WorldWideScience

Sample records for afc flavouring group

  1. Heavy flavours: working group summary

    Energy Technology Data Exchange (ETDEWEB)

    Ali, Ahmed [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Gladilin, Leonid [Moscow State Univ. (Russian Federation). Scobeltsyn Inst. of Nuclear Physics; Tonelli, Diego [Fermi National Accelerator Lab., Batavia, IL (United States)

    2009-07-15

    The talks presented in the working group ''Heavy flavours'' of the DIS 2009 workshop are summarised. New and recently updated results from theory, proton antiproton and heavy ion colliders, as well from HERA and e{sup +}e{sup -} colliders are discussed. (orig.)

  2. Working group report: Collider and flavour physics

    Indian Academy of Sciences (India)

    Debajyoti Choudhury; Asesh K Datta; Anirban Kundu

    2009-01-01

    The activities of the working group took place under two broad subgroups: Collider Physics subgroup and Flavour Physics subgroup. Reports on some of the projects undertaken are included. Also, some of the leading discussions organized by the working group are summarized.

  3. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF) ; Scientific Opinion on Flavouring Group Evaluation 305 (FGE.305): L - Methionylglycine of chemical group 34

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Frandsen, Henrik Lauritz; Lund, Pia; Nørby, Karin Kristiane

    data on metabolism and toxicity. The Panel concluded that for the flavouring substance, evaluated through the Procedure, no appropriate NOAEL was available and additional data are required. The present evaluation of the candidate substance L-methionylglycine [FL-no: 17.037] is only applicable for its......The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate one flavouring substance, the dipeptide L-methionylglycine [FL-no: 17.037], in the Flavouring Group Evaluation 305, using the Procedure in Commission...... use in foods that are not heated or intended to be heated. Besides the safety assessment of the flavouring substance, the specifications for the material of commerce have also been considered. Adequate specifications including complete purity criteria and identity for the material of commerce have...

  4. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 303 (FGE.303): Spilanthol from chemical group 30

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    candidate substance spilanthol [FL-no: 16.121] is a branched chain unsaturated aliphatic amide from chemical group 30. The substance has been presented with specification of the stereoisomeric composition. The candidate substance was assigned to structural class III, according to the decision tree approach......, the Panel was requested to evaluate one flavouring substance in the Flavouring Group Evaluation 303, using the Procedure as referred to in the Commission Regulation (EC) No 1565/2000. The flavouring substance belongs to chemical group 30, Annex I of the Commission Regulation (EC) No 1565/2000. The....... In the absence of more precise information that would enable the Panel to make a more realistic estimate of the intakes of the flavouring substances, the Panel has decided also to perform an estimate of the daily intakes per person using a “modified Theoretical Added Maximum Daily Intake” (m...

  5. EFSA ; Scientific Opinion on Flavouring Group Evaluation 66, Revision 1 (FGE.66Rev1): Consideration of Furfuryl Alcohol and Related Flavouring Substances Evaluated by JECFA (55th meeting)

    OpenAIRE

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise

    2011-01-01

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 14 flavouring substances in the Revision 1 of Flavouring Group Evaluation 66, using the Procedure in Commission Regulation (EC) No 1565/2000. None of the substances were considered to have genotoxic potential. The substances were evaluated through a stepwise approach (the Procedure) that integrates information on structure-activity relationships, intake...

  6. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 12, Revision 2 (FGE.12Rev2): Primary saturated or unsaturated alicyclic alcohol, aldehyde, acid, and esters from chemical group 7

    OpenAIRE

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise

    2011-01-01

    The European Food Safety Authority (EFSA) asked the Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (the Panel) to provide scientific advice to the Commission on the implications for human health of chemically defined flavouring substances used in or on foodstuffs in the Member States. In particular, the Panel was requested to evaluate nine flavouring substances in the Flavouring Group Evaluation 12, Revision 2 (FGE.12Rev2), using the Procedure as referred to in the ...

  7. Relating quarks and leptons with the T7 flavour group

    Directory of Open Access Journals (Sweden)

    Cesar Bonilla

    2015-03-01

    Full Text Available In this letter we present a model for quarks and leptons based on T7 as flavour symmetry, predicting a canonical mass relation between charged leptons and down-type quarks proposed earlier. Neutrino masses are generated through a Type-I seesaw mechanism, with predicted correlations between the atmospheric mixing angle and neutrino masses. Compatibility with oscillation results leads to lower bounds for the lightest neutrino mass as well as for the neutrinoless double beta decay rates, even for normal neutrino mass hierarchy.

  8. EFSA Panel on Food Contact Material, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 47, Revision 1: Bi- and tricyclic secondary, ketones and related esters from chemical groups 7 and 8

    OpenAIRE

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    2012-01-01

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate six flavouring substances in the Flavouring Group Evaluation 47, including an additional two substances in this Revision 1, using the Procedure in Commission Regulation (EC) No 1565/2000. None of the substances were considered to have genotoxic potential. The substances were evaluated through a stepwise approach (the Procedure) that integrates informati...

  9. EFSA CEF Panel (EFSA Panel on Fo od Contact Materials, Enzymes, Flavourings and Proce ssing Aids), 2015. Scientific Opinion on Flavouring Group Evalua tion 35, Revision 1 (FGE.35Rev1)

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Nørby, Karin Kristiane

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate three flavouring substances in the Flavouring Group Evaluation 35, Revision 1, using the Procedure in Commission Regulation (EC) No 1565/2000. The present ...

  10. EFSA ; Scientific Opinion on Flavouring Group Evaluation 66, Revision 1 (FGE.66Rev1): Consideration of Furfuryl Alcohol and Related Flavouring Substances Evaluated by JECFA (55th meeting)

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 14 flavouring substances in the Revision 1 of Flavouring Group Evaluation 66, using the Procedure in Commission Regulation (EC) No 1565/2000. None of the s...... Panel concluded that the 14 substances [FL-no: 13.001, 13.002, 13.003, 13.005, 13.018, 13.019, 13.025, 13.038, 13.057, 13.062, 13.067, 13.068, 13.073 and 13.128] do not give rise to safety concerns at their levels of dietary intake, estimated on the basis of the MSDI approach....

  11. EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2013. Scientific Opinion on Flavouring Group Evaluation 76, Revision 1 (FGE.76Rev1)

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Frandsen, Henrik Lauritz; Lund, Pia; Nørby, Karin Kristiane

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (JECFA), and to decide whether further...... evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present opinion concerns a group of 26 sulphur-containing heterocyclic compounds evaluated by the JECFA at the 59th meeting in 2008. This revision is made due to the inclusion of one additional substance, 5-methyl-2...

  12. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Flavouring Group Evaluation 46, Revision 1 (FGE.46Rev1): Ammonia and three ammonium salts from chemical group 30

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    The Scientific Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (the Panel) was asked to provide scientific advice to the Commission on the implications for human health of chemically defined flavouring substances used in or on foodstuffs in the Member States. In particular...... Regulation (EC) No 1565/2000. The present Flavouring Group Evaluation deals with ammonia [FL-no: 16.009], and three ammonia salts (diammonium sulphide [FL-no: 16.002], ammonium chloride [FL-no: 16.048] and ammonium hydrogen sulphide [FL-no: 16.059]). The flavouring substances cannot exist as geometrical or...... a wide range of food items up to very high amounts. Hydrogen sulphide is also reported to occur naturally in a wide range of food items. In its evaluation, the Panel as a default used the “Maximised Survey-derived Daily Intake” (MSDI) approach to estimate the per capita intakes of the flavouring...

  13. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 11, Revision 2 (FGE.11Rev2): Aliphatic dialcohols, diketones, and hydroxyketones from chemical groups 8 and 10

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    substances in the present group have been reported to occur naturally in a wide range of food items. In its evaluation, the Panel as a default used the “Maximised Survey-derived Daily Intake” (MSDI) approach to estimate the per capita intakes of the flavouring substances in Europe. However, when the Panel......, the Panel was requested to evaluate 12 flavouring substances in the Flavouring Group Evaluation 11, Revision 2 (FGE.11Rev2), using the Procedure as referred to in the Commission Regulation (EC) No 1565/2000. These 12 flavouring substances belong to chemical group 10, Annex I of the Commission...... required. For the remaining candidate substances, genotoxicity data are only available for a limited number of substances, and the genotoxicity could not be assessed adequately. However, the genotoxicity data available on these remaining 11 candidate substances do not preclude evaluation using the...

  14. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 12, Revision 2 (FGE.12Rev2): Primary saturated or unsaturated alicyclic alcohol, aldehyde, acid, and esters from chemical group 7

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    group 7. Seven of the nine flavouring substances possess one or more chiral centres and additionally, and due to the presence of a double bond, one of these substances can exist as geometric isomer. For two of these substances, the stereoisomeric composition has not been specified. The nine flavouring...... precise information that would enable the Panel to make a more realistic estimate of the intakes of the flavouring substances, the Panel has decided also to perform an estimate of the daily intakes per person using a “modified Theoretical Added Maximum Daily Intake” (mTAMDI) approach based on the normal...... precise data on use and use levels. According to the default MSDI approach, the nine flavouring substances in this group have intakes in Europe from 0.011 to 43 micrograms/capita/day, which are below the threshold of concern value for structural class I (1800 micrograms/person/day) substances. The...

  15. Advanced Fuel Cycle Initiative AFC-1D, AFC-1G and AFC-1H Irradiation Report

    Energy Technology Data Exchange (ETDEWEB)

    Debra J. Utterbeck; Gray Chang

    2005-09-01

    The U. S. Advanced Fuel Cycle Initiative (AFCI) seeks to develop and demonstrate the technologies needed to transmute the long-lived transuranic actinide isotopes contained in spent nuclear fuel into shorter-lived fission products, thereby dramatically decreasing the volume of material requiring disposition and the long-term radiotoxity and heat load of high-level waste sent to a geologic repository. The AFC-1 irradiation experiments on transmutation fuels are expected to provide irradiation performance data on non-fertile and low-fertile fuel forms specifically, irradiation growth and swelling, helium production, fission gas release, fission product and fuel constituent migration, fuel phase equilibria, and fuel-cladding chemical interaction. Contained in this report are the to-date physics evaluations performed on three of the AFC-1 experiments; AFC-1D, AFC-1G and AFC-1H. The AFC-1D irradiation experiment consists of metallic non-fertile fuel compositions with minor actinides for potential use in accelerator driven systems and AFC-1G and AFC-1H irradiation experiments are part of the fast neutron reactor fuel development effort. These experiments are high burnup analogs to previously irradiated experiments and are to be irradiated to = 20 atom % burnup. Results of the evaluations show that AFC-1D will remain in the ATR for approximately 100 additional effective full power days (EFPDs), and AFC-1G and AFC-1H for approximately 300 additional EFPDs in order to reach the desired programmatic burnup. The specific irradiation schedule for these tests will be determined based on future physics evaluations and all results will be documented in subsequent reports.

  16. Food contact materials, flavouring substances and smoke flavourings

    Directory of Open Access Journals (Sweden)

    Engel K-H

    2012-10-01

    Full Text Available

    The EFSA Panel on Food Additives, Flavourings, Processing Aids and Materials in Contact with Food (AFC Panel and the subsequent Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF Panel have undertaken evaluations of the safety of flavourings (both chemically defined substances and mixtures such as smoke flavourings and food contact materials (FCM, as well as assessments on other substances used in food. The major progress in methodologies for the evaluation of the safety of these substances is highlighted in this article. By December 2011, scientific opinions had been adopted for 247 substances for food contact materials, mainly plastics. Adoption of a series of opinions on active and/or intelligent packaging substances and on recycling processes of plastics is planned between July 2012 and December 2013. Panel opinions, EFSA statements/reports and guidance documents were published on specific issues and on substances for which there was an urgent request for safety evaluation (for example isopropylthioxanthone (ITX, bisphenol A (BPA, phthalates, epoxidised soybean oil (ESBO, benzophenone and 4-methylbenzophenone. By 2009, the AFC and CEF Panels had completed the safety review of 2 067 flavourings substances used in the EU. Additional data, which were requested for 404 substances, are currently under evaluation or have been generated. Eleven smoke flavourings have been evaluated, and the CEF Panel has prepared a guidance document on the future data required for the evaluation of flavourings.

  17. EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2013. Scientific Opinion on Flavouring Group Evaluation 93, Revision 1 (FGE.93Rev1)

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Frandsen, Henrik Lauritz; Lund, Pia; Nørby, Karin Kristiane

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further...... evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of five sulphur-containing heterocyclic compounds [FL-no: 15.010, 15.126, 15.128, 15.130 and 15.131] evaluated by the JECFA at its 68th meeting in 2007. This revision is required owing...... to additional available genotoxicity data on 2-acetyl-2-thiazoline [FL-no: 15.010]. Since the publication of FGE.93, the substance [FL-no: FL-no: 15.127] is no longer supported by Industry for use as a flavouring substance in Europe and will therefore not be considered any further. The substances...

  18. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 06, Revision 3 (FGE.06Rev3): Straight- and branched-chain aliphatic unsaturated primary alcohols, aldehydes, carboxylic acids, and esters from chemical groups 1

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 50 flavouring substances in the Flavouring Group Evaluation 6, Revision 3, using the Procedure in Commission Regulation (EC) No 1565/2000. None of the subs...

  19. Flavour reformulation and flavour stability

    OpenAIRE

    Yang, Ni

    2012-01-01

    ABSTRACT This project addressed two areas in the flavour industry – flavour reformulation required as a consequence of ingredient changes and flavour stability in solid food products. The aim of the flavour reformulation study was to evaluate both instrumental and modelling approaches to reformulate commercial flavourings for food products of different fat contents. A strawberry flavouring was chosen, which delivered an acceptable flavour in pectin jelly (0% fat) but did not perform so...

  20. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 310 (FGE.310): Rebaudioside A from chemical group 30

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate rebaudioside A [FL-no: 16.113], a steviol glycoside. The substance was not considered to have genotoxic potential. Since a comprehensive and adequate...... toxicological database, including human studies, is available for steviol glycosides, the Panel based its evaluation of rebaudioside A on a comparison of the ADI of 4 mg/kg bw, expressed as steviol, established by EFSA, with the estimated dietary exposure figures based on the MSDI and mTAMDI approaches. The...... Panel concluded that rebaudioside A [FL-no: 16.113] would not give rise to safety concerns at the estimated level of intake arising from its use as flavouring substance....

  1. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 310 (FGE.310): Rebaudioside A from chemical group 30

    OpenAIRE

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    2011-01-01

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate rebaudioside A [FL-no: 16.113], a steviol glycoside. The substance was not considered to have genotoxic potential. Since a comprehensive and adequate toxicological database, including human studies, is available for steviol glycosides, the Panel based its evaluation of rebaudioside A on a comparison of the ADI of 4 mg/kg bw, expressed as steviol, establ...

  2. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 21, Revision 3 (FGE.21Rev3): Thiazoles, thiophenes, thiazoline and thienyl derivatives from chemical groups 29 and 30

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 59 flavouring substances in the Flavouring Group Evaluation 21, including an additional three substances in this Revision 3, using the Procedure in...... Commission Regulation (EC) No 1565/2000. Since the publication of the last revision of this FGE, the EFSA has been requested to evaluate three additional substances [FL-no: 15.057, 15.079 and 15.135], which have been included in the present revision of FGE.21. Seven of the substances [FL-no: 15.060, 15.......091, 15.092, 15.093, 15.094, 15.096, 15.097, 15.106, 15.107, 15.129 and 15.135] evaluated through the Procedure, no appropriate NOAEL was available and additional data are required. Besides the safety assessment of these flavouring substances, the specifications for the materials of commerce have also...

  3. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 10, Revision 3 (FGE.10Rev3): Aliphatic primary and secondary saturated and unsaturated alcohols, aldehydes, acetals, carboxylic acids and esters containing an

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 63 flavouring substances in the Flavouring Group Evaluation 10, including additional two substances in this Revision 3, using the Procedure in Commission R...

  4. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 10, Revision 2 (FGE.10Rev2): Aliphatic primary and secondary saturated and unsaturated alcohols, aldehydes, acetals, carboxylic acids and esters containing an

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 61 flavouring substances in the Flavouring Group Evaluation 10, Revision 2, using the Procedure in Commission Regulation (EC) No 1565/2000. None of the sub...

  5. EFSA CEF Panel (EFSA Panel on Fo od Contact Materials, Enzymes, Flavourings and Proce ssing Aids), 2015. Scientific Opinion on Flavouring Group Evalua tion 09, Revision 6 (FGE.09Rev6): Secondary alicyclic saturated and unsaturated alcohols, ketones and esters containing secondary alicyclic alcohols

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Nørby, Karin Kristiane

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 22 flavouring substances in the Flavouring Group Evaluation 9, Revision 6, using the Procedure in Commission Regulation (EC) No 1565/2000. None of the subs...

  6. Advanced Fuel Cycle Initiative AFC-1D, AFC-1G and AFC-1H End of FY-06 Irradiation Report

    Energy Technology Data Exchange (ETDEWEB)

    Advanced Fuel Cycle Initiative AFC-1D, AFC-1G and

    2006-09-01

    The U. S. Advanced Fuel Cycle Initiative (AFCI) seeks to develop and demonstrate the technologies needed to transmute the long-lived transuranic actinide isotopes contained in spent nuclear fuel into shorter-lived fission products, thereby dramatically decreasing the volume of material requiring disposition and the long-term radiotoxity and heat load of high-level waste sent to a geologic repository. The AFC-1 irradiation experiments on transmutation fuels are expected to provide irradiation performance data on non-fertile and low-fertile fuel forms specifically, irradiation growth and swelling, helium production, fission gas release, fission product and fuel constituent migration, fuel phase equilibria, and fuel-cladding chemical interaction. Contained in this report are the to-date physics evaluations performed on three of the AFC-1 experiments; AFC-1D, AFC-1G and AFC-1H. The AFC-1D irradiation experiment consists of metallic non-fertile fuel compositions with minor actinides for potential use in accelerator driven systems and AFC-1G and AFC-1H irradiation experiments are part of the fast neutron reactor fuel development effort. The metallic fuel experiments and nitride experiment are high burnup analogs to previously irradiated experiments and are to be irradiated to = 40 at.% burnup and = 25 at.% burnup, respectively. Based on the results of the physics evaluations it has been determined that the AFC-1D experiment will remain in the ATR for approximately 4 additional cycles, the AFC-1G experiment for an additional 4-5 cycles, and the AFC-1H experiment for approximately 8 additional cycles, in order to reach the desired programmatic burnup. The specific irradiation schedule for these tests will be determined based on future physics evaluations and all results will be documented in subsequent reports.

  7. EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2013. Scientific Opinion on Flavouring Group Evaluation 216, Revision 1 (FGE.216Rev1). Consideration of genotoxic potential for α,β-unsaturated 2-Phenyl -2-Alkenals from Subgroup 3.3 of FGE.19

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Lund, Pia;

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of five flavouring substances from subgroup 3.3 of FGE.19. In the Flavouring Group Evaluation 216 (FGE.216) additional genotoxicity...... of animals treated with 2-phenylcrotonaldehyde. Moreover, since the substance was genotoxic only without metabolic activation, it appears necessary to prove the absence of genotoxic effect locally in the gastro intestinal system using the Comet assay....

  8. Advanced Fuel Cycle Initiative AFC-1D, AFC-1G, and AFC-1H End of FY-07 Irradiation Report

    Energy Technology Data Exchange (ETDEWEB)

    Debra J Utterbeck; Gray S Chang; Misit A Lillo

    2007-09-01

    The purpose of the U.S. Advanced Fuel Cycle Initiative (AFCI), now within the broader context of the Global Nuclear Energy Partnership (GNEP), is to develop and demonstrate the technologies needed to transmute the long-lived transuranic isotopes contained in spent nuclear fuel into shorter-lived fission products. Success in this undertaking could potentially dramatically decrease the volume of material requiring disposal with attendant reductions in long-term radio-toxicity and heat load of high-level waste sent to a geologic repository. One important component of the technology development is investigation of irradiation/transmutation effects on actinide-bearing metallic fuel forms containing plutonium, neptunium, americium (and possibly curium) isotopes. Goals of this initiative include addressing the limited irradiation performance data available on metallic fuels with high concentrations of Pu, Np and Am, as are envisioned for use as actinide transmutation fuels. The AFC-1 irradiation experiments of transmutation fuels are expected to provide irradiation performance data on non-fertile and low-fertile fuel forms specifically, irradiation growth and swelling, helium production, fission gas release, fission product and fuel constituent migration, fuel phase equilibria, and fuel-cladding chemical interaction. Contained in this report are the to-date physics evaluations performed on three of the AFC-1 experiments; AFC-1D, AFC-1G and AFC-1H. The AFC-1D irradiation experiment consists of metallic non-fertile fuel compositions with minor actinides for potential use in accelerator driven systems and AFC-1G and AFC-1H irradiation experiments are part of the fast neutron reactor fuel development effort. The metallic fuel experiments and nitride experiment are high burnup analogs to previously irradiated experiments and are to be irradiated to = 40 at.% burnup.

  9. EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2014. Scientific Opinion on Flavouring Group Evaluation 210, Revision 1 (FGE.210Rev1): Consideration of genotoxic potential for α,β-unsaturated alicyclic ketones and precursors from chemical subgroup 2

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Lund, Pia; Nørby, Karin Kristiane

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of 13 flavouring substances in Flavouring Group Evaluation 210 (FGE.210) and one additional substance [FL-no: 07.225] in this...... revision 1 (FGE.210Rev1). In the first version of FGE.210 the Panel concluded that a genotoxic potential could not be ruled out for any of the 13 substances based on data available at that time. The Flavouring Industry has now submitted additional genotoxicity data. The Panel has evaluated these data and...

  10. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 3, Revision 2 (FGE.03Rev2): Acetals of branched- and straight-chain aliphatic saturated primary alcohols and branched- and straight-chain saturated or unsaturated

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate one flavouring substance, acetaldehyde ethyl isopropyl acetal [FL-no: 06.137], structurally related to the 58 flavouring substances in the Flavouring Group...... structure-activity relationships, intake from current uses, toxicological threshold of concern, and available data on metabolism and toxicity. The Panel concluded as for the other already evaluated substances that the substance [FL-no: 06.137] do not give rise to safety concern at its level of dietary...

  11. EFSA Panel on Food Contact Materials , Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 224 (FGE.224): Consideration of genotoxic potential for two α,β - unsaturated thiophenes from subgroup 5.2 of FGE.19 by EFSA

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Lund, Pia; Nørby, Karin Kristiane

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of two flavouring substances from subgroup 5.2 of FGE.19 in the Flavouring Group Evaluation 224 (FGE.224). The Flavour Industry has...... are still pending and no conclusion could be drawn in the present FGE. © European Food Safety Authority, 2013......The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of two flavouring substances from subgroup 5.2 of FGE.19 in the Flavouring Group Evaluation 224 (FGE.224). The Flavour Industry has...... provided additional genotoxicity studies for one of the two substances in FGE.224, namely 5-methyl-2-thiophenecarbaldehyde [FL-no: 15.004]. The data requested by EFSA for the other substance, 3-acetyl-2,5-dimethylthiophene [FL-no: 15.024] of FGE.224 will be provided subsequently according to the Flavour...

  12. Optimal AFCS: particularities of real design

    Science.gov (United States)

    Platonov, A.; Zaitsev, Ie.; Chaciński, H.

    2015-09-01

    The paper discusses particularities of optimal adaptive communication systems (AFCS) design conditioned by the particularities of their architecture and way of functioning, as well as by the approach to their design. The main one is that AFCS employ the analog method of transmission (in the paper - amplitude modulation), and are intended for short-range transmission of signals from the analog sources. Another one is that AFCS design is carried out on the basis of strict results of concurrent analytical optimisation of the transmitting and receiving parts of the system. Below, general problems appearing during transition from the theoretical results to the real engineering design, as well as approach to their solution are discussed. Some concrete tasks of AFCS design are also considered.

  13. Scientific Opinion on Flavouring Group Evaluation 20, Revision 4 (FGE.20Rev4): Benzyl alcohols, benzaldehydes, a related acetal, benzoic acids, and related esters from chemical groups 23 and 30

    OpenAIRE

    EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF)

    2012-01-01

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 45 flavouring substances in the Flavouring Group Evaluation 20, Revision 4 (FGE.20Rev4), using the Procedure in Commission Regulation (EC) No 1565/2000. This revision 4 is made due to inclusion of four additional substances, o-, m- and p-tolualdehyde [FL no: 05.026, 05.028 and 05.029] and phenylmethyl 2-methyl-2-butenoate [FL no: 09.858]. None of the su...

  14. Various applications of Active Field Control (AFC)

    Science.gov (United States)

    Watanabe, Takayuki; Miyazaki, Hideo; Kishinaga, Shinji; Kawakami, Fukushi

    2003-10-01

    AFC is an electro-acoustic enhancement system, which has been under development at Yamaha Corporation. In this paper, several types of various AFC applications are discussed, while referring to representative projects for each application in Japan. (1) Realization of acoustics in a huge hall to classical music program, e.g., Tokyo International Forum. This venue is a multipurpose hall with approximately 5000 seats. AFC achieves loudness and reverberance equivalent to those of a hall with 2500 seats or fewer. (2) Optimization of acoustics for a variety of programs, e.g., Arkas Sasebo. AFC is used to create the optimum acoustics for each program, such as reverberance for classical concerts, acoustical support for opera singers, uniformity throughout the hall from the stage to under-balcony area, etc. (3) Control of room shape acoustical effect, e.g., Osaka Central Public Hall: In this renovation project, preservation of historically important architecture in the original form is required. AFC is installed to vary only the acoustical environment without architectural changes. (4) Assistance with crowd enthusiasm for sports entertainment, e.g., Tokyo Metropolitan Gymnasium. In this venue, which is designed as a very absorptive space for speech intelligibility, AFC is installed to enhance the atmosphere of live sports entertainment.

  15. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 08, Revision 4 (FGE.08Rev4): Aliphatic and alicyclic mono-, di-, tri-, and polysulphides with or without additional oxygenated functional groups from chemical

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    publication of the last revision of this FGE, the EFSA has been requested to evaluate 10 additional substances, which have been included in the present revision of FGE.08. For the substances methyl methanethiosulphonate [FL-no: 12.159], 2-methylbutane-2-thiol [FL-no: 12.172], 2-methylpropane-2- thiol [FL......The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 80 flavouring substances in the Flavouring Group Evaluation 08, Revision 4, using the Procedure in Commission Regulation (EC) No 1565/2000. Since the.......112, 12.116, 12.120, 12.164, 12.167, 12.199, 15.007, 15.102 and 15.125 and 15.134], evaluated through the Procedure, no appropriate NOAEL was available and additional data are required. Besides the safety assessment of the flavouring substances, the specifications for the materials of commerce have also...

  16. Meat flavour

    International Nuclear Information System (INIS)

    For the consumer, meat is characterized by a certain number of organoleptic qualities; among them, flavour -that is to say the association of both odour and taste- plays a leading part. This property is based upon a great number of chemical components: some volatile components are responsible for the aroma and some non-volatile ones for the taste. These substances are either made or released during the heating of the meat on account of components called precursors which are produced during the aging of the meat. The two main reactions which preside over the elaboration of flavour are: the Maillard's reaction and the autooxidation reactions. Meat flavour is associated with the animal characteristics; it is influenced by the ante- and post mortem treatments as well as by the technological treatments for storing it. The use of synthetical flavours is to be considered as possible in the future

  17. Scientific Opinion on Flavouring Group Evaluation 210 Revision 2 (FGE.210Rev2): Consideration of genotoxic potential for α,β-unsaturated alicyclic ketones and precursors from chemical subgroup 2.4 of FGE.19

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Nørby, Karin Kristiane

    Safety Authority was requested to evaluate the genotoxic potential of 14 flavouring substances in Flavouring Group Evaluation 210 (FGE.210). In FGE.210, the Panel concluded that the genotoxic potential could not be ruled out for any of the flavouring substances. In FGE.210 Revision1, the Panel.......226 and 07.231] the concern for genotoxicity remains and additional data were requested. The Flavour Industry has submitted additional genotoxicity data for allyl a-ionone [FL-no: 07.061], that are evaluated in the present revision of FGE.210 (Revision 2). Based on these new data the Panel concluded that...

  18. EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2014. Scientific Opinion on Flavouring Group Evaluation 82, Revision 1 (FGE.82Rev1): Consideration of Epoxides evaluated by the JECFA (65 th meeting)

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Frandsen, Henrik Lauritz; Lund, Pia; Nørby, Karin Kristiane

    evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of five epoxides evaluated by the JECFA at the 65th meeting in 2005. This revision is made due to inclusion of one additional substance, beta-ionone epoxide [FL-no: 07.170], cleared...... for genotoxicity concern and due to additional toxicity data have become available for beta-caryophyllene epoxide [FL-no: 16.043]. Since publication of FGE.82 one substance epoxy oxophorone [FL-no: 16.051] is no longer supported for use as flavouring substances in Europe by Industry and will therefore...

  19. Flavour Behavior

    Institute of Scientific and Technical Information of China (English)

    奎斯特国际有限公司

    2004-01-01

    @@ A good flavour must taste realistic and natural as well as performing under tough conditions, says Mairi Coia. In conjunction with texture or mouthfeel, flavour is the most important aspect of food. It is the one thing can bring consumers back to a product again and again - or not, as the case may be. In short, taste is the number one attribute in food and that is why the global fiavour business is worth A5 billion every year as manufacturers strive to make food taste better and fresher for longer.

  20. Heavy flavours

    CERN Document Server

    Buras, Andrzej J

    1992-01-01

    This volume is a collection of review articles on the most outstanding topics in heavy flavour physics. All the authors have made significant contributions to this field. The book reviews in detail the theoretical structure of heavy flavour physics within the Standard Model and its confrontation with existing experimental data. The physics of the top quark and of the Higgs play an important role in this volume. Beginning with radiative electroweak corrections and their impressive tests at LEP and hadron colliders, the book summarizes the present status of quark mixing, CP violation and rare de

  1. Heavy flavours

    CERN Document Server

    Buras, Andrzej J

    1998-01-01

    This volume is a collection of review articles on the most outstanding topics in heavy flavour physics. All the authors have made significant contributions to this field. The book reviews in detail the theoretical structure of heavy flavour physics and confronts the Standard Model and some of its extensions with existing experimental data.This new edition covers new trends and ideas and includes the latest experimental information. Compared to the previous edition interesting new activities are included and some of the key contributions are updated. Particular attention is paid to the discover

  2. Scientific Opinion on Flavouring Group Evaluation 82, Revision 1 (FGE.82Rev1: Consideration of Epoxides evaluated by the JECFA (65th meeting

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF

    2014-06-01

    Full Text Available The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA, and to decide whether further evaluation is necessary, as laid down in Commission Regulation (EC No 1565/2000. The present consideration concerns a group of five epoxides evaluated by the JECFA at the 65th meeting in 2005. This revision is made due to inclusion of one additional substance, beta-ionone epoxide [FL-no: 07.170], cleared for genotoxicity concern and due to additional toxicity data have become available for beta-caryophyllene epoxide [FL-no: 16.043]. Since publication of FGE.82 one substance epoxy oxophorone [FL-no: 16.051] is no longer supported for use as flavouring substances in Europe by Industry and will therefore not be considered any further. The substances were evaluated through a stepwise approach that integrates information on structure-activity relationships, intake from current uses, toxicological threshold of concern, and available data on metabolism and toxicity. For four substances [FL-no: 16.015, 16.018, 16.040 and 16.043] the Panel agreed with the JECFA conclusion, “No safety concern at estimated levels of intake as flavouring substances” based on the MSDI approach. For one substance [FL-no: 07.170] additional toxicity data are required. Besides the safety assessment of these flavouring substances, the specifications for the materials of commerce have also been considered and for four substances, the information is adequate; but for the substance [FL-no: 07.170] further information on stereoisomerism is required.

  3. AFC-Enabled Vertical Tail System Integration Study

    Science.gov (United States)

    Mooney, Helen P.; Brandt, John B.; Lacy, Douglas S.; Whalen, Edward A.

    2014-01-01

    This document serves as the final report for the SMAAART AFC-Enabled Vertical Tail System Integration Study. Included are the ground rule assumptions which have gone into the study, layouts of the baseline and AFC-enabled configurations, critical sizing information, system requirements and architectures, and assumed system properties that result in an NPV assessment of the two candidate AFC technologies.

  4. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 20, Revision 3 (FGE.20Rev3): Benzyl alcohols, benzaldehydes, a related acetal, benzoic acids, and related esters from chemical groups 23 and 30

    OpenAIRE

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    2011-01-01

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider in this revision 3 of Flavouring Group Evaluation 20, the SCF Opinion on benzoic acid. Furthermore information on stereoisomeric composition for two substances [FL-no: 06.104 and 09.570] and new information to support the re-allocation of the structural class for the candidate substance piperonyl alcohol [FL-no: 02.205] has been submitted. The 41 flavou...

  5. EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2014. Scientific Opinion on Flavouring Group Evaluation 87, Revision 2 (FGE.87Rev2): Consideration of bicyclic secondary alcohols, ketones and related esters evaluated by JECFA (63rd meeting) structurally related to bicyclic secondary alcohols, ketones and related esters evaluated by EFSA in FGE.47Rev1 (2008)

    OpenAIRE

    Beltoft, Vibe Meister; Frandsen, Henrik Lauritz; Nørby, Karin Kristiane

    2014-01-01

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of 19 bicyclic secondary alcohols, ketones and related esters evaluated by...

  6. EFSA Panel on Food Contact Material, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 51, Revision 1: Consideration of alicyclic ketones and secondary alcohols and related esters evaluated by the JECFA (59th meeting) structurally related to alicyclic ketones secondary alcohols and related esters in FGE.09Rev3 (2011)

    OpenAIRE

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    2012-01-01

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of 20 alicyclic ketones and secondary alcohols and related esters evaluate...

  7. Flavour Visions

    CERN Document Server

    Buras, Andrzej J

    2011-01-01

    This decade will allow to improve the resolution of the short distance scales by at least an order of magnitude, extending the picture of fundamental physics down to scales $5\\cdot 10^{-20}$m with the help of the LHC. Further resolution down to scales as short as $10^{-21}$m should be possible with the help of high precision experiments in which flavour violating processes will play a prominent role. Will this increase in resolution allow us to see new particles (new animalcula) similarly to what Antoni van Leeuvenhoek saw by discovering bacteria in 1676? The basic question for particle physics is how these new animalcula will look like and which difficulties of the Standard Model (SM) they will help us to solve and which new puzzles and problems they will bring with them. I will describe what role flavour physics will play in these exciting times provided this new world is animalculated.

  8. AFC applied to HVDC interconnected systems and multivariable control. Chokuryu renkeiyo AFC to tahensu seigyo

    Energy Technology Data Exchange (ETDEWEB)

    Hatano, M. (Electric Power Development Co. Ltd., Tokyo (Japan)); Tsumenaga, M. (Toshiba Corp., Tokyo (Japan))

    1993-06-20

    Together with a growth of the power demand as well as becoming to be a higher degree and diversification of the social function, the power system has been getting more and more complicated. By the digital technology, which has remarkably developed in recent years, in addition, the control theory in a high level, which had been hard to be handled by the conventional technology, has become possible to be applied for the control devices, also in the control system of the power system. In this paper, an example applied the multivariable control, the modern control theory has been utilized, for the automatic frequency control(AFC) of the HVDC interconnected systems, which connect two power systems, is introduced. In order to verify the control performance of AFC applied the multivariable control, in addition, the AFC device is manufactured, and then the simulation is performed by combining it with the power system simulator simulated two AC systems and one DC interconnected system. When the multivariable controlled AFC is compared with the conventional AFC as for the frequency fluctuation, it is clearly found that the control performance of the former is better than the latter. 2 refs., 5 figs., 1 tab.

  9. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 08, Revision 5 (FGE.08Rev5): Aliphatic and alicyclic mono-, di-, tri-, and polysulphides with or without additional oxygenated functional groups from chemical

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 80 flavouring substances in the Flavouring Group Evaluation 08, Revision 4, using the Procedure in Commission Regulation (EC) No 1565/2000. Since the...... publication of the last revision of this FGE, the EFSA has been requested to evaluate additional toxicological data submitted for two flavouring substances, one on supporting substance 2,5-dihydroxy-2,5-dimethyl-1,4-dithiane [FL-no: 15.006], which support the evaluation of the candidate substance 2...... present revision of FGE.08. For the substances methyl methanethiosulphonate [FL-no: 12.159], 2-methylbutane-2-thiol [FL-no: 12.172], 2-methylpropane-2-thiol [FL-no: 12.174], ethyl-2-mercapto-2-methyl propanoate [FL-no: 12.304] and 2,4,4-trimethyl-1,3-oxathiane [FL-no: 16.057] there is an indication of a...

  10. Scientific Opinion on the safety and efficacy of the use of amino acids (chemical group 34) when used as flavourings for all animal species

    OpenAIRE

    EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP)

    2014-01-01

    Chemical group (CG) 34 comprises amino acids, of which 20 are currently authorised for use as flavours in food. The FEEDAP Panel was unable to perform an assessment of D,L-valine because of the lack of data on its purity. The Panel cannot conclude on the use of these compounds in water for drinking. In the absence of any information on the microbial strains or substrates used for the production of the additives, and with little information on the manufacturing process, the Panel cannot ascert...

  11. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 301 (FGE.301): A sulphur substituted pyrimidin-derivative and its hydrochloride salt

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate two flavouring substances, 4-amino-5,6-dimethylthieno[2,3-d]pyrimidin-2(1H)-one [FL-no: 16.116] and 4-amino-5,6-dimethylthieno[2,3-d]pyrimidin-2(1H...

  12. EFSA Panel on food contact materials, enzymes, flavourings and processing aids (CEF); Scientific Opinion on Flavouring Group Evaluation 23, Revision 2 (FGE.23Rev2): Aliphatic, alicyclic and aromatic ethers including anisole derivatives from chemical groups 15, 16, 22, 26 and 30

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    ether, three are alicyclic hydrocarbons with an ether side chain, two are ethers containing a benzene moiety, eight are phenol ethers and one is a naphthol ether. Five of the 19 candidate substances possess one or more chiral centres and three can exist as geometrical isomers. For one substance [FL...... enable the Panel to make a more realistic estimate of the intakes of the flavouring substances, the Panel has decided also to perform an estimate of the daily intakes per person using a “modified Theoretical Added Maximum Daily Intake” (mTAMDI) approach based on the normal use levels reported by Industry...... levels. According to the default MSDI approach, the 19 flavouring substances in this group have intakes in Europe from 0.011 to 49 micrograms/capita/day, which are below the threshold of concern value for structural class I of 1800 micrograms/person/day, for structural class II of 540 micrograms/person...

  13. Dicty_cDB: AFC108 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFC108 (Link to dictyBase) - - - Contig-U16540-1 AFC108P (Link to Original ... ATTAGTATGTTTGGTTTTAGTTTTCTCAACATTATCAATTAGTAATGCAAATCC GGAACA TGATAAATGGTGGAAACCTCCTCC TAGAAATTGTGATAGTTTGT ... ACAAAGAAATT CTTTTGTGTAGAAGATAATGGAAATGGTTGTGGAAATGCTCC ATTAAGTTGTATGAAAGA TTCAAAAACCGATGCAATTTATGAGATTTGGA ... GG AGTTTGTGAATGGGTTGACCCAGTACCATGTATGGGTACATCATGTTGTCC ACGTTATCC ... AGTTTGTAAGGGTGGTGGTGGCGGTGGTGGACCAGTCTCAC ... CATGTAAGAATGTAATTTG TCC XXXXXXXXXXAAGGATTCAATTGTGTCGAATTTGGTGGAACCGCCAATTGT ...

  14. AFC-Auto Oy:n asiakkuudenhallinta

    OpenAIRE

    Kinnunen, Ville-Markus

    2013-01-01

    Asiakkuudenhallinnan merkitys yrityksen jokapäiväisessä toiminnassa on muuttumassa koko ajan tärke-ämmäksi. Opinnäytetyöni tavoitteena oli kehittää AFC-Auto Oy:lle toimiva järjestelmä, jolla se pystyy tulevaisuudessa pitämään asiakkuudet paremmin hallinnassa. Toimeksiantajana minulla toimi varkaute-lainen perhe-yritys, joka harjoittaa käytettyjen autojen myyntiä. Olen itse osakkaana yrityksessä, joten järjestelmä tulee varmasti olemaan yrityksellä käytössä, ja sitä kehitetään eteenpäin. Te...

  15. EFSA Panel on Food Contact Material, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 51, Revision 1: Consideration of alicyclic ketones and secondary alcohols and related esters evaluated by the JECFA (59th meeting) structurally related to alicyclic

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further...... evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of 20 alicyclic ketones and secondary alcohols and related esters evaluated by JECFA (59th meeting) in 2002. This revision is made due to inclusion of seven additional substances...

  16. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 96 (FGE.96): Consideration of 88 flavouring substances considered by EFSA for which EU production volumes / anticipated production volumes have been submitted on

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further...

  17. Software Piracy Forensics: The Need for Further Developing AFC

    Science.gov (United States)

    Baboo, S. Santhosh; Bhattathiripad, P. Vinod

    Among all the available approaches for software piracy forensics, one existing and exceptional approach is the theoretical frame work called AFC (Abstraction-Filtering-Comparison), an accepted approach in US courts for evaluating copyright infringement claims involving computer software. Through this paper, the authors would like to approach AFC in a threefold manner: One, to discuss the nature and efficacy of AFC; two, to recount some existing observations on it, and three, to identify areas, if any, where there is scope and need for appropriate modifications to further increase the efficacy and validate the legitimacy of the AFC approach, and in particular from the view point of a researcher who believes that software intelligence offered by the automated tools for software piracy investigation needs to be supplemented with manual intelligence for making the expert report more judiciary-friendly.

  18. Refined AFC-Enabled High-Lift System Integration Study

    Science.gov (United States)

    Hartwich, Peter M.; Shmilovich, Arvin; Lacy, Douglas S.; Dickey, Eric D.; Scalafani, Anthony J.; Sundaram, P.; Yadlin, Yoram

    2016-01-01

    A prior trade study established the effectiveness of using Active Flow Control (AFC) for reducing the mechanical complexities associated with a modern high-lift system without sacrificing aerodynamic performance at low-speed flight conditions representative of takeoff and landing. The current technical report expands on this prior work in two ways: (1) a refined conventional high-lift system based on the NASA Common Research Model (CRM) is presented that is more representative of modern commercial transport aircraft in terms of stall characteristics and maximum Lift/Drag (L/D) ratios at takeoff and landing-approach flight conditions; and (2) the design trade space for AFC-enabled high-lift systems is expanded to explore a wider range of options for improving their efficiency. The refined conventional high-lift CRM (HL-CRM) concept features leading edge slats and slotted trailing edge flaps with Fowler motion. For the current AFC-enhanced high lift system trade study, the refined conventional high-lift system is simplified by substituting simply-hinged trailing edge flaps for the slotted single-element flaps with Fowler motion. The high-lift performance of these two high-lift CRM variants is established using Computational Fluid Dynamics (CFD) solutions to the Reynolds-Averaged Navier-Stokes (RANS) equations. These CFD assessments identify the high-lift performance that needs to be recovered through AFC to have the CRM variant with the lighter and mechanically simpler high-lift system match the performance of the conventional high-lift system. In parallel to the conventional high-lift concept development, parametric studies using CFD guided the development of an effective and efficient AFC-enabled simplified high-lift system. This included parametric trailing edge flap geometry studies addressing the effects of flap chord length and flap deflection. As for the AFC implementation, scaling effects (i.e., wind-tunnel versus full-scale flight conditions) are addressed

  19. EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2014. Scientific Opinion on Flavouring Group Evaluation 91, Re vision 2 (FGE.91Rev2): Consid eration of simple aliphatic and aromatic sulphides and thiols evaluated by the JECFA (53rd and 68th meetings, ) structurally related to aliphatic and alicyclic mono-, di-, tri-, and polysulphides with or without additional oxygenated functional groups evaluated by EFSA in FGE.08Rev5 (2012)

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Frandsen, Henrik Lauritz; Lund, Pia; Nørby, Karin Kristiane

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further...... evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of 44 simple aliphatic and aromatic sulphides and thiols evaluated by the JECFA at the 53rd and the 68th meeting. The substances were evaluated through a stepwise approach that...

  20. Scientific Opinion on the safety and efficacy of aliphatic and alicyclic ethers (chemical group 16 when used as flavourings for all animal species

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP

    2012-11-01

    Full Text Available Chemical group 16 consists of aliphatic and alicyclic ethers, of which four are currently authorised for use as flavours in food. The FEEDAP Panel was unable to perform an assessment of 1,5,5,9-tetramethyl-13-oxatricyclo[8.3.0.0.(4.9]tridecane and theaspirane because of issues related to the purity of the compounds. The FEEDAP Panel concludes that: i1,8-cineole is safe at the high use level proposed by the applicant (5 mg/kg complete feed for all animal species with a margin of safety of 5.6 to 28.2; ii2-(2-methylprop-1-enyl-4-methyltetrahydropyran (Class II is safe at a maximum of 0.3 mg/kg complete feed for cattle, salmonids and non food producing animals and of 0.5 mg/kg complete feed for pigs and poultry. The absence of a margin of safety would not allow the simultaneous administration in feed and water for drinking of these substances. The total dose from all sources should not exceed that recommended when given in feed alone. No safety concern would arise for the consumer from the use of compounds belonging to CG 16 up to the highest safe level in feedingstuffs for all animal species. The FEEDAP Panel considers it prudent to treat both compounds under assessment as irritants to skin, eyes and respiratory tract, and as skin sensitisers. The FEEDAP Panel considers that the concentrations of the compounds belonging to CG 16 in the environment are not expected to exceed levels of concern when used in animal feeds at the levels considered to be safe to the target species. Since these compounds are used in food as flavourings, and their function in feed is essentially the same as that in food, no further demonstration of efficacy is necessary.

  1. EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2014. Scientific Opinion on Flavouring Group Evaluation 74, Revision 3 (FGE.74Rev3): Consideration of Simple Aliphatic Sulphides and Thiols evaluated by the JECFA (53rd and 61st meeting) Structurally, related to Aliphatic and Alicyclic Mono-, Di-, Tri-, and Polysulphides with or wi thout Additional Oxygenated Functional Groups from Chemical Group 20 evaluated by EFSA in FGE.08Rev5 (2012)

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Frandsen, Henrik Lauritz; Lund, Pia; Nørby, Karin Kristiane

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further...... evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of 19 simple aliphatic sulphides and thiols evaluated by the JECFA at the 53rd meeting in 1999 and the 61st meeting in 2003. The substances were evaluated through a stepwise approach...... basis of the MSDI approach. For 10 candidate substances in FGE.74Rev3 [FL-no: 12.009, 12.013, 12.020, 12.023, 12.045, 12.074, 12.155, 12.169, 12.241 and 12.280] evaluated through the Procedure, the Panel concluded that additional toxicity data are required....

