and welding of CNT

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Probe anodic oxidation by atomic force microscope (AFM) is one of the most important techniques in fabricating nano structures and devices. The technique was further studied in this paper. By analyzing the distribution of the electric field on substrate surface the dependence of oxide characters on field was discussed. The impacts of various parameters on oxide fabrication were experimentally studied. Based on these studies, we realized the oxidative cutting and welding of carbon nanotube (CNT) by the AFM based oxidation technique and provided a novel technique for the assembly and fabrication of CNT based nano devices.

  9. FRAME (Force Review Automation Environment): MATLAB-based AFM data processor.

    Science.gov (United States)

    Partola, Kostyantyn R; Lykotrafitis, George

    2016-05-01

    Data processing of force-displacement curves generated by atomic force microscopes (AFMs) for elastic moduli and unbinding event measurements is very time consuming and susceptible to user error or bias. There is an evident need for consistent, dependable, and easy-to-use AFM data processing software. We have developed an open-source software application, the force review automation environment (or FRAME), that provides users with an intuitive graphical user interface, automating data processing, and tools for expediting manual processing. We did not observe a significant difference between manually processed and automatically processed results from the same data sets.

  10. AFM and XPA data on structural features and properties of films and powders based on naphthalocyanines

    Science.gov (United States)

    Ramonova, A. G.; Nakusov, A. T.; Sozanov, V. G.; Bliev, A. P.; Magkoev, T. T.

    2015-06-01

    The template synthesis is used to produce powders and films based on naphthalocyanines and the corresponding metal complexes (Pc, CuPc, and NiPc). The atomic-force microscopy (AFM) and X-ray phase analysis (XPA) are employed in the study of structure and phase of fine powders and nanostructured films. The AFM data are used to determine the orientation and density of primary particles packed in the film. The XPA method is used to study the chemical composition and crystal structure of the synthesized samples. The regularities related to the structural features that affect the electrophysical properties of the films under study are revealed.

  11. Exploring the complex mechanical properties of xanthan scaffolds by AFM-based force spectroscopy

    Directory of Open Access Journals (Sweden)

    Hao Liang

    2014-03-01

    Full Text Available The polysaccharide xanthan has been extensively studied owing to its potential application in tissue engineering. In this paper, xanthan scaffold structures were investigated by atomic force microscope (AFM in liquid, and the mechanical properties of the complex xanthan structures were investigated by using AFM-based force spectroscopy (FS. In this work, three types of structures in the xanthan scaffold were identified based on three types of FS stretching events. The fact that the complex force responses are the combinations of different types of stretching events suggests complicated intermolecular interactions among xanthan fibrils. The results provide crucial information to understand the structures and mechanical properties of the xanthan scaffold.

  12. Study on the AFM Force Spectroscopy method for elastic modulus measurement of living cells

    Science.gov (United States)

    Demichelis, A.; Pavarelli, S.; Mortati, L.; Sassi, G.; Sassi, M.

    2013-09-01

    The cell elasticity gives information about its pathological state and metastatic potential. The aim of this paper is to study the AFM Force Spectroscopy technique with the future goal of realizing a reference method for accurate elastic modulus measurement in the elasticity range of living cells. This biological range has not been yet explored with a metrological approach. Practical hints are given for the realization of a Sylgard elasticity scale. Systematic effects given by the sample curing thickness and nanoindenter geometry have been found with regards of the measured elastic modulus. AFM measurement reproducibility better than 20% is obtained in the entire investigated elastic modulus scale of 101 - 104 kPa.

  13. Afm Measrurements of Martian Soil Particles Using Mems Technology - Results from the PHOENIX Mission

    Science.gov (United States)

    Gautsch, S.; Parrat, D.; de Rooij, N. F.; Staufer, U.; Morookian, J. M.; Hecht, M. H.; Vijendran, S.; Sykulska, H.; Pike, W. T.

    2011-12-01

    Light scattering experiments conducted on Mars indicated that soil particles have dimensions around 1 μm. Particles in that range play an important role in the gas exchange between sub-surface water ice and the atmosphere. Their shape can help tracing the geological history and may indicate past presence of liquid water. NASA's Phoenix mission therefore decided to analyze soil and dust particles in the sub-micrometer to a few micrometer range using an atomic force microscope (AFM) for the first time on another planet. The co-axially mounted AFM was capable of resolving particles with 10nm lateral resolution. A MEMS approach combined with mechatronic concepts for the scanner was selected for implementing the AFM. For redundancy, the sensor chip featured eight silicon cantilevers each with a 7 to 8 μm high tip. The cantilevers could be cleaved off if contaminated. During NASA's Phoenix Mission, which operated on the red planet from May to October 2008, we could demonstrate successful AFM operations. The instrument has executed 85 experiments of which 26 were needed for calibration. Of the remaining experiments about half (28) returned images where signatures of particles could be discerned.

  14. New insights into the mucoadhesion of pectins by AFM roughness parameters in combination with SPR

    DEFF Research Database (Denmark)

    Joergensen, Lars; Klösgen, Beate; Simonsen, Adam Cohen;

    2011-01-01

    of the AFM scans revealed a significant change of roughness parameters when low-ester pectin was introduced to mica supported bovine submaxillarymucin, indicating a high mucoadhesion for this type of pectin. Only minor changes were observed with high-ester and amidated pectin. The same ranking order...

  15. Effective AFM cantilever tip size: methods for in-situ determination

    Science.gov (United States)

    Maragliano, Carlo; Glia, Ayoub; Stefancich, Marco; Chiesa, Matteo

    2015-01-01

    In atomic force microscopy (AFM) investigations, knowledge of the cantilever tip radius R is essential for the quantitative interpretation of experimental observables. Here we propose two techniques to rapidly quantify in-situ the effective tip radius of AFM probes. The first method is based on the strong dependency of the minimum value of the free amplitude required to observe a sharp transition from attractive to repulsive force regimes on the AFM probe radius. Specifically, the sharper the tip, the smaller the value of free amplitude required to observe such a transition. The key trait of the second method is to treat the tip-sample system as a capacitor. Provided with an analytical model that takes into account the geometry of the tip-sample’s capacitance, one can quantify the effective size of the tip apex fitting the experimental capacitance versus distance curve. Flowchart-like algorithms, easily implementable on any hardware, are provided for both methods, giving a guideline to AFM practitioners. The methods’ robustness is assessed over a wide range of probes of different tip radii R (i.e. 4 < R < 50 nm) and geometries. Results obtained from both methods are compared with the nominal values given by manufacturers and verified by acquiring scanning electron microscopy images. Our observations show that while both methods are reliable and robust over the range of tip sizes tested, the critical amplitude method is more accurate for relatively sharp tips (4 nm < R < 10 nm).

  16. Nanomechanical probing of soft matter through hydrophobic AFM tips fabricated by two-photon polymerization

    Science.gov (United States)

    Suriano, Raffaella; Zandrini, Tommaso; De Marco, Carmela; Osellame, Roberto; Turri, Stefano; Bragheri, Francesca

    2016-04-01

    Atomic force microscopy (AFM) nanoindentation of soft materials is a powerful tool for probing mechanical properties of biomaterials. Though many results have been reported in this field over the last decade, adhesion forces between the tip and the sample hinder the elastic modulus measurement when hydrophilic soft samples are investigated. Here, two-photon polymerization (2PP) technology was used to fabricate hydrophobic perfluoropolyether-based AFM tips. The hydrophobic 2PP tips allowed us to overcome the limitations of commercial and functionalized tips as well as to successfully measure the elastic modulus of medically relevant soft materials in air. Our results obtained in the characterization of poly(dimethyl siloxane) and polyethylene glycol hydrogels showed lower adhesion forces over a larger measurement range when compared to measurements performed with commercial tips. The elastic moduli measured by means of hydrophobic 2PP AFM tips were also found to be comparable to those obtained using conventional techniques for macroscopic samples. We successfully showed that the hydrophobic AFM tips developed by this highly versatile technology enable the study of mechanical properties of soft matter, benefiting from reduced sample-tip interactions, and a custom-made shape and dimension of the tips.

  17. Modelling the surface generation process during AFM probe-based machining: simulation and experimental validation

    International Nuclear Information System (INIS)

    The controlled removal of material conducted with the tip of an atomic force microscope (AFM) probe is a technique that has started gaining increased attention in recent years within the micro and nano manufacturing research community. The attractive characteristics of this process are that it is relatively simple to implement and low-cost compared with vacuum-based lithography techniques for micro and nano fabrication. However, similarly to any machining process, the resulting surface finish of features cut with an AFM probe can be critical. In this context, the focus of the paper is on the development and validation of a novel analytical model for predicting the floor surface roughness induced by AFM probe-based machining when generating cavities composed of linear parallel grooves. In addition to kinematic parameters, the proposed model takes into account the minimum chip thickness and elastic recovery associated with each phase present within the microstructure of a workpiece. The implementation of the model was carried out and its performance tested when processing a dual phase brass alloy using an AFM nano-indentation probe. A relatively good agreement was achieved between the analytical and experimental results with an average prediction error of 21% when assessing the arithmetic average roughness, Ra. (paper)

  18. The atomic force (AFM), scanning tunneling (STM) and scanning force (SFM) microscopies

    International Nuclear Information System (INIS)

    This work deals with the atomic force (AFM), scanning tunneling (STM) and scanning force (SFM) microscopies. These analysis methods are based on different physical principles. Nevertheless, in all of them, a probe is situated at a few angstroms or at the direct contact of the studied sample and carries out a controlled scanning of the sample surface. Their physical principles and their running ways are described. Their potentialities and limits are given too. With these analysis methods, and more particularly with the AFM can be observed the crystal structure of isolated biological molecules and the tri dimensional structure of biological molecules which are inserted in artificial membranes. One of the future prospect of the AFM in biology is the direct observation of living cells. Indeed, it will offer the opportunity to follow, with time and in space, the individual cells behaviour and their morphological modifications. Others uses and developments of the AFM concerns the in situ analysis of mechanisms which govern the crystal growth or the direct viewing of a protein enzymatic activity. (O.M.). 37 refs., 7 figs

  19. Photoluminescence and AFM characterisation of photochemically etched highly resistive n-type silicon

    NARCIS (Netherlands)

    Hadjesi, T.; Kooij, E.S.; Yamamoto, N.; Sakamaki, K.; Takai, H.; Gabouze, N.

    2005-01-01

    A light-emitting layer has been made on highly resistive n-type silicon (6.4 kcm) using photochemical etching in a mixture of HF with H2O2. The morphology of the porous films grown after exposure to a He-Ne laser (633 nm) at normal incidence was analysed by Atomic Force Microscopy (AFM). The results

  20. Fracture Mechanics Testing of Titanium 6AL-4V in AF-M315E

    Science.gov (United States)

    Sampson, J. W.; Martinez, J.; McLean, C.

    2016-01-01

    The Green Propellant Infusion Mission (GPIM) will demonstrate the performance of AF-M315E monopropellant on orbit. Flight certification requires a safe-life analysis of the titanium alloy fuel tank to ensure inherent processing flaws will not cause failure during the design life of the tank. Material property inputs for this analysis require testing to determine the stress intensity factor for environment-assisted cracking (KEAC) of Ti 6Al-4V in combination with the AF-M315E monopropellant. Testing of single-edge notched, or SE(B), specimens representing the bulk tank membrane and weld material were performed in accordance with ASTM E1681. Specimens with fatigue pre-cracks were loaded into test fixtures so that the crack tips were exposed to AF-M315E at 50 C for a duration of 1,000 hours. Specimens that did not fail during exposure were opened to inspect the crack surfaces for evidence of crack growth. The threshold stress intensity value, KEAC, is the highest applied stress intensity that produced neither a failure of the specimen during the exposure nor showed evidence of crack growth. The threshold stress intensity factor for environment-assisted cracking of the Ti 6Al-4V forged tank material was found to be at least 22 ksivin and at least 31 ksivin for the weld material when exposed to AF-M315E monopropellant.

  1. Relaxation of a Simulated Lipid Bilayer Vesicle Compressed by an AFM

    CERN Document Server

    Barlow, Ben M; Joos, Béla

    2016-01-01

    Using Coarse-Grained Molecular Dynamics simulations, we study the relaxation of bilayer vesicles, uniaxially compressed by an Atomic Force Microscope (AFM) cantilever. The relaxation time exhibits a strong force-dependence. Force-compression curves are very similar to recent experiments wherein giant unilamellar vesicles were compressed in a nearly identical manner.

  2. Closed Mechanoelectrochemical Cycles of Individual Single-Chain Macromolecular Motors by AFM

    NARCIS (Netherlands)

    Shi, Weiqing; Giannotti, Marina I.; Zhang, Xi; Hempenius, Mark A.; Schönherr, Holger; Vancso, G. Julius

    2007-01-01

    Motor cycles: Mechanoelectrochemical loops of single-chain macromolecular motors based on individual end-grafted poly(ferrocenyldimethylsilane) are shown by AFM to have an efficiency of up to 26 %. Upon oxidation of a prestretched chain, the chain length increases and the force decreases significant

  3. Thin block copolymer films : film formation and corrugation under the AFM tip

    NARCIS (Netherlands)

    Maas, J.H.; Cohen Stuart, M.A.; Fleer, G.J.

    2000-01-01

    The tip of an atomic force microscope was used to induce nanoscale ordering in thin films of polystyrene-poly(4-vinyl pyridine) block copolymers under low force. The AFM tip produces rims on a mesoscopic scale oriented perpendicularly to the scanning direction. A wide range of molecular weights of b

  4. Surface Mapping with an AFM-CMM Integrated System and Stitching Software

    DEFF Research Database (Denmark)

    De Chiffre, Leonardo; Marinello, Francesco; Bariani, Paolo;

    2004-01-01

    In the context of micro-technology, dimensions in the order of hundreds of micrometers are often to be measured, while the detection of the finest details and the analysis of nano-roughness call for the use of highly resolving sensors. AFM probes, owing to the sharpness of their tip combined with...

  5. Nano-Workbench: A Combined Hollow AFM Cantilever and Robotic Manipulator

    NARCIS (Netherlands)

    Pérez Garza, H.; Ghatkesar, M.K.; Basak, S.; Löthman, P.; Staufer, U.

    2015-01-01

    To manipulate liquid matter at the nanometer scale, we have developed a robotic assembly equipped with a hollow atomic force microscope (AFM) cantilever that can handle femtolitre volumes of liquid. The assembly consists of four independent robots, each sugar cube sized with four degrees of freedom.

  6. Interaction between nitric oxide and lipid-like DDPA LB film investigated with SHG and AFM

    Institute of Scientific and Technical Information of China (English)

    YU, An- Chi; LIU, Ting-Ting; LUO, Guo-Bin; YING, Li-Ming; ZHAO, Xin-Sheng; HUANG, Yan-Yi; HUANG, Chun-Hui

    2000-01-01

    Interactions between Nitric oxide (NO) and DDPA LangmuirBlodgett (LB) film are investigated with second harmonic generation (SHG) and atomic force microscopy (AFM). It has been found that the adsorption of NO molecules on DDPA LB film only changes the value of the second-order susceptibility of the DDPA molecule on film but not its orientation.

  7. Evaluation of shooting distance by AFM and FTIR/ATR analysis of GSR.

    Science.gov (United States)

    Mou, Yongyan; Lakadwar, Jyoti; Rabalais, J Wayne

    2008-11-01

    The techniques of atomic force microscopy (AFM) and Fourier transform infrared attenuated total reflectance (FTIR/ATR) spectroscopy are applied to the analysis of gun-shot residue (GSR) to test their ability to determine shooting distance and discrimination of the powder manufacturers. AFM is a nondestructive technique that is capable of characterizing the shapes and size distributions of GSR particles with resolution down to less than a nanometer. This may be useful for estimation of the shooting distance. Our AFM images of GSR show that the size distribution of the particles is inversely proportional to the shooting distance. Discrimination of powder manufacturers is tested by FTIR/ATR investigation of GSR. Identifying the specific compounds in the GSR by FTIR/ATR was not possible because it is a mixture of the debris of several compounds that compose the residue. However, it is shown that the GSR from different cartridges has characteristic FTIR/ATR bands that may be useful in differentiating the powder manufacturers. It appears promising that the development of AFM and FTIR/ATR databases for various powder manufacturers may be useful in analysis and identification of GSR. PMID:18761553

  8. Characterization of Local Mechanical Properties of Polymer Thin Films and Polymer Nanocomposites via AFM indentations

    Science.gov (United States)

    Cheng, Xu

    AFM indentation has become a tool with great potential in the characterization of nano-mechanical properties of materials. Thanks to the nanometer sized probes, AFM indentation is capable of capturing the changes of multiple properties within the range of tens of nanometers, such task would otherwise be difficult by using other experiment instruments. Despite the great potentials of AFM indentation, it operates based on a simple mechanism: driving the delicate AFM probe to indent the sample surface, and recording the force-displacement response. With limited information provided by AFM indentation, efforts are still required for any practice to successfully extract the desired nano-scale properties from specific materials. In this thesis, we focus on the mechanical properties of interphase between polymer and inorganic materials. It is known that in nanocomposites, a region of polymer exist around nanoparticles with altered molecular structures and improved properties, which is named as interphase polymer. The system with polymer thin films and inorganic material substrates is widely used to simulate the interphase effect in nanocomposites. In this thesis, we developed an efficient and reliable method to process film/substrate samples and characterize the changes of local mechanical properties inside the interphase region with ultra-high resolution AFM mechanical mapping technique. Applying this newly developed method, the interphase of several film/substrate pairs were examined and compared. The local mechanical properties on the other side of the polymer thin film, the free surface side, was also investigated using AFM indentation equipped with surface modified probes. In order to extract the full spectrum of local elastic modulus inside the surface region in the range of only tens of nanometers, the different contact mechanics models were studied and compared, and a Finite Element model was also established. Though the film/substrate system has been wide used as

  9. Calibration of AFM cantilever stiffness: a microfabricated array of reflective springs.

    Science.gov (United States)

    Cumpson, P J Peter J; Zhdan, Peter; Hedley, John

    2004-08-01

    Calibration of the spring constant of atomic force microscope (AFM) cantilevers is necessary for the measurement of nanonewton and piconewton forces, which are critical to analytical applications of AFM in the analysis of polymer surfaces, biological structures and organic molecules. We have developed a compact and easy-to-use reference standard for this calibration. The new artifact consists of an array of 12 dual spiral-cantilever springs, each supporting a mirrored polycrystalline silicon disc of 160 microm in diameter. These devices were fabricated by a three-layer polysilicon surface micromachining method, including a reflective layer of gold on chromium. We call such an array a Microfabricated Array of Reference Springs (MARS). These devices have a number of advantages. Cantilever calibration using this device is straightforward and rapid. The devices have very small inertia, and are therefore resistant to shock and vibration. This means they need no careful treatment except reasonably clean laboratory conditions. The array spans the range of spring constant from around 0.16 to 11 N/m important in AFM, allowing almost all contact-mode AFM cantilevers to be calibrated easily and rapidly. Each device incorporates its own discrete gold mirror to improve reflectivity. The incorporation of a gold mirror both simplifies calibration of the devices themselves (via Doppler velocimetry) and allows interferometric calibration of the AFM z-axis using the apparent periodicity in the force-distance curve before contact. Therefore, from a single force-distance curve, taking about one second to acquire, one can calibrate the cantilever spring constant and, optionally, the z-axis scale. These are all the data one needs to make accurate and reliable force measurements. PMID:15231316

  10. Effects of the AFM tip trace on nanobundles formation on the polymer surface

    Energy Technology Data Exchange (ETDEWEB)

    Yan Yongda, E-mail: yanyongda@yahoo.com.cn [Key Laboratory of Micro-systems and Micro-structures Manufacturing of Ministry of Education, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Center for Precision Engineering, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Sun Yang; Yang Yanting; Hu Zhenjiang [Key Laboratory of Micro-systems and Micro-structures Manufacturing of Ministry of Education, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Center for Precision Engineering, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Zhao Xuesen [Center for Precision Engineering, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China)

    2012-10-01

    Highlights: Black-Right-Pointing-Pointer The AFM tip is used to scratch the PC surface once to form nanobundle structures. Black-Right-Pointing-Pointer Effects of the tip trace on bundles formation are studied based on a modified AFM. Black-Right-Pointing-Pointer The sample scanning mode is feasible for perfect nanobundle structures formation. - Abstract: Atomic Force Microscope (AFM) has become a popular experimental tool for the nanotribological studies. Nanobundles formation perpendicular to the scanning direction has been reported as a typical wear mode for the thermoplastics, and such bundle structures are also considered as sinusoidal wave micro-/nanostructures now. In the present study, the AFM tip based nanomechanical machining method is employed to scratch a polymer Polycarbonate (PC) surface for only once with the normal load of several micro-Newtons in order to achieve the perfect regular nanobundle structures. Based on a modified AFM system, effects of different tip traces in the tip scanning mode and in the sample scanning mode on nanobundles formation on the PC surface are studied. The experimental results show that the controlled reciprocal movement of the stage in the sample scanning mode is feasible for perfect nanobundle structures formation. Moreover, effects of the normal load and the feed on bundles formation in the sample scanning mode are analyzed. Experimental results reveal that the feed value directly affects the formed patterns including the bundles and grooves structures. The reciprocal effect of the tip trace is the decisive factor of forming ideal nanobundles. The repeating times on the same area acted by the tip which are larger than twice are necessary to form a perfect nanobundle structure.

  11. Influence of smectite suspension structure on sheet orientation in dry sediments: XRD and AFM applications.

    Science.gov (United States)

    Zbik, Marek S; Frost, Ray L

    2010-06-15

    The structure-building phenomena within clay aggregates are governed by forces acting between clay particles. Measurements of such forces are important to understand in order to manipulate the aggregate structure for applications such as dewatering of mineral processing tailings. A parallel particle orientation is required when conducting XRD investigation on the oriented samples and conduct force measurements acting between basal planes of clay mineral platelets using atomic force microscopy (AFM). To investigate how smectite clay platelets were oriented on silicon wafer substrate when dried from suspension range of methods like SEM, XRD and AFM were employed. From these investigations, we conclude that high clay concentrations and larger particle diameters (up to 5 microm) in suspension result in random orientation of platelets in the substrate. The best possible laminar orientation in the clay dry film, represented in the XRD 001/020 intensity ratio of 47 was obtained by drying thin layers from 0.02 wt.% clay suspensions of the natural pH. Conducted AFM investigations show that smectite studied in water based electrolytes show very long-range repulsive forces lower in strength than electrostatic forces from double-layer repulsion. It was suggested that these forces may have structural nature. Smectite surface layers rehydrate in water environment forms surface gel with spongy and cellular texture which cushion approaching AFM probe. This structural effect can be measured in distances larger than 1000 nm from substrate surface and when probe penetrate this gel layer, structural linkages are forming between substrate and clay covered probe. These linkages prevent subsequently smooth detachments of AFM probe on way back when retrieval. This effect of tearing new formed structure apart involves larger adhesion-like forces measured in retrieval. It is also suggested that these effect may be enhanced by the nano-clay particles interaction.

  12. Structural impact of cations on lipid bilayer models: nanomechanical properties by AFM-force spectroscopy.

    Science.gov (United States)

    Redondo-Morata, Lorena; Giannotti, Marina I; Sanz, Fausto

    2014-02-01

    Atomic Force Microscopy (AFM) has become an invaluable tool for studying the micro- and nanoworlds. As a stand-alone, high-resolution imaging technique and force transducer, it defies most other surface instrumentation in ease of use, sensitivity and versatility. The main strength of AFM relies on the possibility to operate in an aqueous environment on a wide variety of biological samples, from single molecules - DNA or proteins - to macromolecular assemblies like biological membranes. Understanding the effect of mechanical stress on membranes is of primary importance in biophysics, since cells are known to perform their function under a complex combination of forces. In the later years, AFM-based Force-Spectroscopy (AFM-FS) has provided a new vista on membrane mechanics in a confined area within the nanometer realm, where most of the specific molecular interactions take place. Lipid membranes are electrostatically charged entities that physiologically coexist with electrolyte solutions. Thus, specific interactions with ions are a matter of considerable interest. The distribution of ions in the solution and their interaction with the membranes are factors that substantially modify the structure and dynamics of the cell membranes. Furthermore, signaling processes are modified by the membrane capability of retaining ions. Supported Lipid Bilayers (SLBs) are a versatile tool to investigate phospholipid membranes mimicking biological surfaces. In the present contribution, we review selected experiments on the mechanical stability of SLBs as models of lipid membranes by means of AFM-FS, with special focus on the effect of cations and ionic strength in the overall nanomechanical stability. PMID:24341385

  13. High Throughput Nanofabrication of Silicon Nanowire and Carbon Nanotube Tips on AFM Probes by Stencil-Deposited Catalysts

    DEFF Research Database (Denmark)

    Engstrøm, Daniel Southcott; Savu, Veronica; Zhu, Xueni;

    2011-01-01

    A new and versatile technique for the wafer scale nanofabrication of silicon nanowire (SiNW) and multiwalled carbon nanotube (MWNT) tips on atomic force microscope (AFM) probes is presented. Catalyst material for the SiNW and MWNT growth was deposited on prefabricated AFM probes using aligned wafer...

  14. 基于稳健回归的 AFM 图像水平矫正算法%An AFM Image Leveling Algorithm Based on Robust Regression

    Institute of Scientific and Technical Information of China (English)

    翟腾飞; 雷宏; 冯文森

    2014-01-01

    AFM( Atomic Force Microscope ,原子力显微镜)图像经常会出现背景倾斜或弯曲。背景倾斜的原因源于探针和样本表面的倾角或XYZ扫描仪带来的弯曲。本文将稳健的MM估计算法应用到AFM图像二维背景拟合中,消除背景的倾斜,并利用fast-s估计算法作为初始化,以缩短计算时间。实验结果表明,与传统方法相比,本方法的AFM图像水平矫正效果更好。%AFM images always have some background slope or curvature that must be removed from the image .Sources of the background can be an offset angle between the probe and surface , or curvature introduced into the image from the XYZ scanner . There are a number of background subtraction options that are possible .In this paper, we take use of mm-estimators, one most commonly employed robust regression technique to calculate the background in the image and enhance its speed via fast -s estima-tion approach .Numerical results prove its excellent performances in AFM image leveling compared with other traditional algo -rithms.

  15. Surface electrical properties of stainless steel fibres: An AFM-based study

    Science.gov (United States)

    Yin, Jun; D'Haese, Cécile; Nysten, Bernard

    2015-03-01

    Atomic force microscopy (AFM) electrical modes were used to study the surface electrical properties of stainless steel fibres. The surface electrical conductivity was studied by current sensing AFM and I-V spectroscopy. Kelvin probe force microscopy was used to measure the surface contact potential. The oxide film, known as passivation layer, covering the fibre surface gives rise to the observation of an apparently semiconducting behaviour. The passivation layer generally exhibits a p-type semiconducting behaviour, which is attributed to the predominant formation of chromium oxide on the surface of the stainless steel fibres. At the nanoscale, different behaviours are observed from points to points, which may be attributed to local variations of the chemical composition and/or thickness of the passivation layer. I-V curves are well fitted with an electron tunnelling model, indicating that electron tunnelling may be the predominant mechanism for electron transport.

  16. Soft colloidal probes for AFM force measurements between water droplets in oil

    KAUST Repository

    Vakarelski, Ivan Uriev

    2014-11-01

    Here we introduce an extension of the atomic force microscopy (AFM) colloidal probe technique, as a simple and reliable experimental approach to measure the interaction forces between small water droplets (~80-160. μm) dispersed in oil. Small water droplets are formed by capillary breakup of a microscale water jet in air, which is forced out of a fine capillary nozzle, and deposited on a superhydrophobic substrate immersed in tetradecane oil medium. In these conditions the water droplets are very loosely attached to the superhydrophobic substrate and are easily picked up with a hydrophobic AFM cantilever to form a soft colloidal probe. Sample force measurements are conducted to demonstrate the capability of the technique.

  17. Study of relaxation and transport processes by means of AFM based dielectric spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Miccio, Luis A. [Centro de Física de Materiales CSIC-UPV/EHU, P. M. de Lardizabal 5, 20018 San Sebastian, Spain and Departamento de Física de Materiales UPV/EHU, Fac. de Química, 20080 San Sebastian (Spain); Schwartz, Gustavo A. [Centro de Física de Materiales CSIC-UPV/EHU, P. M. de Lardizabal 5, 20018 San Sebastian, Spain and Donostia International Physics Center, Paseo Manuel de Lardizabal 4, 20018 San Sebastian (Spain)

    2014-05-15

    Since its birth a few years ago, dielectric spectroscopy studies based on atomic force microscopy (AFM) have gained a growing interest. Not only the frequency and temperature ranges have become broader since then but also the kind of processes that can be studied by means of this approach. In this work we analyze the most adequate experimental setup for the study of several dielectric processes with a spatial resolution of a few nanometers by using force mode AFM based dielectric spectroscopy. Proof of concept experiments were performed on PS/PVAc blends and PMMA homopolymer films, for temperatures ranging from 300 to 400 K. Charge transport processes were also studied by this approach. The obtained results were analyzed in terms of cantilever stray contribution, film thickness and relaxation strength. We found that the method sensitivity is strongly coupled with the film thickness and the relaxation strength, and that it is possible to control it by using an adequate experimental setup.

  18. Conservative and dissipative tip-sample interaction forces probed with dynamic AFM

    Science.gov (United States)

    Gotsmann, B.; Seidel, C.; Anczykowski, B.; Fuchs, H.

    1999-10-01

    The conservative and dissipative forces between tip and sample of a dynamic atomic force microscopy (AFM) were investigated using a combination of computer simulations and experimental AFM data obtained by the frequency modulation technique. In this way it became possible to reconstruct complete force versus distance curves and damping coefficient versus distance curves from experimental data without using fit parameters for the interaction force and without using analytical interaction models. A comparison with analytical approaches is given and a way to determine a damping coefficient curve from experimental data is proposed. The results include the determination of the first point of repulsive contact of a vibrating tip when approaching a sample. The capability of quantifying the tip-sample interaction is demonstrated using experimental data obtained with a silicon tip and a mica sample in UHV.

  19. Atom probe, AFM, and STM studies on vacuum-fired stainless steels.

    Science.gov (United States)

    Stupnik, A; Frank, P; Leisch, M

    2009-04-01

    The surface morphology of grades 304L and 316LN stainless steels, after low-temperature bake-out process and vacuum annealing, has been studied by atomic force microscopy (AFM) and scanning tunnelling microscopy (STM). The local elemental composition on the surface before and after thermal treatment has been investigated by atom probe (AP) depth profiling measurements. After vacuum annealing, AFM and STM show significant changes in the surface structure and topology. Recrystallization and surface reconstruction is less pronounced on the 316LN stainless steel. AP depth profiling analyses result in noticeable nickel enrichment on the surface of grade 304L samples. Since hydrogen recombination is almost controlled by surface structure and composition, a strong influence on the outgassing behaviour by the particular surface microstructure can be deduced. PMID:19167824

  20. Quadruplex-targeting anticancer drug BRACO-19 voltammetric and AFM characterization

    International Nuclear Information System (INIS)

    The quadruplex-targeting anticancer drug BRACO-19 adsorption and redox behaviour were investigated by atomic force microscopy (AFM) on a highly oriented pyrolytic graphite surface and by cyclic, differential pulse and square-wave voltammetry at a glassy carbon electrode. The AFM and voltammetric results demonstrated that the BRACO-19 orientation and strong adsorption, with the acridine aromatic core parallel or perpendicular to the carbon electrode surface depending on solution pH, directly influences the peak potentials and redox behaviour. BRACO-19 oxidation was a complex, pH-dependent, four-step electrode process. The first oxidation step was reversible, the second, third and fourth oxidation steps irreversible, and an electroactive irreversibly oxidized BRACO-19 oxidation product was formed. BRACO-19 reduction occurred in two irreversible, pH-independent steps. The proposed redox mechanisms are related to the pyrrolidine and acridine moieties

  1. The use of functionalized AFM tips as molecular sensors in the detection of pesticides

    Directory of Open Access Journals (Sweden)

    Daiana K. Deda

    2013-06-01

    Full Text Available Atomic force spectroscopy, a technique derived from Atomic Force Microscopy (AFM, allowed us to distinguish nonspecific and specific interactions between the acetolactate synthase enzyme (ALS and anti-atrazine antibody biomolecules and the herbicides imazaquin, metsulfuron-methyl and atrazine. The presence of specific interactions increased the adhesion force (Fadh between the AFM tip and the herbicides, which made the modified tip a powerful biosensor. Increases of approximately 132% and 145% in the Fadh values were observed when a tip functionalized with ALS was used to detect imazaquin and metsulfuron-methyl, respectively. The presence of specific interactions between the atrazine and the anti-atrazine antibody also caused an increase in the Fadh values (approximately 175% compared to those observed when using an unfunctionalized tip. The molecular modeling results obtained with the ALS enzyme suggest that the orientation of the biomolecule on the tip surface could be suitable for allowing interaction with the herbicides imazaquin and metsulfuron-methyl.

  2. Surface features on Sahara soil dust particles made visible by atomic force microscope (AFM phase images

    Directory of Open Access Journals (Sweden)

    M. O. Andreae

    2008-10-01

    Full Text Available We show that atomic force microscopy (AFM phase images can reveal surface features of soil dust particles, which are not evident using other microscopic methods. The non-contact AFM method is able to resolve topographical structures in the nanometer range as well as to uncover repulsive atomic forces and attractive van der Waals' forces, and thus gives insight to surface properties. Though the method does not allow quantitative assignment in terms of chemical compound description, it clearly shows deposits of distinguishable material on the surface. We apply this technique to dust aerosol particles from the Sahara collected over the Atlantic Ocean and describe micro-features on the surfaces of such particles.

  3. Surface features on Sahara soil dust particles made visible by atomic force microscope (AFM phase images

    Directory of Open Access Journals (Sweden)

    G. Helas

    2008-08-01

    Full Text Available We show that atomic force microscopy (AFM phase images can reveal surface features of soil dust particles, which are not evident using other microscopic methods. The non-contact AFM method is able to resolve topographical structures in the nanometer range as well as to uncover repulsive atomic forces and attractive van der Waals' forces, and thus gives insight to surface properties. Though the method does not allow quantitative assignment in terms of chemical compound description, it clearly shows deposits of distinguishable material on the surface. We apply this technique to dust aerosol particles from the Sahara collected over the Atlantic Ocean and describe micro-features on the surfaces of such particles.

  4. Atomic-scale non-contact AFM studies of alumina supported nanoparticles

    DEFF Research Database (Denmark)

    Jensen, Thomas Nørregaard; Meinander, Kristoffer; Simonsen, Søren Bredmose;

    ATOMIC-SCALE NON-CONTACT ATOMIC FORCE STUDIES OF ALUMINA SUPPORTED NANOPARTICLES Thomas N. Jensen, Kristoffer Meinander, Flemming Besenbacher and Jeppe V. Lauritsen Interdisciplinary Nanoscience Center, Aarhus University, DK-8000 Aarhus C, Denmark Heterogeneous catalysis plays a crucial role...... materials is a prerequisite for the synthesis of more sintering stable catalysts and the realizations of nanocatalysts implementing catalyst particles with a tailored size and morphology. In the last two decades the atomic force microscope (AFM) has become one of the premier tools for studying surfaces...... at the nanometre scale [1]. When operated in the so-called non-contact mode (nc-AFM), this technique yields genuine atomic resolution and offers a unique tool for atomic-scale studies of clean surfaces, as well as, nanoparticles and thin films on these surfaces irrespective of the substrate being electrically...

  5. Cell mechanics as a marker for diseases: Biomedical applications of AFM

    Science.gov (United States)

    Rianna, Carmela; Radmacher, Manfred

    2016-08-01

    Many diseases are related to changes in cell mechanics. Atomic Force Microscopy (AFM) is one of the most suitable techniques allowing the investigation of both topography and mechanical properties of adherent cells with high spatial resolution under physiological conditions. Over the years the use of this technique in medical and clinical applications has largely increased, resulting in the notion of cell mechanics as a biomarker to discriminate between different physiological and pathological states of cells. Cell mechanics has proven to be a biophysical fingerprint able discerning between cell phenotypes, unraveling processes in aging or diseases, or even detecting and diagnosing cellular pathologies. We will review in this report some of the works on cell mechanics investigated by AFM with clinical and medical relevance in order to clarify the state of research in this field and to highlight the role of cell mechanics in the study of pathologies, focusing on cancer, blood and cardiovascular diseases.

  6. Characterization of the polycaprolactone melt crystallization: complementary optical microscopy, DSC, and AFM studies.

    Science.gov (United States)

    Speranza, V; Sorrentino, A; De Santis, F; Pantani, R

    2014-01-01

    The first stages of the crystallization of polycaprolactone (PCL) were studied using several techniques. The crystallization exotherms measured by differential scanning calorimetry (DSC) were analyzed and compared with results obtained by polarized optical microscopy (POM), rheology, and atomic force microscope (AFM). The experimental results suggest a strong influence of the observation scale. In particular, the AFM, even if limited on time scale, appears to be the most sensitive technique to detect the first stages of crystallization. On the contrary, at least in the case analysed in this work, rheology appears to be the least sensitive technique. DSC and POM provide closer results. This suggests that the definition of induction time in the polymer crystallization is a vague concept that, in any case, requires the definition of the technique used for its characterization.

  7. AFM assessment of the surface nano/microstructure on chemically damaged historical and model glasses

    Energy Technology Data Exchange (ETDEWEB)

    Carmona, Noemi [Centro Nacional de Investigaciones Metalurgicas, CSIC, Avda. Gregorio del Amo, 8, 28040 Madrid (Spain); Kowal, Andrzej [Institute of Catalysis and Surface Chemistry, PAN, ul. Niezapominajek 8, 30239 Cracow (Poland); Rincon, Jesus-Maria [Instituto Eduardo Torroja de Ciencias de la Construccion, CSIC, C. Serrano Galvache s/n, 28033 Madrid (Spain); Villegas, Maria-Angeles, E-mail: mariangeles.villegas@cchs.csic.es [Centro Nacional de Investigaciones Metalurgicas, CSIC, Avda. Gregorio del Amo, 8, 28040 Madrid (Spain); Instituto de Historia, Centro de Ciencias Humanas y Sociales, CSIC, C. Albasanz, 26-28, 28037 Madrid (Spain)

    2010-01-15

    Surface chemical damage on selected historical glasses from 13th to 19th centuries was evaluated by means of atomic force microscopy (AFM). Nano- and microstructure, roughness and topography of ancient glass samples have been compared with those of model glasses prepared by conventional melting at the laboratory with similar compositions to those most frequently found in historical glass pieces. The results obtained allow discussing the chemical degradation mechanisms in terms of the acid and/or basic chemical attack carried out by the combination of gaseous pollutants and environmental humidity. Even though deep corrosion features escape to the observation order of magnitude of the AF microscope used, the AFM technique proves to be quite useful for the study and evaluation of the most common surface pathologies of historical glasses with different compositions once submitted to natural weathering.

  8. SEM and AFM images of pyrite surfaces after bioleaching by the indigenous Thiobacillus thiooxidans.

    Science.gov (United States)

    Liu, H-L; Chen, B-Y; Lan, Y-W; Cheng, Y-C

    2003-09-01

    The bioleaching mechanism of pyrite by the indigenous Thiobacillus thiooxidans was examined with the aid of scanning electron microscopy (SEM) and atomic force microscopy (AFM) images of the pyrite surface. The presence of pyrite eliminated the lag phase during growth of this microorganism. This was due to the stimulatory effect on cell growth of the slight amount of Cu2+ that had leached from the pyrite. Zn2+ was found to be much more readily solubilized than Cu2+. The efficiency of bioleaching was four times higher than that of chemical leaching. SEM images provided evidence of direct cell attachment onto the pyrite surface, thereby enhancing the bioleaching rate. Furthermore, extracellular polymeric substances (EPSs) were found on the pyrite surface after 4 days of oxidation. AFM images showed that the pyrite surface area positively correlated with the oxidation rate. A combination of direct and indirect mechanism is probably responsible for the oxidation of pyrite by T. thiooxidans.

  9. GISAXS and AFM investigation of Cobalt sputtering onto a polymer template

    Energy Technology Data Exchange (ETDEWEB)

    Buffet, Adeline; Couet, Sebastien; Gehrke, Rainer; Roehlsberger, Ralf; Rothkirch, Andre; Schlage, Kai; Roth, Stephan V. [HASYLAB, DESY, Hamburg (Germany); Herzog, Gerd [HASYLAB, DESY, Hamburg (Germany); Inst. f. Exp. Phys., Univ. Hamburg (Germany); Wurth, Wilfried [Inst. f. Exp. Phys., Univ. Hamburg (Germany); Kaune, Gunar; Koerstgens, Volker; Meier, Robert; Metwalli, Ezzeldin; Mueller-Buschbaum, Peter [TU Muenchen, Physik-Department Lehrstuhl E13, Garching (Germany)

    2009-07-01

    Polymeric nanocomposite materials are outstanding materials for basic research and technological applications such as optical coating, solar cell technology and magnetic recording. Comprehension of their growth process is mandatory to improve the tailoring of the material final properties. Stop-sputter experiments (Cobalt (Co) onto a polystyrene nanoparticle spin coated Si substrate) were performed at the beamline BW4 of the DORIS III storage ring at HASYLAB (DESY, Hamburg). The growth process was investigated using grazing incidence small-angle X-ray scattering (GISAXS). The surface topography of the sputtered samples was then investigated by atomic force microscopy (AFM). We present the GISAXS and AFM measurements, which highlight a two-step growth process. In the initial stages, Co grows on polystyrene colloids. Afterwards, a percolated Co layer is formed, which replicates the full substrate morphology.

  10. A study of AFM-based scratch process on polycarbonate surface and grating application

    International Nuclear Information System (INIS)

    We report on the possibility of applying atomic force microscope (AFM) lithography to draw micro/nano-structures on the surface of a polycarbonate (PC) substrate. We also fabricated a grating structure on the PC surface using the scratch method. An AFM silicon tip coated with a diamond layer was utilized as a cutting tool to scratch the surface of the sample. In order to obtain pattern depth deeper than the control method of interaction force, we used a scanner movement method which the sample scanner moves along the Z-axis. A grating of 100 μm x 150 μm was fabricated by the step and repeat method wherein the sample stage is moved in the direction of the XY-axis. The period and the depth of the grating are 500 and 50 nm, respectively. Light of 632.8 nm wavelength was diffracted on the surface of the PC substrate.

  11. AFM and STM investigations of hydrogenated amorphous silicon: topography and barrier heights

    Energy Technology Data Exchange (ETDEWEB)

    Herion, J. [Forschungszentrum Juelich GmbH (Germany). Inst. fuer Schicht- und Ionentechnik; Szot, K. [Silesian Univ., Katowice (Poland); Barzen, S. [Colorado Univ., Boulder, CO (United States). Joint Inst. for Laboratory Astrophysics; Siebke, F. [Forschungszentrum Juelich GmbH (Germany). Inst. fuer Schicht- und Ionentechnik; Teske, M. [Forschungszentrum Juelich GmbH (Germany). Inst. fuer Grenzflaechenforschung und Vakuumphysik

    1997-05-01

    As-grown films of hydrogenated amorphous silicon (a-Si : H, highly phosphorous-doped) were investigated by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). Hills up to 10 nm in height and 10 to 20 nm in diameter have been observed by AFM. By using STM in a new high-sensitivity mode, (1) atomically smooth areas (roughness about 0.3 A rms) which occur at the top of the hills, (2) subnanometer structures several A in height which cover large parts of the surface have been identified. Simultaneous measurements of the local apparent barrier heights (LABH) show a clear correlation to the topography. Areas showing subnanometer structures have always low LABHs while the highest values of the LABH occur on the smooth areas. (orig.). With 5 figs.

  12. Observation and Analysis of in vitro Expression of Mouse Heart Nuclear DNA Fragments by AFM

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Using AFM,we observed linear chain-like complexes formed by some specific proteins and the multi-mRNAs during the in vitro expression of some active genes on the DNA fragments. The LDH mRNA in the multi-mRNA complex can in vitro translate LDH. Via AFM, we also discovered that nmRNA prepared from heart muscles, along with some specific proteins can form linear chain-like nmRNA complexes in which LDH mRNA can also translate LDH in vitro. Our work shows the prospective application of AFM in the research of the biological reaction of the active genes on the DNA fragments.

  13. In vitro study of AFB1 and AFM1 effects on human lymphoblastoid Jurkat T-cell model.

    Science.gov (United States)

    Luongo, D; Russo, R; Balestrieri, A; Marzocco, S; Bergamo, P; Severino, L

    2014-10-01

    Aflatoxin B(1) (AFB(1)) is a mycotoxin produced by Aspergillus spp. that can occur as a natural contaminant in foods and feeds of vegetable origin. Post-ingestion, AFB(1) can be metabolized in the liver of mammals into hydroxylated aflatoxin M(1) (AFM(1)) that is excreted with milk. Although several studies have been carried out to evaluate effects of AFB(1) on the immune system, studies regarding AFM(1) are moreover lacking. The aim of the current study was to investigate effects of AFB(1) and AFM(1) on immune function using a lymphoblastoid Jurkat T-cell line as an experimental model. Both AFB(1) and AFM(1) produced significant decreases in Jurkat cell proliferation, whereas only minor effects were noted on interleukin (IL)-2 and interferon (IFN)-γ cytokines mRNA expression in stimulated cells that had been pre-incubated with AFB(1) and AFM(1). Particularly, AFB(1), but not AFM(1), at the highest concentration (50 µM) induced a marked increase in IL-8 mRNA expression. The results of the current study suggested the existence of a concentration threshold for AFB(1) and AFM(1) needed to exert biological activity on cell viability and innate immunity.

  14. GROWTH MODES AND DEFECTS OF MANGANESE MERCURY THIOCYANATE CRYSTALS OBSERVED BY AFM

    OpenAIRE

    Y. L. GENG; Sun, Z. H.

    2009-01-01

    Growth mechanisms and defects formation of the manganese mercury thiocyanate (MMTC) crystal have been investigated by atomic force microscopy (AFM). Both screw dislocation controlled growth and 2D nucleation growth occur on the {110} faces. Stacking faults are observed among dislocation hillocks and the formation of them probably results from the different crystallization orientations of different spirals. Hollow channels are found around the nucleation islands and the formation of them is du...

  15. Visualization of the equilibrium FCC catalyst surface by AFM and SEM-EDS

    OpenAIRE

    Bayraktar, Oğuz; Kugler, Edwin L.

    2003-01-01

    The deposition of metal contaminants (e.g., Ni, V, and Fe) from the hydrocarbon feed causes the deactivation of fluid catalytic cracking (FCC) catalyst used in petroleum refining. It is very important to understand the changes in the morphology and chemical composition on the catalyst surface and how these structural and chemical changes affect the catalyst performance. In this research, metal-contaminated FCC catalysts from a commercial unit have been characterized using AFM together with SE...

  16. Crystallization of Probucol in Nanoparticles Revealed by AFM Analysis in Aqueous Solution.

    Science.gov (United States)

    Egami, Kiichi; Higashi, Kenjirou; Yamamoto, Keiji; Moribe, Kunikazu

    2015-08-01

    The crystallization behavior of a pharmaceutical drug in nanoparticles was directly evaluated by atomic force microscopy (AFM) force curve measurements in aqueous solution. A ternary spray-dried sample (SPD) was prepared by spray drying the organic solvent containing probucol (PBC), hypromellose (HPMC), and sodium dodecyl sulfate (SDS). The amorphization of PBC in the ternary SPD was confirmed by powder X-ray diffraction (PXRD) and solid-state 13C NMR measurements. A nanosuspension containing quite small particles of 25 nm in size was successfully prepared immediately after dispersion of the ternary SPD into water. Furthermore, solution-state 1H NMR measurements revealed that a portion of HPMC coexisted with PBC as a mixed state in the freshly prepared nanosuspension particles. After storing the nanosuspension at 25 °C, a gradual increase in the size of the nanoparticles was observed, and the particle size changed to 93.9 nm after 7 days. AFM enabled the direct observation of the morphology and agglomeration behavior of the nanoparticles in water. Moreover, AFM force-distance curves were changed from (I) to (IV), depending on the storage period, as follows: (I) complete indentation within an applied force of 1 nN, (II) complete indentation with an applied force of 1-5 nN, (III) partial indentation with an applied force of 5 nN, and (IV) nearly no indentation with an applied force of 5 nN. This stiffness increase of the nanoparticles was attributed to gradual changes in the molecular state of PBC from the amorphous to the crystal state. Solid-state 13C NMR measurements of the freeze-dried samples demonstrated the presence of metastable PBC Form II crystals in the stored nanosuspension, strongly supporting the AFM results. PMID:26106951

  17. An AFM-based methodology for measuring axial and radial error motions of spindles

    International Nuclear Information System (INIS)

    This paper presents a novel atomic force microscopy (AFM)-based methodology for measurement of axial and radial error motions of a high precision spindle. Based on a modified commercial AFM system, the AFM tip is employed as a cutting tool by which nano-grooves are scratched on a flat surface with the rotation of the spindle. By extracting the radial motion data of the spindle from the scratched nano-grooves, the radial error motion of the spindle can be calculated after subtracting the tilting errors from the original measurement data. Through recording the variation of the PZT displacement in the Z direction in AFM tapping mode during the spindle rotation, the axial error motion of the spindle can be obtained. Moreover the effects of the nano-scratching parameters on the scratched grooves, the tilting error removal method for both conditions and the method of data extraction from the scratched groove depth are studied in detail. The axial error motion of 124 nm and the radial error motion of 279 nm of a commercial high precision air bearing spindle are achieved by this novel method, which are comparable with the values provided by the manufacturer, verifying this method. This approach does not need an expensive standard part as in most conventional measurement approaches. Moreover, the axial and radial error motions of the spindle can both be obtained, indicating that this is a potential means of measuring the error motions of the high precision moving parts of ultra-precision machine tools in the future. (paper)

  18. Crystal structures of Boro-AFm and sBoro-AFt phases

    International Nuclear Information System (INIS)

    Crystal structures of boron-containing AFm (B-AFm) and AFt (B-AFt) phases have been solved ab-initio and refined from X-ray powder diffraction. 11B NMR and Raman spectroscopies confirm the boron local environment in both compounds: three-fold coordinated in B-AFm corresponding to HBO32− species, and four-fold coordinated in B-AFt corresponding to B (OH)4− species. B-AFm crystallizes in the rhombohedral R3¯c space group and has the 3CaO·Al2O3·CaHBO3·12H2O (4CaO·Al2O3·1/2B2O3·12.5H2O, C4AB1/2H12.5) general formulae with planar trigonal HBO32− anions weakly bonded at the centre of the interlayer region. One HBO32− anion is statistically distributed with two weakly bonded water molecules on the same crystallographic site. B-AFt crystallizes in the trigonal P3cl space group and has the 3CaO·Al2O3·Ca(OH)2·2Ca(B (OH)4)2·24H2O (6CaO·Al2O3·2B2O3·33H2O, C6AB2H33) general formulae with tetrahedral B (OH)4− anions located in the channel region of the structure. All tetrahedral anions are oriented in a unique direction, leading to a hexagonal c lattice parameter about half that of ettringite.

  19. Endothelial permeability is controlled by spatially defined cytoskeletal mechanics: AFM force mapping of pulmonary endothelial monolayer

    OpenAIRE

    Birukova, Anna A.; Arce, Fernando T.; Moldobaeva, Nurgul; Dudek, Steven M.; Garcia, Joe G. N.; Lal, Ratnesh; Birukov, Konstantin G.

    2008-01-01

    Actomyosin contraction directly regulates endothelial cell (EC) permeability, but intracellular redistribution of cytoskeletal tension associated with EC permeability is poorly understood. We used atomic force microscopy (AFM), EC permeability assays and fluorescence microscopy to link barrier regulation, cell remodeling and cytoskeletal mechanical properties in EC treated with barrier-protective as well as barrier-disruptive agonists. Thrombin, VEGF and H2O2 increased EC permeability, disrup...

  20. Damage of DNA ends induced by mechanical force during AFM nano-manipulation

    International Nuclear Information System (INIS)

    An experimental and statistical study was carried out to explore the effects of mechanical forces on the ends of linear double-stranded DNA (dsDNA) fragments. Mechanical force was applied onto individual DNA molecules during atomic force microscope (AFM)-based picking-up manipulation. By comparing the PCR efficiency of two DNA fragments with primers either at ends or at the inner regions, it was found that the ends of DNA fragments were damaged during picking-up process. (authors)

  1. Pericellular Brush and Mechanics of Guinea Pig Fibroblast Cells Studied with AFM.

    Science.gov (United States)

    Dokukin, Maxim; Ablaeva, Yulija; Kalaparthi, Vivekanand; Seluanov, Andrei; Gorbunova, Vera; Sokolov, Igor

    2016-07-12

    The atomic force microscopy (AFM) indentation method combined with the brush model can be used to separate the mechanical response of the cell body from deformation of the pericellular layer surrounding biological cells. Although self-consistency of the brush model to derive the elastic modulus of the cell body has been demonstrated, the model ability to characterize the pericellular layer has not been explicitly verified. Here we demonstrate it by using enzymatic removal of hyaluronic content of the pericellular brush for guinea pig fibroblast cells. The effect of this removal is clearly seen in the AFM force-separation curves associated with the pericellular brush layer. We further extend the brush model for brushes larger than the height of the AFM probe, which seems to be the case for fibroblast cells. In addition, we demonstrate that an extension of the brush model (i.e., double-brush model) is capable of detecting the hierarchical structure of the pericellular brush, which, for example, may consist of the pericellular coat and the membrane corrugation (microridges and microvilli). It allows us to quantitatively segregate the large soft polysaccharide pericellular coat from a relatively rigid and dense membrane corrugation layer. This was verified by comparison of the parameters of the membrane corrugation layer derived from the force curves collected on untreated cells (when this corrugation membrane part is hidden inside the pericellular brush layer) and on treated cells after the enzymatic removal of the pericellular coat part (when the corrugations are exposed to the AFM probe). We conclude that the brush model is capable of not only measuring the mechanics of the cell body but also the parameters of the pericellular brush layer, including quantitative characterization of the pericellular layer structure. PMID:27410750

  2. Direct Measurement of Optical Force Induced by Near-Field Plasmonic Cavity Using Dynamic Mode AFM

    OpenAIRE

    Dongshi Guan; Zhi Hong Hang; Zsolt Marcet; Hui Liu; I. I. Kravchenko; Chan, C. T.; Chan, H. B.; Penger Tong

    2015-01-01

    Plasmonic nanostructures have attracted much attention in recent years because of their potential applications in optical manipulation through near-field enhancement. Continuing experimental efforts have been made to develop accurate techniques to directly measure the near-field optical force induced by the plasmonic nanostructures in the visible frequency range. In this work, we report a new application of dynamic mode atomic force microscopy (DM-AFM) in the measurement of the enhanced optic...

  3. Crystallization of Probucol in Nanoparticles Revealed by AFM Analysis in Aqueous Solution.

    Science.gov (United States)

    Egami, Kiichi; Higashi, Kenjirou; Yamamoto, Keiji; Moribe, Kunikazu

    2015-08-01

    The crystallization behavior of a pharmaceutical drug in nanoparticles was directly evaluated by atomic force microscopy (AFM) force curve measurements in aqueous solution. A ternary spray-dried sample (SPD) was prepared by spray drying the organic solvent containing probucol (PBC), hypromellose (HPMC), and sodium dodecyl sulfate (SDS). The amorphization of PBC in the ternary SPD was confirmed by powder X-ray diffraction (PXRD) and solid-state 13C NMR measurements. A nanosuspension containing quite small particles of 25 nm in size was successfully prepared immediately after dispersion of the ternary SPD into water. Furthermore, solution-state 1H NMR measurements revealed that a portion of HPMC coexisted with PBC as a mixed state in the freshly prepared nanosuspension particles. After storing the nanosuspension at 25 °C, a gradual increase in the size of the nanoparticles was observed, and the particle size changed to 93.9 nm after 7 days. AFM enabled the direct observation of the morphology and agglomeration behavior of the nanoparticles in water. Moreover, AFM force-distance curves were changed from (I) to (IV), depending on the storage period, as follows: (I) complete indentation within an applied force of 1 nN, (II) complete indentation with an applied force of 1-5 nN, (III) partial indentation with an applied force of 5 nN, and (IV) nearly no indentation with an applied force of 5 nN. This stiffness increase of the nanoparticles was attributed to gradual changes in the molecular state of PBC from the amorphous to the crystal state. Solid-state 13C NMR measurements of the freeze-dried samples demonstrated the presence of metastable PBC Form II crystals in the stored nanosuspension, strongly supporting the AFM results.

  4. Fabrication of tuning-fork based AFM and STM tungsten probe

    KAUST Repository

    Al-Falih, Hisham

    2011-12-01

    We compare the sharpness of tungsten probe tips produced by the single-step and two-step dynamic electrochemical etching processes. A small radius of curvature (RoC) of 25 nm or less was routinely obtained when the two-step electrochemical etching (TEE) process was adopted, while the smallest achievable RoC was ∼10 nm, rendering it suitable for atomic force microscopy (AFM) or scanning tunneling microscopy (STM) applications. © 2011 IEEE.

  5. Tumor suppressor protein SMAR1 modulates the roughness of cell surface: combined AFM and SEM study

    Directory of Open Access Journals (Sweden)

    Mamgain Hitesh

    2009-10-01

    Full Text Available Abstract Background Imaging tools such as scanning electron microscope (SEM and atomic force microscope (AFM can be used to produce high-resolution topographic images of biomedical specimens and hence are well suited for imaging alterations in cell morphology. We have studied the correlation of SMAR1 expression with cell surface smoothness in cell lines as well as in different grades of human breast cancer and mouse tumor sections. Methods We validated knockdown and overexpression of SMAR1 using RT-PCR as well as Western blotting in human embryonic kidney (HEK 293, human breast cancer (MCF-7 and mouse melanoma (B16F1 cell lines. The samples were then processed for cell surface roughness studies using atomic force microscopy (AFM and scanning electron microscopy (SEM. The same samples were used for microarray analysis as well. Tumors sections from control and SMAR1 treated mice as well as tissues sections from different grades of human breast cancer on poly L-lysine coated slides were used for AFM and SEM studies. Results Tumor sections from mice injected with melanoma cells showed pronounced surface roughness. In contrast, tumor sections obtained from nude mice that were first injected with melanoma cells followed by repeated injections of SMAR1-P44 peptide, exhibited relatively smoother surface profile. Interestingly, human breast cancer tissue sections that showed reduced SMAR1 expression exhibited increased surface roughness compared to the adjacent normal breast tissue. Our AFM data establishes that treatment of cells with SMAR1-P44 results into increase in cytoskeletal volume that is supported by comparative gene expression data showing an increase in the expression of specific cytoskeletal proteins compared to the control cells. Altogether, these findings indicate that tumor suppressor function of SMAR1 might be exhibited through smoothening of cell surface by regulating expression of cell surface proteins. Conclusion Tumor suppressor

  6. Single-cycle-PLL detection for real-time FM-AFM applications.

    Science.gov (United States)

    Schlecker, Benedikt; Dukic, Maja; Erickson, Blake; Ortmanns, Maurits; Fantner, Georg; Anders, Jens

    2014-04-01

    In this paper we present a novel architecture for phase-locked loop (PLL) based high-speed demodulation of frequency-modulated (FM) atomic force microscopy (AFM) signals. In our approach, we use single-sideband (SSB) frequency upconversion to translate the AFM signal from the position sensitive detector to a fixed intermediate frequency (IF) of 10 MHz. In this way, we fully benefit from the excellent noise performance of PLL-based FM demodulators still avoiding the intrinsic bandwidth limitation of such systems. In addition, the upconversion to a fixed IF renders the PLL demodulator independent of the cantilever's resonance frequency, allowing the system to work with a large range of cantilever frequencies. To investigate if the additional noise introduced by the SSB upconverter degrades the system noise figure we present a model of the AM-to-FM noise conversion in PLLs incorporating a phase-frequency detector. Using this model, we can predict an upper corner frequency for the demodulation bandwidth above which the converted noise from the single-sideband upconverter becomes the dominant noise source and therefore begins to deteriorate the overall system performance. The approach is validated by both electrical and AFM measurements obtained with a PCB-based prototype implementing the proposed demodulator architecture. PMID:24760947

  7. Thermodynamic behavior of D-sphingosine/cholesterol monolayers and the topography observed by AFM

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Lipid rafts are of a dynamic microdomain structure found in recent years,enriched in sphingolipids,cholesterol and particular proteins.The change of structure and function of lipid rafts could result in many diseases.In this work,the monolayer behavior of mixed systems of D-sphingosine with choles-terol was investigated in terms of the mean surface area per molecule(Am),excess molecular area(Aex),surface excess Gibbs energy(Gex),interaction parameter(ω),activity coefficients(1 and 2) as well as elasticity(Cs1) of formed films.The deposited Langmuir-Blodgett(LB) monolayers were inves-tigated with atomic force microscopy(AFM).Thermodynamic analysis indicates Aex and Gex in the binary systems with negative deviations from the ideal behavior,suggesting attractive interaction be-tween molecules.The stability,elasticity and activity coefficients show a marked dependence on the mole faction of D-sphingosine.The results of observation by AFM show that the single D-sphingosine molecular film took on small granule structure.When mixing the D-sphingosine and cholesterol at dif-ferent ratios,the mixed films transform from the chains structure to larger slice and net coexisting structure with the increasing of the cholesterol content.In the end,pure cholesterol forms more ag-gregated structure.AFM experiments effectively support the above findings and interpretation.

  8. Thermodynamic behavior of D-sphingosine/cholesterol monolayers and the topography observed by AFM

    Institute of Scientific and Technical Information of China (English)

    HAO ChangChun; SUN RunGuang; ZHANG Jing; CHANG YiGuang; NIU ChunLing

    2009-01-01

    Lipid rafts are of a dynamic microdomain structure found in recent years, enriched in sphingolipids, cholesterol and particular proteins. The change of structure and function of lipid rafts could result in many diseases. In this work, the monolayer behavior of mixed systems of D-sphingosine with choles-terol was investigated in terms of the mean surface area per molecule (Am), excess molecular area (△Aex), surface excess Gibbs energy (△Gex), interaction parameter (ω) activity coefficients (f1 and f2) as well as elasticity (Cs-1) of formed films. The deposited Langmuir-Blodgett (LB) monolayers were inves-tigated with atomic force microscopy (AFM). Thermodynamic analysis indicates △Aex and △Gex in the binary systems with negative deviations from the ideal behavior, suggesting attractive interaction be-tween molecules. The stability, elasticity and activity coefficients show a marked dependence on the mole faction of D-sphingosine. The results of observation by AFM show that the single D-sphingosine molecular film took on small granule structure. When mixing the D-sphingosine and cholesterol at dif-ferent ratios, the mixed films transform from the chains structure to larger slice and net coexisting structure with the increasing of the cholesterol content. In the end, pure cholesterol forms more ag-gregated structure. AFM experiments effectively support the above findings and interpretation.

  9. Measuring protein isoelectric points by AFM-based force spectroscopy using trace amounts of sample

    Science.gov (United States)

    Guo, Shifeng; Zhu, Xiaoying; Jańczewski, Dominik; Lee, Serina Siew Chen; He, Tao; Teo, Serena Lay Ming; Vancso, G. Julius

    2016-09-01

    Protein charge at various pH and isoelectric point (pI) values is important in understanding protein function. However, often only trace amounts of unknown proteins are available and pI measurements cannot be obtained using conventional methods. Here, we show a method based on the atomic force microscope (AFM) to determine pI using minute quantities of proteins. The protein of interest is immobilized on AFM colloidal probes and the adhesion force of the protein is measured against a positively and a negatively charged substrate made by layer-by-layer deposition of polyelectrolytes. From the AFM force–distance curves, pI values with an estimated accuracy of ±0.25 were obtained for bovine serum albumin, myoglobin, fibrinogen and ribonuclease A over a range of 4.7–9.8. Using this method, we show that the pI of the ‘footprint’ of the temporary adhesive proteins secreted by the barnacle cyprid larvae of Amphibalanus amphitrite is in the range 9.6–9.7.

  10. A novel dog-bone oscillating AFM probe with thermal actuation and piezoresistive detection.

    Science.gov (United States)

    Xiong, Zhuang; Mairiaux, Estelle; Walter, Benjamin; Faucher, Marc; Buchaillot, Lionel; Legrand, Bernard

    2014-10-31

    In order to effectively increase the resonance frequency and the quality factor of atomic force microscope (AFM) probes, a novel oscillating probe based on a dog-bone shaped MEMS resonator was conceived, designed, fabricated and evaluated. The novel probe with 400 μm in length, 100 μm in width and 5 μm in thickness was enabled to feature MHz resonance frequencies with integrated thermal actuation and piezoresistive detection. Standard silicon micromachining was employed. Both electrical and optical measurements were carried out in air. The resonance frequency and the quality factor of the novel probe were measured to be 5.4 MHz and 4000 respectively, which are much higher than those (about several hundreds of kHz) of commonly used cantilever probes. The probe was mounted onto a commercial AFM set-up through a dedicated probe-holder and circuit board. Topographic images of patterned resist samples were obtained. It is expected that the resonance frequency and the measurement bandwidth of such probes will be further increased by a proper downscaling, thus leading to a significant increase in the scanning speed capability of AFM instruments.

  11. Fracture Growth Testing of Titanium 6AL-4V in AF-M315E

    Science.gov (United States)

    Sampson, Jeffrey W.; Martinez, Jonathan; McLean, Christopher

    2015-01-01

    The Green Propellant Infusion Mission (GPIM) will demonstrate the performance of AF-M315E monopropellant in orbit. Flight certification requires a safe-life analysis of the titanium alloy fuel tank to ensure inherent flaws will not cause failure during the design life. Material property inputs for this analysis require testing to determine the stress intensity factor for environmentally-assisted cracking (K (sub EAC)) of Ti 6Al-4V in combination with the AF-M315E monopropellant. Testing of single-edge notched specimens SE(B) representing the bulk tank membrane and weld material were performed in accordance with ASTM E1681. Specimens with fatigue pre-cracks were loaded into test fixtures so that the crack tips were exposed to the monopropellant at 50 degrees Centigrade for a duration of 1,000 hours. Specimens that did not fail during exposure were opened to inspect the crack surfaces for evidence of crack growth. The threshold stress intensity value, KEAC, is the highest applied stress intensity that produced neither a failure of the specimen during the exposure nor showed evidence of crack growth. The threshold stress intensity factor of the Ti 6Al-4V forged tank material when exposed to AF-M315E monopropellant was found to be at least 22.0 kilopounds per square inch. The stress intensity factor of the weld material was at least 31.3 kilopounds per square inch.

  12. Rational fabrication of a gold-coated AFM TERS tip by pulsed electrodeposition

    Science.gov (United States)

    Yang, Li-Kun; Huang, Teng-Xiang; Zeng, Zhi-Cong; Li, Mao-Hua; Wang, Xiang; Yang, Fang-Zu; Ren, Bin

    2015-10-01

    Reproducible fabrication of sharp gold- or silver-coated tips has become the bottleneck issue in tip-enhanced Raman spectroscopy, especially for atomic force microscopy (AFM)-based TERS. Herein, we developed a novel method based on pulsed electrodeposition to coat a thin gold layer over atomic force microscopy (AFM) tips to produce plasmonic TERS tips with high reproducibility. We systematically investigated the influence of the deposition potential and step time on the surface roughness and sharpness. This method allows the rational control of the radii of gold-coated TERS tips from a few to hundreds of nanometers, which allows us to systematically study the dependence of the TERS enhancement on the radius of the gold-coated AFM tip. The maximum TERS enhancement was achieved for the tip radius in the range of 60-75 nm in the gap mode. The coated gold layer has a strong adhesion with the silicon tip surface, which is highly stable in water, showing the great potential for application in the aqueous environment.

  13. AFM imaging and fractal analysis of surface roughness of AlN epilayers on sapphire substrates

    Energy Technology Data Exchange (ETDEWEB)

    Dallaeva, Dinara, E-mail: dinara.dallaeva@yandex.ru [Brno University of Technology, Faculty of Electrical Engineering and Communication, Physics Department, Technická 8, 616 00 Brno (Czech Republic); Ţălu, Ştefan [Technical University of Cluj-Napoca, Faculty of Mechanical Engineering, Department of AET, Discipline of Descriptive Geometry and Engineering Graphics, 103-105 B-dul Muncii Street, Cluj-Napoca 400641, Cluj (Romania); Stach, Sebastian [University of Silesia, Faculty of Computer Science and Materials Science, Institute of Informatics, Department of Biomedical Computer Systems, ul. Będzińska 39, 41-205 Sosnowiec (Poland); Škarvada, Pavel; Tománek, Pavel; Grmela, Lubomír [Brno University of Technology, Faculty of Electrical Engineering and Communication, Physics Department, Technická 8, 616 00 Brno (Czech Republic)

    2014-09-01

    Graphical abstract: - Highlights: • We determined the complexity of 3D surface roughness of aluminum nitride layers. • We used atomic force microscopy and analyzed their fractal geometry. • We determined the fractal dimension of surface roughness of aluminum nitride layers. • We determined the dependence of layer morphology on substrate temperature. - Abstract: The paper deals with AFM imaging and characterization of 3D surface morphology of aluminum nitride (AlN) epilayers on sapphire substrates prepared by magnetron sputtering. Due to the effect of temperature changes on epilayer's surface during the fabrication, a surface morphology is studied by combination of atomic force microscopy (AFM) and fractal analysis methods. Both methods are useful tools that may assist manufacturers in developing and fabricating AlN thin films with optimal surface characteristics. Furthermore, they provide different yet complementary information to that offered by traditional surface statistical parameters. This combination is used for the first time for measurement on AlN epilayers on sapphire substrates, and provides the overall 3D morphology of the sample surfaces (by AFM imaging), and reveals fractal characteristics in the surface morphology (fractal analysis)

  14. Custom AFM for X-ray beamlines: in situ biological investigations under physiological conditions

    Energy Technology Data Exchange (ETDEWEB)

    Gumí-Audenis, B. [ESRF, The European Synchrotron, Grenoble (France); Institute for Bioengineering of Catalonia (IBEC), Barcelona (Spain); Physical Chemistry Department, Universitat de Barcelona, Barcelona (Spain); Networking Biomedical Research Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN), Madrid (Spain); Carlà, F. [ESRF, The European Synchrotron, Grenoble (France); Vitorino, M. V. [University of Lisboa, Falculty of Science, Biosystems and Integrative Sciences Institute - BIOISI, Lisbon (Portugal); Panzarella, A. [ESRF, The European Synchrotron, Grenoble (France); Porcar, L. [Institut Laue-Langevin, Grenoble (France); Boilot, M. [ORTEC, Marseille (France); Guerber, S. [CEA, LETI Grenoble (France); Bernard, P. [ESRF, The European Synchrotron, Grenoble (France); Rodrigues, M. S. [University of Lisboa, Falculty of Science, Biosystems and Integrative Sciences Institute - BIOISI, Lisbon (Portugal); Sanz, F.; Giannotti, M. I. [Institute for Bioengineering of Catalonia (IBEC), Barcelona (Spain); Physical Chemistry Department, Universitat de Barcelona, Barcelona (Spain); Networking Biomedical Research Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN), Madrid (Spain); Costa, L., E-mail: luca.costa@esrf.fr [ESRF, The European Synchrotron, Grenoble (France)

    2015-09-30

    The performance of a custom atomic force microscope for grazing-incidence X-ray experiments on hydrated soft and biological samples is presented. A fast atomic force microscope (AFM) has been developed that can be installed as a sample holder for grazing-incidence X-ray experiments at solid/gas or solid/liquid interfaces. It allows a wide range of possible investigations, including soft and biological samples under physiological conditions (hydrated specimens). The structural information obtained using the X-rays is combined with the data gathered with the AFM (morphology and mechanical properties), providing a unique characterization of the specimen and its dynamics in situ during an experiment. In this work, lipid monolayers and bilayers in air or liquid environment have been investigated by means of AFM, both with imaging and force spectroscopy, and X-ray reflectivity. In addition, this combination allows the radiation damage induced by the beam on the sample to be studied, as has been observed on DOPC and DPPC supported lipid bilayers under physiological conditions.

  15. AFM and pulsed laser ablation methods for Cultural Heritage: application to archeometric analysis of stone artifacts

    Science.gov (United States)

    Barberio, M.; Veltri, S.; Stranges, F.; Bonanno, A.; Xu, F.; Antici, P.

    2015-09-01

    In this paper, we introduce the use of the atomic force microscope (AFM) and of the pulsed laser ablation as methods for morphological diagnostic with nanoscale precision of archeological artifacts and corrosive patina removal from stone artifacts. We test our methodology on stone artifacts extracted from the Church of Sotterra (located in Calabria, South Italy). The AFM microscopy was compared with different petrographic, chemical, optical and morphological analysis methods for identifying the textural characteristics, evaluating the state of preservation and formulating some hypotheses about the provenance and composition of the impurity patina located on the artifact surfaces. We demonstrate that with the nanometric precision obtained with AFM microscopy, it is possible to distinguish the different states of preservation, much better than using conventional petrographic methods. The surface's roughness is evaluated from very small artifact's fragments, reducing the coring at micrometric scale with a minimal damage to the artworks. After the diagnosis, we performed restoration tests using the pulsed laser ablation (PLA) method and compared it with the more common micro-sandblasting under dry conditions. We find that the PLA is highly effective for the removal of the surficial patina, with a control of a few hundreds of nanometers in the cleaning of surface, without introducing chemical or morphological damages to the artifacts. Moreover, PLA can be easily implemented in underwater conditions; this has the great advantage that stone and pottery artifacts for marine archeological sites do not need to be removed from the site.

  16. A novel dog-bone oscillating AFM probe with thermal actuation and piezoresistive detection.

    Science.gov (United States)

    Xiong, Zhuang; Mairiaux, Estelle; Walter, Benjamin; Faucher, Marc; Buchaillot, Lionel; Legrand, Bernard

    2014-01-01

    In order to effectively increase the resonance frequency and the quality factor of atomic force microscope (AFM) probes, a novel oscillating probe based on a dog-bone shaped MEMS resonator was conceived, designed, fabricated and evaluated. The novel probe with 400 μm in length, 100 μm in width and 5 μm in thickness was enabled to feature MHz resonance frequencies with integrated thermal actuation and piezoresistive detection. Standard silicon micromachining was employed. Both electrical and optical measurements were carried out in air. The resonance frequency and the quality factor of the novel probe were measured to be 5.4 MHz and 4000 respectively, which are much higher than those (about several hundreds of kHz) of commonly used cantilever probes. The probe was mounted onto a commercial AFM set-up through a dedicated probe-holder and circuit board. Topographic images of patterned resist samples were obtained. It is expected that the resonance frequency and the measurement bandwidth of such probes will be further increased by a proper downscaling, thus leading to a significant increase in the scanning speed capability of AFM instruments. PMID:25365463

  17. Simulation of CNT-AFM tip based on finite element analysis for targeted probe of the biological cell

    Science.gov (United States)

    Yousefi, Amin Termeh; Mahmood, Mohamad Rusop; Miyake, Mikio; Ikeda, Shoichiro

    2016-07-01

    Carbon nanotubes (CNTs) are potentially ideal tips for atomic force microscopy (AFM) due to the robust mechanical properties, nano scale diameter and also their ability to be functionalized by chemical and biological components at the tip ends. This contribution develops the idea of using CNTs as an AFM tip in computational analysis of the biological cell's. Finite element analysis employed for each section and displacement of the nodes located in the contact area was monitored by using an output database (ODB). This reliable integration of CNT-AFM tip process provides a new class of high performance nanoprobes for single biological cell analysis.

  18. Localized electrografting of vinylic monomers on a conducting substrate by means of an integrated electrochemical AFM probe.

    Science.gov (United States)

    Ghorbal, Achraf; Grisotto, Federico; Charlier, Julienne; Palacin, Serge; Goyer, Cédric; Demaille, Christophe

    2009-05-11

    Combinations of scanning electrochemical microscopy (SECM) with other scanning probe microscopy techniques, such as atomic force microscopy (AFM), show great promise for directing localized modification, which is of great interest for chemical, biochemical and technical applications. Herein, an atomic force scanning electrochemical microscope is used as a new electrochemical lithographic tool (L-AFM-SECM) to locally electrograft, with submicrometer resolution, a non-conducting organic coating on a conducting substrate. PMID:19308970

  19. On the Accuracy of Imaging on the Nanometer Scale:Geometry versus Material Properties in High Resolution AFM Studies

    Institute of Scientific and Technical Information of China (English)

    Adam; Mechler; Janos; Kokavecz; Peter; Heszler

    2007-01-01

    1 Results Intermittent Contact Mode Atomic Force Microscopy (ICM-AFM) imaging of sub-micron morphology is a routine operation in many fields of research from materials science to molecular biology,typically used to obtain three dimensional geometrical measures of surface structures.When it comes to the nanometer-angstrom range,however,quantitative interpretation of AFM morphology is less straightforward.Reports of non-topography-originated features as well as anomalies and conflicting reports in nanostr...

  20. Evaluation of surface alterations in different retreatment nickel-titanium files: AFM and SEM study.

    Science.gov (United States)

    Can Sağlam, Baran; Görgül, Güliz

    2015-05-01

    The aim of this study was to evaluate the surface changes of nickel titanium (Ni-Ti) rotary retreatment files after three and five uses. Furthermore, the effects of 2% sodium hypochlorite and chloroform solutions and sterilization procedures on the NiTi rotary retreatment surfaces were investigated. ProTaper Retreatment files, R-endo files, and Mtwo retreatment files were used for this study. The palatinal roots of maxillary molar teeth were obturated with gutta percha and Ah26. Retreatment procedures were performed with these retreatment file systems. The surface changes of untreated NiTi rotary files that were used three and five times, immersed in NaOCl and chloroform and subjected to sterilization procedures were investigated with atomic force microscopy (AFM) and scanning electron microscopy (SEM). The RMS values, three dimensional images and SEM images at various magnifications were obtained. RMS values showed that all three NiTi rotary retreatment file systems showed significant deteriorations after three and five uses. Cracks, damages and spiral construction deteriorations were detected in the SEM images after three and five uses. Furthermore, the Mtwo 15 file was broken off after five uses. AFM data indicated that 2% NaOCl caused significant surface deteriorations on NiTi rotary files and both AFM and SEM evaluation showed that chloroform solution and sterilization procedures did not cause significant surface deteriorations. In conclusion, ProTaper retreatment, R-endo, and Mtwo retreatment files showed surface damages depending on retreatment procedures. Clinicians have to consider that retreatment files always have a tendency to break off after the third time they have been used.

  1. Unspecific membrane protein-lipid recognition: combination of AFM imaging, force spectroscopy, DSC and FRET measurements.

    Science.gov (United States)

    Borrell, Jordi H; Montero, M Teresa; Morros, Antoni; Domènech, Òscar

    2015-11-01

    In this work, we will describe in quantitative terms the unspecific recognition between lactose permease (LacY) of Escherichia coli, a polytopic model membrane protein, and one of the main components of the inner membrane of this bacterium. Supported lipid bilayers of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) (3:1, mol/mol) in the presence of Ca(2+) display lateral phase segregation that can be distinguished by atomic force microscopy (AFM) as well as force spectroscopy. LacY shows preference for fluid (Lα) phases when it is reconstituted in POPE : POPG (3:1, mol/mol) proteoliposomes at a lipid-to-protein ratio of 40. When the lipid-to-protein ratio is decreased down to 0.5, two domains can be distinguished by AFM. While the upper domain is formed by self-segregated units of LacY, the lower domain is constituted only by phospholipids in gel (Lβ) phase. On the one hand, classical differential scanning calorimetry (DSC) measurements evidenced the segregation of a population of phospholipids and point to the existence of a boundary region at the lipid-protein interface. On the other hand, Förster Resonance Energy Transfer (FRET) measurements in solution evidenced that POPE is selectively recognized by LacY. A binary pseudophase diagram of POPE : POPG built from AFM observations enables to calculate the composition of the fluid phase where LacY is inserted. These results are consistent with a model where POPE constitutes the main component of the lipid-LacY interface segregated from the fluid bulk phase where POPG predominates.

  2. In situ Stiffness Adjustment of AFM Probes by Two Orders of Magnitude

    Directory of Open Access Journals (Sweden)

    Marcel Lambertus Cornelis de Laat

    2016-04-01

    Full Text Available The choice on which type of cantilever to use for Atomic Force Microscopy (AFM depends on the type of the experiment being done. Typically, the cantilever has to be exchanged when a different stiffness is required and the entire alignment has to be repeated. In the present work, a method to adjust the stiffness in situ of a commercial AFM cantilever is developed. The adjustment is achieved by changing the effective length of the cantilever by electrostatic pull-in. By applying a voltage between the cantilever and an electrode (with an insulating layer at the point of contact, the cantilever snaps to the electrode, reducing the cantilever’s effective length. An analytical model was developed to find the pull-in voltage of the system. Subsequently, a finite element model was developed to study the pull-in behavior. The working principle of this concept is demonstrated with a proof-of-concept experiment. The electrode was positioned close to the cantilever by using a robotic nanomanipulator. To confirm the change in stiffness, the fundamental resonance frequency of the cantilever was measured for varying electrode positions. The results match with the theoretical expectations. The stiffness was adjusted in situ in the range of 0.2 N/m to 27 N/m, covering two orders of magnitude in one single cantilever. This proof-of-concept is the first step towards a micro fabricated prototype, that integrates the electrode positioning system and cantilever that can be used for actual AFM experiments.

  3. Cell visco-elasticity measured with AFM and optical trapping at sub-micrometer deformations.

    Directory of Open Access Journals (Sweden)

    Schanila Nawaz

    Full Text Available The measurement of the elastic properties of cells is widely used as an indicator for cellular changes during differentiation, upon drug treatment, or resulting from the interaction with the supporting matrix. Elasticity is routinely quantified by indenting the cell with a probe of an AFM while applying nano-Newton forces. Because the resulting deformations are in the micrometer range, the measurements will be affected by the finite thickness of the cell, viscous effects and even cell damage induced by the experiment itself. Here, we have analyzed the response of single 3T3 fibroblasts that were indented with a micrometer-sized bead attached to an AFM cantilever at forces from 30-600 pN, resulting in indentations ranging from 0.2 to 1.2 micrometer. To investigate the cellular response at lower forces up to 10 pN, we developed an optical trap to indent the cell in vertical direction, normal to the plane of the coverslip. Deformations of up to two hundred nanometers achieved at forces of up to 30 pN showed a reversible, thus truly elastic response that was independent on the rate of deformation. We found that at such small deformations, the elastic modulus of 100 Pa is largely determined by the presence of the actin cortex. At higher indentations, viscous effects led to an increase of the apparent elastic modulus. This viscous contribution that followed a weak power law, increased at larger cell indentations. Both AFM and optical trapping indentation experiments give consistent results for the cell elasticity. Optical trapping has the benefit of a lower force noise, which allows a more accurate determination of the absolute indentation. The combination of both techniques allows the investigation of single cells at small and large indentations and enables the separation of their viscous and elastic components.

  4. Characterization of Pebax angioplasty balloon surfaces with AFM, SEM, TEM, and SAXS.

    Science.gov (United States)

    Warner, Jacob A; Forsyth, Bruce; Zhou, Fang; Myers, Jason; Frethem, Chris; Haugstad, Greg

    2016-04-01

    In the medical device industry, angioplasty balloons have been widely used in the less invasive treatment of heart disease by expanding and relieving clogged structures in various arterial segments. However, new applications using thin coatings on the balloon surface have been explored to enhance therapeutic value in the delivery of pharmaceuticals (drug-elution) or control thermal energy output (RF ablation). In this study, angioplasty balloon materials comprised of poly(ether-block-amide) (Pebax) were investigated via atomic force microscopy (AFM), transmission electron microscopy (TEM), scanning electron microscopy (SEM), and small-angle X-ray scattering (SAXS) to characterize physical properties at the balloon surface that may affect coating adhesion. The soft segment of this Pebax 1074 material is polyethylene oxide (PEO) and the hard segment is nylon-12. The morphology of the hard segments of this block co-polymer are found via AFM stiffness measurements to be (40 ± 20) nm by (300 ± 150) nm and are oriented parallel to the surface of the balloon. SAXS measurements found the lamellar spacing to be (18.5 ± 0.5) nm, and demonstrate a preferential orientation in agreement with TEM and AFM measurements. Fixation of this balloon in resin, followed by cryo-sectioning is shown to provide a novel manner in which to investigate surface characteristics on the balloon such as material or coating thickness as well as uniformity in comparison to the bulk structure. These outputs were deemed critical to improve overall balloon processing such as molding and surface treatment options for robust designs toward better procedural outcomes targeting new therapeutic areas. PMID:25891789

  5. Investigation of the resistive switching in AgxAsS2 layer by conductive AFM

    Science.gov (United States)

    Zhang, Bo; Kutalek, Petr; Knotek, Petr; Hromadko, Ludek; Macak, Jan M.; Wagner, Tomas

    2016-09-01

    In this paper, a study of resistive switching in AgxAsS2 layer, based on a utilization of conductive atomic force microscope (AFM), is reported. As the result of biasing, two distinct regions were created on the surface (the conductive region and non-conductive region). Both were analysed from the spread current maps. The volume change, corresponding to the growth of Ag particles, was derived from the topological maps, recorded simultaneously with the current maps. Based on the results, a model explaining the mechanism of the Ag particle and Ag filament formation was proposed from the distribution of charge carriers and Ag ions.

  6. Tip loading effects on AFM-based transport measurements of metal–oxide interfaces

    International Nuclear Information System (INIS)

    Here we demonstrate the effects of tip loading force on the contact quality and local current–voltage character between conductive AFM tips and individual noble metal nanoparticle–strontium titanate (NP–STO) interfaces. These results show that though contact quality may improve with increased loading force, nanoparticle deformation remains negligible for loading forces in the nN–μN range. Maintaining a moderate loading force in the tens to hundreds of nN therefore enables size-dependent transport of individual NP–STO interfaces to be determined. (paper)

  7. Ultra-high aspect ratio replaceable AFM tips using deformation-suppressed focused ion beam milling

    DEFF Research Database (Denmark)

    Savenko, Alexey; Yildiz, Izzet; Petersen, Dirch Hjorth;

    2013-01-01

    in terms of defining the shape and size of the tip. Due to beam-induced deformation, it has so far not been possible to define HAR structures using lateral FIB milling. In this work we obtain aspect ratios of up to 45, with tip diameters down to 9 nm, by a deformation-suppressing writing strategy. Several...... FIB milling strategies for obtaining sharper tips are discussed. Finally, assembly of the HAR tips on a custom-designed probe as well as the first AFM scanning is shown....

  8. The process of collagen biomineralization observed by AFM in a model dual membrane diffusion system

    International Nuclear Information System (INIS)

    Investigation and simulation of naturally occurring mineralization can offer some new ideas in the design and fabrication of new functional materials for bone analogues. In this paper, a model dual membrane diffusion system (DMDS) was used to study the mineralization behaviour of collagen. The process of mineralization was observed by atomic force microscope (AFM). The results showed that the surface roughness and hardness of mineralized collagen fibers increased with time during the process of mineralization. The adhesion force of mineralized collagen fibers decreased with mineralization time. The micromechanical properties and microstructure changes of mineralized collagen fibers suggested that the mineralization was a step-by-step assembling process.