  2. SFE/SFHTA/AFCE primary aldosteronism consensus: Introduction and handbook.

    Science.gov (United States)

    Amar, Laurence; Baguet, Jean Philippe; Bardet, Stéphane; Chaffanjon, Philippe; Chamontin, Bernard; Douillard, Claire; Durieux, Pierre; Girerd, Xaxier; Gosse, Philippe; Hernigou, Anne; Herpin, Daniel; Houillier, Pascal; Jeunemaitre, Xavier; Joffre, Francis; Kraimps, Jean-Louis; Lefebvre, Hervé; Ménégaux, Fabrice; Mounier-Véhier, Claire; Nussberger, Juerg; Pagny, Jean-Yves; Pechère, Antoinette; Plouin, Pierre-François; Reznik, Yves; Steichen, Olivier; Tabarin, Antoine; Zennaro, Maria-Christina; Zinzindohoue, Franck; Chabre, Olivier

    2016-07-01

    The French Endocrinology Society (SFE) French Hypertension Society (SFHTA) and Francophone Endocrine Surgery Association (AFCE) have drawn up recommendations for the management of primary aldosteronism (PA), based on an analysis of the literature by 27 experts in 7 work-groups. PA is suspected in case of hypertension associated with one of the following characteristics: severity, resistance, associated hypokalemia, disproportionate target organ lesions, or adrenal incidentaloma with hypertension or hypokalemia. Diagnosis is founded on aldosterone/renin ratio (ARR) measured under standardized conditions. Diagnostic thresholds are expressed according to the measurement units employed. Diagnosis is established for suprathreshold ARR associated with aldosterone concentrations >550pmol/L (200pg/mL) on 2 measurements, and rejected for aldosterone concentrationhistory. The patient should be informed of the results expected from medical and surgical treatment of PA before exploration for lateralization is proposed. Lateralization is explored by adrenal vein sampling (AVS), except in patients under 35 years of age with unilateral adenoma on imaging. If PA proves to be lateralized, unilateral adrenalectomy may be performed, with adaptation of medical treatment pre- and postoperatively. If PA is non-lateralized or the patient refuses surgery, spironolactone is administered as first-line treatment, replaced by amiloride, eplerenone or calcium-channel blockers if insufficiently effective or poorly tolerated. PMID:27315757

  3. Lepton-flavour violation in a Pati-Salam model with gauged flavour symmetry

    CERN Document Server

    Feldmann, Thorsten; Moch, Paul

    2016-01-01

    Combining Pati-Salam (PS) and flavour symmetries in a renormalisable setup, we devise a scenario which produces realistic masses for the charged leptons. Flavour-symmetry breaking scalar fields in the adjoint representations of the PS gauge group are responsible for generating different flavour structures for up- and down-type quarks as well as for leptons. The model is characterised by new heavy fermions which mix with the Standard Model quarks and leptons. In particular, the partners for the third fermion generation induce sizeable sources of flavour violation. Focusing on the charged-lepton sector, we scrutinise the model with respect to its implications for lepton-flavour violating processes such as $\\mu \\rightarrow e\\gamma$, $\\mu\\rightarrow 3e$ and muon conversion in nuclei.

  4. Scientific Opinion on Flavouring Group Evaluation 74, Revision 3 (FGE.74Rev3): Consideration of Simple Aliphatic Sulphides and Thiols evaluated by the JECFA (53rd and 61st meeting) Structurally related to Aliphatic and Alicyclic Mono-, Di-, Tri-, and Polysulphides with or without Additional Oxygenated Functional Groups from Chemical Group 20 evaluated by EFSA in FGE.08Rev5 (2012)

    OpenAIRE

    EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF)

    2014-01-01

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of 19 simple aliphatic sulphides and thiols evaluated by the JECFA at the ...

  5. Scientific Opinion on the safety and efficacy of aliphatic and aromatic mono- and di-thiols and mono-, di-, tri-, and polysulphides with or without additional oxygenated functional groups (chemical group 20 when used as flavourings for all animal species

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP

    2013-05-01

    Full Text Available Chemical group 20 consists of aliphatic and aromatic mono- and di-thiols and mono-, di-, tri-, and polysulphides with or without additional oxygenated functional groups, of which 31 are currently authorised for use as flavours in food. The FEEDAP Panel was unable to perform an assessment of six compounds (methanethiol, methyl propyl disulphide, dipropyl trisulphide, 3-mercaptobutan-2-one, 3-(methylthiobutanal and 3-methyl-1,2,4-trithiane because of issues related to the purity of the compounds. The FEEDAP Panel concludes that the following 25 compounds are safe for the target species at the proposed maximum dose level (0.05 mg/kg complete feed: 3-(methylthiopropionaldehyde, methyl 3-(methylthiopropionate, allylthiol, dimethyl sulphide, dibutyl sulphide, diallyl disulphide, diallyl trisulphide, dimethyl trisulphide, dipropyl disulphide, allyl isothiocyanate, dimethyl disulphide, 2-methylbenzene-1-thiol, S-methyl butanethioate, allyl methyl disulphide, 3-(methylthiopropan-1-ol, 3-(methylthiohexan-1-ol, 1-propane-1-thiol, diallyl sulphide, 2,4-dithiapentane, 2-methyl-2-(methyldithiopropanal, 2-methylpropane-1-thiol, methylsulfinylmethane, propane-2-thiol, 3,5-dimethyl-1,2,4-trithiolane and 2-methyl-4-propyl-1,3-oxathiane. No safety concern for the consumer would arise from the use of these 25 compounds of CG 20 up to the highest safe level in feedingstuffs for all animal species, with the exception of allyl isothiocyanate. Although additional exposure to this substance through its low use level in animal feeds would not substantially increase consumer exposure, the FEEDAP Panel notes that the estimated exposure of consumers is already higher than the acceptable daily intake (ADI. All compounds should be considered irritant to skin, eyes and respiratory tract and as skin sensitisers. The proposed concentration of 0.05 mg flavour/kg feed is not expected to cause detrimental effects to the environment, except for 2-methylpropane-1-thiol, for which 0

  6. General principles and stages of optimal AFCS design

    Science.gov (United States)

    Platonov, A.; Zaitsev, Ie.

    2014-11-01

    The goal of the paper is a discussion of general principle and stages of the optimal analog feedback communication systems (AFCS) design. Previous research devoted to the analysis of particularities of AFCS functioning gave necessary analytical basis for transition to practical design of optimal AFCS. This is new class of communication systems (CS) transmitting the signals, under given bit error rate (BER), with bit rate equal to the capacity of the forward channel and power-bandwidth efficiency attaining the theoretical limit. In the paper, we describe the ordered sequence of the stages of transition from the abstract results to designing of the pre-commercial versions of optimal AFCS considering them as the basic communication link "sensor node (SN)" - "base station" (BS) of the wireless sensor network (WSN). We also show that verified theoretical results enable analytically argued decision making at different stages of designing of the high quality and energy efficient WSN communication links. This facilitates optimisation of the project works schedule, distribution of the tasks and resources for their realization, reduce the time and cost of design.

  7. Flavour Tagging at LHCb

    CERN Multimedia

    Grabalosa Gandara, M

    2009-01-01

    To do precise CP violation measurements, the most possible accurate knowledge of the flavour at production of the reconstructed B meson is required. This poster summarizes the flavour tagging performances for the LHCb experiment. We use same side an opposite side algorithms to establish wheter the meson contained a b or a b\\bar quark. The final decision is obtained through a combination of several methods. The use of control channels, decays to a flavour specific final state, will allow to determine the wrong tag fraction \\omega (the probability of a tag to be wrong), which can be used as input for the determination of CKM unitary triangle angles.

  8. Heavy flavour in ALICE

    CERN Document Server

    Pillot, Philippe

    2008-01-01

    Open heavy flavours and heavy quarkonium states are expected to provide essential informa- tion on the properties of the strongly interacting system fo rmed in the early stages of heavy-ion collisions at very high energy density. Such probes are espe cially promising at LHC energies where heavy quarks (both c and b) are copiously produced. The ALICE detector shall measure the production of open heavy flavours and heavy quarkonium st ates in both proton-proton and heavy-ion collisions at the LHC. The expected performances of ALICE for heavy flavour physics is discussed based on the results of simulation studies on a s election of benchmark channels

  9. AFC-Enabled Simplified High-Lift System Integration Study

    Science.gov (United States)

    Hartwich, Peter M.; Dickey, Eric D.; Sclafani, Anthony J.; Camacho, Peter; Gonzales, Antonio B.; Lawson, Edward L.; Mairs, Ron Y.; Shmilovich, Arvin

    2014-01-01

    The primary objective of this trade study report is to explore the potential of using Active Flow Control (AFC) for achieving lighter and mechanically simpler high-lift systems for transonic commercial transport aircraft. This assessment was conducted in four steps. First, based on the Common Research Model (CRM) outer mold line (OML) definition, two high-lift concepts were developed. One concept, representative of current production-type commercial transonic transports, features leading edge slats and slotted trailing edge flaps with Fowler motion. The other CRM-based design relies on drooped leading edges and simply hinged trailing edge flaps for high-lift generation. The relative high-lift performance of these two high-lift CRM variants is established using Computational Fluid Dynamics (CFD) solutions to the Reynolds-Averaged Navier-Stokes (RANS) equations for steady flow. These CFD assessments identify the high-lift performance that needs to be recovered through AFC to have the CRM variant with the lighter and mechanically simpler high-lift system match the performance of the conventional high-lift system. Conceptual design integration studies for the AFC-enhanced high-lift systems were conducted with a NASA Environmentally Responsible Aircraft (ERA) reference configuration, the so-called ERA-0003 concept. These design trades identify AFC performance targets that need to be met to produce economically feasible ERA-0003-like concepts with lighter and mechanically simpler high-lift designs that match the performance of conventional high-lift systems. Finally, technical challenges are identified associated with the application of AFC-enabled highlift systems to modern transonic commercial transports for future technology maturation efforts.

  10. Scientific Opinion on the safety and efficacy of the use of amino acids (chemical group 34 when used as flavourings for all animal species

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP

    2014-05-01

    Full Text Available Chemical group (CG 34 comprises amino acids, of which 20 are currently authorised for use as flavours in food. The FEEDAP Panel was unable to perform an assessment of D,L-valine because of the lack of data on its purity. The Panel cannot conclude on the use of these compounds in water for drinking. In the absence of any information on the microbial strains or substrates used for the production of the additives, and with little information on the manufacturing process, the Panel cannot ascertain whether the manufacturing process introduces any safety concerns. The conclusions on target animals and consumer safety apply only to the compounds per se, and can be extrapolated only to feed additives containing these compounds when obtained by chemical synthesis or protein hydrolysis and to those produced by fermentation which have already undergone a strain-specific safety assessment by EFSA. The 19 compounds under assessment in CG 34 are safe at the proposed use level of 25 mg/kg feed for all animal species. The FEEDAP Panel considers the use of glycine at 20 g/kg in food for cats and dogs as safe. The safety of the proposed use of beta-alanine in pet food at 20 g/kg was not substantiated. Use of these compounds does not give rise to concern for consumer safety. The Panel considers it prudent to treat all 19 compounds as irritant to skin and eyes, skin sensitisers and hazardous by inhalation. They do not give rise to any concern for the safety of the environment. No further demonstration of their efficacy is necessary when used at concentrations up to 25 mg/kg complete feed. There is some evidence that high concentrations (20 g/kg in cat and dog food of glycine may influence the food preference of cats and dogs. Comparable evidence for beta-alanine is not available.

  11. Scientific Opinion on Flavouring Group Evaluation 9, Revision 4 (FGE.09Rev4: Secondary alicyclic saturated and unsaturated alcohols, ketones and esters containing secondary alicyclic alcohols from chemical group 8 and 30, and an ester of a phenol derivative from chemical group 25

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF

    2012-07-01

    Full Text Available

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 21 flavouring substances in the Flavouring Group Evaluation 9, Revision 4, using the Procedure in Commission Regulation (EC No 1565/2000. The present revision of FGE.09 includes the assessment of four additional flavouring substances, p-menthan-3-one [FL-no: 07.059], 2,6,6-trimethylcyclohex-2-en-1-one [FL-no: 07.202], l-piperitone [FL-no: 07.255] and menthol 1-and 2-propylene glycol carbonate [FL-no: 09.843]. None of the substances were considered to have genotoxic potential. The substances were evaluated through a stepwise approach (the Procedure that integrates information on structure-activity relationships, intake from current uses, toxicological threshold of concern, and available data on metabolism and toxicity. The Panel concluded that the 20 substances [FL-no: 02.070, 02.075, 02.135, 02.167, 06.136, 07.059, 07.202, 07.203, 07.255, 09.154, 09.355, 09.520, 09.618, 09.619, 09.621, 09.843, 09.870, 09.929, 09.935 and 09.949] do not give rise to safety concerns at their levels of dietary intake, estimated on the basis of the MSDI approach. For the remaining candidate substance [FL-no: 07.207], additional toxicity data are requested (further metabolism and/or toxicity studies. Besides the safety assessment of these flavouring substances, the specifications for the materials of commerce have been considered. Specifications including complete purity criteria and identity for the materials of commerce have been provided for all candidate substances.

  12. Supersymmetric Radiative Flavour

    OpenAIRE

    Conlon, Joseph P.; Pedro, Francisco G.

    2011-01-01

    We examine possibilities for the radiative generation of the Yukawa couplings and flavour structure in supersymmetric models in the supersymmetric phase. Not withstanding the non-renormalisation of the Wilsonian superpotential, this can occur through the 2-loop vertex renormalisation of the physical 1PI couplings. We describe this effect and construct models in which this occurs. For models attempting to reproduce the full flavour structure of the Standard Model, we analyse the tension betwee...

  13. EFSA Scientific Opinion on Flavouring Group Evaluation 87 Revision 1 (FGE.87Rev1): Consideration of bicyclic secondary alcohols, ketones and related esters evaluated by JECFA (63rd meeting) structurally related to bicyclic secondary alcohols, ketones and related esters evaluated by EFSA in FGE.47 (2008)

    OpenAIRE

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    2012-01-01

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of 17 bicyclic secondary alcohols, ketones and related esters evaluated by...

  14. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 9, Revision 4 (FGE.09Rev4): Secondary alicyclic saturated and unsaturated alcohols, ketones and esters containing secondary alicyclic alcohols from chemical group 8 and 30, and an ester of a phenol derivative from chemical group 25

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    revision of FGE.09 includes the assessment of four additional flavouring substances, p-menthan-3-one [FL-no: 07.059], 2,6,6-trimethylcyclohex-2-en-1-one [FL-no: 07.202], l-piperitone [FL-no: 07.255] and menthol 1-and 2-propylene glycol carbonate [FL-no: 09.843]. None of the substances were considered to...

  15. Flavour in the era of the LHC

    CERN Multimedia

    2006-01-01

    The 4th meeting of the 'Flavour in the era of the LHC'workshop will take place at CERN on 9-11 October, 2006. The goal of this workshop is to outline and document a programme for flavour physics for the next decade, addressing in particular the complementarity and synergy between the discoveries we expect to emerge from the LHC and the potential for accurate measurements of future flavour factories. Over 150 physicists will join in the discussions of the three working groups dedicated to 'Flavour physics at high Q', 'B/D/K decays'and 'Flavour in the lepton sector, EDM's, g-2, etc'. The previous meetings took place in November 2005, and in February and May this year. In addition to the working group sessions, a special miniworkshop dedicated to future prospects for electric dipole moment (EDM) searches and g-2 measurements will be held on 9-10 October. Sensitive EDM and g-2 experiments probe physics in an integral way, and in many cases their physics reach is much higher than the spectrometer searches at th...

  16. Flavour in the era of the LHC

    CERN Multimedia

    2006-01-01

    The 4th meeting of the 'Flavour in the era of the LHC' workshop will take place at CERN on 9-11 October, 2006. The goal of this workshop is to outline and document a programme for flavour physics for the next decade, addressing in particular the complementarity and synergy between the discoveries we expect to emerge from the LHC and the potential for accurate measurements of future flavour factories. Over 150 physicists will join in the discussions of the three working groups dedicated to 'Flavour physics at high Q', 'B/D/K decays' and 'Flavour in the lepton sector, EDM's, g-2, etc'. The previous meetings took place in November 2005, and in February and May this year. In addition to the working group sessions, a special miniworkshop dedicated to future prospects for electric dipole moment (EDM) searches and g-2 measurements will be held on 9-10 October. Sensitive EDM and g-2 experiments probe physics in an integral way, and in many cases their physics reach is much higher than the spectrometer searches at th...

  17. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 06, Revision 2 (FGE.06Rev2): Straight- and branched-chain aliphatic unsaturated primary alcohols, aldehydes, carboxylic acids, and esters from chemical groups 1 and 4

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    .143, 09.341, 09.612, 09.871, 09.872 and 09.938]. Thirty-one of the 48 substances can exist as geometrical isomers [FL-no: 02.152, 02.195, 02.222, 02.234, 05.061, 05.082, 05.203, 05.217, 05.218, 05.220, 08.074, 08.102, 09.377, 09.567, 09.569, 09.572, 09.575, 09.638, 09.640, 09.643, 09.672, 09.673, 09...... wide range of food items. According to the default MSDI approach, the 48 flavouring substances in this group have intakes in Europe from 0.001 to 120 microgram/capita/day, which are below the thresholds of concern value for both structural class I (1800 microgram/person/day) and structural class II...... (540 microgram/person/day) substances. On the basis of the reported annual production volumes in Europe (MSDI approach), the combined intake of the 46 candidate substances belonging to structural class I and of the two candidate substances belonging to structural class II would result in a total intake...

  18. EFSA Panel on food contact materials, enzymes, flavourings and processing aids (CEF); Scientific Opinion on Flavouring Group Evaluation 74, Revision 1 (FGE.74Rev1): Consideration of Simple Aliphatic Sulphides and Thiols evaluated by the JECFA (53rd and 61st meeting) Structurally related to Aliphatic and Alicyclic Mono-, Di-, Tri-, and Polysulphides with or without Additional Oxygenated Functional Groups from Chemical Group 20 evaluated by EFSA in FGE.08Rev1 (2009)

    OpenAIRE

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    2011-01-01

    The European Food Safety Authority (EFSA) asked the Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (the Panel) to provide scientific advice to the Commission on the implications for human health of chemically defined flavouring substances used in or on foodstuffs in the Member States. In particular, the Panel was requested to consider the Joint FAO/WHO Expert Committee on Food Additives (the JECFA) evaluations of flavouring substances assessed since 2000, and to dec...

  19. Scientific Opinion on Flavouring Group Evaluation 91, Revision 2 (FGE.91Rev2): Consideration of simple aliphatic and aromatic sulphides and thiols evaluated by the JECFA (53rd and 68th meetings) structurally related to aliphatic and alicyclic mono-, di-, tri-, and polysulphides with or without additional oxygenated functional groups evaluated by EFSA in FGE.08Rev5 (2012)

    OpenAIRE

    EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF)

    2014-01-01

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of 44 simple aliphatic and aromatic sulphides and thiols evaluated by the ...

  20. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 220, Revision 1 (FGE.220Rev1): alpha,beta-Unsaturated ketones and precursors from chemical subgroup 4.4 of FGE.19: 3(2H)-Furanones.

    OpenAIRE

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise

    2011-01-01

    The European Food Safety Authority (EFSA) asked the Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (the Panel) to provide scientific advice to the Commission on the implications for human health of chemically defined flavouring substances used in or on foodstuffs in the Member States. In particular, the Panel was asked to evaluate flavouring substances using the Procedure as referred to in the Commission Regulation (EC) No 1565/2000. The present revision of FGE.220,...

  1. Flavour Compounds in Fungi

    DEFF Research Database (Denmark)

    Ravasio, Davide Antonio

    Fungi produce a variety of volatile organic compounds (VOCs) during their primary or secondary metabolism and with a wide range of functions. The main focus of this research work has been put on flavour molecules that are produced during fermentation processes, mainly esters and alcohols derived...

  2. Scientific Opinion on the safety and efficacy of glycyrrhizic acid ammoniated (chemical group 30, miscellaneous substances when used as a flavouring for all animal species

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP

    2015-01-01

    Full Text Available Glycyrrhizic acid is extracted from the dried and ground rhizome and root portions of the perennial leguminous plant Glycyrrhiza glabra L., native to southern Europe and Central Asia, or other species of the genus Glycyrrhiza. It is currently listed in the register of flavouring substances, allowing its use in food without restriction. Glycyrrhyzic acid ammoniated is safe at the concentration of 1 mg/kg complete feed for all species, except chickens for fattening and laying hens. For these two categories, a safe concentration of 0.3 mg/kg complete feed applies. The Panel on Additives and Products or Substances used in Animal Feed (FEEDAP cannot conclude on the safety of the additive used in water for drinking. The FEEDAP Panel considers that the use of glycyrrhizic acid ammoniated in animal nutrition would not measurably increase consumer exposure. In the absence of data on user safety, the FEEDAP Panel considers it prudent to treat glycyrrhizic acid ammoniated as an irritant to skin, eyes and respiratory tract and as a skin sensitiser. The use of glycyrrhizic acid ammoniated in animal feeds would not pose a risk to the environment. As glycyrrhizic acid ammoniated is used in food as a flavouring, no further demonstration of efficacy is necessary.

  3. Flavoured Dark Matter Beyond MFV

    CERN Document Server

    Blanke, Monika

    2014-01-01

    We review a model of quark flavoured dark matter with new flavour violating interactions. This simplified model describes Dirac fermionic dark matter that is charged under a new U(3) flavour symmetry and couples to right-handed down quarks via a scalar mediator. The corresponding coupling matrix is assumed to be the only new source of flavour violation, which we refer to as the Dark Minimal Flavour Violation (DMFV) hypothesis. This ansatz ensures the stability of dark matter. We discuss the phenomenology of the simplest DMFV model in flavour violating observables, LHC searches, and direct dark matter detection experiments. Especially interesting is the non-trivial interplay between the constraints from the different sectors.

  4. Charged-lepton flavour physics

    Indian Academy of Sciences (India)

    Andreas Hoecker

    2012-11-01

    This write-up on a talk at the 2011 Lepton–Photon symposium in Mumbai, India, summarizes recent results in the charged-lepton flavour sector. Searches for charged-lepton flavour violation, lepton electric dipole moments and flavour-conserving CP violation are reviewed here. Recent progress in -lepton physics and in the Standard Model prediction of the muon anomalous magnetic moment is also discussed.

  5. Lepton flavour violation in composite Higgs models

    Energy Technology Data Exchange (ETDEWEB)

    Feruglio, Ferruccio, E-mail: feruglio@pd.infn.it; Paradisi, Paride, E-mail: paride.paradisi@pd.infn.it [Sezione di Padova, Dipartimento di Fisica e Astronomia ‘G. Galilei’, INFN, Università di Padova, Via Marzolo 8, 35131, Padua (Italy); Pattori, Andrea, E-mail: pattori@physik.uzh.ch [Physik-Institut, Universität Zürich, 8057, Zurich (Switzerland)

    2015-12-08

    We discuss in detail the constraints on the partial compositeness coming from flavour and CP violation in the leptonic sector. In the first part we present a formulation of partial compositeness in terms of a flavour symmetry group and a set of spurions, whose background values specify the symmetry breaking pattern. In such a framework we construct the complete set of dimension-six operators describing lepton flavour violation and CP violation. By exploiting the existing bounds, we derive limits on the compositeness scale in different scenarios, characterised by increasing restrictions on the spurion properties. We confirm that in the most general case the compositeness scale should lie well above 10 TeV. However, if in the composite sector the mass parameters and Yukawa couplings are universal, such a bound can be significantly lowered, without necessarily reproducing the case of minimal flavour violation. The most sensitive processes are decays of charged leptons either of radiative type or into three charged leptons, μ→e conversion in nuclei and the electric dipole moment of the electron. In the second part we explicitly compute the Wilson coefficients of the relevant dimension-six operators in the so-called two-site model, embodying the symmetry breaking pattern discussed in our first part, and we compare the results with those of the general spurion analysis.

  6. Lepton flavour violation in composite Higgs models

    Energy Technology Data Exchange (ETDEWEB)

    Feruglio, Ferruccio; Paradisi, Paride [Universita di Padova, Dipartimento di Fisica e Astronomia ' G. Galilei' , Padua (Italy); INFN, Padua (Italy); Pattori, Andrea [Universitaet Zuerich, Physik-Institut, Zurich (Switzerland)

    2015-12-15

    We discuss in detail the constraints on the partial compositeness coming from flavour and CP violation in the leptonic sector. In the first part we present a formulation of partial compositeness in terms of a flavour symmetry group and a set of spurions, whose background values specify the symmetry breaking pattern. In such a framework we construct the complete set of dimension-six operators describing lepton flavour violation and CP violation. By exploiting the existing bounds, we derive limits on the compositeness scale in different scenarios, characterised by increasing restrictions on the spurion properties. We confirm that in the most general case the compositeness scale should lie well above 10 TeV. However, if in the composite sector the mass parameters and Yukawa couplings are universal, such a bound can be significantly lowered, without necessarily reproducing the case of minimal flavour violation. The most sensitive processes are decays of charged leptons either of radiative type or into three charged leptons, μ → e conversion in nuclei and the electric dipole moment of the electron. In the second part we explicitly compute the Wilson coefficients of the relevant dimension-six operators in the so-called two-site model, embodying the symmetry breaking pattern discussed in our first part, and we compare the results with those of the general spurion analysis. (orig.) 7.

  7. Flavour Tagging with the LHCb experiment

    CERN Multimedia

    Birnkraut, Alex

    2015-01-01

    Measurements of flavour oscillations and time-dependent CP asymmetries in neutral B meson systems require knowledge of the b quark production flavour. This identification is performed by the Flavour Tagging.

  8. Two approaches towards the flavour puzzle. Dynamical minimal flavour violation and warped extra dimensions

    Energy Technology Data Exchange (ETDEWEB)

    Albrecht, Michaela E.

    2010-08-16

    The minimal-flavour-violating (MFV) hypothesis considers the Standard Model (SM) Yukawa matrices as the only source of flavour violation. In this work, we promote their entries to dynamical scalar spurion fields, using an effective field theory approach, such that the maximal flavour symmetry (FS) of the SM gauge sector is formally restored at high energy scales. The non-vanishing vacuum expectation values of the spurions induce a sequence of FS breaking and generate the observed hierarchy in the SM quark masses and mixings. The fact that there exists no explanation for it in the SM is known as the flavour puzzle. Gauging the non-abelian subgroup of the spontaneously broken FS, we interpret the associated Goldstone bosons as the longitudinal degrees of freedom of the corresponding massive gauge bosons. Integrating out the heavy Higgs modes in the Yukawa spurions leads directly to flavour-changing neutral currents (FCNCs) at tree level. The coefficients of the effective four-quark operators, resulting from the exchange of heavy flavoured gauge bosons, strictly follow the MFV principle. On the other hand, the Goldstone bosons associated with the global abelian symmetry group behave as weakly coupled axions which can be used to solve the strong CP problem within a modified Peccei-Quinn formalism. Models with a warped fifth dimension contain five-dimensional (5D) fermion bulk mass matrices in addition to their 5D Yukawa matrices, which thus represent an additional source of flavour violation beyond MFV. They can address the flavour puzzle since their eigenvalues allow for a different localisation of the fermion zero mode profiles along the extra dimension which leads to a hierarchy in the effective four-dimensional (4D) Yukawa matrices. At the same time, the fermion splitting introduces non-universal fermion couplings to Kaluza-Klein (KK) gauge boson modes, inducing tree-level FCNCs. Within a Randall-Sundrum model with custodial protection (RSc model) we carefully work

  9. Two approaches towards the flavour puzzle. Dynamical minimal flavour violation and warped extra dimensions

    International Nuclear Information System (INIS)

    The minimal-flavour-violating (MFV) hypothesis considers the Standard Model (SM) Yukawa matrices as the only source of flavour violation. In this work, we promote their entries to dynamical scalar spurion fields, using an effective field theory approach, such that the maximal flavour symmetry (FS) of the SM gauge sector is formally restored at high energy scales. The non-vanishing vacuum expectation values of the spurions induce a sequence of FS breaking and generate the observed hierarchy in the SM quark masses and mixings. The fact that there exists no explanation for it in the SM is known as the flavour puzzle. Gauging the non-abelian subgroup of the spontaneously broken FS, we interpret the associated Goldstone bosons as the longitudinal degrees of freedom of the corresponding massive gauge bosons. Integrating out the heavy Higgs modes in the Yukawa spurions leads directly to flavour-changing neutral currents (FCNCs) at tree level. The coefficients of the effective four-quark operators, resulting from the exchange of heavy flavoured gauge bosons, strictly follow the MFV principle. On the other hand, the Goldstone bosons associated with the global abelian symmetry group behave as weakly coupled axions which can be used to solve the strong CP problem within a modified Peccei-Quinn formalism. Models with a warped fifth dimension contain five-dimensional (5D) fermion bulk mass matrices in addition to their 5D Yukawa matrices, which thus represent an additional source of flavour violation beyond MFV. They can address the flavour puzzle since their eigenvalues allow for a different localisation of the fermion zero mode profiles along the extra dimension which leads to a hierarchy in the effective four-dimensional (4D) Yukawa matrices. At the same time, the fermion splitting introduces non-universal fermion couplings to Kaluza-Klein (KK) gauge boson modes, inducing tree-level FCNCs. Within a Randall-Sundrum model with custodial protection (RSc model) we carefully work

  10. Flavour Physics and CP Violation

    CERN Document Server

    Pich, Antonio

    2013-01-01

    An introductory overview of the Standard Model description of flavour is presented. The main emphasis is put on present tests of the quark-mixing matrix structure and the phenomenological determination of its parameters. Special attention is given to the experimental evidences of CP violation and their important role in our understanding of flavour dynamics.

  11. Flavour-changing neutral currents in models with extra ' boson

    Indian Academy of Sciences (India)

    S Sahoo; L Maharana

    2004-09-01

    New neutral gauge bosons ' are the features of many models addressing the physics beyond the standard model. Together with the existence of new neutral gauge bosons, models based on extended gauge groups (rank > 4) often predict new charged fermions also. A mixing of the known fermions with new states, with exotic weak-isospin assignments (left-handed singlets and right-handed doublets) will induce tree-level flavour-changing neutral interactions mediated by exchange, while if the mixing is only with new states with ordinary weak-isospin assignments, the flavour-changing neutral currents are mainly due to the exchange of the new neutral gauge boson '. We review flavour-changing neutral currents in models with extra ' boson. Then we discuss some flavour-changing processes forbidden in the standard model and new contributions to standard model processes.

  12. Scientific Opinion on Flavouring Group Evaluation 63, Revision 2 (FGE.63Rev2): Consideration of aliphatic secondary alcohols, ketones and related esters evaluated by JECFA (59th and 69th meetings) structurally related to saturated and unsaturated aliphatic secondary alcohols, ketones and esters of secondary alcohols and saturated linear or branched-chain carboxylic acids evaluated by EFSA in FGE.07Rev4

    OpenAIRE

    EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF)

    2013-01-01

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of 20 aliphatic secondary alcohols, ketones and related esters evaluated b...

  13. Non-minimally flavour violating dark matter

    CERN Document Server

    Blanke, Monika

    2015-01-01

    Flavour symmetries provide an appealing mechanism to stabilize the dark matter particle. I present a simple model of quark flavoured dark matter that goes beyond the framework of minimal flavour violation. I discuss the phenomenological implications for direct and indirect dark matter detection experiments, high energy collider searches as well as flavour violating precision data.

  14. Revisiting Lepton Flavour Universality in B Decays

    CERN Document Server

    Feruglio, Ferruccio; Pattori, Andrea

    2016-01-01

    Lepton flavour universality (LFU) in B-decays is revisited in a model-independent way by considering semileptonic operators defined at a scale Lambda above the electroweak scale v. The importance of quantum effects, so far neglected in the literature, is emphasised. We construct the low-energy effective Lagrangian taking into account the running effects from Lambda down to v through the one-loop renormalization group equations (RGE) in the limit of exact electroweak symmetry and QED RGEs from v down to the 1 GeV scale. The most important quantum effects turn out to be the modification of the leptonic couplings of the vector boson Z and the generation of a purely leptonic effective Lagrangian. Large LFU breaking effects in Z and tau decays and visible lepton flavour violating (LFV) effects in the processes tau -> mu ll, tau -> mu rho, tau -> mu pi and tau -> mu eta^(') are induced.

  15. Flavour chemicals in electronic cigarette fluids

    OpenAIRE

    Tierney, Peyton A; Karpinski, Clarissa D; Jessica E Brown; Luo, Wentai; Pankow, James F.

    2015-01-01

    Background Most e-cigarette liquids contain flavour chemicals. Flavour chemicals certified as safe for ingestion by the Flavor Extracts Manufacturers Association may not be safe for use in e-cigarettes. This study identified and measured flavour chemicals in 30 e-cigarette fluids. Methods Two brands of single-use e-cigarettes were selected and their fluids in multiple flavour types analysed by gas chromatography/mass spectrometry. For the same flavour types, and for selected confectionary fla...

  16. Forensics of Software Copyright Infringement Crimes: The Modern POSAR Test Juxtaposed With the Dated AFC Test

    OpenAIRE

    Vinod Polpaya Bhattathiripad

    2014-01-01

    This paper presents a new development in the forensics of software copyright through a juxtaposed comparison between the proven AFC test and the recent POSAR test, the two forensic procedures for establishing software copyright infringement cases. First, the paper separately overviews the 3-stage, linear sequential AFC test and then the 5-phase, cyclic POSAR test (as AFC’s logical extension). The paper then compares the processes involved in each of the 5 phases of the POSAR test with the pro...

  17. Heavy Flavour Production at HERA

    International Nuclear Information System (INIS)

    ZEUS and H1 results on heavy quark production using the HERA data from 1995 to 2000 are summarised with emphasis on unresolved problems. The HERA upgrade and its impact on future heavy flavour measurements is briefly discussed

  18. Flavour blindness and patterns of flavour symmetry breaking in lattice simulations of up, down and strange quarks

    Energy Technology Data Exchange (ETDEWEB)

    Bietenholz, W. [Univ. Autonoma de Mexico, Mexico City (Mexico). Inst. de Ciencias Nucleares; Bornyakov, V. [Inst. for High Energy Physics, Protovino (Russian Federation); Inst. for Theoretical and Experimental Physics, Moscow (Russian Federation); Goeckeler, M. [Regensburg Univ. (DE). Inst. fuer Theoretische Physik] (and others)

    2011-02-15

    QCD lattice simulations with 2+1 flavours typically start at rather large up-down and strange quark masses and extrapolate first the strange quark mass to its physical value and then the up-down quark mass. An alternative method of tuning the quark masses is discussed here in which the singlet quark mass is kept fixed, which ensures that the kaon always has mass less than the physical kaon mass. Using group theory the possible quark mass polynomials for a Taylor expansion about the flavour symmetric line are found, first for the general 1+1+1 flavour case and then for the 2+1 flavour case (when two quark flavours are mass degenerate). These enable highly constrained fits to be used in the extrapolation of hadrons to the physical pion mass. Numerical results for the 2+1 flavour case confirm the usefulness of this expansion and an extrapolation to the physical pion mass gives hadron mass values to within a few percent of their experimental values. Singlet quantities remain constant which allows the lattice spacing to be determined from hadron masses (without necessarily being at the physical point). Furthermore an extension of this programme to include partially quenched results is also given. (orig.)

  19. Summary of the Minor Actinide-bearing MOX AFC-2C and -2D Irradiations

    International Nuclear Information System (INIS)

    The AFC-2C and AFC-2D irradiations were conducted by the US-DOE under the Advanced Fuel Cycle program with primary objectives of: 1) evaluating the use of a Cd-shrouded capsule to mimic fast neutron spectrum conditions for testing transmutation fuels in the Advanced Test Reactor (ATR), and 2) obtaining a preliminary assessment of the performance characteristics of minor actinide bearing mixed oxide (MA-MOX) fuel under conditions for service in a fast reactor. The AFC-2C and AFC-2D tests targeted intermediate and high burn-ups, respectively, where each test included nominal MA-MOX compositions of (U0.75Pu0.20Np0.02Am0.03)O2-x with x = 0.02 and 0.05 along with reference (U0.80Pu0.20)O1.98 MOX. This paper describes the design of the ATR irradiation configuration and fabrication of the MA-MOX fuel and associated test hardware. In addition, the specifics of the AFC-2C and AFC-2D irradiation tests are presented along with the baseline nondestructive and destructive postirradiation examination (PIE) that has been completed to date. (author)

  20. Gauge Invariants and Correlators in Flavoured Quiver Gauge Theories

    CERN Document Server

    Mattioli, Paolo

    2016-01-01

    In this paper we study the construction of holomorphic gauge invariant operators for general quiver gauge theories with flavour symmetries. Using a characterisation of the gauge invariants in terms of equivalence classes generated by permutation actions, along with representation theory results in symmetric groups and unitary groups, we give a diagonal basis for the 2-point functions of holomorphic and anti-holomorphic operators. This involves a generalisation of the previously constructed Quiver Restricted Schur operators to the flavoured case. The 3-point functions are derived and shown to be given in terms of networks of symmetric group branching coefficients. The networks are constructed through cutting and gluing operations on the quivers.

  1. Scientific Opinion on the safety and efficacy of aliphatic, alicyclic and aromatic saturated and unsaturated tertiary alcohols and esters with esters containing tertiary alcohols ethers (chemical group 6 when used as flavourings for all animal species

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP

    2012-11-01

    Full Text Available Chemical group 6 consists of aliphatic, alicyclic and aromatic saturated and unsaturated tertiary alcohols and esters with esters containing tertiary alcohols ethers, of which 13 are currently authorised for use as flavours in food. The high use level proposed by the applicant for linalool (25 mg/kg complete feed is safe for salmonids, veal calves, cattle for fattening and pets (excluding cats without a margin of safety with the exception of dogs (SF = 1.4. The safe use level for pigs and dairy cows is 20, for piglets 12 and for poultry 10 mg/kg complete feed. The high use level of 5 mg/kg complete feed for linalyl acetate, linalyl butyrate, linalyl formate, linalyl propionate, linalyl isobutyrate, terpineol, α-terpineol and terpineol acetate and 4-terpinenol is safe for all species with a margin of safety of 1.2 to 12. For nerolidol, 2-methyl-1-phenylpropan-2-ol and 2-(4-methylphenylpropan-2-ol, the maximum safe concentration is 1 mg/kg complete feed for pigs and poultry and 1.5 mg/kg complete feed for all other species. The absence of a margin of safety would not allow the simultaneous administration in feed and water for drinking of the following compounds: linalool, nerolidol, 2-methyl-1-phenylpropan-2-ol and 2-(4methylphenylpropan-2-ol. No safety concern would arise for the consumer from the use of compounds belonging to CG 6 up to the highest safe level in feedingstuffs for all animal species. All compounds should be considered as irritants to skin, eyes and respiratory tract, and as skin sensitisers. All compounds of CG 6 are predicted to be safe to the soil compartment when used at levels safe to the target species. Using predictions based on chemical structure, 2-methyl-1-phenylpropan-2-ol and 2-(4-methylphenylpropan-2-ol were estimated to be safe to aquatic compartments. In the absence of experimental data, safety to aquatic compartments could not be established for linalyl butyrate, linalyl isobutyrate, terpineol acetate, 4

  2. Hypersensitivity to electricity; Gibt es Elektrosensibilitaet im D-Netzbereich. Ein 3-AFC-Doppelblindversuch

    Energy Technology Data Exchange (ETDEWEB)

    Radon, K.; Maschke, C. [Technische Univ. Berlin (Germany). Inst. fuer Technische Akustik

    1998-07-01

    An increasing number of people are claiming that they are hypersensitive to electricity. A double blind provocative study was carried out using a 3-AFC-method to verify the possible perception of pulsed electromagnetic fields (carrier frequency 900 MHz pulse modulated with 217 Hz) as emitted from modern digital wireless telecommunication devices (GSM standard). The reactions of 11 persons were observed who claimed to be hypersensitive to electricity. Each subject was tested twelve times over one day. A hypersensitivity to electromagnetic fields could not be confirmed for these persons because neither the mean of the group nor one of the individuals reached the classical perceptive threshold. When the first six tests were compared to the last six, no differences could be observed. Thus, too short breaks between retesting or a habituation to the electromagnetic fields could not be verified. However, because of the small number of cases, further investigations are necessary. The results of the study helped to optimize the design and performing conditions for subsequent tests with more subjects and more tests per subject. (orig.) [Deutsch] Eine steigende Anzahl von Personen klagt ueber unspezifische Krankheitssymptome durch das Vorhandensein elektromagnetischer Felder (Elektrosensibilitaet). Zum objektiven Nachweis einer moeglichen Wahrnehmbarkeit von elektromagnetischen Feldern mit D-Netz Frequenz, wie sie von Mobilfunksendemasten ausgestrahlt werden, wurde ein Doppelblindprovokationsversuch nach einem 3-AFC-Verfahren durchgefuehrt. Hierbei wurde die Reaktion von elf sich selbst als elektrosensibel einstufenden Probanden beobachtet. Jede Person nahm an zwoelf ueber einen Tag verteilten Versuchen teil. Die klassische Wahrnehmungsschwelle wurde weder im Gruppenmittel noch von einzelnen Probanden ueberschritten. Es konnte folglich das Vorhandensein einer Elektrosensibilitaet an dem untersuchten Kollektiv nicht bestaetigt werden. Die weitergehende Auswertung der Versuche

  3. Lepton flavour violating decays of $\\mu$ and $\\tau$ lepton in a gauge group $SU_L(2)\\times SU_R(2)\\times SU_l(2)$

    CERN Document Server

    Fayyazuddin,

    2016-01-01

    A model for electroweak unification based on gauge group $ SU_L(2)\\times SU_R(2)\\times SU_l(2) $ for leptons is formulated. The group $SU_l(2)$ is in the lepton space.The left handed leptons and anti-leptons are assigned to the fundamental representation $(2,2,\\bar{2})$ of the group.The left- right symmetric gauge group $ SU_L(2)\\times SU_R(2)\\times U_{Y_1}(1) $ is contained in the above group for leptons. Out of three vector bossons $ Y_\\mu^\\pm $,$Y_{3\\mu}$ of $SU_l(2)$,the charged vector bosons $Y_\\mu^\\pm$ mediate the lepton number violating $ \\mu$ and $\\tau$ decays. The neutral vector bosson $ Y_{3\\mu}$ with coupling constant $ g_{Y}$ plays the same role as the vector bosson $B_{1\\mu}$ with coupling constant $g_1$ associated with Abelian part $ U_{Y_1}(1)$ with $Y_1=\\mp1$ for leptons and anti leptons. The left handed quarks and anti quarks are assigned to representations (2,1) and (1,2) with $Y_1=\\pm \\frac{1}{3}$ of the left-right symmetric gauge group. The lepton number violating $\\mu~and~\\tau$ decays sim...

  4. Phenomenological aspects of flavoured dark matter

    CERN Document Server

    Blanke, Monika

    2015-01-01

    Flavour symmetries in the dark sector are a theoretically motivated and phenomenologically appealing concept. The dark matter particle can be stabilised with the help of flavour symmetries, without the need to introduce an additional discrete symmetry by hand. Apart from the usual searches in direct and indirect detection experiments and high energy colliders, flavoured dark matter generally also gives rise to new flavour violating interactions leading to interesting signatures in rare meson decays. This proceedings article reviews a simplified model of flavoured dark matter in which the dark matter coupling to quarks constitutes a new source of flavour violation, so that the model goes beyond Minimal Flavour Violation. Particular emphasis is put on the discussion of its phenomenological implications in flavour, collider and direct detection experiments.

  5. A four-alternative forced choice (4AFC) software for observer performance evaluation in radiology

    Science.gov (United States)

    Zhang, Guozhi; Cockmartin, Lesley; Bosmans, Hilde

    2016-03-01

    Four-alternative forced choice (4AFC) test is a psychophysical method that can be adopted for observer performance evaluation in radiological studies. While the concept of this method is well established, difficulties to handle large image data, perform unbiased sampling, and keep track of the choice made by the observer have restricted its application in practice. In this work, we propose an easy-to-use software that can help perform 4AFC tests with DICOM images. The software suits for any experimental design that follows the 4AFC approach. It has a powerful image viewing system that favorably simulates the clinical reading environment. The graphical interface allows the observer to adjust various viewing parameters and perform the selection with very simple operations. The sampling process involved in 4AFC as well as the speed and accuracy of the choice made by the observer is precisely monitored in the background and can be easily exported for test analysis. The software has also a defensive mechanism for data management and operation control that minimizes the possibility of mistakes from user during the test. This software can largely facilitate the use of 4AFC approach in radiological observer studies and is expected to have widespread applicability.

  6. Flavour Physics of Leptons and Dipole Moments.

    OpenAIRE

    Raidal, M.; van der Schaaf, A.; Bigi, I.; Mangano, M.L.; Semertzidis, Y.; Abel, S.; Albino, S.; Antusch, S.; Arganda, E.; Bajc, B.; Banerjee, S.; Biggio, C.; Blanke, M.; W. Bonivento; Branco, G. C.

    2008-01-01

    This chapter of the report of the ``Flavour in the era of the LHC'' Workshop discusses the theoretical, phenomenological and experimental issues related to flavour phenomena in the charged lepton sector and in flavour-conserving CP-violating processes. We review the current experimental limits and the main theoretical models for the flavour structure of fundamental particles. We analyze the phenomenological consequences of the available data, setting constraints on explicit models beyond the ...

  7. Flavour symmetry breaking and tuning the strange quark mass for 2+1 quark flavours

    Energy Technology Data Exchange (ETDEWEB)

    Bietenholz, W. [Universidad Autonoma de Mexico (Mexico). Inst. de Ciencias Nucleares; Bornyakov, V. [Institute for High Energy Physics, Protovino (Russian Federation); Institute of Theoretical and Experimental Physics, Moscow (Russian Federation); Goeckeler, M. [Regensburg Univ. (DE). Inst. fuer Theoretische Physik] (and others)

    2010-12-15

    QCD lattice simulations with 2+1 flavours typically start at rather large up-down and strange quark masses and extrapolate first the strange quark mass to its physical value and then the updown quark mass. An alternative method of tuning the quark masses is discussed here in which the singlet quark mass is kept fixed, which ensures that the kaon always has mass less than the physical kaon mass. Using group theory the possible quark mass polynomials for a Taylor expansion about the flavour symmetric line are found, which enables highly constrained fits to be used in the extrapolation of hadrons to the physical pion mass. Numerical results confirm the usefulness of this expansion and an extrapolation to the physical pion mass gives hadron mass values to within a few percent of their experimental values. (orig.)

  8. Heavy flavour at the Large Hadron Collider

    CERN Document Server

    Gibson, V

    2013-01-01

    Heavy flavour physics provides a crucial role in the validation of the Standard Model of particle physics and in the search for new phenomena beyond. This review provides a personal summary of the headline results as of May 2013 from the LHC heavy flavour community in the subject areas of heavy flavour production and spectroscopy, mixing and CP violation and rare decays.

  9. Flavour-active wine yeasts

    OpenAIRE

    Cordente, Antonio G.; Curtin, Christopher D.; Varela, Cristian; Pretorius, Isak S.

    2012-01-01

    The flavour of fermented beverages such as beer, cider, saké and wine owe much to the primary fermentation yeast used in their production, Saccharomyces cerevisiae. Where once the role of yeast in fermented beverage flavour was thought to be limited to a small number of volatile esters and higher alcohols, the discovery that wine yeast release highly potent sulfur compounds from non-volatile precursors found in grapes has driven researchers to look more closely at how choice of yeast can infl...

  10. Forensics of Software Copyright Infringement Crimes: The Modern POSAR Test Juxtaposed With the Dated AFC Test

    Directory of Open Access Journals (Sweden)

    Vinod Polpaya Bhattathiripad

    2014-09-01

    Full Text Available This paper presents a new development in the forensics of software copyright through a juxtaposed comparison between the proven AFC test and the recent POSAR test, the two forensic procedures for establishing software copyright infringement cases. First, the paper separately overviews the 3-stage, linear sequential AFC test and then the 5-phase, cyclic POSAR test (as AFC’s logical extension. The paper then compares the processes involved in each of the 5 phases of the POSAR test with the processes involved in the 3 stages in the AFC test, for the benefit of forensic practitioners and researchers. Finally, the paper discusses some common areas where both the tests will need careful handling while implementing them in the judiciaries across the world.

  11. Reducing friction-induced vibration using intelligent active force control (AFC) with piezoelectric actuators

    Indian Academy of Sciences (India)

    S M Hashemi-Dehkordi; A R Abu-Bakar; M Mailah

    2012-12-01

    In this paper, a novel approach to reduce the effect of mode coupling that causes friction induced vibration (FIV) is proposed by applying an intelligent active force control (AFC)-based strategy employing piezoelectric actuators with hysteresis effect to a simplified two degree-of-freedom mathematical model of a friction-induced vibration system. At first, the model is simulated and analysed using a closed loop pure Proportional-Integral-Derivative (PID) controller. Later, it is integrated with the intelligent AFC with fuzzy logic (FL) estimator and simulated under similar operating condition. After running several tests with different sets of operating and loading conditions, the results both in time and frequency domains show that the PID controller with the intelligent AFC is much more effective in reducing the vibration, compared to the pure PID controller alone.

  12. Selected results on heavy flavour physics at LHCb

    CERN Document Server

    Charles, Matthew

    Selected results from the LHCb experiment in the domain of heavy flavour particle physics are presented. These results are split into two groups: the first concerns searches for new physics in the decays of charmed hadrons, and the second consists of studies of the spectroscopy of baryons.

  13. Maximal conserved flavour symmetry in models with complementarity

    International Nuclear Information System (INIS)

    Models with complementarity for massless composite fermions are investigated. Through a study of 't Hooft's equations, we find a simple general criterion for the maximal conserved flavour group in terms of a given set of bi-fermion condensates in the Higgs picture. (orig.)

  14. Flavour Changing Higgs Couplings in a Class of Two Higgs Doublet Models

    CERN Document Server

    Botella, F J; Nebot, M; Rebelo, M N

    2015-01-01

    We analyse various flavour changing processes like $t\\to hu,hc$, $h\\to \\tau e,\\tau\\mu$ as well as hadronic decays $h\\to bs,bd$, in the framework of a class of two Higgs doublet models where there are flavour changing neutral scalar currents at tree level. These models have the remarkable feature of having these flavour-violating couplings entirely determined by the CKM and PMNS matrices as well as $\\tan\\beta$. The flavour structure of these scalar currents results from a symmetry of the Lagrangian and therefore it is natural and stable under the renormalization group. We show that in some of the models the rates of the above flavour changing processes can reach the discovery level at the LHC at 13 TeV even taking into account the stringent bounds on low energy processes, in particular $\\mu\\to e\\gamma$.

  15. Flavour-changing Higgs couplings in a class of two Higgs doublet models

    Energy Technology Data Exchange (ETDEWEB)

    Botella, F.J. [Universitat de Valencia-CSIC, Departament de Fisica Teorica y IFIC, Burjassot (Spain); Branco, G.C. [Universitat de Valencia-CSIC, Departament de Fisica Teorica y IFIC, Burjassot (Spain); Instituto Superior Tecnico (IST), Lisboa Univ., Departamento de Fisica and Centro de Fisica Teorica de Particulas (CFTP), Lisbon (Portugal); Nebot, M. [Instituto Superior Tecnico (IST), Lisboa Univ., Centro de Fisica Teorica de Particulas (CFTP), Lisbon (Portugal); Rebelo, M.N. [Instituto Superior Tecnico (IST), Lisboa Univ., Departamento de Fisica and Centro de Fisica Teorica de Particulas (CFTP), Lisbon (Portugal)

    2016-03-15

    We analyse various flavour-changing processes like t → hu, hc, h → τe, τμ as well as hadronic decays h @→ bs, bd, in the framework of a class of two Higgs doublet models where there are flavour-changing neutral scalar currents at tree level. These models have the remarkable feature of having these flavour-violating couplings entirely determined by the CKM and PMNS matrices as well as tan β. The flavour structure of these scalar currents results from a symmetry of the Lagrangian and there fore it is natural and stable under the renormalisation group. We show that in some of the models the rates of the above flavour-changing processes can reach the discovery level at the LHC at 13 TeV even taking into account the stringent bounds on low energy processes, in particular μ @→ eγ. (orig.)

  16. Flavour physics and CP violation

    Indian Academy of Sciences (India)

    Rukmani Mohanta; Anjan Kumar Giri

    2010-05-01

    It is well known that the study of flavour physics and CP violation is very important to critically test the Standard Model and to look for possible signature of new physics beyond it. The observation of CP violation in kaon system in 1964 has ignited a lot of experimental and theoretical efforts to understand its origin and to look for CP violation effects in other systems besides the neutral kaons. The two -factories BABAR and BELLE, along with other experiments, in the last decade or so made studies in flavour physics and CP violation a very interesting one. In this article we discuss the status and prospectives of the flavour physics associated with the strange, charm and bottom sectors of the Standard Model. The important results in kaon sector will be briefly discussed. Recently, mixing in the charm system has been observed, which was being pursued for quite some time without any success. The smallness of the mixing parameters in the charm system is due to the hierarchical structure of the CKM matrix. Interestingly, so far we have not found CP violation in the charm system but in the future, with more dedicated experiments at charm threshold, the situation could change. Many interesting observations have been made in the case of bottom mesons and some of them show some kind of deviations from that of the Standard Model expectations which are mainly associated with the → flavour changing neutral current transitions. It is long believed that the system could be the harbinger of new physics since it is a system in which both bottom and strange quarks are the constituents. Recently, D0 and CDF announced their result for the mixing which is claimed to be the first possible new physics signature in the flavour sector. We plan to touch upon all important issues pointing out both theoretical and experimental developments and future prospects in this review article.

  17. Role of anterior piriform cortex in the acquisition of conditioned flavour preference.

    Science.gov (United States)

    Mediavilla, Cristina; Martin-Signes, Mar; Risco, Severiano

    2016-01-01

    Flavour aversion learning (FAL) and conditioned flavour preference (CFP) facilitate animal survival and play a major role in food selection, but the neurobiological mechanisms involved are not completely understood. Neuroanatomical bases of CFP were examined by using Fos immunohistochemistry to record neuronal activity. Rats were trained over eight alternating one-bottle sessions to acquire a CFP induced by pairing a flavour with saccharin (grape was CS+ in Group 1; cherry in Group 2; in Group 3, grape/cherry in half of animals; Group 4, grape/cherry in water). Animals were offered the grape flavour on the day immediately after the training and their brains were processed for c-Fos. Neurons evidencing Fos-like immunoreactivity were counted in the infralimbic cortex, nucleus accumbens core, and anterior piriform cortex (aPC). Analysis showed a significantly larger number of activated cells after learning in the aPC alone, suggesting that the learning process might have produced a change in this cortical region. Ibotenic lesions in the aPC blocked flavour-taste preference but did not interrupt flavour-toxin FAL by LiCl. These data suggest that aPC cells may be involved in the formation of flavour preferences and that the integrity of this region may be specifically necessary for the acquisition of a CFP. PMID:27624896

  18. Scientific Opinion on Flavouring Group Evaluation 77, Revision 1 (FGE.77Rev1: Consideration of Pyridine, Pyrrole and Quinoline Derivatives evaluated by JECFA (63rd meeting structurally related to Pyridine, Pyrrole, Indole and Quinoline Derivatives evaluated by EFSA in FGE.24Rev2 (2013

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF

    2014-02-01

    Full Text Available The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA, and to decide whether further evaluation is necessary, as laid down in Commission Regulation (EC No 1565/2000. The present consideration concerns a group of 22 pyridine, pyrrole and quinoline derivatives evaluated by the JECFA (63rd meeting. The revision of this consideration is made since additional toxicity data have become available for isoquinoline [FL-no: 14.001], pyrrole [FL-no: 14.041] and 2-acetylpyrrole [FL-no: 14.047]. The toxicity data on 2-acetylpyrrole should also cover 2-propionylpyrrole [FL-no: 14.068]. Further, additional genotoxicity data on 6-methylquinoline [FL-no: 14.042] have become available. The Panel concluded that for 6-methylquinoline [FL-no: 14.042], the new genotoxicity data did not clear the concern with respect to genotoxicity in vitro and accordingly the substance is not evaluated through the Procedure. For 18 substances [FL-no: 14.001, 14.004, 14.007, 14.030, 14.038, 14.039, 14.041, 14.047, 14.058, 14.059, 14.060, 14.061, 14.065, 14.066, 14.068, 14.071, 14.072 and 14.164] considered in this FGE, the Panel agrees with the JECFA conclusion, “No safety concern at estimated levels of intake as flavouring substances” based on the MSDI approach. For three substances [FL-no: 13.134, 14.045 and 14.046], additional toxicological data are still required. Besides the safety assessment of these flavouring substances, the specifications for the materials of commerce have also been evaluated, and the information is considered adequate for all the substances.

  19. AMH and AFC as predictors of excessive response in controlled ovarian hyperstimulation : a meta-analysis

    NARCIS (Netherlands)

    Broer, S. L.; Dolleman, M.; Opmeer, B. C.; Fauser, B. C.; Mol, B. W.; Broekmans, F. J. M.

    2011-01-01

    background: Anti-Mullerian hormone (AMH) is a marker of ovarian reserve status and represents a good predictor of ovarian response to ovarian hyperstimulation. The aim of this study was to assess the accuracy of AMH and antral follicle count (AFC) as predictors of an excessive response in IVF/ICSI t

  20. EFSA ; Scientific Opinion on Flavouring Group Evaluation 94, Revision 1 (FGE.94Rev1): Consideration of aliphatic amines and amides evaluated in an addendum to the group of aliphatic and aromatic amines and amides evaluated by the JECFA (68th meeting)

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further...... substance, [FL-no: 16.090], the composition of the stereoisomeric mixture has to be specified....

  1. Quark-flavour phenomenology of models with extended gauge symmetries

    International Nuclear Information System (INIS)

    Gauge invariance is one of the fundamental principles of the Standard Model of particles and interactions, and it is reasonable to believe that it also regulates the physics beyond it. In this thesis we have studied the theory and phenomenology of two New Physics models based on gauge symmetries that are extensions of the Standard Model group. Both of them are particularly interesting because they provide some answers to the question of the origin of flavour, which is still unexplained. Moreover, the flavour sector represents a promising field for the research of indirect signatures of New Physics, since after the first run of LHC we do not have any direct hint of it yet. The first model assumes that flavour is a gauge symmetry of nature, SU(3)3f, spontaneously broken by the vacuum expectation values of new scalar fields; the second model is based on the gauge group SU(3)c x SU(3)L x U(1)X, the simplest non-abelian extension of the Standard Model group. We have traced the complete theoretical building of the models, from the gauge group, passing through the nonanomalous fermion contents and the appropriate symmetry breakings, up to the spectra and the Feynman rules, with a particular attention to the treatment of the flavour structure, of tree-level Flavour Changing Neutral Currents and of new CP-violating phases. In fact, these models present an interesting flavour phenomenology, and for both of them we have analytically calculated the contributions to the ΔF=2 and ΔF=1 down-type transitions, arising from new tree-level and box diagrams. Subsequently, we have performed a comprehensive numerical analysis of the phenomenology of the two models. In both cases we have found very effective the strategy of first to identify the quantities able to provide the strongest constraints to the parameter space, then to systematically scan the allowed regions of the latter in order to obtain indications about the key flavour observables, namely the mixing parameters of the

  2. The STAR Heavy Flavour Tracker

    International Nuclear Information System (INIS)

    In order to understand the partonic EOS of matter created at RHIC, one needs to study both the collectivity of the produced matter and the degree of thermalization. We propose to address this physics through the study of heavy flavour hadrons in high-energy nuclear collisions at RHIC. The heavy flavour tracker (HFT), a tracking upgrade of the STAR experiment, is being designed to provide an unambiguous measurement of charm hadrons through the direct reconstruction of hadronic decays. These measurements require high accuracy space points near the collision vertex. The current design of our detector uses a novel CMOS-based sensor, allowing for a low-mass and high-resolution detector element. We provide rate estimations for D0 v2 measurements in Au+Au collisions at 200 GeV

  3. The flavour of natural SUSY

    Energy Technology Data Exchange (ETDEWEB)

    Bruemmer, Felix [SISSA/ISAS, Trieste (Italy); Kraml, Sabine; Kulkarni, Suchita; Smith, Christopher [Universite Grenoble-Alpes, CNRS/IN2P3, Laboratoire de Physique Subatomique et de Cosmologie, Grenoble Cedex (France)

    2014-09-15

    An inverted mass hierarchy in the squark sector, as in so-called ''natural supersymmetry'', requires non-universal boundary conditions at the mediation scale of supersymmetry breaking. We propose a formalism to define such boundary conditions in a basis-independent manner and apply it to generic scenarios where the third-generation squarks are light, while the first two-generation squarks are heavy and near-degenerate. We show that not only is our formalism particularly well suited to study such hierarchical squark mass patterns, but in addition the resulting soft terms at the TeV scale are manifestly compatible with the principle of minimal flavour violation, and thus automatically obey constraints from flavour physics. (orig.)

  4. Neutrino and Changed Lepton Flavour Today

    CERN Document Server

    Alonso, R; Hernandez, D; Merlo, L; Rigolin, S

    2013-01-01

    Flavour physics is a priceless window on physics beyond the Standard Model. In particular, flavour violation in the lepton sector looks very promising, as high precision measurements are prospected in future experiments investigating on $\\mu\\rightarrow e$ conversion in atomic nuclei: the predictions for this observable are analysed in the context of the type I Seesaw mechanism. Furthermore, new ideas to explain the Flavour Puzzle recently appeared, mainly based on a possible dynamical origin of the Yukawa couplings and on flavour symmetries. The focus of this proceeding will be set on the Minimal Flavour Violation ansatz and on the role of the neutrino Majorana character: when an $O(2)_{N}$ flavour symmetry acts on the right-handed neutrino sector, the minimum of the scalar potential allows for large mixing angles -in contrast to the simplest quark case- and predicts a maximal Majorana phase. This leads to a strong correlation between neutrino mass hierarchy and mixing pattern.

  5. EFSA Panel on food contact materials, enzymes, flavourings and processing aids (CEF); Scientific Opinion on Flavouring Group Evaluation 74, Revision 1 (FGE.74Rev1): Consideration of Simple Aliphatic Sulphides and Thiols evaluated by the JECFA (53rd and 61st meeting) Structurally related to Aliphatic and Alicyclic Mono-, Di-, Tri-, and Polysulphides with or without Additional Oxygenated Functional Groups from Chemical Group 20 evaluated by EFSA in FGE.08Rev1 (2009)

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    Member States. In particular, the Panel was requested to consider the Joint FAO/WHO Expert Committee on Food Additives (the JECFA) evaluations of flavouring substances assessed since 2000, and to decide whether no further evaluation is necessary, as laid down in Commission Regulation (EC) No 1565......-no: 12.009, 12.020, 12.045, 12.169, 12.238, 12.239 and 12.291] information on secondary components and/or composition of mixture is requested. For six substances [FL-no: 12.009, 12.020, 12.023, 12.045, 12.074 and 12.155] no solubility in ethanol and/or solubility in water is available. Finally, the...

  6. Flavour perception: aroma, taste and texture interactions

    OpenAIRE

    Tournier, Carole; Sulmont-Rossé, Claire; Guichard, Elisabeth

    2007-01-01

    Flavour perception is determinant for the acceptability of food products by consumers. Aroma and taste play an important role in flavour perception and it is well known that the chemical composition of the matrix and consequently its structure influences release and perception of flavour. However, from simultaneous measurements of human perception and physical concentration in vivo, texture – aroma and texture – taste interactions are not always explained by physico-chemical mechanisms. Moreo...

  7. Flavour Chemistry of Chicken Meat: A Review

    OpenAIRE

    Jayasena, Dinesh D.; Ahn, Dong Uk; Nam, Ki Chang; Jo, Cheorun

    2013-01-01

    Flavour comprises mainly of taste and aroma and is involved in consumers’ meat-buying behavior and preferences. Chicken meat flavour is supposed to be affected by a number of ante- and post-mortem factors, including breed, diet, post-mortem ageing, method of cooking, etc. Additionally, chicken meat is more susceptible to quality deterioration mainly due to lipid oxidation with resulting off-flavours. Therefore, the intent of this paper is to highlight the mechanisms and chemical compounds res...

  8. Definitions of minimal flavour violation for leptons

    International Nuclear Information System (INIS)

    Neutrino masses imply the violation of lepton flavour and new physics beyond the Standard Model. However, flavour change has only been observed in oscillations. In analogy with the quark sector, we could deduce the existence of a principle of Minimal Flavour Violation also for Leptons (MFVL). Such an extension is not straightforward, since the mechanisms generating neutrino masses are unknown and many scenarios can be envisaged. Thus, we explore some possible definitions of MFVL and propose a notion that can include many models. We show, furthermore, that flavour violating processes are not necessarily controlled by the PMNS mixing matrix. (author)

  9. Heavy flavour physics

    CERN Document Server

    CERN. Geneva. Physics Department; Blaschke, D; Bodwin, G T; Carrer, N; Cole, B; Crochet, Philippe; Dainese, A; Deandrea, A; Frixione, Stefano; Hoyer, P; Kharzeev, Dima E; Kodolova, Olga; Kvatadze, R A; Lee Jun Gil; Vogt, Ramona; Lokhtin, Igor P; Mangano, Michelangelo L; Nardi, M; Nardulli, Giuseppe; Niemi, H; Peigné, S; Petreczky, P; Polosa, Antonio; Satz, Helmut; Takai, H; Tapprogge, Stefan; Thews, R L; Vercellin, Ermanno; Marchal, N

    2004-01-01

    We present the results from the heavy quarks and quarkonia working group. This report gives benchmark heavy quark and quarkonium cross sections for $pp$ and $pA$ collisions at the LHC against which the $AA$ rates can be compared in the study of the quark-gluon plasma. We also provide an assessment of the theoretical uncertainties in these benchmarks. We then discuss some of the cold matter effects on quarkonia production, including nuclear absorption, scattering by produced hadrons, and energy loss in the medium. Hot matter effects that could reduce the observed quarkonium rates such as color screening and thermal activation are then discussed. Possible quarkonium enhancement through coalescence of uncorrelated heavy quarks and antiquarks is also described. Finally, we discuss the capabilities of the LHC detectors to measure heavy quarks and quarkonia as well as the Monte Carlo generators used in the data analysis.

  10. CP and Lepton-Number Violation in GUT Neutrino Models with Abelian Flavour Symmetries

    OpenAIRE

    Ellis, John; Gomez, Mario E.; Lola, Smaragda

    2006-01-01

    We study the possible magnitudes of CP and lepton-number-violating quantities in specific GUT models of massive neutrinos with different Abelian flavour groups, taking into account experimental constraints and requiring successful leptogenesis. We discuss SU(5) and flipped SU(5) models that are consistent with the present data on neutrino mixing and upper limits on the violations of charged-lepton flavours and explore their predictions for the CP-violating oscillation and Majorana phases. In ...

  11. Heavy flavour production at CMS

    CERN Document Server

    Negro, Giulia

    2016-01-01

    Three recent results in heavy flavour production at the CMS experiment are addressed in this report. Measurements of the differential production cross sections of B hadron and quarkonium states in pp collisions at $\\sqrt{s} = 13$ TeV are presented. These are important tools to investigate heavy-quark production mechanisms in QCD. The dependences on transverse momentum and rapidity are investigated and comparisons with theory expectations and among different collision energies are provided. Also the new observation of $\\Upsilon(1S)\\Upsilon(1S)$ production is reported.

  12. Production of Japanese Soy-Sauce Flavours

    NARCIS (Netherlands)

    Sluis, van der C.

    2001-01-01

    The salt-tolerant yeasts Zygosaccharomyces rouxii and Candida versatilis are important for the formation of flavour in Japanese soy-sauce processes. In these processes Z. rouxii produces the flavour components ethanol, higher alcohols and 4-hydroxyfuranones, while C. versatilis is responsible for th

  13. Lepton flavour violation searches at the LHC

    CERN Document Server

    Dawe, Edmund; The ATLAS collaboration

    2015-01-01

    Recent results from searches for lepton flavour violation performed by ATLAS and CMS in the $\\sqrt{s}=8~\\text{TeV}$ data are presented. The search for $Z\\rightarrow e\\mu$ and lepton flavour violating heavy neutral particle decays are summarized before covering the search for $H\\rightarrow \\mu \\tau$ in greater detail.

  14. Spontaneous CP violation and neutral flavour conservation

    International Nuclear Information System (INIS)

    The conditions for one-loop stability of neutral flavour conservation in SU(2)LxU(1) models with spontaneous CP violation are analysed. In addition to previously known cases there is an essentially unique two-generation model with two Higgs doublets where neutral flavour conservation is guaranteed to all orders by a non-standard CP symmetry. (orig.)

  15. Flavour physics and CP-violation

    International Nuclear Information System (INIS)

    An introductory overview of the Standard Model description of flavour is presented. The main emphasis is put on present tests of the quark-mixing matrix structure and the phenomenological determination of its parameters. Special attention is given to the experimental evidence for CP-violation and its important role in our understanding of flavour dynamics. (author)

  16. Recent studies on the biogeneration of flavours

    Energy Technology Data Exchange (ETDEWEB)

    Fuganti, Claudio; Zucchi, Gioia [CNR, Milan (Italy). Dipt. di Chimica del Politecnico

    1997-07-01

    The requirements by the flavour industry for large quantities of natural flavouring compounds, has stimulated the research for enzymatic procedures enabling the access from extractive precursor to rare odorants not accessible by extraction, including alcohols, aldehyde, lactones and sulfurated compounds. The ability of the SNIF-NMR technique in the authentication of the products is discussed.

  17. Holiday Destination Choice Behavior Analysis Based on AFC Data of Urban Rail Transit

    Directory of Open Access Journals (Sweden)

    Chang-jun Cai

    2015-01-01

    Full Text Available For urban rail transit, the spatial distribution of passenger flow in holiday usually differs from weekdays. Holiday destination choice behavior analysis is the key to analyze passengers’ destination choice preference and then obtain the OD (origin-destination distribution of passenger flow. This paper aims to propose a holiday destination choice model based on AFC (automatic fare collection data of urban rail transit system, which is highly expected to provide theoretic support to holiday travel demand analysis for urban rail transit. First, based on Guangzhou Metro AFC data collected on New Year’s day, the characteristics of holiday destination choice behavior for urban rail transit passengers is analyzed. Second, holiday destination choice models based on MNL (Multinomial Logit structure are established for each New Year’s days respectively, which takes into account some novel explanatory variables (such as attractiveness of destination. Then, the proposed models are calibrated with AFC data from Guangzhou Metro using WESML (weighted exogenous sample maximum likelihood estimation and compared with the base models in which attractiveness of destination is not considered. The results show that the ρ2 values are improved by 0.060, 0.045, and 0.040 for January 1, January 2, and January 3, respectively, with the consideration of destination attractiveness.

  18. A wideband frequency synthesizer with VCO and AFC co-design for fast calibration

    International Nuclear Information System (INIS)

    A wideband fractional-N frequency synthesizer is implemented in a 65 nm CMOS process. It employs a wideband LC voltage-controlled oscillator (VCO) with optimized VCO gain (KVCO) and a sub-band step to improve automatic frequency calibration (AFC) efficiency at negligible expense of phase noise performance. An agile AFC is realized by direct mapping based on the division ratio, and optional redundant counting and comparing calibration is introduced accommodating PVT variations, which samples the reference clock using the prescaled VCO output as a discriminating clock. A charge pump with switched charging current is adopted to compensate for the loop bandwidth variation. Measurement results show this directly-mapped AFC locates the target sub-band in 100 ns and only needs 1.2 μs for redundant calibration. The frequency synthesizer spans a frequency range from 0.62 to 1.52 GHz, with phase noise of −86 dBc/Hz at 10 kHz offset and −122 dBc/Hz at 1 MHz offset while consuming 9.76 mA from a 1.2 V supply. (semiconductor integrated circuits)

  19. EFSA ; Scientific Opinion on Flavouring Group Evaluation 91, Revision 1 (FGE.91Rev1): Consideration of simple aliphatic and aromatic sulphides and thiols evaluated by JECFA (53rd and 68th meetings) structurally related to aliphatic and alicyclic mono-, di-, tri-, and polysulphides with or without additional oxygenated functional groups evaluated by EFSA in FGE.08Rev3 (2011)

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further...... have also been considered for the substances evaluated through the Procedure and for three substances, [FL-no: 12.274, 12.284 and 15.049], information on the composition of stereoisomeric mixture is lacking....

  20. Scientific Opinion on the safety and efficacy of straight-chain primary aliphatic alcohols/aldehydes/acids, acetals and esters with esters containing saturated alcohols and acetals containing saturated aldehydes (chemical group 1 when used as flavourings for all animal species

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP

    2013-04-01

    Full Text Available Chemical group 1 (CG 1 consists of straight-chain primary aliphatic alcohols/aldehydes/acids, acetals and esters with esters containing saturated alcohols and acetals containing saturated aldehydes of which 86 are currently authorised for use as flavours in food. The FEEDAP Panel was unable to perform an assessment of ethyl oleate because of its insufficient purity. The following compounds are considered to be safe for all animal species at the use level proposed for feed flavourings: formic acid, acetic acid, propionic acid, octanoic acid, decanoic acid, dodecanoic acid, tetradecanoic acid, hexadecanoic acid, oleic acid, decanol, dodecanol, decyl acetate and dodecyl acetate. The remaining substances are considered safe for all animal species at 5 mg/kg complete feed (with a margin of safety between 1 and 120 and at 25 mg/kg complete feed (ethyl acetate and hexyl acetate, with a margin of safety between 2 and 6; and at 1 mg/kg complete feed for pigs and poultry and 1.5 mg/kg complete feed for all other species (ethylacrylate, ethyl hex-3-enoate, ethyl trans-2-butenoate, ethyl isobutyrate, ethyl isovalerate, butyl isovalerate, methyl isovalerate, hexyl isobutyrate, methyl 2-methyl butyrate, pentyl isovalerate, butyl 2-methyl butyrate, hexyl isovalerate, ethyl 2-methyl butyrate, hexyl 2-methyl butyrate and methyl 2-methylvalerate. No safety concern would arise for the consumer from the use of compounds belonging to CG 1 up to the highest safe level in feedingstuffs for all animal species. The FEEDAP Panel considers it prudent to treat all compounds under assessment as irritants to skin, eyes and respiratory tract and as skin sensitizers. No risk for the safety for the environment is foreseen. Since all 85 compounds are used in food as flavourings, no further demonstration of efficacy is necessary.

  1. The flavour problem and family symmetry beyond the Standard Model

    CERN Document Server

    Dziewit, Bartosz; Richter, Monika; Zając, Sebastian; Zrałek, Marek

    2016-01-01

    In the frame of two Higgs doublet model we try to explain the lepton masses and mixing matrix elements assuming that neutrinos are Dirac particles. Discrete family symmetry groups, which are subgroups of U(3) up to the 1025 order are considered. Like in the one Higgs Standard Model, we found that discrete family symmetries do not give satisfactory answer for this basic questions in the flavour problem.

  2. -chain carboxylic acids from chemical group 5

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 49 flavouring substances in the Flavouring Group Evaluation 07, including additional five substances in this Revision 4, using the Procedure in Commission ...

  3. Minimal gauge-Higgs unification with a flavour symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Martinelli, Guido [Dip. di Fisica, Univ. di Roma ' La Sapienza' , and INFN, Sez. di Roma, Piazzale Aldo Moro 2, 00185 Rome (Italy); Salvatori, Matteo [Dep. de Fisica Teorica, C-XI, and Ist. de Fisica Teorica, C-XVI, Univ. Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Scrucca, Claudio Alessandro [Institut de Physique, Univ. de Neuchatel, Rue Breguet 1, 2000 Neuchatel (Switzerland); Silvestrini, Luca [Dip. di Fisica, Univ. di Roma ' La Sapienza' , and INFN, Sez. di Roma, Piazzale Aldo Moro 2, 00185 Rome (Italy); Physik-Department T31, TU-Muenchen, 85748 Garching (Germany)

    2005-10-15

    We show that a flavour symmetry a la Froggatt-Nielsen can be naturally incorporated in models with gauge-Higgs unification, by exploiting the heavy fermions that are anyhow needed to realize realistic Yukawa couplings. The case of the minimal five-dimensional model, in which the SU(2){sub L} x U(1){sub Y} electroweak group is enlarged to an SU(3){sub W} group, and then broken to U(1){sub em} by the combination of an orbifold projection and a Scherk-Schwarz twist, is studied in detail. We show that the minimal way of incorporating a U(1){sub F} flavour symmetry is to enlarge it to an SU(2){sub F} group, which is then completely broken by the same orbifold projection and Scherk-Schwarz twist. The general features of this construction, where ordinary fermions live on the branes defined by the orbifold fixed-points and messenger fermions live in the bulk, are compared to those of ordinary four-dimensional flavour models, and some explicit examples are constructed.

  4. Flavour Physics and Implication for New Phenomena

    CERN Document Server

    Isidori, Gino

    2015-01-01

    Flavour physics represents one of the most interesting and, at the same time, less understood sector of the Standard Theory. On the one hand, the peculiar pattern of quark and lepton masses, and their mixing angles, may be the clue to some new dynamics occurring at high-energy scales. On the other hand, the strong suppression of flavour-changing neutral-current processes, predicted by the Standard Theory and confirmed by experiments, represents a serious challenge to extend the Theory. This article reviews both these aspects of flavour physics from a theoretical perspective.

  5. Precision physics with heavy-flavoured hadrons

    CERN Document Server

    Koppenburg, Patrick

    2015-01-01

    The understanding of flavour dynamics is one of the key aims of elementary particle physics. The last 15 years have witnessed the triumph of the Kobayashi-Maskawa mechanism, which describes all flavour changing transitions of quarks in the Standard Model. This important milestone has been reached owing to a series of experiments, in particular to those operating at the so-called $B$ factories, at the Tevatron, and now at the LHC. We briefly review status and perspectives of flavour physics, highlighting the results where the LHC has given the most significant contributions, notably including the recent observation of the $B_s^0\\to\\mu^+\\mu^-$ decay.

  6. Selected topics in heavy flavour physics

    International Nuclear Information System (INIS)

    We review the status of flavour physics in spring 2014. The numerous accurate new measurements of flavour experiments have enabled us to test our theoretical understanding of flavour processes with an unprecedented precision. At first sight the dominant amount of measurements seems to be standard model like. Having a closer look one finds, however, that in most of the observables there is still some considerable space for new effects. In addition many discrepancies are still not yet settled. For further investigations and definite conclusions an improvement of the theoretical precision as well as the experimental one is mandatory. Communicated by Professor Alan Martin (topical review)

  7. Novel structured emulsions for delivering of food flavours

    OpenAIRE

    Mao, Like

    2014-01-01

    Flavour release from food is determined by the binding of flavours to other food ingredients and the partition of flavour molecules among different phases. Food emulsions are used as delivery systems for food flavours, and tailored structuring in emulsions provides novel means to better control flavour release. The current study investigated four structured oil-in-water emulsions with structuring in the oil phase, oil-water interface, and water phase. Oil phase structuring was achieved by the...

  8. Researcher Profile: An Interview with Sonya Britt, Ph.D., CFP, AFC

    OpenAIRE

    Sonya Britt

    2013-01-01

    Sonya Britt, Ph.D., CFP, AFC graduated from Texas Tech University in 2010 with a doctorate in Personal Financial Planning. Her first two degrees are from Kansas State University in Personal Financial Planning (B.S.) and Marriage and Family Therapy (M.S.). and she was the founding president of the Financial Therapy Association and recently retired from the board as past-president. She currently serves on the board of the American Council on Consumer Interests association. Sonya is an associate...

  9. Flavour models with Dirac and fake gluinos

    International Nuclear Information System (INIS)

    In the context of supersymmetric models where the gauginos may have both Majorana and Dirac masses we investigate the general constraints from flavour-changing processes on the scalar mass matrices. One finds that the chirality-flip suppression of flavour-changing effects usually invoked in the pure Dirac case holds in the mass insertion approximation but not in the general case, and fails in particular for inverted hierarchy models. We quantify the constraints in several flavour models which correlate fermion and scalar superpartner masses. We also discuss the limit of very large Majorana gaugino masses compared to the chiral adjoint and Dirac masses, where the remaining light eigenstate is the “fake” gaugino, including the consequences of suppressed couplings to quarks beyond flavour constraints

  10. Strong color fields and heavy flavour production

    International Nuclear Information System (INIS)

    The clustering of color sources provides a natural framework of partonic interactions producing strong color fields. We study the consequences of these color fields in the production of heavy flavour and in the behavior of the nuclear modified factor.

  11. Heavy flavour hadron spectroscopy: An overview

    Indian Academy of Sciences (India)

    P C Vinodkumar

    2014-11-01

    A comprehensive overview and some of the theoretical attempts towards understanding heavy flavour hadron spectroscopy are presented. Apart from the conventional quark structure (quark, antiquarks structure for the mesons and three-quarks structure of baryons) of hadrons, multiquark hadrons the hadron molecular states etc., also will be reviewed. Various issues and challenges in understanding the physics and dynamics of the quarks at the hadronic dimensions are highlighted. Looking into the present and future experimental prospects at different heavy flavour laboratories like BES-III, CLEO-c, BaBar, Belle, LHC etc., the scope for theoretical extensions of the present knowledge of heavy flavour physics would be very demanding. In this context, many relevant contributions from the forthcoming PANDA Facility are expected. Scopes and outlook of the hadron physics at the heavy flavour sector in view of the future experimental facilities are highlighted.

  12. Dynamics of Non-supersymmetric Flavours

    CERN Document Server

    Alam, M Sohaib; Kundu, Arnab; Kundu, Sandipan

    2013-01-01

    We continue investigating the effect of the back-reaction by non-supersymmetric probes in the Kuperstein-Sonnenschein model. In the limit when the back-reaction is small, we discuss physical properties of the back-reacted geometry. We further introduce additional probe flavours in this back-reacted geometry and study in detail the phase structure of this sector when a constant electromagnetic field or a chemical potential are present. We find that the Landau pole, which serves as the UV cut-off of the background geometry, also serves as an important scale in the corresponding thermodynamics of the additional flavour sector. We note that since this additional probe flavours are indistinguishable from the back-reacting flavours, the results we obtain point to a much richer phase structure of the system.

  13. b-flavour tagging in pp collisions

    CERN Multimedia

    Birnkraut, Alex

    2015-01-01

    An essential ingredient of all time-dependent CP violation studies of B mesons is the ability to tag the initial flavour of the B meson. The harsh environment of 7 and 8 TeV pp collisions makes this a particularly difficult enterprise. We report progresses in the flavour tagging of B0 and Bs mesons, including developments of novel techniques like the use of an opposite side charm tagger.

  14. New Physics in the Flavour Sector

    CERN Document Server

    Crivellin, Andreas

    2016-01-01

    Several experiments observed deviations from the Standard Model (SM) in the flavour sector: LHCb found a $4-5\\,\\sigma$ discrepancy compared to the SM in $b\\to s\\mu^+\\mu^-$ transitions (recently supported by an Belle analysis) and CMS reported a non-zero measurement of $h\\to\\mu\\tau$ with a significance of $2.4\\,\\sigma$. Furthermore, BELLE, BABAR and LHCb founds hints for the violation of flavour universality in $B\\to D^{(*)}\\tau\

  15. Flavour Violation in Anomaly Mediated Supersymmetry Breaking

    OpenAIRE

    Allanach, B. C.; Hiller, G; Jones, D. R. T.; Slavich, P.(LPTHE, UPMC Univ. Paris 06, Sorbonne Universités, 4 Place Jussieu, 75252, Paris, France)

    2009-01-01

    32 pages, 8 figures International audience We study squark flavour violation in the anomaly mediated supersymmetry broken (AMSB) minimal supersymmetric standard model. Analytical expressions for the three-generational squark mass matrices are derived. We show that the anomaly-induced soft breaking terms have a decreasing amount of squark flavour violation when running from the GUT to the weak scale. Taking into account inter-generational squark mixing, we work out non-trivial constraint...

  16. Flavour in supersymmetric Grand Unification a democratic approach

    CERN Document Server

    Barbieri, Riccardo; Dvali, Gia; Hall, L; Strumia, A

    1994-01-01

    We consider the flavour problem in a supersymmetric Grand Unified theory with gauged SU(6) group, where the Higgs doublets are understood as pseudo-Goldstone bosons of a larger $\\SU(6)\\otimes\\SU(6)$ global symmetry of the Higgs superpotential. A key element of this work is that we never appeal to any flavour symmetry. One main interesting feature emerges: only one of the light fermions, an up-type quark, to be identified with the top, can get a Yukawa coupling at renormalizable level. This fact, together with bottom-tau Yukawa unification, also implied in our scheme, gives rise to a characteristic correlation between the top and the Higgs mass. By including a flavour-blind discrete symmetry and requiring that all higher dimensional operators be mediated by the exchange of appropriate heavy multiplets, it is possible to give an approximate description of all masses and mixing angles in term of a hierarchy of grand unified scales. A special ``texture'' arises, implying a relation between the top mass and the th...

  17. EFSA ; Scientific Opinion on Flavouring Group Evaluation 59, Revision 1 (FGE.59Rev1): Consideration of aliphatic and aromatic ethers evaluated by JECFA (61st meeting and 63rd meeting) structurally related to aliphatic, alicyclic and aromatic ethers including anisole derivatives evaluated by EFSA in FGE.23 Rev2 (2010)

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further......, “No safety concern at estimated levels of intake as flavouring substances” based on the MSDI approach. Besides the safety assessment of these flavouring substances, the specifications for the materials of commerce have also been considered and for two substances, are information on the composition of...

  18. Heavy Flavour production in ATLAS

    International Nuclear Information System (INIS)

    ATLAS prepared a program for measurements of production cross sections both of b-hadrons and Onia in central proton-proton collisions at new energy 14 TeV of LHC. Dedicated triggers based on muon, di-muon or electron signatures are designed to accommodate large statistics with already first several months. Starting from semi-inclusive measurements for very early stage exclusive channels will soon dominate measurements, allowing tests of QCD in Heavy Flavour sector already with 10 pb-1. With larger statistics production polarization measurements are being prepared for J/ψ and Λb. It is expected that 30 fb-1 collected at 1033cm-2 s-1 will allow specific measurements not accessible with limited statistics of Tevatron. In particular b polarization measurement can be achieved using Λb → J/ψ Λ decay. In J/ψ a polarization measurement will allow to confirm or exclude model predictions within large interval of transverse momenta. (author)

  19. Flavour singlets in gauge theory as Permutations

    CERN Document Server

    Kimura, Yusuke; Suzuki, Ryo

    2016-01-01

    Gauge-invariant operators can be specified by equivalence classes of permutations. We develop this idea concretely for the singlets of the flavour group $SO(N_f)$ in $U(N_c)$ gauge theory by using Gelfand pairs and Schur-Weyl duality. The singlet operators, when specialised at $N_f =6$, belong to the scalar sector of ${\\cal N}=4$ SYM. A simple formula is given for the two-point functions in the free field limit of $g_{YM}^2 =0$. The free two-point functions are shown to be equal to the partition function on a 2-complex with boundaries and a defect, in a topological field theory of permutations. The permutation equivalence classes are Fourier transformed to a representation basis which is orthogonal for the two-point functions at finite $N_c , N_f$. Counting formulae for the gauge-invariant operators are described. The one-loop mixing matrix is derived as a linear operator on the permutation equivalence classes.

  20. The effects of flavour symmetry breaking on hadron matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Cooke, A.N.; Horsley, R. [Edinburgh Univ. (United Kingdom). School of Physics and Astronomy; Nakamura, Y. [RIKEN Advanced Institute for Computational Science, Kobe (Japan); Pleiter, D. [Juelich Research Centre (Germany); Regensburg Univ. (Germany). Institut fuer Theoretische Physik; Rakow, P.E.L. [Liverpool Univ. (United Kingdom). Theoretical Physics Division; Schierholz, G. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Zanotti, J.M. [Adelaide Univ. (Australia). School of Chemistry and Physics

    2012-12-15

    By considering a flavour expansion about the SU(3)-flavour symmetric point, we investigate how flavour-blindness constrains octet baryon matrix elements after SU(3) is broken by the mass difference between the strange and light quarks. We find the expansions to be highly constrained along a mass trajectory where the singlet quark mass is held constant, which proves beneficial for extrapolations of 2+1 flavour lattice data to the physical point. We investigate these effects numerically via a lattice calculation of the flavour-conserving and flavour-changing matrix elements of the vector and axial operators between octet baryon states.

  1. The effects of flavour symmetry breaking on hadron matrix elements

    International Nuclear Information System (INIS)

    By considering a flavour expansion about the SU(3)-flavour symmetric point, we investigate how flavour-blindness constrains octet baryon matrix elements after SU(3) is broken by the mass difference between the strange and light quarks. We find the expansions to be highly constrained along a mass trajectory where the singlet quark mass is held constant, which proves beneficial for extrapolations of 2+1 flavour lattice data to the physical point. We investigate these effects numerically via a lattice calculation of the flavour-conserving and flavour-changing matrix elements of the vector and axial operators between octet baryon states.

  2. The effects of flavour symmetry breaking on hadron matrix elements

    CERN Document Server

    Cooke, A N; Nakamura, Y; Pleiter, D; Rakow, P E L; Schierholz, G; Zanotti, J M

    2012-01-01

    By considering a flavour expansion about the SU(3)-flavour symmetric point, we investigate how flavour-blindness constrains octet baryon matrix elements after SU(3) is broken by the mass difference between the strange and light quarks. We find the expansions to be highly constrained along a mass trajectory where the singlet quark mass is held constant, which proves beneficial for extrapolations of 2+1 flavour lattice data to the physical point. We investigate these effects numerically via a lattice calculation of the flavour-conserving and flavour-changing matrix elements of the vector and axial operators between octet baryon states.

  3. Two-Higgs-doublet models with Minimal Flavour Violation

    CERN Document Server

    Carlucci, Maria Valentina

    2010-01-01

    The tree-level flavour-changing neutral currents in the two-Higgs-doublet models can be suppressed by protecting the breaking of either flavour or flavour-blind symmetries, but only the first choice, implemented by the application of the Minimal Flavour Violation hypothesis, is stable under quantum corrections. Moreover, a two-Higgs-doublet model with Minimal Flavour Violation enriched with flavour-blind phases can explain the anomalies recently found in the Delta F = 2 transitions, namely the large CP-violating phase in B_s mixing and the tension between epsilon_K and S_\\psi_K.

  4. Children's liking and wanting of snack products: Influence of shape and flavour

    Directory of Open Access Journals (Sweden)

    Liem Djin G

    2009-07-01

    Full Text Available Abstract Background Children's food choices are guided by their preferences. However, these preferences may change due to repeated exposure. Methods This study investigated children's (n = 242, 7–12 yrs-old liking and wanting for snacks over 3 weeks of daily consumption. The snacks differed in size (small vs large or flavour (sweet vs sweet-sour. Two conditions were designed: 1 a monotonous group in which children continuously consumed the same snack across the 3 weeks, and 2 a free choice group in which children were allowed to freely choose amongst 3 different flavours of the snack each day during 3 weeks. Results Shape influenced long-term liking, i.e. small shaped snacks remained stable in liking over repeated consumption, whereas large shaped snacks with the same flavour decreased in liking. Mean wanting ratings for all snack products decreased over 3 weeks daily consumption. Flavour did not significantly influence liking and wanting over time. The ability to freely choose amongst different flavours tended to decrease children's liking (p Conclusion Wanting rather than liking was most affected by repeated daily consumption of snack foods over three weeks. In order to increase the likelihood that children will repeatedly eat a food product, smaller sized healthy snacks are preferred to larger sized snacks. Future research should focus on stabilizing wanting over repeated consumption.

  5. Relationships between volatile and non-volatile metabolites and attributes of processed potato flavour.

    Science.gov (United States)

    Morris, Wayne L; Shepherd, Tom; Verrall, Susan R; McNicol, James W; Taylor, Mark A

    2010-10-01

    Although the flavour of processed potatoes (Solanum tuberosum L.) is important to consumers, the blend of volatile and non-volatile metabolites that impact on flavour attributes is not well-defined. Additionally, it is important to understand how potato flavour changes during storage. In this study, quantitative descriptive analysis of potato samples by a trained taste panel was undertaken, comparing tubers from S. tuberosum group Phureja with those from S. tuberosum group Tuberosum, both at harvest and following storage. The cooked tuber volatile profile was analysed by solid phase micro extraction followed by gas chromatography-mass spectrometry analysis in sub-samples of the tubers that were assessed by taste panels. A range of non-volatile metabolites including the major umami compounds, glycoalkaloids and sugars was also measured in tuber sub-samples. Correlation and principal component analyses revealed differences between the potato cultivars and storage conditions and demonstrated associations of metabolites with the different sensory attributes. PMID:20678781

  6. Impact of Flavour Variability on Electronic Cigarette Use Experience: An Internet Survey

    Directory of Open Access Journals (Sweden)

    Konstantinos E. Farsalinos

    2013-12-01

    enjoyable and more boring, while 48.5% mentioned that it would increase craving for cigarettes and 39.7% said that it would have been less likely for them to reduce or quit smoking. The number of flavours used was independently associated with smoking cessation. Conclusions: The results of this survey of dedicated users indicate that flavours are marketed in order to satisfy vapers’ demand. They appear to contribute to both perceived pleasure and the effort to reduce cigarette consumption or quit smoking. Due to the fact that adoption of ECs by youngsters is currently minimal, it seems that implementing regulatory restrictions to flavours could cause harm to current vapers while no public health benefits would be observed in youngsters. Therefore, flavours variability should be maintained; any potential future risk for youngsters being attracted to ECs can be sufficiently minimized by strictly prohibiting EC sales in this population group.

  7. Scientific Opinion on the safety and efficacy of branched-chain primary aliphatic alcohols/aldehydes/acids, acetals and esters with esters containing branched-chain alcohols and acetals containing branched-chain aldehydes (chemical group 2 when used as flavourings for all animal species

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP

    2012-10-01

    Full Text Available

    Chemical group 2 consists of branched-chain primary aliphatic alcohols/aldehydes/acids, acetals and esters with esters containing branched-chain alcohols and acetals containing branched-chain aldehydes, of which 34 are currently authorised for use as flavours in food. The use of 2-methylpropionic acid, isopentyl acetate, 3-methylbutyl butyrate and 2-methylbutyl acetate is safe at the proposed use level of 25 mg/kg complete feed for cattle, salmonids and non food producing animals and at 5 mg/kg complete feed for pigs and poultry. 2-Methylpropan-1-ol, isopentanol, 2-ethylhexan-1-ol, 2-methylpropanal, 3-methylbutanal, 2-methylbutyraldehyde, 3-methylbutyric acid, 2-methylvaleric acid, 2-ethylbutyric acid, 2-methylbutyric acid, 2-methylheptanoic acid, 4-methyloctanoic acid, isobutyl acetate, isobutyl butyrate, 3-methylbutyl propionate, 3-methylbutyl formate, glyceryl tributyrate, isobutyl isobutyrate, isopentyl isobutyrate, isobutyl isovalerate, isopentyl 2-methylbutyrate, 2-methylbutyl isovalerate and 2-methylbutyl butyrate are safe at the proposed use level of 5 mg/kg complete feed for all animal species. 3,7-Dimethyloctan-1-ol, 2-methylundecanal, 4-methylnonanoic acid, 3-methylbutyl hexanoate, 3-methylbutyl dodecanoate, 3-methylbutyl octanoate and 3-methylbutyl 3-methylbutyrate are safe at a maximum of 1.5 mg/kg complete feed for cattle, salmonids and non food-producing animals and of 1.0 mg/kg complete feed for pigs and poultry. No safety concern was identified for the consumer from the use of these compounds up to the highest safe level in feedingstuffs for all animal species. All compounds should be considered as irritants to skin, eyes and respiratory tract, and as skin sensitisers. The compounds do not pose a risk to the environment when used at concentrations considered safe for the target species. Since all compounds are used in food as flavourings, no further demonstration of efficacy is necessary.

  8. Metabolic pathways of biotransformation and biosynthesis of aromatic compounds for the flavour industry by the basidiomycete Pycnoporus cinnabarinus

    OpenAIRE

    Asther, Marcel; Lomascolo, A.; Asther, M.; Moukha, S.; Lesage-Meessen, L.

    1998-01-01

    Among filamentous fungi, white-rot Basidiomycetes have become a strategic group to generate industrial aromatic flavours. In the course of a basidiomycete screening, the biotechnological potential of #Pycnoporus cinnabarinus$ strains was studied in order to produce, by transformation or de novo, natural aromatic flavours in liquid cultures. Ferulic acid and L-phenylalanine were found to be suitable substrates for vanillin and benzaldehyde (bitter almond aroma) production, respectively. These ...

  9. Hadron masses in QCD with one quark flavour

    International Nuclear Information System (INIS)

    One-flavour QCD - a gauge theory with SU(3) colour gauge group and a fermion in the fundamental representation - is studied by Monte Carlo simulations. The mass spectrum of hadronic bound states is investigated in a volume with extensions of L≅4.4r0(≅2.2 fm) at two different lattice spacings: a ≅0.37r0 (≅0.19 fm) and a≅ 0.27r0 (≅0.13 fm). The lattice action is Symanzik tree-level-improved Wilson action for the gauge field and (unimproved) Wilson action for the fermion. (orig.)