  9. AFM research on the mechanism of Fe-based alloy stress annealed inducing magnetic anisotropy

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The cross-section of the Fe-based alloy (Fe73.5Cu1Nb3Si13.5B9) ribbon annealed at 540℃ under various tensile stress was investigated with atomic force microscope (AFM). The stress effect mechanism in Fe-based alloy ribbon tensile stress an-nealed inducing transverse magnetic anisotropy field was studied using the X-ray diffraction spectra and longitudinal drive giant magneto-impedance effect curves, and the model of direction dominant in encapsulated grain agglomeration was es-tablished. The relationship between the direction dominant in encapsulated grain agglomeration and magnetic anisotropy field was disclosed.

  10. A model for superconductivity induced by AFM magnons exchange in CuO2 layers

    International Nuclear Information System (INIS)

    In this paper, the authors present the calculation of the critical superconducting temperature in La2-xMxCuO4. The pairing here is between the holes on the O-sites in the CuO2 layers and is ascribed to the fluctuations of the antiferromagnetic background of the localized spins on the Cu-sites. The effective O-holes interaction Hamiltonian is obtained integrating out the Cu-spins, and is interpreted as due to virtual exchange of either paramagnons or AFM magnons. In both cases the d-wave singlet pairing is found to have the highest critical temperature

  11. A Study on HA Titanium Surface with Atomic Force Microscope (AFM)

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Three kinds of titanium surface especially the HA surface are analyzed. Titanium was treated by 3 kinds of methods that were acid & alkali, calcic solution and apatite solution. Samples were observed by optic microscope and atomic force microscope ( AFM). The typical surface morphology of the acid and alkali group is little holes, and on the two HA surface the tiny protuberances is typical. The surface treated by apatite solution was smoother than the two formers. The rough surface treated with acid and alkali was propitious to Ca + , Pand proteins' adhesion, and the relatively smooth HA surface was of benefit to the cell adhesion.

  12. The AFM-FM phase transition in FeRh investigated using XMCD

    Energy Technology Data Exchange (ETDEWEB)

    Stamm, Christian; Duerr, Hermann A.; Eberhardt, Wolfgang [BESSY, Albert-Einstein-Str. 15, 12489 Berlin (Germany); Back, Christian [Institut fuer Experimentelle und Angewandte Physik, Universitaet Regensburg, Universitaetsstr. 31, 93040 Regensburg (Germany); Radu, Ilie [BESSY, Albert-Einstein-Str. 15, 12489 Berlin (Germany); Institut fuer Experimentelle und Angewandte Physik, Universitaet Regensburg, Universitaetsstr. 31, 93040 Regensburg (Germany); Thiele, Jan-Ulrich [Hitachi Global Storage Technologies, 3403 Yerba Buena Road, San Jose, CA 95135 (United States)

    2008-07-01

    The phase transition from antiferromagnetic to ferromagnetic ordering in FeRh is investigated in an element specific way by means of X-ray absorption spectroscopy. Dichroism sum rules allow us to determine spin and orbital moments of the two elements. Increasing the temperature from 300 to 450 Kelvin, the magnetic moments in Fe and Rh both evolve from zero to their final value, while the ratio of Rh to Fe moments stays constant. We attribute this to a coexistence of the AFM and FM phases.

  13. Crystal structures of Boro-AFm and sBoro-AFt phases

    Energy Technology Data Exchange (ETDEWEB)

    Champenois, Jean-Baptiste [Commissariat a l' Energie Atomique et aux Energies Alternatives, CEA DEN/DTCD/SPDE, F-30207 Bagnols sur Ceze (France); Mesbah, Adel [Commissariat a l' Energie Atomique et aux Energies Alternatives, CEA DEN/DTCD/SPDE, F-30207 Bagnols sur Ceze (France); Clermont Universite, ENSCCF, Institut de Chimie de Clermont-Ferrand, BP 10448, F-63000 Clermont-Ferrand (France); Cau Dit Coumes, Celine, E-mail: celine.cau-dit-coumes@cea.fr [Commissariat a l' Energie Atomique et aux Energies Alternatives, CEA DEN/DTCD/SPDE, F-30207 Bagnols sur Ceze (France); Renaudin, Guillaume [Clermont Universite, ENSCCF, Institut de Chimie de Clermont-Ferrand, BP 10448, F-63000 Clermont-Ferrand (France); CNRS, UMR 6296, ICCF, F-63171 Aubiere (France); Leroux, Fabrice [Clermont Universite, Universite Blaise Pascal, Institut de Chimie de Clermont-Ferrand, BP 10448, F-63000 Clermont-Ferrand (France); CNRS, UMR 6296, ICCF, F-63171 Aubiere (France); Mercier, Cyrille [LMCPA, Universite de Valenciennes et du Hainaut Cambresis, 59600 Maubeuge (France); Revel, Bertrand [Centre Commun de Mesure RMN, Universite Lille1 Sciences et Technologies, Cite Scientifique 59655 Villeneuve d' Ascq Cedex (France); Damidot, Denis [EM Douai, MPE-GCE, 59508 Douai (France)

    2012-10-15

    Crystal structures of boron-containing AFm (B-AFm) and AFt (B-AFt) phases have been solved ab-initio and refined from X-ray powder diffraction. {sup 11}B NMR and Raman spectroscopies confirm the boron local environment in both compounds: three-fold coordinated in B-AFm corresponding to HBO{sub 3}{sup 2-} species, and four-fold coordinated in B-AFt corresponding to B (OH){sub 4}{sup -} species. B-AFm crystallizes in the rhombohedral R3{sup Macron }c space group and has the 3CaO{center_dot}Al{sub 2}O{sub 3}{center_dot}CaHBO{sub 3}{center_dot}12H{sub 2}O (4CaO{center_dot}Al{sub 2}O{sub 3}{center_dot}1/2B{sub 2}O{sub 3}{center_dot}12.5H{sub 2}O, C{sub 4}AB{sub 1/2}H{sub 12.5}) general formulae with planar trigonal HBO{sub 3}{sup 2-} anions weakly bonded at the centre of the interlayer region. One HBO{sub 3}{sup 2-} anion is statistically distributed with two weakly bonded water molecules on the same crystallographic site. B-AFt crystallizes in the trigonal P3cl space group and has the 3CaO{center_dot}Al{sub 2}O{sub 3}{center_dot}Ca(OH){sub 2}{center_dot}2Ca(B (OH){sub 4}){sub 2}{center_dot}24H{sub 2}O (6CaO{center_dot}Al{sub 2}O{sub 3}{center_dot}2B{sub 2}O{sub 3}{center_dot}33H{sub 2}O, C{sub 6}AB{sub 2}H{sub 33}) general formulae with tetrahedral B (OH){sub 4}{sup -} anions located in the channel region of the structure. All tetrahedral anions are oriented in a unique direction, leading to a hexagonal c lattice parameter about half that of ettringite.

  14. Mechanical force-induced DNA damage during AFM single-molecule manipulation

    International Nuclear Information System (INIS)

    Many environmental factors can cause DNA damage, such as radiation, heat, oxygen free radical, etc., which can induce mutation during DNA replication. Meanwhile, DNA molecules are subjected to various mechanical forces in numerous biological processes. However, it is unknown whether the mechanical force would induce DNA damage and introduce mutation during DNA replication, With the combination of single-molecule manipulation based on atomic force microscopy (AFM), single molecular polymerase chain reaction (SM-PCR) and Sanger's sequencing, we investigated the effect of mechanical force on DNA. The results show that mechanical force can cause DNA damage and induce DNA mutation during amplification. (authors)

  15. Multiscale patterning of nanocomposite polyelectrolyte/nanoparticle films using inkjet printing and AFM scratching

    Science.gov (United States)

    Leigh, S. J.; Bowen, J.; Preece, J. A.

    2015-06-01

    The fabrication of structured polymer/nanoparticle composite films through a combination of additive, subtractive and self-assembly methodologies is investigated. Consumer grade inkjet printing hardware is employed to deposit cationic polyelectrolytes on (i) hydrophilic and (ii) hydrophobised glass substrates. The hydrophobisation process controls the spreading of the droplets and hence the lateral size of printed features. The printed cationic polyelectrolyte regions are used as a template to direct the self-assembly of negatively charged gold nanoparticles onto the surface. Micro-scale features are created in the polyelectrolyte/nanoparticle films using AFM scratching to selectively displace material. The effect of substrate wettability on film morphology is discussed.

  16. Fabrication of 3D structure by combining AFM and chemical etching on crystalline silicon surface

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    AFM is used for forming silicon dioxide as a layer (nask) on the silicon wafer surface (100) during the cutting process in ambient atmosphere. The silicon dioxide is made through reaction of silicon and oxygen in the atmosphere. As a result of the anisotropic behavior of single crystalline silicon, the etching rates in alkaline solution depend greatly on the various crystal orientations. The anisotropic etching behaviors in KOH solution and reasons of crystalline silicon are described. Effect of etching conditions such as etching temperature and KOH concentration of the alkaline solution on height of the micro-protuberances has been described.

  17. Study of β-amyloid adsorption and aggregation on graphite by STM and AFM

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The scanning tunneling microscopy (STM) and the atomic force microscopy (AFM) have been applied to the direct study of the adsorption and aggregation of β-amyloid(1-42)(Aβ42) on the hydrophobic graphite surface. It was found that Aβ42 were preferentially adsorbed on graphite defects such as the edges. Aβ42 peptides self-assembled into intermediate protofibrils, which in turn self-associated to form fibrils. Usually, two or more fibrils intertwined to form the helical structure. These results will provide an important clue to studying the aggregation process of β-amyloid.

  18. Label-free and quantitative evaluation of cytotoxicity based on surface nanostructure and biophysical property of cells utilizing AFM.

    Science.gov (United States)

    Lee, Young Ju; Lee, Gi-Ja; Kang, Sung Wook; Cheong, Youjin; Park, Hun-Kuk

    2013-06-01

    In this study, the four commonly used cytotoxicity assays and the mechanical properties as evaluated by atomic force microscopy (AFM) were compared in a cellular system. A cytotoxicity assay is the first and most essential test to evaluate biocompatibility of various toxic substances. Many of the cytotoxicity methods require complicated and labor-intensive process, as well as introduce experimental error. In addition, these methods cannot provide instantaneous and quantitative cell viability information. AFM has become an exciting analytical tool in medical, biological, and biophysical research due to its unique abilities. AFM-based force-distance curve measurements precisely measure the changes in the biophysical properties of the cell. Therefore, we observed the morphological changes and mechanical property changes in L929 cells following sodium lauryl sulfate (SLS) treatment utilizing AFM. AFM imaging showed that the toxic effects of SLS changed not only the spindle-like shape of L929 cells into a round shape, but also made a rough cell surface. As the concentration of SLS was increased, the surface roughness of L929 cell was increased, and stiffness decreased. We confirmed that inhibition of proliferation clearly increased with increases in SLS concentration based on results from MTT, WST, neutral red uptake, and LIVE/DEAD viability/cytotoxicity assays. The estimated IC₅₀ value by AFM analysis was similar to those of other conventional assays and was included within the 95% confidence interval range. We suggest that an AFM quantitative analysis of the morphological and biophysical changes in cells can be utilized as a new method for evaluating cytotoxicity. PMID:23582483

  19. Atomic force microscopy (AFM) study of thick lamellar stacks of phospholipid bilayers

    CERN Document Server

    Schafer, Arne; Rheinstadter, Maikel C

    2007-01-01

    We report an Atomic Force Microscopy (AFM) study on thick multi lamellar stacks of approx. 10 mum thickness (about 1500 stacked membranes) of DMPC (1,2-dimyristoyl-sn-glycero-3-phoshatidylcholine) deposited on silicon wafers. These thick stacks could be stabilized for measurements under excess water or solution. From force curves we determine the compressional modulus B and the rupture force F_r of the bilayers in the gel (ripple), the fluid phase and in the range of critical swelling close to the main transition. AFM allows to measure the compressional modulus of stacked membrane systems and values for B compare well to values reported in the literature. We observe pronounced ripples on the top layer in the Pbeta' (ripple) phase and find an increasing ripple period Lambda_r when approaching the temperature of the main phase transition into the fluid Lalpha phase at about 24 C. Metastable ripples with 2Lambda_r are observed. Lambda_r also increases with increasing osmotic pressure, i.e., for different concent...

  20. Oscillatory structural forces due to nonionic surfactant micelles: data by colloidal-probe AFM vs theory.

    Science.gov (United States)

    Christov, Nikolay C; Danov, Krassimir D; Zeng, Yan; Kralchevsky, Peter A; von Klitzing, Regine

    2010-01-19

    Micellar solutions of nonionic surfactants Brij 35 and Tween 20 are confined between two surfaces in a colloidal-probe atomic-force microscope (CP-AFM). The experimentally detected oscillatory forces due to the layer-by-layer expulsion of the micelles agree very well with the theoretical predictions for hard-sphere fluids. While the experiment gives parts of the stable branches of the force curve, the theoretical model allows reconstruction of the full oscillatory curve. Therewith, the strength and range of the ordering could be determined. The resulting aggregation number from the fits of the force curves for Brij 35 is close to 70 and exhibits a slight tendency to increase with the surfactant concentration. The last layer of micelles cannot be pressed out. The measured force-vs-distance curve has nonequilibrium portions, which represent "jumps" from one to another branch of the respective equilibrium oscillatory curve. In the case of Brij 35, at concentrations force oscillations are almost suppressed, which implies that the micelles of this surfactant are labile and are demolished by the hydrodynamic shear stresses due to the colloidal-probe motion. The comparison of the results for the two surfactants demonstrates that in some cases the micelles can be destroyed by the CP-AFM, but in other cases they can be stable and behave as rigid particles. This behavior correlates with the characteristic times of the slow micellar relaxation process for these surfactants. PMID:20067306

  1. On the molecular interaction between albumin and ibuprofen: An AFM and QCM-D study.

    Science.gov (United States)

    Eleta-Lopez, Aitziber; Etxebarria, Juan; Reichardt, Niels-Christian; Georgieva, Radostina; Bäumler, Hans; Toca-Herrera, José L

    2015-10-01

    The adsorption of proteins on surfaces often results in a change of their structural behavior and consequently, a loss of bioactivity. One experimental method to study interactions on a molecular level is single molecular force spectroscopy that permits to measure forces down to the pico-newton range. In this work, the binding force between human serum albumin (HSA), covalently immobilized on glutaraldehyde modified gold substrates, and ibuprofen sodium salt was studied by means of single molecular force spectroscopy. First of all, a protocol was established to functionalize atomic force microscopy (AFM) tips with ibuprofen. The immobilization protocol was additionally tested by quartz crystal microbalance with dissipation (QCM-D) and contact angle measurements. AFM was used to characterize the adsorption of HSA on gold substrates, which lead to a packed monolayer of thickness slightly lower than the reported value in solution. Finally, single molecule spectroscopy results were used to characterize the binding force between albumin and ibuprofen and calculate the distance of the transition state (0.6 nm) and the dissociation rate constant (0.055 s(-1)). The results might indicate that part of the adsorbed protein still preserves its functionality upon adsorption. PMID:26218522

  2. Friction behavior of nano-textured polyimide surfaces measured by AFM colloidal probe

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiaoliang [College of Equipment Manufacturing, Hebei University of Engineering, Handan 056038 (China); State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Wu, Chunxia; Che, Hongwei; Hou, Junxian [College of Equipment Manufacturing, Hebei University of Engineering, Handan 056038 (China); Jia, Junhong, E-mail: jhjia@licp.cas.cn [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China)

    2014-11-30

    Highlights: • Flat PI film and nano-textured PI film were prepared by spin-coating process. • The nano-textured PI surface has effectively reduced the adhesion and friction. • Friction increased with the increasing of contact area and adhesion. • The growth rate of friction decreased with the increasing of applied load. - Abstract: Flat polyimide (PI) film and silicon dioxide nanoparticle-textured PI film were prepared by means of the spin-coating technique. The adhesion and friction properties of the flat PI surface and nano-textured PI surface were investigated by a series of Atomic force microscope (AFM) colloidal probes. Experimental results revealed that the nano-textured PI surface can significantly reduce the adhesive force and friction force, compared with the flat PI surface. The main reason is that the nano-textures can reduce the contact area between the sample surface and colloidal probe. The effect of colloidal probe size on the friction behavior of the flat and nano-textured PI surfaces was evaluated. The adhesive force and friction force of nano-textured PI surface were increased with the increasing of the size of interacting pairs (AFM colloidal probe) due to the increased contact area. Moreover, the friction forces of flat and nano-textured PI surfaces were increased with applied load and sliding velocity.

  3. Influence of the tip mass on the tip-sample interactions in TM-AFM

    International Nuclear Information System (INIS)

    This paper focuses on the influences of the tip mass ratio (the ratio of the tip mass to the cantilever mass), on the excitation of higher oscillation eigenmodes and also on the tip-sample interaction forces in tapping mode atomic force microscopy (TM-AFM). A precise model for the cantilever dynamics capable of accurate simulations is essential for the investigation of the tip mass effects on the interaction forces. In the present work, the finite element method (FEM) is used for modeling the AFM cantilever to consider the oscillations of higher eigenmodes oscillations. In addition, molecular dynamics (MD) is used to calculate precise data for the tip-sample force as a function of tip vertical position with respect to the sample. The results demonstrate that in the presence of nonlinear tip-sample interaction forces, the tip mass ratio plays a significant role in the excitations of higher eigenmodes and also in the normal force applied on the surface. Furthermore, it has been shown that the difference between responses of the FEM and point-mass models in different system operational conditions is highly affected by the tip mass ratio. -- Highlights: → A strong correlation exists between the tip mass ratio and the 18th harmonic amplitude. → Near the critical tip mass ratio a small change in the tip mass may lead to a significant force change. → Inaccuracy of the lumped model depends significantly on the tip mass ratio

  4. Adsorption mechanisms for fatty acids on DLC and steel studied by AFM and tribological experiments

    Energy Technology Data Exchange (ETDEWEB)

    Simič, R.; Kalin, M., E-mail: mitjan.kalin@tint.fs.uni-lj.si

    2013-10-15

    Fatty acids are known to affect the friction and wear of steel contacts via adsorption onto the surface, which is one of the fundamental boundary-lubrication mechanisms. The understanding of the lubrication mechanisms of polar molecules on diamond-like carbon (DLC) is, however, still insufficient. In this work we aimed to find out whether such molecules have a similar effect on DLC coatings as they do on steel. The adsorption of hexadecanoic acid in various concentrations (2–20 mmol/l) on DLC was studied under static conditions using an atomic force microscope (AFM). The amount of surface coverage of the adsorbed fatty-acid molecules was analysed. In addition, tribological tests were performed to correlate the wear and friction behaviours in tribological contacts with the adsorption of molecules on the surface under static conditions. A good correlation between the AFM results and the tribological behaviour was observed. We confirmed that fatty acids can adsorb onto the DLC surfaces and are, therefore, potential boundary-lubrication agents for DLC coatings. The adsorption of the fatty acid onto the DLC surfaces reduces the wear of the coatings, but it is less effective in reducing the friction. Tentative adsorption mechanisms that include an environmental species effect, a temperature effect and a tribochemical effect are proposed for DLC and steel surfaces based on our results and few potential mechanisms found in literature.

  5. Adsorption mechanisms for fatty acids on DLC and steel studied by AFM and tribological experiments

    Science.gov (United States)

    Simič, R.; Kalin, M.

    2013-10-01

    Fatty acids are known to affect the friction and wear of steel contacts via adsorption onto the surface, which is one of the fundamental boundary-lubrication mechanisms. The understanding of the lubrication mechanisms of polar molecules on diamond-like carbon (DLC) is, however, still insufficient. In this work we aimed to find out whether such molecules have a similar effect on DLC coatings as they do on steel. The adsorption of hexadecanoic acid in various concentrations (2-20 mmol/l) on DLC was studied under static conditions using an atomic force microscope (AFM). The amount of surface coverage of the adsorbed fatty-acid molecules was analysed. In addition, tribological tests were performed to correlate the wear and friction behaviours in tribological contacts with the adsorption of molecules on the surface under static conditions. A good correlation between the AFM results and the tribological behaviour was observed. We confirmed that fatty acids can adsorb onto the DLC surfaces and are, therefore, potential boundary-lubrication agents for DLC coatings. The adsorption of the fatty acid onto the DLC surfaces reduces the wear of the coatings, but it is less effective in reducing the friction. Tentative adsorption mechanisms that include an environmental species effect, a temperature effect and a tribochemical effect are proposed for DLC and steel surfaces based on our results and few potential mechanisms found in literature.

  6. Adsorption mechanisms for fatty acids on DLC and steel studied by AFM and tribological experiments

    International Nuclear Information System (INIS)

    Fatty acids are known to affect the friction and wear of steel contacts via adsorption onto the surface, which is one of the fundamental boundary-lubrication mechanisms. The understanding of the lubrication mechanisms of polar molecules on diamond-like carbon (DLC) is, however, still insufficient. In this work we aimed to find out whether such molecules have a similar effect on DLC coatings as they do on steel. The adsorption of hexadecanoic acid in various concentrations (2–20 mmol/l) on DLC was studied under static conditions using an atomic force microscope (AFM). The amount of surface coverage of the adsorbed fatty-acid molecules was analysed. In addition, tribological tests were performed to correlate the wear and friction behaviours in tribological contacts with the adsorption of molecules on the surface under static conditions. A good correlation between the AFM results and the tribological behaviour was observed. We confirmed that fatty acids can adsorb onto the DLC surfaces and are, therefore, potential boundary-lubrication agents for DLC coatings. The adsorption of the fatty acid onto the DLC surfaces reduces the wear of the coatings, but it is less effective in reducing the friction. Tentative adsorption mechanisms that include an environmental species effect, a temperature effect and a tribochemical effect are proposed for DLC and steel surfaces based on our results and few potential mechanisms found in literature.

  7. Spontaneous aggregation of humic acid observed with AFM at different pH.

    Science.gov (United States)

    Colombo, Claudio; Palumbo, Giuseppe; Angelico, Ruggero; Cho, Hyen Goo; Francioso, Ornella; Ertani, Andrea; Nardi, Serenella

    2015-11-01

    Atomic force microscopy in contact (AFM-C) mode was used to investigate the molecular dynamics of leonardite humic acid (HA) aggregate formed at different pH values. HA nanoparticles dispersed at pH values ranging from 2 to 12 were observed on a mica surface under dry conditions. The most clearly resolved and well-resulted AFM images of single particle were obtained at pH 5, where HA appeared as supramolecular particles with a conic shape and a hole in the centre. Those observations suggested that HA formed under these conditions exhibited a pseudo-amphiphilic nature, with secluded hydrophobic domains and polar subunits in direct contact with hydrophilic mica surface. Based on molecular simulation methods, a lignin-carbohydrate complex (LCC) model was proposed to explain the HA ring-like morphology. The LCC model optimized the parameters of β-O-4 linkages between 14 units of 1-4 phenyl propanoid, and resulted in an optimized structure comprising 45-50 linear helical molecules looped spirally around a central cavity. Those results added new insights on the adsorption mechanism of HA on polar surfaces as a function of pH, which was relevant from the point of view of natural aggregation in soil environment. PMID:26295541

  8. Structure of tetracene films on hydrogen-passivated Si(001) studied via STM, AFM, and NEXAFS

    International Nuclear Information System (INIS)

    Scanning tunneling microscopy (STM), atomic force microscopy (AFM), and near-edge x-ray absorption fine structure (NEXAFS) have been used to study the structure of tetracene films on hydrogen-passivated Si(001). STM imaging of the films with nominal thickness of three monolayers (3 ML) exhibits the characteristic 'herringbone' molecular packing known from the bulk crystalline tetracene, showing standing molecules on the ab plane. The dimensions and orientation of the herringbone lattice indicate a commensurate structural relationship between the lattice and the crystalline substrate. The corresponding AFM images illustrate that at and above the third layer of the films, the islands are anisotropic, in contrast with the submonolayer fractals, with two preferred growth directions appearing orthogonal to each other. The polarization dependent NEXAFS measurements indicate that the average molecular tilting angle with respect to the surface first increases with the film thickness up to 3 ML, then stabilizes at a value close to the bulk tetracene case afterwards. The combined results indicate a distinct growth morphological change that occurs around a few monolayers of thickness

  9. The use of functionalized AFM tips as molecular sensors in the detection of pesticides

    Energy Technology Data Exchange (ETDEWEB)

    Deda, Daiana K.; Pereira, Barbara B.S.; Bueno, Carolina C.; Silva, Aline N. da; Ribeiro, Gabrielle A.; Amarante, Adriano M.; Leite, Fabio L., E-mail: fabioleite@ufscar.br [Universidade Federal de Sao Carlos (LNN/UFSCar), Sorocaba, SP (Brazil). Dept. de Fisica, Quimica e Matematica. Lab. de Nanoneurobiofisica; Franca, Eduardo F. [Universidade Federal de Uberlandia (UFU), MG (Brazil). Inst. de Quimica

    2013-11-01

    Atomic force spectroscopy, a technique derived from Atomic Force Microscopy (AFM), allowed to distinguish nonspecific and specific interactions between the acetolactate synthase enzyme (ALS) and anti-atrazine antibody biomolecules and the herbicides imazaquin, metsulfuron-methyl and atrazine. The presence of specific interactions increased the adhesion force (F{sub adh}) between the AFM tip and the herbicides, which made the modified tip a powerful biosensor. Increases of approximately 132% and 145% in the F{sub adh} values were observed when a tip functionalized with ALS was used to detect imazaquin and metsulfuron-methyl, respectively. The presence of specific interactions between the atrazine and the anti-atrazine antibody also caused an increase in the F{sub adh} values (approximately 175%) compared to those observed when using an unfunctionalized tip. The molecular modeling results obtained with the ALS enzyme suggest that the orientation of the biomolecule on the tip surface could be suitable for allowing interaction with the herbicides imazaquin and metsulfuron-methyl. (author)

  10. Spin Dynamics and Quantum Tunneling in Fe8 Nanomagnet and in AFM Rings by NMR

    International Nuclear Information System (INIS)

    In this thesis, our main interest has been to investigate the spin dynamics and quantum tunneling in single molecule magnets (SMMs), For this we have selected two different classes of SMMs: a ferrimagnetic total high spin S = 10 cluster Fe8 and antiferromagnetic (AFM) ring-type clusters. For Fe8, our efforts have been devoted to the investigation of the quantum tunneling of magnetization in the very low temperature region. The most remarkable experimental finding in Fe8 is that the nuclear spin-lattice relaxation rate (1/Tl) at low temperatures takes place via strong collision mechanism, and thus it allows to measure directly the tunneling rate vs T and H for the first time. For AFM rings, we have shown that 1/Tl probes the thermal fluctuations of the magnetization in the intermediate temperature range. We find that the fluctuations are dominated by a single characteristic frequency which has a power law T-dependence indicative of fluctuations due to electron-acoustic phonon interactions

  11. Adaptive AFM scan speed control for high aspect ratio fast structure tracking

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, Ahmad; Schuh, Andreas; Rangelow, Ivo W. [Department of Microelectronic and Nanoelectronic Systems, Faculty of Electrical Engineering and Information Technology Ilmenau University of Technology, Gustav-Kirchhoffstr. 1, 98684 Ilmenau (Germany)

    2014-10-15

    Improved imaging rates in Atomic Force Microscopes (AFM) are of high interest for disciplines such as life sciences and failure analysis of semiconductor wafers, where the sample topology shows high aspect ratios. Also, fast imaging is necessary to cover a large surface under investigation in reasonable times. Since AFMs are composed of mechanical components, they are associated with comparably low resonance frequencies that undermine the effort to increase the acquisition rates. In particular, high and steep structures are difficult to follow, which causes the cantilever to temporarily loose contact to or crash into the sample. Here, we report on a novel approach that does not affect the scanner dynamics, but adapts the lateral scanning speed of the scanner. The controller monitors the control error signal and, only when necessary, decreases the scan speed to allow the z-piezo more time to react to changes in the sample's topography. In this case, the overall imaging rate can be significantly increased, because a general scan speed trade-off decision is not needed and smooth areas are scanned fast. In contrast to methods trying to increase the z-piezo bandwidth, our method is a comparably simple approach that can be easily adapted to standard systems.

  12. Measuring cell wall elasticity on enteroaggregative Escherichia coli wild type and dispersin mutant by AFM

    Energy Technology Data Exchange (ETDEWEB)

    Beckmann, Melissa [ORNL; Venkataraman, Sankar [ORNL; Doktycz, Mitchel John [ORNL; Nataro, James P [University of Maryland; Sullivan, Claretta J [ORNL; Morrell-Falvey, Jennifer L [ORNL; Allison, David P [ORNL

    2006-07-01

    Enteroaggregative Escherichia coli (EAEC) is pathogenic and produces severe diarrhea in humans. A mutant of EAEC that does not produce dispersin, a cell surface protein, is not pathogenic. It has been proposed that dispersin imparts a positive charge to the bacterial cell surface allowing the bacteria to colonize on the negatively charged intestinal mucosa. However, physical properties of the bacterial cell surface, such as rigidity, may be influenced by the presence of dispersin and may contribute to pathogenicity. Using the system developed in our laboratory for mounting and imaging bacterial cells by atomic force microscopy (AFM), in liquid, on gelatin coated mica surfaces, studies were initiated to measure cell surface elasticity. This was carried out in both wild type EAEC, that produces dispersin, and the mutant that does not produce dispersin. This was accomplished using AFM force-distance (FD) spectroscopy on the wild type and mutant grown in liquid or on solid medium. Images in liquid and in air of both the wild-type and mutant grown in liquid and on solid media are presented. This work represents an initial step in efforts to understand the pathogenic role of the dispersin protein in the wild-type bacteria.

  13. Measuring cell surface elasticity on enteroaggregative Escherichia coli wild type and dispersin mutant by AFM

    Energy Technology Data Exchange (ETDEWEB)

    Beckmann, M.A. [UT-ORNL Graduate School of Genome Science and Technology, University of Tennessee, Knoxville, TN 37996-0840 (United States); Venkataraman, S. [Department of Electrical and Computer Engineering, University of Tennessee, Knoxville, TN 37996-0840 (United States); Life Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6123 (United States); Doktycz, M.J. [UT-ORNL Graduate School of Genome Science and Technology, University of Tennessee, Knoxville, TN 37996-0840 (United States); Life Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6123 (United States); Nataro, J.P. [Department of Pediatrics, University of Maryland School of Medicine, Baltimore, MD 21201 (United States); Sullivan, C.J. [UT-ORNL Graduate School of Genome Science and Technology, University of Tennessee, Knoxville, TN 37996-0840 (United States); Morrell-Falvey, J.L. [Life Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6123 (United States); Allison, D.P. [UT-ORNL Graduate School of Genome Science and Technology, University of Tennessee, Knoxville, TN 37996-0840 (United States) and Department of Biochemistry and Cellular and Molecular Biology, University of Tennessee, Knoxville, TN 37996-0840 (United States) and Life Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6123 (United States) and Molecular Imaging Inc. Tempe, AZ 85282 (United States)]. E-mail: allisond@utk.edu

    2006-06-15

    Enteroaggregative Escherichia coli (EAEC) is pathogenic and produces severe diarrhea in humans. A mutant of EAEC that does not produce dispersin, a cell surface protein, is not pathogenic. It has been proposed that dispersin imparts a positive charge to the bacterial cell surface allowing the bacteria to colonize on the negatively charged intestinal mucosa. However, physical properties of the bacterial cell surface, such as rigidity, may be influenced by the presence of dispersin and may contribute to pathogenicity. Using the system developed in our laboratory for mounting and imaging bacterial cells by atomic force microscopy (AFM), in liquid, on gelatin coated mica surfaces, studies were initiated to measure cell surface elasticity. This was carried out in both wild type EAEC, that produces dispersin, and the mutant that does not produce dispersin. This was accomplished using AFM force-distance (FD) spectroscopy on the wild type and mutant grown in liquid or on solid medium. Images in liquid and in air of both the wild-type and mutant grown in liquid and on solid media are presented. This work represents an initial step in efforts to understand the pathogenic role of the dispersin protein in the wild-type bacteria.

  14. XPS and AFM analysis of antifouling PEG interfaces for microfabricated silicon biosensors.

    Science.gov (United States)

    Sharma, Sadhana; Johnson, Robert W; Desai, Tejal A

    2004-09-15

    In the past two decades, the biological and medical fields have seen great advances in the development of biosensors capable of quantifying biomolecules. Many of these biosensors have micro- and nano-scale features, are fabricated using biochip technology, and use silicon as a base material. The creation of antifouling sensor interfaces is critical to avoid serious consequences that arise due to their contact with biological fluids. To this end, we have created thin PEG interfaces of various grafting densities on silicon using a single-step PEG-silane coupling reaction scheme. Initial PEG concentration (5-50 mM) and coupling time (0.5-24 h) were varied to attain different grafting densities, and different PEG interfaces so created were analyzed using XPS and AFM. Furthermore, all the PEG interfaces were evaluated using XPS and AFM for their antifouling abilities using fibrinogen as the model protein. Results indicated that PEG interfaces created in this investigation are appropriate for biosensors with micro- and nano-scale features, and are efficient in controlling protein fouling. PMID:15308226

  15. Friction behavior of nano-textured polyimide surfaces measured by AFM colloidal probe

    International Nuclear Information System (INIS)

    Highlights: • Flat PI film and nano-textured PI film were prepared by spin-coating process. • The nano-textured PI surface has effectively reduced the adhesion and friction. • Friction increased with the increasing of contact area and adhesion. • The growth rate of friction decreased with the increasing of applied load. - Abstract: Flat polyimide (PI) film and silicon dioxide nanoparticle-textured PI film were prepared by means of the spin-coating technique. The adhesion and friction properties of the flat PI surface and nano-textured PI surface were investigated by a series of Atomic force microscope (AFM) colloidal probes. Experimental results revealed that the nano-textured PI surface can significantly reduce the adhesive force and friction force, compared with the flat PI surface. The main reason is that the nano-textures can reduce the contact area between the sample surface and colloidal probe. The effect of colloidal probe size on the friction behavior of the flat and nano-textured PI surfaces was evaluated. The adhesive force and friction force of nano-textured PI surface were increased with the increasing of the size of interacting pairs (AFM colloidal probe) due to the increased contact area. Moreover, the friction forces of flat and nano-textured PI surfaces were increased with applied load and sliding velocity

  16. Advanced Compatibility Characterization Of AF-M315E With Spacecraft Propulsion System Materials Project

    Science.gov (United States)

    McClure, Mark B.; Greene, Benjamin

    2014-01-01

    All spacecraft require propulsion systems for thrust and maneuvering. Propulsion systems can be chemical, nuclear, electrical, cold gas or combinations thereof. Chemical propulsion has proven to be the most reliable technology since the deployment of launch vehicles. Performance, storability, and handling are three important aspects of liquid chemical propulsion. Bipropellant systems require a fuel and an oxidizer for propulsion, but monopropellants only require a fuel and a catalyst for propulsion and are therefore simpler and lighter. Hydrazine is the state of the art propellant for monopropellant systems, but has drawbacks because it is highly hazardous to human health, which requires extensive care in handling, complex ground ops due to safety and environmental considerations, and lengthy turnaround times for reusable spacecraft. All users of hydrazine monopropellant must contend with these issues and their associated costs. The development of a new monopropellant, intended to replace hydrazine, has been in progress for years. This project will apply advanced techniques to characterize the engineering properties of materials used in AF-M315E propulsion systems after propellant exposure. AF-M315E monopropellant has been selected HQ's Green Propellant Infusion Mission (GPIM) to replace toxic hydrazine for improved performance and reduce safety and health issues that will shorten reusable spacecraft turn-around time. In addition, this project will fundamentally strengthen JSC's core competency to evaluate, use and infuse liquid propellant systems.

  17. Identifying and quantifying two ligand-binding sites while imaging native human membrane receptors by AFM

    Science.gov (United States)

    Pfreundschuh, Moritz; Alsteens, David; Wieneke, Ralph; Zhang, Cheng; Coughlin, Shaun R.; Tampé, Robert; Kobilka, Brian K.; Müller, Daniel J.

    2015-11-01

    A current challenge in life sciences is to image cell membrane receptors while characterizing their specific interactions with various ligands. Addressing this issue has been hampered by the lack of suitable nanoscopic methods. Here we address this challenge and introduce multifunctional high-resolution atomic force microscopy (AFM) to image human protease-activated receptors (PAR1) in the functionally important lipid membrane and to simultaneously localize and quantify their binding to two different ligands. Therefore, we introduce the surface chemistry to bifunctionalize AFM tips with the native receptor-activating peptide and a tris-N-nitrilotriacetic acid (tris-NTA) group binding to a His10-tag engineered to PAR1. We further introduce ways to discern between the binding of both ligands to different receptor sites while imaging native PAR1s. Surface chemistry and nanoscopic method are applicable to a range of biological systems in vitro and in vivo and to concurrently detect and localize multiple ligand-binding sites at single receptor resolution.

  18. Dry powder inhaler: influence of humidity on topology and adhesion studied by AFM.

    Science.gov (United States)

    Bérard, V; Lesniewska, E; Andrès, C; Pertuy, D; Laroche, C; Pourcelot, Y

    2002-01-31

    In the dry powder inhalers (DPIs), the adhesion results of the interactions between the active substance and the excipient. The carrier and the micronized drug particle morphologies are believed to affect the delivery of the drug. In this work, the couple studied was the lactose monohydrate and micronized zanamivir, used for the treatment of influenza. In a first approach, observations by scanning electron microscopy (SEM) have shown that the relative humidity (RH) greatly influenced the zanamivir amount fixed on the lactose monohydrate surface. This paper deals with the direct measurement in controlled atmosphere by atomic force microscopy (AFM) of the forces and the interaction ranges between a zanamivir probe and a lactose substrate. Selected zanamivir crystals were attached to the standard AFM probe. Different RH have been used in order to determine influent parameters permitting to identify the nature of adhesion forces between them. This study demonstrated that the increase of RH modified progressively the surface topology of the two components and increased the adhesion force.

  19. Enamel crystals of mice susceptible or resistant to dental fluorosis: an AFM study

    Directory of Open Access Journals (Sweden)

    Marília Afonso Rabelo BUZALAF

    2014-06-01

    Full Text Available Objective: This study aimed to assess the overall apatite crystals profile in the enamel matrix of mice susceptible (A/J strain or resistant (129P3/J strain to dental fluorosis through analyses by atomic force microscopy (AFM. Material and Methods: Samples from the enamel matrix in the early stages of secretion and maturation were obtained from the incisors of mice from both strains. All detectable traces of matrix protein were removed from the samples by a sequential extraction procedure. The purified crystals (n=13 per strain were analyzed qualitatively in the AFM. Surface roughness profile (Ra was measured. Results: The mean (±SD Ra of the crystals of A/J strain (0.58±0.15 nm was lower than the one found for the 129P3/J strain (0.66±0.21 nm but the difference did not reach statistical significance (t=1.187, p=0.247. Crystals of the 129P3/J strain (70.42±6.79 nm were found to be significantly narrower (t=4.013, p=0.0013 than the same parameter measured for the A/J strain (90.42±15.86 nm. Conclusion: enamel crystals of the 129P3/J strain are narrower, which is indicative of slower crystal growth and could interfere in the occurrence of dental fluorosis.

  20. Nanopuller-open data acquisition platform for AFM force spectroscopy experiments.

    Science.gov (United States)

    Pawlak, Konrad; Strzelecki, Janusz

    2016-05-01

    Atomic Force Microscope (AFM) is a widely used tool in force spectroscopy studies. Presently, this instrument is accessible from numerous vendors, albeit commercial solutions are expensive and almost always hardware and software closed. Approaches for open setups were published, as with modern low cost and readily available piezoelectric actuators, data acquisition interfaces and optoelectronic components building such force spectroscopy AFM is relatively easy. However, suitable software to control such laboratory made instrument was not released. Developing it in the lab requires significant time and effort. Our Nanopuller software described in this paper is intended to eliminate this obstacle. With only minimum adjustments this program can be used to control and acquire data with any suitable National Instruments universal digital/analog interface and piezoelectric actuator analog controller, giving significant freedom and flexibility in designing force spectroscopy experiment. Since the full code, written in a graphical LabVIEW environment is available, our Nanopuller can be easily customized. In this paper we describe the program and test its performance in controlling different setups. Successful and accurate force curve acquisition for standard samples (single molecules of I27O reference titin polyprotein and DNA as well as red blood cells) is shown.

  1. Nanoindentation and AFM studies of PECVD DLC and reactively sputtered Ti containing carbon films

    Indian Academy of Sciences (India)

    A Pauschitz; J Schalko; T Koch; C Eisenmenger-Sittner; S Kvasnica; Manish Roy

    2003-10-01

    Amorphous carbon film, also known as DLC film, is a promising material for tribological application. It is noted that properties relevant to tribological application change significantly depending on the method of preparation of these films. These properties are also altered by the composition of the films. In view of this, the objective of the present work is to compare the nanoindentation and atomic force microscopy (AFM) study of diamond like carbon (DLC) film obtained by plasma enhanced chemical vapour deposition (PECVD) with the Ti containing amorphous carbon (Ti/-C : H) film obtained by unbalanced magnetron sputter deposition (UMSD). Towards that purpose, DLC and Ti/-C : H films are deposited on silicon substrate by PECVD and UMSD processes, respectively. The microstructural features and the mechanical properties of these films are evaluated by scanning electron microscopy (SEM), transmission electron microscopy (TEM), nanoindentation and by AFM. The results show that the PECVD DLC film has a higher elastic modulus, hardness and roughness than the UMSD Ti/-C : H film. It also has a lower pull off force than Ti containing amorphous carbon film.

  2. Structural changes of polysulfone membrane use for hemodialysis in the consecutive regime: nanometric analysis by AFM

    Science.gov (United States)

    Batina, Nikola; Acosta García, Ma. Cristina; Avalos Pérez, Angélica; Alberto Ramírez, Mario; Franco, Martha; Pérez Gravas, Héctor; Cadena Méndez, Miguel

    2013-08-01

    Nowadays, the hemodialytic treatment of patients with either acute or chronic renal failure has been improved by promoting biocompatibility in the use of new materials and improve membrane surface characteristics. Low and high flux polysulfone membranes (PM) used in dialysis and ultra filtration have been studied in order to understand the geometry and surface chemistry of the pores at inner (nanometric) and outer (micrometric) membrane parts. The surface changes of polysulfone cartridge membrane (PM) during different number of consecutive reuse trials: after 1st, 10th and 23th times of use. The morphology of the hollow fibers surfaces was studied by means of the atomic force microscopy (AFM) imaging and the surface roughness analysis. The roughness of both inner and outer part of PM surface increases with numbers of reuse trails. Thus, small and medium size pores were wiped out when the number of uses changed from zero to 23 on the outer surface. The pore density decreases. The inner part of membrane shows some nanometric size deformation in forms of new openings and raptures. The AFM analysis show differences in the PM morphology at the nanometric level, not previously revealed, which could be important in the evaluation of the PM.

  3. Cell mechanics as a marker for diseases: Biomedical applications of AFM

    Science.gov (United States)

    Rianna, Carmela; Radmacher, Manfred

    2016-08-01

    Many diseases are related to changes in cell mechanics. Atomic Force Microscopy (AFM) is one of the most suitable techniques allowing the investigation of both topography and mechanical properties of adherent cells with high spatial resolution under physiological conditions. Over the years the use of this technique in medical and clinical applications has largely increased, resulting in the notion of cell mechanics as a biomarker to discriminate between different physiological and pathological states of cells. Cell mechanics has proven to be a biophysical fingerprint able discerning between cell phenotypes, unraveling processes in aging or diseases, or even detecting and diagnosing cellular pathologies. We will review in this report some of the works on cell mechanics investigated by AFM with clinical and medical relevance in order to clarify the state of research in this field and to highlight the role of cell mechanics in the study of pathologies, focusing on cancer, blood and cardiovascular diseases. At the request of all authors of the paper, and with the agreement of the Proceedings Editor, an updated version of this article was published on 26 September 2016. The original version supplied to AIP Publishing contained blurred figures introduced during the PDF conversion process. Moreover, Equations (5), (6), and (7) were not correctly cited in the text. These errors have been corrected in the updated and republished article.

  4. Self-assembled polyelectrolyte nanorings observed by liquid-cell AFM

    Energy Technology Data Exchange (ETDEWEB)

    Menchaca, J-Luis [Instituto de Fisica, Universidad Autonoma de San Luis Potosi, Alvaro Obregon 64, San Luis Potosi (Mexico); Flores, Hector [Facultad de Estomatologia, Universidad Autonoma de San Luis Potosi, Alvaro Obregon 64, San Luis Potosi (Mexico); Cuisinier, Frederic [INSERM U 595, Federation de Recherche Odontologiques, Universite Louis Pasteur, 11 rue Humann, 67085 Strasbourg Cedex (France); Perez, ElIas [Instituto de Fisica, Universidad Autonoma de San Luis Potosi, Alvaro Obregon 64, San Luis Potosi (Mexico)

    2004-06-09

    Self-assembled polyelectrolyte nanorings formed by polyelectrolytes are presented for the first time in this work. They are formed by poly(ethylenimine) (PEI) and poly(sodium 4-styrenesulfanate) (PSS) during the two first steps of the formation of the self-assembled polyelectrolyte films (SAPFs). These are formed on a negatively charged glass surface and observed by an in situ liquid-cell AFM technique, which has recently been introduced as an alternative technique to follow polyelectrolyte multilayer formation without drying effects (Menchaca et al 2003 Colloids Surf. A 222 185). Nanoring formation strongly depends on the preparation method and parameters such as polyelectrolyte filtration, air and CO{sub 2} presence during SAPFs formation and buffer solution. A necessary condition to obtain nanorings is that polyelectrolyte solutions have to be filtered prior to injection into the liquid-cell AFM. The outer diameter of nanorings can be varied from hundreds of nanometres to microns by changing these parameters. Nanorings are stable in the liquid cell for hours but they disappear on contact with air. Additionally, carbonate ions seem to be mainly responsible for the formation of this novel structure.

  5. Tribological behavior of micro/nano-patterned surfaces in contact with AFM colloidal probe

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Xiaoliang; Wang Xiu; Kong Wen [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Graduate University of Chinese Academy of Sciences, Beijing 100049 (China); Yi Gewen [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Jia Junhong, E-mail: jhjia@licp.cas.cn [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China)

    2011-10-15

    In effort to investigate the influence of the micro/nano-patterning or surface texturing on the nanotribological properties of patterned surfaces, the patterned polydimethylsiloxane (PDMS) surfaces with pillars were fabricated by replica molding technique. The surface morphologies of patterned PDMS surfaces with varying pillar sizes and spacing between pillars were characterized by atomic force microscope (AFM) and scanning electron microscope (SEM). The AFM/FFM was used to acquire the friction force images of micro/nano-patterned surfaces using a colloidal probe. A difference in friction force produced a contrast on the friction force images when the colloidal probe slid over different regions of the patterned polymer surfaces. The average friction force of patterned surface was related to the spacing between the pillars and their size. It decreased with the decreasing of spacing between the pillars and the increasing of pillar size. A reduction in friction force was attributed to the reduced area of contact between patterned surface and colloidal probe. Additionally, the average friction force increased with increasing applied load and sliding velocity.

  6. Tribological behavior of micro/nano-patterned surfaces in contact with AFM colloidal probe

    Science.gov (United States)

    Zhang, Xiaoliang; Wang, Xiu; Kong, Wen; Yi, Gewen; Jia, Junhong

    2011-10-01

    In effort to investigate the influence of the micro/nano-patterning or surface texturing on the nanotribological properties of patterned surfaces, the patterned polydimethylsiloxane (PDMS) surfaces with pillars were fabricated by replica molding technique. The surface morphologies of patterned PDMS surfaces with varying pillar sizes and spacing between pillars were characterized by atomic force microscope (AFM) and scanning electron microscope (SEM). The AFM/FFM was used to acquire the friction force images of micro/nano-patterned surfaces using a colloidal probe. A difference in friction force produced a contrast on the friction force images when the colloidal probe slid over different regions of the patterned polymer surfaces. The average friction force of patterned surface was related to the spacing between the pillars and their size. It decreased with the decreasing of spacing between the pillars and the increasing of pillar size. A reduction in friction force was attributed to the reduced area of contact between patterned surface and colloidal probe. Additionally, the average friction force increased with increasing applied load and sliding velocity.

  7. AFM Surface Roughness and Topography Analysis of Lithium Disilicate Glass Ceramic

    Directory of Open Access Journals (Sweden)

    M. Pantić

    2015-12-01

    Full Text Available The aim of this study is presenting AFM analysis of surface roughness of Lithium disilicate glass ceramic (IPS e.max CAD under different finishing procedure (techniques: polishing, glazing and grinding. Lithium disilicate glass ceramics is all-ceramic dental system which is characterized by high aesthetic quality and it can be freely said that properties of material provide all prosthetic requirements: function, biocompatibility and aesthetic. Experimental tests of surface roughness were investigated on 4 samples with dimensions: 18 mm length, 14 mm width and 12 mm height. Contact surfaces of three samples were treated with different finishing procedure (polishing, glazing and grinding, and the contact surface of the raw material is investigated as a fourth sample. Experimental measurements were done using the Atomic Force Microscopy (AFM of NT-MDT manufacturers, in the contact mode. All obtained results of different prepared samples are presented in the form of specific roughness parameters (Rа, Rz, Rmax, Rq and 3D surface topography.

  8. Bacteria attachment to surfaces--AFM force spectroscopy and physicochemical analyses.

    Science.gov (United States)

    Harimawan, Ardiyan; Rajasekar, Aruliah; Ting, Yen-Peng

    2011-12-01

    Understanding bacterial adhesion to surfaces requires knowledge of the forces that govern bacterial-surface interactions. Biofilm formation on stainless steel 316 (SS316) by three bacterial species was investigated by examining surface force interaction between the cells and metal surface using atomic force microscopy (AFM). Bacterial-metal adhesion force was quantified at different surface delay time from 0 to 60s using AFM tip coated with three different bacterial species: Gram-negative Massilia timonae and Pseudomonas aeruginosa, and Gram-positive Bacillus subtilis. The results revealed that bacterial adhesion forces on SS316 surface by Gram-negative bacteria is higher (8.53±1.40 nN and 7.88±0.94 nN) when compared to Gram-positive bacteria (1.44±0.21 nN). Physicochemical analysis on bacterial surface properties also revealed that M. timonae and P. aeruginosa showed higher hydrophobicity and surface charges than B. subtilis along with the capability of producing extracellular polymeric substances (EPS). The higher hydrophobicity, surface charges, and greater propensity to form EPS by M. timonae and P. aeruginosa led to high adhesive force on the metal surface. PMID:21889162

  9. Surface characterization and AFM imaging of mixed fibrinogen-surfactant films.

    Science.gov (United States)

    Hassan, Natalia; Maldonado-Valderrama, Julia; Gunning, A Patrick; Morris, Victor J; Ruso, Juan M

    2011-05-19

    This study describes the adsorption behavior of mixed protein/surfactant systems at the air-water interface: specifically fibrinogen and the fluorinated and hydrogenated surfactants (C(8)FONa, C(8)HONa, and C(12)HONa). Surface tension techniques and atomic force microscopy (AFM) have been combined to investigate the adsorption behavior of these mixed systems. Interfacial rheology showed that fibrinogen has a low dilatational modulus at the air-water interface when compared to other proteins, suggesting the formation of a weak surface network. Fluorinated and hydrogenated surfactants severely decreased the dilatational modulus of the adsorbed fibrinogen film at the air-water interface. These measurements suggest the progressive displacement of fibrinogen from the air-water interface by both types of surfactants. However, in the case of fibrinogen/fluorinated surfactant systems, surface tension and dilatational rheology measurements suggest the formation of complexes with improved surface activity. AFM imaging of fibrinogen in the presence and absence of surfactants provided new information on the structure of mixed surface films, and revealed new features of the interaction of fibrinogen with hydrogenated and fluorinated surfactants. These studies suggest complexes formed between fibrinogen and fluorinated surfactants which are more surface active than fibrinogen, while the absence of interaction between fibrinogen and hydrogenated surfactants (C(8)HONa and C(12)HONa) results in compaction of the surface layer.

  10. Cellular mechanoadaptation to substrate mechanical properties: contributions of substrate stiffness and thickness to cell stiffness measurements using AFM.

    Science.gov (United States)

    Vichare, Shirish; Sen, Shamik; Inamdar, Mandar M

    2014-02-28

    Mechanosensing by adherent cells is usually studied by quantifying cell responses on hydrogels that are covalently linked to a rigid substrate. Atomic force microscopy (AFM) represents a convenient way of characterizing the mechanoadaptation response of adherent cells on hydrogels of varying stiffness and thickness. Since AFM measurements reflect the effective cell stiffness, therefore, in addition to measuring real cytoskeletal alterations across different conditions, these measurements might also be influenced by the geometry and physical properties of the substrate itself. To better understand how the physical attributes of the gel influence AFM stiffness measurements of cells, we have used finite element analysis to simulate the indentation of cells of various spreads resting on hydrogels of varying stiffness and thickness. Consistent with experimental results, our simulation results indicate that for well spread cells, stiffness values are significantly over-estimated when experiments are performed on cells cultured on soft and thin gels. Using parametric studies, we have developed scaling relationships between the effective stiffness probed by AFM and the bulk cell stiffness, taking cell and tip geometry, hydrogel properties, nuclear stiffness and cell contractility into account. Finally, using simulated mechanoadaptation responses, we have demonstrated that a cell stiffening response may arise purely due to the substrate properties. Collectively, our results demonstrate the need to take hydrogel properties into account while estimating cell stiffness using AFM indentation. PMID:24651595

  11. Mechanical properties of in situ demineralised human enamel measured by AFM nanoindentation

    Science.gov (United States)

    Finke, Manuela; Hughes, Julie A.; Parker, David M.; Jandt, Klaus D.

    2001-10-01

    Diet-induced demineralisation is one of the key factors in surface changes of tooth enamel, with soft drinks being a significant etiological agent. The first step in this dissolution process is characterised by a change in the mechanical properties of the enamel and a roughening of the surface. The objective of this pilot study was to measure early stages of in situ induced hardness changes of polished human enamel surfaces with high accuracy using a nanoindenter attached to an atomic force microscope (AFM). Human unerupted third molars were cleaned, sterilised with sodium hypochlorite, sectioned and embedded in epoxy resin. The outer enamel surface was polished and the samples partly covered with a tape, allowing a 2-mm-wide zone to be exposed to the oral environment. Samples were fitted in an intra-oral appliance, which was worn from 9 a.m. to 5 p.m. for one day. During this time the volunteer sipped 250 ml of a drink over 10 min periods at 9.00, 11.00, 13.00 and 15.00 h. Three different drinks, mineral water, orange juice and the prototype of a blackcurrant drink with low demineralisation potential were used in this study. At the end of the experiment the samples were detached from the appliance, the tape removed and the surfaces chemically cleaned. The surface hardness and reduced Young's modulus of the exposed and unexposed areas of each sample were determined. In addition, high resolution topographical AFM images were obtained. This study shows that by determining the hardness and reduced Young's modulus, the difference in demineralisation caused by the drinks can be detected and quantified before statistically significant changes in surface topography could be observed with the AFM. The maximum decrease in surface hardness and Young's modulus occurred in the samples exposed to orange juice, followed by those exposed to the blackcurrant drink, while exposure to water led to the same values as unexposed areas. A one-way ANOVA showed a statistically significant

  12. Molecular dynamics study on the mechanism of AFM-based nanoscratching process with water-layer lubrication

    Science.gov (United States)

    Ren, Jiaqi; Zhao, Jinsheng; Dong, Zeguang; Liu, Pinkuan

    2015-08-01

    The atomic force microscopy (AFM) based direct nanoscratching has been thoroughly studied but the mechanism of nanoscratching with water-layer lubrication is yet to be well understood. In current study, three-dimensional molecular dynamics (MD) simulations are conducted to evaluate the effects of the water-layer lubrication on the AFM-based nanoscratching process on monocrystalline copper. Comparisons of workpiece deformation, scratching forces, and friction coefficients are made between the water-lubricated and dry scratching under various thickness of water layer, scratching depth and scratching velocity. Simulation results reveal that the water layer has positive impact on the surface quality and significant influence on the scratching forces (normal forces and tangential forces). The friction coefficients of the tip in water-lubricated nanoscratching are significantly bigger than those in the dry process. Our simulation results shed lights on a promising AFM-based nanofabrication method, which can assist to get nanoscale surface morphologies with higher quality than traditional approaches.

  13. Direct observation of hydration of TiO 2 on Ti using electrochemical AFM: freely corroding versus potentiostatically held

    Science.gov (United States)

    Bearinger, Jane P.; Orme, Christine A.; Gilbert, Jeremy L.

    2001-10-01

    Hydration of titanium/titanium oxide surfaces under freely corroding and potentiostatically held conditions has been characterized using electrochemical atomic force microscopy (EC AFM). In contrast to conventional high vacuum techniques, AFM enables measurement of morphological surface structure in the in situ hydrated state. Electrochemical probes in the imaging environment further enable acquisition of electrical characteristics during AFM imaging. Experiments were performed on etched, electropolished commercially pure titanium. As noted by direct observation and corroborated by power spectral density (Fourier analysis) measurements, oxide domes cover the titanium surface and grow laterally during hydration. Applied potential altered the growth rate. Under open circuit potential conditions, growth proceeded approximately six times faster than under a -1 V applied voltage ( 1098±52 nm2/ min ± versus 184.84±19 nm2/min). Film growth increased electrical resistance and lowered interfacial capacitance based on step polarization impedance spectroscopy tests.

  14. Membrane Surface Nanostructures and Adhesion Property of T Lymphocytes Exploited by AFM

    Directory of Open Access Journals (Sweden)

    Lu Hongsong

    2009-01-01

    Full Text Available Abstract The activation of T lymphocytes plays a very important role in T-cell-mediated immune response. Though there are many related literatures, the changes of membrane surface nanostructures and adhesion property of T lymphocytes at different activation stages have not been reported yet. However, these investigations will help us further understand the biophysical and immunologic function of T lymphocytes in the context of activation. In the present study, the membrane architectures of peripheral blood T lymphocytes were obtained by AFM, and adhesion force of the cell membrane were measured by acquiring force–distance curves. The results indicated that the cell volume increased with the increases of activation time, whereas membrane surface adhesion force decreased, even though the local stiffness for resting and activated cells is similar. The results provided complementary and important data to further understand the variation of biophysical properties of T lymphocytes in the context of in vitro activation.

  15. The experimental rules of mica as a reference sample of AFM/FFM measurement

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    For the friction measurements with AFM/FFM, usually the relativevalues of friction signal can be obtained. In order to compare the micro-tribological properties of different samples, mica is often used as an reference sample for friction measurement. However, due to the friction force of new cleaved mica surface is unstable, it is urged to systematically investigate the tribological properties of mica to design the experimental rules of the reference sample mica for friction measurements. Experimental results show that the friction of mica varies with the cleaving time, humidity and surface state of tip. The friction measured with different tips on mica varies in the range of ± 15%. For a new tip, the friction increases with the tip’s wear and then becomes stable. For new cleaved mica, the friction increases within the first two hours and then keeps unchanged. The friction of mica also decreases with the relative humidity because of its hydrophilicity.

  16. Quantifying molecule-surface interactions using AFM-based single-molecule manipulation

    Science.gov (United States)

    Tautz, F. S.; Wagner, C.; Temirov, R.; Fournier, N.; Green, M.; Esat, T.; Leinen, P.; Groetsch, A.; Ruiz, V. G.; Tkatchenko, A.; Li, C.; Muellen, K.; Rohlfing, M.

    2015-03-01

    Scanning probe microscopy plays an important role in the investigation of molecular adsorption. Promising, is the possibility to probe the molecule-surface interaction while tuning its strength through AFM tip-induced single-molecule manipulation. Here, we outline a strategy to achieve quantitative understanding of such manipulation experiments. The example of qPlus sensor based PTCDA molecule lifting experiments is used to demonstrate how different aspects of the molecule-surface interaction, namely the short-range adsorption potential, the asymptotic van der Waals potential, local chemical bonds which are the source of the surface corrugation, and molecule-molecule interactions can be measured with SPM and interpreted by the help of force-field simulations.

  17. Charge dependent asphaltene adsorption onto metal substrate : electrochemistry and AFM, STM, SAM, SEM analysis

    Energy Technology Data Exchange (ETDEWEB)

    Batina, N.; Morales-Martinez, J. [Univ. Autonoma Metropolitana-Iztapalapa (Mexico). Lab. de Nanotecnologia e Ingenieria Molecular; Ivar-Andersen, S. [Technical Univ. of Denmark (Denmark). Dept. Hem. Eng; Lira-Galeana, C. [Inst. Mexicano del Petroleo, Lazaro (Mexico). Molecular Simulation Research Program; De la Cruz-Hernandez, W.; Cota-Araiza, L.; Avalos-Borja, M. [Univ. Nacional Autonoma de Mexico (Mexico)

    2008-07-01

    Asphaltenes have been identified as the main component of pipeline molecular deposits that cause plugging of oil wells. In this study, Atomic Force Microscopy (AFM), Scanning Tunneling Microscopy (STM), Scanning Auger Microprobe Spectroscopy (SAM) and Scanning Electron Microscopy (SEM) were used to characterized molecular deposits of Mexican crude oil and asphaltenes formed at a charged metal surface. The qualitative and quantitative characterization involved determining the size and shape of adsorbed molecules and aggregates, and the elemental analysis of all components in molecular films. Samples were prepared by electrolytic deposition under galvanostatic or potentiostatic conditions directly from the crude oil or asphaltene in toluene solutions. The study showed that the formation of asphaltene deposit depends on the metal substrate charge. Asphaltenes as well as crude oil readily adsorbed at the negatively charged metal surface. Two elements were present, notably carbon and sulfur. Their content ratio varied depending on the metal substrate charge.

  18. Self assembly of epicuticular waxes on living plant surfaces imaged by atomic force microscopy (AFM).

    Science.gov (United States)

    Koch, Kerstin; Neinhuis, Christoph; Ensikat, Hans-Jürgen; Barthlott, Wilhelm

    2004-03-01

    The cuticle of terrestrial vascular plants and some bryophytes is covered with a complex mixture of lipids, usually called epicuticular waxes. Self-assembly processes of wax molecules lead to crystalline three-dimensional micro- and nanostructures that emerge from an underlying wax film. This paper presents the first AFM study on wax regeneration on the surfaces of living plants and the very early stages of wax crystal formation at the molecular level. Wax formation was analysed on the leaves of Euphorbia lathyris, Galanthus nivalis, and Ipheion uniflorum. Immediately after wax removal, regeneration of a wax film began, consisting of individual layers of, typically, 3-5 nm thickness. Subsequently, several different stages of crystal growth could be distinguished, and different patterns of wax regeneration as well as considerable variation in regeneration speed were found.

  19. Is atomic-scale dissipation in NC-AFM real? Investigation using virtual atomic force microscopy

    International Nuclear Information System (INIS)

    Using a virtual dynamic atomic force microscope, that explicitly simulates the operation of a non-contact AFM experiment, we have performed calculations to investigate the formation of atomic-scale contrast in dissipation images. A non-conservative tip-surface interaction was implemented using the theory of dynamical response in scanning probe microscopy with energies and barriers derived from realistic atomistic modelling. It is shown how contrast in the damping signal is due to the hysteresis in the tip-surface force and not an artefact of the finite response of the complicated instrumentation. Topography and dissipation images of the CaO(001) surface are produced which show atomic-scale contrast in the dissipation with a corrugation of approximately 0.1 eV, which is typical of that observed in images of similar binary ionic surfaces. The effect of the fast-direction scanning speed on the image formation is also investigated and discussed

  20. Deformation characteristics of various grain boundary angles on AFM-based nanolithography using molecular dynamics

    International Nuclear Information System (INIS)

    Molecular dynamics simulations are performed to verify the deformation characteristics of grain boundaries on the AFM-based nanolithography. The model used has about 750,000 (Cu) atoms and is composed of two different crystal orientations. The grain boundaries are located in the center of model and have 45, 90, 135, and -135 degree angles in the xz-plane. The tool is made of rigid diamond-like carbon and is in the shape of the Berkovich indenter. The simulation has four different stages: relaxation, indentation, re-relaxation, and lithography. The simulation results reveal that the lithography deforms the grain boundary shape by the tool. The deformation of grain boundary's angle proceeds to minimize the total potential energy of whole system. Consequently, the grain boundary angle is changed about 90 degrees

  1. Measuring precision analysis of capsule vertical-AFM surface profiler system

    International Nuclear Information System (INIS)

    A capsule surface profiler system based on vertical spindle structure and atomic force microscope (AFM) was developed, and its systematic measurement tests were carried out. In order to evaluate the measurement uncertainty, the experimental studies mainly included the air-bearing spindle rotation run out error test, the system static noise test, and the comprehensive test. The rotary precision of air bearing was tested and the error curve of the spindle was obtained with a standard ball and two-step separation method. Further, this error curve was eliminated as in a systematic error. Comprehensive measurement tests of the system prove that the noise peak value of this system is about 22 nm and its RMS is about 5.2 nm during the measurement process. (authors)

  2. Analysis of air adsorptive on solid surfaces by AFM and XPS

    Institute of Scientific and Technical Information of China (English)

    WANG Rong-guang; Mitsuo KIDO

    2006-01-01

    Solid surfaces of HOPG,pure copper,chromium,zinc,copper and SUS304 steel were observed in ambient air with an a.c. non-contact mode of atomic force microscope(AFM). A type of film-like-domains (adsorptive) was detected on the above surfaces. The thickness of the adsorptive was about 1.2-2.4 nm in this case. The film-like-adsorptive was confirmed to be a liquid layer by the static contact-mode scanning,the measurement of the elasticity and viscosity images,and the detection of the condensation/ evaporation phenomena when the relative humidity changed. The liquid layer is considered to be condensed water covered with organic contaminant.

  3. FABRICATION AND AFM/FFM STUDIES OF C60-CONTAINING POLYELECTROLYTE SELF-ASSEMBLED FILMS

    Institute of Scientific and Technical Information of China (English)

    Lan Huang; Xiao-rong Hou; Yuan-kang He; Xiao-liang Zheng; Fang Wei; Xin-sheng Zhao; Wei-xiao Cao

    2002-01-01

    An initial investigation on the roughness and frictional properties of the self-assembled thin films from polyelectrolytes is presented. Star-shaped C60-poly(styrene-maleic anhydride) was successful prepared. The multilayer thin films have been fabricated on mica with diazoresin as the cationic polyelectrolyte and hydrolyzed star-shaped C60-poly(styrene-maleic anhydride) as the anionic polyelectrolyte via self-assembly technique. The crosslinking structure of the films is formed from the conversion of ionic bond to covalent bond after UV irradiation. AFM/FFM investigations provide insights into the roughness and frictional properties on a microscale. The roughness depends strongly on the number of film layers in the case of C60-containing films. The frictional forces of the films exhibited a well behaved non-linear relationship in response to the change of applied load. It supports the prediction of enhanced load-bearing property of C60-containing thin films.

  4. AFM显微图像Gabor滤波增强%AFM Micrograph Enhancement Using Gabor Filtering

    Institute of Scientific and Technical Information of China (English)

    雷跃荣; 孙兴波

    2007-01-01

    提出了多尺度多方向Gabor滤波自适应融合的图像增强方法.使用特定不同方向不同尺度的Gabor滤波器与图像卷积,卷积图像进行规格化,通过取极小值和平均值对多通道图像Gabor滤波结果进行自适应融合,得到增强图像.将其用于原子力显微镜(AFM)显微图像增强,能有效消除阴影和噪声,获得了良好效果.

  5. In Situ STM and AFM of the Copper Protein Pseudomonas Aeruginosa Azurin

    DEFF Research Database (Denmark)

    Friis, Esben P.; Andersen, Jens Enevold Thaulov; Madsen, L.L.;

    1997-01-01

    to gold and facile electron tunnel routes between this group and the copper atom. Azurin adsorbed on Au(111) can be imaged to molecular resolution by in situ STM and shows regular arrays of individual structures corresponding well to the known molecular size of azurin. The current falls off approximately...... exponentially with increasing distance with a decay constant of 0.4–0.5 Å−1. In comparison in situ AFM shows structures laterally convoluted with the tip while the vertical extension is in the same range as the structural size of azurin. The results are of interest in relation to electron tunnel mechanisms...... of redox metalloproteins and in technological contexts such as electrochemical biosensors, microbial corrosion and broadly for protein adsorption from biological liquids....

  6. Study on the specific interaction between angiogenin and aptamer by atomic force microscopy (AFM)

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The specific interaction between angiogenin and aptamer has been investigated by using AFM. The specificity of the interaction is revealed by comparing the binding probability of aptamer to other elements in a series of control experiments.The results have shown that there is specific interaction force between angiogenin and aptamer. Moreover, the single molecular pull-off force between angiogenin and aptamer has also been determined using the Poisson statistical method to be 133.7±11.7 pN. These findings obtained are helpful to the better revelation of recognition mechanism between angiogenin and aptamer, which provided basis for further understanding the inhibition of the aptamer to angiogenic activity.

  7. Nanomechanical characterization of nanostructured bainitic steel: Peak Force Microscopy and Nanoindentation with AFM.

    Science.gov (United States)

    Morales-Rivas, Lucia; González-Orive, Alejandro; Garcia-Mateo, Carlos; Hernández-Creus, Alberto; Caballero, Francisca G; Vázquez, Luis

    2015-01-01

    The full understanding of the deformation mechanisms in nanostructured bainite requires the local characterization of its mechanical properties, which are expected to change from one phase, bainitic ferrite, to another, austenite. This study becomes a challenging process due to the bainitic nanostructured nature and high Young's modulus. In this work, we have carried out such study by means of the combination of AFM-based techniques, such as nanoindentation and Peak Force Quantitative Nanomechanical Mapping (PF-QNM) measurements. We have addressed critically the limits and advantages of these techniques and been able to measure some elastoplastic parameters of both phases. Specifically, we have analyzed by PF-QNM two nanostructured bainitic steels, with a finer and a coarser structure, and found that both phases have a similar Young's modulus. PMID:26602631

  8. Nano-Workbench: A Combined Hollow AFM Cantilever and Robotic Manipulator

    Directory of Open Access Journals (Sweden)

    Héctor Hugo Pérez Garza

    2015-05-01

    Full Text Available To manipulate liquid matter at the nanometer scale, we have developed a robotic assembly equipped with a hollow atomic force microscope (AFM cantilever that can handle femtolitre volumes of liquid. The assembly consists of four independent robots, each sugar cube sized with four degrees of freedom. All robots are placed on a single platform around the sample forming a nano-workbench (NWB. Each robot can travel the entire platform and has a minimum position resolution of 5 nm both in-plane and out-of-plane. The cantilever chip was glued to the robotic arm. Dispensing was done by the capillarity between the substrate and the cantilever tip, and was monitored visually through a microscope. To evaluate the performance of the NWB, we have performed three experiments: clamping of graphene with epoxy, mixing of femtolitre volume droplets to synthesize gold nanoparticles and accurately dispense electrolyte liquid for a nanobattery.

  9. Pulse gas alignment and AFM manipulation of single-wall carbon nanotube

    Institute of Scientific and Technical Information of China (English)

    TIAN XiaoJun; WANG YueChao; XI Ning; DONG ZaiLi; TUNG Steve

    2008-01-01

    In the fabrication process of nanoelectronic device arrays based on single-wall carbon nanotube (SWCNT), oriented alignment of SWCNTs and property modification of metallic SWCNTs in the array are the key problems to be solved. Pulse gas alignment with substrate downward tilt is proposed to realize the controllable alignment of SWCNTs. Experimental results demonstrate that 84% SWCNTs are aligned in -15°- 15° angular to the pulse gas direction. A modified nanomanipulation technology based on atomic force microscope (AFM) is utilized to perform various kinds of SWCNT manipulation, such as SWCNT separation from the "Y" CNT, catalyst removal from the SWCNT end, continual nano buckles fabrication on SWCNT and even stretching to break, which provides a feasible way to modify the size, shape and the electrical property of SWCNTs.

  10. The dynamics of individual nucleosomes controls the chromatin condensation pathway: direct AFM visualization of variant chromatin

    CERN Document Server

    Montel, Fabien; Castelnovo, Martin; Bednar, Jan; Dimitrov, Stefan; Angelov, Dimitar; Faivre-Moskalenko, Cendrine

    2009-01-01

    Chromatin organization and dynamics is studied in this work at scales ranging from single nucleosome to nucleosomal array by using a unique combination of biochemical assays, single molecule imaging technique and numerical modeling. We demonstrate that a subtle modification in the nucleosome structure induced by the histone variant H2A.Bbd drastically modifies the higher order organization of the nucleosomal arrays. Importantly, as directly visualized by AFM, conventional H2A nucleosomal arrays exhibit specific local organization, in contrast to H2A.Bbd arrays, which show ?beads on a string? structure. The combination of systematic image analysis and theoretical modeling allows a quantitative description relating the observed gross structural changes of the arrays to their local organization. Our results strongly suggest that higher-order organization of H1-free nucleosomal arrays is mainly determined by the fluctuation properties of individual nucleosomes. Moreover, numerical simulations suggest the existenc...

  11. AFM Study on Reliability of Nanoscale DLC Films Deposited by ECR-MPCVD

    Institute of Scientific and Technical Information of China (English)

    ZHU Shou-xing; ZHU Shi-gen; DING Jian-ning

    2004-01-01

    Nanoindentation, scratch and wear tests based on an atomic force microscope (AFM) were carried out to study the reliability of diamond-like carbon (DLC) films, deposited by electron cyclotron resonance microwave plasma chemical vapor deposition (ECR-MPCVD). The predictors for film reliability were given to investigate the resistance of DLC films to indent, scratch, and wear. Experimental results showed that the films at 64.9nm and 12.07nm exhibited better reliability than thin one at 2.78nm, 4.48nm. In addition, the reliability strength of films above 12.07nm went stable, and the films showed good performance of anti-indentation, anti-scratch and anti-wear. Finally, size effect of nanoscale monolayer film was introduced to explain the reliability of nanoscale DLC films.

  12. Quantitative multichannel NC-AFM data analysis of graphene growth on SiC(0001

    Directory of Open Access Journals (Sweden)

    Christian Held

    2012-02-01

    Full Text Available Noncontact atomic force microscopy provides access to several complementary signals, such as topography, damping, and contact potential. The traditional presentation of such data sets in adjacent figures or in colour-coded pseudo-three-dimensional plots gives only a qualitative impression. We introduce two-dimensional histograms for the representation of multichannel NC-AFM data sets in a quantitative fashion. Presentation and analysis are exemplified for topography and contact-potential data for graphene grown epitaxially on 6H-SiC(0001, as recorded by Kelvin probe force microscopy in ultrahigh vacuum. Sample preparations by thermal decomposition in ultrahigh vacuum and in an argon atmosphere are compared and the respective growth mechanisms discussed.

  13. Hematite/silver nanoparticle bilayers on mica--AFM, SEM and streaming potential studies.

    Science.gov (United States)

    Morga, Maria; Adamczyk, Zbigniew; Oćwieja, Magdalena; Bielańska, Elżbieta

    2014-06-15

    Bilayers of hematite/silver nanoparticles were obtained in the self-assembly process and thoroughly characterized using scanning electron microscopy (SEM), atomic force microscopy (AFM), and in situ streaming potential measurements. The hematite nanoparticles, forming a supporting layer, were 22 nm in diameter, exhibiting an isoelectric point at pH 8.9. The silver nanoparticles, used to obtain an external layer, were 29 nm in diameter, and remained negative within the pH range 3 to 11. In order to investigate the particle deposition, mica sheets were used as a model solid substrate. The coverage of the supporting layer was adjusted by changing the bulk concentration of the hematite suspension and the deposition time. Afterward, silver nanoparticle monolayers of controlled coverage were deposited under the diffusion-controlled transport. The coverage of bilayers was determined by a direct enumeration of deposited particles from SEM micrographs and AFM images. Additionally, the formation of the hematite/silver bilayers was investigated by streaming potential measurements carried out under in situ conditions. The effect of the mica substrate and the coverage of a supporting layer on the zeta potential of bilayers was systematically studied. It was established that for the coverage exceeding 0.20, the zeta potential of bilayers was independent on the substrate and the supporting layer coverage. This behavior was theoretically interpreted in terms of the 3D electrokinetic model. Beside significance for basic sciences, these measurements allowed to develop a robust method of preparing nanoparticle bilayers of controlled properties, having potential applications in catalytic processes.

  14. Hematite/silver nanoparticle bilayers on mica--AFM, SEM and streaming potential studies.

    Science.gov (United States)

    Morga, Maria; Adamczyk, Zbigniew; Oćwieja, Magdalena; Bielańska, Elżbieta

    2014-06-15

    Bilayers of hematite/silver nanoparticles were obtained in the self-assembly process and thoroughly characterized using scanning electron microscopy (SEM), atomic force microscopy (AFM), and in situ streaming potential measurements. The hematite nanoparticles, forming a supporting layer, were 22 nm in diameter, exhibiting an isoelectric point at pH 8.9. The silver nanoparticles, used to obtain an external layer, were 29 nm in diameter, and remained negative within the pH range 3 to 11. In order to investigate the particle deposition, mica sheets were used as a model solid substrate. The coverage of the supporting layer was adjusted by changing the bulk concentration of the hematite suspension and the deposition time. Afterward, silver nanoparticle monolayers of controlled coverage were deposited under the diffusion-controlled transport. The coverage of bilayers was determined by a direct enumeration of deposited particles from SEM micrographs and AFM images. Additionally, the formation of the hematite/silver bilayers was investigated by streaming potential measurements carried out under in situ conditions. The effect of the mica substrate and the coverage of a supporting layer on the zeta potential of bilayers was systematically studied. It was established that for the coverage exceeding 0.20, the zeta potential of bilayers was independent on the substrate and the supporting layer coverage. This behavior was theoretically interpreted in terms of the 3D electrokinetic model. Beside significance for basic sciences, these measurements allowed to develop a robust method of preparing nanoparticle bilayers of controlled properties, having potential applications in catalytic processes. PMID:24767501

  15. Characterization of mineral-associated organic matter: a combined approach of AFM and NanoSIMS

    Science.gov (United States)

    Pohl, Lydia; Schurig, Christian; Eusterhues, Karin; Mueller, Carsten W.; Höschen, Carmen; Totsche, Kai-Uwe; Kögel-Knabner, Ingrid

    2016-04-01

    The heterogeneous spatial distribution and amount of organic matter (OM) in soils, especially at the micro- or submicron-scale, has major consequences for the soil microstructure and for the accessibility of OM to decomposing microbial communities. Processes occurring at the microscale control soil properties and processes at larger scales, such as macro-aggregation and carbon turnover. Since OM acts as substrate and most important driver for biogeochemical processes, particular attention should be paid to its spatial interaction with soil minerals. In contrast to bulk analysis, Nanoscale Secondary Ion Mass Spectrometry (NanoSIMS) offers the possibility to examine the composition and spatial distribution of OM within the intact organo-mineral matrix. Nevertheless, the yield of secondary electrons is influenced by the individual topography of the analysed particles, which aggravated the quantitative interpretation of the data. A combination of NanoSIMS and Atomic Force Microscopy (AFM), enabled us to visualize and quantify the topographical features of individual particles and correct the NanoSIMS data for this effect. We performed adsorption experiments with water-soluble soil OM in 6 concentration steps, which was extracted from forest floor layer of a Podzol, and adsorbed to illite. Upon the end of the sorption experiments the liquid phase and the solid phase were separated and the carbon content was analysed with TOC- and C/N-measurement, respectively. For the spatially resolved analyses, the samples were applied as thin layers onto silicon wafers and individual particles were chosen by means of the AFM. Subsequently, the identical particles were analysed with NanoSIMS to investigate the distribution of C, N, O, Si, P and Al. The recorded data were analysed for differences in elemental distribution between the different concentration steps. Additionally, we performed a correlation of the detectable counts with the topography of the particle within one

  16. Raman confocal microscopy and AFM combined studies of cancerous cells treated with Paclitaxel

    Science.gov (United States)

    Derely, L.; Collart Dutilleul, P.-Y.; Michotte de Welle, Sylvain; Szabo, V.; Gergely, C.; Cuisinier, F. J. G.

    2011-03-01

    Paclitaxel interferes with the normal function of microtubule breakdown, induces apoptosis in cancer cells and sequesters free tubulin. As this drug acts also on other cell mechanisms it is important to monitor its accumulation in the cell compartments. The intracellular spreading of the drug was followed using a WITEC 300R confocal Raman microscope equipped with a CCD camera. Hence Atomic force microscopy (an MFP3D- Asylum Research AFM) in imaging and force mode was used to determine the morphological and mechanical modifications induced on living cells. These studies were performed on living epithelial MCF-7 breast cancer cells. Paclitaxel was added to cell culture media for 3, 6 and 9 hours. Among the specific paclitaxel Raman bands we selected the one at 1670 cm-1 because it is not superposed by the spectrum of the cells. Confocal Raman images are formed by monitoring this band, the NH2 and the PO4 band. Paclitaxel slightly accumulates in the nucleus forming patches. The drug is also concentrated in the vicinity of the cell membrane and in an area close to the nucleus where proteins accumulate. Our AFM images reveal that the treated cancerous MCF-7 cells keep the same size as the non treated ones, but their shape becomes more oval. Cell's elasticity is also modified: a difference of 2 kPa in the Young Modulus characterizes the treated MCF-7 mammary cancerous cell. Our observations demonstrate that paclitaxel acts not only on microtubules but accumulates also in other cell compartments (nucleus) where microtubules are absent.

  17. AFM studies of swift heavy ion and electron irradiated mixed barium strontium borate nonlinear optical crystal

    International Nuclear Information System (INIS)

    Single crystals of novel nonlinear optical material of mixed barium strontium borate is grown in our laboratory by employing the low-temperature solution technique. Equal proportion (1:1 molar ratio) of AR grade barium borate and strontium borate are mixed together in double distilled water to prepare a supersaturated solution. The solution is allowed to evaporate at constant temperature (30 deg. C) in a Petri dish for about a week which resulted in the formation of seed crystals. These seed crystals are used to grow larger crystals by suspending them using fine silk thread in the supersaturated mother solution. The solution is allowed to evaporate at constant temperature. This resulted in the growth of good transparent crystals of dimension 15 mmx10 mmx1 mm after about one month. These crystals show good second harmonic generation (SHG) efficiency. The mixed barium strontium borate crystal is found to be a promising nonlinear optical crystal, which possibly can be used for fabrication of photonic devices. The single crystals of mixed barium strontium borate are irradiated by 120 MeV Ag+13 swift heavy ions (SHI) of fluence 5x1011 ions/cm2 at Nuclear Science Centre, New Delhi and also by electrons of 8 MeV energy with a fluence 5.7x109/cm2 using Microtron accelerator at Mangalore University. Surface morphology studies of these crystals are carried out using atomic force microscope. The AFM topographical images of these SHI/electron irradiated single crystals of mixed barium strontium borate are obtained from different frames of the sample taken at different magnifications using atomic force microscope. An attempt is made to explain the surface damage caused due to SHI/electron irradiation using the observed AFM images

  18. The graphene sheet versus the 2DEG: a relativistic Fano spin-filter via STM and AFM tips

    OpenAIRE

    Seridonio, A. C.; Siqueira, E. C.; de Souza, F. M.; Machado, R. S.; Lyra, S. S.; Shelykh, I. A.

    2013-01-01

    We explore theoretically the density of states (LDOS) probed by an STM tip of 2D systems hosting an adatom and a subsurface impurity,both capacitively coupled to AFM tips and traversed by antiparallel magnetic fields. Two kinds of setups are analyzed, a monolayer of graphene and a two-dimensional electron gas (2DEG). The AFM tips set the impurity levels at the Fermi energy, where two contrasting behaviors emerge: the Fano factor for the graphene diverges, while in the 2DEG it approaches zero....

  19. A new approach of recognition of ellipsoidal micro- and nanoparticles on AFM images and determination of their sizes

    Science.gov (United States)

    Akhmadeev, Albert A.; Salakhov, Myakzyum Kh

    2016-10-01

    In this work we develop an approach of automatic recognition of ellipsoidal particles on the atomic force microscopy (AFM) image and determination of their size, which is based on image segmentation and the surface approximation by ellipsoids. In addition to the comparative simplicity and rapidity of processing, this method allows us to determine the size of particles, the surface of which is not completely visible on the image. The proposed method showed good results on simulated images including noisy ones. Using this algorithm the size distributions of silica particles on experimental AFM images have been determined.

  20. Replication and dimensional quality control of industrial nanoscale surfaces using calibrated AFM measurements and SEM image processing

    DEFF Research Database (Denmark)

    Tosello, Guido; Hansen, Hans Nørgaard; Marinello, F.;

    2010-01-01

    application of AFM to calibrate height, depth and pitch of sub-micrometer features and SEM image processing to detect replication accuracy in terms of number of replicated features. Surface replication is analyzed using a metrological approach: nano-features on nickel stampers and injection...

  1. Understanding the TERS Effect with On-line Tunneling and Force Feedback Using Multiprobe AFM/NSOM with Raman Integration

    Science.gov (United States)

    Lewis, Aaron; Dekhter, Rimma; Hamra, Patricia; Bar-David, Yossi; Taha, Hesham

    Tip enhanced Raman scattering (TERS) has evolved in several directions over the past years. The data from this variety of methodologies has now accumulated to the point that there is a reasonable possibility of evolving an understanding of the underlying cause of the resulting effects that could be the origin of the various TERS enhancement processes. The objective of this presentation is to use the results thus far with atomic force microscopy (AFM) probes with noble metal coating, etching, transparent gold nanoparticles with and without a second nanoparticle [Wang and Schultz, ANALYST 138, 3150 (2013)] and tunneling feedback probes [R. Zhang et. al., NATURE 4 9 8, 8 2 (2013)]. We attempt at understanding this complex of results with AFM/NSOM multiprobe techniques. Results indicate that TERS is dominated by complex quantum interactions. This produces a highly confined and broadband plasmon field with all k vectors for effective excitation. Normal force tuning fork feedback with exposed tip probes provides an excellent means to investigate these effects with TERS probes that we have shown can circumvent the vexing problem of jump to contact prevalent in conventional AFM methodology and permit on-line switching between tunneling and AFM feedback modes of operation.

  2. The use of colloid probe microscopy to predict aerosolization performance in dry powder inhalers: AFM and in vitro correlation.