  10. Minimal flavour violation and SU(5)-unification

    Energy Technology Data Exchange (ETDEWEB)

    Barbieri, Riccardo; Senia, Fabrizio [Scuola Normale Superiore, Pisa (Italy); INFN, Pisa (Italy)

    2015-12-15

    Minimal flavour violation in its strong or weak versions, based on U(3){sup 3} and U(2){sup 3}, respectively, allows suitable extensions of the standard model at the TeV scale to comply with current flavour constraints in the quark sector. Here we discuss considerations analogous to minimal flavour violation (MFV) in the context of SU(5)-unification, showing the new effects/constraints that arise both in the quark and in the lepton sector, where quantitative statements can be made controlled by the CKM matrix elements. The case of supersymmetry is examined in detail as a particularly motivated example. Third generation sleptons and neutralinos in the few hundred GeV range are shown to be compatible with current constraints. (orig.)

  11. Minimal flavour violation and SU(5)-unification

    International Nuclear Information System (INIS)

    Minimal flavour violation in its strong or weak versions, based on U(3)3 and U(2)3, respectively, allows suitable extensions of the standard model at the TeV scale to comply with current flavour constraints in the quark sector. Here we discuss considerations analogous to minimal flavour violation (MFV) in the context of SU(5)-unification, showing the new effects/constraints that arise both in the quark and in the lepton sector, where quantitative statements can be made controlled by the CKM matrix elements. The case of supersymmetry is examined in detail as a particularly motivated example. Third generation sleptons and neutralinos in the few hundred GeV range are shown to be compatible with current constraints. (orig.)

  12. Combining Pati-Salam and flavour symmetries

    Science.gov (United States)

    Feldmann, Thorsten; Hartmann, Florian; Kilian, Wolfgang; Luhn, Christoph

    2015-10-01

    We construct an extension of the Standard Model (SM) which is based on grand unification with Pati-Salam symmetry. The setup is supplemented with the idea of spontaneous flavour symmetry breaking which is mediated through flavon fields with renormalizable couplings to new heavy fermions. While we argue that the new gauge bosons in this approach can be sufficiently heavy to be irrelevant at low energies, the fermionic partners of the SM quarks, in particular those for the third generation, can be relatively light and provide new sources of flavour violation. The size of the effects is constrained by the observed values of the SM Yukawa matrices, but in a way that is different from the standard minimal-flavour violation approach. We determine characteristic deviations from the SM that could eventually be observed in future precision measurements.

  13. Combining Pati-Salam and Flavour Symmetries

    CERN Document Server

    Feldmann, Thorsten; Kilian, Wolfgang; Luhn, Christoph

    2015-01-01

    We construct an extension of the Standard Model (SM) which is based on grand unification with Pati-Salam symmetry. The setup is supplemented with the idea of spontaneous flavour symmetry breaking which is mediated through flavon fields with renormalizable couplings to new heavy fermions. While we argue that the new gauge bosons in this approach can be sufficiently heavy to be irrelevant at low energies, the fermionic partners of the SM quarks, in particular those for the third generation, can be relatively light and provide new sources of flavour violation. The size of the effects is constrained by the observed values of the SM Yukawa matrices, but in a way that is different from the standard minimal-flavour violation approach. We determine characteristic deviations from the SM that could eventually be observed in future precision measurements.

  14. Minimal flavour violation and SU(5)-unification

    Energy Technology Data Exchange (ETDEWEB)

    Barbieri, Riccardo, E-mail: barbieri@sns.it; Senia, Fabrizio, E-mail: fabrizio.senia@sns.it [Scuola Normale Superiore and INFN, Piazza dei Cavalieri 7, 56126, Pisa (Italy)

    2015-12-17

    Minimal flavour violation in its strong or weak versions, based on U(3){sup 3} and U(2){sup 3}, respectively, allows suitable extensions of the standard model at the TeV scale to comply with current flavour constraints in the quark sector. Here we discuss considerations analogous to minimal flavour violation (MFV) in the context of SU(5)-unification, showing the new effects/constraints that arise both in the quark and in the lepton sector, where quantitative statements can be made controlled by the CKM matrix elements. The case of supersymmetry is examined in detail as a particularly motivated example. Third generation sleptons and neutralinos in the few hundred GeV range are shown to be compatible with current constraints.

  15. Researcher Profile: An Interview with Sonya Britt, Ph.D., CFP, AFC

    Directory of Open Access Journals (Sweden)

    Sonya Britt

    2013-08-01

    Full Text Available Sonya Britt, Ph.D., CFP, AFC graduated from Texas Tech University in 2010 with a doctorate in Personal Financial Planning. Her first two degrees are from Kansas State University in Personal Financial Planning (B.S. and Marriage and Family Therapy (M.S.. and she was the founding president of the Financial Therapy Association and recently retired from the board as past-president. She currently serves on the board of the American Council on Consumer Interests association. Sonya is an associate editor for the Journal of Family and Economic Issues and on the editorial board of the Journal of Financial Therapy and on the international scientific board of the Italian Journal of Sociology of Education.

  16. AREVA Fatigue Concept (AFC). Live demonstration of a modern fatigue monitoring system FAMOS i

    International Nuclear Information System (INIS)

    The prevention of fatigue damage is to be considered as a crucial issue in the view of changing boundary conditions: code modifications, long term operation, new plants with operating periods of 60 years. The AREVA Fatigue Concept (AFC) provides for a multiple step and multidisciplinary process (process engineering, fatigue monitoring, fatigue analyses etc.) against fatigue before and during the entire operation of nuclear power plants (NPPs). The ensuing fatigue analyses are based on the real operational loads measured continuously on site in the plant by means of an installed fatigue monitoring system. This way, realistic load data are available and qualified fatigue usage factors can be determined. Locations of potential fatigue failure are reliably identified and expensive cost for inspection can be essentially reduced. The direct processing of the measured temperatures can immediately be used for a Fast Fatigue Evaluation (FFE). FFE calculates the real stress history in form of a six stress tensor approach. The shape functions of fatigue relevant NPP parts are included. Based on the stress history the fatigue evaluation is the last step. Effects based on environmental fatigue influence can also be analyzed inside AFC. The fatigue calculation workflow will be processed on the FAMOS i (i stands for ''integrated'') demonstration wall (cf. Figure 1). Starting with the measurement of transient temperatures, the thermal loads will be shown with the FAMOS i-viewer software. Within the next step the inner wall temperature is calculated, which is based on the FAMOS i measurements. In a third step the computation of the stress history is done, followed by the combination of the relevant stress ranges for the purpose of a particular fatigue usage calculation. In addition, a short overview will be given about the requirements and solutions of an effective modern measurement system, followed by showing the benefit of local monitoring for NPP owners. (orig.)

  17. Image similarity ranking of focal computed tomography liver lesions using a 2AFC technique

    Science.gov (United States)

    Faruque, Jessica; Antani, Sameer; Long, Rodney; Kim, Lauren; Thoma, George

    2016-03-01

    Content-based image retrieval (CBIR) for radiological images has experienced massive growth over the past two decades, and shows great potential as a tool for use in precision medicine. A recurring challenge in CBIR evaluation has been in obtaining reference sets of images from human viewers of the system. Our work seeks to determine the feasibility of creating a reference set from images ranked by similarity from human viewers of the images. We obtained 2 sets each of 10 images of CT focal liver lesions from a database of open-access publications with and without markings showing the region containing the lesions, respectively. We created 2 sets of all 45 pair-wise combinations of the images, and displayed them to 10 volunteers, of which 2 had medical training. We used a Two-Alternative Forced Choice (2AFC) paradigm to obtain complete rankings of similarity levels in these image pairs. Analysis showed that inter-reader agreement for rankings ranged from Tau=0.21-0.69 (median=0.37) for the image pairs without any markings, and Tau=0.21-0.57 (median=0.33) for the image pairs with markings. A comparison of the regions of interests drawn by the study participants outlining the lesions in images without markings showed that participants tended to agree on images containing a single focal lesion of a single density, and inter-reader agreement for image rankings in which the regions of interest agree ranged from Tau=0.39-0.85 (median=0.58). These results show that the use of image ranking using 2AFC may be a feasible method for creating reference sets for CBIR system validation.

  18. LHCb New algorithms for Flavour Tagging at the LHCb experiment

    CERN Multimedia

    Fazzini, Davide

    2016-01-01

    The Flavour Tagging technique allows to identify the B initial flavour, required in the measurements of flavour oscillations and time-dependent CP asymmetries in neutral B meson systems. The identification performances at LHCb are further enhanced thanks to the contribution of new algorithms.

  19. Heavy Flavour Production and Decay at ATLAS

    CERN Document Server

    Jones, RWL; The ATLAS collaboration

    2013-01-01

    ATLAS is taking advantage of its large integrated luminosity band sophisticated muon and dimuon triggers to make competitive measurements of heavy flavour production and decay. Inclusive production and heavy flavour jet production is discussed before turning to charm and onium production. The production and decay of individual B hadron species is then addressed, including the current best measurement of the Λb lifetime. A much improved analysis of CP related quantities in Bs decays is presented, before turning to recent results and prospects for rare B decays.

  20. SU(3) flavour breaking and baryon structure

    Energy Technology Data Exchange (ETDEWEB)

    Cooke, A.N.; Horsley, R. [Edinburgh Univ. (United Kingdom). School of Physics and Astronomy; Nakamura, Y. [RIKEN Advanced Institute for Computational Science, Kobe, Hyogo (Japan); Pleiter, D. [Forschungszentrum Juelich GmbH (Germany). Juelich Supercomputing Centre (JSC); Regensburg Univ. (Germany). Institut fuer Theoretische Physik; Rakow, P.E.L. [Liverpool Univ. (United Kingdom). Theoretical Physics Div.; Shanahan, P.; Zanotti, J.M. [Adelaide Univ., SA (Australia). CSSM, School of Chemistry and Physics; Schierholz, G. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Stueben, H. [Hamburg Univ. (Germany). Regionales Rechenzentrum; Collaboration: QCDSF/UKQCD Collaboration

    2013-11-15

    We present results from the QCDSF/UKQCD collaboration for hyperon electromagnetic form factors and axial charges obtained from simulations using N{sub f}=2+1 flavours of O(a)-improved Wilson fermions. We also consider matrix elements relevant for hyperon semileptonic decays. We find flavour-breaking effects in hyperon magnetic moments which are consistent with experiment, while our results for the connected quark spin content indicates that quarks contribute more to the spin of the {Xi} baryon than they do to the proton.

  1. Phenomenological Implications of an S4 x SU(5) SUSY GUT of Flavour

    CERN Document Server

    Dimou, Maria; Luhn, Christoph

    2015-01-01

    We discuss the low energy phenomenological implications of an SU(5) Supersymmetric Grand Unified Theory (SUSY GUT) whose flavour structure is controlled by the family symmetry S4 x U(1), which provides a good description of all quark and lepton masses, mixings as well as CP violation. Although the model closely mimics Minimal Flavour Violation (MFV) as shown in arXiv:1511.07886, here we focus on the differences. We first present numerical estimates of the low energy mass insertion parameters, including canonical normalisation and renormalisation group running, for well-defined ranges of SUSY parameters and compare the naive model expectations to the numerical scans and the experimental bounds. Our results are then used to estimate the predictions for Electric Dipole Moments (EDMs), Lepton Flavour Violation (LFV), B and K meson mixing as well as rare B decays. The largest observable deviations from MFV come from the LFV process mu --> e gamma and the EDMs.

  2. Higgs-mediated FCNCs: Natural Flavour Conservation vs. Minimal Flavour Violation

    CERN Document Server

    Buras, Andrzej J; Gori, Stefania; Isidori, Gino

    2010-01-01

    We compare the effectiveness of two hypotheses, Natural Flavour Conservation (NFC) and Minimal Flavour Violation (MFV), in suppressing the strength of flavour-changing neutral-currents (FCNCs) in models with more than one Higgs doublet. We show that the MFV hypothesis, in its general formulation, is more stable in suppressing FCNCs than the hypothesis of NFC alone when quantum corrections are taken into account. The phenomenological implications of the two scenarios are discussed analysing meson-antimeson mixing observables and the rare decays B -> mu+ mu-. We demonstrate that, introducing flavour-blind CP phases, two-Higgs doublet models respecting the MFV hypothesis can accommodate a large CP-violating phase in Bs mixing, as hinted by CDF and D0 data and, without extra free parameters, soften significantly in a correlated manner the observed anomaly in the relation between epsilon_K and S_psi_K.

  3. General squark flavour mixing: constraints, phenomenology and benchmarks

    CERN Document Server

    De Causmaecker, Karen; Herrmann, Bjoern; Mahmoudi, Farvah; O'Leary, Ben; Porod, Werner; Sekmen, Sezen; Strobbe, Nadja

    2015-01-01

    We present an extensive study of non-minimal flavour violation in the squark sector in the framework of the Minimal Supersymmetric Standard Model. We investigate the effects of multiple non-vanishing flavour-violating elements in the squark mass matrices by means of a Markov Chain Monte Carlo scanning technique and identify parameter combinations that are favoured by both current data and theoretical constraints. We then detail the resulting distributions of the flavour-conserving and flavour-violating model parameters. Based on this analysis, we propose a set of benchmark scenarios relevant for future studies of non-minimal flavour violation in the Minimal Supersymmetric Standard Model.

  4. Sweetness flavour interactions in soft drinks.

    NARCIS (Netherlands)

    Nahon, D.F.; Roozen, J.P.; Graaf, de C.

    1996-01-01

    Sucrose can be substituted by intense sweeteners to lower the calorie content of soft drinks. Although the sweetness is kept at the same level as much as possible, the flavour of the product often changes. This change could be due to both the mechanism of sensory perception and interactive effects o

  5. Heavy flavour physics at the LHC

    International Nuclear Information System (INIS)

    A summary of results in heavy flavour physics from Run 1 of the LHC is presented. Topics discussed include spectroscopy, mixing, CP violation and rare decays of charmed and beauty hadrons. The results are consistent with Standard Model predictions, although several puzzles and hints of discrepancies demand further investigation with larger data samples

  6. Search for new flavour production at PETRA

    International Nuclear Information System (INIS)

    The topological distribution of hadrons from the reaction e+e- → multihadrons has been studied at PETRA energies between √ s = 22 and 31.6 GeV. No evidence is seen for spherical events which would be expected if massive particles bearing new flavours were produced. (orig.)

  7. Minimal flavour violation and beyond: Towards a flavour code for short distance dynamics

    CERN Document Server

    Buras, Andrzej J

    2010-01-01

    This decade should provide the first definitive signals of New Physics (NP) beyond the Standard Model (SM) and the goal of these lectures is a review of flavour physics in various extensions of the SM that have been popular in the last ten years. After an overture, two pilot sections and a brief summary of the structure of flavour violation and CP violation in the SM, we will present the theoretical framework for weak decays that will allow us to distinguish between different NP scenarios. Subsequently we will present twelve concrete BSM models summarizing the patterns of flavour violation characteristic for each model. In addition to models with minimal flavour violation (MFV) accompanied by flavour blind phases we will discuss a number of extensions containing non-MFV sources of flavour and CP violation and, in particular, new local operators originating in right-handed charged currents and scalar currents. Next we will address various anomalies in the data as seen from the point of view of the SM that appe...

  8. Cern Academic Training programme 2011 - Flavour Physics and CP Violation

    CERN Multimedia

    PH Department

    2011-01-01

    LECTURE SERIES   4, 5, 6 and 7 April 2011 Flavour Physics and CP Violation Dr. Yosef Nir (Weizmann Institute of Science, Rehovot, Israel 11:00-12:00 - 4, 6 and 7 April - Bldg. 222-R-001 - Filtration Plant 5 April - Bldg. 80-1-001 - Globe 1st Floor   The B-factories have led to significant progress in our understanding of CP violation and of flavour physics. Yet, two flavour puzzles remain. The standard model flavour puzzle is the question of why there is smallness and hierarchy in the flavour parameters. The new physics flavour puzzle is the question of why TeV-scale new physics was not signalled in flavour changing neutral current processes. The high pT experiments, ATLAS and CMS, are likely to shed light on these puzzles. As concerns CP violation, the LHC will lead to progress on the puzzle of the baryon asymmetry as well.  

  9. Scientific Opinion on Flavouring Group Evaluation 63, Revision 1 (FGE.63Rev1: Consideration of aliphatic secondary alcohols, ketones and related esters evaluated by JECFA (59th and 69th meetings structurally related to saturated and unsaturated aliphatic secondary alcohols, ketones and esters of secondary alcohols and saturated linear or branched-chain carboxylic acids evaluated by EFSA in FGE.07Rev4 (2012

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF

    2012-10-01

    Full Text Available

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA, and to decide whether further evaluation is necessary, as laid down in Commission Regulation (EC No 1565/2000. The present consideration concerns a group of 19 aliphatic secondary alcohols, ketones and related esters evaluated by the JECFA at the 59th and 69th meetings in 2002 and 2008. This revision is made due to inclusion of six additional substances, 4,8-dimethyl-3,7-nonadien-2-ol, 6-methylhepta-3,5-dien-2-one, octa-1,5-dien-3-one, (E,E-3,5-octadien-2-one, (3Z-4,8-dimethyl-3,7-nonadiene-2-one and 4,8-dimethyl-3,7-nonadien-2-yl acetate [FL-no: 02.252, 07.099, 07.190, 07.247, 07.256 and 09.936] cleared for genotoxicity concern. The substances were evaluated through a stepwise approach that integrates information on structure-activity relationships, intake from current uses, toxicological threshold of concern, and available data on metabolism and toxicity. The Panel agrees with the application of the Procedure as performed by the JECFA for all 19 substances considered in this FGE and agrees with the JECFA conclusion, “No safety concern at estimated levels of intake as flavouring substances” based on the MSDI approach.

  10. Analysis of Performance of Selected AFC, ATF Fuels, and Lanthanide Transport

    Energy Technology Data Exchange (ETDEWEB)

    Unal, Cetin [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Galloway, Jack D. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-09-29

    We started to look at the performance of ATF concept in LWRs late in FY14 and finish our studies in FY15. The work has been presented in AFC review meetings, ICAPP and TOPFUEL conferences. The final version of the work is accepted for publication in Nuclear Engineering and Science Journal (NES). The copy of ICAPP and NES papers are attached separately to this document as our milestone deliverables. We made an important progress in the modeling of lanthanide transport in FY15. This work produced an ANS Winter Meeting paper and GLOBAL 2015 paper. GLOBAL 2015 paper is also attached as deliverable of FY15. The work on the lanthanide transport is preliminary. We are exploring other potential mechanisms, in addition to “liquid-like” diffusion mechanisms, proposed by Robert Mariani [1] before we analyze data that will be taken by Ohio State University. This year, we concentrate on developing diffusion kernels and principles of modeling. Next year, this work will continue and analyze the Ohio State data and develop approaches to solve multicomponent diffusion. In addition to three papers we attached to this report, we have done some research on coupling and the development of gas release model for metallic fuels in FY15. They are also preliminary in nature; therefore, we give the summary of what we found rather than an extended report that will be done in FY16.

  11. Flavon-induced connections between lepton flavour mixing and charged lepton flavour violation processes

    CERN Document Server

    Pascoli, Silvia

    2016-01-01

    In leptonic flavour models with discrete flavour symmetries, couplings between flavons and leptons can result in special flavour structures after they gain vacuum expectation values. At the same time, they can also contribute to the other lepton-flavour-violating processes. We study the flavon-induced LFV 3-body charged lepton decays and radiative decays and we take as example the $A_4$ discrete symmetry. In $A_4$ models, a $Z_3$ residual symmetry roughly holds in the charged lepton sector for the realisation of tri-bimaximal mixing at leading order. The only processes allowed by this symmetry are $\\tau^-\\to \\mu^+ e^- e^-, e^+ \\mu^- \\mu^-$, and the other 3-body and all radiative decays are suppressed by small $Z_3$-breaking effects. These processes also depend on the representation the flavon is in, whether pseudo-real (case i) or complex (case ii). We calculate the decay rates for all processes for each case and derive their strong connection with lepton flavour mixing. In case i, sum rules for the branching...

  12. Neutrino observables from predictive flavour patterns

    Energy Technology Data Exchange (ETDEWEB)

    Cebola, Luis M.; Emmanuel-Costa, David [Universidade de Lisboa, Departamento de Fisica and Centro de Fisica Teorica de Particulas - CFTP, Instituto Superior Tecnico, Lisboa (Portugal); Felipe, Ricardo Gonzalez [Universidade de Lisboa, Departamento de Fisica and Centro de Fisica Teorica de Particulas - CFTP, Instituto Superior Tecnico, Lisboa (Portugal); ISEL - Instituto Superior de Engenharia de Lisboa, Instituto Politecnico de Lisboa, Lisboa (Portugal)

    2016-03-15

    We look for predictive flavour patterns of the effective Majorana neutrino mass matrix that are compatible with current neutrino oscillation data. Our search is based on the assumption that the neutrino mass matrix contains equal elements and a minimal number of parameters, in the flavour basis where the charged lepton mass matrix is diagonal and real. Three unique patterns that can successfully explain neutrino observables at the 3σ confidence level with just three physical parameters are presented. Neutrino textures described by four and five parameters are also studied. The predictions for the lightest neutrino mass, the effective mass parameter in neutrinoless double beta decays and for the CP-violating phases in the leptonic mixing are given. (orig.)

  13. Neutrino observables from predictive flavour patterns

    CERN Document Server

    Cebola, Luis M; Felipe, Ricardo Gonzalez

    2016-01-01

    We look for predictive flavour patterns of the effective Majorana neutrino mass matrix that are compatible with current neutrino oscillation data. Our search is based on the assumption that the neutrino mass matrix contains equal elements and a minimal number of parameters, in the flavour basis where the charged lepton mass matrix is diagonal and real. Three unique patterns that can successfully explain neutrino observables at the $3\\sigma$ confidence level with just three physical parameters are presented. Neutrino textures described by four and five parameters are also studied. The predictions for the lightest neutrino mass, the effective mass parameter in neutrinoless double beta decays and the CP-violating phases in the leptonic mixing are given.

  14. Relic neutrino decoupling including flavour oscillations

    Energy Technology Data Exchange (ETDEWEB)

    Mangano, Gianpiero [Dipartimento di Scienze Fisiche, Universita di Napoli Federico II and INFN, Sezione di Napoli, Complesso Universitario di Monte S. Angelo, Via Cintia, I-80126 Naples (Italy); Department of Physics, Syracuse University, Syracuse, NY 13244-1130 (United States); Miele, Gennaro [Dipartimento di Scienze Fisiche, Universita di Napoli Federico II and INFN, Sezione di Napoli, Complesso Universitario di Monte S. Angelo, Via Cintia, I-80126 Naples (Italy); Pastor, Sergio [Instituto de Fisica Corpuscular (CSIC-Universitat de Valencia), Ed. Institutos de Investigacion, Apdo. 22085, E-46071 Valencia (Spain)]. E-mail: pastor@ific.uv.es; Pinto, Teguayco [Instituto de Fisica Corpuscular (CSIC-Universitat de Valencia), Ed. Institutos de Investigacion, Apdo. 22085, E-46071 Valencia (Spain); Pisanti, Ofelia [Dipartimento di Scienze Fisiche, Universita di Napoli Federico II and INFN, Sezione di Napoli, Complesso Universitario di Monte S. Angelo, Via Cintia, I-80126 Naples (Italy); Serpico, Pasquale D. [Max-Planck-Institut fuer Physik (Werner-Heisenberg-Institut), Foehringer Ring 6, D-80805 Munich (Germany)

    2005-11-21

    In the early universe, neutrinos are slightly coupled when electron-positron pairs annihilate transferring their entropy to photons. This process originates non-thermal distortions on the neutrino spectra which depend on neutrino flavour, larger for {nu}{sub e} than for {nu}{sub {mu}} or {nu}{sub {tau}}. We study the effect of three-neutrino flavour oscillations on the process of neutrino decoupling by solving the momentum-dependent kinetic equations for the neutrino spectra. We find that oscillations do not essentially modify the total change in the neutrino energy density, giving N{sub eff}=3.046 in terms of the effective number of neutrinos, while the small effect over the production of primordial {sup 4}He is increased by O(20%), up to 2.1x10{sup -4}. These results are stable within the presently favoured region of neutrino mixing parameters.

  15. Dark matter and observable Lepton Flavour Violation

    OpenAIRE

    Heurtier, Lucien; Teresi, Daniele

    2016-01-01

    Seesaw models with leptonic symmetries allow right-handed (RH) neutrino masses at the electroweak scale, or even lower, at the same time having large Yukawa couplings with the Standard Model leptons, thus yielding observable effects at current or near-future lepton-flavour-violation (LFV) experiments. These models have been previously considered also in connection to low-scale leptogenesis, but the combination of observable LFV and successful leptogenesis has appeared to be difficult to achie...

  16. Extracting gamma Through Flavour-Symmetry Strategies

    OpenAIRE

    Fleischer, Robert

    2002-01-01

    A brief overview of flavour-symmetry strategies to extract the angle gamma of the unitarity triangle is given, focusing on B --> pi K modes and the B_d --> pi^+ pi^-, B_s --> K^+ K^- system. We discuss also a variant of the latter approach for the e^+ e^- B-factories, where B_s --> K^+ K^- is replaced by B_d --> pi^{+/-} K^{+/-}.

  17. Including heavy flavour production in PDF fits

    OpenAIRE

    A.M. Cooper-Sarkar

    2007-01-01

    AT HERA heavy quarks may contribute up to 30% of the structure function $F_2$. The introduction of heavy quarks requires an extension of the DGLAP formalism. The effect of using different heavy flavour number schemes, and different approaches to the running of $\\alpha_s$, are compared using the ZEUS PDF fit formalism. The potential of including charm data in the fit is explored, using $D^*$ double differential cross-sections rather than the inclusive quantity $F_2^{c\\bar{c}}$.

  18. Flavour of fundamental particles and prime numbers

    International Nuclear Information System (INIS)

    The discreteness and continuity as described by the ratio of the discreteness of the n's and the continuous spread of n/2n, which is directly connected with the width and lifetimes of fundamental particles, the flavours of fundamental particles can be directly obtained. The behaviour of beta decay and the energy levels of light nuclei can also be predicted. The appearance of primes also seems to suggest that further application of reductionism to fundamental particles is not possible

  19. Heavy flavour physics from top to bottom

    Energy Technology Data Exchange (ETDEWEB)

    Paulini, M. [Lawrence Berkeley National Lab., CA (United States); CDF and D0 Collaborations

    1997-01-01

    We review the status of heavy flavour physics at the Fermilab Tevatron collider by summarizing recent top quark and B physics results from CDF and D0. In particular we discuss the measurement of the top quark mass and top production cross section as well as B meson lifetimes and time dependent B{bar B} mixing results. An outlook of perspectives for top and B physics in Run II starting in 1999 is also given. 38 refs., 23 figs., 8 tabs.

  20. Some theoretical issues in heavy flavour physics

    Indian Academy of Sciences (India)

    Amol Dighe

    2012-11-01

    Some of the recent developments in heavy flavour physics will be reviewed. This will include an update on some of the Standard Model predictions, and a summary of recent measurements that may indicate the presence of new physics (NP). The focus will be on selected models of NP that are indicated by the anomalies in the current data. Observables that can potentially yield signatures of specific physics beyond the Standard Model will be pointed out.

  1. Creating innovative flavour and texture experiences

    OpenAIRE

    Edwards-Stuart, Rachel

    2009-01-01

    The work presented in this thesis describes the use of scientific research in the development of novel texture and flavour experiences and their potential for use in fine gastronomy. In order to create an interesting textural experience, modified celluloses were investigated. Their unique property is that they have the ability to gel at high temperatures, but return to the solution state upon cooling. This phenomena was used to test the hypothesis that hot gels made from these materials could...

  2. Flavour democracy calls for the fourth generation

    International Nuclear Information System (INIS)

    It is argued with the help of an illustrative mode, that the inter species hierarchy among the fermion masses and the quark mixing angles can be accommodated naturally in the standard model with (approximate) flavour democracy provided there are four families of sequential quark-leptons with all members of the fourth family having roughly equal masses. The special problem of light neutrino masses (if any) and possible solutions are also discussed. (author). 15 refs

  3. Gauge-Higgs unification with broken flavour symmetry

    International Nuclear Information System (INIS)

    We study a five-dimensional Gauge-Higgs unification model on the orbifold S1/Z2 based on the extended standard model (SM) gauge group SU(2)L x U(1)Y x SO(3)F. The group SO(3)F is treated as a chiral gauged flavour symmetry. Electroweak-, flavour- and Higgs interactions are unified in one single gauge group SU(7). The unified gauge group SU(7) is broken down to SU(2)L x U(1)Y x SO(3)F by orbifolding and imposing Dirichlet and Neumann boundary conditions. The compactification scale of the theory is O(1) TeV. Furthermore, the orbifold S1/Z2 is put on a lattice. This setting gives a well-defined staring point for renormalisation group (RG) transformations. As a result of the RG-flow, the bulk is integrated out and the extra dimension will consist of only two points: the orbifold fixed points. The model obtained this way is called an effective bilayered transverse lattice model. Parallel transporters (PT) in the extra dimension become nonunitary as a result of the blockspin transformations. In addition, a Higgs potential V(Φ) emerges naturally. The PTs can be written as a product eAyeηeAy of unitary factors eAy and a selfadjoint factor eη. The reduction 48 → 35 + 6 + anti 6 + 1 of the adjoint representation of SU(7) with respect to SU(6) contains SU(2)L x U(1)Y x SO(3)F leads to three SU(2)L Higgs doublets: one for the first, one for the second and one for the third generation. Their zero modes serve as a substitute for the SM Higgs. When the extended SM gauge group SU(2)L x U(1)Y x SO(3)F is spontaneously broken down to U(1)em, an exponential gauge boson mass splitting occurs naturally. At a first step SU(2)L x U(1)Y x SO(3)F is broken to SU(2)L x U(1)Y by VEVs for the selfadjoint factor eη. This breaking leads to masses of flavour changing SO(3)F gauge bosons much above the compactification scale. Such a behaviour has no counterpart within the customary approximation scheme of an ordinary orbifold theory. This way tree-level flavour-changing-neutral-currents are

  4. Gauge-Higgs unification with broken flavour symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Olschewsky, M.

    2007-05-15

    We study a five-dimensional Gauge-Higgs unification model on the orbifold S{sup 1}/Z{sub 2} based on the extended standard model (SM) gauge group SU(2){sub L} x U(1){sub Y} x SO(3){sub F}. The group SO(3){sub F} is treated as a chiral gauged flavour symmetry. Electroweak-, flavour- and Higgs interactions are unified in one single gauge group SU(7). The unified gauge group SU(7) is broken down to SU(2){sub L} x U(1){sub Y} x SO(3){sub F} by orbifolding and imposing Dirichlet and Neumann boundary conditions. The compactification scale of the theory is O(1) TeV. Furthermore, the orbifold S{sup 1}/Z{sub 2} is put on a lattice. This setting gives a well-defined staring point for renormalisation group (RG) transformations. As a result of the RG-flow, the bulk is integrated out and the extra dimension will consist of only two points: the orbifold fixed points. The model obtained this way is called an effective bilayered transverse lattice model. Parallel transporters (PT) in the extra dimension become nonunitary as a result of the blockspin transformations. In addition, a Higgs potential V({phi}) emerges naturally. The PTs can be written as a product e{sup A{sub y}}e{sup {eta}}e{sup A{sub y}} of unitary factors e{sup A{sub y}} and a selfadjoint factor e{sup {eta}}. The reduction 48 {yields} 35 + 6 + anti 6 + 1 of the adjoint representation of SU(7) with respect to SU(6) contains SU(2){sub L} x U(1){sub Y} x SO(3){sub F} leads to three SU(2){sub L} Higgs doublets: one for the first, one for the second and one for the third generation. Their zero modes serve as a substitute for the SM Higgs. When the extended SM gauge group SU(2){sub L} x U(1){sub Y} x SO(3){sub F} is spontaneously broken down to U(1){sub em}, an exponential gauge boson mass splitting occurs naturally. At a first step SU(2){sub L} x U(1){sub Y} x SO(3){sub F} is broken to SU(2){sub L} x U(1){sub Y} by VEVs for the selfadjoint factor e{sup {eta}}. This breaking leads to masses of flavour changing SO(3){sub F

  5. Predicting lepton mixing parameters including Majorana phases from Δ(6n2) flavour symmetry and generalised CP

    International Nuclear Information System (INIS)

    An important class of flavour groups that are subgroups of U(3) and that predict experimentally viable lepton mixing parameters including Majorana phases is the Δ(6n2) series. The most well-known member is Δ(24)=S4. I present results of several extensive studies of lepton mixing predictions obtained in models with a Δ(6n2) flavour group that preserve either the full Klein symmetry or a Z2 subgroup for neutrinos and can include a generalised CP symmetry. Predictions include mixing angles and Dirac CP phase generally; and if invariance under a generalised CP symmetry is included, also Majorana phases. For this, the interplay of flavour group and generalised CP symmetry has to be studied carefully. Furthermore, I present results for neutrinoless double-beta decay.

  6. Effects of flavour absorption on foods and their packaging materials

    OpenAIRE

    Willige, van, R.W.G.

    2002-01-01

    Keywords: flavour absorption, scalping, packaging, food matrix, lldpe, ldpe, pp, pc, pet, pen,b-lactoglobulin, casein, pectin, cmc, lactose, saccharose, oil, modelling, storage, oxygen permeability, taste perception, sensory quality.Absorption of flavour compounds by linear low-density polyethylene (LLDPE) was studied in model systems representing differences in composition of the food matrix. Proteins,b-lactoglobuline and casein, were able to bind flavours, resulting in suppression of absorp...

  7. Leptonic minimal flavour violation in warped extra dimensions

    Indian Academy of Sciences (India)

    Abhishek M Iyer; Sudhir K Vempati

    2012-10-01

    Lepton mass hierarchies and lepton flavour violation are revisited in the framework of Randall–Sundrum models. Models with Dirac-type as well as Majorana-type neutrinos are considered. The five-dimensional -parameters are fit to the charged lepton and neutrino masses and mixings using 2 minimization. Leptonic flavour violation is shown to be large in these cases. Schemes of minimal flavour violation are considered for the cases of an effective LLHH operator and Dirac neutrinos and are shown to significantly reduce the limits from lepton flavour violation.

  8. Flavour tagging of $b$ mesons in $pp$ collisions at LHCb

    CERN Multimedia

    Mueller, Vanessa

    2016-01-01

    Flavour tagging, i.e. the inference of the production flavour of reconstructed $b$ hadrons, is essential for precision measurements of decay time-dependent $CP$ violation and of mixing parameters in the the neutral $B$ meson systems. LHC's $pp$ collisions with their high track multiplicities constitute a challenging environment for flavour tagging and demand for new and improved strategies. We present recent progress and new developments in flavour tagging at the LHCb experiment, which will allow for a further improvement of $CP$ violation measurements in decays of $B^0$ and $B_s^0$ mesons.

  9. Scientific Opinion on Flavouring Group Evaluation 67 Revision 2 (FGE.67Rev2): Consideration of 28 furan-substituted compounds evaluated by JECFA at the 55th, 65th and 69th meetings (JECFA, 2001, 2006a, 2009b)

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Nørby, Karin Kristiane

    evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The substances were evaluated through a stepwise approach (the Procedure) that integrates information on structure-activity relationships, intake from current uses, toxicological threshold of concern, and available data on...... metabolism and toxicity. The present consideration concerns a group of 28 furan-substituted compounds evaluated by the JECFA. This revision of FGE.67 is due to new data on toxicity for 3-(-methyl-2-furyl) butanal [FL-no: 13.058] providing an appropriate NOAEL for the evaluation of candidate substance [FL...

  10. EFSA Scientific Opinion on Flavouring Group Evaluation 87 Revision 1 (FGE.87Rev1): Consideration of bicyclic secondary alcohols, ketones and related esters evaluated by JECFA (63rd meeting) structurally related to bicyclic secondary alcohols, ketones and related esters evaluated by EFSA in FGE.47 (2008)

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further...... substances [FL-no: 02.100 and 02.101] compared to previous version. Additionally, new information on EU production volume on two substances and information on stereoisomeric composition for 13 substances are also included. The substances were evaluated through a stepwise approach that integrates information...... for two substances, [FL-no: 02.100 and 02.101], information on the stereoisomeric composition is lacking....

  11. Flavouring compounds in Indian potato snacks.

    Science.gov (United States)

    Raigond, Pinky; Singh, Brajesh; Dhulia, Akshita; Chopra, Shelly; Dutt, Som

    2015-12-01

    Market for processed potato products is rising day by day. Flavour plays important role in decision making by consumers due to their preferences for better tasting food. In potato and potato products, glutamic acid, aspartic acid, guanosine 5'-monophosphate (GMP) and adenosine 5'-monophosphate (AMP) are the major umami compounds which contribute towards flavour. Therefore, umami 5' nucleotides (AMP+GMP) were estimated from local potato products available as common fried products in the Indian markets and processed potato products being sold by the retailers. The analysis was also carried in raw, microwaved and pressure cooked tubers of forty seven Indian potato cultivars. Umami 5' nucleotide content ranged from 2.63 (Aloo seekh) to 8.26 μg/g FW (fried lachcha) in local potato products. In processed potato products, the content ranged from 2.72 μg/g FW (Smiles) to 14.75 μg/g FW (Aloo Bhujia). Along with aloo bhujia, umami 5' nucleotides were also high in dehydrated aloo lachcha (11.14 μg/g FW) and dehydrated potato chips (10.13 μg/g FW) and low in Smiles (2.72 μg/g FW) and Potato Shortz (3.40 μg/g FW). The study suggests that the potato products prepared solely from potato contained higher levels of umami 5' nucleotides compared to other products prepared by mixing potato with other cereals and vegetables. In Indian potato cultivars overall there was 14 % increase on microwave cooking and 31 % increase in flavouring compounds on pressure cooking. This type of study enabled in identifying better tasting cultivars for further product development and also to develop products with less addition of salt. PMID:26604408

  12. New aspects of flavour model building in supersymmetric grand unification

    International Nuclear Information System (INIS)

    We derive predictions for Yukawa coupling ratios within Grand Unified Theories generated from operators with mass dimension four and five. These relations are a characteristic property of unified flavour models and can reduce the large number of free parameters related to the flavour sector of the Standard Model. The Yukawa couplings of the down-type quarks and charged leptons are affected within supersymmetric models by tan β-enhanced threshold corrections which can be sizeable if tan β is large. In this case their careful inclusion in the renormalisation group evolution is mandatory. We analyse these corrections and give simple analytic expressions and numerical estimates for them. The threshold corrections sensitively depend on the soft supersymmetry breaking parameters. Especially, they determine the overall sign of the corrections and therefore if the affected Yukawa couplings are enhanced or suppressed. In the minimal supersymmetric extension of the Standard Model many free parameters are introduced by supersymmetry breaking about which we make some plausible assumptions in our first simplified approach. In a second, more sophisticated approach we use three common breaking schemes in which all the soft breaking parameters at the electroweak scale can be calculated from only a handful of parameters. Within the second approach, we apply various phenomenological constraints on the supersymmetric parameters and find in this way new viable Yukawa coupling relations, for example yμ/ys=9/2 or 6 or yτ/yb=3/2 in SU(5). Furthermore, we study a special class of quark mass matrix textures for small tan β where θu13=θd13=0. We derive sum rules for the quark mixing parameters and find a simple relation between the two phases δu12 and δd12 and the right unitarity triangle angle α which suggests a simple phase structure for the quark mass matrices where one matrix element is purely imaginary and the remaining ones are purely real. To complement the aforementioned

  13. New aspects of flavour model building in supersymmetric grand unification

    Energy Technology Data Exchange (ETDEWEB)

    Spinrath, Martin

    2010-05-19

    We derive predictions for Yukawa coupling ratios within Grand Unified Theories generated from operators with mass dimension four and five. These relations are a characteristic property of unified flavour models and can reduce the large number of free parameters related to the flavour sector of the Standard Model. The Yukawa couplings of the down-type quarks and charged leptons are affected within supersymmetric models by tan {beta}-enhanced threshold corrections which can be sizeable if tan {beta} is large. In this case their careful inclusion in the renormalisation group evolution is mandatory. We analyse these corrections and give simple analytic expressions and numerical estimates for them. The threshold corrections sensitively depend on the soft supersymmetry breaking parameters. Especially, they determine the overall sign of the corrections and therefore if the affected Yukawa couplings are enhanced or suppressed. In the minimal supersymmetric extension of the Standard Model many free parameters are introduced by supersymmetry breaking about which we make some plausible assumptions in our first simplified approach. In a second, more sophisticated approach we use three common breaking schemes in which all the soft breaking parameters at the electroweak scale can be calculated from only a handful of parameters. Within the second approach, we apply various phenomenological constraints on the supersymmetric parameters and find in this way new viable Yukawa coupling relations, for example y{sub {mu}}/y{sub s}=9/2 or 6 or y{sub {tau}}/y{sub b}=3/2 in SU(5). Furthermore, we study a special class of quark mass matrix textures for small tan {beta} where {theta}{sup u}{sub 13}={theta}{sup d}{sub 13}=0. We derive sum rules for the quark mixing parameters and find a simple relation between the two phases {delta}{sup u}{sub 12} and {delta}{sup d}{sub 12} and the right unitarity triangle angle {alpha} which suggests a simple phase structure for the quark mass matrices where

  14. Effective theories with broken flavour symmetry

    International Nuclear Information System (INIS)

    The work of Ovrut and Schnitzer on effective theories derived from a non Abelian Gauge Theory is generalised to include the physically interesting case of broken flavour symmetry. The calculations are performed at the 1-loop level. It is shown that at an intermediate stage in the calculations two distinct renormalised gauge coupling constants appear, one describing gauge field coupling to heavy particles and the other describing coupling to light particles. Appropriately modified Slavnov-Taylor identities are shown to hold. A simple alternative to the Ovrut-Schnitzer rules for calculating with effective theories is also considered

  15. Flavour perception of oxidation in beef.

    Science.gov (United States)

    Campo, M M; Nute, G R; Hughes, S I; Enser, M; Wood, J D; Richardson, R I

    2006-02-01

    Lipid oxidation is a major factor in meat quality. In order to relate human perceptions of lipid oxidation, as determined by a trained taste panel, to a chemical measurement of oxidation, we studied meat from animals with a wide range of potential oxidation through differences in their PUFA composition and by displaying the meat in high oxygen modified atmosphere packs for varying lengths of time. Meat was obtained from 73 Angus- and Charolais-cross steers from different trials that had been raised on 10 different diets: grass silage (high in C18:3, n-3), cereal concentrate (high in C18:2, n-6), three diets with 3% added fat consisting of three levels of protected lipid supplement (high in C18:2, n-6 and C18:3, n-3, ratio 1:1), a control with Megalac(®) (relatively saturated), three diets with three levels of inclusion of protected fish oil (high in C20:5 n-3 and C22:6 n-3) plus a constant amount of unprotected fish oil and a final diet with an unprotected fish oil control. The longissimus dorsi muscle was excised from the left carcass side, aged vacuum packaged for 10-13 days depending on the projects and frozen for less than eight months. TBARS and sensory analyses were performed on steaks displayed for 0, 4 or 9 days under simulated retail conditions, exposed to light in modified atmosphere packaging (CO(2):O(2); 25:75). Meat oxidation increased throughout display for each of the diets, as shown by a rise in TBARS values. This increase was not linear, differences between 0 and 4 days of display were smaller than between 4 and 9 days of display. The lowest TBARS and lowest increment occurred in the two control diets and the grass-fed animals, probably due to the more saturated fat of meat from animals fed the control diets and the higher content of vitamin E. Sensory attributes were also influenced by time of display. Positive attributes, such as beef flavour or overall liking, decreased throughout display, whereas negative attributes, such as abnormal and

  16. Discrete Symmetries and Models of Flavour Mixing

    Science.gov (United States)

    King, Stephen F.

    2015-07-01

    In this talk we shall give an overview of the role of discrete symmetries, including both CP and family symmetry, in constructing unified models of quark and lepton (including especially neutrino) masses and mixing. Various different approaches to model building will be described, denoted as direct, semi-direct and indirect, and the pros and cons of each approach discussed. Particular examples based on Δ(6n2) will be discussed and an A to Z of Flavour with Pati-Salam will be presented.

  17. Heavy flavour decay properties with ATLAS

    CERN Document Server

    Carli, Ina; The ATLAS collaboration

    2016-01-01

    We present the results on CP-violation searches in the Bs system, studied in the decay into J/psi phi, and the Bd system through the comparison of the decay time distributions in the flavour specific state J/psi K* and in the CP eigenstate J/psi KS. We additionally present new results in the search for the rare decays of Bs and Bd into mu+mu-. These searches are based on the full sample of data collected by ATLAS at 7 and 8 TeV collision energy. The consistency with the SM and with other available measurements is discussed.

  18. New Physics Search in Flavour Physics

    CERN Document Server

    Hurth, Tobias

    2006-01-01

    With the running B, kaon and neutrino physics experiments, flavour physics takes centre stage within today's particle physics. We discuss the opportunities offered by these experiments in our search for new physics beyond the SM and discuss their complementarity to collider physics. We focus on rare B and kaon decays, highlighting specific observables in an exemplary mode. We also comment on the so-called B --> pi pi and B --> K pi puzzles. Moreover, we briefly discuss the restrictive role of long-distance strong interactions and some new tools such as QCD factorization and SCET to handle them.

  19. Heavy flavour production in 13 TeV pp collisions

    CERN Multimedia

    Braun, Svende Annelies

    2015-01-01

    This summer first data at the unprecedented energy of 13 TeV is collected at the LHC. This opens a new era in searches for new particles and precision tests of the Standard Model. Heavy flavour production plays an important role both as precision QCD test and as backgrounds for new particles. The first measurements of heavy flavour production are presented.

  20. Flavour democracy and the lepton-quark hierarchy

    International Nuclear Information System (INIS)

    The mass hierarchy of the leptons and quarks is interpreted as a consequence of a coherent state phenomenon ('flavour democracy'). It is emphasized that particular forms of the mass matrices can arise from the coherent state basis. The violations of the 'flavour democracy' turn out to be relatively large. Numerical examples are presented. (orig.)

  1. On the Physics Case of a Super Flavour Factory

    CERN Document Server

    Browder, T; Gershon, T; Hazumi, M; Hurth, Tobias; Okada, Y; Stocchi, A

    2008-01-01

    We summarize the physics case of a high-luminosity e+e- flavour factory collecting an integrated luminosity of 50-75 ab^(-1). Many New Physics sensitive measurements involving B and D mesons and tau leptons, unique to a Super Flavour Factory, can be performed with excellent sensitivity to new particles with masses up to ~100 (or even ~1000 TeV). Flavour- and CP-violating couplings of new particles that may be discovered at the LHC can be measured in most scenarios, even in unfavourable cases assuming minimal flavour violation. Together with the LHC, a Super Flavour Factory, following either the SuperKEKB or the SuperB proposal, could be soon starting the project of reconstructing the New Physics Lagrangian.

  2. Flavour constraints on multi-Higgs-doublet models: Yukawa alignment

    CERN Document Server

    Pich, Antonio

    2010-01-01

    In multi-Higgs-doublet models, the alignment in flavour space of all Yukawa matrices coupling to a given right-handed fermion guarantees the absence of tree-level flavour-changing neutral couplings, while introducing new sources of CP violation. With N Higgs doublets (and no right-handed neutrinos) the Yukawa Lagrangian is characterized by the fermion masses, the CKM quark mixing matrix and 3(N-1) complex couplings. Quantum corrections break the alignment, generating a minimal-flavour-violation structure with flavour-blind phases. The aligned multi-Higgs-doublet models lead to a rich and viable phenomenology with an interesting hierarchy of flavour-changing neutral current effects, suppressing them in light-quark systems while allowing potentially relevant signals in heavy-quark transitions.

  3. AREVA Fatigue Concept (AFC) - an integrated and multi-disciplinary approach to the fatigue assessment of NPP components

    International Nuclear Information System (INIS)

    The AREVA fatigue concept (AFC) provides for a multi-step and multi-disciplinary process (process engineering, fatigue monitoring, fatigue analyses, etc.) against fatigue in the design and construction phase and also during the entire operation cycle of nuclear power plants (NPPs). The ensuing fatigue analyses are based on the real operational loads measured continuously on site in the plant. The entire process of fatigue design is based on an installed fatigue monitoring system, the FAMOS. This way, realistic load data are available. This system enables a reliable and realistic fatigue assessment of stressed components. FAMOS, as the central module of the AFC, contributes critically to the management of the component ageing problem and enables the identification of operating modes unfavorable to fatigue. Moreover, code conforming fatigue usage factors can be determined for the lifetime of the plant. The direct processing of the measured temperatures is immediately used for a fast fatigue evaluation (FFE). By means of FFE, the inverse thermal field at the inner surface of the pipe is calculated and transferred from measuring location to the component of concern for stress calculation. Then, a real time fatigue evaluation of the cumulative usage factor (CUF) can be performed after every operational cycle. This procedure is highly automated and gives a first fatigue status of the power plant. In the framework of the periodic safety inspection (PSI), a detailed fatigue calculation conforming to the code rules is carried out in order to determine the current state of the plant. This detailed fatigue check is based on the real loads (specification of thermal transient loads) and finite element analyses (FEA) in connection with the local strain approach to design against fatigue. These FEA always include transient thermal determination of the temperature field and subsequent determination of stresses and strains. The latter analyses may consist of simplified elastic or

  4. Critical Number of Flavours in QED

    CERN Document Server

    Bashir, A; Gutiérrez-Guerrero, L X; Tejeda-Yeomans, M E

    2011-01-01

    We demonstrate that in unquenched quantum electrodynamics (QED), chiral symmetry breaking ceases to exist above a critical number of fermion flavours $N_f$. This is a necessary and sufficient consequence of the fact that there exists a critical value of electromagnetic coupling $\\alpha$ beyond which dynamical mass generation gets triggered. We employ a multiplicatively renormalizable photon propagator involving leading logarithms to all orders in $\\alpha$ to illustrate this. We study the flavour and coupling dependence of the dynamically generated mass analytically as well as numerically. We also derive the scaling laws for the dynamical mass as a function of $\\alpha$ and $N_f$. Up to a multiplicative constant, these scaling laws are related through $(\\alpha, \\alpha_c) \\leftrightarrow (1/N_f, 1/N_f^c)$. Calculation of the mass anomalous dimension $\\gamma_m$ shows that it is always greater than its value in the quenched case. We also evaluate the $\\beta$-function. The criticality plane is drawn in the $(\\alpha...

  5. B decays and lepton flavour (universality) violation

    Science.gov (United States)

    Crivellin, A.

    2016-07-01

    LHCb found hints for physics beyond the standard model in Bto K^*μ^+μ^- , Bto K^*μ^+μ^-/Bto K^*e^+e^- and B_stoφμ^+μ^- . In addition, the BABAR results for Bto D^{(*)}τν and the CMS excess in htoτ^±μ^∓ also point towards lepton flavour (universality) violating new physics. While Bto D^{(*)}τν and htoτ^±μ^∓ can be naturally explained by an extended Higgs sector, the probably most promising explanation for the bto sμμ anomalies is a Z' boson. Furthermore, combining a 2HDM with a gauged L_μ-L_τ symmetry allows for explaining the bto sμ^+μ^- anomalies and htoτ^±μ^∓ simultaneously, with interesting correlations to τto3μ . In the light of these deviations from the SM we also discuss the possibilities of observing lepton flavour violating B decays ( e.g. Bto K^{(*)}τ^±μ^∓ and B_stoτ^±μ^∓ in Z^' models.

  6. Children's liking and wanting of snack products: Influence of shape and flavour

    OpenAIRE

    Liem Djin G; Zandstra Liesbeth H

    2009-01-01

    Abstract Background Children's food choices are guided by their preferences. However, these preferences may change due to repeated exposure. Methods This study investigated children's (n = 242, 7–12 yrs-old) liking and wanting for snacks over 3 weeks of daily consumption. The snacks differed in size (small vs large) or flavour (sweet vs sweet-sour). Two conditions were designed: 1) a monotonous group in which children continuously consumed the same snack across the 3 weeks, and 2) a free choi...

  7. Lepton mixing predictions including Majorana phases from Δ(6n2) flavour symmetry and generalised CP

    International Nuclear Information System (INIS)

    Generalised CP transformations are the only known framework which allows to predict Majorana phases in a flavour model purely from symmetry. For the first time generalised CP transformations are investigated for an infinite series of finite groups, Δ(6n2)=(Zn×Zn)⋊S3. In direct models the mixing angles and Dirac CP phase are solely predicted from symmetry. The Δ(6n2) flavour symmetry provides many examples of viable predictions for mixing angles. For all groups the mixing matrix has a trimaximal middle column and the Dirac CP phase is 0 or π. The Majorana phases are predicted from residual flavour and CP symmetries where α21 can take several discrete values for each n and the Majorana phase α31 is a multiple of π. We discuss constraints on the groups and CP transformations from measurements of the neutrino mixing angles and from neutrinoless double-beta decay and find that predictions for mixing angles and all phases are accessible to experiments in the near future

  8. Development of automatic frequency control (AFC) and governor free (GF) operation control systems for PWR nuclear power plants

    International Nuclear Information System (INIS)

    To maintain frequency and voltage at the prescribed values is one of the missions imposed on electric power companies. As for frequency, the control in carried out by AFC operation, in which generator power output is increased or decreased by the signals from a central power supply commandpost operating power systems, and by GF operation in which generators themselves increase or decrease power output corresponding to frequency variation. In the present state, nuclear power stations carry out the constant output operation, and frequency adjustment is made by thermal and hydroelectric power plants. However, as the measures to the time of low power demand in holidays and nights, it is supposed that frequency adjustment operation is required to be carried out also in nuclear power stations in future. Based on these situations, Kansai Electric Power Co., Inc. in cooperation with Mitsubishi Heavy Industries Ltd. carried out the technical development and verification required for executing the AFC-GF operation of nuclear power stations, therefore, the outline is reported. Frequency adjustment, the outline of the operation control of PWRs, the subjects on the adoption of frequency adjustment operation and the verification test on the improved control system are described. (Kako, I.)

  9. Modelling the effect of oil/fat content in food systems on flavour absorption by LLDPE.

    NARCIS (Netherlands)

    Dekker, M.; Willige, van R.W.G.; Linssen, J.P.H.; Voragen, A.G.J.

    2003-01-01

    One of the phenomena in food packaging interactions is flavour absorption. Absorption of flavour compounds from food products into food-packaging materials can result in loss of flavour compounds or an unbalance in the flavour profile changing a product's quality. The food matrix influences the amou

  10. Flavour-changing neutral currents in the flavour-blind MSSM at large tanβ

    International Nuclear Information System (INIS)

    A popular way to avoid too large FCNC in supersymmetric models is the assumption of minimal flavour violation (MFV), where SUSY is broken by a flavour-blind mechanism. We study how loop effects which are enhanced at large tanβ can circumvent the MFV constraint to generate new FCNCs. We show that these effects can be resummed to all orders in perturbation theory in analogy to the tanβ-enhanced corrections to the bottom mass. This procedure yields new Feynman rules which automatically contain the enhanced effects without resorting to the decoupling limit. We also include the enhanced bottom-mass corrections and clarify their dependence on the input scheme. Finally, we study contributions to FCNC observables in B physics resulting from the new Feynman rules

  11. The Strong Interactions, Flavour Physics and Beyond

    Science.gov (United States)

    Zuberi, Saba

    In this thesis we use effective field theories of the strong interactions to improve our understanding of several quantities in the Standard Model of particle physics (SM). We also examine constraints on an extension of the SM scalar sector and study the implications for the Higgs mass. We first examine an approach to extracting the Cabibbo-Kobayashi-Maskawa matrix element |Vub| via the relationship between the B meson decays B → X uℓnul and B → Xsgamma, where Xi is any final state hadron containing a quark of flavour i. Model dependence is reduced in this approach since the non-perturbative shape function at leading order is universal and drops out; however the perturbative expansion at next-to-leading order is found to be poorly behaved. We carry out a renormalon analysis of the relationship between these spectra to examine higher order perturbative corrections and compare the fixed-order and log expansions. Our analysis can be used to estimate the perturbative uncertainty in the extraction of |Vub|, which we show to be relatively small. Next we take a step towards the broader goal of summing large phase space logarithms from a variety of jet algorithms using Soft Collinear Effective Theory (SCET). We develop a consistent approach to implementing arbitrary phase space constraints in SCET and demonstrate the connection between cutoffs in SCET and phase space limits. By considering several jet algorithms at next-to-leading order, we gain some insight into factorization of final state jets. In particular, we point out the connection between the ultraviolet regulator and factorization. Finally we consider a scalar sector that contains a colour-octet electroweak-doublet scalar, in addition to the SM Higgs. This extension contains the only scalar representations that Yukawa-couple to quarks and are consistent with minimal flavour violation. We examine constraints from electroweak precision data, direct production from LEPII and the Tevatron, and from flavour

  12. Realization of digital AFC and AVC based on beam loading in RF system of a petal-shaped E-beam irradiator

    International Nuclear Information System (INIS)

    In this paper, we report the coupling system of RF power, accelerating cavity and beam acceleration of the petal-shaped accelerator developed at Ningbo Superpower High-tech Co., Ltd. The stability requirement on amplitude-frequency characteristics are derived by considering the beam loading and cavity detuning. The implementation scheme of low level controller based on digital AFC and AVC is proposed. The working process and implementation method of AFC and PID algorithm are described. Test results show that the stability index of cavity voltage is less than 0.8%, and the digital AFC and AVC closed-loop function has been proved by a 24-h test operation of the system. (authors)

  13. Active Flow Control (AFC) and Insect Accretion and Mitigation (IAM) System Design and Integration on the Boeing 757 ecoDemonstrator

    Science.gov (United States)

    Alexander, Michael G.; Harris, F. Keith; Spoor, Marc A.; Boyland, Susannah R.; Farrell, Thomas E.; Raines, David M.

    2016-01-01

    This paper presents a systems overview of how the Boeing and NASA team designed, analyzed, fabricated, and integrated the Active Flow Control (AFC) technology and Insect Accretion Mitigation (IAM) systems on the Boeing 757 ecoDemonstrator. The NASA Environmentally Responsible Aviation (ERA) project partnered with Boeing to demonstrate these two technology systems on a specially outfitted Boeing 757 ecoDemonstrator during the spring of 2015. The AFC system demonstrated attenuation of flow separation on a highly deflected rudder and increased the side force generated. This AFC system may enable a smaller vertical tail to provide the control authority needed in the event of an engine failure during takeoff while still operating in a conventional manner over the rest of the flight envelope. The AFC system consisted of ducting to obtain air from the Auxiliary Power Unit (APU), a control valve to modulate the system mass flow, a heat exchanger to lower the APU air temperature, and additional ducting to deliver the air to the AFC actuators located on the vertical tail. The IAM system demonstrated how to mitigate insect residue adhesion on a wing's leading edge. Something as small as insect residue on a leading edge can cause turbulent wedges that interrupt laminar flow, resulting in an increase in drag and fuel use. The IAM system consisted of NASA developed Engineered Surfaces (ES) which were thin aluminum sheet substrate panels with coatings applied to the exterior. These ES were installed on slats 8 and 9 on the right wing of the 757 ecoDemonstrator. They were designed to support panel removal and installation in one crew shift. Each slat accommodated 4 panels. Both the AFC and IAM flight test were the culmination of several years of development and produced valuable data for the advancement of modern aircraft designs.

  14. Search for lepton flavour violation at HERA

    CERN Document Server

    Hennekemper, E; Contreras, J G; Bruncko, D; Henderson, R C W; Martyn, H U; Rostovtsev, A; Olsson, J E; Feltesse, J; Buschhorn, G; Bozovic-Jelisavcic, I; Patel, G D; Pandurovic, M; Picuric, I; Staykova, Z; Povh, B; Campbell, A J; Backovic, S; Nowak, G; Ceccopieri, F; Fischer, D J; Kogler, R; Raicevic, N; Nowak, K; Polifka, R; Cvach, J; Huber, F; Lendermann, V; Mehta, A; Hildebrandt, M; Barrelet, E; Sauvan, E; Bizot, J C; Eisen, E; Sauter, M; Dobre, M; Schoeffel, L; Wunsch, E; Steder, M; Muller, K; Alexa, C; Henschel, H; Kleinwort, C; Papadopoulou, T; Pascaud, C; Pahl, P; Wegener, D; Boudry, V; Zacek, J; Turnau, J; Gogitidze, N; Robmann, R; Cerny, V; Niebuhr, C; Zomer, E; De Wolf, E A; Malinovski, E; Brinkmann, M; Fedotov, A; Schultz-Coulon, H C; Greenshaw, T; Horisberger, R; Mikocki, S; Chekelian, V; Gabathuler, E; Dodonov, V; Morris, J V; Valkarova, A; Glazov, A; Newman, P R; Salek, D; Sefkow, E; Lastovicka-Medin, G; Grab, C; Haidt, D; Grell, B R; Tseepeldorj, B; Toll, T; Van Mechelen, P; Goerlich, L; Bystritskaya, L; Ghazaryan, S; Specka, A; Spaskov, V; Laycock, R; Kluge, T; Fleischer, M; Rotaru, M; Vazdik, Y; von den Driesch, M V; Baghdasaryan, A; Pokorny, B; Panagoulias, I; Andreev, V; Zhang, Z; Felst, R; Lipka, K; Sankey, D P C; Baghdasaryan, S; Tsakov, I; Delcourt, B; Shushkevich, S; Kenyon, I R; Hreus, T; Lebedev, A; Aaron, F D; Habib, S; Coughlan, J A; Vallee, C; Shtarkov, L N; Herbst, M; Dubak, A; Schoning, A; Zhokin, A; Stella, B; Ferencei, J; Rusakov, S; Brisson, V; Osman, S; Favart, L; Dainton, J B; Belov, P; Schmitt, S; Sopicki, P; Soloviev, Y; Zohrabyan, H; Smiljanic, I; List, B; Perez, E; Tran, T H; Milcewicz-Mika, I; List, J; Bracinik, J; Dossanov, A; Traynor, D; Diaconu, C; Klein, M; Kraemer, M; Jung, H; Eckerlin, G; Pitzl, D; Petrukhin, A; Landon, M P J; Gayler, J; Jacquet, M; Delvax, J; Jonsson, L; Grindhammer, G; Bunyatyan, A; Helebrant, C; Hiller, K H; Sykora, T; Placakyte, R; Sloan, T; Cerny, K; Ravdandorj, T; Palichik, V; Fomenko, A; Kostka, P; Truol, P; Kapichine, M; Kretzschmar, J; Marage, P; Tabasco, J E R; Morozov, A; Brandt, G; Meyer, A B; Nikitin, D; Kruger, K; Naumann, T; Janssen, X; Daum, K; Stoicea, G; Zalesak, J; Britzger, D; Meyer, J; Meyer, H; Mudrinic, M; Straumann, U; Moreau, E; Bartel, W; Reimer, P; Kiesling, C; Avila, K B C; South, D; Eliseev, A; Roosen, R; Pirumov, H; Maxfield, S J; Grebenyuk, A; Belousov, A; Makankine, A; Ozerov, D; Hoffmann, D; Urban, K; Thompson, P D; Begzsuren, K; Lange, W; Egli, S; Gouzevitch, M; Levonian, S; Radescu, V; Piec, S; Lubimov, V

    2011-01-01

    A search for second and third generation scalar and vector leptoquarks produced in ep collisions via the lepton flavour violating processes ep -> mu X and ep -> tau X is performed by the H1 experiment at HERA. The full data sample taken at a centre-of-mass energy root s = 319 GeV is used for the analysis, corresponding to an integrated luminosity of 245 pb(-1) of e(+)p and 166 pb(-1) of e(-)p collision data. No evidence for the production of such leptoquarks is observed in the H1 data. Leptoquarks produced in e(+/-)p collisions with a coupling strength of lambda = 0.3 and decaying with the same coupling strength to a muon-quark pair or a tau-quark pair are excluded at 95\\% confidence level up to leptoquark masses of 712 GeV and 479 GeV, respectively.

  15. Flavour physics, supersymmetry and grand unification

    CERN Document Server

    Nierste, Ulrich

    2011-01-01

    A global fit to quark flavour-physics data disfavours the Standard Model with 3.6 standard deviations and points towards new CP-violating physics in meson-antimeson mixing amplitudes. Tevatron data call for a new Bs-Bs-bar mixing phase and new physics in Bd-Bd-bar mixing alleviates the tension on the unitarity triangle driven by B(B-> tau nu). In supersymmetric GUT models the large atmospheric neutrino mixing angle can influence b -> s transitions. I present the results of a recent analysis in an SO(10) GUT model which accomodates the large Bs-Bs-bar mixing phase while simultaneously obeying all other experimental constraints.

  16. CP violation versus flavour in supersymmetric theories

    Science.gov (United States)

    Abel, S.; Branco, G. C.; Khalil, S.

    2003-09-01

    We show that the quark flavour structure and CP violating phenomena are strongly correlated in supersymmetric theories. For a generic pattern of supersymmetry breaking the two broad categories of Yukawa couplings, democratic and hierarchical textures, have entirely different phenomenological implications. With hierarchical Yukawas, the rephasing invariant phase, arg(VusVcbVcb∗Vcs∗), in the CKM mixing matrix has to be of order unity, while the SUSY CP violating phases are severely constrained by electric dipole moments, giving rise to the so-called SUSY CP problem. With democratic Yukawas, all experimental CP results can be accommodated with small values for the CKM and SUSY CP violating phases (i.e., CP can be considered as an approximate symmetry at the high energy scale). We also show that within this scenario, an entirely real CKM matrix in supersymmetric models is still allowed by the present experimental results.

  17. CP violation versus flavour in supersymmetric theories

    CERN Document Server

    Abel, S A; Khalil, S

    2003-01-01

    We show that the quark flavour structure and CP violating phenomena are strongly correlated in supersymmetric theories. For a generic pattern of supersymmetry breaking the two broad categories of Yukawa couplings, democratic and hierarchical textures, have entirely different phenomenological implications. With hierarchical Yukawas, the rephasing invariant phase, arg(V_us V_cb V_cb^* V_cs^*), in the CKM mixing matrix has to be of order unity, while the SUSY CP violating phases are severely constrained by electric dipole moments, giving rise to the so-called SUSY CP problem. With democratic Yukawas, all experimental CP results can be accommodated with small values for the CKM and SUSY CP violating phases (i.e., CP can be considered as an approximate symmetry at the high energy scale). We also show that within this scenario, an entirely real CKM matrix in supersymmetric models is still allowed by the present experimental results.

  18. EFSA Scientific Opinion on Flavouring Group Evaluation 78, Revision 1 (FGE.78Rev1): Consideration of aliphatic and alicyclic and aromatic hydrocarbons evaluated by JECFA (63rd meeting) structurally related to aliphatic and aromatic hydrocarbons evaluated by EFSA in FGE.25Rev2

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister;

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to consider evaluations of flavouring substances assessed since 2000 by the Joint FAO/WHO Expert Committee on Food Additives (the JECFA), and to decide whether further...... production figure is needed to finalise the evaluation. Besides the safety assessment of these substances, the specifications for the materials of commerce have been considered. For two substances [FL-no: 01.018 and 01.061] the isomeric composition is lacking. For 14 substances [FL-no: 01.004, 01.007, 01.......008, 01.009, 01.017, 01.018, 01.019, 01.020, 01.024, 01.026, 01.029, 01.040, 01.045 and 01.061] further information on the composition of mixture is requested....

  19. Euroopa Liidu 7. Raamprogrammi projekt FLAVOURE / Marge Malbe

    Index Scriptorium Estoniae

    Malbe, Marge, 1968-

    2011-01-01

    2009. a sai Eesti Maaviljeluse Instituut 843,270.00 € suuruse Euroopa Liidu finantseeringu 3 aastat kestva projekti FLAVOURE (Food and Feed Laboratory of Varied and Outstanding Research in Estonia) läbiviimiseks ja koordineerimiseks

  20. Two-point functions for flavour changing currents in QCD

    International Nuclear Information System (INIS)

    We complete the calculations of two-point functions in QCD by presenting the results for the flavour changing vector current, including perturbative and non-perturbative contributions (to first ordern in αsub(s)). (orig.)

  1. Open heavy flavour production: conceptual framework and implementation issues

    International Nuclear Information System (INIS)

    Heavy flavour production is an important quantum chromodynamics (QCD) process both in its own right and as a key component of precision global QCD analysis. Apparent disagreements between fixed-flavour scheme calculations of b-production rate with experimental measurements in hadro-, lepto- and photo-production provide new impetus for a thorough examination of the theory and phenomenology of this process. We review existing methods of calculation and place them in the context of the general perturbative QCD framework of Collins. A distinction is drawn between scheme dependence and implementation issues related to quark mass effects near threshold. We point out a so far overlooked kinematic constraint on the threshold behaviour, which greatly simplifies the variable flavour number scheme. This obviates the need for the elaborate existing prescriptions and leads to robust predictions. It can facilitate the study of current issues on heavy flavour production as well as precision global QCD analysis. (author)

  2. Risk assessment of flavouring substances used in foods

    DEFF Research Database (Denmark)

    Norby, Karin; Beltoft, Vibe Meister; Greve, Krestine;

    2006-01-01

    The aim of the present project, the FLAVIS project, is to perform risk assessment of chemically defined flavouring substances. The evaluations are then presented to the European Food Safety Authority (EFSA) for final adoption in its Scientific Panel on food additives, flavourings, processing aids...... EU. In application of this Regulation, a Register of about 2800 flavouring substances used in or on foodstuffs in the EU Member States was adopted and are currently being evaluated according to the evaluation programme laid down by Commission Regulation. The EU Safety Evaluation Procedure is derived...... not to present a safety concern, have been specified. In the project a very comprehensive database (the FLAVIS database) has been developed for the evaluation. It compiles information on the about 2800 flavouring substances used in Europe: specifications, structural class, food categories used in...

  3. Risk assessment of flavouring substances used in foods

    DEFF Research Database (Denmark)

    Norby, Karin; Beltoft, Vibe Meister; Greve, Krestine; Reffstrup, Trine Klein; Gry, Jørn

    2006-01-01

    not to present a safety concern, have been specified. In the project a very comprehensive database (the FLAVIS database) has been developed for the evaluation. It compiles information on the about 2800 flavouring substances used in Europe: specifications, structural class, food categories used in......The aim of the present project, the FLAVIS project, is to perform risk assessment of chemically defined flavouring substances. The evaluations are then presented to the European Food Safety Authority (EFSA) for final adoption in its Scientific Panel on food additives, flavourings, processing aids...... and materials in contact with food. The regulatory background for the work is found in the European Parliament and Council Regulation No. 2232/96 laying down a procedure for the establishment of a list of flavouring substances the use of which will be authorised to the exclusion of all others in the...

  4. Relationship between texture of gels and flavour release

    OpenAIRE

    Koliandris, Andreas

    2009-01-01

    To provide further insight into the relationship between the structure of hydrocolloid solutions and gels and perception of taste and flavour, solutions of gelatin and locust bean gum, and gels prepared from mixtures of (a) high acyl and low acyl gellan (b) carrageenan and locust bean gum were studied. Both solutions contained sodium chloride and the gels were flavoured with ethyl butyrate. The gels were classified from rheological measurements into 3 categories: strong/brittle, intermedi...

  5. Impact on odorant partition coefficients and flavour perception

    OpenAIRE

    Rusu, Manuela

    2007-01-01

    Foods are complex multi-component systems which are composed of volatile and non-volatile substances. The flavour profile of a food is an important criterion for the selection of our foodstuffs. The main objective of this study was the clarification of the complex relationships of the flavour release as a function of the composition of the food matrix at molecular level. Therefore the influence of matrix effects onto the partition coefficients, odour activity values and sens...

  6. Application of Electrostatic Extrusion – Flavour Encapsulation and Controlled Release

    OpenAIRE

    Manojlovic, Verica; Rajic, Nevenka; Djonlagic, Jasna; Obradovic, Bojana; Nedovic, Viktor; Bugarski, Branko

    2008-01-01

    The subject of this study was the development of flavour alginate formulations aimed for thermally processed foods. Ethyl vanilline was used as the model flavour compound. Electrostatic extrusion was applied for the encapsulation of ethyl vanilline in alginate gel microbeads. The obtained microbeads with approx. 10 % w/w of ethyl vanilline encapsulated in about 2 % w/w alginate were uniformly sized spheres of about 450 μm. Chemical characterization by H-NMR spectroscopy revealed that the algi...

  7. Signatures of top flavour-changing dark matter

    OpenAIRE

    D’Hondt, Jorgen; Mariotti, Alberto; Mawatari, Kentarou; Moortgat, Seth; Tziveloglou, Pantelis; Van Onsem, Gerrit

    2016-01-01

    We develop the phenomenology of scenarios in which a dark matter candidate interacts with a top quark through flavour-changing couplings, employing a simplified dark matter model with an s -channel vector-like mediator. We study in detail the top-charm flavour-changing interaction, by investigating the single top plus large missing energy signature at the LHC as well as constraints from the relic density and direct and indirect dark matter detection experiments. We present strategies to disti...

  8. The negative binomial distribution in quark jets with fixed flavour

    OpenAIRE

    Alberto GiovanniniTurin U. & INFN, Turin; Sergio Lupia(Munich, Max Planck Inst.); Roberto Ugoccioni(Lund U.)

    2015-01-01

    We show that both the multiplicity distribution and the ratio of factorial cumulants over factorial moments for 2-jet events in e+e- annihilation at the Z^0 peak can be well reproduced by the weighted superposition of two negative binomial distributions, associated to the contribution of $b\\bar b$ and light flavoured events respectively. The negative binomial distribution is then suggested to describe the multiplicity distribution of 2-jet events with fixed flavour.

  9. Formation of Amino Acid Derived Cheese Flavour Compounds

    OpenAIRE

    Smit, B.A.

    2004-01-01

    Lactic acid bacteria (LAB), among them Lactococcus lactis, are often used for the fermentation of milk into various products, such as cheeses. For their growth and maintenance LAB metabolise milk sugar, protein and fat into various low molecular compounds, which sometimes have strong flavour characteristics. This thesis focuses on the production of one class of these compounds as a model system: aldehydes, in particular the key-flavour compounds 3-methylbutanal and 2-methyl propanal, which ar...

  10. Theory of electric dipole moments and lepton flavour violation

    OpenAIRE

    Jung, Martin

    2016-01-01

    Electric dipole moments and charged-lepton flavour-violating processes are extremely sensitive probes for new physics, complementary to direct searches as well as flavour-changing processes in the quark sector. Beyond the "smoking-gun" feature of a potential significant measurement, however, it is crucial to understand their implications for new physics models quantitatively. The corresponding multi-scale problem of relating the existing high-precision measurements to fundamental parameters c...

  11. Balancing macronutrient intake in a mammalian carnivore: disentangling the influences of flavour and nutrition.

    Science.gov (United States)

    Hewson-Hughes, Adrian K; Colyer, Alison; Simpson, Stephen J; Raubenheimer, David

    2016-06-01

    There is a large body of research demonstrating that macronutrient balancing is a primary driver of foraging in herbivores and omnivores, and more recently, it has been shown to occur in carnivores. However, the extent to which macronutrient selection in carnivores may be influenced by organoleptic properties (e.g. flavour/aroma) remains unknown. Here, we explore the roles of nutritional and hedonic factors in food choice and macronutrient balancing in a mammalian carnivore, the domestic cat. Using the geometric framework, we determined the amounts and ratio of protein and fat intake in cats allowed to select from combinations of three foods that varied in protein : fat (P : F) composition (approx. 10 : 90, 40 : 60 and 70 : 30 on a per cent energy basis) to which flavours of different 'attractiveness' (fish, rabbit and orange) were added. In two studies, in which animal and plant protein sources were used, respectively, the ratio and amounts of protein and fat intake were very consistent across all groups regardless of flavour combination, indicating regulation of both protein and fat intake. Our results suggest that macronutrient balancing rather than hedonistic rewards based on organoleptic properties of food is a primary driver of longer-term food selection and intake in domestic cats. PMID:27429768

  12. Patterns of Flavour Violation in Models with Vector-Like Quarks

    CERN Document Server

    Bobeth, Christoph; Celis, Alejandro; Jung, Martin

    2016-01-01

    We study the patterns of flavour violation in renormalizable extensions of the Standard Model (SM) that contain vector-like quarks (VLQs) in a single complex representation of either the SM gauge group G_SM or G_SM' = G_SM x U(1)_{L_mu - L_tau}. We first decouple VLQs in the (1 - 10) TeV range and then at the electroweak scale also Z, Z' gauge bosons and additional scalars to study the resulting phenomenology that depends on the relative size of Z- and Z'-induced flavour-changing neutral currents, as well as the size of |Delta F|=2 contributions. In addition to rare decays like M--> l^+l^-, M--> M' l^+l^-, M--> M' vv with M = K, B_s, B_d and |Delta F|=2 observables we analyze the ratio epsilon'/epsilon which appears in the SM to be significantly below the data. We study patterns and correlations between various flavour observables in VLQ models with left-handed (LH) and right-handed currents (RH) including experimental constraints. Among the highlights are large new physics (NP) effects in Kaon observables in...

  13. Understanding Darjeeling tea flavour on a molecular basis.

    Science.gov (United States)

    Gohain, Bornali; Borchetia, Sangeeta; Bhorali, Priyadarshini; Agarwal, Niraj; Bhuyan, L P; Rahman, A; Sakata, K; Mizutani, M; Shimizu, B; Gurusubramaniam, G; Ravindranath, R; Kalita, M C; Hazarika, M; Das, Sudripta

    2012-04-01

    Darjeeling teas are the highest grown teas in the world and preferred for its flavour, aroma and quality. Apart from the genetic makeup of the plant, earlier reports suggest that insect infestation, particularly jassids and thrips triggers the aroma and flavour formation in Darjeeling tea. The present work encompasses the identification of the genes/transcriptomes responsible for the typical flavour of Darjeeling tea, besides understanding the role of jassids and thrips in particular, in producing the best cup character and quality. The quantitative real time PCR analysis was based on a suppression subtractive hybridisation forward library of B157 (tea clone infested with thrips), providing us transcripts related to aroma and flavour formation. We observed the expression of genes like leucine zipper, ntd, nced, geraniol synthase, raffinose synthase, trehalose synthase, amylase, farnesyl transferase, catalase, methyl transferase, linalool synthase, peroxidases, elicitor responsive proteins, linamarase, nerolidol linalool synthase 2, 12-oxophytodienoate reductase, glucosidase, MYB transcription factor, and alcohol dehydrogenase, highly regulated due to insect infestation, manufacturing stresses and mechanical injury. The first report on gene expression dynamics in thrips infested Darjeeling tea leaves can be extrapolated with increase in volatiles which is responsible for enhancing the quality of Darjeeling tea, specially the flavour and aroma of the infusion. We hope to model these responses in order to understand the molecular changes that occur during Darjeeling tea flavour formation. PMID:22328090

  14. Acceleration feedback control (AFC) enhanced by disturbance observation and compensation (DOC) for high precision tracking in telescope systems

    Science.gov (United States)

    Wang, Qiang; Cai, Hua-Xiang; Huang, Yong-Mei; Ge, Liang; Tang, Tao; Su, Yan-Rui; Liu, Xiang; Li, Jin-Ying; He, Dong; Du, Sheng-Ping; Ling, Yu

    2016-08-01

    In this paper, a cascade acceleration feedback control (AFC) enhanced by a disturbance observation and compensation (DOC) method is proposed to improve the tracking precision of telescope systems. Telescope systems usually suffer some uncertain disturbances, such as wind load, nonlinear friction and other unknown disturbances. To ensure tracking precision, an acceleration feedback loop which can increase the stiffness of such a system is introduced. Moreover, to further improve the tracking precision, we introduce the DOC method which can accurately estimate the disturbance and compensate it. Furthermore, the analysis of tracking accuracy used by this method is proposed. Finally, a few comparative experimental results show that the proposed control method has excellent performance for reducing the tracking error of a telescope system.

  15. Flavour development of East Midlands cheeses and evaluation of flavour producing microorganisms in a small scale real-cheese model

    OpenAIRE

    Whiley, Henry

    2013-01-01

    Stilton is a blue-veined cheese made from pasteurised milk. The diversity of the microflora found within the cheese helps develop the unique flavour and aroma of Stilton compared to other blue cheese. However, this flora is not controlled and so product may be variable. A small-scale cheese model was developed to allow examination of the effect of different microflora on flavour production in a controlled way. Texture analysis, water activity and viable count of the cheese models were comp...

  16. Implication of Higgs mediated Flavour Changing Neutral Currents with Minimal Flavour Violation

    CERN Document Server

    Rebelo, M N

    2015-01-01

    We analise phenomenological implications of two Higgs doublet models with Higgs flavour changing neutral currents suppressed in the quark sector by small entries of the Cabibbo-Kokayashi-Maskawa matrix. This suppression occurs in a natural way since it is the result of a symmetry applied to the Lagrangian. These type of models were proposed some time ago by Branco Grimus and Lavoura. Our results clearly show that these class of models allow for new physical scalars, with masses which are reachable at the LHC. The imposed symmetry severely reduces the number of free parameters and allows for predictions. Therefore these models can eventually be proved right or eliminated experimentally.

  17. Linking Natural Supersymmetry to Flavour Physics

    CERN Document Server

    Dudas, Emilian; Pokorski, Stefan; Ziegler, Robert

    2013-01-01

    With the aim of linking natural supersymmetry to flavour physics, a model is proposed based on a family symmetry G \\times U(1), where G is a discrete nonabelian subgroup of SU(2), with both F-term and (abelian) D-term supersymmetry breaking. A good fit to the fermion masses and mixing is obtained with the same U(1) charges for the left- and right- handed quarks of the first two families and the right-handed bottom quark, and with zero charge for the left-handed top-bottom doublet and the the right handed top. The model shows an interesting indirect correlation between the correct prediction for the V_{ub}/V_{cb} ratio and large right-handed rotations in the (s,b) sector, required to diagonalise the Yukawa matrix. For the squarks, one obtains almost degenerate first two generations. The main source of the FCNC and CP violation effects is the splitting between the first two families and the right-handed sbottom determined by the relative size of F-term and D-term supersymmetry breaking. The presence of the larg...

  18. Relic neutrino decoupling with flavour oscillations revisited

    CERN Document Server

    de Salas, Pablo F

    2016-01-01

    We study the decoupling process of neutrinos in the early universe in the presence of three-flavour oscillations. The evolution of the neutrino spectra is found by solving the corresponding momentum-dependent kinetic equations for the neutrino density matrix, including for the first time the proper collision integrals for both diagonal and off-diagonal elements. This improved calculation modifies the evolution of the off-diagonal elements of the neutrino density matrix and changes the deviation from equilibrium of the frozen neutrino spectra. However, it does not vary the contribution of neutrinos to the cosmological energy density in the form of radiation, usually expressed in terms of the effective number of neutrinos, N_eff. We find a value of N_eff=3.045, in agreement with previous theoretical calculations and consistent with the latest analysis of Planck data. This result does not depend on the ordering of neutrino masses. We also consider the effect of non-standard neutrino-electron interactions (NSI), ...

  19. Flavour Physics with High-Luminosity Experiments

    CERN Document Server

    2016-01-01

    With the first dedicated B-factory experiments BaBar (USA) and BELLE (Japan) Flavour Physics has entered the phase of precision physics. LHCb (CERN) and the high luminosity extension of KEK-B together with the state of the art BELLE II detector will further push this precision frontier. Progress in this field always relied on close cooperation between experiment and theory, as extraction of fundamental parameters often is very indirect. To extract the full physics information from existing and future data, this cooperation must be further intensified. This MIAPP programme aims in particular to prepare for this task by joining experimentalists and theorists in the various relevant fields, with the goal to build the necessary tools in face of the challenge of new large data sets. The programme will begin with a focus on physics with non-leptonic final states, continued by semileptonic B meson decays and Tau decays, and on various aspects of CP symmetry violation closer to the end. In addition, in the final ...

  20. Search for lepton flavour violation at HERA

    Energy Technology Data Exchange (ETDEWEB)

    Aaron, F.D. [National Institute for Physics and Nuclear Engineering (NIPNE), Bucharest (Romania); Bucharest Univ. (Romania). Faculty of Physics; Alexa, C. [National Institute for Physics and Nuclear Engineering (NIPNE), Bucharest (Romania); Andreev, V. [Lebedev Physical Institute, Moscow (RU)] (and others)

    2011-03-15

    A search for second and third generation scalar and vector leptoquarks produced in ep collisions via the lepton flavour violating processes ep{yields}{mu}X and ep{yields}{tau}X is performed by the H1 experiment at HERA. The full data sample taken at a centre-of-mass energy {radical}(s)=319 GeV is used for the analysis, corresponding to an integrated luminosity of 245 pb{sup -1} of e{sup +}p and 166 pb{sup -1} of e{sup -}p collision data. No evidence for the production of such leptoquarks is observed in the H1 data. Leptoquarks produced in e{sup {+-}}p collisions with a coupling strength of {lambda}=0.3 and decaying with the same coupling strength to a muon-quark pair or a tau-quark pair are excluded at 95% confidence level up to leptoquark masses of 712 GeV and 479 GeV, respectively. (orig.)

  1. Dark matter and observable Lepton Flavour Violation

    CERN Document Server

    Heurtier, Lucien

    2016-01-01

    Seesaw models with leptonic symmetries allow right-handed (RH) neutrino masses at the electroweak scale, or even lower, at the same time having large Yukawa couplings with the Standard Model leptons, thus yielding observable effects at current or near-future lepton-flavour-violation (LFV) experiments. These models have been previously considered also in connection to low-scale leptogenesis, but the combination of observable LFV and successful leptogenesis has appeared to be difficult to achieve unless the leptonic symmetry is embedded into a larger one. In this paper, instead, we follow a different route and consider a possible connection between large LFV rates and Dark Matter (DM). We present a model in which the same leptonic symmetry responsible for the large Yukawa couplings guarantees the stability of the DM candidate, identified as the lightest of the RH neutrinos. The spontaneous breaking of this symmetry, caused by a Majoron-like field, also provides a mechanism to produce the observed relic density ...

  2. Flavour physics in the soft wall model

    Science.gov (United States)

    Archer, Paul R.; Huber, Stephan J.; Jäger, Sebastian

    2011-12-01

    We extend the description of flavour that exists in the Randall-Sundrum (RS) model to the soft wall (SW) model in which the IR brane is removed and the Higgs is free to propagate in the bulk. It is demonstrated that, like the RS model, one can generate the hierarchy of fermion masses by localising the fermions at different locations throughout the space. However, there are two significant differences. Firstly the possible fermion masses scale down, from the electroweak scale, less steeply than in the RS model and secondly there now exists a minimum fermion mass for fermions sitting towards the UV brane. With a quadratic Higgs VEV, this minimum mass is about fifteen orders of magnitude lower than the electroweak scale. We derive the gauge propagator and despite the KK masses scaling as m_n^2 ˜ n , it is demonstrated that the coefficients of four fermion operators are not divergent at tree level. FCNC's amongst kaons and leptons are considered and compared to calculations in the RS model, with a brane localised Higgs and equivalent levels of tuning. It is found that since the gauge fermion couplings are slightly more universal and the SM fermions typically sit slightly further towards the UV brane, the contributions to observables such as ɛ K and Δ m K , from the exchange of KK gauge fields, are significantly reduced.

  3. Linking natural supersymmetry to flavour physics

    International Nuclear Information System (INIS)

    With the aim of linking natural supersymmetry to flavour physics, a model is proposed based on a family symmetry G×U(1), where G is a discrete nonabelian subgroup of SU(2), with both F-term and (abelian) D-term supersymmetry breaking. A good fit to the fermion masses and mixing is obtained with the same U(1) charges for the left- and right- handed quarks of the first two families and the right-handed bottom quark, and with zero charge for the left-handed top-bottom doublet and the the right handed top. The model shows an interesting indirect correlation between the correct prediction for the Vub/Vcb ratio and large right-handed rotations in the (s,b) sector, required to diagonalise the Yukawa matrix. For the squarks, one obtains almost degenerate first two generations. The main source of the FCNC and CP violation effects is the splitting between the first two families and the right-handed sbottom determined by the relative size of F-term and D-term supersymmetry breaking. The presence of the large right-handed rotation implies that the bounds on the masses of the first two families of squarks and the right handed sbottom are in a few to a few tens TeV range. The picture that emerges is light stops and left handed sbottom and much heavier other squarks

  4. Generalised geometrical CP violation in a T′ lepton flavour model

    International Nuclear Information System (INIS)

    We analyse the interplay of generalised CP transformations and the non-Abelian discrete group T′ and use the semi-direct product Gf=T′⋊HCP, as family symmetry acting in the lepton sector. The family symmetry is shown to be spontaneously broken in a geometrical manner. In the resulting flavour model, naturally small Majorana neutrino masses for the light active neutrinos are obtained through the type I see-saw mechanism. The known masses of the charged leptons, lepton mixing angles and the two neutrino mass squared differences are reproduced by the model with a good accuracy. The model allows for two neutrino mass spectra with normal ordering (NO) and one with inverted ordering (IO). For each of the three spectra the absolute scale of neutrino masses is predicted with relatively small uncertainty. The value of the Dirac CP violation (CPV) phase δ in the lepton mixing matrix is predicted to be δ≅π/2 or 3π/2. Thus, the CP violating effects in neutrino oscillations are predicted to be maximal (given the values of the neutrino mixing angles) and experimentally observable. We present also predictions for the sum of the neutrino masses, for the Majorana CPV phases and for the effective Majorana mass in neutrinoless double beta decay. The predictions of the model can be tested in a variety of ongoing and future planned neutrino experiments

  5. Update of the flavour-physics constraints in the NMSSM

    CERN Document Server

    Domingo, Florian

    2015-01-01

    We consider the impact of several flavour-changing observables in the $B$- and the Kaon sectors on the parameter space of the NMSSM, in a minimal flavour violating version of this model. Our purpose consists in updating our previous results in arXiv:0710.3714 and designing an up-to-date flavour test for the public package NMSSMTools. We provide details concerning our implementation of the constraints in a series of brief reviews of the current status of the considered channels. Finally, we present a few consequences of these flavour constraints for the NMSSM, turning to two specific scenarios: one is characteristic of the MSSM-limit and illustrates the workings of charged-Higgs and genuinely supersymmetric contributions to flavour-changing processes; the second focus is a region where a light CP-odd Higgs is present. Strong limits are found whenever an enhancement factor - large $\\tan\\beta$, light $H^{\\pm}$, resonant pseudoscalar - comes into play.

  6. The Correlations of Anti-Mullerian Hormone, Follicle-Stimulating Hormone and Antral Follicle Count in Different Age Groups of Infertile Women

    Directory of Open Access Journals (Sweden)

    Ludmila Barbakadze

    2015-02-01

    Full Text Available Background: The objective of our study was to identify the correlations between the tests currently used in ovarian reserve assessment: anti-Mullerian hormone (AMH, follicle stimulating hormone (FSH and antral follicle count (AFC and to distinguish the most reliable markers for ovarian reserve in order to select an adequate strategy for the initial stages of infertility treatment. Materials and Methods: In this prospective study, 112 infertile women were assessed. Subjects were divided into three age groups: group I <35 years (n=39, group II 35-40 years (n=31, and group III 41-46 years (n=42. AMH, FSH and AFC were determined on days 2-3 of the patients’ menstrual cycles. Results: There was a significantly elevated negative correlation between age and AMH level (rs =-0.67, p<0.0001 and AFC (rs =-0.55, p<0.0001. We observed a significantly positive correlation between age and FSH (rs =0.38, p<0.0001. AMH negatively correlated with FSH (rs =-0.48, p<0.0001 and positively with AFC (r=- 0.71, p=0.0001. There was a moderate negative relation between FSH and AFC (r=-0.41, p=0.0001 and moderate positive relation between age and FSH (rs =0.38, p<0.0001. The correlation analysis performed in separate groups showed that AMH and AFC showed a statistically significant positive correlation for group I (r=0.57, p<0.0001, group II (r=0.69, p<0.0001 and group III (r=0.47, p<0.002. A statistically significant correlation between FSH and AMH was detected only in groups I (r=-0.41, p<0.02 and II (r=-0.55, p<0.0001. A statistically significant correlation existed between FSH and AFC only in group III (r=-0.42, p<0.006, as well as between age and AFC only in group I (r=-0.35, p<0.03. Conclusion: Currently, AMH should be considered as the more reliable of the ovarian reserve assessments tests compared to FSH. There is a strong positive correlation between serum AMH level and AFC. The use of AMH combined with AFC may improve ovarian reserve evaluation.

  7. Authenticity and Traceability of Vanilla Flavour by Analysis of Stable Isotopes

    DEFF Research Database (Denmark)

    Hansen, Anne-Mette Sølvbjerg; Fromberg, Arvid; Frandsen, Henrik Lauritz

    For authentification of vanilla flavours, vanilla pods of the type Vanilla planifolia and Vanilla tahitensis from different geographical habitats were extracted and analyzed together with vanilla flavours made by fermentations and chemical synthesis. Isotopic delta values were determined using Ga...

  8. η'-π mass splitting in full QCD from negative flavour numbers

    International Nuclear Information System (INIS)

    η'-π splitting in full QCD can be estimated extrapolating from negative to positive flavour numbers. Our results show a flavour dependence consistent with the Witten Veneziano formula based on the U(1) anomaly. (orig.)

  9. Approaching Minimal Flavour Violation from an S4 x SU(5) SUSY GUT

    CERN Document Server

    Dimou, Maria; Luhn, Christoph

    2015-01-01

    We show how approximate Minimal Flavour Violation (MFV) can emerge from an SU(5) Supersymmetric Grand Unified Theory (SUSY GUT) supplemented by an S4 x U(1) family symmetry, which provides a good description of all quark and lepton (including neutrino) masses, mixings and CP violation. Assuming a SUSY breaking mechanism which respects the family symmetry, we calculate in full explicit detail the low energy mass insertion parameters in the super-CKM basis, including the effects of canonical normalisation and renormalisation group running. We find that the very simple family symmetry S4 x U(1) is sufficient to approximately reproduce the effects of low energy MFV.

  10. Measurement of charm flow with the STAR Heavy Flavour Tracker

    International Nuclear Information System (INIS)

    In order to understand the partonic EOS of matter created at RHIC, one needs to study both the collectivity of the produced matter and the degree of thermalization. Anisotropic flow measurements have already demonstrated the development of partonic collectivity at RHIC (Ackermann K et al 2001 Phys. Rev. Lett. 86 402), and now it is necessary to address the issue of quark thermalization. Since the masses of the heavy flavour quarks are larger than the possible excitations of the system created in the collision, their collective motion could be used to indicate the degree of thermalization of the light flavour quarks (u, d, s). The Heavy Flavour Tracker (HFT), a tracking upgrade of the STAR experiment, is being designed to provide an unambiguous measurement of charm quark flow through the direct reconstruction of the D0. The current design of our detector uses a novel CMOS-based sensor, allowing for a low mass and high resolution detector element

  11. A U(2)^3 flavour symmetry in Supersymmetry

    CERN Document Server

    Sala, Filippo

    2012-01-01

    A U(2)^3 flavour symmetry acting on the first two generations of quarks partially explains the hierarchies of the yukawa couplings, and provides a natural embedding for Supersymmetry with heavier first two generations, where collider constraints are not in conflict with the requirement of naturalness and the SUSY CP problem is solved. Within this context a specific pattern of flavour symmetry breaking is considered. The K, B_d and B_s mixing amplitudes show a definite correlation that can resolve existing tensions in the CKM fit, pointing in this way to sbottom and gluino masses below about 1.5 TeV. Potentially sizeable contributions to both indirect and direct CP violation in B decays are allowed, even in the absence of flavour-blind phases. In case some effects are observed, the peculiar pattern in Delta(F) = 2 and Delta(B) = 1 observables may allow to distinguish between this and other models.

  12. The neutron EDM vs up and charm flavour violation

    CERN Document Server

    Sala, Filippo

    2014-01-01

    We derive a strong bound on the chromo-electric dipole moment of the charm quark, and we quantify its impact on models that allow for a sizeable flavour violation in the up quark sector. In particular we show how the constraints coming from the charm and up CEDMs limit the size of new physics contributions to direct flavour violation in D meson decays. We also specialize our analysis to the cases of split-families Supersymmetry and composite Higgs models. The results we expose motivate an increase in experimental sensitivity to fundamental hadronic dipoles, and a further exploration of the SM contribution to both flavour violating D decays and nuclear electric dipole moments.