    Science.gov (United States)

    Young, Paul M; Tobyn, Michael J; Price, Robert; Buttrum, Mark; Dey, Fiona

    2006-08-01

    The atomic force microscope (AFM) colloid probe technique was utilized to measure cohesion forces (separation energy) between three drug systems as a function of relative humidity (RH). The subsequent data was correlated with in vitro aerosolization data collected over the same RH range. Three drug-only systems were chosen for study; salbutamol sulphate (SS), triamcinolone acetonide (TAA), and di-sodium cromoglycate (DSCG). Analysis of the AFM and in vitro data suggested good correlations, with the separation energy being related inversely to the aerosolization performance (measured as fine particle fraction, FPF(LD)). In addition, the relationship between, cohesion, RH, and aerosolization performance was drug specific. For example, an increase in RH between 15% and 75% resulted in increased cohesion and decreased FPF(LD) for SS and DSCG. In comparison, for TAA, a decrease in cohesion and increased FPF(LD) was observed when RH was increased (15-75%). Linear regression analysis comparing AFM with in vitro data indicated R(2) values > 0.80, for all data sets, suggesting the AFM could be used to indicate in vitro aerosolization performance. PMID:16795018

  3. Study of influence on micro-fabricated resistive switching organic ZrO2 array by C-AFM measurement

    Indian Academy of Sciences (India)

    Ying Li; Gaoyang Zhao; Zhibo Kou; Long Jin; Yajing Wang

    2015-08-01

    In this paper, a comparison of the interfacial electronic properties between Pt/Ir conductive atomic force microscopy (C-AFM) tip and ZrO2 organic array was carried out. A uniformed ZrO2 array was fabricated with a mean diameter of around 1 m using laser interference lithography. A C-AFM measurement set-up was built up. The - curve was directly measured of the organic ZrO2 array which shows a resistive switching characteristic by C-AFM measurement. The set voltage is 18.0 V and the reset voltage is −5.0 V. After the Pt layer was coated on the ZrO2 array, the set voltage decreases to 0.8 V and the reset voltage decreases to −2.2 V. This result shows that Pt layer can prevent the potential drop effectively. The electron barrier height between Pt/Ir C-AFM tip and organic ZrO2 array was enhanced by sputtering Pt layer on the ZrO2 organic array.

  4. The effect of PeakForce tapping mode AFM imaging on the apparent shape of surface nanobubbles

    NARCIS (Netherlands)

    Walczyk, W.; Schön, P.M.; Schönherr, H.

    2013-01-01

    Until now, TM AFM (tapping mode or intermittent contact mode atomic force microscopy) has been the most often applied direct imaging technique to analyze surface nanobubbles at the solid–aqueous interface. While the presence and number density of nanobubbles can be unequivocally detected and estimat

  5. Changes in collagen fibril pattern and adhesion force with collagenase-induced injury in rat Achilles tendon observed via AFM.

    Science.gov (United States)

    Lee, Gi-Ja; Choi, Samjin; Chon, Jinmann; Yoo, Seungdon; Cho, Ilsung; Park, Hun-Kuk

    2011-01-01

    The Achilles tendon consists mainly of type I collagen fibers that contain collagen fibrils. When the Achilles tendon is injured, it is inflamed. The collagenase-induced model has been widely used to study tendinitis. The major advantages of atomic force microscopy (AFM) over conventional optical and electron microscopy for bio-imaging include its non-requirement of a special coating and vacuum, and its capability to perform imaging in all environments. AFM force-distance measurements have become a fundamental tool in the fields of surface chemistry, biochemistry and materials science. Therefore, the changes in the ultrastructure and adhesion force of the collagen fibrils on the Achilles tendons of rats with Achilles tendinitis were observed using AFM. The changes in the structure of the Achilles tendons were evaluated based on the diameter and D-banding of the collagen fibrils. Collagenase-induced Achilles tendinitis was induced with the injection of 30 microl crude collagenase into 7-week-old male Sprague-Dawley rats. The animals were each sacrificed on the first, second, third, fifth and seventh day after the collagenase injection. The normal and injured Achilles tendons were fixed in 4% buffered formalin and dehydrated with increasing concentrations of ethanol. AFM was performed using the non-contact mode at the resolution of 512 x 512 pixels, with a scan speed of 0.8 line/sec. The adhesion force was measured via the force-distance curve that resulted from the interactions between the AFM tip and the collagen fibril sample using the contact mode. The diameter of the collagen fibrils in the Achilles tendons significantly decreased (p force decreased until the fifth day after the collagenase injection, but increased on the seventh day after the collagenase injection (p < 0.0001). PMID:21446543

  6. Research on corona discharge based on AFM probe%基于AFM探针的电晕放电研究

    Institute of Scientific and Technical Information of China (English)

    赵贵; 孔德义; Juergen Brugger; 陈池来; 程玉鹏; 李庄

    2011-01-01

    针对扫描探针显微镜与质谱联用系统中的采样方式,提出了利用原子力显微镜(AFM)探针进行电晕放电解吸附的采样方案.运用ANSYS软件对AFM导电探针进行了有限元仿真,电场分析表明间距100 μm加1 kV高压时的AFM探针周围场强在0.32 ~62.4 V/μm间,验证了利用其产生电晕放电的可行性;通过实验观察了电晕放电现象及其规律,测得了AFM探针加高压时的伏安特性曲线,为下一步利用AFM探针产生电晕放电进行非触式采样奠定了良好的基础.%An atomic force microscopy ( AFM) probe based corona discharge sampling device for desorption ionization in scanning probe microscope mass spectrometer (SPM-MS) is put forward. Through finite element analysis, research is done on the mechanical and electrical character of the AFM probe tip. Electrical analysis shows that the field intensity around the AFM probe could achieve 0.32 -62.4 V/μun when the gap distance is 100 fun and the applied voltage is 1 kV, validating the feasibility and usability of the sampling device. The relationship between discharge current I and applied voltage V is studied through corona discharge experiment. These works lay a foundation for developing the corona discharge for non-contact sampling based on AFM probe.

  7. Advances in CO2 cryogenic aerosol technology for photomask post AFM repair

    Science.gov (United States)

    Bowers, Charles; Varghese, Ivin; Balooch, Mehdi; Rodriguez, Jaime

    2009-10-01

    As the mask technology moves towards production of 36 nm and 22 nm DRAM half pitch nodes, printing features and sub-resolution assist features (SRAF) shrink below 80 nm. These narrow features become more fragile and place new demands on cleaning processes for a physically non damaging solution. These challenges include compatibility with new materials, oxidation, chemical contamination sensitivity, proportionally decreasing printable defect size, and a requirement for a damage-free clean. CO2 cryogenic aerosol cleaning has, for many years, shown potential to offer a wide process window for meeting some of these new challenges. CO2 cryogenic aerosol cleaning for post AFM repair debris cleaning has been used for many years on masks greater than 90 nm DRAM half pitch nodes. Until recently, CO2 purity and delivery hardware issues resulted in foreign material adder (FMACO2) contamination and SRAF damage below 150 nm critical feature size. Some key desirable properties of CO2 cryogenic aerosol cleaning are the non-oxidizing and non-etching properties when compared to current chemical wet clean processes. In this paper, recent advancements of CO2 cryogenic aerosol cleaning technology are presented, highlighting improvements in the areas of FMACO2 reduction, lowering the critical feature size without damage, and electrostatic discharge (ESD) mitigation. Key aspects of successful CO2 cryogenic aerosol cleaning include the spray nozzle design, CO2 liquid purity, and integrated system design. The design of the nozzle directly controls the size, flux, and velocity of the CO2 snow particles. Methodology and measurements of the solid CO2 particle size and velocity distributions will be presented, and their responses to various control parameters will be discussed. FMACO2 mitigation can be achieved only through use of highly purified CO2 and careful materials selection of the delivery hardware. Recent advances in CO2 purity will be discussed and data shown. The mask cleaning

  8. In situ AFM crystal growth and dissolution study of calcite in the presence of aqueous fluoride

    Science.gov (United States)

    Vavouraki, A.; Putnis, C. V.; Putnis, A.; Koutsoukos, P. G.

    2009-04-01

    Fluoride is naturally abundant, encountered in rocks, soil and fresh and ocean water. Calcite crystals, during crystal growth may incorporate fluoride ions into their lattice (Okumura et al., 1983). In situ atomic force microscopy (AFM) has been used to study the growth and dissolution of calcite {104} surfaces in aqueous solutions in the presence of fluoride, using a fluid cell in which the supersaturated and the understaturated solutions respectively, flow over a freshly cleaved calcite crystal. For growth experiments, supersaturation index (S.I.) with respect to calcite was equal to 0.89 and the initial solution pH 10.2. The crystal growth rates were measured from the closure of the rhombohedral etch pits along the [010] direction induced by an initial dissolution step using pure water. The spreading rate of 2-dimensional nuclei was also measured along the same direction. In the presence of low fluoride concentrations (≤0.33 mM), the crystal growth rate of calcite was unaffected. At higher concentrations (up to 5 mM) growth rate decreased substantially to 50% of the rate in the absence of fluoride. Potential fluoride sorption over the calcite surface may ascribe the decrease of growth rates. Dissolution experiments were conducted at pH= 7.2 and dissolution rates of calcite were measured from the spreading of rhombohedral etch pits along both [010] and [42] directions. The presence of low concentrations of fluoride (≤1.1 mM) in the undersaturated solutions enhanced the dissolution rate along the [42] direction by 50% in comparison with pure water. The morphology of rhombohedral etch pits changed to hexagonal in the presence of fluoride in the undersaturated solutions. The AFM dissolution experiments suggested that the fluoride ions adsorbed onto the calcite surface. Further increase of fluoride concentrations (up to 1.6 mM) resulted in the decrease of the calcite dissolution rate by 60% in both [010] and [42] directions. Reference: Okumura, M, Kitano, Y

  9. AFM/FFM测量参考样品云母的规范实验

    Institute of Scientific and Technical Information of China (English)

    钱林茂; 雒建斌; 温诗铸; 萧旭东

    2000-01-01

    在原子力/摩擦力显微镜(AFM/FFM)实验中, 通常只能得到摩擦力信号的相对值, 为了比较各种样品表面的微观摩擦性能, 常选用新鲜解理的云母作为摩擦力测量的参考样品. 由于新鲜解理云母表面摩擦性能的不稳定性, 使得不同条件下在云母表面上测得的摩擦力信号有较大的变化. 为此, 需要通过对云母表面摩擦性能的系统研究, 建立一个以云母为AFM/FFM摩擦力测试参考样品实验规范. 实验结果表明, 云母样品的摩擦特性受其解理时间的长短、湿度以及测试针尖的变化等多种因素的影响. 不同针尖在云母表面的摩擦力信号大约在±15%的范围内波动; 新针尖在云母表面作摩擦实验时, 摩擦力信号随磨损次数的增加逐渐增大, 然后趋于稳定. 对于新鲜解理的云母表面, 其摩擦力信号随解理时间的增长而逐渐增大并逐步趋于稳定. 由于云母表面的亲水性, 其摩擦力信号随湿度的增大而逐渐减小.

  10. AFM quantitative analysis and determination of shear angle of {259}f martensitic surface relief

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    An attentive observation and quantitative analysis of {259}f martensitic surface relief in an Fe-23Ni-0.55C alloy are made by means of an atomic force microscope (AFM), and different martensitic variants' shear angles are determined in this paper. The experiments show that {259}f martensitic surface relief exhibits regular shape in many cases, which is in agreement with the prediction of invariant plane strain (IPS). Generally, {259}f martensitic surface relief appears to be "N"-shaped, but it is tent-shaped in the case of zigzag-shaped martensite. The compressed deformation of parent phase diminishes the surface relief in size but with little change of its relief angle. {259}f martensitic surface relief, large or small, has approximately the same relief angles, exhibiting a good "self-similar fractal". The determined values of different {259}f martensitic variants' shear angles are in fine agreement with the prediction of Wechsler-Liberman-Read (W-L-R) theory, with only a slight difference of less than 3.65°.

  11. Interaction force measurement between E. coli cells and nanoparticles immobilized surfaces by using AFM.

    Science.gov (United States)

    Zhang, Wen; Stack, Andrew G; Chen, Yongsheng

    2011-02-01

    To better understand environmental behaviors of nanoparticles (NPs), we used the atomic force microscopy (AFM) to measure interaction forces between E. coli cells and NPs immobilized on surfaces in an aqueous environment. The results showed that adhesion force strength was significantly influenced by particle size for both hematite (α-Fe(2)O(3)) and corundum (α-Al(2)O(3)) NPs whereas the effect on the repulsive force was not observed. The adhesion force decreased from 6.3±0.7nN to 0.8±0.4nN as hematite NPs increased from 26nm to 98nm in diameter. Corundum NPs exhibited a similar dependence of adhesion force on particle size. The Johnson-Kendall-Roberts (JKR) model was employed to estimate the contact area between E. coli cells and NPs, and based on the JKR model a new model that considers local effective contact area was developed. The prediction of the new model matched the size dependence of adhesion force in experimental results. Size effects on adhesion forces may originate from the difference in local effective contact areas as supported by our model. These findings provide fundamental information for interpreting the environmental behaviors and biological interactions of NPs, which barely have been addressed. PMID:20932723

  12. Interaction force measurement between E. coli cells and nanoparticles immobilized surfaces by using AFM

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wen [Georgia Institute of Technology; Chen, Yongsheng [Georgia Institute of Technology

    2011-01-01

    To better understand environmental behaviors of nanoparticles (NPs), we used the atomic force microscopy (AFM) to measure interaction forces between E. coli cells and NPs immobilized on surfaces in an aqueous environment. The results showed that adhesion force strength was significantly influenced by particle size for both hematite ( -Fe2 O3 ) and corundum ( -Al2 O3 ) NPs whereas the effect on the repulsive force was not observed. The adhesion force decreased from 6.3 0.7 nN to 0.8 0.4 nN as hematite NPs increased from 26 nm to 98 nm in diameter. Corundum NPs exhibited a similar dependence of adhesion force on particle size. The Johnson Kendall Roberts (JKR) model was employed to estimate the contact area between E. coli cells and NPs, and based on the JKR model a new model that considers local effective contact area was developed. The prediction of the new model matched the size dependence of adhesion force in experimental results. Size effects on adhesion forces may originate from the difference in local effective contact areas as supported by our model. These findings provide fundamental information for interpreting the environmental behaviors and biological interactions of NPs, which barely have been addressed.

  13. The influence of aminophylline on the nanostructure and nanomechanics of T lymphocytes: an AFM study

    Science.gov (United States)

    Huang, Xun; He, Jiexiang; Liu, Mingxian; Zhou, Changren

    2014-09-01

    Although much progress has been made in the illustration of the mechanism of aminophylline (AM) treating asthma, there is no data about its effect on the nanostructure and nanomechanics of T lymphocytes. Here, we presented atomic force spectroscopy (AFM)-based investigations at the nanoscale level to address the above fundamental biophysical questions. As increasing AM treatment time, T lymphocytes' volume nearly double increased and then decreased. The changes of nanostructural features of the cell membrane, i.e., mean height of particles, root-mean-square roughness (Rq), crack and fragment appearance, increased with AM treatment time. T lymphocytes were completely destroyed with 96-h treatment, and they existed in the form of small fragments. Analysis of force-distance curves showed that the adhesion force of cell surface decreased significantly with the increase of AM treatment time, while the cell stiffness increased firstly and then decreased. These changes were closely correlated to the characteristics and process of cell oncosis. In total, these quantitative and qualitative changes of T lymphocytes' structure and nanomechanical properties suggested that AM could induce T lymphocyte oncosis to exert anti-inflammatory effects for treating asthma. These findings provide new insights into the T lymphocyte oncosis and the anti-inflammatory mechanism and immune regulation actions of AM.

  14. AFM and EDX Study of Self Assembled Pt Nanostructures on PEDOT Thin Films under Ambient Conditions

    Science.gov (United States)

    Senevirathne, Indrajith; Mohney, Austin; Buchheit, Joshua; Goonewardene, Anura

    2011-03-01

    Noble metal nanostructure systems on conductive polymer thin films under ambient conditions are interesting due to their use in BioMEMS and hybrid systems further and considering the physics of the polymer - metal interactions The observed nanostructures have deformed spherical shape. The Pt was magnetron sputter deposited at RT (300K), PEDOT Baytron P 60nm thick, spin coated on glass slides cleaned with acetone and IPA. The system was studied using ambient IC mode Atomic Force Microscopy (AFM) for its structure. Elemental composition/distribution of the system was measured with Energy Dispersive X ray Spectroscopy (EDX). Pt nanostructures on the surface observed to be likely Volmer - Weber growth mode At Pt coverage of 120 ML, nanostructures had a mean diameter of 32 nm and mean height of 5 nm. When annealing at 15min at 473K systems changes to smaller nanostructures coexisting with bigger structures of mean diameter of 120 nm and mean height of 36 nm. Elemental/morphological variations when annealed at successively higher temperatures were also investigated. NSF Grant #: 0923047 and PASSHE FPDC (LOU # 2010-LHU-03).

  15. Nonlinear Dynamics and Chaos of Microcantilever-Based TM-AFMs with Squeeze Film Damping Effects

    Directory of Open Access Journals (Sweden)

    Jie-Yu Chen

    2009-05-01

    Full Text Available In Atomic force microscope (AFM examination of a vibrating microcantilever, the nonlinear tip-sample interaction would greatly influence the dynamics of the cantilever. In this paper, the nonlinear dynamics and chaos of a tip-sample dynamic system being run in the tapping mode (TM were investigated by considering the effects of hydrodynamic loading and squeeze film damping. The microcantilever was modeled as a spring-mass-damping system and the interaction between the tip and the sample was described by the Lennard-Jones (LJ potential. The fundamental frequency and quality factor were calculated from the transient oscillations of the microcantilever vibrating in air. Numerical simulations were carried out to study the coupled nonlinear dynamic system using the bifurcation diagram, Poincaré maps, largest Lyapunov exponent, phase portraits and time histories. Results indicated the occurrence of periodic and chaotic motions and provided a comprehensive understanding of the hydrodynamic loading of microcantilevers. It was demonstrated that the coupled dynamic system will experience complex nonlinear oscillation as the system parameters change and the effect of squeeze film damping is not negligible on the micro-scale.

  16. Size and orientation of the lipid II headgroup as revealed by AFM imaging.

    Science.gov (United States)

    Ganchev, D N; Hasper, H E; Breukink, E; de Kruijff, B

    2006-05-16

    In this study, we investigated the size and orientation of the bacterial Lipid II (L II) headgroup when the L II molecule is present in liquid-crystalline domains of DOPC in a supported DPPC bilayer. Using atomic force microscopy, we detected that L II causes the appearance of a 1.9 nm thick layer, situated over the DOPC headgroup region. With an increased scanning force, this layer can be penetrated by the AFM tip down to the level of the DOPC bilayer. Using different L II precursor molecules, we demonstrated that the detected layer consists of the headgroups of L II and that the MurNAc-pentapeptide unit of the headgroup is responsible for the measured 1.9 nm height of that layer. Monolayer experiments provided information about the in-plane dimensions of the L II headgroup. On the basis of these results and considerations of the molecular dimensions of L II headgroup constituents, we propose a model for the orientation of the L II headgroup in the membrane. In this model, the pentapeptide of the L II headgroup is rather extended and points away from the bilayer surface, which could be important for biological processes, in which L II is involved. PMID:16681392

  17. AFM study of glucagon fibrillation via oligomeric structures resulting in interwoven fibrils

    Energy Technology Data Exchange (ETDEWEB)

    Dong Mingdong [Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, DK-8000 Aarhus C (Denmark); Hovgaard, Mads Bruun [Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, DK-8000 Aarhus C (Denmark); Xu Sailong [Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, DK-8000 Aarhus C (Denmark); Otzen, Daniel Erik [Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, DK-8000 Aarhus C (Denmark); Besenbacher, Flemming [Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, DK-8000 Aarhus C (Denmark)

    2006-08-28

    Glucagon is a 29-residue amphiphatic hormone involved in the regulation of blood glucose levels in conjunction with insulin. In concentrated aqueous solutions, glucagon spontaneously aggregates to form amyloid fibrils, destroying its biological activity. In this study we utilize the atomic force microscope (AFM) to elucidate the fibrillation mechanism of glucagon at the nanoscale under acidic conditions (pH 2.0) by visualizing the nanostructures of fibrils formed at different stages of the incubation. Hollow disc-shaped oligomers form at an early stage in the process and subsequently rearrange to more solid oligomers. These oligomers co-exist with, and most likely act as precursors for, protofibrils, which subsequently associate to form at least three different classes of higher-order fibrils of different heights. A repeat unit of around 50 nm along the main fibril axis suggests a helical arrangement of interwoven protofibrils. The diversity of oligomeric and fibrillar arrangements formed at pH 2.0 complements previous spectroscopic analyses that revealed that fibrils formed under different conditions can differ substantially in stability and secondary structure.

  18. FTIR, AFM and PL properties of thin SiO{sub x} films deposited by HFCVD

    Energy Technology Data Exchange (ETDEWEB)

    Luna-Lopez, J.A., E-mail: jalbluna@siu.buap.mx [CIDS-ICUAP, BUAP, Ciudad Universitaria, Ed. 103 D, Col. San Manuel, C.P. 72570, Puebla (Mexico); Garcia-Salgado, G.; Diaz-Becerril, T.; Lopez, J. Carrillo; Vazquez-Valerdi, D.E.; Juarez-Santiesteban, H.; Rosendo-Andres, E.; Coyopol, A. [CIDS-ICUAP, BUAP, Ciudad Universitaria, Ed. 103 D, Col. San Manuel, C.P. 72570, Puebla (Mexico)

    2010-10-25

    In order to have optoelectronic functions integrated in a single chip, it is very important to obtain a silicon compatible material with an optimal photoluminescence response. The non-stoichiometric silicon oxide (SiO{sub x}) has shown photoluminescence response and is also compatible with silicon technology. In this work, the composition and optical properties of the SiO{sub x} films are studied using null ellipsometry, Fourier transformed infrared spectroscopy (FTIR), atomic force microscopy (AFM), and photoluminescence (PL). The SiO{sub x} films were growth to different temperatures. The IR absorption spectrum shows the presence of three typical Si-O-Si vibrations modes in SiO{sub 2}. However, changes in their intensity and position were observed. Also, when growth temperature decreased, the Si-H vibrations modes were observed. These changes are directly related with compositional variation in the SiO{sub x} films due to the growth temperature. A PL spectrum shows a considerable emission in the range 400-850 nm that varies with the growth temperatures.

  19. AFM and uni-axial testing of pericardium exposed to radiotherapy doses

    International Nuclear Information System (INIS)

    The pericardium, a double-layered sac that encloses the heart, is made up of collagen and elastin fibres embedded in an amorphous matrix (forming the extracellular matrix). Collagen fibres are aligned in multidirectional orientation layers. This free arrangement of fibres gives the pericardium its viscoelastic properties and the ability to deform in all directions. This is an important mechanical property for the heart to perform its physiological functions, acknowledging the fact that the heart is attached to different ligaments and muscles in all directions. The present study aims to investigate the effect of penetrating photon ionising radiation on bovine pericardium tissue. This links to an interest in seeking to understand possible mechanisms underlying cardiac complications following treatment of the left breast in radiotherapy regimes. Pericardium samples were subjected to doses in the range 0-80 Gy. Atomic force microscopy (AFM) has been applied in characterising changes in the infrastructural and mechanical properties of the tissues. Preliminary data for doses of 80 Gy shows there was no significant change in the D-spacing period of the banded structure collagen type I but a significant increase is observed in the FWHM of the fibril widths (by between 25% and 27%) over that of unirradiated pericardium tissue.

  20. Growth behaviour and mechanical properties of PLL/HA multilayer films studied by AFM

    Directory of Open Access Journals (Sweden)

    Cagri Üzüm

    2012-11-01

    Full Text Available Scanning- and colloidal-probe atomic force microscopy were used to study the mechanical properties of poly(L-lysine/hyaluronan (PLL/HAn films as a function of indentation velocity and the number of polymer deposition steps n. The film thickness was determined by two independent AFM-based methods: scratch-and-scan and newly developed full-indentation. The advantages and disadvantages of both methods are highlighted, and error minimization techniques in elasticity measurements are addressed. It was found that the film thickness increases linearly with the bilayer number n, ranging between 400 and 7500 nm for n = 12 and 96, respectively. The apparent Young’s modulus E ranges between 15 and 40 kPa and does not depend on the indenter size or the film bilayer number n. Stress relaxation measurements show that PLL/HA films have a viscoelastic behaviour, regardless of their thickness. If indentation is performed several times at the same lateral position on the film, a viscous/plastic deformation takes place.

  1. Investigation the Al–Fe–Cr–Ti nano composites structures with using XRD and AFM techniques

    Indian Academy of Sciences (India)

    Ali Bahari; Aref Sadeghi Nik; Mandana Roodbari; Nordin Mirnia

    2012-12-01

    The performance of multilayers has been widely investigated in metal/metal systems. Shrinking this system down to less than 10 nm dislocation blocking occurs. We should thus try to find a way to get a structure with less dislocation, and/or strain because low diffusivity ultra high vacuum chamber is the basic requirements for growing ultra thin films and nano scale materials. We used William–Hall relation based on Scherr equation in X-ray powder spectrum and drawn the stress–strain diagrams. It shows that Al–Fe–Cr–Ti composites have very low diffusivity and equilibrium solubility in Al (0.05 at.% Fe, >0.02 at.% Cr, and >0.3 at.% Ti). Al–Ti– Fe–Cr composite powders have also been prepared from sol–gel method starting from elemental powders at both ambient and elevated temperatures. The obtained results from XRD (X-ray Diffraction), AFM (Atomic Force Microscopy) and X-ray powder techniques indicate that nano-grains with 0.03 at %Cr can cause a reduction of leakage current through the SS chamber due to its amorphous structure.

  2. AFM study of hydrodynamics in boundary layers around micro- and nanofibers

    CERN Document Server

    de Baubigny, Julien Dupré; Mortagne, Caroline; Devailly, Clémence; Acharige, Sébastien Kosgodagan; Laurent, Justine; Steinberger, Audrey; Salvetat, Jean-Paul; Aimé, Jean-Pierre; Ondarçuhu, Thierry

    2016-01-01

    The description of hydrodynamic interactions between a particle and the surrounding liquid, down to the nanometer scale, is of primary importance since confined liquids are ubiquitous in many natural and technological situations. In this paper, we combine three non-conventional atomic force microscopes to study hydrodynamics around micro- and nano-cylinders. These complementary methods allow the independent measurement of the added mass and friction terms over a large range of probe sizes, fluid viscosities and solicitation conditions. A theoretical model based on an analytical description of the velocity field around the probe shows that the friction force depends on a unique parameter, the ratio of the probe radius to the thickness of the viscous boundary layer. We demonstrate that the whole range of experimental data can be gathered in a master curve which is well reproduced by the model. This validates the use of these AFM modes for a quantitative study of nano-hydrodynamics, and opens the way to the inve...

  3. Colloid-probe AFM studies of the interaction forces of proteins adsorbed on colloidal crystals.

    Science.gov (United States)

    Singh, Gurvinder; Bremmell, Kristen E; Griesser, Hans J; Kingshott, Peter

    2015-04-28

    In recent years, colloid-probe AFM has been used to measure the direct interaction forces between colloidal particles of different size or surface functionality in aqueous media, as one can study different forces in symmerical systems (i.e., sphere-sphere geometry). The present study investigates the interaction between protein coatings on colloid probes and hydrophilic surfaces decorated with hexagonally close packed single particle layers that are either uncoated or coated with proteins. Controlled solvent evaporation from aqueous suspensions of colloidal particles (coated with or without lysozyme and albumin) produces single layers of close-packed colloidal crystals over large areas on a solid support. The measurements have been carried out in an aqueous medium at different salt concentrations and pH values. The results show changes in the interaction forces as the surface charge of the unmodified or modified particles, and ionic strength or pH of the solution is altered. At high ionic strength or pH, electrostatic interactions are screened, and a strong repulsive force at short separation below 5 nm dominates, suggesting structural changes in the absorbed protein layer on the particles. We also study the force of adhesion, which decreases with an increment in the salt concentration, and the interaction between two different proteins indicating a repulsive interaction on approach and adhesion on retraction. PMID:25758979

  4. Optimization of Q-factor of AFM cantilevers using genetic algorithms.

    Science.gov (United States)

    Perez-Cruz, Angel; Dominguez-Gonzalez, Aurelio; Stiharu, Ion; Osornio-Rios, Roque A

    2012-04-01

    Micro cantilever beams have been intensively used in sensing applications including to scanning profiles and surfaces where there resolution and imaging speed are critical. Force resolution is related to the Q-factor. When the micro-cantilever operates in air with small separation gaps, the Q-factor is even more reduced due to the squeeze-film damping effect. Thus, the optimization of the configuration of an AFM micro-cantilever is presented in this work with the objective of improving its Q-factor. To accomplish this task, we propose the inclusion of holes as breathing chimneys in the initial design to reduce the squeeze-film damping effect. The evaluation of the Q-factor was carried out using finite element model, which is implemented to work together with the squeeze-film damping model. The methodology applied in the optimization process was genetic algorithms, which considers as constraints the maximum allowable stress, fundamental frequency and spring constant with respect to the initial design. The results show that the optimum design, which includes holes with an optimal location, increases the Q-factor almost five times compared to the initial design. PMID:22459119

  5. Porous titania films fabricated via sol gel rout - Optical and AFM characterization

    Science.gov (United States)

    Karasiński, Paweł; Gondek, Ewa; Drewniak, Sabina; Kajzer, Anita; Waczyńska-Niemiec, Natalia; Basiaga, Marcin; Izydorczyk, Weronika; Kouari, Youssef E. L.

    2016-06-01

    Mesoporous titania films of low refractive index ∼1.72 and thickness within the range of 57-96 nm were fabricated via sol-gel rout and dip-coating technique on a soda-lime glass substrate. Tetrabutylorthotitanate Ti(OBu)4 was used as a titania precursor. High porosity and consequently low refractive index were achieved using the polyethylene glycol (PEG 1100) as a template. Based on transmittance, using Tauc's relations, the optical energy band gaps and the Urbach energy were determined. The research shows that in the fabricated titania films there are two types of optical energy band gaps, connected with direct and indirect electron transitions and brought about by the presence of amorphous and crystalline phase respectively. Based on the quantum size effect, the diameters of nanocrystals versus film thickness were determined. AFM studies of the titania films have demonstrated that there are changes of surface morphology taking place with the change of thickness. We have demonstrated that the surface morphology of titania films has influence on wettability.

  6. IMPROVED FABRICATION METHOD FOR CARBON NANOTUBE PROBE OF ATOMIC FORCE MICROSCOPY(AFM)

    Institute of Scientific and Technical Information of China (English)

    XU Zongwei; DONG Shen; GUO Liqiu; ZHAO Qingliang

    2006-01-01

    An improved arc discharge method is developed to fabricate carbon nanotube probe of atomic force microscopy (AFM) here. First, silicon probe and carbon nanotube are manipulated under an optical microscope by two high precision microtranslators. When silicon probe and carbon nanotube are very close, several tens voltage is applied between them. And carbon nanotube is divided and attached to the end of silicon probe, which mainly due to the arc welding function.Comparing with the arc discharge method before, the new method here needs no coat silicon probe with metal film in advance, which can greatly reduce the fabrication's difficulty. The fabricated carbon nanotube probe shows good property of higher aspect ratio and can more accurately reflect the true topography of silicon grating than silicon probe. Under the same image drive force, carbon nanotube probe had less indentation depth on soft triblock copolymer sample than silicon probe. This showed that carbon nanotube probe has lower spring constant and less damage to the scan sample than silicon probe.

  7. AFM studies in diverse ionic environments of nucleosomes reconstituted on the 601 positioning sequence.

    Science.gov (United States)

    Nazarov, Igor; Chekliarova, Iana; Rychkov, Georgy; Ilatovskiy, Andrey V; Crane-Robinson, Colyn; Tomilin, Alexey

    2016-02-01

    Atomic force microscopy (AFM) was used to study mononucleosomes reconstituted from a DNA duplex of 353 bp containing the strong 601 octamer positioning sequence, together with recombinant human core histone octamers. Three parameters were measured: 1) the length of DNA wrapped around the core histones; 2) the number of superhelical turns, calculated from the total angle through which the DNA is bent, and 3) the volume of the DNA-histone core. This approach allowed us to define in detail the structural diversity of nucleosomes caused by disassembly of the octasome to form subnucleosomal structures containing hexasomes, tetrasomes and disomes. At low ionic strength (TE buffer) and in the presence of physiological concentrations of monovalent cations, the majority of the particles were subnucleosomal, but physiological concentrations of bivalent cations resulted in about half of the nucleosomes being canonical octasomes in which the exiting DNA duplexes cross orthogonally. The dominance of this last species explains why bivalent but not monovalent cations can induce the initial step towards compaction and convergence of neighboring nucleosomes in nucleosomal arrays to form the chromatin fiber in the absence of linker histone. The observed nucleosome structural diversity may reflect the functional plasticity of nucleosomes under physiological conditions.

  8. Mechanical Characterization of Photo-crosslinked, Thermoresponsive Hydrogel Thin Films via AFM Nanoindentation

    Science.gov (United States)

    Le, Thao; Aidala, Katherine; Hayward, Ryan

    2014-03-01

    Thin hydrogel films with patterned swelling are known to buckle into programmed three-dimensional shapes, offering approaches to fabricate reversibly self-folding micro-devices for actuators and drug delivery devices. To precisely control the shapes adopted, it is important to quantitatively understand the relationship between swelling and mechanical properties. Furthermore, to understand the buckling pathways and the mechanical responses of the swelled materials, it is also important to identify how the gels undergo stress relaxation. However, the low moduli, high water contents, and micrometer-scale thicknesses of these materials have so far made mechanical characterization difficult. In this study, we use an AFM nanoindentation technique to characterize the mechanical properties of photo-crosslinked, thermoresponsive poly(N-isopropylacrylamide) hydrogel thin films. Simultaneously, we conduct stress relaxation experiments at microscopic indentation lengths to differentiate between the effects of viscoelastic and poroelastic response mechanisms. This research was funded by the Army Research Office through W911NF-11-1-0080 and the NSF Materials Research Science and Engineering Center at the University of Massachusetts through DMR-0820506.

  9. High resolution AFM and single cell resonance Raman spectroscopy of Geobacter sulfurreducens biofilms early in growth.

    Directory of Open Access Journals (Sweden)

    Nikolai eLebedev

    2014-08-01

    Full Text Available AFM and confocal resonance Raman microscopy (CRRM of single-cells were used to study the transition of anode-grown Geobacter sulfurreducens biofilms from lag phase (initial period of low current to exponential phase (subsequent period of rapidly increasing current. Results reveal that lag phase biofilms consist of lone cells and tightly packed single-cell thick clusters crisscrossed with extracellular linear structures that appear to be comprised of nodules approximately 20 nm in diameter aligned end to end. By early exponential phase cell clusters expand laterally and a second layer of closely packed cells begins to form on top of the first. Abundance of c-type cytochromes (c-Cyt is > 3-fold greater in 2-cell thick regions than in 1-cell thick regions. The results indicate that early biofilm growth involves two transformations. The first is from lone cells to 2-dimensionally associated cells during lag phase when current remains low. This is accompanied by formation of extracellular linear structures. The second is from 2- to 3-dimensionally associated cells during early exponential phase when current begins to increases rapidly. This is accompanied by a dramatic increase in c-Cyt abundance.

  10. Magnetotransport measurements on AFM structured two-dimensional electron gases on cleaved edges of GaAs/AlGaAs; Magnetotransportmessungen an AFM-strukturierten zweidimensionalen Elektronengasen auf GaAs/AlGaAs-Spaltkanten

    Energy Technology Data Exchange (ETDEWEB)

    Reinwald, Elisabeth

    2009-06-25

    In this thesis a two dimensional electron gas (2DEG) on a (110) cleavage plane of a GaAs/AlGaAs(001) heterostructure was produced by means of cleaved edge overgrowth (CEO) and modulated in two dimensions. The 2DEG was modulated in one direction by a superlattice of the subjacent GaAs/AlGaAs(001) heterostructure. A second modulation, perpendicular to the first was realized by local anodic oxidation (LAO) with an atomic force microscope (AFM). For the process of LAO an electric voltage is applied between the tip of the AFM and the surface of the GaAs. The natural water film on the surface acts as electrolyte so that the GaAs surface is locally oxidized underneath the AFM tip. This oxide leads to a band bending so that the 2DEG underneath the oxide is locally depleted. On these systems magnetotransport measurements revealed that it is actually possible to modulate 2DEGs on a sufficient large area by local anodic oxidation. On the cleaved surfaces the influence of the two dimensional modulation on the electron gas has been demonstrated. (orig.)

  11. A solution for an inverse problem in liquid AFM: calculation of three-dimensional solvation structure on a sample surface

    CERN Document Server

    Amano, Ken-ich

    2013-01-01

    Recent frequency-modulated atomic force microscopy (FM-AFM) can measure three-dimensional force distribution between a probe and a sample surface in liquid. The force distribution is, in the present circumstances, assumed to be solvation structure on the sample surface, because the force distribution and solvation structure have somewhat similar shape. However, the force distribution is exactly not the solvation structure. If we would like to obtain the solvation structure by using the liquid AFM, a method for transforming the force distribution into the solvation structure is necessary. Therefore, in this letter, we present the transforming method in a brief style. We call this method as a solution for an inverse problem, because the solvation structure is obtained at first and the force distribution is obtained next in general calculation processes. The method is formulated (mainly) by statistical mechanics of liquid.

  12. PREFACE: NC-AFM 2004: Proceedings of the 7th International Conference on Non-contact Atomic Force Microscopy

    Science.gov (United States)

    Schwarz, Udo

    2005-03-01

    With the ongoing miniaturization of devices and controlled nanostructuring of materials, the importance of atomic-scale information on surfaces and surface properties is growing continuously. The astonishing progress in nanoscience and nanotechnology that took place during the last two decades was in many ways related to recent progress in high-resolution imaging techniques such as scanning tunnelling microscopy and transmission electron microscopy. Since the mid-1990s, non-contact atomic force microscopy (NC-AFM) performed in ultrahigh vacuum has evolved as an alternative technique that achieves atomic resolution, but without the restriction to conducting surfaces of the previously established techniques. Advances of the rapidly developing field of NC-AFM are discussed at annual conferences as part of a series that started in 1998 in Osaka, Japan. This special issue of Nanotechnology is a compilation of original work presented at the 7th International Conference on Non-contact Atomic Force Microscopy that took place in Seattle, USA, 12-15 September 2004. Over the years, the conference grew in size and scope. Atomic resolution imaging of oxides and semiconductors remains an issue. Noticeable new developments have been presented in this regard such as, e.g., the demonstrated ability to manipulate individual atoms. Additionally, the investigation of individual molecules, clusters, and organic materials gains more and more attention. In this context, considerable effort is undertaken to transfer the NC-AFM principle based on frequency modulation to applications in air and liquids with the goal of enabling high-resolution surface studies of biological material in native environments, as well as to reduce the experimental complexity, which so far involves the availability of (costly) vacuum systems. Force spectroscopy methods continue to be improved and are applied to topics such as the imaging of the three-dimensional force field as a function of the distance with

  13. Non-reciprocal directional dichroism in the AFM phase of BiFeO3 at THz frequencies

    Science.gov (United States)

    Nagel, Urmas; Rõõm, T.; Farkas, D.; Szaller, D.; Bordács, S.; Kézsmárki, I.; Engelkamp, H.; Ozaki, Y.; Tomiaki, Y.; Ito, T.; Fishman, Randy S.

    We did THz absorption spectroscopy of BiFeO3 single crystals in the AFM phase, where the spin cycloid is destroyed in magnetic fields between 18 T and 32 T in Voigt geometry at 1.6 K. If B0 ∥ [ 1 1 0 ] , we see strong directional dichroism (DD) of absorption of the magnon mode with light propagating along the direction of the ferroelectric polarization k ∥ P ∥ [ 111 ] and eω ∥ [ 1 1 0 ] , bω ∥ [ 1 1 2 ] . The sign of DD can be reversed (i) by reversing the direction of B0 or (ii) by flipping the sample, thus reversing the propagation direction of light. The observed effect is caused by the strong magneto-electric coupling in the collinear AFM phase. Research sponsored by the Estonian Ministry of Education and Research (IUT23-3).

  14. AFM PeakForce QNM mode: Evidencing nanometre-scale mechanical properties of chitin-silica hybrid nanocomposites.

    Science.gov (United States)

    Smolyakov, G; Pruvost, S; Cardoso, L; Alonso, B; Belamie, E; Duchet-Rumeau, J

    2016-10-20

    PeakForce Quantitative Nanomechanical Mapping (QNM) AFM mode was used to explore the mechanical properties of textured chitin-silica hybrid films at the nanoscale. The influence of the force applied by the tip on the sample surface was studied for standard homogeneous samples, for chitin nanorods and for chitin-silica hybrid nanocomposites. Thick films of superimposed chitin nanorods showed a monotonous increase of DMT modulus (based on the Derjaguin-Muller-Toporov model) owing to an increase in modulus at the interface between nanorods due to geometrical constraints of the AFM acquisition. A similar variation of DMT modulus was obtained for chitin-silica hybrid thick films related to mechanical strengthening induced by the presence of silica. This work revealed the role of the organic-inorganic interface, at the nanoscale, in the mechanical behaviour of textured materials using PeakForce QNM mode, with optimized analysis conditions. PMID:27474579

  15. Observation of Transcription Regulation in the Mouse Heart Nuclear DNA Fragments and the Specific-protein Interaction by AFM

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Using atom force microscopy (AFM), in vitro transcription, PAGE and other experimental technologies, it is observed that, in active genes of mice (Balb/c) nuclear DNA fragments of non-transcriptional state, only regulation sequences at both ends are associated with scaffold proteins (indissociable proteins) and some transcriptional factors such as complexes (dissociable proteins) made of gene-coding proteins and specific auxiliary small molecules, while there are no combining proteins in intermediate coding sequences. However, in active genes of transcriptional state, both regulation sequences and intermediate coding sequences are associated with active transcriptional factors by non-covalent bonds.This paper shows the prospective application of AFM observation and in vitro transcription in the research on gene expression and regulation. It also offers some theoretical basis for localization of specific genes in human genomes.

  16. Surface investigations of ZnBeMnSe mixed crystals by means of the piezoelectric spectroscopy and the AFM technique

    Science.gov (United States)

    Strzałkowski, K.; Kulesza, S.; Zakrzewski, J.; Maliński, M.

    2014-01-01

    Piezoelectric photoacoustic spectroscopy with a piezoelectric detection has been used for measurements of the amplitude and phase spectra of Zn1-x-yBexMnySe mixed semiconductors. The investigated crystals were grown from the melt by the modified high pressure Bridgman method under the argon overpressure. The preliminary study of the sample's surface of the investigated crystals was carried out using the AFM technique. The influence of a different surface treatment on the amplitude and phase piezoelectric spectra as well as on AFM images is presented and analyzed. The correlations between these two techniques have been found and are discussed. Piezoelectric (PZE) spectra were analyzed using an extended and modified Jackson-Amer theory.

  17. Characterization of deep nanoscale surface trenches with AFM using thin carbon nanotube probes in amplitude-modulation and frequency-force-modulation modes

    Science.gov (United States)

    Solares, Santiago D.

    2008-01-01

    The characterization of deep surface trenches with atomic force microscopy (AFM) presents significant challenges due to the sharp step edges that disturb the instrument and prevent it from faithfully reproducing the sample topography. Previous authors have developed AFM methodologies to successfully characterize semiconductor surface trenches with dimensions on the order of tens of nanometers. However, the study of imaging fidelity for features with dimensions smaller than 10 nm has not yet received sufficient attention. Such a study is necessary because small features in some cases lead to apparently high-quality images that are distorted due to tip and sample mechanical deformation. This paper presents multi-scale simulations, illustrating common artifacts affecting images of nanoscale trenches taken with fine carbon nanotube probes within amplitude-modulation and frequency-force-modulation AFM (AM-AFM and FFM-AFM, respectively). It also describes a methodology combining FFM-AFM with a step-in/step-out algorithm analogous to that developed by other groups for larger trenches, which can eliminate the observed artifacts. Finally, an overview of the AFM simulation methods is provided. These methods, based on atomistic and continuum simulation, have been previously used to study a variety of samples including silicon surfaces, carbon nanotubes and biomolecules.

  18. Recombinant albumin adsorption on mica studied by AFM and streaming potential measurements.

    Science.gov (United States)

    Kujda, Marta; Adamczyk, Zbigniew; Morga, Maria; Sofińska, Kamila

    2015-03-01

    Recombinant human serum albumin (rHSA) in monomeric state is widely used in pharmaceutical industry as a drug excipient and for preparing coatings for medical devices. In this work the adsorption process of rHSA on model mica surface at pH 3.5 was studied using the atomic force microscopy (AFM) and in situ streaming potential measurements. The kinetics of albumin adsorption was determined by a direct enumeration of single molecules over various substrate areas. These results were consistent with streaming potential measurements carried out for the parallel-plate channel flow and with theoretical predictions derived from the random sequential adsorption (RSA) model. Desorption kinetics of albumin under flow conditions was also evaluated via the streaming potential measurements. In this way, the amount of irreversibly bound albumin was quantitatively evaluated to be 0.64 and 1.2 mg m(-2) for ionic strength of 0.01 and 0.15 M, respectively. This agrees with previous results obtained for HSA and theoretical calculations derived from the RSA model. Additionally, it was demonstrated that there existed a fraction of reversibly bound albumin that can be fully eluted within a few hours. The binding energy of these fraction of molecules was -18 kT that is consistent with the electrostatic controlled adsorption mechanism of albumin at this pH. It was concluded that the rHSA monolayers of well-defined coverage can find applications for quantitatively analyzing ligand binding and for performing efficient biomaterials and immunological tests.

  19. Mechanism of immonoglobulin G adsorption on mica-AFM and electrokinetic studies.

    Science.gov (United States)

    Dąbkowska, Maria; Adamczyk, Zbigniew

    2014-06-01

    Adsorption of immunoglobulin G (IgG) from aqueous NaCl solutions of the concentration 10(-3)-0.15M on mica was studied. Initially, the kinetics was evaluated at pH 3.5 by direct AFM imaging. A monotonic increase in the maximum coverage of IgG with NaCl concentration was observed. These results were interpreted in terms of the theoretical model postulating an irreversible adsorption of the protein governed by the random sequential adsorption (RSA) model. Additionally, IgG adsorption and desorption was studied under in situ conditions, with streaming potential measurements. These measurements revealed that the maximum coverage of irreversibly adsorbed IgG varies from 0.37mgm(-2) for 10(-3)M, NaCl to 1.2mgm(-2) for 0.15M, NaCl. The significant role of ionic strength was attributed to the lateral electrostatic repulsion among adsorbed IgG molecules, positively charged at this pH value. These experimental results confirmed that monolayers of irreversibly bound IgG can be produced by adjusting ionic strength of the protein solution. In further experiments the stability and acid base properties of such monolayers were studied using the streaming potential method. It revealed that the monolayers were stable against pH cycling for the range from 3.5 to 9.5. The isoelectric point of mica supported IgG monolayers was 5.9, similar to derived from the micro-electrophoretic measurements in the bulk (5.8). Beside significance for basic sciences, the results indicate that thorough characteristics of IgG can be acquired via streaming potential measurements using microgram quantities of the protein.

  20. Advances in post AFM repair cleaning of photomask with CO2 cryogenic aerosol technology

    Science.gov (United States)

    Bowers, Charles; Varghese, Ivin; Balooch, Mehdi; Brandt, Werner

    2009-04-01

    As the mask technology matures, critical printing features and sub-resolution assist features (SRAF) shrink below 100 nm, forcing critical cleaning processes to face significant challenges. These challenges include use of new materials, oxidation, chemical contamination sensitivity, proportionally decreasing printable defect size, and a requirement for a damage-free clean. CO2 cryogenic aerosol cleaning has the potential to offer a wide process window for meeting these new challenges, if residue adder issues and damage can be eliminated. Some key differentiations of CO2 cryogenic aerosol cleaning are the non-oxidizing and non-etching properties compared to conventional chemical wet clean processes with or without megasonics. In prior work, the feasibility of CO2 cryogenic aerosol in post AFM repair photomask cleaning was demonstrated. In this paper, recent advancements of CO2 cryogenic aerosol cleaning technology are presented, focusing on the traditional problem areas of particle adders, electrostatic discharge (ESD), and mask damage mitigation. Key aspects of successful CO2 cryogenic aerosol cleaning include the spray nozzle design, CO2 liquid purity, and system design. The design of the nozzle directly controls the size, density, and velocity of the CO2 snow particles. Methodology and measurements of the solid CO2 particle size and velocity distributions will be presented, and their responses to various control parameters will be discussed. Adder control can be achieved only through use of highly purified CO2 and careful materials selection. Recent advances in CO2 purity will be discussed and data shown. The mask cleaning efficiency by CO2 cryogenic aerosol and damage control is essentially an optimization of the momentum of the solid CO2 particles and elimination of adders. The previous damage threshold of 150 nm SRAF structures has been reduced to 70nm and data will be shown indicating 60 nm is possible in the near future. Data on CO2 tribocharge mitigation

  1. Effect of enamel morphology on nanoscale adhesion forces of streptococcal bacteria : An AFM study.

    Science.gov (United States)

    Wang, Chuanyong; Zhao, Yongqi; Zheng, Sainan; Xue, Jing; Zhou, Jinglin; Tang, Yi; Jiang, Li; Li, Wei

    2015-01-01

    We explore the influence of enamel surface morphology on nanoscale bacterial adhesion forces. Three dimensional morphology characteristics of enamel slices, which were treated with phosphoric acid (for 0 s, 5 s, 10 s, 20 s, and 30 s), were acquired. Adhesion forces of three initial colonizers (Streptococcus oralis, Streptococcus sanguinis, and Streptococcus mitis) and two cariogenic bacterial strains (Streptococcus mutans and Streptococcus sobrinus) with etched enamel surfaces were determined. Comparison of the forces was made by using bacterial probe method under atomic force microscope (AFM) in adhesion buffer. The results showed that enamel morphology was significantly altered by etching treatment. The roughness, peak-to-valley height, and valley-to-valley width of the depth profile, surface area, and volume increased linearly with acid exposure time, and reached the maximum at 30s, respectively. The adhesion forces of different strains increased accordingly with etching time. Adhesion forces of S. oralis, S. mitis, S. mutans, and S. sobrinus reached the maximum values of 0.81 nN, 0.84 nN, 0.73 nN, and 0.64 nN with enamel treated for 20s, respectively, whereas that of S. sanguinis at 10s (1.28nN), and dropped on coarser enamel surfaces. In conclusion, enamel micro-scale morphology may significantly alter the direct adhesion forces of bacteria. And there may be a threshold roughness for bacterial adhesion on enamel surface.

  2. Lipid asymmetry in DLPC/DSPC supported lipid bilayers, a combined AFM and fluorescence microscopy study

    Energy Technology Data Exchange (ETDEWEB)

    Lin, W; Blanchette, C D; Ratto, T V; Longo, M L

    2005-06-20

    A fundamental attribute of cell membranes is transmembrane asymmetry, specifically the formation of ordered phase domains in one leaflet that are compositionally different from the opposing leaflet of the bilayer. Using model membrane systems, many previous studies have demonstrated the formation of ordered phase domains that display complete transmembrane symmetry but there have been few reports on the more biologically relevant asymmetric membrane structures. Here we report on a combined atomic force microscopy (AFM) and fluorescence microscopy study whereby we observe three different states of transmembrane symmetry in phase-separated supported bilayers formed by vesicle fusion. We find that if the leaflets differ in gel-phase area fraction, then the smaller domains in one leaflet are in registry with the larger domains in the other leaflet and the system is dynamic. In a presumed lipid flip-flop process similar to Ostwald Ripening, the smaller domains in one leaflet erode away while the large domains in the other leaflet grow until complete compositional asymmetry is reached and remains stable. We have quantified this evolution and determined that the lipid flip-flop event happens most frequently at the interface between symmetric and asymmetric DSPC domains. If both leaflets have nearly identical area fraction of gel-phase, gel-phase domains are in registry and are static in comparison to the first state. The stability of these three DSPC domain distributions, the degree of registry observed, and the domain immobility have direct biological significance with regards to maintenance of lipid asymmetry in living cell membranes, communication between inner leaflet and outer leaflet, membrane adhesion, and raft mobility.

  3. Comparative studies of thin film growth on aluminium by AFM, TEM and GDOES characterization

    Science.gov (United States)

    Qi, Jiantao; Thompson, George E.

    2016-07-01

    In this present study, comparative studies of trivalent chromium conversion coating formation, associated with aluminium dissolution process, have been investigated using atomic force microscopy (AFM), transmission electron microscopy (TEM) and glow-discharge optical emission spectroscopy (GDOES). High-resolution electron micrographs revealed the evident and uniform coating initiation on the whole surface after conversion treatment for only 30 s, although a network of metal ridges was created by HF etching pre-treatment. In terms of conversion treatment process on electropolished aluminium, constant kinetics of coating growth, ∼0.30 ± 0.2 nm/s, were found after the prolonged conversion treatment for 600 s. The availability of electrolyte anions for coating deposition determined the growth process. Simultaneously, a proceeding process of aluminium dissolution during conversion treatment, of ∼0.11 ± 0.02 nm/s, was found for the first time, indicating constant kinetics of anodic reactions. The distinct process of aluminium consumption was assigned with loss of corrosion protection of the deposited coating material as evidenced in the electrochemical impedance spectroscopy. Based on the present data, a new mechanism of coating growth on aluminium was proposed, and it consisted of an activation period (0-30 s), a linear growth period (0.30 nm/s, up for 600 s) and limited growth period (0.17 nm/s, 600-1200 s). In addition, the air-drying post-treatment and a high-vacuum environment in the microscope revealed a coating shrinkage, especially in the coatings after conversion treatments for longer time.

  4. Optimization of Q-factor of AFM cantilevers using genetic algorithms

    Energy Technology Data Exchange (ETDEWEB)

    Perez-Cruz, Angel, E-mail: elapc27@gmail.com [Faculty of Engineering, Universidad Autonoma de Queretaro, Queretaro (Mexico); Dominguez-Gonzalez, Aurelio [Faculty of Engineering, Universidad Autonoma de Queretaro, Queretaro (Mexico); Stiharu, Ion [Department of Mechanical and Industrial Engineering, Concordia University, Montreal (Canada); Osornio-Rios, Roque A. [Faculty of Engineering, Universidad Autonoma de Queretaro, Queretaro (Mexico)

    2012-04-15

    Micro cantilever beams have been intensively used in sensing applications including to scanning profiles and surfaces where there resolution and imaging speed are critical. Force resolution is related to the Q-factor. When the micro-cantilever operates in air with small separation gaps, the Q-factor is even more reduced due to the squeeze-film damping effect. Thus, the optimization of the configuration of an AFM micro-cantilever is presented in this work with the objective of improving its Q-factor. To accomplish this task, we propose the inclusion of holes as breathing chimneys in the initial design to reduce the squeeze-film damping effect. The evaluation of the Q-factor was carried out using finite element model, which is implemented to work together with the squeeze-film damping model. The methodology applied in the optimization process was genetic algorithms, which considers as constraints the maximum allowable stress, fundamental frequency and spring constant with respect to the initial design. The results show that the optimum design, which includes holes with an optimal location, increases the Q-factor almost five times compared to the initial design. -- Highlights: Black-Right-Pointing-Pointer It was optimized the Q-factor of a cantilever, which operates near to the surface in air. Black-Right-Pointing-Pointer It was proposed the inclusion of holes as breathing chimneys in the cantilever's surface. Black-Right-Pointing-Pointer Genetic algorithms and finite element analysis were applied to find the optimum configuration for the Q-factor. Black-Right-Pointing-Pointer Optimum design keeps first frequency and the spring constant very close to the original and has a better force resolution. Black-Right-Pointing-Pointer Final design can be easily manufactured through a mask.

  5. The study of optical disk pattern based on AFM%基于AFM的光盘形貌研究

    Institute of Scientific and Technical Information of China (English)

    孙大许; 刘万里; 马强; 闫勇刚

    2005-01-01

    介绍了原子力显微镜(AFM)的原理及特点.用AFM对光盘上记录信息用的凹坑结构进行了三维检测,并对测量结果进行了分析.结论表明AFM在光盘质量检测过程中具有独特的优势.

  6. AFM of the ultrastructural and mechanical properties of lipid-raft-disrupted and/or cold-treated endothelial cells.

    Science.gov (United States)

    Wu, Li; Huang, Jie; Yu, Xiaoxue; Zhou, Xiaoqing; Gan, Chaoye; Li, Ming; Chen, Yong

    2014-02-01

    The nonionic detergent extraction at 4 °C and the cholesterol-depletion-induced lipid raft disruption are the two widely used experimental strategies for lipid raft research. However, the effects of raft disruption and/or cold treatment on the ultrastructural and mechanical properties of cells are still unclear. Here, we evaluated the effects of raft disruption and/or cold (4 °C) treatment on these properties of living human umbilical vein endothelial cells (HUVECs). At first, the cholesterol-depletion-induced raft disruption was visualized by confocal microscopy and atomic force microscopy (AFM) in combination with fluorescent quantum dots. Next, the cold-induced cell contraction and the formation of end-branched filopodia were observed by confocal microscopy and AFM. Then, the cell-surface ultrastructures were imaged by AFM, and the data showed that raft disruption and cold treatment induced opposite effects on cell-surface roughness (a significant decrease and a significant increase, respectively). Moreover, the cell-surface mechanical properties (stiffness and adhesion force) of raft-disrupted- and/or cold-treated HUVECs were measured by the force measurement function of AFM. We found that raft disruption and cold treatment induced parallel effects on cell stiffness (increase) or adhesion force (decrease) and that the combination of the two treatments caused dramatically strengthened effects. Finally, raft disruption was found to significantly impair cell migration as previously reported, whereas temporary cold treatment only caused a slight but nonsignificant decrease in cell migration performed at physiological temperature. Although the mechanisms for causing these results might be complicated and more in-depth studies will be needed, our data may provide important information for better understanding the effects of raft disruption or cold treatment on cells and the two strategies for lipid raft research.

  7. Application of the Discrete Wavelet Transform to SEM and AFM Micrographs for Quantitative Analysis of Complex Surfaces.

    Science.gov (United States)

    Workman, Michael J; Serov, Alexey; Halevi, Barr; Atanassov, Plamen; Artyushkova, Kateryna

    2015-05-01

    The discrete wavelet transform (DWT) has found significant utility in process monitoring, filtering, and feature isolation of SEM, AFM, and optical images. Current use of the DWT for surface analysis assumes initial knowledge of the sizes of the features of interest in order to effectively isolate and analyze surface components. Current methods do not adequately address complex, heterogeneous surfaces in which features across multiple size ranges are of interest. Further, in situations where structure-to-property relationships are desired, the identification of features relevant for the function of the material is necessary. In this work, the DWT is examined as a tool for quantitative, length-scale specific surface metrology without prior knowledge of relevant features or length-scales. A new method is explored for determination of the best wavelet basis to minimize variation in roughness and skewness measurements with respect to change in position and orientation of surface features. It is observed that the size of the wavelet does not directly correlate with the size of features on the surface, and a method to measure the true length-scale specific roughness of the surface is presented. This method is applied to SEM and AFM images of non-precious metal catalysts, yielding new length-scale specific structure-to-property relationships for chemical speciation and fuel cell performance. The relationship between SEM and AFM length-scale specific roughness is also explored. Evidence is presented that roughness distributions of SEM images, as measured by the DWT, is representative of the true surface roughness distribution obtained from AFM.

  8. DNA-coated AFM cantilevers for the investigation of cell adhesion and the patterning of live cells

    Energy Technology Data Exchange (ETDEWEB)

    Hsiao, Sonny C.; Crow, Ailey K.; Lam, Wilbur A.; Bertozzi, Carolyn R.; Fletcher, Daniel A.; Francis, Matthew B.

    2008-08-01

    Measurement of receptor adhesion strength requires the precise manipulation of single cells on a contact surface. To attach live cells to a moveable probe, DNA sequences complementary to strands displayed on the plasma membrane are introduced onto AFM cantilevers (see picture, bp=base pairs). The strength of the resulting linkages can be tuned by varying the length of DNA strands, allowing for controlled transport of the cells.

  9. Integrin-Specific Mechanoresponses to Compression and Extension Probed by Cylindrical Flat-Ended AFM Tips in Lung Cells

    OpenAIRE

    Irene Acerbi; Tomás Luque; Alícia Giménez; Marta Puig; Noemi Reguart; Ramon Farré; Daniel Navajas; Jordi Alcaraz

    2012-01-01

    Cells from lung and other tissues are subjected to forces of opposing directions that are largely transmitted through integrin-mediated adhesions. How cells respond to force bidirectionality remains ill defined. To address this question, we nanofabricated flat-ended cylindrical Atomic Force Microscopy (AFM) tips with ~1 µm(2) cross-section area. Tips were uncoated or coated with either integrin-specific (RGD) or non-specific (RGE/BSA) molecules, brought into contact with lung epithelial cells...

  10. Characterization and analysis of weld lines on micro-injection moulded parts using atomic force microscopy (AFM)

    DEFF Research Database (Denmark)

    Tosello, Guido; Gava, Alberto; Hansen, Hans Nørgaard;

    2009-01-01

    In recent years plastic moulding techniques, such as injection moulding, have been developed to fulfil the needs of micro-components fabrication. Micro-injection moulding (SLIM) is the process which enables the mass production of polymer micro-systems such as micro-mechanical parts, micro-fluidic...... injection moulding parameters on the weld lines' dimensions is presented, using an atomic force microscope (AFM). Depth and width of weld lines were chosen as parameters to be optimized....

  11. Impact of AFM-induced nano-pits in a-Si:H films on silicon crystal growth

    Directory of Open Access Journals (Sweden)

    Verveniotis Elisseos

    2011-01-01

    Full Text Available Abstract Conductive tips in atomic force microscopy (AFM can be used to localize field-enhanced metal-induced solid-phase crystallization (FE-MISPC of amorphous silicon (a-Si:H at room temperature down to nanoscale dimensions. In this article, the authors show that such local modifications can be used to selectively induce further localized growth of silicon nanocrystals. First, a-Si:H films by plasma-enhanced chemical vapor deposition on nickel/glass substrates are prepared. After the FE-MISPC process, yielding both conductive and non-conductive nano-pits in the films, the second silicon layer at the boundary condition of amorphous and microcrystalline growth is deposited. Comparing AFM morphology and current-sensing AFM data on the first and second layers, it is observed that the second deposition changes the morphology and increases the local conductivity of FE-MISPC-induced pits by up to an order of magnitude irrespective of their prior conductivity. This is attributed to the silicon nanocrystals (<100 nm that tend to nucleate and grow inside the pits. This is also supported by micro-Raman spectroscopy.

  12. AFM and XRD characterization of silver nanoparticles films deposited on the surface of DGEBA epoxy resin by ion sputtering

    International Nuclear Information System (INIS)

    In this work, silver atoms were deposited by ion sputtering on the surface of diglycidyl ether of bisphenol A (DGEBA) epoxy resin cured at 150 deg C for 6 hours in air. The films of DGEBA and its precursors were characterized by Raman spectroscopy to identify the main functional groups and their relationship with the deposited silver atoms. Silver thin films of 5, 10, 15 and 20 nm were deposited on the epoxy resin at room temperature. Both the initial film of DGEBA and the subsequent silver thin film were analyzed by Atomic Force Microscopy (AFM) in the non-contact mode. Silver thin films were also analyzed using X-ray diffraction (XRD) at room temperature. The AFM results showed the formation of silver crystallites on the surface of DGEBA at very low coverage whereas XRD indicated that most of them had their main axis aligned to the normal of the surface. An increase in the coverage led to an increase in the grain size as indicated by AFM. However, XRD results indicated that the crystallite size remained almost constant while the appearance of peaks corresponding to other crystalline orientations suggests the coalescence of the original crystallites and an increase in size of the more dense planes, namely [111]. (author)

  13. AFM and XRD characterization of silver nanoparticles films deposited on the surface of DGEBA epoxy resin by ion sputtering

    International Nuclear Information System (INIS)

    In this work, silver atoms were deposited by ion sputtering on the surface of diglycidyl ether of bisphenol A (DGEBA) epoxy resin cured at 150 °C for 6 hours in air. The films of DGEBA and its precursors were characterized by Raman spectroscopy to identify the main functional groups and their relationship with the deposited silver atoms. Silver thin films of 5, 10, 15 and 20 nm were deposited on the epoxy resin at room temperature. Both the initial film of DGEBA and the subsequent silver thin film were analyzed by Atomic Force Microscopy (AFM) in the non-contact mode. Silver thin films were also analyzed using X-ray diffraction (XRD) at room temperature. The AFM results showed the formation of silver crystallites on the surface of DGEBA at very low coverage whereas XRD indicated that most of them had their main axis aligned to the normal of the surface. An increase in the coverage led to an increase in the grain size as indicated by AFM. However, XRD results indicated that the crystallite size remained almost constant while the appearance of peaks corresponding to other crystalline orientations suggests the coalescence of the original crystallites and an increase in size of the more dense planes, namely [111]. (author)

  14. AFM and XRD characterization of silver nanoparticles films deposited on the surface of DGEBA epoxy resin by ion sputtering

    Energy Technology Data Exchange (ETDEWEB)

    Andrade, Jose Elisandro de; Machado, Rogerio; Macedo, Marcelo Andrade; Cunha, Frederico Guilherme Carvalho [Clinica de Medicina Nuclear e Radiologia de Maceio (MedRadiUS), Radiology and Imaging Diagnosis at Universidade Federal de Alagoas (UFAL), Maceio, AL (Brazil)

    2012-07-01

    In this work, silver atoms were deposited by ion sputtering on the surface of diglycidyl ether of bisphenol A (DGEBA) epoxy resin cured at 150 deg C for 6 hours in air. The films of DGEBA and its precursors were characterized by Raman spectroscopy to identify the main functional groups and their relationship with the deposited silver atoms. Silver thin films of 5, 10, 15 and 20 nm were deposited on the epoxy resin at room temperature. Both the initial film of DGEBA and the subsequent silver thin film were analyzed by Atomic Force Microscopy (AFM) in the non-contact mode. Silver thin films were also analyzed using X-ray diffraction (XRD) at room temperature. The AFM results showed the formation of silver crystallites on the surface of DGEBA at very low coverage whereas XRD indicated that most of them had their main axis aligned to the normal of the surface. An increase in the coverage led to an increase in the grain size as indicated by AFM. However, XRD results indicated that the crystallite size remained almost constant while the appearance of peaks corresponding to other crystalline orientations suggests the coalescence of the original crystallites and an increase in size of the more dense planes, namely [111]. (author)

  15. AFM and XRD characterization of silver nanoparticles films deposited on the surface of DGEBA epoxy resin by ion sputtering

    Energy Technology Data Exchange (ETDEWEB)

    Andrade, Jose Elisandro de; Machado, Rogerio; Macedo, Marcelo Andrade [Universidade Federal de Sergipe (UFSE), Aracaju, SE (Brazil). Programa de Pos-graduacao em Fisica; Cunha, Frederico Guilherme Carvalho [Universidade Federal de Sergipe (UFSE), Aracaju, SE (Brazil). Programa de Pos-graduacao em Ciencia e Engenharia de Materiais

    2012-07-01

    In this work, silver atoms were deposited by ion sputtering on the surface of diglycidyl ether of bisphenol A (DGEBA) epoxy resin cured at 150 Degree-Sign C for 6 hours in air. The films of DGEBA and its precursors were characterized by Raman spectroscopy to identify the main functional groups and their relationship with the deposited silver atoms. Silver thin films of 5, 10, 15 and 20 nm were deposited on the epoxy resin at room temperature. Both the initial film of DGEBA and the subsequent silver thin film were analyzed by Atomic Force Microscopy (AFM) in the non-contact mode. Silver thin films were also analyzed using X-ray diffraction (XRD) at room temperature. The AFM results showed the formation of silver crystallites on the surface of DGEBA at very low coverage whereas XRD indicated that most of them had their main axis aligned to the normal of the surface. An increase in the coverage led to an increase in the grain size as indicated by AFM. However, XRD results indicated that the crystallite size remained almost constant while the appearance of peaks corresponding to other crystalline orientations suggests the coalescence of the original crystallites and an increase in size of the more dense planes, namely [111]. (author)

  16. In situ Electrochemical-AFM Study of LiFePO4 Thin Film in Aqueous Electrolyte.

    Science.gov (United States)

    Wu, Jiaxiong; Cai, Wei; Shang, Guangyi

    2016-12-01

    Lithium-ion (Li-ion) batteries have been widely used in various kinds of electronic devices in our daily life. The use of aqueous electrolyte in Li-ion battery would be an alternative way to develop low cost and environmentally friendly batteries. In this paper, the lithium iron phosphate (LiFePO4) thin film cathode for the aqueous rechargeable Li-ion battery is prepared by radio frequency magnetron sputtering deposition method. The XRD, SEM, and AFM results show that the film is composed of LiFePO4 grains with olivine structure and the average size of 100 nm. Charge-discharge measurements at current density of 10 μAh cm(-2) between 0 and 1 V show that the LiFePO4 thin film electrode is able to deliver an initial discharge capacity of 113 mAh g(-1). Specially, the morphological changes of the LiFePO4 film electrode during charge and discharge processes were investigated in aqueous environment by in situ EC-AFM, which is combined AFM with chronopotentiometry method. The changes in grain area are measured, and the results show that the size of the grains decreases and increases during the charge and discharge, respectively; the relevant mechanism is discussed. PMID:27117633

  17. Molecular dynamics study on the mechanism of AFM-based nanoscratching process with water-layer lubrication

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Jiaqi; Zhao, Jinsheng; Dong, Zeguang; Liu, Pinkuan, E-mail: pkliu@sjtu.edu.cn

    2015-08-15

    Highlights: • MD simulations are conducted to study the water-lubricated nanoscratching process. • The water layer has positive impact on the surface quality. • Comparisons are made in aspects of deformation, forces, and fricion coefficients. • Effects of water thickness, scratching depth and velocity are thoroughly studied. - Abstract: The atomic force microscopy (AFM) based direct nanoscratching has been thoroughly studied but the mechanism of nanoscratching with water-layer lubrication is yet to be well understood. In current study, three-dimensional molecular dynamics (MD) simulations are conducted to evaluate the effects of the water-layer lubrication on the AFM-based nanoscratching process on monocrystalline copper. Comparisons of workpiece deformation, scratching forces, and friction coefficients are made between the water-lubricated and dry scratching under various thickness of water layer, scratching depth and scratching velocity. Simulation results reveal that the water layer has positive impact on the surface quality and significant influence on the scratching forces (normal forces and tangential forces). The friction coefficients of the tip in water-lubricated nanoscratching are significantly bigger than those in the dry process. Our simulation results shed lights on a promising AFM-based nanofabrication method, which can assist to get nanoscale surface morphologies with higher quality than traditional approaches.

  18. Evaluation of defect density by top-view large scale AFM on metamorphic structures grown by MOVPE

    Energy Technology Data Exchange (ETDEWEB)

    Gocalinska, Agnieszka, E-mail: agnieszka.gocalinska@tyndall.ie; Manganaro, Marina; Dimastrodonato, Valeria; Pelucchi, Emanuele

    2015-09-15

    Highlights: • Metamorphic buffer layers of In{sub x}Ga{sub 1−x}As were grown by MOVPE and characterised by AFM and TEM. • It was found that AFM provides sufficient information to estimate threading defect density in metamorphic structures, even when significant roughness is present. • When planar-view TEM is lacking, a combination of cross-sectional TEM and large scale AFM can provide good evaluation of the material quality. • It is fast, cheap and non-destructive – can be very useful in development process of complicated structures, requiring multiple test growths and characterisation. - Abstract: We demonstrate an atomic force microscopy based method for estimation of defect density by identification of threading dislocations on a non-flat surface resulting from metamorphic growth. The discussed technique can be applied as an everyday evaluation tool for the quality of epitaxial structures and allow for cost reduction, as it lessens the amount of the transmission electron microscopy analysis required at the early stages of projects. Metamorphic structures with low surface defectivities (below 10{sup 6}) were developed successfully with the application of the technique, proving its usefulness in process optimisation.

  19. NC-AFM identification of different aluminum atoms on Al2O3/NiAl(110) surface

    Science.gov (United States)

    Stich, Ivan; Brndiar, Jan; Li, Yan Jun; Sugawara, Yasuhiro

    2015-03-01

    Ultrathin alumina film formed by oxidation of NiAl(110) is widely used as a system for technologically important oxide-supported catalysts. Using small amplitude NC-AFM we have obtained images of this system with unprecedented resolution, significantly surpassing the previous STM and NC-AFM images. In particular, we are able to resolve aluminum atoms with different coordination, such as five-, and four-fold coordinated Al atoms. Experiments are supported by extensive density functional theory modeling. Starting from the previous atomic model, we have been able to describe the gross image features such as the dark oxygen sites. We find that the system is strongly ionic with the oxygen sites strongly negatively charged and aluminum sites positively charged. Hence, the NC-AFM images can reliably be understood from electrostatic potentials. These finding also suggest an oxygen terminated apex. Resolving finer contrast features of the differently coordinated Al atoms required construction of better and more realistic approximants to the ultra-thin incommensurable alumina interface. Supported by APVV-0207-11 and VEGA (2/0007/12) projects.

  20. Observation of the in vitro Transcription of the Mouse (Balb/c) Heart Nuclear DNA Fragments by AFM

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    It is observed that the regulation sequences at the two ends of every active gene of the heart nuclear DNA fragments may differentially combine with active regulation factors such as some specific binding proteins by using AFM and other experimental technologies. These active genes form different "gene knots", which are separated by "intervals". Using AFM, occasionally, it is also discovered that during the transcription stage, the heart nuclear DNA fragments consist of 3-4-5 "gene knots" and related "intervals", which form various "gene lineages" respectively by some "permutation and combination". Each gene lineage is likely to form nRNA chain-like complexes that are 3 times the quantity of gene knots, and each nRNA chain-like complex is connected with both ends of corresponding gene lineage. One gene knot of the DNA fragments participates the formation of different gene lineage and corresponding RNA chain-like complexes by different combination. By posttranscriptional modification, they can form nmRNA linear chain-like complexes that show the speciality of tissues. The beginnings of transcription units have the same number as gene lineages, and all gene lineages in DNA molecules may transcribe efficiently from corresponding beginnings of transcription unit simultaneously. Our work shows the prospective application of AFM in the research of the diversity of gene lineages formation from gene knots in the transcription stage and the efficiency of gene knots transcription.

  1. Nano-scale modification of electrical and magnetic properties on Fe3O4 thin film by AFM lithography

    Science.gov (United States)

    Hirooka, Motoyuki; Vilquin, Bertrand; Li, Runwei; Tanaka, Hidekazu; Kawai, Tomoji

    2004-03-01

    We report the nano-patterning of the Fe3O4(111) epitaxial ultrathin film with room temperature ferromagnetism using atomic force microscopy (AFM). Fe3O4 thin film with atomically flat surface were grown along the 'q111' rdirection using laser-molecular beam epitaxy on MgAl2O4(111) single crystal substrate. The nano-wires were constructed on Fe3O4 thin film by applying electric field between an AFM conductive tip and the surface of the film. The minimum width and height in the resulting nano-wire are 48 nm and 2 nm, respectively. The patterned region shows 105 times higher resistance than the unpatterned region of Fe3O4 film. Furthermore, magnetic force microscopy (MFM) measurements by phase detection also revealed that magnetization of the patterned region are strongly suppressed. Remarkably, phase shift became almost zero in the patterned region, including no magnetic field was detected. We consider that magnetization is decreased in the patterned region by AFM lithography.

  2. AFM and XRD characterization of silver nanoparticles films deposited on the surface of DGEBA epoxy resin by ion sputtering

    Directory of Open Access Journals (Sweden)

    José Elisandro de Andrade

    2013-01-01

    Full Text Available In this work, silver atoms were deposited by ion sputtering on the surface of diglycidyl ether of bisphenol A (DGEBA epoxy resin cured at 150 °C for 6 hours in air. The films of DGEBA and its precursors were characterized by Raman spectroscopy to identify the main functional groups and their relationship with the deposited silver atoms. Silver thin films of 5, 10, 15 and 20 nm were deposited on the epoxy resin at room temperature. Both the initial film of DGEBA and the subsequent silver thin film were analyzed by Atomic Force Microscopy (AFM in the non-contact mode. Silver thin films were also analyzed using X-ray diffraction (XRD at room temperature. The AFM results showed the formation of silver crystallites on the surface of DGEBA at very low coverage whereas XRD indicated that most of them had their main axis aligned to the normal of the surface. An increase in the coverage led to an increase in the grain size as indicated by AFM. However, XRD results indicated that the crystallite size remained almost constant while the appearance of peaks corresponding to other crystalline orientations suggests the coalescence of the original crystallites and an increase in size of the more dense planes, namely [111].

  3. In situ Electrochemical-AFM Study of LiFePO4 Thin Film in Aqueous Electrolyte

    Science.gov (United States)

    Wu, Jiaxiong; Cai, Wei; Shang, Guangyi

    2016-04-01

    Lithium-ion (Li-ion) batteries have been widely used in various kinds of electronic devices in our daily life. The use of aqueous electrolyte in Li-ion battery would be an alternative way to develop low cost and environmentally friendly batteries. In this paper, the lithium iron phosphate (LiFePO4) thin film cathode for the aqueous rechargeable Li-ion battery is prepared by radio frequency magnetron sputtering deposition method. The XRD, SEM, and AFM results show that the film is composed of LiFePO4 grains with olivine structure and the average size of 100 nm. Charge-discharge measurements at current density of 10 μAh cm-2 between 0 and 1 V show that the LiFePO4 thin film electrode is able to deliver an initial discharge capacity of 113 mAh g-1. Specially, the morphological changes of the LiFePO4 film electrode during charge and discharge processes were investigated in aqueous environment by in situ EC-AFM, which is combined AFM with chronopotentiometry method. The changes in grain area are measured, and the results show that the size of the grains decreases and increases during the charge and discharge, respectively; the relevant mechanism is discussed.

  4. Electrochemical oxidation of the chalcopyrite surface: an XPS and AFM study in solution at pH 4

    Energy Technology Data Exchange (ETDEWEB)

    Farquhar, Morag L.; Wincott, Paul L.; Wogelius, Roy A.; Vaughan, David J

    2003-09-30

    The electrochemical oxidation of chalcopyrite (CuFeS{sub 2}) has been studied at pH 4 using voltammetry, coulometry, X-ray photoelectron spectroscopy (XPS) and both ex situ and in situ atomic force microscopy (AFM). Between 500 and 650 mV an anodic oxidation peak is observed, prior to the onset of the main decomposition reactions. Chalcopyrite electrodes in contact with electrolyte show some release of Cu into solution even without an applied potential. At 500 and 650 mV, the loss of Cu from the surface increases by a factor of 2 and 6, respectively. Oxidation at 500 mV results in the formation of a mixed oxide or hydroxide of iron, coincident with islands (<0.15 {mu}m wide) of reaction products observed on the surface using AFM. The surface coverage of these islands increases with amount of charge passed. Oxidation at 650 mV shows similar processes have occurred, but with a greater island surface coverage and a more deeply altered surface. XPS depth profiling suggests iron oxide or hydroxide is now a major phase in the top {approx}40 A, with significant sulphate also formed. Observation of islands (alteration products) using in situ AFM under potential control shows that these features are not an artefact of the preparation methods.

  5. Adhesion of B. subtilis spores and vegetative cells onto stainless steel--DLVO theories and AFM spectroscopy.

    Science.gov (United States)

    Harimawan, Ardiyan; Zhong, Shaoping; Lim, Chwee-Teck; Ting, Yen-Peng

    2013-09-01

    Interactions between the bacterium Bacillus subtilis (either as vegetative cells or as spores) and stainless steel 316 (SS-316) surfaces were quantified using the classical Derjaguin-Landau-Verwey-Overbeek (DLVO) theory and extended DLVO (xDLVO) approach in conjunction with live force spectroscopy using an Atomic Force Microscope (AFM). The xDLVO approach accounts for acid-base (polar) interactions that are not considered in the classical DLVO theory. AFM results revealed that spores manifested stronger attraction interactions to stainless steel compared to their vegetative cells counterparts due to lower energy barrier as predicted by both the theoretical approaches as well as the higher hydrophobicity on the spore surfaces. Both DLVO and xDLVO theories predict that vegetative cells manifest weaker attachment on the surfaces compared to spores. Results of AFM force measurement corroborate these findings; spores recorded significantly higher adhesion force (2.92±0.4 nN) compared to vegetative cells (0.65±0.2 nN). The adhesion of spores presents greater challenges in biofilm control owing to its stronger attachment and persistence when the spores are formed under adverse environmental conditions. PMID:23777862

  6. Effect of TMAH Etching Duration on the Formation of Silicon Nano wire Transistor Patterned by AFM Nano lithography

    International Nuclear Information System (INIS)

    Atomic force microscopy (AFM) lithography was applied to produce nano scale pattern for silicon nano wire transistor fabrication. This technique takes advantage of imaging facility of AFM and the ability of probe movement controlling over the sample surface to create nano patterns. A conductive AFM tip was used to grow the silicon oxide nano patterns on silicon on insulator (SOI) wafer. The applied tip-sample voltage and writing speed were well controlled in order to form pre-designed silicon oxide nano wire transistor structures. The effect of tetra methyl ammonium hydroxide (TMAH) etching duration on the oxide covered silicon nano wire transistor structure has been investigated. A completed silicon nano wire transistor was obtained by removing the oxide layer via hydrofluoric acid etching process. The fabricated silicon nano wire transistor consists of a silicon nano wire that acts as a channel with source and drain pads. A lateral gate pad with a nano wire head was fabricated very close to the channel in the formation of transistor structures. (author)

  7. AFM stiffness nanotomography of normal, metaplastic and dysplastic human esophageal cells

    International Nuclear Information System (INIS)

    The mechanical stiffness of individual cells is important in tissue homeostasis, cell growth, division and motility, and the epithelial–mesenchymal transition in the initiation of cancer. In this work, a normal squamous cell line (EPC2) and metaplastic (CP-A) as well as dysplastic (CP-D) Barrett's Esophagus columnar cell lines are studied as a model of pre-neoplastic progression in the human esophagus. We used the combination of an atomic force microscope (AFM) with a scanning confocal fluorescence lifetime imaging microscope to study the mechanical properties of single adherent cells. Sixty four force indentation curves were taken over the nucleus of each cell in an 8 × 8 grid pattern. Analyzing the force indentation curves, indentation depth-dependent Young's moduli were found for all cell lines. Stiffness tomograms demonstrate distinct differences between the mechanical properties of the studied cell lines. Comparing the stiffness for indentation forces of 1 nN, most probable Young's moduli were calculated to 4.7 kPa for EPC2 (n = 18 cells), 3.1 kPa for CP-A (n = 10) and 2.6 kPa for CP-D (n = 19). We also tested the influence of nuclei and nucleoli staining organic dyes on the mechanical properties of the cells. For stained EPC2 cells (n = 5), significant stiffening was found (9.9 kPa), while CP-A cells (n = 5) showed no clear trend (2.9 kPa) and a slight softening was observed (2.1 kPa) in the case of CP-D cells (n = 16). Some force–indentation curves show non-monotonic discontinuities with segments of negative slope, resembling a sawtooth pattern. We found the incidence of these 'breakthrough events' to be highest in the dysplastic CP-D cells, intermediate in the metaplastic CP-A cells and lowest in the normal EPC2 cells. This observation suggests that the microscopic explanation for the increased compliance of cancerous and pre-cancerous cells may lie in their susceptibility to 'crumble and yield' rather than their

  8. Using Atomic Force Microscopy (AFM) in the Nanometer Structure Imaging of Starch%原子力显微镜(AFM)在淀粉纳米级结构分析中的应用

    Institute of Scientific and Technical Information of China (English)

    黄强; 罗发兴

    2004-01-01

    详述了原子力显微镜(AFM)工作的基本原理,测定淀粉纳米结构中样品的处理方法,以及AFM在观察淀粉溶液的分子链结构、淀粉颗粒表面的纳米结构、淀粉颗粒内部的纳米结构中的应用,对AFM在淀粉纳米结构分析的前景进行了展望.