  13. Impact of sterile neutrinos in lepton flavour violating processes

    Science.gov (United States)

    De Romeri, Valentina

    2016-05-01

    We discuss charged lepton flavour violating processes occurring in minimal extensions of the Standard Model via the addition of sterile fermions. We firstly investigate the possibility of their indirect detection at a future high-luminosity Z-factory (such as FCC-ee). Rare decays such as Z → l 1 ± l 2 ± can indeed be complementary to low-energy (high-intensity) observables of lepton flavour violation. We further consider a sterile neutrino-induced charged lepton flavour violating process occurring in the presence of muonic atoms: their (Coulomb enhanced) decay into a pair of electrons μ¯e¯ → e¯e¯. Our study reveals that, depending on their mass range and on the active-sterile mixing angles, sterile neutrinos can give significant contributions to the above mentioned observables, some of them even lying within present and future sensitivity of dedicated cLFV experiments and of FCC-ee.

  14. Challenges for New Physics in the Flavour Sector

    International Nuclear Information System (INIS)

    In these proceedings I present a personal perspective of the challenges for new physics (NP) searches in the flavour sector. Since the CKM mechanism of flavour violation has been established to a very high precision, we know that physics beyond the Standard Model can only contribute sub-dominantly. Therefore, any realistic model of physics beyond the Standard Model (SM) must respect the stringent constrains from flavour observables like b → sγ, BS → μ+μ-, ΔF=2 processes etc., in a first step. In a second step, it is interesting to ask the question if some deviations from the SM predictions (like the anomalous magnetic moment of the muon or recently observed discrepancies in tauonic B decays or B → K*μ+μ-) can be explained by a model of NP without violating bounds from other observables. (author)

  15. Signatures of top flavour-changing dark matter

    CERN Document Server

    D'Hondt, Jorgen; Mawatari, Kentarou; Moortgat, Seth; Tziveloglou, Pantelis; Van Onsem, Gerrit

    2015-01-01

    We develop the phenomenology of scenarios in which a dark matter candidate interacts with a top quark through flavour-changing couplings, employing a simplified dark matter model with an s-channel vector-like mediator. We study in detail the top-charm flavour-changing interaction, by investigating the single top plus large missing energy signature at the LHC as well as constraints from the relic density and direct and indirect dark matter detection experiments. We present strategies to distinguish between the top-charm and top-up flavour-changing models by taking advantage of the lepton charge asymmetry as well as by using charm-tagging techniques on an extra jet. We also show the complementarity between the LHC and canonical dark matter experiments in exploring the viable parameter space of the models.

  16. LHCb: Optimization and Calibration of Flavour Tagging Algorithms for the LHCb experiment

    CERN Multimedia

    Falabella, A

    2013-01-01

    The LHCb purposes are to make precise measurements in $B$ and $D$ meson decays. In particular in time-dependent CP violation studies the determination of $B$ flavour at production ("Flavour Tagging") is fundamental. The performances and calibration of the flavour tagging algorithms with 2011 data collected by LHCb are reported. The performances of the flavour tagging algorithms on the relevant CP violation and asymmetry studies are also reported.

  17. LHCb: Optimization and Calibration of Flavour Tagging Algorithms for the LHCb experiment

    CERN Multimedia

    Falabella, A

    2013-01-01

    The LHCb purposes are to make precise measurements of $B$ and $D$ meson decays. In particular in time-dependent CP violation studies the determination of $B$ flavour at production is fundamental. This is known as "flavour tagging" and at LHCb it is performed with several algorithms. The performances and calibration of the flavour tagging algorithms with 2011 data collected by LHCb are reported. Also the performances of the flavour tagging algorithms in the relevant CP violation and asymmetry studies are also reported.

  18. Open heavy flavour at the CERN-LHC

    Directory of Open Access Journals (Sweden)

    Mischke André

    2014-04-01

    Full Text Available In this contribution recent open heavy flavour measurements from the CERN-Large Hadron Collider are presented and discussed. The focus is on prompt D meson and heavy flavour decay lepton production in pp, p-Pb and Pb-Pb collisions. Open beauty is studied through a displaced J/Ψ analysis. Heavy quarks allow to probe the degree of thermalization and energy loss mechanism(s in the hot QCD matter produced in heavy ion collisions, whereas pp provide important baseline measurements for the studies in heavy ion collisions. The p-Pb data give an access to investigate cold nuclear matter effects.

  19. Running of the SF-coupling with four massless flavours

    International Nuclear Information System (INIS)

    We discuss the status of different determinations of αs, motivating a precise and reliable computation from lattice QCD. In order to suppress perturbative errors, the non-perturbative computation has to reach high energy scales μ. Such results already exist in the SF-scheme for Nf=0;2 and Nf=3. We recently added the running with four massless flavours in a range of α from about 0.07 to 0.3. It is based on our recent determination of the Sheikholeslami Wohlert coefficient in the four-flavour theory. (orig.)

  20. Theory of electric dipole moments and lepton flavour violation

    CERN Document Server

    Jung, Martin

    2016-01-01

    Electric dipole moments and charged-lepton flavour-violating processes are extremely sensitive probes for new physics, complementary to direct searches as well as flavour-changing processes in the quark sector. Beyond the "smoking-gun" feature of a potential significant measurement, however, it is crucial to understand their implications for new physics models quantitatively. The corresponding multi-scale problem of relating the existing high-precision measurements to fundamental parameters can be approached model-independently to a large extent; however, care must be taken to include the uncertainties from especially nuclear and QCD calculations properly.

  1. New physics searches in heavy flavours in ATLAS

    International Nuclear Information System (INIS)

    Precision determinations of the flavour sector allow the search for indirect new physics signatures. At the forefront of these studies are the determinations of interference of new physics with known ΔF = 1 and ΔF = 2 processes. The ATLAS collaboration explores this area with competitive results measuring the CP violating phase φs from Bs0 → J/ψφ decays and investigating rare B decays with dileptons in the final state with data collected at the Large Hadron Collider. In this paper, the latest ATLAS results relevant for new physics searches in the heavy flavour sector will be discussed. (authors)

  2. KLOE results in flavour physics and prospects for KLOE-2

    International Nuclear Information System (INIS)

    A review of the most recent results in flavour physics obtained by the KLOE experiment at DAΦNE collider together with prospects for kaon physics at KLOE-2 is presented. A brief description of KS meson lifetime measurement and determination of upper limit for BR(Ks→3π0) are discussed. In addition a CPT symmetry test in the Standard Model Extension framework and study of the Dalitz plot of η→π+π−π0 are reported. Last two sections are devoted to the KLOE-2 project and prospects in flavour physics

  3. KLOE results in flavour physics and prospects for KLOE-2

    Energy Technology Data Exchange (ETDEWEB)

    Czerwiński, E., E-mail: eryk.czerwinski@uj.edu.pl [Institute of Physics, Jagiellonian University, Cracow (Poland); Babusci, D.; Badoni, D.; Balwierz, I.; Bencivenni, G.; Bini, C.; Bloise, C.; Bocci, V.; Bossi, F.; Branchini, P.; Budano, A.; Caldeira Balkeståhl, L.; Capon, G.; Ceradini, F.; Ciambrone, P.; Czerwiński, E.; Dané, E.; De Lucia, E.; De Robertis, G.; De Santis, A.; and others

    2013-08-15

    A review of the most recent results in flavour physics obtained by the KLOE experiment at DAΦNE collider together with prospects for kaon physics at KLOE-2 is presented. A brief description of K{sub S} meson lifetime measurement and determination of upper limit for BR(K{sub s}→3π{sup 0}) are discussed. In addition a CPT symmetry test in the Standard Model Extension framework and study of the Dalitz plot of η→π{sup +}π{sup −}π{sup 0} are reported. Last two sections are devoted to the KLOE-2 project and prospects in flavour physics.

  4. New physics search with flavour in the LHC era

    CERN Document Server

    Hurth, Tobias

    2013-01-01

    We give a status report on quark flavour physics in view of the latest data from the B factories and the LHC, and discuss the impact of the latest experimental results on new physics in the MFV framework. We also show some examples of the implications in supersymmetry.

  5. Flavour alignment in physics beyond the standard model

    Energy Technology Data Exchange (ETDEWEB)

    Braeuninger, Carolin Barbara

    2012-11-21

    There are numerous reasons to think that the Standard Model of physics is not the ultimate theory of nature on very small scales. However, attempts to construct theories that go beyond the Standard Model generically lead to high rates of flavour changing neutral processes that are in conflict with experiment: Quarks are the fundamental constituents of protons and neutrons. Together with electrons they form the visible matter of the universe1. They come in three generations or ''flavours''. In interactions, quarks of different generations can mix, i.e. a quark of one flavour can transform into a quark of another flavour. In the Standard Model, at first order in perturbation theory, such processes occur only via the exchange of a charged particle. Flavour changing neutral processes can only arise in processes involving loops of charged particles. This is due to the fact that all couplings of two quarks to a neutral particle are diagonal in the basis of the mass eigenstates of the quarks. There is thus no mixing of quarks of different flavour at first order. Since the loop processes are suppressed by a loop factor, the Standard Model predicts very low rates for neutral processes that change the flavour of quarks. So far, this is in agreement with experiment. In extensions of the Standard Model, new couplings to the quarks are usually introduced. In general there is no reason why the new coupling matrices should be diagonal in the mass basis of the quarks. These models therefore predict high rates for processes that mix quarks of different flavour. Extensions of the Standard Model must therefore have a non-trivial flavour structure. A possibility to avoid flavour violation is to assume that the new couplings are aligned with the mass matrices of the quarks, i.e. diagonal in the same basis. This alignment could be due to a flavour symmetry. In this thesis, two extensions of the Standard Model with alignment are studied. The first is a simple

  6. LHCb results on flavour physics and implications to BSM

    International Nuclear Information System (INIS)

    LHCb is a dedicated flavour physics experiment at the LHC. Precision measurements of CP violation and the study of rare decays of hadrons containing beauty and charm quarks constitute powerful searches for New Physics. A selection of recent LHCb results and their implications to physics beyond the Standard Model are discussed.

  7. Supersymmetry, the flavour puzzle and rare B decays

    International Nuclear Information System (INIS)

    The gauge hierarchy problem and the flavour puzzle belong to the most pressing open questions in the Standard Model of particle physics. Supersymmetry is arguably the most popular framework of physics beyond the Standard Model and provides an elegant solution to the gauge hierarchy problem; however, it aggravates the flavour puzzle. In the first part of this thesis, I discuss several approaches to address the flavour puzzle in the minimal supersymmetric extension of the Standard Model and experimental tests thereof: supersymmetric grand unified theories with a unification of Yukawa couplings at high energies, theories with minimal flavour violation and additional sources of CP violation and theories with gauge mediation of supersymmetry breaking and a large ratio of Higgs vacuum expectation values. In the second part of the thesis, I discuss the phenomenology of two rare B meson decay modes which are promising probes of physics beyond the Standard Model: The exclusive B → K*l+l- decay, whose angular decay distribution will be studied at LHC and gives access to a large number of observables and the b→sνanti ν decays, which are in the focus of planned high-luminosity Super B factories. I discuss the predictions for these observables in the Standard Model and their sensitivity to New Physics. (orig.)

  8. Chromomagnetism, flavour symmetry breaking and S-wave tetraquarks

    Energy Technology Data Exchange (ETDEWEB)

    Buccella, F. [Napoli Federico II Univ. (Italy). Dipartimento di Scienze Fisiche; INFN, Napoli (Italy); Hoegaasen, H. [University of Oslo, Department of Physics (Norway); Richard, J.M. [Universite Joseph Fourier-IN2P3-CNRS 53, Laboratoire de Physique Subatomique et Cosmologie, Grenoble (France); Sorba, P. [Laboratoire d' Annecy-le-Vieux de Physique Theorique (LAPTH) (France)

    2007-02-15

    The chromomagnetic interaction, with full account for flavour-symmetry breaking, is applied to S-wave configurations containing two quarks and two antiquarks. Phenomenological implications are discussed for light, charmed, charmed and strange, hidden-charm and double-charm mesons, and extended to their analogues with beauty. (orig.)

  9. Chromomagnetism, flavour symmetry breaking and S-wave tetraquarks

    International Nuclear Information System (INIS)

    The chromomagnetic interaction, with full account for flavour-symmetry breaking, is applied to S-wave configurations containing two quarks and two antiquarks. Phenomenological implications are discussed for light, charmed, charmed and strange, hidden-charm and double-charm mesons, and extended to their analogues with beauty. (orig.)

  10. Chromomagnetism, flavour symmetry breaking and S-wave tetraquarks

    Science.gov (United States)

    Buccella, F.; Høgaasen, H.; Richard, J.-M.; Sorba, P.

    2007-02-01

    The chromomagnetic interaction, with full account for flavour-symmetry breaking, is applied to S-wave configurations containing two quarks and two antiquarks. Phenomenological implications are discussed for light, charmed, charmed and strange, hidden-charm and double-charm mesons, and extended to their analogues with beauty.

  11. Chromomagnetism, flavour symmetry breaking and S-wave tetraquarks

    CERN Document Server

    Buccella, F; Richard, J M; Sorba, Paul; Buccella, Franco; Hogaasen, Hallstein; Richard, Jean-Marc; Sorba, Paul

    2007-01-01

    The chromomagnetic interaction, with full account for flavour-symmetry breaking, is applied to S-wave configurations containing two quarks and two antiquarks. Phenomenological implications are discussed for light, charmed, charmed and strange, hidden-charm and double-charm mesons, and extended to their analogues with beauty.

  12. Chromomagnetism, flavour symmetry breaking and S-wave tetraquarks

    OpenAIRE

    Buccella, Franco; Hogaasen, Hallstein; Richard, Jean-Marc; Sorba, Paul

    2006-01-01

    The chromomagnetic interaction, with full account for flavour-symmetry breaking, is applied to S-wave configurations containing two quarks and two antiquarks. Phenomenological implications are discussed for light, charmed, charmed and strange, hidden-charm and double-charm mesons, and extended to their analogues with beauty.

  13. LHCb : Search for Lepton Flavour Violation at LHCb

    CERN Multimedia

    Rives Molina, Vicente

    2014-01-01

    The observation of neutrino oscillations has re-opened the case for searches of lepton-flavour violating decays. We report on recent results on searches for short or long-lived Majorana heavy neutrinos in B&arr;μμπ and τ→μμμ decays

  14. The role of flavon cross couplings in leptonic flavour mixing

    CERN Document Server

    Pascoli, Silvia

    2016-01-01

    In models with discrete flavour symmetries, flavons are critical to realise specific flavour structures. Leptonic flavour mixing originates from the misalignment of flavon vacuum expectation values which respect different residual symmetries in the charged lepton and neutrino sectors. Flavon cross couplings are usually forbidden, in order to protect these symmetries. Contrary to this approach, we show that cross couplings can play a key role and give raise to necessary corrections to flavour-mixing patterns, including a non-zero value for the reactor angle and CP violation. For definiteness, we present two models based on $A_4$. In the first model, all flavons are assumed to be real or pseudo-real, with 7 real degrees of freedom in the flavon sector in total. A sizable reactor angle associated with nearly maximal CP violation is achieved, and, as both originate from the same cross coupling, a sum rule results with a precise prediction for the value of the Dirac CP-violating phase. In the second model, the fla...

  15. Flavour alignment in physics beyond the standard model

    International Nuclear Information System (INIS)

    There are numerous reasons to think that the Standard Model of physics is not the ultimate theory of nature on very small scales. However, attempts to construct theories that go beyond the Standard Model generically lead to high rates of flavour changing neutral processes that are in conflict with experiment: Quarks are the fundamental constituents of protons and neutrons. Together with electrons they form the visible matter of the universe1. They come in three generations or ''flavours''. In interactions, quarks of different generations can mix, i.e. a quark of one flavour can transform into a quark of another flavour. In the Standard Model, at first order in perturbation theory, such processes occur only via the exchange of a charged particle. Flavour changing neutral processes can only arise in processes involving loops of charged particles. This is due to the fact that all couplings of two quarks to a neutral particle are diagonal in the basis of the mass eigenstates of the quarks. There is thus no mixing of quarks of different flavour at first order. Since the loop processes are suppressed by a loop factor, the Standard Model predicts very low rates for neutral processes that change the flavour of quarks. So far, this is in agreement with experiment. In extensions of the Standard Model, new couplings to the quarks are usually introduced. In general there is no reason why the new coupling matrices should be diagonal in the mass basis of the quarks. These models therefore predict high rates for processes that mix quarks of different flavour. Extensions of the Standard Model must therefore have a non-trivial flavour structure. A possibility to avoid flavour violation is to assume that the new couplings are aligned with the mass matrices of the quarks, i.e. diagonal in the same basis. This alignment could be due to a flavour symmetry. In this thesis, two extensions of the Standard Model with alignment are studied. The first is a simple extension of the Standard

  16. Supersymmetry, the flavour puzzle and rare B decays

    Energy Technology Data Exchange (ETDEWEB)

    Straub, David Michael

    2010-07-14

    The gauge hierarchy problem and the flavour puzzle belong to the most pressing open questions in the Standard Model of particle physics. Supersymmetry is arguably the most popular framework of physics beyond the Standard Model and provides an elegant solution to the gauge hierarchy problem; however, it aggravates the flavour puzzle. In the first part of this thesis, I discuss several approaches to address the flavour puzzle in the minimal supersymmetric extension of the Standard Model and experimental tests thereof: supersymmetric grand unified theories with a unification of Yukawa couplings at high energies, theories with minimal flavour violation and additional sources of CP violation and theories with gauge mediation of supersymmetry breaking and a large ratio of Higgs vacuum expectation values. In the second part of the thesis, I discuss the phenomenology of two rare B meson decay modes which are promising probes of physics beyond the Standard Model: The exclusive B {yields} K{sup *}l{sup +}l{sup -} decay, whose angular decay distribution will be studied at LHC and gives access to a large number of observables and the b{yields}s{nu}anti {nu} decays, which are in the focus of planned high-luminosity Super B factories. I discuss the predictions for these observables in the Standard Model and their sensitivity to New Physics. (orig.)

  17. Heavy flavour physics at colliders with silicon strip vertex detectors

    International Nuclear Information System (INIS)

    The physics of heavy flavours has played a dominant role in high energy physics research ever since the discovery of charm in 1974, followed by the τ lepton in 1975 and bottom in 1977. With the startup of the large experiments at the e+e- colliders LEP and the SLC a new type of detector system has now come into operation which has a major impact on the studies of heavy flavours: the silicon strip vertex detector. The basic design principles of these novel detector systems are outlined and three representative experimental realizations are discussed. The impact of these detectors on the studies of the properties of heavy flavours is just emerging and focuses on the measurement of lifetimes and the tagging of the presence of heavy flavour hadrons in hadronic events. The tools that are being developed for these studies are described as well as details of representative analyses. The potential of these devices and the associated technological developments that were necessary for their application in the colliding beam environment is reflected in a plethora of new proposals to build sophisticated silicon detector systems for a large variety of future high energy physics applications. Two examples will be briefly sketched, a vertex detector for an asymmetric e+e- bottom factory and a large scale tracking system for a multipurpose detector at one of the new large hadron colliders. (orig.)

  18. Flavour Condensates in Brane Models and Dark Energy

    CERN Document Server

    Mavromatos, Nick E; Tarantino, Walter

    2009-01-01

    In the context of a microscopic model of string-inspired foam, in which foamy structures are provided by brany point-like defects (D-particles) in space-time, we discuss flavour mixing as a result of flavour non-preserving interactions of (low-energy) fermionic stringy matter excitations with the defects. Such interactions involve splitting and capture of the matter string state by the defect, and subsequent re-emission. Quantum fluctuations of the D-particles induce a non-trivial space-time background; in some circumstances this could be akin to a cosmological Friedman-Robertson Walker expanding-Universe, with weak (but non-zero) particle production. Furthermore the D-particle medium can induce an MSW type effect. We have argued previously, in the context of bosons, that the so-called flavour vacuum is the appropriate state to be used, at least for low-energy excitations, with energies/momenta up to a dynamically determined cutoff scale. In this work we evaluate the flavour-vacuum expectation value (condensa...

  19. Effects of flavour absorption on foods and their packaging materials

    NARCIS (Netherlands)

    Willige, van R.W.G.

    2002-01-01

    Keywords: flavour absorption, scalping, packaging, food matrix, lldpe, ldpe, pp, pc, pet, pen,b-lactoglobulin, casein, pectin, cmc, lactose, saccharose, oil, modelling, storage, oxygen permeability, taste perception, sensory quality.Abso

  20. Heavy Flavour Production at the electron-proton collider HERA

    CERN Document Server

    Urban, Klaus

    2009-01-01

    An overview over the recent heavy flavour results of the H1 and ZEUS collaborations is presented. Various techniques to tag the heavy quark, which allow to explore different phase space regions, are employed. Predictions of pertubative QCD are compared to the charm and beauty production data. Charm and beauty fractions of the proton structure function $F_2$ are

  1. Minimal flavour violation and neutrino masses without R-parity

    DEFF Research Database (Denmark)

    Arcadi, G.; Di Luzio, L.; Nardecchia, M.

    2012-01-01

    symmetry breaking all the couplings of the superpotential including the R-parity violating ones. If R-parity violation is responsible for neutrino masses, our setup can be seen as an extension of MFV to the lepton sector. We analyze two patterns based on the non-abelian flavour symmetries SU(3)(4) circle...

  2. A taste of dark matter: flavour constraints on pseudoscalar mediators

    NARCIS (Netherlands)

    M.J. Dolan; F. Kahlhoefer; C. McCabe; K. Schmidt-Hoberg

    2015-01-01

    Dark matter interacting via the exchange of a light pseudoscalar can induce observable signals in indirect detection experiments and experience large self-interactions while evading the strong bounds from direct dark matter searches. The pseudoscalar mediator will however induce flavour-changing int

  3. Formation of Amino Acid Derived Cheese Flavour Compounds

    NARCIS (Netherlands)

    Smit, B.A.

    2004-01-01

    Lactic acid bacteria (LAB), among them Lactococcus lactis, are often used for the fermentation of milk into various products, such as cheeses. For their growth and maintenance LAB metabolise milk sugar, protein and fat into various low molecular compounds, which sometimes have strong flavour charact

  4. Flavour development in pork. Influence of flavour precursor concentrations in longissimus dorsi from pigs with different raw meat qualities

    DEFF Research Database (Denmark)

    Meinert, Lene; Tikk, Kaja; Tikk, Meelis; Brockhoff, Per B.; Bredie, Wender L. P.; Bjergegaard, Charlotte; Aaslyng, Margit D.

    2009-01-01

    Flavour development and overall eating quality of pan-fried pork chops of longissimus dorsi from eight different raw meat qualities aged for 4 and IS days were assessed by a trained sensory panel. The raw meat qualities were obtained through combinations of strategic feeding/fasting (control vs...

  5. Heavy flavour production and heavy flavour mixing at the CERN proton-antiproton collider

    International Nuclear Information System (INIS)

    In this thesis some results of the proton-antiproton-collision experiment UA1 with the CERN Super Proton-Antiproton Synchrotron are presented and interpreted. Ch. 1 contians a general introduction to the physics motivations behind the proton-antiproton-collider project, a brief description of the CERN facilities and a summary of collider and UA1 physics achievements. Furthermore the concept of studying heavy flavours via their weak decays into muons is introduced. Ch. 2 gives a brief overview of the UA1 experimental set-up, while those parts of the detector that are relevant for the analysis, presented in this thesis, is discussed in some more detail. Ch. 3 contains a short introduction to, and motivation for the use of Monte Carlo techniques in event simulations, while Ch. 4 describes the framework of the recently developed 'EUROJET' event generator. In Ch. 5 a treatment is given of the theoretical background and concepts like 'quark-mixing' and 'CP-violation' are explained, also other useful definitions and formulae are introduced on which the later analysis of the same-sign to opposite-sign dimuon ratio is built. Data collection and event reconstruction is the subject of Ch. 6, while a detailed comparison between the theoretical models and experimentally obtained distributions is given in Ch. 7. Finally, in Ch. 8 some concluding remarks are made. 182 refs.; 81 figs.; 9 tabs

  6. New physics searches with heavy flavour with the ATLAS experiment

    International Nuclear Information System (INIS)

    Flavour changing neutral currents and precision measurements of CP violation are investigated by the ATLAS experiment at the Large Hadron Collider at CERN as probes to physics beyond the Standard Model. This paper presents recent update of flavour tagged time- dependent analysis of Bs → J/ψ φ, angular analysis of Bd → K*μ+μ− and a search for the rare decay B0s → μ+μ− with measurement of upper limit on its branching fraction. All analyses use 4.9 fb−1 of integrated luminosity collected in 2011 at centre-of-mass energy of 7 TeV and the results are in agreement with Standard Model predictions

  7. Matter inflation with A4 flavour symmetry breaking

    International Nuclear Information System (INIS)

    We discuss model building in tribrid inflation, which is a framework for realising inflation in the matter sector of supersymmetric particle physics models. The inflaton is a D-flat combination of matter fields, and inflation ends by a phase transition in which some Higgs field obtains a vacuum expectation value. We first describe the general procedure for implementing tribrid inflation in realistic models of particle physics that can be applied to a wide variety of BSM particle physics models around the GUT scale. We then demonstrate how the procedure works for an explicit lepton flavour model based on an A4 family symmetry. The model is both predictive and phenomenologically viable, and illustrates how tribrid inflation connects cosmological and particle physics parameters. In particular, it predicts a relation between the neutrino Yukawa coupling and the running of the spectral index αs. We also show how topological defects from the flavour symmetry breaking can be avoided automatically

  8. Heavy Flavour Cascade Production in a Beam Dump

    CERN Document Server

    2015-01-01

    SHiP will use a 400~GeV/c proton beam impinging on a several interaction length long Molybdenum target. Heavy flavour hadrons produced in the dump can decay semi-leptonically, which can produce both the Heavy Neutral Leptons as signal, but also potential background from muons and neutrinos. The absolute rate of heavy flavour production is taken from measurements. Pythia is used to predict the phase space distribution of the charm and beauty hadrons which are produced both in the primary interaction of the 400~GeV/c proton and in interactions of the secondaries produced in the cascade. The full cascade production of both HNL and background is compared to that reported in the SHiP Technical Proposal, where only the primary $pN$ interactions were taken into account.

  9. Light third-generation squarks from flavour gauge messengers

    International Nuclear Information System (INIS)

    We study models of gauge-mediated supersymmetry breaking with a gauged horizontal SU(3)F symmetry acting on the quark superfields. If SU(3)F is broken non-supersymmetrically by F-term vacuum expectation values, the massive gauge bosons and gauginos become messengers for SUSY breaking mediation. These gauge messenger fields induce a flavour-dependent, negative contribution to the soft masses of the squarks at one loop. In combination with the soft terms from standard gauge mediation, one obtains large and degenerate first- and second-generation squark masses, while the stops and sbottoms are light. We discuss the implications of this mechanism for the superparticle spectrum and for flavour precision observables. We also provide an explicit realization in a model with simultaneous SUSY and SU(3)F breaking

  10. Green tea flavour determinants and their changes over manufacturing processes.

    Science.gov (United States)

    Han, Zhuo-Xiao; Rana, Mohammad M; Liu, Guo-Feng; Gao, Ming-Jun; Li, Da-Xiang; Wu, Fu-Guang; Li, Xin-Bao; Wan, Xiao-Chun; Wei, Shu

    2016-12-01

    Flavour determinants in tea infusions and their changes during manufacturing processes were studied using Camellia sinensis cultivars 'Bai-Sang Cha' ('BAS') possessing significant floral scents and 'Fuding-Dabai Cha' ('FUD') with common green tea odour. Metabolite profiling based on odour activity threshold revealed that 'BAS' contained higher levels of the active odorants β-ionone, linalool and its two oxides, geraniol, epoxylinalool, decanal and taste determinant catechins than 'FUD' (pmanufacturing processes, the levels of linalool and geraniol decreased whereas those of β-ionone, linalool oxides, indole and cis-jasmone increased. Compared with pan-fire treatment, steam treatment reduced the levels of catechins and proportion of geraniol, linalool and its derivatives, consequently, reducing catechin-related astringency and monoterpenol-related floral scent. Our study suggests that flavour determinant targeted modulation could be made through genotype and manufacturing improvements. PMID:27374591

  11. Lepton Flavour Violating Higgs Decays in the (SUSY) Inverse Seesaw

    CERN Document Server

    Arganda, E; Marcano, X; Weiland, C

    2016-01-01

    The observation of charged lepton flavour violation would be a smoking gun for new physics and could help in pinpointing the mechanism at the origin of neutrino masses and mixing. We present here our recent studies of lepton flavour violating Higgs decays in the inverse seesaw and its supersymmetric embedding, two examples of low-scale seesaw mechanisms. We predict branching ratios as large as $10^{-5}$ for the decays $h\\rightarrow \\tau \\mu$ and $h \\rightarrow \\tau e$ in the inverse seesaw, which can be probed in future colliders. Supersymmetric contributions can enhance the branching ratio of $h\\rightarrow \\tau \\mu$ up to $1\\%$, making it large enough to explain the small excess observed by ATLAS and CMS.

  12. $B$ flavour tagging using charm decays at the LHCb experiment

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; d'Argent, Philippe; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belloli, Nicoletta; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Billoir, Pierre; Bird, Thomas; Birnkraut, Alex; Bizzeti, Andrea; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Buchanan, Emma; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Demmer, Moritz; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Ruscio, Francesco; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fohl, Klaus; Fol, Philip; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gauld, Rhorry; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gligorov, Vladimir; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo

    2015-01-01

    An algorithm is described for tagging the flavour content at production of neutral $B$ mesons in the LHCb experiment. The algorithm exploits the correlation of the flavour of a $B$ meson with the charge of a reconstructed secondary charm hadron from the decay of the other $b$ hadron produced in the proton-proton collision. Charm hadron candidates are identified in a number of fully or partially reconstructed Cabibbo-favoured decay modes. The algorithm is calibrated on the self-tagged decay modes $B^+ \\to J/\\psi \\, K^+$ and $B^0 \\to J/\\psi \\, K^{*0}$ using $3.0\\mathrm{\\,fb}^{-1}$ of data collected by the LHCb experiment at $pp$ centre-of-mass energies of $7\\mathrm{\\,TeV}$ and $8\\mathrm{\\,TeV}$. Its tagging power on these samples of $B \\to J/\\psi \\, X$ decays is $(0.30 \\pm 0.01 \\pm 0.01) \\%$.

  13. Lepton Flavour Violation in a Left-Right Symmetric Model

    CERN Document Server

    Pastor, S; Valle, José W F; Pastor, Sergio; Rindani, Saurabh D.; Valle, Jose W.F.

    1999-01-01

    We consider in this paper a Left-Right symmetric gauge model in which a global lepton-number-like symmetry is introduced and broken spontaneously at a scale that could be as low as 10^4 GeV or so. The corresponding physical Nambu-Goldstone boson, which we call majoron and denote J, can have tree-level flavour-violating couplings to the charged fermions, leading to sizeable majoron-emitting lepton-flavour-violating weak decays. We consider explicitly a leptonic variant of the model and show that the branching ratios for \\mu -> e+J, \\tau -> e+J and \\tau -> \\mu+J decays can be large enough to fall within the sensitivities of future \\mu and \\tau factories. On the other hand the left-right gauge symmetry breaking scale may be as low as few TeV.

  14. Light third-generation squarks from flavour gauge messengers

    International Nuclear Information System (INIS)

    We study models of gauge-mediated supersymmetry breaking with a gauged horizontal SU(3)F symmetry acting on the quark superfields. If SU(3)F is broken non-supersymmetrically by F-term vacuum expectation values, the massive gauge bosons and gauginos become messengers for SUSY breaking mediation. These gauge messenger fields induce a flavour-dependent, negative contribution to the soft masses of the squarks at one loop. In combination with the soft terms from standard gauge mediation, one obtains large and degenerate first- and second-generation squark masses, while the stops and sbottoms are light. We discuss the implications of this mechanism for the superparticle spectrum and for flavour precision observables. We also provide an explicit realization in a model with simultaneous SUSY and SU(3)F breaking.

  15. Higgs and flavour as doors to new physics

    Science.gov (United States)

    Sala, Filippo

    2016-04-01

    A natural solution to the hierarchy problem of the Fermi scale motivates signals of New Physics at current and near-future experiments. After a critical synthesis of this general motivation, we concentrate our attention on the interplay between LHC searches for new resonances, and precision measurements of both Higgs couplings and flavour violating observables. We do so for i) the Higgs sectors of the NMSSM and MSSM, as paradigmatic examples of theories providing extra scalars, and for ii) CKM-like flavour symmetries, with a focus on U(2)3. This article is mainly based on several papers by the author, but it also reviews other recent related results. Its goal is to provide a synthetic, yet comprehensive, orientation on these subjects, at the dawn of several (ATLAS and CMS, LHCb, NA62, etc.) forthcoming experimental results.

  16. Light third-generation squarks from flavour gauge messengers

    Energy Technology Data Exchange (ETDEWEB)

    Bruemmer, Felix [International School for Advanced Studies, Trieste (Italy); Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); McGarrie, Moritz [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Univ. of the Witwatersrand, Johannesburg (South Africa). School of Physics and Centre for Theoretical Physics; Weiler, Andreas [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); CERN - European Organization for Nuclear Research, Geneva (Switzerland). Theory Div.

    2014-04-15

    We study models of gauge-mediated supersymmetry breaking with a gauged horizontal SU(3){sub F} symmetry acting on the quark superfields. If SU(3){sub F} is broken non-supersymmetrically by F-term vacuum expectation values, the massive gauge bosons and gauginos become messengers for SUSY breaking mediation. These gauge messenger fields induce a flavour-dependent, negative contribution to the soft masses of the squarks at one loop. In combination with the soft terms from standard gauge mediation, one obtains large and degenerate first- and second-generation squark masses, while the stops and sbottoms are light. We discuss the implications of this mechanism for the superparticle spectrum and for flavour precision observables. We also provide an explicit realization in a model with simultaneous SUSY and SU(3){sub F} breaking.

  17. Light third-generation squarks from flavour gauge messengers

    Energy Technology Data Exchange (ETDEWEB)

    Brümmer, Felix [SISSA/ISAS,Via Bonomea 265, Trieste I-34136 (Italy); Deutsches Elektronen-Synchrotron DESY,Notkestrasse 85, D-22607 Hamburg (Germany); McGarrie, Moritz [Deutsches Elektronen-Synchrotron DESY,Notkestrasse 85, D-22607 Hamburg (Germany); National Institute for Theoretical Physics, School of Physics,and Centre for Theoretical Physics, University of the Witwatersrand,Johannesburg, WITS 2050 (South Africa); Weiler, Andreas [Deutsches Elektronen-Synchrotron DESY,Notkestrasse 85, D-22607 Hamburg (Germany); CERN Theory Division,CH-1211 Geneva 23 (Switzerland)

    2014-04-10

    We study models of gauge-mediated supersymmetry breaking with a gauged horizontal SU(3){sub F} symmetry acting on the quark superfields. If SU(3){sub F} is broken non-supersymmetrically by F-term vacuum expectation values, the massive gauge bosons and gauginos become messengers for SUSY breaking mediation. These gauge messenger fields induce a flavour-dependent, negative contribution to the soft masses of the squarks at one loop. In combination with the soft terms from standard gauge mediation, one obtains large and degenerate first- and second-generation squark masses, while the stops and sbottoms are light. We discuss the implications of this mechanism for the superparticle spectrum and for flavour precision observables. We also provide an explicit realization in a model with simultaneous SUSY and SU(3){sub F} breaking.

  18. Comparison of flavour qualities of three sourced Eriocheir sinensis.

    Science.gov (United States)

    Wang, Shuai; He, Yu; Wang, Yayue; Tao, Ningping; Wu, Xugan; Wang, Xichang; Qiu, Weiqiang; Ma, Mingjun

    2016-06-01

    Flavour qualities of three edible parts of three types of Chinese mitten crab from different areas were examined. The flavour profiles detected by E-tongue and E-nose showed that differences existed in tastes and odours among wild-caught crabs (WC), Yangcheng crabs (YC) and Chongming crabs (CM). The total free amino acids contents of WC were all at the highest level in meat, gonads and hepatopancreas. Ovaries had the highest nucleotides content and equivalent umami concentration (EUC) than other tissues in both female and male. The EUC was the highest in all parts of WC, followed by YC and CM. The total content of nine key volatile compounds was the highest for WC in the gonads and hepatopancreas; in the muscle, they were the highest in female YC and male CM, but the lowest for WC. PMID:26830556

  19. Lepton Flavour Violating top decays at the LHC

    CERN Document Server

    Davidson, Sacha; Perries, Stephane; Sordini, Viola

    2015-01-01

    We consider lepton flavour violating decays of the top quark, mediated by four-fermion operators. We compile constraints on a complete set of SU(3)*U(1)-invariant operators, arising from their loop contributions to rare decays and from HERA's single top search. The bounds on e-mu flavour change are more restrictive than l-tau; nonetheless the top could decay to a jet $+ e \\bar{\\mu}$ with a branching ratio of order $10^{-3}$. We estimate that the currently available LHC data (20 inverse-fb at 8 TeV) could be sensitive to $BR(t \\to e \\bar{\\mu}$+ jet) $ \\sim 6\\times 10^{-5}$, and extrapolate that 100 inverse-fb at 13 TeV could reach a sensitivity of $ \\sim 1 \\times 10^{-5}$.

  20. Visibility of microcalcification clusters and masses in breast tomosynthesis image volumes and digital mammography: A 4AFC human observer study

    International Nuclear Information System (INIS)

    Purpose: To investigate the visibility of simulated lesions in digital breast tomosynthesis (BT) image volumes compared with 2D digital mammography (DM). Methods: Simulated lesions (masses and microcalcifications) were added to images of the same women acquired on a DM system (Mammomat Novation, Siemens) and a BT prototype. The same beam quality was used for the DM and BT acquisitions. The total absorbed dose resulting from a 25-projection BT acquisition and reconstruction (BT25) was approximately twice that of a single DM view. By excluding every other projection image from the reconstruction (BT13), approximately the same dose as in DM was effected. Simulated microcalcifications were digitally added with varying contrast to the DM and BT images. Simulated masses with 8 mm diameter were also added to BT images. A series of 4-alternative forced choice (4AFC) human observer experiments were conducted. Four medical physicists participated in all experiments, each consisting of 60 trials per experimental condition. The observers interpreted the BT image volumes in cine-mode at a fixed image sequence speed. The required threshold contrast (St) to achieve a detectability index (d') of 2.5 (i.e., 92.5% correct decisions) was determined. Results: The St for mass detection in DM was approximately a factor of 2 higher than required in BT indicating that the detection of masses was improved under BT conditions compared to DM. St for microcalcification detection was higher for BT than for DM at both BT dose levels (BT25 and BT13), with a statistically significant difference in St between DM and BT13. These results indicate a dose-dependent decrease in detection performance in BT for detection of microcalcifications. Conclusions: In agreement with previous investigations, masses of size 8 mm can be detected with less contrast in BT than in DM indicating improved detection performance for BT. However, for the investigated microcalcifications, the results of this study indicate

  1. Search for Flavoured Multiquarks in a Simple Bag Model

    CERN Document Server

    Zouzou, S

    1993-01-01

    We use a bag model to study flavoured mesonic $(Qq\\bar q\\bar q)$ and baryonic $({\\overline Q}qqqq)$ states, where one heavy quark $Q$ is associated with light quarks or antiquarks, and search for possible stable multiquarks. No bound state is found. However some states lie not too high above their dissociation threshold, suggesting the possibility of resonances, or perhaps bound states in improved models.

  2. Heavy-flavour transport: from large to small systems

    CERN Document Server

    Beraudo, A; Monteno, M; Nardi, M; Prino, F

    2015-01-01

    Predictions for heavy-flavour production in relativistic heavy-ion experiments provided by the POWLANG transport setup, including now also an in-medium hadronization model, are displayed, After showing some representative findings for the Au-Au and Pb-Pb cases, a special focus will be devoted to the results obtained in the small systems formed in proton(deuteron)-nucleus collisions, where recent experimental data suggest the possible formation of a medium featuring a collective behaviour.

  3. Analytical Analysis and Numerical Solution of Two Flavours Skyrmion

    CERN Document Server

    Hadi, Miftachul; Hermawanto, Denny

    2010-01-01

    Two flavours Skyrmion will be analyzed analytically, in case of static and rotational Skyrme equations. Numerical solution of a nonlinear scalar field equation, i.e. the Skyrme equation, will be worked with finite difference method. This article is a more comprehensive version of \\textit{SU(2) Skyrme Model for Hadron} which have been published at Journal of Theoretical and Computational Studies, Volume \\textbf{3} (2004) 0407.

  4. Lifetimes of heavy-flavour hadrons whence and whither?

    CERN Document Server

    Bigi, Ikaros I

    1995-01-01

    A theoretical treatment for the weak decays of heavy-flavour hadrons has been developed that is genuinely based on QCD. Its methodology as it applies to total lifetimes and the underlying theoretical issues are sketched. Predictions are compared with present data. One discrepancy emerges: the beauty baryon lifetime appears to be significantly shorter than expected. The ramifications of those findings are analyzed in detail.

  5. The QCD perspective on lifetimes of heavy-flavour hadrons

    CERN Document Server

    Bigi, Ikaros I

    1995-01-01

    Over the last few years a theoretical treatment for the weak decays of heavy-flavour hadrons has been developed that is genuinely based on QCD. Its methodology is described as it applies to total lifetimes, and the underlying theoretical issues are discussed. Theoretical expectations are compared with present data. One discrepancy emerges: the beauty baryon lifetime appears to be significantly shorter than predicted. The ramifications of those findings are analyzed in detail, and future refinements are described.

  6. A Short Guide to Flavour Physics and CP Violation

    CERN Document Server

    Lee, Seung J

    2015-01-01

    We present the invited lectures given at the second Asia-Europe-Pacific School of High-Energy Physics (AEPSHEP), which took place in Puri, India in November 2014. The series of lectures aimed at graduate students in particle experiment/theory, covering the very basics of flavor physics and CP violation, some useful theoretical methods such as OPE and effective field theories, and some selected topics of flavour physics in the era of LHC.

  7. The supersymmetric Higgs boson with flavoured A-terms

    Directory of Open Access Journals (Sweden)

    Andrea Brignole

    2015-09-01

    Full Text Available We consider a supersymmetric scenario with large flavour violating A-terms in the stop/scharm sector and study their impact on the Higgs mass, the electroweak ρ parameter and the effective Higgs couplings to gluons, photons and charm quarks. For each observable we present explicit analytical expressions which exhibit the relevant parametric dependences, both in the general case and in specific limits. We find significant effects and comment on phenomenological implications for the LHC and future colliders.

  8. Violation of lepton flavour universality in composite Higgs models

    CERN Document Server

    Niehoff, Christoph; Straub, David M

    2015-01-01

    We investigate whether the the $2.6\\sigma$ deviation from lepton flavour universality in $B^+\\to K^+\\ell^+\\ell^-$ decays recently observed at the LHCb experiment can be explained in minimal composite Higgs models. We show that a visible departure from universality is indeed possible if left-handed muons have a sizable degree of compositeness. Constraints from $Z$-pole observables are avoided by a custodial protection of the muon coupling.

  9. Phenomenological constraints on the flavour asymmetry of the nucleon sea

    Energy Technology Data Exchange (ETDEWEB)

    Martin, A.D.; Stirling, W.J. [Durham Univ. (United Kingdom). Dept. of Physics; Roberts, R.G.

    1993-03-01

    We study the possible flavour asymmetry, u-bar {ne} d-bar, of the light quark sea distributions of the proton. We discuss the information that is at present available from data on deep-inelastic lepton-nucleon scattering and from Drell-Yan production on various nuclear targets. We show that the ratio of dilepton yields on hydrogen and deuterium targets is very sensitive to u-bar - d-bar. (author).

  10. The pT spectrum in heavy-flavour hadroproduction

    International Nuclear Information System (INIS)

    The Authors consider the transverse-momentum distribution of heavy flavours in hadronic collisions. The authors present a formalism in which large transverse-momentum logarithms are summed at the next-to-leading level, and mass effects are included exactly up to order αS3, so as to retain predictivity at both small and large transverse momenta. As an example, the Authors apply our formalism to b production at the Tevatron

  11. The supersymmetric Higgs boson with flavoured A-terms

    Energy Technology Data Exchange (ETDEWEB)

    Brignole, Andrea, E-mail: brignole@pd.infn.it

    2015-09-15

    We consider a supersymmetric scenario with large flavour violating A-terms in the stop/scharm sector and study their impact on the Higgs mass, the electroweak ρ parameter and the effective Higgs couplings to gluons, photons and charm quarks. For each observable we present explicit analytical expressions which exhibit the relevant parametric dependences, both in the general case and in specific limits. We find significant effects and comment on phenomenological implications for the LHC and future colliders.

  12. Open flavour charmed mesons in a quantum chromodynamics potential model

    Indian Academy of Sciences (India)

    Krishna Kingkar Pathak; D K Choudhury

    2012-12-01

    We modify the mesonic wave function by using a short distance scale 0 in analogy with hydrogen atom and estimate the values of masses and decay constants of the open flavour charm mesons , $D_{s}$ and $B_{c}$ within the framework of a QCD potential model. We also calculate leptonic decay widths of these mesons to study branching ratios and lifetime. The results are in good agreement with experimental and other theoretical values.

  13. A Grand Delta(96) x SU(5) Flavour Model

    CERN Document Server

    King, Stephen F; Stuart, Alexander J

    2012-01-01

    Recent results from the Daya Bay and RENO reactor experiments have measured the smallest lepton mixing angle and found it to have a value of theta_13 approximately 9 degrees. This result presents a new challenge for the existing paradigms of discrete flavour symmetries which attempt to describe all quark and lepton masses and mixing angles. Here we propose a Supersymmetric Grand Unified Theory of Flavour based on Delta(96) x SU(5), together with a U(1) x Z3 symmetry, including a full discussion of Delta(96) in a convenient basis. The Grand Delta(96) x SU(5) Flavour Model relates the quark mixing angles and masses in the form of the Gatto-Sartori-Tonin relation and realises the Georgi-Jarlskog mass relations between the charged leptons and down-type quarks. We predict a Bi-trimaximal (not Tri-bimaximal) form of neutrino mixing matrix, which, after including charged lepton corrections with zero phase, leads to the following GUT scale predictions for the atmospheric, solar, and reactor mixing angles: theta_23=36...

  14. Hints for new sources of flavour violation in meson mixing

    CERN Document Server

    Blanke, Monika

    2016-01-01

    The recent results by the Fermilab Lattice and MILC collaborations on the hadronic matrix elements entering $B_{d,s}-\\bar B_{d,s}$ mixing show a significant tension of the measured values of the mass differences $\\Delta M_{d,s}$ with their SM predictions. We review the implications of these results in the context of Constrained Minimal Flavour Violation models. In these models, the CKM elements $\\gamma$ and $|V_{ub}|/|V_{cb}|$ can be determined from $B_{d,s}-\\bar B_{d,s}$ mixing observables, yielding a prediction for $\\gamma$ below its tree-level value. Determining subsequently $|V_{cb}|$ from the measured value of either $\\Delta M_s$ or $\\varepsilon_K$ gives inconsistent results, with the tension being smallest in the Standard Model limit. This tension can be resolved if the flavour universality of new contributions to $\\Delta F = 2$ observables is broken. We briefly discuss the case of $U(2)^3$ flavour models as an illustrative example.

  15. Chiral order and fluctuations in multi-flavour QCD

    CERN Document Server

    Descotes-Genon, S; Stern, J

    2003-01-01

    Multi-flavour (N_f>=3) Chiral Perturbation Theory (ChPT) may exhibit instabilities due to vacuum fluctuations of sea q-bar q pairs. Keeping the fluctuations small would require a very precise fine-tuning of the low-energy constants L_4 and L_6 to L_4[crit](M_rho) = - 0.51 * 10^(-3), and L_6[crit](M_rho) = - 0.26 * 10^(-3). A small deviation from these critical values -- like the one suggested by the phenomenology of OZI-rule violation in the scalar channel -- is amplified by huge numerical factors inducing large effects of vacuum fluctuations. This would lead in particular to a strong N_f-dependence of chiral symmetry breaking and a suppression of multi-flavour chiral order parameters. A simple resummation is shown to cure the instability of N_f>=3 ChPT, but it modifies the standard expressions of some O(p^2) and O(p^4) low-energy parameters in terms of observables. On the other hand, for r=m_s/m > 15, the two-flavour condensate is not suppressed, due to the contribution induced by massive vacuum s-bar s pair...