  9. Optical imaging beyond the diffraction limit by SNEM: Effects of AFM tip modifications with thiol monolayers on imaging quality

    Energy Technology Data Exchange (ETDEWEB)

    Cumurcu, Aysegul [Materials Science and Technology of Polymers, MESA+ Institute for Nanotechnology, University of Twente, Enschede NL-7500 (Netherlands); Dutch Polymer Institute (DPI), P.O. Box 902, 5600 AX, Eindhoven (Netherlands); Diaz, Jordi [Scientific and Technological Centers of the University of Barcelona, C/ Lluís Solé i Sabaris, 1-3, 08028 Barcelona (Spain); Lindsay, Ian D. [Nanophysics and Soft Matter Group, H.H. Wills Physics Laboratory, University of Bristol, Tyndall Avenue, Bristol BS8 1TL (United Kingdom); Beer, Sissi de; Duvigneau, Joost [Materials Science and Technology of Polymers, MESA+ Institute for Nanotechnology, University of Twente, Enschede NL-7500 (Netherlands); Schön, Peter [Materials Science and Technology of Polymers, MESA+ Institute for Nanotechnology, University of Twente, Enschede NL-7500 (Netherlands); NanoBioInterface, Research Center Design and Technology, Saxion University of Applied Sciences, 7500 KB Enschede (Netherlands); Julius Vancso, G., E-mail: g.j.vancso@utwente.nl [Materials Science and Technology of Polymers, MESA+ Institute for Nanotechnology, University of Twente, Enschede NL-7500 (Netherlands)

    2015-03-15

    Tip-enhanced nanoscale optical imaging techniques such as apertureless scanning near-field optical microscopy (a-SNOM) and scanning near-field ellipsometric microscopy (SNEM) applications can suffer from a steady degradation in performance due to adhesion of atmospheric contaminants to the metal coated tip. Here, we demonstrate that a self-assembled monolayer (SAM) of ethanethiol (EtSH) is an effective means of protecting gold-coated atomic force microscopy (AFM) probe tips from accumulation of surface contaminants during prolonged exposure to ambient air. The period over which they yield consistent and reproducible results for scanning near-field ellipsometric microscopy (SNEM) imaging is thus extended. SNEM optical images of a microphase separated polystyrene-block-poly (methylmethacrylate) (PS-b-PMMA) diblock copolymer film, which were captured with bare and SAM-protected gold-coated AFM probes, both immediately after coating and following five days of storage in ambient air, were compared. During this period the intensity of the optical signals from the untreated gold tip fell by 66%, while those from the SAM protected tip fell by 14%. Additionally, gold coated AFM probe tips were modified with various lengths of alkanethiols to measure the change in intensity variation in the optical images with SAM layer thickness. The experimental results were compared to point dipole model calculations. While a SAM of 1-dodecanethiol (DoSH) was found to strongly suppress field enhancement we find that it can be locally removed from the tip apex by deforming the molecules under load, restoring SNEM image contrast. - Highlights: • SAM of ethanethiol is used to prevent contamination of gold coated tips. • Functionalizing gold coated tips with a SAM lead to reproducible SNEM imaging. • Point dipole model agreed with the experimental results of the SNEM images. • SAM of 1-dodecanethiol was found to strongly suppress field enhancement in SNEM. • SAM of 1-dodecanethiol

  10. Study of the passive film on duplex stainless steels and its breakdown by Atomic Force Microscopy and Conductive-AFM

    Energy Technology Data Exchange (ETDEWEB)

    Souier, T.; Cousty, J. [CEA Saclay, DSM/IRAMIS/SPCSI, 91 - Gif-sur-Yvette (France); Martin, F.; Bataillon, C. [CEA Saclay, DEN/DPC/LECA, 91 - Gif-sur-Yvette (France)

    2009-07-01

    In order to characterize the local electronic properties of the passive film formed on austeno-ferritic stainless steel (Uranus 50), its electric resistance has been measured by using a Current-Sensing Atomic Force Microscope (CSAFM). The surface topography and maps of electric current for a constant voltage bias applied between the sample and the conductive AFM tip, have been simultaneously acquired with an 80-100 nm lateral resolution. The results reveal that the passive film on both phases presents different conductive properties. The passive film covering austenite grains has a high and homogenous electrical resistance (typically 10 G{omega} under 1 V). In strong contrast, conductivity maps of the passive layer on the ferrite grains exhibit a high density of conductive spots (few 10-100 M{omega}). This suggests that it contains numerous defects resulting from a non-stoichiometric oxi-hydroxide layer. I/V curves acquired on both phases show an asymmetric shape (different from an ohmic behaviour) and are attributed to the electrical characteristic of a passive layer. However the I/V curves measured on the passive film on austenite grains are shifted by 1 V when compared to the curves obtained on ferrite grains. The origin of such differences is discussed in terms of changes in chemical compositions and/or semi-conductive properties of the passive layer growing on austenite and ferrite phases. Besides the CS-AFM measurements, the pitting corrosion process on duplex stainless steel is studied by electrochemical-AFM in chloride solutions. The obtained results show that pits initiate at a highly electric conductive zones: the ferrite/austenite interface and inside a ferrite grains. (authors)

  11. AFM study on the adsorption and aggregation behavior of dissolved humic substances on mica

    Institute of Scientific and Technical Information of China (English)

    GE; Xiaopeng

    2006-01-01

    characterization of microporous and mesoporous materials.Microporous Mesoporous Mat,2003,65(2-3):93-126[27]Heil D,Sposito G.Organic matter role in illitic soil colloids flocculation (Ⅲ):Scanning force microscopy.Soil Sci Soc Am J,1995,59(1):266-269[28]Gerin P A,Dufr(e)ne Y F.Native surface structure of natural soil particles determined by combining atomic force microscopy and X-ray photoelectron spectroscopy.Colloid Surf B-Biointerfaces,2003,28(4):295-305[29]Namjesnik-Dejanovic K,Maurice P A.Atomic force microscopy of soil and stream fulvic acids.Colloid Surf A-Physicochem Eng Asp,1997,120(1-3):77-86[30]Maurice P A,Namjesnik-Dejanovic K.Aggregate structures of sorbed humic substances observed in aqueous solution.Environ Sci Technol,1999,33(9):1538-1541[31]Wilkinson K J,Balnois E,Leppard G G,et al.Characteristic features of the major components of freshwater colloidal organic matter revealed by transmission electron and atomic force microscopy.Colloid Surf A-Physicochem Eng Asp,1999,155(2-3):287-310[32]Balnois E,Wilkinson K J,Lead J R,et al.Atomic force microscopy of humic substances:Effects of pH and ionic strength.Environ Sci Technol,1999,33(21):3911-3917[33]Plaschke M,R(o)mer J,Klenze R,et al.In situ AFM study of sorbed humic acid colloids at different pH.Colloid Surf A-Physicochem Eng Asp,1999,160(3):269-279[34]Plaschke M,R(o)mer J,Klenze R.Influence of europium (Ⅲ) on the adsorption of humic acid onto mica studied by AFM.Surf Interface Anal,2000,30(1):297-300[35]Plaschke M,Rothe J,Sch(a)fer T,et al.Combined AFM and STXM in situ study of the influence of Eu(Ⅲ) on the agglomeration of humic acid.Colloid Surf A-Physicochem Eng Asp,2002,197(1-3):245-256[36]Liu A G.Wu R C,Eschenazi E,et al.AFM on humic acid adsorption on mica.Colloid Surf A-Physicochem Eng Asp,2000,174(1-2):245-252[37]Liu Y,Wang Y X,Mo H J,et al.Effect of organic substrate on the formation of extracellular polymeric substrates in activated sludge.Environmental Chemistry (in Chinese),2004

  12. Characterization of Cr/6H-SiC(0 0 0 1) nano-contacts by current-sensing AFM

    International Nuclear Information System (INIS)

    The electrical properties and interface chemistry of Cr/6H-SiC(0 0 0 1) contacts have been studied by current-sensing atomic force microscopy (CS-AFM) and X-ray photoelectron spectroscopy (XPS). Cr layers were vapor deposited under ultrahigh vacuum onto both ex situ etched in H2 and in situ Ar+ ion-bombarded samples. The Cr/SiC contacts are electrically non-uniform. Both the measured I-V characteristics and the modeling calculations enabled to estimate changes of the Schottky barrier height caused by Ar+ bombardment. Formation of ohmic nano-contacts on Ar+-bombarded surfaces was observed.

  13. In situ Electrochemical-AFM Study of LiFePO4 Thin Film in Aqueous Electrolyte

    OpenAIRE

    Wu, Jiaxiong; Cai, Wei; Shang, Guangyi

    2016-01-01

    Lithium-ion (Li-ion) batteries have been widely used in various kinds of electronic devices in our daily life. The use of aqueous electrolyte in Li-ion battery would be an alternative way to develop low cost and environmentally friendly batteries. In this paper, the lithium iron phosphate (LiFePO4) thin film cathode for the aqueous rechargeable Li-ion battery is prepared by radio frequency magnetron sputtering deposition method. The XRD, SEM, and AFM results show that the film is composed of ...

  14. In situ QCM and TM-AFM investigations of the early stages of degradation of silver and copper surfaces

    Science.gov (United States)

    Kleber, Ch.; Hilfrich, U.; Schreiner, M.

    2007-01-01

    The early stages of atmospheric corrosion of pure copper and pure silver specimens were investigated performing in situ tapping mode atomic force microscopy (TM-AFM), in situ quartz crystal microbalance (QCM) and X-ray photoelectron spectroscopy (XPS). The information obtained by TM-AFM is the change of the topography of the sample surfaces with emphasis on the shape and lateral distribution of the corrosion products grown within the first hours of weathering. The simultaneously performed in situ QCM measurements are indicating the mass changes due to possibly occurring corrosive processes on the surface during weathering and are therefore a valuable tool for the determination of corrosion rates. Investigations were carried out in synthetic air at different levels of relative humidity (RH) with and without addition of 250 ppb SO 2 as acidifying agent. On a polished copper surface the growth of corrosion products could be observed by TM-AFM analysis at 60% RH without any addition of acidifying gases [M. Wadsak, M. Schreiner, T. Aastrup, C. Leygraf, Surf. Sci. 454-456 (2000) 246-250]. On a weathered copper surface the addition of SO 2 to the moist air stream leads to the formation of additional features as already described in the literature [M. Wadsak, M. Schreiner, T. Aastrup, C. Leygraf, Surf. Sci. 454-456 (2000) 246-250; Ch. Kleber, J. Weissenrieder, M. Schreiner, C. Leygraf, Appl. Surf. Sci. 193 (2002) 245-253]. Exposing a silver specimen to humidity leads to the degradation of the surface structure as well as to a formation of corrosion products, which could be detected by in situ QCM measurements. After addition of 250 ppb SO 2 to the moist gas stream an increase of the formed feature's volume on the silver surface could be observed by TM-AFM measurements. The results obtained additionally from the in situ QCM measurements confirm the influence of SO 2 due to a further increase of the mass of the formed corrosion layer (and therefore an increase of the

  15. Addressing potent single molecule AFM study in prediction of swelling and dissolution rate in polymer matrix tablets

    OpenAIRE

    Sovány, Tamás; Pintyé-Hodi, Klára; Govedarica, Biljana; Muševič, Igor; Baumgartner, Saša; Srčič, Stanko; Škarabot, Miha

    2015-01-01

    Our goal was to understand and thus be able to predict the swelling behavior of xanthan matrix tablets in 28 media of various pH and ionic strengths using data obtained from single xanthan molecules and films 29 with atomic force microscopy. 30 Imaging was performed in 1-butanol using contact mode AFM in order to characterize single xanthan 31 chains prepared from various solutions. Image analysis was used to calculate the molecular contour, per- 32 sistence length, and radius of gyration. Na...

  16. Germ direct observation by AFM under crystallization of self-organized assemblies of mono-protonated meso-tetraphenylporphine dimers

    Science.gov (United States)

    Udal'tsov, Alexander V.

    2016-08-01

    Assemblies consisting of mono-protonated meso-tetraphenylporphine dimers and water have been investigated by UV-vis spectroscopy in solution and atomic force microscopy (AFM) in thin layers. These assemblies self-organized into domains produce microcrystals in thin layer. Morphology of the microcrystals and characteristic features of crystallization germ on the top found by contact AFM indicate that surface tension of an aqueous layer on the domain generates the crystallization process. Estimations of the pressure producing the germ and bulk modulus (Bm) of microcrystals give 26.3±2.6 MPa and 3.72 GPa and Bm=12.7 GPa obtained for dried thin films. The former modulus is comparable with bulk modulus of water (2.174 GPa) that implies liquid crystals formation. Absorptions of longitudinal optical (LO) phonons with ћωLO=0.3761 and 0.3577 eV, which are arisen because of hole polaron moving through water, are found in the electronic spectra of the assemblies. The crystallization is suggested to occur due to Zundel cation (H5O2+) operation like the water-porphyrin matrix self-organization found earlier.

  17. Three-channel false colour AFM images for improved interpretation of complex surfaces: A study of filamentous cyanobacteria

    International Nuclear Information System (INIS)

    Imaging signals derived from the atomic force microscope (AFM) are typically presented as separate adjacent images with greyscale or pseudo-colour palettes. We propose that information-rich false-colour composites are a useful means of presenting three-channel AFM image data. This method can aid the interpretation of complex surfaces and facilitate the perception of information that is convoluted across data channels. We illustrate this approach with images of filamentous cyanobacteria imaged in air and under aqueous buffer, using both deflection-modulation (contact) mode and amplitude-modulation (tapping) mode. Topography-dependent contrast in the error and tertiary signals aids the interpretation of the topography signal by contributing additional data, resulting in a more detailed image, and by showing variations in the probe-surface interaction. Moreover, topography-independent contrast and topography-dependent contrast in the tertiary data image (phase or friction) can be distinguished more easily as a consequence of the three dimensional colour-space.

  18. Enhancing local absorption within a gold nano-sphere on a dielectric surface under an AFM probe

    Science.gov (United States)

    Talebi Moghaddam, Sina; Ertürk, Hakan; Mengüç, M. Pınar

    2016-07-01

    This study considers enhancing localized absorption by a gold nanoparticle (NP) placed over a substrate where an atomic force microscope (AFM) tip is in close proximity of the particle. The gold NP and AFM tip are interacting with a surface evanescent wave, resulting a near-field coupling between the tip and NP and consequently enhances the absorption. This concept can be used for selective heating of NPs placed over a surface that enables precise manufacturing at nanometer scales. Different tip positions are considered to identify the optimal tip location and the corresponding enhancement limits. The effects of these interactions on the absorption profiles of dielectric core/gold shell NPs are also studied. It is observed that using core-shell nanoparticles with a dielectric core leads to further enhancement of the absorption efficiency and a more uniform distribution of absorption over the shell. Discrete dipole approximation coupled with surface interactions (DDA-SI) is employed throughout the study, and it is vectorized to improve its computational efficiency.

  19. Evaluating interaction forces between BSA and rabbit anti-BSA in sulphathiazole sodium, tylosin and levofloxacin solution by AFM

    Science.gov (United States)

    Wang, Congzhou; Wang, Jianhua; Deng, Linhong

    2011-11-01

    Protein-protein interactions play crucial roles in numerous biological processes. However, it is still challenging to evaluate the protein-protein interactions, such as antigen and antibody, in the presence of drug molecules in physiological liquid. In this study, the interaction between bovine serum albumin (BSA) and rabbit anti-BSA was investigated using atomic force microscopy (AFM) in the presence of various antimicrobial drugs (sulphathiazole sodium, tylosin and levofloxacin) under physiological condition. The results show that increasing the concentration of tylosin decreased the single-molecule-specific force between BSA and rabbit anti-BSA. As for sulphathiazole sodium, it dramatically decreased the specific force at a certain critical concentration, but increased the nonspecific force as its concentration increasing. In addition, the presence of levofloxacin did not greatly influence either the specific or nonspecific force. Collectively, these results suggest that these three drugs may adopt different mechanisms to affect the interaction force between BSA and rabbit anti-BSA. These findings may enhance our understanding of antigen/antibody binding processes in the presence of drug molecules, and hence indicate that AFM could be helpful in the design and screening of drugs-modulating protein-protein interaction processes.

  20. Impact of galactosylceramides on the nanomechanical properties of lipid bilayer models: an AFM-force spectroscopy study.

    Science.gov (United States)

    Gumí-Audenis, Berta; Sanz, Fausto; Giannotti, Marina I

    2015-07-21

    Galactosylceramides (GalCer) are glycosphingolipids bound to a monosaccharide group, responsible for inducing extensive hydrogen bonds that yield their alignment and accumulation in the outer leaflet of the biological membrane together with cholesterol (Chol) in rafts. In this work, the influence of GalCer on the nanomechanical properties of supported lipid bilayers (SLBs) based on DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine) and DLPC (1,2-didodecanoyl-sn-glycero-3-phosphocoline) as model systems was assessed. Phosphatidylcholine (PC):GalCer SLBs were characterized by means of differential scanning calorimetry (DSC) and atomic force microscopy (AFM), in both imaging and force spectroscopy (AFM-FS) modes. Comparing both PC systems, we determined that the behaviour of SLB mixtures is governed by the PC phase-like state at the working temperature. While a phase segregated system is observed for DLPC:GalCer SLBs, GalCer are found to be dissolved in DPPC SLBs for GalCer contents up to 20 mol%. In both systems, the incorporation of GalCer intensifies the nanomechanical properties of SLBs. Interestingly, segregated domains of exceptionally high mechanical stability are formed in DLPC:GalCer SLBs. Finally, the role of 20 mol% Chol in GalCer organization and function in the membranes was assessed. Both PC model systems displayed phase segregation and remarkable nanomechanical stability when GalCer and Chol coexist in SLBs. PMID:26058499

  1. Measurement of cluster-cluster interaction in liquids by deposition and AFM of silicon clusters onto HOPG surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Galinis, Gediminas; Torricelli, Gauthier; Akraiam, Atea; Haeften, Klaus von, E-mail: kvh6@le.ac.uk [University of Leicester, Department of Physics and Astronomy (United Kingdom)

    2012-08-15

    We have investigated the interaction and aggregation of novel fluorescent silicon nanoclusters in liquids by measuring the size distribution of dried clusters on graphite. The clusters were produced by gas aggregation and co-deposition with a beam of water vapour. Drops of the solutions were placed on freshly cleaved highly oriented pyrolitic graphite, subsequently vacuum dried and investigated by atomic force microscopy (AFM) in ultra high vacuum. The AFM images show single clusters and agglomerates. The height distributions are Gaussian-shaped with average heights of 1 nm and widths of 1 nm. The heights never exceed 3 nm. In some regions a second cluster layer is observed. In all samples the separation between first and second layers is larger than the separation between the first layer and the graphite substrate, which we attribute to a stronger interaction between clusters and surface than the cluster self-interaction. We conclude that the separation between first and second layer represents a much better fingerprint of the original size distribution of the clusters in solution than the height of the first layer. The observation of a second cluster layer is important for using silicon clusters as building blocks for cluster-assembled materials.

  2. Measurement of the friction coefficient of a fluctuating contact line using an AFM-based dual-mode mechanical resonator

    International Nuclear Information System (INIS)

    A dual-mode mechanical resonator using an atomic force microscope (AFM) as a force sensor is developed. The resonator consists of a long vertical glass fiber with one end glued onto a rectangular cantilever beam and the other end immersed through a liquid—air interface. By measuring the resonant spectrum of the modified AFM cantilever, one is able to accurately determine the longitudinal friction coefficient ζv along the fiber axis associated with the vertical oscillation of the hanging fiber and the traversal friction coefficient ζh perpendicular to the fiber axis associated with the horizontal swing of the fiber around its joint with the cantilever. The technique is tested by measurement of the friction coefficient of a fluctuating (and slipping) contact line between the glass fiber and the liquid interface. The experiment verifies the theory and demonstrates its applications. The dual-mode mechanical resonator provides a powerful tool for the study of the contact line dynamics and the rheological property of anisotropic fluids. (special topic — non-equilibrium phenomena in soft matters)

  3. Synthesis of polymer nano-brushes by self-seeding method and study of various morphologies by AFM

    Science.gov (United States)

    Agbolaghi, S.; Abbaspoor, S.; Abbasi, F.

    2016-11-01

    Polymer brushes due to their high sensitivity to environmental changes are the best and newest means for developing the responsive materials. Polymer nano-brushes consisting various surface morphologies and uniformly distributed amorphous grafted chains were synthesized via single-crystal growth procedure. Poly(ethylene glycol)- b-polystyrene (PEG- b-PS) and poly(ethylene glycol)- b-poly(methyl methacrylate) (PEG- b-PMMA) block copolymers were prepared by atom transfer radical polymerization (ATRP). On the basis of various height differences, phase regions were detectable through atomic force microscopy (AFM NanoscopeIII). The novelty of this work is developing and characterizing the random and intermediate single-co-crystals. Besides, some other sorts of brush-covered single crystals like homo-brush and matrix-dispersed mixed-brushes were involved just for comparing the distinct morphologies. The intermediate (neither matrix-dispersed nor random) single-co-crystals were detectable through their thickness fluctuations in AFM height profiles. On the contrary, the random single-co-crystals were verified through comparing with their corresponding homopolymer and homo-brush single crystals. The growth fronts of (120), (240), (200) and (040) were detected by electron diffraction of transmission electron microscope.

  4. Molecular shape and binding force of Mycoplasma mobile's leg protein Gli349 revealed by an AFM study

    Energy Technology Data Exchange (ETDEWEB)

    Lesoil, Charles [Department of Life Science, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Nagatsutacho 4259, Midori-ku, Yokohama 226-8501 (Japan); Nonaka, Takahiro [Department of Biology, Graduate School of Science, Osaka City University, Sumiyoshi-ku, Osaka 558-8585 (Japan); Sekiguchi, Hiroshi; Osada, Toshiya [Department of Life Science, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Nagatsutacho 4259, Midori-ku, Yokohama 226-8501 (Japan); Miyata, Makoto [Department of Biology, Graduate School of Science, Osaka City University, Sumiyoshi-ku, Osaka 558-8585 (Japan); Afrin, Rehana [Department of Life Science, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Nagatsutacho 4259, Midori-ku, Yokohama 226-8501 (Japan); Biofrontier Center, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Nagatsutacho 4259, Midori-ku, Yokohama 226-8501 (Japan); Ikai, Atsushi, E-mail: ikai.a.aa@m.titech.ac.jp [Department of Life Science, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Nagatsutacho 4259, Midori-ku, Yokohama 226-8501 (Japan)

    2010-01-15

    Recent studies of the gliding bacteria Mycoplasma mobile have identified a family of proteins called the Gli family which was considered to be involved in this novel and yet fairly unknown motility system. The 349 kDa protein called Gli349 was successfully isolated and purified from the bacteria, and electron microscopy imaging and antibody experiments led to the hypothesis that it acts as the 'leg' of M. mobile, responsible for attachment to the substrate as well as for gliding motility. However, more precise evidence of the molecular shape and function of this protein was required to asses this theory any further. In this study, an atomic force microscope (AFM) was used both as an imaging and a force measurement device to provide new information about Gli349 and its role in gliding motility. AFM images of the protein were obtained revealing a complex structure with both rigid and flexible parts, consistent with previous electron micrographs of the protein. Single-molecular force spectroscopy experiments were also performed, revealing that Gli349 is able to specifically bind to sialyllactose molecules and withstand unbinding forces around 70 pN. These findings strongly support the idea that Gli349 is the 'leg' protein of M. mobile, responsible for binding and also most probably force generation during gliding motility.

  5. Molecular shape and binding force of Mycoplasma mobile's leg protein Gli349 revealed by an AFM study

    International Nuclear Information System (INIS)

    Recent studies of the gliding bacteria Mycoplasma mobile have identified a family of proteins called the Gli family which was considered to be involved in this novel and yet fairly unknown motility system. The 349 kDa protein called Gli349 was successfully isolated and purified from the bacteria, and electron microscopy imaging and antibody experiments led to the hypothesis that it acts as the 'leg' of M. mobile, responsible for attachment to the substrate as well as for gliding motility. However, more precise evidence of the molecular shape and function of this protein was required to asses this theory any further. In this study, an atomic force microscope (AFM) was used both as an imaging and a force measurement device to provide new information about Gli349 and its role in gliding motility. AFM images of the protein were obtained revealing a complex structure with both rigid and flexible parts, consistent with previous electron micrographs of the protein. Single-molecular force spectroscopy experiments were also performed, revealing that Gli349 is able to specifically bind to sialyllactose molecules and withstand unbinding forces around 70 pN. These findings strongly support the idea that Gli349 is the 'leg' protein of M. mobile, responsible for binding and also most probably force generation during gliding motility.

  6. AFM study of growth of Bi2Sr2-xLaxCuO6 thin films

    International Nuclear Information System (INIS)

    c-axis-oriented Bi2Sr1.6La0.4CuO6 thin films deposited on flat planes of (100)SrTiO3, (100)LaAlO3 and (100)MgO substrates and vicinal planes (off-angle ∼ 6 deg.) of SrTiO3 substrates by RF magnetron sputtering were studied by atomic force microscopy (AFM). Tc of these films reached 29 K. Film thickness ranged from 15 nm to 600 nm. Two typical growth modes have been observed. AFM images of thin films on flat planes of substrates showed a terraced-island growth mode. By contrast, Bi-2201 thin films on vicinal planes of substrates showed a step-flow growth mode. The growth unit is a half-unit-cell in the c-axis for both growth modes. No example of spiral growth, which was thought to be the typical structure of YBCO thin films, was found in either of these kinds of thin films. (author)

  7. Implementation of a four quadrant optic fibre bundle as a deflection sensor to get rid of heat sources in an AFM head

    International Nuclear Information System (INIS)

    In the frame of developing a thermally passive atomic force microscope head, a new kind of 2D displacement sensor based on a four quadrant optic fibre bundle has been implemented. The aim is to replace the quad cell photodiode used in the optical beam deflection method to detect cantilever deflection. The use of the bundle as a position sensor has already been modelled and experimentally evaluated in a previous work. This article reports on the implementation of the bundle as a deflection sensor for atomic force microscopy. The main motivation for such a development was to reduce the heat sources in the instrument. To reach this goal the photodiode and its conditioning circuit used for the measurement of cantilever deflection has been externalized from the AFM head. For the same reason, the laser diode and its electronic driver have been deported using optic fibre. To test the AFM head prototype in real conditions, approach curves and AFM images have been performed. The results show that the bundle is very well suited for AFM applications that require very low heat sources such as metrological AFM where each error source has to be managed. (paper)

  8. Absorption Spectroscopy and Imaging from the Visible through Mid-IR with 20 nm Resolution Using AFM probes

    Science.gov (United States)

    Centrone, Andrea

    2015-03-01

    Correlated nanoscale composition and optical property maps are important to engineer nanomaterials in applications ranging from photovoltaics to sensing and therapeutics. Wavelengths (λs) from the visible to near-IR probe electronic transitions in materials, providing information regarding band gap and defects while light in mid-IR probes vibrational transitions and provide chemical composition. However, light diffraction limits the lateral resolution of conventional micro-spectroscopic techniques to approximately λ/2, which is insufficient to image nanomaterials. Additionally, the λ-dependent resolution impedes direct comparison of spectral maps from different spectral ranges. Photo Thermal Induced Resonance (PTIR) is a novel technique that circumvents light diffraction by employing an AFM tip as a local detector for measuring light absorption with λ-independent nanoscale resolution. Our PTIR setup combines an AFM microscope with three lasers providing λ-tunability from 500 nm to 16000 nm continuously. The AFM tip transduces locally the sample thermal expansion induced by light absorption into large cantilever oscillations. Local absorption spectra (electronic or vibrational) and maps are obtained recording the amplitude of the tip deflection as a function of λ and position, respectively. The working principles of the PTIR technique will be described first, and nano-patterned polymer samples will be used to evaluate its lateral resolution, sensitivity and linearity. Results show that the PTIR signal intensity is proportional to the local absorbed energy suggesting applicability of this technique for quantitative chemical analysis at nanoscale, at least for thin (less than 1000 nm thick) samples. Additionally, a λ-independent resolution as high as 20 nm is demonstrated across the whole spectral range. In the second part of the talk, PTIR will be applied to image the dark plasmonic resonance of gold Asymmetric Split Ring Resonators (A-SRRs) in the mid

  9. Computational Fracture Analysis of an AFM-Specimen under Mixed Mode Loading Conditions%AFM试样复合加载下的计算断裂分析

    Institute of Scientific and Technical Information of China (English)

    朱莉; 李庆芬; F. G. Buchholz

    2011-01-01

    Fracture processes in ship-building structures are in many cases ora 3-D character. A finite element (FE) model of an all fracture mode (AFM) specimen was built for the study of 3-D mixed mode crack fracture behavior including modes Ⅰ, Ⅱ, and Ⅲ. The stress intensity factors (SIFs) were calculated by the modified virtual crack closure integral (MVCCI) method, and the crack initiation angle assessment was based on a recently developed 3-D fracture criterion-the Richard criterion. It was shown that the FE model of the AFM-specimen is applicable for investigations under general mixed mode loading conditions, and the computational results of crack initiation angles are in agreement with some available experimental findings.Thus, the applicability of the FE model of the AFM-specimen for mixed mode loading conditions and the validity of the Richard criterion can be demonstrated.

  10. The Development of the High-Resolution Transmission Electron Microscope (HRTEM) Combined with AFM for Simultaneous Observation of Structure and Force of the Nanocontact

    Science.gov (United States)

    Shibata, Sakiko; Tanishiro, Yasumasa; Kondo, Yukihito; Minoda, Hiroki; Takayanagi, Kunio

    2004-03-01

    A high-resolution transmission electron microscope combined with an atomic force microscope (HRTEM-AFM) has been developed. It enables us to observe mechanical force and atomic structure of nanowires formed at the nanocontact simultaneously. And the self-sensing piezoresistive cantilever is used as an AFM probe in the HRTEM-AFM. It has high spatial resolution of 0.2nm and high force sensitivity of sub-nN. The HRTEM has also ability to work on ultra high vacuum(UHV) which is necessary to keep the nanocontact clean. The present system could never be developed without total redesigning of the goniometer stage of UHV-TEM which operates at 10-8 Pa.

  11. Small amplitude Dynamic AFM: quantifying interactions with different tip detection and excitation schemes in presence of additional resonances

    CERN Document Server

    Costa, Luca

    2014-01-01

    Quantifying the tip-sample interaction at the nanoscale in Amplitude Modulation mode AFM is challenging, especially when measuring in liquids. Here, we derive formulas for the tip-sample conservative and dissipative interactions and investigate the effect that spurious resonances have on the measured interaction. Both direct and acoustic excitation are considered. We also highlight the differences between measuring directly the tip position or the cantilever deflection. We show that, when probing the tip-sample forces, the acoustically excited cantilever behavior is insensitive to spurious resonances as long as the measured signal corresponds to the tip position, or if the excitation force is correctly taken into account. Since the effective excitation force may depend on the presence of such spurious resonances, we consider the cases where the frequency is kept constant during the measurement so that the proportionality between excitation signal and actual excitation force is kept constant. With the present ...

  12. DEVELOPPEMENTS METHODOLOGIQUES POUR LA CARACTERISATION DES COMPLEXES ADN-PROTEINES PAR AFM ET ETUDE DES INTERACTIONS ADN-KU.

    OpenAIRE

    Landousy, Fabrice

    2006-01-01

    La microscopie à force atomique (AFM) ouvre de nouvelles perspectives dans l'étude des interactions ADN-protéines. Mon travail a consisté à développer de nouvelles méthodologies pour contrôler l'adsorption de l'ADN sur les surfaces et permettre l'étude en liquide de la dynamique des complexes. Nous avons caractérisé les interactions entre l'ADN et la surface de mica. Nous proposons un modèle simple pour décrire les interactions électrostatiques en solution entre l'ADN et le mica, en considéra...

  13. Morphology of ablation craters generated by ultra-short laser pulses in dentin surfaces: AFM and ESEM evaluation

    International Nuclear Information System (INIS)

    In this study, the surface morphology and structure of dentin after ablation by ultra-short pulses were evaluated using environmental scanning electron microscopy (ESEM) and atomic force microscopy (AFM). The dentin specimens examined were irradiated by a chirped-pulse-amplification (CPA) Ti:sapphire laser (800 nm) and the optimal conditions for producing various nanostructures were determined. Based on the ESEM results, it was possible to identify an energy density range as the ablation threshold for dentin. The laser-induced damage was characterized over the fluence range 1.3-2.1 J/cm2. The results demonstrate that by selecting suitable parameters one can obtain efficient dentin surface preparation without evidence of thermal damage, i.e., with minimized heat affected zones and reduced collateral damage, the latter being normally characterized by formation of microcracks, grain growth and recrystallization in the heat affected zones.

  14. An active reference spring array for in-situ calibration of the normal spring constant of AFM cantilevers

    Science.gov (United States)

    Gao, S.; Brand, U.; Hahn, S.; Hiller, K.

    2015-05-01

    In this paper the concept of an "active reference spring array (ARSA)" for the AFM cantilever normal spring constant calibration is proposed. The ARSA with nominal stiffness varying from 0.4 N/m to 150 N/m will be available on these arrays with the aim to calibrate the normal stiffness of cantilevers ranging from 0.04 N/m to 1500 N/m. The fabrication process of the MEMS ARSA on basis of the Bonding Deep RIE technology developed at Chemnitz University of Technology is reported. A first characterization of the MEMS and the traceable determination of the stiffness of the MEMS suspending system have been realized. First experimental results compare very well with the Finite Element (FE) simulation of the numerical design, and prove the feasibility of the proposed concept.

  15. Polymer coatings on conductive polypyrroles surface characterization by XPS, ToFSIMS, inverse gas chromatography and AFM

    International Nuclear Information System (INIS)

    The study of PMMA adsorption on some conducting polypyrroles (PPys) using a variety of surface analytical techniques is reported. PMMA adsorption was monitored by X-ray photoelectron spectroscopy (XPS), time of flight secondary ion mass spectroscopy (ToF-SIMS) and inverse gas chromatography (IGC). XPS and ToF-SIMS permit to determine the surface composition of PMMA-coated PPy surfaces vs the solvent nature, temperature and the PPy dopant anion. Both techniques show that acid-base interactions may govern PMMA adsorption. IGC was used to determine the coating morphology by monitoring the surface energy of the coated PPy powders. It is suggested that homogeneity of PMMA coatings increases with decreasing solvent power. Preliminary atomic force microscopy (AFM) results on PMMA films cast on flat PPy surfaces confirm the IGC observation. copyright 1996 American Institute of Physics

  16. AFM-investigation of differently treated Ti-surfaces with respect to their usability for dental implants

    Energy Technology Data Exchange (ETDEWEB)

    Wille, Sebastian; Adelung, Rainer [Funktionale Nanomaterialien, Institut fuer Materialwissenschaft, CAU Kiel Kaiserstr. 2 24143 Kiel (Germany); Yang, Bin [Klinik fuer Zahnaerztliche Prothetik, Propaedeutik und Werkstoffkunde, Arnold-Heller-Strasse 16, 24105 Kiel (Germany); Groessner-Schreiber, Birte [Klinik fuer Zahnerhaltungskunde und Parodontologie, Arnold-Heller-Str. 16, 24105 Kiel (Germany)

    2008-07-01

    Microbial adherence to dental implant surfaces is one initiating step in the formation of plaque and is considered to be an important event in the pathogenesis of peri-implant disease. Besides good connective tissue adhesion in the transmucosal part of an implant, titanium implants exposed to the oral cavity require surface modification to inhibit the adherence of oral bacteria. Surface roughness and chemical composition of the implant surface were found to have a significant impact on plaque formation. The aim of the present study was to examine bacterial adherence of differently modified potential implant surfaces. Therefore the surface roughness was decreased and for example a thin ceramic or composite layer of antibacterial material was deposited on abutment surface by sputtering. We analyze the new surface with AFM to control the roughness. For further characterization contact angle measurements were carried out. Biocompatibility and antibacterial effects will be determined in cooperation with the dental clinic at the University Kiel.

  17. Utilization of profilometry, SEM, AFM and contact angle measurements in describing surfaces of plastic floor coverings and explaining their cleanability

    Science.gov (United States)

    Kuisma, R.; Pesonen-Leinonen, E.; Redsven, I.; Kymäläinen, H.-R.; Saarikoski, I.; Sjöberg, A.-M.; Hautala, M.

    2005-06-01

    The tendency to soil and cleanability of ten commercial plastic floor coverings: eight vinyl (PVC) floor coverings, one vinyl composite tile and one plastic composite tile, were examined. Floor coverings were soiled with inorganic, organic and biological soil. The cleanability was measured both by bioluminescence of ATP (adenosine triphosphate) and colorimetrically. The surface topography was studied by AFM, SEM and with a profilometer. From the 2D- and 3D-profilometric measurements several characteristic parameters of the surface profiles were extracted. The tendency to soil and cleanability were compared with the characteristics of the surface. A weak correlation was found between roughness and soilability but no correlation between roughness and cleanability. Roughness had no correlation with contact angle.

  18. The physics of pulling polyproteins: a review of single molecule force spectroscopy using the AFM to study protein unfolding

    Science.gov (United States)

    Hughes, Megan L.; Dougan, Lorna

    2016-07-01

    One of the most exciting developments in the field of biological physics in recent years is the ability to manipulate single molecules and probe their properties and function. Since its emergence over two decades ago, single molecule force spectroscopy has become a powerful tool to explore the response of biological molecules, including proteins, DNA, RNA and their complexes, to the application of an applied force. The force versus extension response of molecules can provide valuable insight into its mechanical stability, as well as details of the underlying energy landscape. In this review we will introduce the technique of single molecule force spectroscopy using the atomic force microscope (AFM), with particular focus on its application to study proteins. We will review the models which have been developed and employed to extract information from single molecule force spectroscopy experiments. Finally, we will end with a discussion of future directions in this field.

  19. Nanodimentional Aggregates In Organic Monolayers Studied With Atomic Force Microscopy (AFM) And Fluorescence Lifetime Imaging Microscopy (FLIM)

    Science.gov (United States)

    Ivanov, George R.; Burov, Julian

    2007-04-01

    Organic monolayers from a fluorescently labeled phospholipid (DPPE-NBD) were deposited on solid supports under special conditions that form stable nanometer wide bilayers cylinders that protrude from the monolayer. This molecule was frequently used in sensor applications due to its sensitivity to environment changes. The proposed configuration should provide both fast response times (ultra thin film) and increased sensitivity (greatly increased surface area). AFM can clearly distinguish between the different phases. The height difference between the solid-expanded and the liquid-expanded phase was measured to be 1.4 nm while the bilayer thickness was 5.6 nm. The solid domains show a 20 % decrease in fluorescence lifetime in comparison to the monolayer as measured by FLIM. This difference in lifetimes is explained in the model of fluorescence self quenching in the solid phase due to the molecules being closer to each other.

  20. Wavelength dependent laser-induced etching of Cr–O doped GaAs: Morphology studies by SEM and AFM

    Indian Academy of Sciences (India)

    B Joshi; S S Islam; H S Mavi; Vinita Kumari; T Islam; A K Shukla; Harsh

    2009-02-01

    The laser induced etching of semi-insulating GaAs $\\langle$100$\\rangle$ is carried out to create porous structure under super- and sub-bandgap photon illumination (ℎν). The etching mechanism is different for these separate illuminations where defect states play the key role in making distinction between these two processes. Separate models are proposed for both the cases to explain the etching efficiency. It is observed that under sub-bandgap photon illumination the etching process starts vigorously through the mediation of intermediate defect states. The defect states initiate the pits formation and subsequently pore propagation occurs due to asymmetric electric field in the pore. Formation of GaAs nanostructures is observed using scanning electron (SEM) and atomic force microscopy (AFM).

  1. STM/AFM investigations of β-MoTe 2, α-MoTe 2 and WTe 2

    Science.gov (United States)

    Hla, S. W.; Marinković, V.; Prodan, A.; Muševič, I.

    1996-05-01

    There is controversy in the literature concerning the correspondence of STM images to the atomic positions on some transition metal layered dichalcogenide surfaces. Although it is difficult to differentiate between metal and chalcogen atoms in these crystals with hexagonal symmetry, like α-MoTe 2, this can be done in cases of β-MoTe 2 and WTe 2 with changed metal-Te distances. Contrary to published STM images of WTe 2 our STM images of β-MoTe 2 show details which resemble the structure of both corrugated topmost Te and metal layers. The d z 2 orbitals of metal atoms protruding vertically upward may provide the tunneling current in this case. The detection of surface or sub-surface atoms depends on the tip electronic condition. The STM results are compared with those from AFM.

  2. On the use of CR-39 PNTD with AFM analysis in measuring proton-induced target fragmentation particles

    Energy Technology Data Exchange (ETDEWEB)

    Kodaira, Satoshi, E-mail: koda@nirs.go.jp [Radiation Measurement Research Section, National Institute of Radiological Sciences, Chiba 263-8555 (Japan); Konishi, Teruaki; Kitamura, Hisashi; Kurano, Mieko; Kawashima, Hajime; Uchihori, Yukio [Radiation Measurement Research Section, National Institute of Radiological Sciences, Chiba 263-8555 (Japan); Nishio, Teiji [Particle Therapy Division, Research Center for Innovative Oncology, National Cancer Center, Chiba 277-8577 (Japan); Yasuda, Nakahiro [Research Institute of Nuclear Engineering, University of Fukui, Fukui 914-0055 (Japan); Ogura, Koichi [College of Industrial Technology, Nihon University, Chiba 275-8576 (Japan); Sihver, Lembit [Nuclear Engineering, Applied Physics, Chalmers University of Technology, SE-412 96 Göteborg (Sweden); Benton, Eric R. [Department of Physics, Oklahoma State University, 74074 OK (United States)

    2015-04-15

    In addition to energy loss by ionization process, protons of energy >∼50 MeV, such as those used in proton radiotherapy, can undergo nuclear interactions with nuclei of Z > 1, resulting in the production of short range (<20 μm), high-LET (linear energy transfer) target fragment particles. One of the few methods to detect these short-range particles is by means of CR-39 plastic nuclear track detector (PNTD) analyzed with an atomic force microscope (AFM). However, due to the LET-dependent angular sensitivity of CR-39 PNTD, multiple detectors exposed at a range of incident angles to the primary proton beam, must be analyzed in order to accurately determine the LET spectrum, absorbed dose and dose equivalent. The LET spectrum of 160 MeV proton-induced secondary particles was experimentally measured with CR-39 PNTDs, which were exposed at six different incident angles to take into account the intrinsic sensitivity of the critical angle for track registration. The irradiated detectors were chemically processed to remove a 1 μm thick volume of CR-39 PNTD. The measured LET range of short range tracks was from 15 keV/μm up to 1.5 MeV/μm. The absorbed dose contribution (D{sub s}/D{sub p}) from secondary particles to primary proton dose was ∼1%, while the dose equivalent contribution (H{sub s}/D{sub p}) was found to be ∼20%. Analysis of CR-39 PNTD by AFM yielded ∼60% higher value for absorbed dose compared to standard optical microscopy analysis.

  3. Coating of AFM probes with aquatic humic and non-humic NOM to study their adhesion properties

    KAUST Repository

    Aubry, Cyril

    2013-06-01

    Atomic force microscopy (AFM) was used to study interaction forces between four Natural Organic Matter (NOM) samples of different physicochemical characteristics and origins and mica surface at a wide range of ionic strength. All NOM samples were strongly adsorbed on positively charged iron oxide-coated silica colloidal probe. Cross-sectioning by focused ion beam milling technique and elemental mapping by energy-filtered transmission electron microscopy indicated coating completeness of the NOM-coated colloidal probes. AFM-generated force-distance curves were analyzed to elucidate the nature and mechanisms of these interacting forces. Electrostatics and steric interactions were important contributors to repulsive forces during approach, although the latter became more influential with increasing ionic strength. Retracting force profiles showed a NOM adhesion behavior on mica consistent with its physicochemical characteristics. Humic-like substances, referred as the least hydrophilic NOM fraction, i.e., so called hydrophobic NOM, poorly adsorbed on hydrophilic mica due to their high content of ionized carboxyl groups and aromatic/hydrophobic character. However, adhesion force increased with increasing ionic strength, suggesting double layer compression. Conversely, polysaccharide-like substances showed high adhesion to mica. Hydrogen-bonding between hydroxyl groups on polysaccharide-like substances and highly electronegative elements on mica was suggested as the main adsorption mechanism, where the adhesion force decreased with increasing ionic strength. Results from this investigation indicated that all NOM samples retained their characteristics after the coating procedure. The experimental approach followed in this study can potentially be extended to investigate interactions between NOM and clean or fouled membranes as a function of NOM physicochemical characteristics and solution chemistry. © 2013 Elsevier Ltd.

  4. Progress of AFM Technology in the Study of Cells%原子力显微镜技术在细胞研究中的进展

    Institute of Scientific and Technical Information of China (English)

    刘波; 马立; 谢炜; 张志伟

    2013-01-01

    原子力显微镜(AFM)是生物显微技术的一个重要组成部分,可实现液体环境下活细胞高分辨率的成像与操作,为细胞生物学研究提供了新的方法.近年来,AFM已经逐渐发展成为集样品成像、力测量及操作等功能于一体的多功能生物细胞研究平台,在细胞研究中得到了广泛的应用.在简要介绍AFM组成与工作原理的基础上,详细阐述了近年来基于AFM成像与力谱技术的细胞研究的发展状况.针对AFM本身所存在的不足,介绍了AFM与其他技术相结合的研究成果,并对AFM在生物细胞研究中未来的发展方向进行了展望.%Atomic force microscopy (AFM) is an important part of the biological microscope technology, which can realize high resolution imaging and manipulating of living cells in liquid environment, and provide a new method for the cell biology research. In recent years, AFM has gradually developed into a multi-function biological cell research platform with the functions of the sample imaging, force measurement and operation, which has been widely used in the cell research. On the basis of the brief introduction of AFM configuration and working principle, the cell research developments based on the AFM imaging and force spectrum technology are discussed in detail. For covering the shortages of the AFM, the research results of AFM combined with other technologies are introduced, and the development trends of the AFM in the cell biology research are prospected.

  5. Simulated structure and imaging of NTCDI on Si(1 1 1)-7 × 7 : a combined STM, NC-AFM and DFT study

    OpenAIRE

    Jarvis, Samuel Paul; Sweetman, Adam; Lekkas, Ioannis; Champness, Neil R.; Kantorovich, Lev; Moriarty, Philip

    2015-01-01

    The adsorption of naphthalene tetracarboxylic diimide (NTCDI) on Si(1 1 1)-7 × 7 is investigated through a combination of scanning tunnelling microscopy (STM), noncontact atomic force microscopy (NC-AFM) and density functional theory (DFT) calculations. We show that NTCDI adopts multiple planar adsorption geometries on the Si(1 1 1)-7 × 7 surface which can be imaged with intramolecular bond resolution using NC-AFM. DFT calculations reveal adsorption is dominated by covalent bond formation bet...