  16. Characterization of beer flavour stability (EPR - spin trapping)

    International Nuclear Information System (INIS)

    The beer flavour stability is coupled with free radical degradation processes. Probably, aldehydes produced during the brewery but also generated by stalling are responsible for beer flavour as well as for its breaking down. The storing beer at the lower temperatures and in the dark place inhibits, and otherwise the rising temperature and illumination accelerate the rate of such radical processes. Beers contain naturally occurring radical scavengers - antioxidants which inhibit such unwanted reactions. Then depleting of scavengers results in the breaking down of the beer stability. EPR spin trapping technique was used as monitor such processes and for characterising so the flavour stability of beer. The probe was temperated at 60 grad C in the cavity of EPR spectrometer in the presence of spin trapping agent, N-tert.-butyl-α-phenyl nitrone (PBN) and EPR spectra were recorded for few hours. After beer antioxidants become depleted, free radicals formed by the beer degradation are scavenged by PBN spin trap and this point is characterised with a dramatically increased concentration of the free radicals trapped

  17. Kadanoff–Baym approach to flavour mixing and oscillations in resonant leptogenesis

    International Nuclear Information System (INIS)

    We describe a loopwise perturbative truncation scheme for quantum transport equations in the Kadanoff–Baym formalism, which does not necessitate the use of the so-called Kadanoff–Baym or quasi-particle ansaetze for dressed propagators. This truncation scheme is used to study flavour effects in the context of Resonant Leptogenesis (RL), showing explicitly that, in the weakly-resonant regime, there exist two distinct and pertinent flavour effects in the heavy-neutrino sector: (i) the resonant mixing and (ii) the oscillations between different heavy-neutrino flavours. Moreover, we illustrate that Kadanoff–Baym and quasi-particle ansaetze, whilst appropriate for the flavour-singlet dressed charged-lepton and Higgs propagators of the RL scenario, should not be applied to the dressed heavy-neutrino propagators. The use of these approximations for the latter is shown to capture only flavour oscillations, whilst discarding the separate phenomenon of flavour mixing

  18. Self-induced conversion in dense neutrino gases: Pendulum in flavour space

    CERN Document Server

    Hannestad, S; Sigl, G; Wong, Y Y Y

    2006-01-01

    Neutrino-neutrino interactions can lead to collective flavour conversion effects in supernovae and in the early universe. We demonstrate that the case of "bipolar" oscillations, where a dense gas of neutrinos and antineutrinos in equal numbers completely converts from one flavour to another even if the mixing angle is small, is equivalent to a pendulum in flavour space. Bipolar flavour conversion corresponds to the swinging of the pendulum, which begins in an unstable upright position (the initial flavour), and passes through momentarily the vertically downward position (the other flavour) in the course of its motion. The time scale to complete one cycle of oscillation depends logarithmically on the vacuum mixing angle. Likewise, the presence of an ordinary medium can be shown analytically to contribute to a logarithmic increase in the bipolar conversion period. We further find that a more complex (and realistic) system of unequal numbers of neutrinos and antineutrinos is analogous to a spinning top subject t...

  19. Dark Matter and Dark Energy via Non-Perturbative (Flavour) Vacua

    OpenAIRE

    Tarantino, Walter

    2011-01-01

    A non-perturbative field theoretical approach to flavour physics (Blasone-Vitiello formalism) has been shown to imply a highly non-trivial vacuum state. In a previous work, we implemented the approach on a simple supersymmetric model (free Wess-Zumino), with flavour mixing, which was regarded as a model for free neutrinos and sneutrinos. The resulting effective vacuum (called "flavour vacuum") was found to be characterized by a strong SUSY breaking. In this paper we explore the phenomenology ...

  20. Exploring flavour-producing core microbiota in multispecies solid-state fermentation of traditional Chinese vinegar

    OpenAIRE

    Zong-Min Wang; Zhen-Ming Lu; Jin-Song Shi; Zheng-Hong Xu

    2016-01-01

    Multispecies solid-state fermentation (MSSF), a natural fermentation process driven by reproducible microbiota, is an important technique to produce traditional fermented foods. Flavours, skeleton of fermented foods, was mostly produced by microbiota in food ecosystem. However, the association between microbiota and flavours and flavour-producing core microbiota are still poorly understood. Here, acetic acid fermentation (AAF) of Zhenjiang aromatic vinegar was taken as a typical case of MSSF....

  1. Volatile and non-volatile compounds in ripened cheese: their formation and their contribution to flavour.

    OpenAIRE

    Engels, W.J.M.

    1997-01-01

    Flavour is one of the most important attributes of cheese. Cheese flavour is the result of the breakdown of milk protein, fat, lactose and citrate due to enzymes from milk, rennet and microorganisms during production and ripening of cheese. For a large part the development of flavour during the ripening of cheese is determined by the process of proteolysis of caseins. Over the past years proteolysis has been studied very extensively and as a result a wealth of information about this process h...

  2. Identification and sensory evaluation of flavour enhancers in Japanese traditional dried herring (Clupea pallasii) fillet

    OpenAIRE

    Shah, A.K.M. Azad; Ogasawara, Masashi; Egi, Makoto; Kurihara, Hideyuki; Takahashi, Koretaro

    2010-01-01

    Flavour-enhancing components of dried herring fillet (migaki-nishin in Japanese) were isolated and evaluated for their effects on sensory perception. Sensory evaluation revealed that addition of dried herring fillet water-soluble extracts to Japanese noodle soup significantly (P < 0.05) enhanced the soup flavour characters such as thickness, mouthfulness and continuity. The extracts were fractionated by dialysis and chromatography. Fractions containing flavour enhancers were isolated by senso...

  3. Charm electroproduction viewed in the variable-flavour number scheme versus fixed-order perturbation theory

    OpenAIRE

    Buza, M.; Matiounine, Y.; Smith, J.; van Neerven, W. L.

    1996-01-01

    Starting from fixed-order perturbation theory (FOPT) we derive expressions for the heavy-flavour components of the deep-inelastic structure functions FL and F2 in the variable-flavour number scheme (VFNS). These expressions are valid in all orders of perturbation theory. This derivation establishes a relation between the parton densities parametrized at N and N light flavours. The consequences for the existing parametrizations of the parton densities are discussed. Further we show that in cha...

  4. The formation of fat-derived flavour compounds during the ripening of Gouda-type cheese

    OpenAIRE

    Alewijn, M.

    2006-01-01

    Cheese flavour is an important quality attribute, and is mainly formed during cheese ripening. Besides compounds that are formed from protein and carbohydrates, milk fat-derived compounds are essential for cheese flavour. Before, but mainly during ripening, free fatty acids, lactones, ketones, esters, alcohols and aldehydes can be formed from milk fat, compounds that all contribute their own special character to the final cheese flavour. The formation mechanisms that lead to these compounds a...

  5. Searches for Lepton Flavour Violation and Lepton Number Violation in Hadron Decays

    CERN Document Server

    Seyfert, P

    2012-01-01

    In the Standard Model of particle physics, lepton flavour and lepton number are conserved quantities although no fundamental symmetry demands their conservation. I present recent results of searches for lepton flavour and lepton number violating hadron decays measured at the B factories and LHCb. In addition, the LHCb collaboration has recently performed a search for the lepton flavour violating decay $\\tau^- \\mu^- \\mu^- \\mu^+$ The obtained upper exclusion limit, that has been presented in this talk for the first time, is of the same order of magnitude as those observed at the B factories. This is the first search for a lepton flavour violating $\\tau$ decay at a hadron collider.

  6. Experimental constraints from flavour changing processes and physics beyond the standard model

    Energy Technology Data Exchange (ETDEWEB)

    Gersabeck, M.; Gligorov, V.V. [CERN, Geneva (Switzerland); Serra, N. [University of Zuerich (Switzerland)

    2012-08-15

    Flavour physics has a long tradition of paving the way for direct discoveries of new particles and interactions. Results over the last decade have placed stringent bounds on the parameter space of physics beyond the Standard Model. Early results from the LHC, and its dedicated flavour factory LHCb, have further tightened these constraints and reiterate the ongoing relevance of flavour studies. The experimental status of flavour observables in the charm and beauty sectors is reviewed in measurements of CP violation, neutral meson mixing, and measurements of rare decays. (orig.)

  7. Qualitative research with a Kenyan flavour.

    Science.gov (United States)

    Mburu, J; Cogswell, L; Crane, E; Todreas, I L

    1991-01-01

    The Essential Drugs Program in Kenya's Ministry of Health included a qualitative research phase of focus group discussions (FGDs) to assess the communication needs in educating the public about responsible essential drug use. This article discusses the general parameters of FGDs, and specific outcomes of essential drug FGDs and the evaluation of the health education tools generated in the FGDs. The purpose of the pilot project was to develop effective materials on the correct use of drug regimens and promoting authorized drug providers. FGDs were used as a quick and relatively inexpensive means of gauging a target audience's beliefs and practices. The facilitator of the group directed discussion and probed for participants views on the community's needs, and forms of expression. (Drawing on positive social customs within a culture helps bridge the difference between local perceptions and knowledge.) Pretesting of draft materials in FGDs assured the ability to reach the target audience. These 2 methods contributed to the project's success by involving the target group as experts in providing useful information, fostering a sense of ownership and commitment, and building a relationship between the staff and target group that renewed dedication and willingness to cooperate. Program staff conducted 19 FGDs with 171 clients and 9 FGDs with 63 providers, and also interviewed 36 providers and observed in 4 locations client/provider exchanges. The results showed that client were unaware of the importance of strict compliance with a drug regimen, and consequences of ineffectiveness. Clients were uneasy about side effects, and purchased drugs from unauthorized dealers. The 3 messages to be promoted were 1) return to the clinic or hospital if drug problems arise, 2) use only authorized providers, and 3) follow directions carefully and completely. It was also decided that posters and audio cassette were the communication modes. A description of the materials developed is

  8. Fermion mass hierarchies and flavour mixing from a minimal discrete symmetry

    Science.gov (United States)

    Feruglio, Ferruccio; Lin, Yin

    2008-09-01

    We construct a simple model of fermion masses based on a spontaneously broken S×Z flavour group. At the leading order, in the neutrino sector S is broken down to a ν-ν parity subgroup that enforces a maximal atmospheric mixing angle and a vanishing θ. In the charged lepton sector the ν-ν parity is maximally broken and the resulting mass matrix is nearly diagonal. The charged lepton mass hierarchy is automatically reproduced by the S symmetry breaking parameter alone. A careful analysis shows that, after the inclusion of all relevant subleading effects, the model predicts θ=π/4+O(λc2) and θ=O(λc2), λ denoting the Cabibbo angle. A simple extension to the quark sector is also illustrated, where the mass spectrum and the mixing angles are naturally reproduced, with the exception of the mixing angle between the first two generations, that requires a small accidental enhancement.

  9. Flavour breaking effects of Wilson twisted mass fermions

    International Nuclear Information System (INIS)

    We study the flavour breaking effects appearing in the Wilson twisted mass formulation of lattice QCD. In this quenched study, we focus on the mass splitting between the neutral and the charged pion, determining the neutral pion mass with a stochastic noise method to evaluate the disconnected contributions. We find that these disconnected contributions are significant. Using the Osterwalder-Seiler interpretation of the connected piece of the neutral pion correlator, we compute the corresponding neutral pion mass to study with more precision the scaling behaviour of the mass splitting

  10. SU(3) flavour symmetry breaking and charmed states

    International Nuclear Information System (INIS)

    By extending the SU(3) flavour symmetry breaking expansion from up, down and strange sea quark masses to partially quenched valence quark masses we propose a method to determine charmed quark hadron masses including possible QCD isospin breaking effects. Initial results for some open charmed pseudoscalar meson states and singly and doubly charmed baryon states are encouraging and demonstrate the potential of the procedure. Essential for the method is the determination of the scale using singlet quantities, and to this end we also give here a preliminary estimation of the recently introduced Wilson flow scales.

  11. Probing lepton flavour violation in slepton NLSP scenarios

    Energy Technology Data Exchange (ETDEWEB)

    Hamaguchi, Koichi [Deutsches Elektronen-Synchrotron, DESY, 22603 Hamburg (Germany); Ibarra, Alejandro [Department of Physics, Theory Division, CERN, CH-1211 Geneva 23 (Switzerland); Instituto de Fisica Teirica, CSIC/UAM, C-XVI, Universidad Autinoma de Madrid, Cantoblanco, 28049 Madrid (Spain)]. E-mail: ibarra@mail.cern.ch

    2005-02-01

    In supersymmetric models where the gravitino is the lightest superparticle, the next-to-lightest superparticle (NLSP) is long-lived, and hence could be collected and studied in detail. We study the prospects of direct detection of lepton flavour violation in charged slepton NLSP decays. Mixing angles in the slepton sector as small as {approx} 3x10{sup -2} (9x10{sup -3}) could be probed at the 90% confidence level if 3x10{sup 3} (3x10{sup 4}) sleptons could be collected. (author)

  12. Baryons in 2+1 flavour domain wall QCD

    OpenAIRE

    Antonio, D. J.; Bowler, K. C.; Boyle, P. A.; Clark, M A; Joó, B.; Kennedy, A. D.; Kenway, R. D.; Maynard, C. M.; Tweedie, R. J.; Yamaguchi, A; RBC; collaborations, UKQCD

    2005-01-01

    We present results for some of the light baryon masses and their excited states in 2+1 flavour domain wall QCD. We considered several lattice spacings, with the DBW2 and Iwasaki gauge actions and different sea quark masses on a volume of $16^3\\times32$ and a fifth dimension of size 8. All data were generated on the QCDOC machines. Despite large residual massses and a limited number of sea quark mass values with which to perform chiral extrapolations, our results are in reasonable agreement wi...

  13. Approaching the chiral point in two-flavour lattice simulations

    International Nuclear Information System (INIS)

    We investigate the behaviour of the pion decay constant and the pion mass in two-flavour lattice QCD, with the physical and chiral points as ultimate goal. Measurements come from the ensembles generated by the CLS initiative using the O(a)-improved Wilson formulation, with lattice spacing down to about 0.05 fermi and pion masses as low as 190 MeV. The applicability of SU(2) chiral perturbation theory is investigated, and various functional forms, and their range of validity, are compared. The physical scale is set through the kaon decay constant, whose measurement is enabled by inserting a third, heavier valence strange quark.

  14. Oxidative flavour deterioration of fish oil enriched milk

    DEFF Research Database (Denmark)

    Bruni Let, Mette; Jacobsen, Charlotte; Frankel, E.N.;

    2003-01-01

    than the tuna oil emulsions, having a lower initial peroxide value (0.1 meq/kg). In the tuna oil emulsions the fishy off-flavour could not be detected throughout the storage period. Addition of 5-50 ppm EDTA significantly reduced the development of volatile oxidation products in the cod liver oil......-% of n-3 fatty acids) and one with cod liver oil (26 wt-% of n-3 fatty acids). The effect of added calcium disodium ethylenediaminetetraacetate (EDTA) on oxidation was also investigated. Emulsions based on cod liver oil with a slightly elevated peroxide value (1.5 meq/kg) oxidised significantly faster...

  15. $\\pi K$ Scattering in Three Flavour ChPT

    OpenAIRE

    Bijnens, Johan; Dhonte, Pierre; Talavera, Pere

    2004-01-01

    We present the scattering lengths for the $\\pi K$ processes in the three flavour Chiral Perturbation Theory (ChPT) framework at next-to-next-to-leading order (NNLO). The calculation has been performed analytically but we only include analytical results for the dependence on the low-energy constants (LECs) at NNLO due to the size of the expressions. These results, together with resonance estimates of the NNLO LECs are used to obtain constraints on the Zweig rule suppressed LECs at NLO, $L_4^r$...

  16. Test of the flavour independence of αs

    Science.gov (United States)

    Buskulic, D.; Casper, D.; de Bonis, I.; Decamp, D.; Ghez, P.; Goy, C.; Lees, J.-P.; Minard, M.-N.; Odier, P.; Pietrzyk, B.; Ariztizabal, F.; Chmeissani, M.; Crespo, J. M.; Efthymiopoulos, I.; Fernandez, E.; Fernandez-Bosman, M.; Gaitan, V.; Garrido, Ll.; Martinez, M.; Orteu, S.; Pacheco, A.; Padilla, C.; Palla, F.; Pascual, A.; Perlas, J. A.; Sanchez, F.; Teubert, F.; Creanza, D.; de Palma, M.; Farilla, A.; Iaselli, G.; Maggi, G.; Marinelli, N.; Natali, S.; Nuzzo, S.; Ranieri, A.; Raso, G.; Romano, F.; Ruggieri, F.; Selvaggi, G.; Silvestris, L.; Tempesta, P.; Zito, G.; Huang, X.; Lin, J.; Ouyang, Q.; Wang, T.; Xie, Y.; Xu, R.; Xue, S.; Zhang, J.; Zhang, L.; Zhao, W.; Bonvicini, G.; Cattaneo, M.; Comas, P.; Coyle, P.; Drevermann, H.; Engelhardt, A.; Forty, R. W.; Frank, M.; Girone, M.; Hagelberg, R.; Harvey, J.; Jacobsen, R.; Janot, P.; Jost, B.; Knobloch, J.; Lehraus, I.; Maggi, M.; Markou, C.; Martin, E. B.; Mato, P.; Meinhard, H.; Minten, A.; Miquel, R.; Oest, T.; Palazzi, P.; Pater, J. R.; Perrodo, P.; Pusztaszeri, J.-F.; Ranjard, F.; Rensing, P.; Rolandi, L.; Schlatter, D.; Schmelling, M.; Schneider, O.; Tejessy, W.; Tomalin, I. R.; Venturi, A.; Wachsmuth, H.; Wiedenmann, W.; Wildish, T.; Witzeling, W.; Wotschack, J.; Ajaltouni, Z.; Bardadin-Otwinowska, M.; Barres, A.; Boyer, C.; Falvard, A.; Gay, P.; Guicheney, C.; Henrard, P.; Jousset, J.; Michel, B.; Monteil, S.; Montret, J.-C.; Pallin, D.; Perret, P.; Podlyski, F.; Proriol, J.; Rossignol, J.-M.; Saadi, F.; Fearnley, T.; Hansen, J. B.; Hansen, J. D.; Hansen, J. R.; Hansen, P. H.; Nilsson, B. S.; Kyriakis, A.; Simopoulou, E.; Siotis, I.; Vayaki, A.; Zachariadou, K.; Blondel, A.; Bonneaud, G.; Brient, J. C.; Bourdon, P.; Passalacqua, L.; Rougé, A.; Rumpf, M.; Tanaka, R.; Valassi, A.; Verderi, M.; Videau, H.; Candlin, D. J.; Parsons, M. I.; Focardi, E.; Parrini, G.; Corden, M.; Delfino, M.; Georgiopoulos, C.; Jaffe, D. E.; Antonelli, A.; Bencivenni, G.; Bologna, G.; Bossi, F.; Campana, P.; Capon, G.; Cerutti, F.; Chiarella, V.; Felici, G.; Laurelli, P.; Mannocchi, G.; Murtas, F.; Murtas, G. P.; Pepe-Altarelli, M.; Dorris, S. J.; Halley, A. W.; Ten Have, I.; Knowles, I. G.; Lynch, J. G.; Morton, W. T.; O'Shea, V.; Raine, C.; Reeves, P.; Scarr, J. M.; Smith, K.; Smith, M. G.; Thompson, A. S.; Thompson, F.; Thorn, S.; Turnbull, R. M.; Becker, U.; Braun, O.; Geweniger, C.; Graefe, G.; Hanke, P.; Hepp, V.; Kluge, E. E.; Putzer, A.; Rensch, B.; Schmidt, M.; Sommer, J.; Stenzel, H.; Tittel, K.; Werner, S.; Wunsch, M.; Beuselinck, R.; Binnie, D. M.; Cameron, W.; Colling, D. J.; Dornan, P. J.; Konstantinidis, N.; Moneta, L.; Moutoussi, A.; Nash, J.; San Martin, G.; Sedgbeer, J. K.; Stacey, A. M.; Dissertori, G.; Girtler, P.; Kneringer, E.; Kuhn, D.; Rudolph, G.; Bowdery, C. K.; Brodbeck, T. J.; Colrain, P.; Crawford, G.; Finch, A. J.; Foster, F.; Hughes, G.; Sloan, T.; Whelan, E. P.; Williams, M. I.; Galla, A.; Greene, A. M.; Kleinknecht, K.; Quast, G.; Raab, J.; Renk, B.; Sander, H.-G.; Wanke, R.; Zeitnitz, C.; Aubert, J. J.; Bencheikh, A. M.; Benchouk, C.; Bonissent, A.; Bujosa, G.; Calvet, D.; Carr, J.; Diaconu, C.; Etienne, F.; Thulasidas, M.; Nicod, D.; Payre, P.; Rousseau, D.; Talby, M.; Abt, I.; Assmann, R.; Bauer, C.; Blum, W.; Brown, D.; Dietl, H.; Dydak, F.; Gotzhein, C.; Jakobs, K.; Kroha, H.; Lütjens, G.; Lutz, G.; Männer, W.; Moser, H.-G.; Richter, R.; Rosado-Schlosser, A.; Schwarz, A. S.; Settles, R.; Seywerd, H.; Stierlin, U.; Denis, R. St.; Wolf, G.; Alemany, R.; Boucrot, J.; Callot, O.; Cordier, A.; Courault, F.; Davier, M.; Duflot, L.; Grivaz, J.-F.; Heusse, Ph.; Jacquet, M.; Kim, D. W.; Le Diberder, F.; Lefrançois, J.; Lutz, A.-M.; Musolino, G.; Nikolic, I.; Park, H. J.; Park, I. C.; Schune, M.-H.; Simion, S.; Veillet, J.-J.; Videau, I.; Abbaneo, D.; Azzurri, P.; Bagliesi, G.; Batignani, G.; Bettarini, S.; Bozzi, C.; Calderini, G.; Carpinelli, M.; Ciocci, M. A.; Ciulli, V.; Dell'Orso, R.; Ferrante, I.; Foà, L.; Forti, F.; Giassi, A.; Giorgi, M. A.; Gregorio, A.; Ligabue, F.; Lusiani, A.; Marrocchesi, P. S.; Messineo, A.; Rizzo, G.; Sanguinetti, G.; Sciabà, A.; Spagnolo, P.; Steinberger, J.; Tenchini, R.; Tonelli, G.; Triggiani, G.; Vannini, C.; Verdini, P. G.; Walsh, J.; Betteridge, A. P.; Blair, G. A.; Bryant, L. M.; Gao, Y.; Green, M. G.; Johnson, D. L.; Medcalf, T.; Mir, Ll. M.; Strong, J. A.; Bertin, V.; Botterill, D. R.; Clifft, R. W.; Edgecock, T. R.; Haywood, S.; Edwards, M.; Maley, P.; Norton, P. R.; Thompson, J. C.; Bloch-Devaux, B.; Colas, P.; Duarte, H.; Emery, S.; Kozanecki, W.; Lançon, E.; Lemaire, M. C.; Locci, E.; Marx, B.; Perez, P.; Rander, J.; Renardy, J.-F.; Rosowsky, A.; Roussarie, A.; Schuller, J.-P.; Schwindling, J.; Si Mohand, D.; Trabelsi, A.; Vallage, B.; Johnson, R. P.; Kim, H. Y.; Litke, A. M.; McNeil, M. A.; Taylor, G.; Beddall, A.; Booth, C. N.; Boswell, R.; Cartwright, S.; Combley, F.; Dawson, I.; Koksal, A.; Letho, M.; Newton, W. M.; Rankin, C.; Thompson, L. F.; Böhrer, A.; Brandt, S.; Cowan, G.; Feigl, E.; Grupen, C.; Lutters, G.; Minguet-Rodriguez, J.; Rivera, F.; Saraiva, P.; Smolik, L.; Stephan, F.; Bosisio, L.; Della Marina, R.; Ganis, G.; Giannini, G.; Gobbo, B.; Pitis, L.; Ragusa, F.; Rothberg, J.; Wasserbaech, S.; Armstrong, S. R.; Bellantoni, L.; Elmer, P.; Feng, Z.; Ferguson, D. P. S.; Gao, Y. S.; González, S.; Grahl, J.; Harton, J. L.; Hayes, O. J.; Hu, H.; McNamara, P. A.; Nachtman, J. M.; Orejudos, W.; Pan, Y. B.; Saadi, Y.; Schmitt, M.; Scott, I. J.; Sharma, V.; Turk, J. D.; Walsh, A. M.; Weber, F. V.; Wu, Sau Lan; Wu, X.; Yamartino, J. M.; Zheng, M.; Zobernig, G.; Aleph Collaboration

    1995-02-01

    Using about 950000 hadronic events collected during 1991 and 1992 with the ALEPH detector, the ratios r b = {α sb}/{α sudsc} and r uds = {α suds}/{α scb} have been measured in order to test the flavour independence of the strong coupling constant αs. The analysis is based on event-shape variables using the full hadronic sample, two b-quark samples enriched by lepton tagging and lifetime tagging, and a light-quark sample enriched by lifetime antitagging. The combined results are rb = 1.002±0.023 and ruds = 0.971 ± 0.023.

  17. SU(3) flavour symmetry breaking and charmed states

    Energy Technology Data Exchange (ETDEWEB)

    Horsley, R. [Edinburgh Univ. (United Kingdom). School of Physics and Astronomy; Najjar, J. [Regensburg Univ. (Germany). Institut fuer Theoretische Physik; Nakamura, Y. [RIKEN Advanced Institute for Computational Science, Hyogo (Japan); Perlt, H.; Schiller, A. [Leipzig Univ. (Germany). Inst. fuer Theoretische Physik; Pleiter, D. [Forschungszentrum Juelich GmbH (Germany). Juelich Supercomputing Centre (JSC); Regensburg Univ. (Germany). Institut fuer Theoretische Physik; Rakow, P.E.L. [Liverpool Univ. (United Kingdom). Theoretical Physics Div.; Schierholz, G. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Stueben, H. [Hamburg Univ. (Germany). Regionales Rechenzentrum; Zanotti, J.M. [Adelaide Univ. (Australia). CSSM, School of Chemistry and Physics; Collaboration: QCDSF-UKQCD Collaborations

    2013-11-15

    By extending the SU(3) flavour symmetry breaking expansion from up, down and strange sea quark masses to partially quenched valence quark masses we propose a method to determine charmed quark hadron masses including possible QCD isospin breaking effects. Initial results for some open charmed pseudoscalar meson states and singly and doubly charmed baryon states are encouraging and demonstrate the potential of the procedure. Essential for the method is the determination of the scale using singlet quantities, and to this end we also give here a preliminary estimation of the recently introduced Wilson flow scales.

  18. Search for lepton flavour violation in Z0 decays

    International Nuclear Information System (INIS)

    We have searched for lepton flavour violation in Z0 boson decays into lepton pairs, Z0→μτ, Z0→eτ, and Z-→eμ. The data sample is based on an integrated luminosity of 10.4 pb-1 corresponding to 370 000 Z0's produced. We obtain upper limits on the branching ratios of 4.8x10-5 for the μτ, 3.4x10-5 for the eτ and 2.4x10-5 for the eμ decay modes at the 95% confidence level. (orig.)

  19. Summary of hints for new physics from (quark) flavour physics

    OpenAIRE

    Zwicky, Roman(Higgs Centre for Theoretical Physics, School of Physics and Astronomy, University of Edinburgh, Edinburgh EH9 3JZ, Scotland, United Kingdom)

    2008-01-01

    Recently two hints for new physics have emerged: The B_s mixing phase phi_s and the rate of D_s -> (mu,tau) nu exposing a discrepancy of \\sim 3 sigma and 3.8 sigma deviation from the Standard Model respectively. Moreover the difference of the CP asymmetries in B -> K pi between the charged and neutral modes is at the 5.3 sigma level which is somewhat larger than expected. New physics in phi_s or A_CP(B -> K pi) would be in contradiction with the minimal flavour violation hypothesis. ...

  20. Heavy Flavour Production and Properties at ATLAS and CMS

    CERN Document Server

    Barberis, Dario; The ATLAS collaboration

    2016-01-01

    Recent results by the ATLAS and CMS experiments at LHC are presented on the production and properties of heavy-flavour states. In the charm sector, cross-sections for the prompt and non-prompt production of J/psi and psi’ are presented, as well as the production of open charm states. The b-quark fragmentation, B± production cross-section and several B-meson decay properties are also studied. The used data include LHC Run 1 (at a centre-of-mass energy of 7 and 8 TeV) and also Run 2 (13 TeV) samples collected in 2015.

  1. Aspects of Flavour and Supersymmetry in F-theory GUTs

    CERN Document Server

    Conlon, Joseph P; 10.1007

    2009-01-01

    We study the constraints of supersymmetry on flavour in recently proposed models of F-theory GUTs. We relate the topologically twisted theory to the canonical presentation of eight-dimensional super Yang-Mills and provide a dictionary between the two. We describe the constraints on Yukawa couplings implied by holomorphy of the superpotential in the effective 4-dimensional supergravity theory, including the scaling with \\alpha_{GUT}. Taking D-terms into account we solve explicitly to second order for wavefunctions and Yukawas due to metric and flux perturbations and find a rank-one Yukawa matrix with no subleading corrections.

  2. Collider Aspects of Flavour Physics at High Q

    Energy Technology Data Exchange (ETDEWEB)

    del Aguila, F.; Aguilar-Saavedra, J.A.; Allanach, B.C.; Alwall, J.; Andreev, Yu.; Aristizabal Sierra, D.; Bartl, A.; Beccaria, M.; Bejar, S.; Benucci, L.; Bityukov, S.; Borjanovic, I.; Bozzi, G.; Burdman, G.; Carvalho, J.; Castro, N.; Clerbaux, B.; de Campos, F.; de Gouvea, A.; Dennis, C.; Djouadi, A.; /Cambridge U., DAMTP /Louvain U., CP3 /Moscow, INR /Valencia U. /Vienna U. /Salento U. /INFN, Lecce /Barcelona, Autonoma U. /Barcelona, IFAE /INFN, Pisa /Pisa U. /Karlsruhe U. /Sao Paulo U. /LIP, Coimbra /Brussels U. /Sao Paulo U., Guaratingueta /Northwestern U. /Oxford U. /Orsay, LPT /Athens U. /Lisbon U.

    2008-03-07

    This chapter of the report of the 'Flavour in the era of LHC' workshop discusses flavor related issues in the production and decays of heavy states at LHC, both from the experimental side and from the theoretical side. We review top quark physics and discuss flavor aspects of several extensions of the Standard Model, such as supersymmetry, little Higgs model or models with extra dimensions. This includes discovery aspects as well as measurement of several properties of these heavy states. We also present public available computational tools related to this topic.

  3. The Symmetry behind Extended Flavour Democracy and Large Leptonic Mixing

    CERN Document Server

    Silva-Marcos, Joaquim I

    2002-01-01

    We show that there is a minimal discrete symmetry which leads to the extended flavour democracy scenario constraining the Dirac neutrino, the charged lepton and the Majorana neutrino mass term ($M_R$) to be all proportional to the democratic matrix, with all elements equal. In particular, this discrete symmetry forbids other large contributions to $M_R$, such as a term proportional to the unit matrix, which would normally be allowed by a $S_{3L}\\times S_{3R}$ permutation symmetry. This feature is crucial in order to obtain large leptonic mixing, without violating 't Hooft's, naturalness principle.

  4. Non-perturbative quark mass dependence in the heavy-light sector of two-flavour QCD

    International Nuclear Information System (INIS)

    We present preliminary results of the non-perturbative heavy quark mass dependence of heavy-light meson observables in the continuum limit of finite-volume two-flavour lattice QCD. These observables, which are derived from heavy-light Schroedinger functional correlation functions and computed over a range of renormalization group invariant heavy quark masses from the charm to beyond the bottom region, allow for a quantitative comparison with the predictions of HQET and are of practical relevance for solving renormalization problems in HQET non-perturbatively by a matching to QCD in finite volume. (orig.)

  5. “Popcorn worker’s lung” in Britain in a man making potato crisp flavouring

    OpenAIRE

    Hendrick, D J

    2009-01-01

    This case involves a 36 year old non-smoker who worked in a factory producing food flavourings for potato crisps. He developed exertional breathlessness associated with fixed airway obstruction shortly after an uncharacteristically high exposure to the food flavouring chemical diacetyl. Unfortunately, even though he was removed from further exposure to this agent, his symptoms and spirometry did not improve.

  6. In vivo monitoring of strawberry flavour release from model custards: effect of texture and oral processing

    NARCIS (Netherlands)

    Aprea, E.; Biasioli, F.; Gasperi, F.; Tilmann, M.D.; Ruth, van S.M.

    2006-01-01

    The interaction of oral processing protocols and food texture on in vivo flavour release was evaluated by nose-space analysis. Nose-space analysis was carried out by proton transfer reaction mass spectrometry, and strawberry-flavoured custards were prepared with 0.1% (w/w) and 1.0% (w/w) carboxymeth

  7. Exploring flavour-producing core microbiota in multispecies solid-state fermentation of traditional Chinese vinegar.

    Science.gov (United States)

    Wang, Zong-Min; Lu, Zhen-Ming; Shi, Jin-Song; Xu, Zheng-Hong

    2016-01-01

    Multispecies solid-state fermentation (MSSF), a natural fermentation process driven by reproducible microbiota, is an important technique to produce traditional fermented foods. Flavours, skeleton of fermented foods, was mostly produced by microbiota in food ecosystem. However, the association between microbiota and flavours and flavour-producing core microbiota are still poorly understood. Here, acetic acid fermentation (AAF) of Zhenjiang aromatic vinegar was taken as a typical case of MSSF. The structural and functional dynamics of microbiota during AAF process was determined by metagenomics and favour analyses. The dominant bacteria and fungi were identified as Acetobacter, Lactobacillus, Aspergillus, and Alternaria, respectively. Total 88 flavours including 2 sugars, 9 organic acids, 18 amino acids, and 59 volatile flavours were detected during AAF process. O2PLS-based correlation analysis between microbiota succession and flavours dynamics showed bacteria made more contribution to flavour formation than fungi. Seven genera including Acetobacter, Lactobacillus, Enhydrobacter, Lactococcus, Gluconacetobacer, Bacillus and Staphylococcus were determined as functional core microbiota for production of flavours in Zhenjiang aromatic vinegar, based on their dominance and functionality in microbial community. This study provides a perspective for bridging the gap between the phenotype and genotype of ecological system, and advances our understanding of MSSF mechanisms in Zhenjiang aromatic vinegar. PMID:27241188

  8. Flavour Characters of Wines from Cool-Climate Grape Cultivars in Relation to Different Fermentation Approaches

    DEFF Research Database (Denmark)

    Liu, Jing

    were characterised by floral and fruity flavours, such as banana, peach/apricot and strawberry, while the remainder were mainly described by less desirable flavours for white wine, such as chemical, cheese and rooibos/smoke. Partial least squares regression of the sensory and instrumental analyses...

  9. The minimal flavour violation benchmark in view of the latest LHCb data

    International Nuclear Information System (INIS)

    We derive the consequences of the MFV hypothesis for ΔF=1 flavour observables based on the latest LHCb data. Any future measurement beyond the MFV bounds and relations unambiguously indicates the existence of new flavour structures next to the Yukawa couplings of the Standard Model.

  10. Searches for new physics with lepton flavours and multi-lepton final states in ATLAS

    CERN Document Server

    Madar, Romain; The ATLAS collaboration

    2015-01-01

    Lepton flavours and multi-lepton signatures are powerful probes to new physics. ATLAS searches for lepton flavour violating decays of (beyond) the SM particles, leptoquarks, heavy leptons/neutrinos as well as for new phenomena in multi-lepton/photon final states are summarized in this talk. First LHC Run-2 results will be included if available.

  11. Exploring flavour-producing core microbiota in multispecies solid-state fermentation of traditional Chinese vinegar

    Science.gov (United States)

    Wang, Zong-Min; Lu, Zhen-Ming; Shi, Jin-Song; Xu, Zheng-Hong

    2016-01-01

    Multispecies solid-state fermentation (MSSF), a natural fermentation process driven by reproducible microbiota, is an important technique to produce traditional fermented foods. Flavours, skeleton of fermented foods, was mostly produced by microbiota in food ecosystem. However, the association between microbiota and flavours and flavour-producing core microbiota are still poorly understood. Here, acetic acid fermentation (AAF) of Zhenjiang aromatic vinegar was taken as a typical case of MSSF. The structural and functional dynamics of microbiota during AAF process was determined by metagenomics and favour analyses. The dominant bacteria and fungi were identified as Acetobacter, Lactobacillus, Aspergillus, and Alternaria, respectively. Total 88 flavours including 2 sugars, 9 organic acids, 18 amino acids, and 59 volatile flavours were detected during AAF process. O2PLS-based correlation analysis between microbiota succession and flavours dynamics showed bacteria made more contribution to flavour formation than fungi. Seven genera including Acetobacter, Lactobacillus, Enhydrobacter, Lactococcus, Gluconacetobacer, Bacillus and Staphylococcus were determined as functional core microbiota for production of flavours in Zhenjiang aromatic vinegar, based on their dominance and functionality in microbial community. This study provides a perspective for bridging the gap between the phenotype and genotype of ecological system, and advances our understanding of MSSF mechanisms in Zhenjiang aromatic vinegar. PMID:27241188

  12. Formulae for flavour neutrino masses and its application to texture two zeros

    CERN Document Server

    Kitabayashi, Teruyuki

    2015-01-01

    We demonstrate the usefulness of flavour neutrino masses expressed in terms of $M_{ee},M_{e\\mu}$ and $M_{e\\tau}$. The analytical expressions for the flavour neutrino masses, mass eigenstates and physical CP-violating Majorana phases for texture two zeros are obtained exactly.

  13. Minimal flavour violation in the quark and lepton sector and the impact of extra dimensions on flavour changing neutral currents and electroweak symmetry breaking

    International Nuclear Information System (INIS)

    We study flavor-changing decays of hadrons and leptons and an extra-dimensional approach to electroweak symmetry breaking. Specifically we study the framework of Minimal Flavour Violation (MFV) as an explanation of the flavour problem. We discuss the impact of a specific extra-dimensional model of the MFV class on flavour changing neutral currents. We derive model-independent upper bounds on rare decays. -We discuss the extension of the MFV framework from the quark to the lepton sector and show how baryogenesis through leptogenesis can be achieved and examine if possible correlations with charged lepton flavour violation exist. We discuss the dynamical breaking of the electroweak symmetry in extra dimensions by unifying gauge and Higgs fields and we show that realistic models are possible once the extra dimension is strongly curved. (orig.)

  14. Minimal flavour violation in the quark and lepton sector and the impact of extra dimensions on flavour changing neutral currents and electroweak symmetry breaking

    Energy Technology Data Exchange (ETDEWEB)

    Weiler, A.

    2007-01-16

    We study flavor-changing decays of hadrons and leptons and an extra-dimensional approach to electroweak symmetry breaking. Specifically we study the framework of Minimal Flavour Violation (MFV) as an explanation of the flavour problem. We discuss the impact of a specific extra-dimensional model of the MFV class on flavour changing neutral currents. We derive model-independent upper bounds on rare decays. -We discuss the extension of the MFV framework from the quark to the lepton sector and show how baryogenesis through leptogenesis can be achieved and examine if possible correlations with charged lepton flavour violation exist. We discuss the dynamical breaking of the electroweak symmetry in extra dimensions by unifying gauge and Higgs fields and we show that realistic models are possible once the extra dimension is strongly curved. (orig.)

  15. Flavour tagging methods used in the ATLAS B physics program

    International Nuclear Information System (INIS)

    Full text: Major tasks of the ATLAS B-physics program are the measurement of the B0s oscillations and the weak mixing phase Φs. The B0s oscillation parameter δms will be measured by using the hadronic decay channels B0s → Ds(φ, π)π and B0s → Ds(φ, π)a1, while the weak mixing phase Ψs uses the channel B0s → J/ψ(μ+, μ-)φ, with φ → K+K-. For an accurate measurement the determination of the B0s flavour at production time is crucial. Various methods for flavour tagging like e.g. opposite side soft muon tagging or same side jet charge tagging are studied and possible calibration channels are explored. Also the combination of different kinematic observables in order to receive event-by-event mistag rates using a multivariate analysis will be presented. (author)

  16. Flavour and Higgs physics near the Fermi scale

    CERN Document Server

    Sala, Filippo

    2013-01-01

    After a discussion of the hierarchy problem of the Fermi scale, we study the flavour and Higgs boson(s) phenomenology of new physics close to it, both in general and in the specific cases of Supersymmetry and composite Higgs models. First, we promote the approximate U(2)^3 symmetry exhibited by the quark sector of the Standard Model to be a more fundamental symmetry of Nature, and explore its phenomenological consequences from an effective field theory point of view. We also study the embedding of natural Supersymmetry within the U(2)^3 framework, focusing in particular on the pattern of flavour and CP violation in B decays. Then we consider the CP-even scalar sector of the next-to-minimal supersymmetric Standard Model. We quantify the impact of current and foreseen measurements of the Higgs boson signal strengths on the physical parameters, deriving analytical relations for this purpose, and we outline a possible overall strategy to search for the other Higgs scalars. Finally we analyze the constraints from ...

  17. Extended shelf life flavoured dairy drink using dissolved carbon dioxide.

    Science.gov (United States)

    Ravindra, Menon Rekha; Rao, K Jayaraj; Nath, B Surendra; Ram, Chand

    2014-01-01

    Cardamom flavoured dairy beverage prepared using standardized method was carbonated in glass bottles. Carbonation at 50 psi pressure for 30 s was recommended. The pasteurized flavoured drink, carbonated or otherwise was evaluated for sensory, chemical and microbial quality during its refrigerated storage. The uncarbonated control samples were found to be sensorily acceptable up to 14 days, while the carbonated beverage remained acceptable up to 30 days. Carbonation of drink significantly affected the pH and acidity of product without reducing its acceptability. Carbonation resulted in inhibition of microbes, the effect was pronounced on psychrotrophic count. There was a linear but marginal increase in the pH of the carbonated samples till the 17(th) day of storage; the values diminished thereafter. The carbonated samples also had significantly reduced contents of FFA and soluble nitrogen compared to that of uncarbonated control samples as storage progressed beyond 10 days and this was attributed to inhibited microbial growth. PMID:24426058

  18. Flavour violating gluino three-body decays at LHC

    Energy Technology Data Exchange (ETDEWEB)

    Bartl, A.; Ginina, E. [Wien Univ. (Austria). Fakultaet fuer Physik; Eberl, H.; Majerotto, W. [Oesterreichische Akademie der Wissenschaften, Vienna (Austria). Inst. fuer Hochenergiephysik; Herrmann, B. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Hidaka, K [Tokyo Gakugei Univ., Koganei (Japan). Dept. of Physics; Porod, W. [Wuerzburg Univ. (Germany). Inst. fuer Theoretische Physik und Astrophysik

    2011-07-15

    We study the effect of squark generation mixing on gluino production and decays at LHC in the Minimal Supersymmetric Standard Model (MSSM) for the case that the gluino is lighter than all squarks and dominantly decays into three particles, g {yields} q q {chi}{sup 0}{sub k}, q anti q'{chi}{sup {+-}}{sub l}. We assume mixing between the second and the third squark generations in the up-type and down-type squark sectors. We show that this mixing can lead to very large branching ratios of the quark-flavour violating gluino threebody decays despite the strong constraints on quark-flavour violation (QFV) from the experimental data on B mesons. We also show that the QFV gluino decay branching ratios are very sensitive not only to the generation mixing in the squark sector, but also to the parameters of the neutralino and chargino sectors. We show that the branching ratio of the QFV gluino decay g {yields} c anti t(anti ct) anti {chi}{sup 0}{sub 1} can go up to {approx} 40%. Analogously, that of the QFV decay g {yields} s anti b(anti sb){chi}{sup 0}{sub 1} can reach {approx} 35%. We find that the rates of the resulting QFV signatures, such as pp{yields} tt anti c anti cE{sup mis}{sub T}, can be significant at LHC. This could have an important influence on the gluino searches at LHC. (orig.)

  19. Changes in flavour and taste of irradiated coffee beans

    International Nuclear Information System (INIS)

    The possibility of changes in the smell and taste of coffee from beans submitted to irradiation for preservation is a significant gap in the programme devoted to increasing the product life time with such a process. Therefore, the main objective of the paper was to evaluate changes in aroma and flavour that can be noticed by the consumer. Coffee beans were given disinfestation doses of 50krad, producing an insect mortality rate of 98.33% +-2.89 in Araecerus fasciculatus (adult stage). The samples, provided by IBC, were from the same crop and free from pesticides. Some of the material was kept by that Institute for organoleptic tests. The remainder was sent to the National Institute of Technology for gas-chromatographic analysis. Should any significant changes be noticed, it could be assumed that the gamma-irradiation process would be rejected by the consumer. However, no significant change was observed in the most important characteristics, flavour and aroma, that might induce the consumer to reject irradiated coffee beans. (author)

  20. Changes in Flavour and Taste of Irradiated Coffee Beans

    International Nuclear Information System (INIS)

    The possibility of changes in the smell and taste of coffee from beans submitted to irradiation for preservation is a significant gap in the programme devoted to increasing the product life time with such a process. Therefore, the main objective of the paper was to evaluate changes in aroma and flavour that can be noticed by the consumer. Coffee beans were given disinfestation doses of 50 krad, producing an insect mortality rate of 98.33% ± 2.89 in Araecerus fasciculatus (adult stage). The samples, provided by IBC, were from the same crop and free from pesticides. Some of the material was kept by that Institute for organoleptic tests. The remainder was sent to the National Institute of Technology for gas-chromatographic analysis. Should any significant changes be noticed, it could be assumed that the gamma-irradiation process would be rejected by the consumer. However, no significant change was observed in the most important characteristics, flavour and aroma, that might induce the consumer to reject irradiated coffee beans. (author)

  1. Light flavour hadron production in the ALICE experiment at LHC

    Directory of Open Access Journals (Sweden)

    Badalà Angela

    2016-01-01

    Full Text Available Unique among the LHC experiments, ALICE has excellent particle identification capabilities for the measurement of light-flavour hadrons. A large number of hadron species from pions to multi-strange baryons and light nuclei have been measured over a large transverse momentum region. The measurement of the production of these particles is a valuable tool to study the properties of the medium formed in heavy-ion collisions. In particular they give information on the collective phenomena of the fireball, on the parton energy loss in the hot QCD medium and on the hadronization mechanisms such as recombination and statistical hadronization. The measurements in pp and in p-nucleus collisions provide the necessary baseline for heavy-ion data and help to investigate the effects of the ordinary nuclear matter. In this paper some of the main ALICE results on identified light-flavour hadron production in Pb–Pb collisions at √sNN = 2.76 TeV and p–Pb collisions at √sNN = 5.02 TeV will be presented.

  2. Light flavour hadron production in the ALICE experiment at LHC

    Science.gov (United States)

    Badalà, Angela

    2016-05-01

    Unique among the LHC experiments, ALICE has excellent particle identification capabilities for the measurement of light-flavour hadrons. A large number of hadron species from pions to multi-strange baryons and light nuclei have been measured over a large transverse momentum region. The measurement of the production of these particles is a valuable tool to study the properties of the medium formed in heavy-ion collisions. In particular they give information on the collective phenomena of the fireball, on the parton energy loss in the hot QCD medium and on the hadronization mechanisms such as recombination and statistical hadronization. The measurements in pp and in p-nucleus collisions provide the necessary baseline for heavy-ion data and help to investigate the effects of the ordinary nuclear matter. In this paper some of the main ALICE results on identified light-flavour hadron production in Pb-Pb collisions at √sNN = 2.76 TeV and p-Pb collisions at √sNN = 5.02 TeV will be presented.