  6. Ambient AFM investigation of nanostructures on CaF2 single crystals induced by slow highly charged Ar and Xe ions

    International Nuclear Information System (INIS)

    Full text: Atomic force microscopy (AFM) is a convenient method to study nanostructures on insulating atomically flat surfaces. We have irradiated freshly cleaved CaF2 (111) surfaces with slow (v 2 are known to be stable under atmospheric conditions at room temperature. Topographic AFM images show the generation of nanosized hillocks protruding from the surface. The number of hillocks per unit area stays in good agreement with the applied ion flux. We discuss the role of potential energy as well as compare our results with observations for swift heavy ion irradiations of CaF2 single crystals. (author)

  7. AFM功能化成像与分子识别研究进展%Research progress of AFM functionalized imaging and molecular recognition

    Institute of Scientific and Technical Information of China (English)

    徐小媛; 叶学松

    2012-01-01

    In the past decades, AFM have great advances in high resolution molecular imaging and single molecule detection applications. AFM single molecular force 8pectroscopy(SMFS)are available to explore polymer structural changes, molecular identification of bio-signal transmission or protein folding process and unfolding process,the evidence of the relation between structural changes and functions is provided. Some progresses are mentioned such as using AFM in funcuonalization decoration, in locating using SMFS surface protein and polysaccharide and their elasticity. Prospects are also provided concerning future work and difficulties in AFM application.%在过去的几十年间,AFM在高分辨率分子成像与单分子检测上的应用得到了很大进展.AFM单分子力光谱学(SMFS)模式可以用于研究聚合物结构变化,生物信号传导过程的分子识别或蛋白折叠过程.提出了使用AFM进行功能化修饰和SMFS用于定位表面蛋白与多糖,研究表面蛋白的分子延展性的一些进展,并展望了研究前景与难点.

  8. Biophysical analysis of bacterial and viral systems. A shock tube study of bio-aerosols and a correlated AFM/nanosims investigation of vaccinia virus

    Energy Technology Data Exchange (ETDEWEB)

    Gates, Sean Damien [Stanford Univ., CA (United States)

    2013-05-01

    The work presented herein is concerned with the development of biophysical methodology designed to address pertinent questions regarding the behavior and structure of select pathogenic agents. Two distinct studies are documented: a shock tube analysis of endospore-laden bio-aerosols and a correlated AFM/NanoSIMS study of the structure of vaccinia virus.

  9. Surface Pressure and Elasticity of Hydrophobin HFBII Layers on the Air-Water Interface: Rheology Versus Structure Detected by AFM Imaging

    NARCIS (Netherlands)

    Stanimirova, R.D.; Gurkov, T.D.; Kralchevsky, P.A.; Balashev, K.T.; Stoyanov, S.D.; Pelan, E.G.

    2013-01-01

    Here, we combine experiments with Langmuir trough and atomic force microscopy (AFM) to investigate the reasons for the special properties of layers from the protein HFBII hydrophobin spread on the airwater interface. The hydrophobin interfacial layers possess the highest surface dilatational and she

  10. Study of Schottky contact between Au and NiO nanowire by conductive atomic force microscopy (C-AFM): The case of surface states

    Science.gov (United States)

    Zhang, Yidong

    2015-05-01

    In this work, NiO nanowires have been synthesized by a hydrothermal reaction of NiCl2 with Na2C2O4 in the presence of ethylene glycol at 180 °C for 12 h, then calcinated at 400 °C for 2 h. The NiO nanowires were analyzed by means of scanning electron microscope (SEM), atomic force microscope (AFM), X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS). The resulting current-voltage (I-V) characteristics of the NiO nanowires exhibited a clear rectifying behavior. This rectify behavior was attributed to the formation of a Schottky contact between Au coated atomic force microscopy (AFM) tip and NiO nanowires (nano-M/SC) which was dominated by the surface states in NiO itself. Photo-assisted conductive AFM (PC-AFM) was used to demonstrate how the I-V characteristics are influenced by the surface states. Our I-V results also showed that the nano-M/SCs had a good photoelectric switching effect at reverse bias.

  11. Electrically conducting, ultra-sharp, high aspect-ratio probes for AFM fabricated by electron-beam-induced deposition of platinum

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Jason, E-mail: jason.brown@physics.ox.ac.uk [Clarendon Laboratory, Department of Physics, University of Oxford, Oxford OX1 3PU (United Kingdom); Kocher, Paul; Ramanujan, Chandra S; Sharp, David N [Clarendon Laboratory, Department of Physics, University of Oxford, Oxford OX1 3PU (United Kingdom); Torimitsu, Keiichi [NTT Basic Research Laboratories, NTT Corporation, Atsugi, 243-0198 (Japan); Ryan, John F [Clarendon Laboratory, Department of Physics, University of Oxford, Oxford OX1 3PU (United Kingdom)

    2013-10-15

    We report on the fabrication of electrically conducting, ultra-sharp, high-aspect ratio probes for atomic force microscopy by electron-beam-induced deposition of platinum. Probes of 4.0 ±1.0 nm radius-of-curvature are routinely produced with high repeatability and near-100% yield. Contact-mode topographical imaging of the granular nature of a sputtered gold surface is used to assess the imaging performance of the probes, and the derived power spectral density plots are used to quantify the enhanced sensitivity as a function of spatial frequency. The ability of the probes to reproduce high aspect-ratio features is illustrated by imaging a close-packed array of nanospheres. The electrical resistance of the probes is measured to be of order 100 kΩ. - Highlights: • Electrically conducting, ultra-sharp, high aspect-ratio probes for AFM with radius-of-curvature 4.0±±1.0 nm. • AFM probe fabrication by electron-beam-induced deposition of platinum. • Enhanced spatial resolution demonstrated through AFM of sputtered gold grains. • AFM imaging of deep clefts and recesses on a close-packed array of nanospheres.

  12. Influence of Bulk Elasticity and Interfacial Tension on the Deformation of Gelled Water-in-Oil Emulsion Droplets: An AFM Study

    NARCIS (Netherlands)

    Filip, D.; Uricanu, V.I.; Duits, M.H.G.; Agterof, W.G.M.; Mellema, J.

    2005-01-01

    We used atomic force microscopy (AFM) to study the deformation and wetting behavior of large (50-250 m) emulsion droplets upon mechanical loading with a colloidal glass probe. Our droplets were obtained from water-in-oil emulsions. By adding gelatin to the water prior to emulsification, also droplet

  13. High-resolution noncontact AFM and Kelvin probe force microscopy investigations of self-assembled photovoltaic donor–acceptor dyads

    Science.gov (United States)

    Schwartz, Pierre-Olivier; Biniek, Laure; Brinkmann, Martin; Leclerc, Nicolas; Zaborova, Elena

    2016-01-01

    Summary Self-assembled donor–acceptor dyads are used as model nanostructured heterojunctions for local investigations by noncontact atomic force microscopy (nc-AFM) and Kelvin probe force microscopy (KPFM). With the aim to probe the photo-induced charge carrier generation, thin films deposited on transparent indium tin oxide substrates are investigated in dark conditions and upon illumination. The topographic and contact potential difference (CPD) images taken under dark conditions are analysed in view of the results of complementary transmission electron microscopy (TEM) experiments. After in situ annealing, it is shown that the dyads with longer donor blocks essentially lead to standing acceptor–donor lamellae, where the acceptor and donor groups are π-stacked in an edge-on configuration. The existence of strong CPD and surface photo-voltage (SPV) contrasts shows that structural variations occur within the bulk of the edge-on stacks. SPV images with a very high lateral resolution are achieved, which allows for the resolution of local photo-charging contrasts at the scale of single edge-on lamella. This work paves the way for local investigations of the optoelectronic properties of donor–acceptor supramolecular architectures down to the elementary building block level. PMID:27335768

  14. AFM study of excimer laser patterning of block-copolymer: Creation of ordered hierarchical, hybrid, or recessed structures

    Science.gov (United States)

    Švanda, Jan; Siegel, Jakub; Švorčík, Vaclav; Lyutakov, Oleksiy

    2016-05-01

    We report fabrication of the varied range of hierarchical structures by combining bottom-up self-assembly of block copolymer poly(styrene-block-vinylpyridine) (PS-b-P4VP) with top-down excimer laser patterning method. Different procedures were tested, where laser treatment was applied before phase separation and after phase separation or phase separation and surface reconstruction. Laser treatment was performed using either polarized laser light with the aim to create periodical pattern on polymer surface or non-polarized light for preferential removing of polystyrene (PS) part from PS-b-P4VP. Additionally, dye was introduced into one part of block copolymer (P4VP) with the aim to modify its response to laser light. Resulting structures were analyzed by XPS, UV-vis and AFM techniques. Application of polarized laser light leads to creation of structures with hierarchical, recessed or hybrid geometries. Non-polarized laser beam allows pronouncing the block copolymer phase separated structure. Tuning the order of steps or individual step conditions enables the efficient reorientation of block-copolymer domain at large scale, fabrication of hierarchical, hybrid or recessed structures. The obtained structures can find potential applications in nanotechnology, photonics, plasmonics, information storage, optical devices, sensors and smart surfaces.

  15. Useful oriented immobilization of antibodies on chimeric magnetic particles: direct correlation of biomacromolecule orientation with biological activity by AFM studies.

    Science.gov (United States)

    Marciello, Marzia; Filice, Marco; Olea, David; Velez, Marisela; Guisan, José M; Mateo, Cesar

    2014-12-16

    The preparation and performance of a suitable chimeric biosensor based on antibodies (Abs) immobilized on lipase-coated magnetic particles by means of a standing orienting strategy are presented. This novel system is based on hydrophobic magnetic particles coated with modified lipase molecules able to orient and further immobilize different Abs in a covalent way without any previous site-selective chemical modification of biomacromolecules. Different key parameters attending the process were studied and optimized. The optimal preparation was performed using a controlled loading (1 nmol Ab g(-1) chimeric support) at pH 9 and a short reaction time to recover a biological activity of about 80%. AFM microscopy was used to study and confirm the Abs-oriented immobilization on lipase-coated magnetic particles and the final achievement of a highly active and recyclable chimeric immune sensor. This direct technique was demonstrated to be a powerful alternative to the indirect immunoactivity assay methods for the study of biomacromolecule-oriented immobilizations.

  16. AFM and FTIR characterization of microcrystalline Si obtained from isothermal annealing of Al/a-Si:H

    Energy Technology Data Exchange (ETDEWEB)

    Rojas-Lopez, M.; Orduna-Diaz, A.; Delgado-Macuil, R. [Centro de Investigacion en Biotecnologia Aplicada (CIBA), IPN, Tlaxcala, Tlax. 72197 (Mexico); Olvera-Hernandez, J. [Centro de Investigacion en Dispositivos Semiconductores (CIDS), BUAP, Puebla, Pue. 72570 (Mexico); Navarro-Contreras, H.; Vidal, M.A.; Saucedo, N.; Mendez-Garcia, V.H. [Instituto de Investigacion en Comunicacion Optica (IICO), UASLP, San Luis Potosi, S.L.P. 78100 (Mexico)

    2007-04-15

    Atomic force microscopy and Fourier transform infrared spectroscopy were used to investigate the morphology of the microcrystalline surface, and also the amorphous-crystalline structural transformation of a-Si:H films, isothermally annealed during several hours. Crystallization process was strongly influenced by the deposition of an Al layer on the surface of a-Si:H samples. Representative AFM images show the presence of grains, which increase in diameter with the annealing time. Relative crystallized fraction as a function of the annealing time can be described adequately by using the Avrami equation. The kinetic of this crystallization process suggest a two-dimensional growth of the Si nuclei. Fourier transform infrared measurements show the presence of an intense band near 512 cm{sup -1} associated to Si-Si bonding. We observed the relative diminishing of the intensity of the Si-H wagging mode at 694 cm{sup -1} with annealing time, suggesting effusion of hydrogen to the surface of microcrystalline films. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  17. Correlation between dislocation organization and slip bands: TEM and AFM investigations in hydrogen-containing nickel and nickel–chromium

    International Nuclear Information System (INIS)

    Various forms of the plastic deformation in single crystals are studied in pure and hydrogen-containing nickel and nickel alloys oriented for single slip [1 3 5] and strained in the stage III regime (shear strain, γ = 0.8). The heterogeneity of deformation is investigated at two distinct scales: slip bands and dislocation structures, using atomic force microscopy (AFM) and transmission electronic microscopy (TEM). Size and distribution of slip band thicknesses and geometrically necessary boundary (GNB) spacing are comparable. GNB structures both screen the long-range stress fields and decrease the mean free path of mobile dislocations, whereas equiaxed cells only impede dislocation motion through their role as obstacles. Consequently, GNB formation localizes deformation in specific slip bands. Additionally, the observed similarity between GNB spacing and equiaxed cell size suggests a correlation between these microstructural features. The impact of solid solution atoms on the inter-wall spacing is established for chromium and hydrogen. Both decrease the GNB spacing because of a decrease of the cross-slip probability and stacking fault energy, combined to a shielding effect for the later. The effect of GNB spacing on strain hardening is discussed in terms of the length scale associated with GNBs and the effect of solute content

  18. Nano-dot and nano-pit fabrication on a GaAs substrate by a pulse applied AFM

    International Nuclear Information System (INIS)

    The nano-patterning characteristics of GaAs is investigated using a pulse applied atomic force microscope (AFM). Very short range voltage pulses of micro to nano-seconds’ duration are applied to a conductive diamond-coated silicon (Si) tip in contact mode, to regulate the created feature size. The effects of pulse conditions such as pulse voltage, duration, frequency, offset voltage, anodization time, and applied tip pressure on nano-dot generation are characterized, based on the experiments. An interesting phenomenon, nano-pit creation instead of nano-dot creation, is observed when the applied pulse duration is less than 100 μs. Pulse frequency and offset voltage are also involved in nano-pit generation. The electrical spark discharge between the tip and the GaAs's surface is the most probable cause of the nano-pit creation and its generation mechanism is explained by considering the relevant pulse parameters. Nano-pits over 15 nm in depth are acquired on the GaAs substrate by adjusting the pulse conditions. This research facilitates the fabrication of more complex nano-structures on semiconductor materials since nano-dots and nano-pits could be easily made without any additional post-processes. (paper)

  19. Probing Co/Si interface behaviour by X-ray photoelectron spectroscopy (XPS) and atomic force microscopy (AFM)

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    In this work, we investigate the Co-Si reaction, the Co growth mode at room temperature, diffusion behaviour as well as morphology evolution during annealing on both H-terminated and clean Si(001) and Si(111) surfaces. From in-situ X-ray photoelectron spectroscopy (XPS) investigation, "Co-Si" reaction appears to occur on both H-terminated and clean surfaces at room temperature (RT) and the silicide crystallinity is improved upon annealing.Co growth mode on H-terminated Si surfaces occurs in a pseudo layer-by-layer manner while small close-packed island growth mode is observed on the clean Si surface. Upon annealing at different temperatures, Co atom concentration decreases versus annealing time, which in part is attributed to Co atoms inward diffusion. The diffusion behaviour on both types of surfaces demonstrates a similar trend. Morphology study using ex-situ atomic force microscopy (AFM) shows that the islands formed on Si(001) surface after annealing at 700 ℃ are elongated with growth directions alternate between the two perpendicular [(-1)10] and [110] directions. Triangular islands are observed on Si(111) surface.

  20. Integrin-specific mechanoresponses to compression and extension probed by cylindrical flat-ended AFM tips in lung cells.

    Directory of Open Access Journals (Sweden)

    Irene Acerbi

    Full Text Available Cells from lung and other tissues are subjected to forces of opposing directions that are largely transmitted through integrin-mediated adhesions. How cells respond to force bidirectionality remains ill defined. To address this question, we nanofabricated flat-ended cylindrical Atomic Force Microscopy (AFM tips with ~1 µm(2 cross-section area. Tips were uncoated or coated with either integrin-specific (RGD or non-specific (RGE/BSA molecules, brought into contact with lung epithelial cells or fibroblasts for 30 s to form focal adhesion precursors, and used to probe cell resistance to deformation in compression and extension. We found that cell resistance to compression was globally higher than to extension regardless of the tip coating. In contrast, both tip-cell adhesion strength and resistance to compression and extension were the highest when probed at integrin-specific adhesions. These integrin-specific mechanoresponses required an intact actin cytoskeleton, and were dependent on tyrosine phosphatases and Ca(2+ signaling. Cell asymmetric mechanoresponse to compression and extension remained after 5 minutes of tip-cell adhesion, revealing that asymmetric resistance to force directionality is an intrinsic property of lung cells, as in most soft tissues. Our findings provide new insights on how lung cells probe the mechanochemical properties of the microenvironment, an important process for migration, repair and tissue homeostasis.

  1. The jump-into-contact effect in biased AFM probes on dielectric films and its application to quantify the dielectric permittivity of thin layers.

    Science.gov (United States)

    Revilla, Reynier I

    2016-07-01

    The jump-into-contact (JIC) phenomenon in biased atomic force microscopy (AFM) probes on dielectric films is studied. The influence of the film thickness on the position at which the AFM tip collapses irreversibly into the sample surface was theoretically analyzed using a widely accepted analytical expression of the probe-sample electrostatic interaction force. It was demonstrated that for relatively high values of voltage (V > 10-20 V) applied between the probe and the substrate the cantilever deflection at the JIC is independent of the dielectric film thickness for thin-ultrathin layers (h thin/ultrathin dielectric films using the jump-into-contact distance. The procedure was successfully applied on thin PVD-SiO2 films, obtaining good agreement with a dielectric constant value previously reported for the same material.

  2. The jump-into-contact effect in biased AFM probes on dielectric films and its application to quantify the dielectric permittivity of thin layers.

    Science.gov (United States)

    Revilla, Reynier I

    2016-07-01

    The jump-into-contact (JIC) phenomenon in biased atomic force microscopy (AFM) probes on dielectric films is studied. The influence of the film thickness on the position at which the AFM tip collapses irreversibly into the sample surface was theoretically analyzed using a widely accepted analytical expression of the probe-sample electrostatic interaction force. It was demonstrated that for relatively high values of voltage (V > 10-20 V) applied between the probe and the substrate the cantilever deflection at the JIC is independent of the dielectric film thickness for thin-ultrathin layers (h dielectric permittivity of thin/ultrathin dielectric films using the jump-into-contact distance. The procedure was successfully applied on thin PVD-SiO2 films, obtaining good agreement with a dielectric constant value previously reported for the same material. PMID:27199351

  3. The ReactorAFM: Non-contact atomic force microscope operating under high-pressure and high-temperature catalytic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Roobol, S. B.; Cañas-Ventura, M. E.; Bergman, M.; Spronsen, M. A. van; Onderwaater, W. G.; Tuijn, P. C. van der; Koehler, R.; Frenken, J. W. M., E-mail: frenken@arcnl.nl [Huygens-Kamerlingh Onnes Laboratory, Leiden University, P.O. Box 9504, RA Leiden 2300 (Netherlands); Ofitserov, A.; Baarle, G. J. C. van [Leiden Probe Microscopy B.V., J.H. Oortweg 21, 2333 CH Leiden (Netherlands)

    2015-03-15

    An Atomic Force Microscope (AFM) has been integrated in a miniature high-pressure flow reactor for in-situ observations of heterogeneous catalytic reactions under conditions similar to those of industrial processes. The AFM can image model catalysts such as those consisting of metal nanoparticles on flat oxide supports in a gas atmosphere up to 6 bar and at a temperature up to 600 K, while the catalytic activity can be measured using mass spectrometry. The high-pressure reactor is placed inside an Ultrahigh Vacuum (UHV) system to supplement it with standard UHV sample preparation and characterization techniques. To demonstrate that this instrument successfully bridges both the pressure gap and the materials gap, images have been recorded of supported palladium nanoparticles catalyzing the oxidation of carbon monoxide under high-pressure, high-temperature conditions.

  4. Physical properties of poly(lactic-co-glycolic) and poly(ethylene glycol) nanoparticles for drug delivery using atomic force microscopy (AFM) and electrostatic nanolithography

    Science.gov (United States)

    Lyuksyutov, Sergei; Fedin, Igor; Nedashkivska, Victoria; Lyuksyutova, Caterina; Geldenhuys, Werner; Sutariya, Vijay

    2010-03-01

    Nanoparticles (NP) of biodegradable polymers poly(lactic-co-glycolic)(PLGA) and poly(ethylene glycol) (PEG) are potential drug delivery components for biomedical applications. The NP based on PLGA or PEG can be directed to accumulate in cancer tumor cells with the use of anti-bodies which are conjugated to the NP. The NP's size distribution is the critical property for biochemical affinity and therefore delivery to the specific target organs. We used an atomic force microscopy (AFM) to characterize the NP size and AFM electrostatic nanolithography (AFMEN) to study the behavior of PEG-PLGA NP under the extreme electric fields exceeding 10^9 V m-1. AFMEN allows the displacement of molecules along the lines of the electric field due to electrostatic polarization. This study has an important practical application for the optimum design of NP with the correct characteristics for drug delivery.

  5. Probing the probe: AFM tip-profiling via nanotemplates to determine Hamaker constants from phase-distance curves

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez, Raul D. [Institute of Physics, Chemnitz University of Technology, D-09107 Chemnitz (Germany); Lacaze, Emmanuelle, E-mail: emmanuelle.lacaze@insp.jussieu.fr [CNRS, UMR7588, Institut des Nano-Sciences de Paris (INSP), 4 place Jussieu, F-75005 Paris (France); UPMC Univ Paris 06, UMR 7588, Institut des Nano-Sciences de Paris (INSP), 4 Place Jussieu, F-75005 Paris (France); Jupille, Jacques [CNRS, UMR7588, Institut des Nano-Sciences de Paris (INSP), 4 place Jussieu, F-75005 Paris (France); UPMC Univ Paris 06, UMR 7588, Institut des Nano-Sciences de Paris (INSP), 4 Place Jussieu, F-75005 Paris (France)

    2012-10-15

    A method to determine the van der Waals forces from phase-distance curves recorded by atomic force microscopy (AFM) in tapping mode is presented. The relationship between the phase shift and the tip-sample distance is expressed as a function of the product of the Hamaker constant by tip radius. Silica-covered silicon tips are used to probe silica-covered silicon substrate in dry conditions to avoid capillary effects. Tips being assumed spherical, radii are determined in situ by averaging profiles recorded in different directions on hematite nanocrystals acting as nanotemplates, thus accounting for tip anisotropy. Through a series of reproducible measurements performed with tips of various radii (including the in-situ characterization of a damaged tip), a value of (6.3{+-}0.4) Multiplication-Sign 10{sup -20} J is found for the Hamaker constant of interacting silica surfaces in air, in good agreement with tabulated data. The results demonstrate that the onset of the tip-surface interaction is dominated by the van der Waals forces and that the total force can be modeled in the framework of the harmonic approximation. Based on the tip radius and the Hamaker constant associated to the tip-substrate system, the model is quite flexible. Once the Hamaker constant is known, a direct estimate of the tip size can be achieved whereas when the tip size is known, a quantitative evaluation of the van der Waals force becomes possible on different substrates with a spatial resolution at the nanoscale. -- Highlights: Black-Right-Pointing-Pointer Van der Waal forces in tapping mode atomic force microscopy. Black-Right-Pointing-Pointer Harmonic approximation model of phase-distance curves probed by simulations. Black-Right-Pointing-Pointer Silica tips and surfaces as a model case. Black-Right-Pointing-Pointer Tip geometry determined in situ by nanoparticles as nanotemplates. Black-Right-Pointing-Pointer Method to derive the Hamaker constant for any tip/surface system.

  6. Probing the probe: AFM tip-profiling via nanotemplates to determine Hamaker constants from phase-distance curves.

    Science.gov (United States)

    Rodriguez, Raul D; Lacaze, Emmanuelle; Jupille, Jacques

    2012-10-01

    A method to determine the van der Waals forces from phase-distance curves recorded by atomic force microscopy (AFM) in tapping mode is presented. The relationship between the phase shift and the tip-sample distance is expressed as a function of the product of the Hamaker constant by tip radius. Silica-covered silicon tips are used to probe silica-covered silicon substrate in dry conditions to avoid capillary effects. Tips being assumed spherical, radii are determined in situ by averaging profiles recorded in different directions on hematite nanocrystals acting as nanotemplates, thus accounting for tip anisotropy. Through a series of reproducible measurements performed with tips of various radii (including the in-situ characterization of a damaged tip), a value of (6.3±0.4)×10(-20) J is found for the Hamaker constant of interacting silica surfaces in air, in good agreement with tabulated data. The results demonstrate that the onset of the tip-surface interaction is dominated by the van der Waals forces and that the total force can be modeled in the framework of the harmonic approximation. Based on the tip radius and the Hamaker constant associated to the tip-substrate system, the model is quite flexible. Once the Hamaker constant is known, a direct estimate of the tip size can be achieved whereas when the tip size is known, a quantitative evaluation of the van der Waals force becomes possible on different substrates with a spatial resolution at the nanoscale. PMID:22922181

  7. AFM force measurements of the gp120-sCD4 and gp120 or CD4 antigen-antibody interactions

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yong, E-mail: dr_yongchen@hotmail.com [Institute for Advanced Study, Nanchang University, Nanchang, Jiangxi 330031 (China); Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, IL 60612 (United States); Zeng, Gucheng [Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, IL 60612 (United States); Chen, Sherry Shiyi [Department of Biomedical Engineering, Duke University, Durham, NC 27708 (United States); Feng, Qian [Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, IL 60612 (United States); Chen, Zheng Wei, E-mail: zchen@uic.edu [Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, IL 60612 (United States)

    2011-04-08

    Highlights: {yields} The unbinding force of sCD4-gp120 interaction was 25.45 {+-} 20.46 pN. {yields} The unbinding force of CD4 antigen-antibody interaction was 51.22 {+-} 34.64 pN. {yields} The unbinding force of gp120 antigen-antibody interaction was 89.87 {+-} 44.63 pN. {yields} The interaction forces between various HIV inhibitors and the target molecules are significantly different. {yields} Functionalizing on AFM tip or substrate of an interaction pair caused different results. -- Abstract: Soluble CD4 (sCD4), anti-CD4 antibody, and anti-gp120 antibody have long been regarded as entry inhibitors in human immunodeficiency virus (HIV) therapy. However, the interactions between these HIV entry inhibitors and corresponding target molecules are still poorly understood. In this study, atomic force microscopy (AFM) was utilized to investigate the interaction forces among them. We found that the unbinding forces of sCD4-gp120 interaction, CD4 antigen-antibody interaction, and gp120 antigen-antibody interaction were 25.45 {+-} 20.46, 51.22 {+-} 34.64, and 89.87 {+-} 44.63 pN, respectively, which may provide important mechanical information for understanding the effects of viral entry inhibitors on HIV infection. Moreover, we found that the functionalization of an interaction pair on AFM tip or substrate significantly influenced the results, implying that we must perform AFM force measurement and analyze the data with more caution.

  8. Charge injection in thin dielectric layers by atomic force microscopy: influence of geometry and material work function of the AFM tip on the injection process.

    Science.gov (United States)

    Villeneuve-Faure, C; Makasheva, K; Boudou, L; Teyssedre, G

    2016-06-17

    Charge injection and retention in thin dielectric layers remain critical issues for the reliability of many electronic devices because of their association with a large number of failure mechanisms. To overcome this drawback, a deep understanding of the mechanisms leading to charge injection close to the injection area is needed. Even though the charge injection is extensively studied and reported in the literature to characterize the charge storage capability of dielectric materials, questions about charge injection mechanisms when using atomic force microscopy (AFM) remain open. In this paper, a thorough study of charge injection by using AFM in thin plasma-processed amorphous silicon oxynitride layers with properties close to that of thermal silica layers is presented. The study considers the impact of applied voltage polarity, work function of the AFM tip coating and tip curvature radius. A simple theoretical model was developed and used to analyze the obtained experimental results. The electric field distribution is computed as a function of tip geometry. The obtained experimental results highlight that after injection in the dielectric layer the charge lateral spreading is mainly controlled by the radial electric field component independently of the carrier polarity. The injected charge density is influenced by the nature of electrode metal coating (work function) and its geometry (tip curvature radius). The electron injection is mainly ruled by the Schottky injection barrier through the field electron emission mechanism enhanced by thermionic electron emission. The hole injection mechanism seems to differ from the electron one depending on the work function of the metal coating. Based on the performed analysis, it is suggested that for hole injection by AFM, pinning of the metal Fermi level with the metal-induced gap states in the studied silicon oxynitride layers starts playing a role in the injection mechanisms.

  9. Charge injection in thin dielectric layers by atomic force microscopy: influence of geometry and material work function of the AFM tip on the injection process

    Science.gov (United States)

    Villeneuve-Faure, C.; Makasheva, K.; Boudou, L.; Teyssedre, G.

    2016-06-01

    Charge injection and retention in thin dielectric layers remain critical issues for the reliability of many electronic devices because of their association with a large number of failure mechanisms. To overcome this drawback, a deep understanding of the mechanisms leading to charge injection close to the injection area is needed. Even though the charge injection is extensively studied and reported in the literature to characterize the charge storage capability of dielectric materials, questions about charge injection mechanisms when using atomic force microscopy (AFM) remain open. In this paper, a thorough study of charge injection by using AFM in thin plasma-processed amorphous silicon oxynitride layers with properties close to that of thermal silica layers is presented. The study considers the impact of applied voltage polarity, work function of the AFM tip coating and tip curvature radius. A simple theoretical model was developed and used to analyze the obtained experimental results. The electric field distribution is computed as a function of tip geometry. The obtained experimental results highlight that after injection in the dielectric layer the charge lateral spreading is mainly controlled by the radial electric field component independently of the carrier polarity. The injected charge density is influenced by the nature of electrode metal coating (work function) and its geometry (tip curvature radius). The electron injection is mainly ruled by the Schottky injection barrier through the field electron emission mechanism enhanced by thermionic electron emission. The hole injection mechanism seems to differ from the electron one depending on the work function of the metal coating. Based on the performed analysis, it is suggested that for hole injection by AFM, pinning of the metal Fermi level with the metal-induced gap states in the studied silicon oxynitride layers starts playing a role in the injection mechanisms.

  10. Ex situ and in situ AFM investigations on the growth of the (100) face of KDP with different pH values

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Through investigations on the growth of the (100) face of potassium dihydrogen phosphate (KDP) crystal by ex situ atomic force microscopy (AFM) with different pH values at different supersaturations at 40°C,it was found that the growth of crystal was controlled by step flow at lower supersaturations,and the morphologies of steps were different under different growth conditions.In addition,at the higher supersaturations,2D nucleation mechanism controlled the growth.When the supersaturations were lower,the dislocation mechanism controlled the growth of crystal,and when σ≥0.05,2D nucleation mechanism played a dominant role in the growth of the (100) face for pH=4.2 and pH=2.5.However,for pH=5.0,the dislocation mechanism also dominated the growth of crystal when the supersaturations were lower,but when σ≥0.03,the crystal growth was controlled by 2D nucleation mechanism.Through investigations on the step flow of the (100) face of KDP crystal by in situ AFM with different pH values at lower supersaturations at 25°C,the velocities of normal growth of the (100) face were estimated at different growth conditions by in situ AFM.It was found that when the pH value was 5.0,the normal growth rate was the fastest at the same supersaturation compared to the other pH values and screw dislocation mechanism controlled the crystal growth.In addition,we found that with the reduction of the supersaturation of the solution,the density of steps also decreased,the width of steps became larger.Finally,a phenomenon which was the obvious anisotropic growth of steps in the step flow was observed by in situ AFM at σ=0.025 at pH=5.0.

  11. The co-design of interface sensing and tailoring of ultra-thin film with ultrasonic vibration-assisted AFM system

    Science.gov (United States)

    Shi, Jialin; Liu, Lianqing; Li, Guangyong

    2016-06-01

    Ultra-thin films (e.g., graphene, MoS2, and black phosphorus) have shown amazing performance in a variety of applications. The tailoring or machining of these ultra-thin films is often the preliminary step to manufacturing them into functional devices. Atomic force microscopy (AFM) is a flexible, high-efficiency and low-cost tailoring or machining tool with the advantages of high resolution and precision. However, the current AFM-based tailoring methods are often set up as an open loop regarding the machined depth and state. Thus, because of a lack of real-time feedback, an inappropriate applied force leads to over-cutting or under-cutting, which limits the performance of the manufactured devices. In this study, we propose a real-time tailoring and sensing method based on an ultrasonic vibration-assisted (USV-assisted) AFM system to solve the above problems. With the proposed method, the machined depth and state can be sensed in real time by detecting the phase value of the vibrating cantilever. To characterize and gain insight into the phase responses of the cantilever to the machined depth and sample material, a theoretical dynamic model of a cantilever-film vibrating system is introduced to model the machining process, and a sensing theory of machined depth and state is developed based on a USV-assisted AFM system. The experimental results verify the feasibility and effectiveness of the proposed method, which in turn lay the foundation for a closed-loop tailoring control strategy for ultra-thin films.

  12. Anomalous current-voltage characteristics along the c-axis in YBaCuO thin films prepared by MOCVD and AFM lithography

    Science.gov (United States)

    Yamamoto, Shuu'ichirou; Kawaguchi, Atsushi; Oda, Shunri

    1997-12-01

    We have proposed a fabrication process of intrinsic Josephson junctions (IJJs) using AFM lithography and successfully obtained IJJs in YBaCuO thin films deposited by MOCVD. A sample shows clear hysteresis and 23 voltage steps related to IJJs in the I- V curve. The maximum width of a step is about 2 mV at 5 K. We discuss the I- V characteristics and estimate the order of the parameters for the IJJ.

  13. Iterative control approach to high-speed force-distance curve measurement using AFM: time-dependent response of PDMS example.

    Science.gov (United States)

    Kim, Kyong-Soo; Lin, Zhiqun; Shrotriya, Pranav; Sundararajan, Sriram; Zou, Qingze

    2008-08-01

    Force-distance curve measurements using atomic force microscope (AFM) has been widely used in a broad range of areas. However, currently force-curve measurements are hampered the its low speed of AFM. In this article, a novel inversion-based iterative control technique is proposed to dramatically increase the speed of force-curve measurements. Experimental results are presented to show that by using the proposed control technique, the speed of force-curve measurements can be increased by over 80 times--with no loss of spatial resolution--on a commercial AFM platform and with a standard cantilever. High-speed force curve measurements using this control technique are utilized to quantitatively study the time-dependent elastic modulus of poly(dimethylsiloxane) (PDMS). The force-curves employ a broad spectrum of push-in (load) rates, spanning two-order differences. The elastic modulus measured at low-speed compares well with the value obtained from dynamic mechanical analysis (DMA) test, and the value of the elastic modulus increases as the push-in rate increases, signifying that a faster external deformation rate transitions the viscoelastic response of PDMS from that of a rubbery material toward a glassy one. PMID:18467033

  14. Influence of the atmospheric humidity on the behaviour of silicon AFM probes in photon scanning tunneling microscopy

    Science.gov (United States)

    Benfedda, M.; Lahimer, S.; Bonnafe, J.

    1998-11-01

    The photon scanning tunneling microscopy (PSTM) allows to characterize the surface topography with high resolution. This microscopy exploits the exponential decay of the evanescent field achieved by the total internal reflection under the surface sample. When the distance between the sensor and the surface becomes small (sim 100 nm), the non propagating photons of the evanescent field can be converted into guided propagating mode of polaritons. A bulk Silicon probe is used in the AFM experiment as a sensor of van der Waals forces. The aim of this paper is to discuss the influence of the atmospheric humidity on the PSTM measurements. We have showed that the theoretical predictions of the dielectrical capture model (DCM) are very different from the experimental results when the humidity level is higher than a threshold value (30%). We present the results obtained with TE polarization, but the same behaviour is found with TM polarization. Although, in this paper we do not propose a theoretical model explaining the deviations between DCM values and experimental, however we found a validity threshold for our experimental results and we have emited the assumption that under high humidity level the pollution film presents on the sample surface slide during the displacement of the probe. La microscopie optique à effet tunnel (PSTM) est un outil de caractérisation de surface à haute résolution. Ce microscope exploite la décroissance du champ évanescent créé sur la surface de l'échantillon. Quand la distance entre le capteur et la surface est de quelques dizaines de nanomètres, les ondes évanescentes créées sur la surface sont converties en ondes propagatives et détectées en champ lointain. Le capteur est une sonde en silicium utilisée en microscopie à force atomique. Cet article montre l'influence des conditions atmosphériques sur les mesures PSTM. Il montre qu'au-delà d'un certain taux d'humidité (30%), les mesures ne sont plus valables et ne suivent

  15. Repulsion forces of superplasticizers on ground granulated blast furnace slag in alkaline media, from AFM measurements to rheological properties

    Directory of Open Access Journals (Sweden)

    Palacios, M.

    2012-12-01

    Full Text Available The electrostatic and steric repulsion induced by different superplasticizers on ground granulated blast furnace slag in alkaline media have been studied. The superplasticizers were sulfonated naphthalene, sulfonated melamine, vinyl copolymer, and polycarboxylate- based admixtures. With these superplasticizers the slag suspensions had negative zeta potentials, ranging from -3 to -10 mV. For the first time the adsorbed layer thicknesses for superplasticizers on slag using colloidal probe atomic force microscopy has been measured. To model the interparticle force interactions an effective Hamaker constant was computed from dielectric properties measured on a dense slag sample produced by spark plasma sintering. The obtained results conclude that the dispersion mechanism for all the superplasticizers studied in the present work is mainly dominated by the steric repulsion. Results were then used in a yield stress model, YODEL, to predict the yield stress with and without the superplasticizers. Predictions of the yield stress agreed well with experimental results.

    En este trabajo se ha estudiado la repulsión electrostática y estérica inducida por diferentes aditivos superplastificantes en sistemas de escoria de horno alto en medios alcalinos. Se han estudiado aditivos superplastificantes basados en naftaleno, melamina, copolímeros vinílicos y basados en policarboxilato. Estos aditivos inducen en la escoria un potencial zeta negativo, entre -3 y -10 mV. Por primera vez, se ha determinado el grosor de la capa de aditivo adsorbido sobre la escoria mediante microscopía de fuerzas atómicas (AFM. Para modelizar las fuerzas de interacción entre partículas, se ha determinado la constante efectiva de Hamaker de la escoria a partir de las propiedades dieléctricas de una muestra de escoria obtenida mediante sinterización spark plasma sintering. Los resultados obtenidos concluyen que el mecanismo de dispersión de los superplastificantes

  16. Commentary on “Evaluation of shooting distance by AFM and FTIR⁄ATR analysis of GSR” Mou Y., Lakadwar J., Rabalais J.W., J. Forensic Sci. 2008; 53:1381-6

    OpenAIRE

    Jones, BJ

    2009-01-01

    This piece highlights the disadvantages of utiising atomic force microscopy (AFM) for analysis of gun shot residue (GSR) and other fine powders. Also outlined is the origin of novel particle shapes that can be found in some published images.

  17. XPS, UV–vis spectroscopy and AFM studies on removal mechanisms of Si-face SiC wafer chemical mechanical polishing (CMP)

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yan [State Key Laboratory of Tribology, Tsinghua University, Beijing 100084 (China); Shenzhen Key Laboratory of Micro/Nano Manufacturing, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Pan, Guoshun, E-mail: pangs@tsinghua.edu.cn [State Key Laboratory of Tribology, Tsinghua University, Beijing 100084 (China); Shenzhen Key Laboratory of Micro/Nano Manufacturing, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Shi, Xiaolei; Xu, Li; Zou, Chunli; Gong, Hua; Luo, Guihai [State Key Laboratory of Tribology, Tsinghua University, Beijing 100084 (China); Shenzhen Key Laboratory of Micro/Nano Manufacturing, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China)

    2014-10-15

    Highlights: • CMP removal mechanism of Si-face SiC wafer is investigated through XPS analysis. • UV–vis spectroscopy is used to study CMP removal mechanisms. • CMP removal model of Si-face SiC wafer is proposed. • The variations of atomic step morphology on ultra-smooth surface via AFM is studied. - Abstract: Chemical mechanical polishing (CMP) removal mechanisms of on-axis Si-face SiC wafer have been investigated through X-ray photoelectron spectroscopy (XPS), UV–visible (UV–vis) spectroscopy and atomic force microscopy (AFM). XPS results indicate that silicon oxide is formed on Si-face surface polished by the slurry including oxidant H{sub 2}O{sub 2}, but not that after immersing in H{sub 2}O{sub 2} solution. UV–vis spectroscopy curves prove that • OH hydroxyl radical could be generated only under CMP polishing by the slurry including H{sub 2}O{sub 2} and abrasive, so as to promote oxidation of Si-face to realize the effective removal; meanwhile, alkali KOH during CMP could induce the production of more radicals to improve the removal. On the other side, ultra-smooth polished surface with atomic step structure morphology and extremely low Ra of about 0.06 nm (through AFM) is obtained using the developed slurry with silica nanoparticle abrasive. Through investigating the variations of the atomic step morphology on the surface polished by different slurries, it's reveals that CMP removal mechanism involves a simultaneous process of surface chemical reaction and nanoparticle atomic scale abrasion.

  18. Savinase action on bovine serum albumin (BSA) monolayers demonstrated with measurements at the air-water interface and liquid Atomic Force Microscopy (AFM) imaging

    DEFF Research Database (Denmark)

    Balashev, Konstantin; Callisen, Thomas H; Svendsen, Allan;

    2011-01-01

    We studied the enzymatic action of Savinase on bovine serum albumin (BSA) organized in a monolayer spread at the air/water interface or adsorbed at the mica surface. We carried out two types of experiments. In the first one we followed the degradation of the protein monolayer by measuring...... the surface pressure and surface area decrease versus time. In the second approach we applied AFM imaging of the supported BSA monolayers adsorbed on mica solid supports and extracted information for the enzyme action by analyzing the obtained images of the surface topography in the course of enzyme action...

  19. AFM lithography for the definition of nanometre scale gaps: application to the fabrication of a cantilever-based sensor with electrochemical current detection

    Science.gov (United States)

    Villarroya, María; Pérez-Murano, Francesc; Martín, Cristina; Davis, Zachary; Boisen, Anja; Esteve, Jaume; Figueras, Eduard; Montserrat, Josep; Barniol, Núria

    2004-07-01

    The concept, design and fabrication of a cantilever-based sensor operating in liquid for biochemical applications are reported. A novel approach for detecting the deflection of a functionalized cantilever is proposed. It consists of detecting the change of the electrochemical current level when a voltage is applied between a deflecting cantilever, acting as one of the electrodes, and a reference fixed electrode placed in close proximity to the free extreme of the cantilever. The detection is possible since the distance between the two electrodes is smaller than 50 nm. The sensor is fabricated by using a combination of MEMS technology and AFM-based lithography.

  20. The jump-into-contact effect in biased AFM probes on dielectric films and its application to quantify the dielectric permittivity of thin layers

    Science.gov (United States)

    Revilla, Reynier I.

    2016-07-01

    The jump-into-contact (JIC) phenomenon in biased atomic force microscopy (AFM) probes on dielectric films is studied. The influence of the film thickness on the position at which the AFM tip collapses irreversibly into the sample surface was theoretically analyzed using a widely accepted analytical expression of the probe–sample electrostatic interaction force. It was demonstrated that for relatively high values of voltage (V > 10–20 V) applied between the probe and the substrate the cantilever deflection at the JIC is independent of the dielectric film thickness for thin–ultrathin layers (h < 10–50 nm). Under the same conditions the z–piezo distance at the JIC follows approximately a linear behavior with the film thickness. Based on this effect an empirical model was formulated to estimate the dielectric permittivity of thin/ultrathin dielectric films using the jump-into-contact distance. The procedure was successfully applied on thin PVD–SiO2 films, obtaining good agreement with a dielectric constant value previously reported for the same material.