  3. Leading logarithms in N-flavour mesonic Chiral Perturbation Theory

    International Nuclear Information System (INIS)

    We extend earlier work on leading logarithms in the massive nonlinear O(n) sigma model to the case of SU(N)×SU(N)/SU(N) which coincides with mesonic Chiral Perturbation Theory for N flavours of light quarks. We discuss the leading logarithms for the mass and decay constant to six loops and for the vacuum expectation value 〈q¯q〉 to seven loops. For dynamical quantities the expressions grow extremely large much faster such that we only quote the leading logarithms to five loops for the vector and scalar form factor and for meson–meson scattering. The last quantity we consider is the vector–vector to meson–meson amplitude where we quote results up to four loops for a subset of quantities, in particular for the pion polarizabilities. As a side result we provide an elementary proof that the factors of N appearing at each loop order are odd or even depending on the order and the remaining traces over external flavours

  4. Anarchic Yukawas and top partial compositeness: the flavour of a successful marriage

    CERN Document Server

    Cacciapaglia, Giacomo; Flacke, Thomas; Lee, Seung J; Parolini, Alberto; Serôdio, Hugo

    2015-01-01

    The top quark can be naturally singled out from other fermions in the Standard Model due to its large mass, of the order of the electroweak scale. We follow this reasoning in models of pseudo Nambu Goldstone Boson composite Higgs, which may derive from an underlying confining dynamics. We consider a new class of flavour models, where the top quark obtains its mass via partial compositeness, while the lighter fermions acquire their masses by a deformation of the dynamics generated at a high flavour scale. One interesting feature of such scenario is that it can avoid all the flavour constraints without the need of flavour symmetries, since the flavour scale can be pushed high enough. We show that both flavour conserving and violating constraints can be satisfied with top partial compositeness without invoking any flavour symmetry for the up-type sector, in the case of the minimal SO(5)/SO(4) coset with top partners in the four-plet and singlet of SO(4). In the down-type sector, some degree of alignment is requi...

  5. Anarchic Yukawas and top partial compositeness: the flavour of a successful marriage

    Science.gov (United States)

    Cacciapaglia, Giacomo; Cai, Haiying; Flacke, Thomas; Lee, Seung J.; Parolini, Alberto; Serôdio, Hugo

    2015-06-01

    The top quark can be naturally singled out from other fermions in the Standard Model due to its large mass, of the order of the electroweak scale. We follow this reasoning in models of pseudo Nambu Goldstone Boson composite Higgs, which may derive from an underlying confining dynamics. We consider a new class of flavour models, where the top quark obtains its mass via partial compositeness, while the lighter fermions acquire their masses by a deformation of the dynamics generated at a high flavour scale. One interesting feature of such scenario is that it can avoid all the flavour constraints without the need of flavour symmetries, since the flavour scale can be pushed high enough. We show that both flavour conserving and violating constraints can be satisfied with top partial compositeness without invoking any flavour symmetry for the up-type sector, in the case of the minimal SO(5)/SO(4) coset with top partners in the four-plet and singlet of SO(4). In the down-type sector, some degree of alignment is required if all down-type quarks are elementary. We show that taking the bottom quark partially composite provides a dynamical explanation for the hierarchy causing this alignment. We present explicit realisations of this mechanism which do not require to include additional bottom partner fields. Finally, these conclusions are generalised to scenarios with non-minimal cosets and top partners in larger representations.

  6. Release of peppermint flavour compounds from chewing gum: effect of oral functions

    DEFF Research Database (Denmark)

    Haahr, Anne-Mette; Bardow, A.; Thomsen, C.E.; Jensen, S.B.; Nauntofte, B.; Bakke, M.; Adler-Nissen, Jens; Bredie, W.L.P.

    masseter muscle activity (MMA), chewing force (CFO), and saliva flow rate (SFR), may also play a role. In 10 healthy young males, the retronasal expired air of menthol and menthone from peppermint-flavoured (2%) chewing gum was determined as functions of CF, SFR, MMA, and CFO. The experimental setup......During chewing, the oral cavity functions like a bellow, forcing volatile flavour compounds into the exhaling air to the nasal compartment. Accordingly, we hypothesised that flavour release from chewing gum is predominantly governed by chewing frequency (CF), although other oral functions, like...

  7. Flavour equilibration studies of quark-gluon plasma with non-zero baryon density

    Indian Academy of Sciences (India)

    Abhijit Sen

    2009-12-01

    Flavour equilibration for a thermally equilibrated but chemically non-equilibrated quark-gluon plasma is presented. Flavour equilibration is studied enforcing baryon number conservation. In addition to the usual processes like single additional gluon production $gg \\rightleftharpoons ggg$ and its reverse and quark–antiquark pair production by gluon pair fusion $gg \\rightleftharpoons q_{i}q_{i}^{-}$ and reverse thereof, processes like quark-flavour interchanging $q_{i}q_{i}^{-} \\rightleftharpoons q_{j}q_{j}^{-}$ is also considered. The degree of equilibration is studied comparatively for various reactions/constraints that are being considered.

  8. An MCMC study of general squark flavour mixing in the MSSM

    CERN Document Server

    Herrmann, Björn; Fuks, Benjamin; Mahmoudi, Farvah; O'Leary, Ben; Porod, Werner; Sekmen, Sezen; Strobbe, Nadja

    2015-01-01

    We present an extensive study of non-minimally flavour violating (NMFV) terms in the Lagrangian of the Minimal Supersymmetric Standard Model (MSSM). We impose a variety of theoretical and experimental constraints and perform a detailed scan of the parameter space by means of a Markov Chain Monte-Carlo (MCMC) setup. This represents the first study of several non-zero flavour-violating elements within the MSSM. We present the results of the MCMC scan with a special focus on the flavour-violating parameters. Based on these results, we define benchmark scenarios for future studies of NMFV effects at the LHC.

  9. An MCMC Study of General Squark Flavour Mixing in the MSSM

    Energy Technology Data Exchange (ETDEWEB)

    Herrmann, Björn [Annecy, LAPTH; De Causmaecker, Karen [Intl. Solvay Inst., Brussels; Fuks, Benjamin [UPMC, Paris (main); Mahmoudi, Farvah [Lyon, Ecole Normale Superieure; O' Leary, Ben [Wurzburg U.; Porod, Werner [Wurzburg U.; Sekmen, Sezen [Kyungpook Natl. U.; Strobbe, Nadja [Fermilab

    2015-10-05

    We present an extensive study of non-minimally flavour violating (NMFV) terms in the Lagrangian of the Minimal Supersymmetric Standard Model (MSSM). We impose a variety of theoretical and experimental constraints and perform a detailed scan of the parameter space by means of a Markov Chain Monte-Carlo (MCMC) setup. This represents the first study of several non-zero flavour-violating elements within the MSSM. We present the results of the MCMC scan with a special focus on the flavour-violating parameters. Based on these results, we define benchmark scenarios for future studies of NMFV effects at the LHC.

  10. Mixed symmetric baryon multiplets in large $N_c$ QCD: two and three flavours

    CERN Document Server

    Matagne, N

    2011-01-01

    We propose a new method to study mixed symmetric multiplets of baryons in the context of the $1/N_c$ expansion approach. The simplicity of the method allows to better understand the role of various operators acting on spin and flavour degrees of freedom. The method is tested on two and three flavours. It is shown that the spin and flavour operators proportional to the quadratic invariants of SU$_S$(2) and SU$_F$(3) respectively are dominant in the mass formula.

  11. Quark Yukawa pattern from spontaneous breaking of flavour $SU(3)^3$

    CERN Document Server

    Nardi, Enrico

    2015-01-01

    A $SU(3)_Q \\times SU(3)_u \\times SU(3)_d$ invariant scalar potential breaking spontaneously the quark flavour symmetry can explain the standard model flavour puzzle. The approximate alignment in flavour space of the vacuum expectation values of the up and down `Yukawa fields' results as a dynamical effect. The observed quark mixing angles, the weak CP violating phase, and hierarchical quark masses can be all reproduced at the cost of introducing additional (auxiliary) scalar multiplets, but without the need of introducing hierarchical parameters.

  12. Development of ginger-flavoured soya milk ice cream : Comparison of data analysis methods

    OpenAIRE

    Wiwat Wangcharoen

    2012-01-01

    Sucrose at the concentration of 6 and 7% (w/w) and ginger extract at the concentration of 4 and 5% (w/w) were added to ginger-flavoured soya milk ice cream recipes to determine the consumer acceptablility. One hundred consumers were requested to taste four samples of ginger-flavoured soya milk ice cream and rate the intensity of ginger flavour, sweetness, richness and smoothness, together with their indication for ideal intensity of these attributes as well as their preference of each sampl...

  13. Two-Baryon Correlation Functions in 2-flavour QCD

    CERN Document Server

    Francis, Anthony; Rae, Thomas D; Wittig, Hartmut

    2013-01-01

    We present first results for two-baryon correlation functions, computed using $N_f=2$ flavours of O($a$) improved Wilson quarks, with the aim of explaining potential dibaryon bound states, specifically the H-dibaryon. In particular, we use a GEVP to isolate the groundstate using two-baryon (hyperon-hyperon) correlation functions $\\big(\\langle C_{XY}(t)C_{XY}(0) \\rangle$, where $XY=\\Lambda\\Lambda, \\Sigma\\Sigma, N\\Xi, \\cdots\\big)$, each of which has an overlap with the H-dibaryon. We employ a `blocking' algorithm to handle the large number of contractions, which may easily be extended to N-baryon correlation functions. We also comment on its application to the analysis of single baryon masses ($n$, $\\Lambda$, $\\Xi$, $\\cdots$). This study is performed on an isotropic lattice with $m_\\pi = 460$ MeV, $m_\\pi L = 4.7$ and $a = 0.063$ fm.

  14. Flavour symmetries in a renormalizable SO(10) model

    Science.gov (United States)

    Ferreira, P. M.; Grimus, W.; Jurčiukonis, D.; Lavoura, L.

    2016-05-01

    In the context of a renormalizable supersymmetric SO (10) Grand Unified Theory, we consider the fermion mass matrices generated by the Yukawa couplings to a 10 ⊕ 120 ⊕ 126 ‾ representation of scalars. We perform a complete investigation of the possibilities of imposing flavour symmetries in this scenario; the purpose is to reduce the number of Yukawa coupling constants in order to identify potentially predictive models. We have found that there are only 14 inequivalent cases of Yukawa coupling matrices, out of which 13 cases are generated by Zn symmetries, with suitable n, and one case is generated by a Z2 ×Z2 symmetry. A numerical analysis of the 14 cases reveals that only two of them-dubbed A and B in the present paper-allow good fits to the experimentally known fermion masses and mixings.

  15. Resonant spin-flavour precession of neutrinos and pulsar velocities

    International Nuclear Information System (INIS)

    Young pulsars are known to exhibit large space velocities, up to 103 km/s. We propose a new mechanism for the generation of these large velocities based on an asymmetric emission of neutrinos during the supernova explosion. The mechanism involves the resonant spin-flavour precession of neutrinos with a transition magnetic moment in the magnetic field of the supernova. The asymmetric emission of neutrinos is due the distortion of the resonance surface by matter polarization effects in the supernova magnetic field. The requisite values of the field strengths and neutrino parameters are estimated for various neutrino conversions caused by their Dirac or Majorana-type transition magnetic moments. (author). 30 refs, 1 tab

  16. The CKM matrix from a scheme of flavour symmetry breaking

    International Nuclear Information System (INIS)

    A theoretical |VCKMth| mixing matrix which is a function of the four mass ratios and the CP violating phase α is derived from a simple scheme for breaking the flavour permutational symmetry. We assumed that the symmetry breaking pattern is the same in the u and d-sectors, and imposed a phenomenologically motivated constraint on the amount of mixing of singlet and doublet irreducible representations of S(3)L x S(3)R. A χ2 fit of the matrix of the absolute values |VCKMth| to the experimentally determined |VCKMexp| gives the best value for α=76.7 deg. and the value Jth=-2.18x10-5 for the Jarlskog invariant in good agreement with the experimental values. The agreement between |VCKMth| and |VCKMexp| is also very good with χ2=0.28

  17. Measurements of heavy-flavour decay leptons with ALICE

    Directory of Open Access Journals (Sweden)

    Sakai Shingo

    2015-01-01

    Full Text Available We present measurements of electrons and muons from heavy-flavour hadron decays at central and forward rapidity performed by the ALICE Collaboration in p–Pb (√sNN = 5.02 TeV and Pb–Pb collisions (√sNN = 2.76 TeV. Electrons are reconstructed using several detectors of the ALICE central barrel. Muons are reconstructed using the muon spectrometer at forward rapidity (2.5 < y < 4. The nuclear modification factors in Pb–Pb (RAA and in p–Pb (RpPb collisions, and the azimuthal anisotropy (v2 in Pb– Pb collisions will be discussed. Theoretical predictions are compared with the data. In addition, the measurement of the azimuthal correlation between electrons from heavyflavour hadron decays and charged hadrons in p–Pb collisions will be shown.

  18. Flavour physics and the Large Hadron Collider beauty experiment.

    Science.gov (United States)

    Gibson, Valerie

    2012-02-28

    An exciting new era in flavour physics has just begun with the start of the Large Hadron Collider (LHC). The LHCb (where b stands for beauty) experiment, designed specifically to search for new phenomena in quantum loop processes and to provide a deeper understanding of matter-antimatter asymmetries at the most fundamental level, is producing many new and exciting results. It gives me great pleasure to describe a selected few of the results here-in particular, the search for rare B(0)(s)-->μ+ μ- decays and the measurement of the B(0)(s) charge-conjugation parity-violating phase, both of which offer high potential for the discovery of new physics at and beyond the LHC energy frontier in the very near future. PMID:22253243

  19. Flavour Independent Search for Neutral Higgs Bosons at LEP

    CERN Document Server

    Achard, P; Aguilar-Benítez, M; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alviggi, M G; Anderhub, H; Andreev, V P; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Bajo, A; Baksay, G; Baksay, L; Baldew, S V; Banerjee, S; Banerjee, Sw; Barczyk, A; Barillère, R; Bartalini, P; Basile, M; Batalova, N; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Bellucci, L; Berbeco, R; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Biasini, M; Biglietti, M; Biland, A; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böhm, A; Boldizsar, L; Borgia, B; Bottai, S; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brochu, F; Burger, J D; Burger, W J; Cai, X D; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada, M; Chamizo-Llatas, M; Chang, Y H; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chiefari, G; Cifarelli, Luisa; Cindolo, F; Clare, I; Clare, R; Coignet, G; Colino, N; Costantini, S; de la Cruz, B; Cucciarelli, S; van Dalen, J A; De Asmundis, R; Déglon, P L; Debreczeni, J; Degré, A; Dehmelt, K; Deiters, K; Della Volpe, D; Delmeire, E; Denes, P; De Notaristefani, F; De Salvo, A; Diemoz, M; Dierckxsens, M; Dionisi, C; Dittmar, M; Doria, A; Dova, M T; Duchesneau, D; Duda, M; Echenard, B; Eline, A; El-Hage, A; El-Mamouni, H; Engler, A; Eppling, F J; Extermann, P; Falagán, M A; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, M; Ferguson, T; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, F; Fisher, P H; Fisher, W; Fisk, I; Forconi, G; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gataullin, M; Gentile, S; Giagu, S; Gong, Z F; Grenier, G; Grimm, O; Grünewald, M W; Guida, M; van Gulik, R; Gupta, V K; Gurtu, A; Gutay, L J; Haas, D; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Hirschfelder, J; Hofer, H; Hohlmann, M; Holzner, G; Hou, S R; Hu, Y; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Käfer, D; Kaur, M; Kienzle-Focacci, M N; Kim, J K; Kirkby, Jasper; Kittel, E W; Klimentov, A; König, A C; Kopal, M; Koutsenko, V F; Kräber, M H; Krämer, R W; Krüger, A; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Le Goff, J M; Leiste, R; Levtchenko, M; Levchenko, P M; Li, C; Likhoded, S; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lü, Y S; Luci, C; Luminari, L; Lustermann, W; Ma Wen Gan; Malgeri, L; Malinin, A; Maña, C; Mans, J; Martin, J P; Marzano, F; Mazumdar, K; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Mihul, A; Milcent, H; Mirabelli, G; Mnich, J; Mohanty, G B; Muanza, G S; Muijs, A J M; Musicar, B; Musy, M; Nagy, S; Natale, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Nisati, A; Novák, T; Nowak, H; Ofierzynski, R A; Organtini, G; Pal, I; Palomares, C; Paolucci, P; Paramatti, R; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Pedace, M; Pensotti, S; Perret-Gallix, D; Petersen, B; Piccolo, D; Pierella, F; Pioppi, M; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Pothier, J; Prokofev, D; Prokofiev, D O; Quartieri, J; Rahal-Callot, G; Rahaman, M A; Raics, P; Raja, N; Ramelli, R; Rancoita, P G; Ranieri, R; Raspereza, A V; Razis, P A; Ren, D; Rescigno, M; Reucroft, S; Riemann, S; Riles, K; Roe, B P; Romero, L; Rosca, A; Rosenbleck, C; Rosier-Lees, S; Roth, S; Rubio, J A; Ruggiero, G; Rykaczewski, H; Sakharov, A; Saremi, S; Sarkar, S; Salicio, J; Sánchez, E; Schäfer, C; Shchegelskii, V; Schopper, Herwig Franz; Schotanus, D J; Sciacca, C; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shumilov, E; Shvorob, A V; Son, D; Souga, C; Spillantini, P; Steuer, M; Stickland, D P; Stoyanov, B; Strässner, A; Sudhakar, K; Sultanov, G G; Sun, L Z; Sushkov, S; Suter, H; Swain, J D; Szillási, Z; Tang, X W; Tarjan, P; Tauscher, Ludwig; Taylor, L; Tellili, B; Teyssier, D; Timmermans, C; Ting, Samuel C C; Ting, S M; Tonwar, S C; Tóth, J; Tully, C; Tung, K L; Ulbricht, J; Valente, E; Van de Walle, R T; Vásquez, R; Veszpremi, V; Vesztergombi, G; Vetlitskii, I; Vicinanza, D; Viertel, Gert M; Villa, S; Vivargent, M; Vlachos, S; Vodopyanov, I; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Wadhwa, M; Wang, Q; Wang, X L; Wang, Z M; Weber, M; Wienemann, P; Wilkens, H; Wynhoff, S; Xia, L; Xu, Z Z; Yamamoto, J; Yang, B Z; Yang, C G; Yang, H J; Yang, M; Yeh, S C; Zalite, A; Zalite, Yu; Zhang, Z P; Zhao, J; Zhu, G Y; Zhu, R Y; Zhuang, H L; Zichichi, A; Zimmermann, B; Zöller, M

    2004-01-01

    A flavour independent search for the CP-even and CP-odd neutral Higgs bosons h and A is performed in 624/pb of data collected with the L3 detector at LEP at centre-of-mass energies between 189 and 209GeV. Higgs boson production through the e^+e^- -> Z h and the e^+e^- ->h A processes is considered and decays of the Higgs bosons into hadrons are studied. No significant signal is observed and 95% confidence level limits on the hZZ and hAZ couplings are derived as a function of the Higgs boson masses. Assuming the Standard Model cross section for the Higgs-strahlung process and a 100% branching fraction into hadrons, a 95% confidence level lower limit on the mass of the Higgs boson is set at 110.3GeV.

  20. Flavour symmetries in a renormalizable SO(10) model

    CERN Document Server

    Ferreira, P M; Jurčiukonis, D; Lavoura, L

    2015-01-01

    In the context of a renormalizable supersymmetric SO(10) Grand Unified Theory, we consider the fermion mass matrices generated by the Yukawa couplings to a $\\mathbf{10} \\oplus \\mathbf{120} \\oplus \\overline{\\mathbf{126}}$ representation of scalars. We perform a complete investigation of the possibilities of imposing flavour symmetries in this scenario; the purpose is to reduce the number of Yukawa coupling constants in order to identify potentially predictive models. We have found that there are only 14 inequivalent cases of Yukawa coupling matrices, out of which 13 cases are generated by $Z_n$ symmetries, with suitable $n$, and one case is generated by a $Z_2 \\times Z_2$ symmetry. A numerical analysis of the 14 cases reveals that only two of them---dubbed A and B in the present paper---allow good fits to the experimentally known fermion masses and mixings.

  1. Flavour oscillations and CP asymmetry in semileptonic Bs0 decays

    Energy Technology Data Exchange (ETDEWEB)

    Beale, Steven Thomas; /York U., Canada

    2010-01-01

    The B{sub s}{sup 0} meson spontaneously transforms into its antiparticle ({bar B}{sub s}{sup 0}). These 'flavour oscillations' occur periodically with a frequency that may be measured. The oscillation frequency is related to the fundamental parameters of the electroweak interaction. Measuring the frequency provides a constraint on the electroweak quark coupling parameter V{sub ts} and improves the constraint on V{sub td}. Furthermore, the amplitude of the oscillation process may be slightly different in B{sub s}{sup 0} and {bar B}{sub s}{sup 0} mesons due to CP violating nature of the weak interaction. This 'asymmetry' is expected to be small (a{sub fs}{sup SM,s} = (2.06 {+-} 0.57) {center_dot} 10{sup -5}), but may be enhanced (a{sub fs}{sup s} {approx_equal} {Omicron}(1%)) by new sources of CP violation. This thesis describes a search for B{sub s}{sup 0} flavour oscillations and charge asymmetry in the B{sub s}{sup 0} {yields} D{sub s}{sup -}{mu}{sup +}{nu}{sub {mu}}X (D{sub s}{sup -} {yields} K*{sup 0}K{sup -}) decay mode using 5.0 fb{sup -1} of D0 data. A lower limit is placed on the oscillation frequency, {Delta}m{sub s} > 9.9 ps{sup -1} with an expected sensitivity to oscillations below 14.8 ps{sup -1}. The charge asymmetry is measured to be a{sub fs}{sup s} = 0.018 {+-} 0.025(stat) {+-} 0.002(syst). A combination of these measurements with other decay modes is also presented.

  2. Flavour symmetry breaking in the kaon parton distribution amplitude

    Directory of Open Access Journals (Sweden)

    Chao Shi

    2014-11-01

    Full Text Available We compute the kaon's valence-quark (twist-two parton distribution amplitude (PDA by projecting its Poincaré-covariant Bethe–Salpeter wave-function onto the light-front. At a scale ζ=2 GeV, the PDA is a broad, concave and asymmetric function, whose peak is shifted 12–16% away from its position in QCD's conformal limit. These features are a clear expression of SU(3-flavour-symmetry breaking. They show that the heavier quark in the kaon carries more of the bound-state's momentum than the lighter quark and also that emergent phenomena in QCD modulate the magnitude of flavour-symmetry breaking: it is markedly smaller than one might expect based on the difference between light-quark current masses. Our results add to a body of evidence which indicates that at any energy scale accessible with existing or foreseeable facilities, a reliable guide to the interpretation of experiment requires the use of such nonperturbatively broadened PDAs in leading-order, leading-twist formulae for hard exclusive processes instead of the asymptotic PDA associated with QCD's conformal limit. We illustrate this via the ratio of kaon and pion electromagnetic form factors: using our nonperturbative PDAs in the appropriate formulae, FK/Fπ=1.23 at spacelike-Q2=17 GeV2, which compares satisfactorily with the value of 0.92(5 inferred in e+e− annihilation at s=17 GeV2.

  3. Flavour symmetry breaking in the kaon parton distribution amplitude

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Chao [Key Laboratory of Modern Acoustics, MOE, Institute of Acoustics, Nanjing University, Nanjing 210093 (China); Department of Physics, Nanjing University, Nanjing 210093 (China); Chang, Lei [CSSM, School of Chemistry and Physics University of Adelaide, Adelaide, SA 5005 (Australia); Roberts, Craig D. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Schmidt, Sebastian M. [Institute for Advanced Simulation, Forschungszentrum Jülich and JARA, D-52425 Jülich (Germany); Tandy, Peter C. [Center for Nuclear Research, Department of Physics, Kent State University, Kent, OH 44242 (United States); Zong, Hong-shi [Department of Physics, Nanjing University, Nanjing 210093 (China); State Key Laboratory of Theoretical Physics, Institute of Theoretical Physics, CAS, Beijing 100190 (China); Joint Center for Particle, Nuclear Physics and Cosmology, Nanjing 210093 (China)

    2014-11-10

    We compute the kaon's valence-quark (twist-two parton) distribution amplitude (PDA) by projecting its Poincaré-covariant Bethe–Salpeter wave-function onto the light-front. At a scale ζ=2 GeV, the PDA is a broad, concave and asymmetric function, whose peak is shifted 12–16% away from its position in QCD's conformal limit. These features are a clear expression of SU(3)-flavour-symmetry breaking. They show that the heavier quark in the kaon carries more of the bound-state's momentum than the lighter quark and also that emergent phenomena in QCD modulate the magnitude of flavour-symmetry breaking: it is markedly smaller than one might expect based on the difference between light-quark current masses. Our results add to a body of evidence which indicates that at any energy scale accessible with existing or foreseeable facilities, a reliable guide to the interpretation of experiment requires the use of such nonperturbatively broadened PDAs in leading-order, leading-twist formulae for hard exclusive processes instead of the asymptotic PDA associated with QCD's conformal limit. We illustrate this via the ratio of kaon and pion electromagnetic form factors: using our nonperturbative PDAs in the appropriate formulae, F{sub K}/F{sub π}=1.23 at spacelike-Q{sup 2}=17 GeV{sup 2}, which compares satisfactorily with the value of 0.92(5) inferred in e{sup +}e{sup −} annihilation at s=17 GeV{sup 2}.

  4. Development of "same side" flavour tagging algorithms for measurements of flavour oscillations and $CP$ violation in the $B^0$ mesons system

    CERN Document Server

    Fazzini, Davide; Khanji, Basem

    In this thesis new developments of $\\textit{Flavour Tagging}$ algorithms for the $LHCb$ experiment are presented. The $\\textit{Flavour Tagging}$ is a very usefull tool which allows to determine the flavour of the reconstructed particles, such as the $B^0$ mesons. A correctly identification of the flavour is fundamental in certain measurements such as time-dependent $CP$ violation asymmetries or the $B^0 \\leftrightarrow \\overline{B}^0$ oscillations. Both these type of measurements are exploited by LHCb experiment in the research of new physics beyond the Standard Model. The new developments achieved in this work concern an optimization of the $\\textit{Same Side Tagger}$ algorithms, using protons and pions correlated in charge with the signal $B^0$ to infer its initial flavour. Then two combinations are implemented: the first is a combination of the $\\textit{SS Pion Tagger}$ ($SS\\pi$) and the $\\textit{SS Proton Tagger}$ ($SSp$) in a unique $\\textit{Same Side}$ ($SS$) tagging algorithm; the second one is the fi...

  5. A 125 GeV composite Higgs boson versus flavour and electroweak precision tests

    CERN Document Server

    Barbieri, Riccardo; Sala, Filippo; Straub, David M; Tesi, Andrea

    2012-01-01

    A composite Higgs boson of 125 GeV mass, only mildly fine-tuned, requires top partners with a semi-perturbative coupling and a mass not greater than about a TeV. We analyze the strong constraints on such picture arising from flavour and electroweak precision tests in models of partial compositeness. We consider different representations for the composite fermions and compare the case of an anarchic flavour structure to models with a U(3)^3 and U(2)^3 flavour symmetry. Although non trivially, some models emerge that look capable of accommodating a 125 GeV Higgs boson with top partners in an interesting mass range for discovery at the LHC as well as associated flavour signals.

  6. Stability of aspartame and neotame in pasteurized and in-bottle sterilized flavoured milk.

    Science.gov (United States)

    Kumari, Anuradha; Choudhary, Sonika; Arora, Sumit; Sharma, Vivek

    2016-04-01

    Analytical high performance liquid chromatography (HPLC) conditions were standardized along with the isolation procedure for separation of aspartame and neotame in flavoured milk (pasteurized and in-bottle sterilized flavoured milk). The recovery of the method was approximately 98% for both aspartame and neotame. The proposed HPLC method can be successfully used for the routine determination of aspartame and neotame in flavoured milk. Pasteurization (90 °C/20 min) resulted in approximately 40% loss of aspartame and only 8% of neotame was degraded. On storage (4-7°C/7 days) aspartame and neotame content decreased significantly (Paspartame; however, 50.50% of neotame remained intact. During storage (30 °C/60 days) neotame content decreased significantly (Paspartame in both pasteurized and in-bottle sterilized flavoured milk. PMID:26593524

  7. Claisen, Cope and Related Rearrangements in the Synthesis of Flavour and Fragrance Compounds

    OpenAIRE

    Janusz Nowicki

    2000-01-01

    A review of the use of the Claisen, Cope and related [3,3]-sigmatropic rearrangements, sequential ("tandem") sigmatropic rearrangements and the "ene" reaction in the syntheses of flavour and fragrance compounds is presented.

  8. Radiatively induced flavour violation in the general two-Higgs doublet model with Yukawa alignment

    International Nuclear Information System (INIS)

    The most general two-Higgs doublet model contains new sources of flavour violation that are usually in conflict with the experimental constraints. One possibility to suppress the exotic contribution to the flavour changing neutral currents consists on imposing the alignment of the Yukawa couplings. This condition presumably holds at a high-energy scale and is spoiled by the radiative corrections. We compute in this Letter the size of the radiatively induced flavour violating Higgs couplings at the electroweak scale. These also yield the absolute lower bound on the size of the exotic contributions to the flavour changing neutral currents in any two-Higgs doublet model, barring cancellations and the existence of discrete symmetries. We show that these contributions are well below the experimental bounds in large regions of the parameter space.

  9. Effect of Storage Period on the Physicochemical, Sensory and Microbiological Quality of Bakery Flavoured Ice Cream

    OpenAIRE

    Arashdeep Singh; Usha Bajwa

    2014-01-01

    Storage conditions were known to bring about some physicochemical changes in frozen foods. The present investigation was therefore carried out to examine the effect of storage period on the physicochemical, sensory and microbiological quality of bakery flavoured ice cream. Bakery flavoured ice cream incorporating cookies (plain and chocolate) and cakes (vanilla and chocolate) at 10 per cent level were prepared and subjected to 60 days of frozen storage and evaluated periodically...

  10. Searches for new physics with lepton flavours and multi-lepton final states in ATLAS

    CERN Document Server

    Madar, Romain; The ATLAS collaboration

    2015-01-01

    Lepton flavours and multi-lepton signatures are powerful probes to search for new physics. Also, the lepton sector of the Standard Model has to be extended to describe the observed neutrino oscillations. ATLAS experiment searches for lepton flavour violation, new gauge boson allowing to unify quark and lepton fields, heavy charged and neutral leptons as well as for new phenomena in multiphoton final states are summarized in this document. The most recent results will be discussed and compared with existing results.

  11. B(s)→eμ: search for lepton flavour violation at LHCb

    OpenAIRE

    Onderwater, Cornelis; Pellegrino, Antonio; Kappert, Rosa; Wiersema, Garbrand; van Veghel, Maarten(Nikhef National Institute for Subatomic Physics, Amsterdam, The Netherlands)

    2016-01-01

    The existence of three flavors of fundamental fermions is one of the great mysteries of the standard model of particle physics. At the same time it is at the basis of a variety of exciting phenomena, such as CP violation and neutrino flavor oscillations. Hints are mounting that the assumption of lepton universality and charged lepton flavour conservation, as currently incorporated in the standard model, may not be valid. We report on our test of charged lepton flavour conservation in the deca...

  12. B-anomalies related to leptons and lepton flavour universality violation

    CERN Document Server

    Crivellin, Andreas

    2016-01-01

    Several experiments observed deviations from the Standard Model (SM) in the flavour sector: LHCb found a $4-5\\,\\sigma$ discrepancy compared to the SM in $b\\to s\\mu^+\\mu^-$ transitions (recently supported by an Belle analysis) and CMS reported a non-zero measurement of $h\\to\\mu\\tau$ with a significance of $2.4\\,\\sigma$. Furthermore, BELLE, BABAR and LHCb founds hints for the violation of flavour universality in $B\\to D^{(*)}\\tau\

  13. Mortality among flavour and fragrance chemical plant workers in the United States.

    OpenAIRE

    Thomas, T L

    1987-01-01

    Vital status on 1 January 1981 was determined for a cohort of 1412 white men employed in a flavour and fragrance chemical plant between 1945 and 1965 in order to investigate the risks from fatal diseases among men exposed to multiple chemicals in the manufacture of fragrances, flavours, aroma chemicals, and other organic substances. Cause specific standardised mortality ratios (SMRs) were calculated for the entire study population and for several subsets by likelihood of exposure to chemicals...

  14. First results with two light flavours of quarks with maximally twisted mass

    International Nuclear Information System (INIS)

    We report on first results of an ongoing effort to simulate lattice QCD with two degenerate flavours of quarks by means of the twisted mass formulation tuned to maximal twist. By utilising recent improvements of the HMC algorithm, pseudo-scalar masses well below 300 MeV are simulated on volumes L3.T with T=2L and L>2 fm and at values of the lattice spacing af=2+1+1 flavours are discussed. (orig.)

  15. Lepton flavour violation at high energies: the LHC and a Linear Collider

    CERN Document Server

    Teixeira, A M; Figueiredo, A J R; Romao, J C

    2014-01-01

    We discuss several manifestations of charged lepton flavour violation at high energies. Focusing on a supersymmetric type I seesaw, considering constrained and semi-constrained supersymmetry breaking scenarios, we analyse different observables, both at the LHC and at a future Linear Collider. We further discuss how the synergy between low- and high-energy observables can shed some light on the underlying mechanism of lepton flavour violation.

  16. EFSA ; Scientific Opinion on Flavouring Group Evaluation 67, Revision 1 (FGE.67Rev.1): Consideration of 40 furan-substituted aliphatic hydrocarbons, alcohols, aldehydes, ketones, carboxylic acids and related esters, sulfides, disulfides and ethers evaluated by JECFA at the 65th meeting (JECFA, 2006

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister; Lund, Pia; Binderup, Mona-Lise

    evaluation is necessary, as laid down in Commission Regulation (EC) No 1565/2000. The present consideration concerns a group of 33 furan-substituted aliphatic hydrocarbons, alcohols, aldehydes, ketones, carboxylic acids and related esters, sulfides, disulfides and ethers evaluated by the JECFA. In the...

  17. Study of flavour compounds from orange juices by HS-SPME and GC-MS

    Science.gov (United States)

    Schmutzer, G.; Avram, V.; Covaciu, F.; Feher, I.; Magdas, A.; David, L.; Moldovan, Z.

    2013-11-01

    The flavour of the orange juices, which gives the taste and odour of the product, is an important criterion about the products quality for consumers. A fresh single strength and two commercial orange juices (obtained from concentrate) flavour profile were studied using a selective and sensitive gas chromatography - mass spectrometry (GC-MS) analytical system, after a solvent free, single step preconcentration and extraction technique, the headspace solid phase microextraction (HP-SPME). In the studied orange juices 55 flavour compounds were detected and classified as belonging to the esters, alcohols, ketones, monoterpenes and sesquiterpenes chemical families. The fresh single strength orange juice was characterized by high amount of esters, monoterpenes and sesquiterpenes. Limonene and valencene were the most abundant flavours in this fresh natural orange juice. Alcohols and ketones were found in higher concentration in the commercial orange juices made from concentrate, than in the single strength products. Nevertheless, in commercial juices the most abundant flavour was limonene and α-terpineol. The results highlight clear differences between fresh singles strength orange juice and juice from concentrate. The orange juices reconstructed from concentrate, made in Romania, present low quantity of flavour compounds, suggesting the absence or a low rearomatization process, but extraneous components were not detected.

  18. Heavy-quark mass dependence in global PDF analyses and 3- and 4-flavour parton distributions

    Energy Technology Data Exchange (ETDEWEB)

    Martin, A.D. [University of Durham, Institute for Particle Physics Phenomenology, Durham (United Kingdom); Stirling, W.J. [University of Cambridge, Cavendish Laboratory, Cambridge (United Kingdom); Thorne, R.S. [University College London, Department of Physics and Astronomy, London (United Kingdom); Watt, G. [CERN, Theory Group, Physics Department, Geneva 23 (Switzerland)

    2010-11-15

    We study the sensitivity of our recent MSTW 2008 NLO and NNLO PDF analyses to the values of the charm- and bottom-quark masses, and we provide additional public PDF sets for a wide range of these heavy-quark masses. We quantify the impact of varying m{sub c} and m{sub b} on the cross sections for W, Z and Higgs production at the Tevatron and the LHC. We generate 3- and 4-flavour versions of the (5-flavour) MSTW 2008 PDFs by evolving the input PDFs and {alpha}{sub S} determined from fits in the 5-flavour scheme, including the eigenvector PDF sets necessary for calculation of PDF uncertainties. As an example of their use, we study the difference in the Z total cross sections at the Tevatron and LHC in the 4- and 5-flavour schemes. Significant differences are found, illustrating the need to resum large logarithms in Q{sup 2}/m{sub b}{sup 2} by using the 5-flavour scheme. The 4-flavour scheme is still necessary, however, if cuts are imposed on associated (massive) b-quarks, as is the case for the experimental measurement of Zb anti b production and similar processes. (orig.)

  19. Functional role of starch and kappa-carrageenan on the rheology and flavour of a custard dessert (COST 921 recipe)

    OpenAIRE

    González Tomás, Luis; Tárrega, Amparo; Costell, Elvira

    2005-01-01

    Flavour release and perception are complex processes in which different physico-chemical and physiological phenomena may be involved 1. Whereas flavour release is mainly governed by chemical and/or physical interactions between flavour compounds and the food matrix 2, perception is strongly influenced by physiological factors like mouth volume, saliva flow rate and air flow rate through the mouth and nose 3. In the framework of COST 921 action, the main objective of this work was to study the...

  20. Heavy flavours production in DIS events at HERA

    Energy Technology Data Exchange (ETDEWEB)

    Bellan, Paolo

    2008-10-15

    The estimation of the fraction of events in which an heavy quark is produced in the deeply inelastic electron-proton collisions is the measurement performed in the present analysis. The analysed data sample corresponds to about 130 pb{sup -1} collected during the years 2004-2005 by the ZEUS detector, located in one of the interaction points of the HERA collider in Hamburg. The measured percentages are directly related to the proton structure, formally encoded by the contribution of the heavy quarks to the structure functions F{sub 2}. The tagging of the events in which an heavy quark is produced is achieved by means of the Impact Parameter method. The correlation between the lifetime of the hadrons and the geometrical properties of the relative tracks makes possible to pick out the heavy flavours production form the background. This kind of 'topological' method makes an extensive use of the silicon Micro Vertex Detector (MVD). This essential component of the tracking suite of the ZEUS detector has been the major upgrade realized in the second half of the ZEUS experiment data taking period. The achievement of the physical goal has strongly leaned on its performance and reliability, so a considerable part of the work consisted in feasibility, refinement and optimization studies. (orig.)

  1. Flavour kinetics in an expanding quark-gluon plasma

    International Nuclear Information System (INIS)

    A phenomenological model for the expansion of a quark-gluon plasma is presented and applied to ultra-relativistic nucleus-nucleus collisions. The flavour kinetics is described by rate equations allowing the abundances of the different constituents of the system to be out of equilibrium. The basic constituents are the quarks and gluons in the plasma phase and hadrons in the hadronic phase. Besides ordinary kinetic processes within the two phases (inelastic collisions), we construct a model for the confinement mechanism which is based on the string phenomenology of hadronization. The latter aspect constitutes the novel and essential part of the paper. Abundances of the various hadrons have been calculated for a baryon poor and a baryon rich scenario. The results show that during the hadronization process, the original quark content is roughly doubled. The resulting hadron abundances are found to depend on the hadronization mechanism, while the subsequent hadronic reactions do not have a significant effect on the final hadronic abundances. We find a K-/π- ratio as much as a factor 6 larger than in panti p collisions. (orig.)

  2. Flavour Fields in Steady State: Stress Tensor and Free Energy

    CERN Document Server

    Banerjee, Avik; Kundu, Sandipan

    2015-01-01

    The dynamics of a probe brane in a given gravitational background is governed by the Dirac-Born-Infeld action. The corresponding open string metric arises naturally in studying the fluctuations on the probe. In Gauge-String duality, it is known that in the presence of a constant electric field on the worldvolume of the probe, the open string metric acquires an event horizon and therefore the fluctuation modes on the probe experience an effective temperature. In this article, we bring together various properties of such a system to a formal definition and a subsequent narration of the effective thermodynamics and the stress tensor of the corresponding flavour fields, also including a non-vanishing chemical potential. In doing so, we point out a potentially infinitely-degenerate scheme-dependence of regularizing the free energy, which nevertheless yields a universal contribution in certain cases. This universal piece appears as the coefficient of a log-divergence in free energy when a space-filling probe brane ...

  3. Flavour fields in steady state: stress tensor and free energy

    Science.gov (United States)

    Banerjee, Avik; Kundu, Arnab; Kundu, Sandipan

    2016-02-01

    The dynamics of a probe brane in a given gravitational background is governed by the Dirac-Born-Infeld action. The corresponding open string metric arises naturally in studying the fluctuations on the probe. In Gauge-String duality, it is known that in the presence of a constant electric field on the worldvolume of the probe, the open string metric acquires an event horizon and therefore the fluctuation modes on the probe experience an effective temperature. In this article, we bring together various properties of such a system to a formal definition and a subsequent narration of the effective thermodynamics and the stress tensor of the corresponding flavour fields, also including a non-vanishing chemical potential. In doing so, we point out a potentially infinitely-degenerate scheme-dependence of regularizing the free energy, which nevertheless yields a universal contribution in certain cases. This universal piece appears as the coefficient of a log-divergence in free energy when a space-filling probe brane is embedded in AdS d+1-background, for d = 2, 4, and is related to conformal anomaly. For the special case of d = 2, the universal factor has a striking resemblance to the well-known heat current formula in (1 + 1)-dimensional conformal field theory in steady-state, which endows a plausible physical interpretation to it. Interestingly, we observe a vanishing conformal anomaly in d = 6.

  4. Single top-quark production through flavour changing neutral currents

    International Nuclear Information System (INIS)

    Flavour Changing Neutral Current (FCNC) processes are highly suppressed in the Standard Model due to Glashow-Iliopoulos-Maiani (GIM) mechanism. However, in some extensions of the Standard Model such as supersymmetry (SUSY) and the 2-Higgs doublet model, the FCNC contributes at tree level, enhancing the branching ratio significantly. The FCNC are searched for in single top-quark production where a u(c)-quark interacts with a gluon, producing a single top-quark with no associated quark production. The data collected by the ATLAS detector during year 2012 is used with a center-of-mass energy of √(s)=8 TeV, corresponding to an integrated luminosity of ∝20 fb-1. The candidate signal events are selected by requiring one lepton, muon or electron, missing transverse momentum and exactly one jet originating from a b-quark in the final state. The separation between the signal and background events is enhanced by using neural network algorithms. The cross section upper limit at 95% C.L. is calculated following most frequently statistical approach using a binned likelihood method calculated from the full neural network output.

  5. Heavy flavours in AA collisions: production, transport and final spectra

    CERN Document Server

    Alberico, WW M; De Pace, A; Molinari, A; Monteno, M; Nardi, M; Prino, F; Sitta, M

    2013-01-01

    A multi-step setup for heavy-flavour studies in high-energy nucleus-nucleus (AA) collisions --- addressing within a comprehensive framework the initial Q-Qbar production, the propagation in the hot medium until decoupling and the final hadronization and decays --- is presented. The initial hard production of Q-Qbar pairs is simulated using the POWHEG pQCD event generator, interfaced with the PYTHIA parton shower. Outcomes of the calculations are compared to experimental data in pp collisions and are used as a validated benchmark for the study of medium effects. In the AA case, the propagation of the heavy quarks in the medium is described in a framework provided by the relativistic Langevin equation. For the latter, different choices of transport coefficients are explored (either provided by a perturbative calculation or extracted from lattice-QCD simulations) and the corresponding numerical results are compared to experimental data from RHIC and the LHC. In particular, outcomes for the nuclear modification f...

  6. Production of heavy flavours with associated jets at HERA

    Energy Technology Data Exchange (ETDEWEB)

    Kind, O.M.

    2006-12-15

    Inclusive cross-sections for the production of open beauty and charm in ep collisions at HERA recorded with the ZEUS detector in the years 1996-2000 are measured. The data is restricted to photoproduction processes, i. e. collision events with small four-momentum transfers squared, Q{sup 2} {approx}0. Two associated jets with transverse energies E{sub t}>7(6)GeV and pseudo-rapidities vertical stroke {eta} vertical stroke <2.5 are required. The flavour is tagged by the identification of electrons and positrons from semi-leptonic decays of the heavy quark. For this a likelihood method is developed, mainly consisting of energy loss measurements in the central drift chamber of the detector and some other discriminant variables. The fractions of beauty and charm production are determined by a fit of Monte Carlo templates to the data. The total measured production cross-section for b anti b production is 820{+-}150{sup +20}{sub -30} pb for centre-of-mass energies {radical}(S{sub ep})=300 GeV and 1170{+-}130{sup +30}{sub -100} pb for {radical}(S{sub ep})=318 GeV. The total cross-section for charm production is given as well as differential cross-sections for b anti b and c anti c production. (orig.)

  7. REAL-TIME FLAVOUR TAGGING SELECTION IN ATLAS

    CERN Document Server

    Bokan, Petar; The ATLAS collaboration

    2016-01-01

    The ATLAS experiment includes a well-developed trigger system that allows a selection of events which are thought to be of interest, while achieving a high overall rejection against less interesting processes. An important part of the online event selection is the ability to distinguish between jets arising from heavy-flavour quarks (b- and c-jets) and light jets (jets from u-, d-, s- and gluon jets) in real-time. This is essential for many physics analysis that include processes with large jet multiplicity and b-quarks in the final state. Many changes were implemented to the ATLAS online b-jet selection for the Run-2 of the LHC. An overview of the b-jet trigger strategy and performance during 2015 data taking is presented. The ability to use complex offline Multivariate (MV2) b-tagging algorithms directly at High Level Trigger (HLT) was tested in this period. Details on online tagging algorithms are given together with the plans on how to adapt to the new high-luminosity and increased pileup conditions by ex...

  8. A to Z of Flavour with Pati-Salam

    Science.gov (United States)

    King, Stephen F.

    2014-08-01

    We propose an elegant theory of flavour based on A 4 × Z 5 family symmetry with Pati-Salam unification which provides an excellent description of quark and lepton masses, mixing and CP violation. The A 4 symmetry unifies the left-handed families and its vacuum alignment determines the columns of Yukawa matrices. The Z 5 symmetry distinguishes the right-handed families and its breaking controls CP violation in both the quark and lepton sectors. The Pati-Salam symmetry relates the quark and lepton Yukawa matrices, with Y u = Y ν and Y d ~ Y e . Using the see-saw mechanism with very hierarchical right-handed neutrinos and CSD4 vacuum alignment, the model predicts the entire PMNS mixing matrix and gives a Cabibbo angle θ C ≈ 1/4. In particular, for a discrete choice of Z 5 phases, it predicts maximal atmospheric mixing, θ {23/ l } = 45° ± 0.5° and leptonic CP violating phase δ l = 260° ± 5°. The reactor angle prediction is θ {13/ l } = 9° ± 0.5°, while the solar angle is 34° ≳ θ {12/ l } ≳ 31°, for a lightest neutrino mass in the range 0 ≲ m 1 ≲ 0.5 meV, corresponding to a normal neutrino mass hierarchy and a very small rate for neutrinoless double beta decay.

  9. CP violation and flavour mixing in the standard model

    International Nuclear Information System (INIS)

    We review and update the constraints on the parameters of the quark flavour mixing matrix VCKM in the standard model and estimate the resulting CP asymmetries in B decays, taking into account recent experimental and theoretical developments. In performing our fits, we use inputs from the measurements of the following quantities: (i) vertical stroke εvertical stroke , the CP-violating parameter in K decays, (ii) ΔMd, the mass difference due to the B0d- anti B0d mixing, (iii) the matrix elements vertical stroke Vcbvertical stroke and vertical stroke Vubvertical stroke , (iv) B-hadron lifetimes, and (v) the top quark mass. The experimental input in points (ii) - (v) has improved compared to our previous fits. With the updated CKM matrix we present the currently-allowed range of the ratios vertical stroke Vtd/Vtsvertical stroke and vertical stroke Vtd/Vubvertical stroke , as well as the standard model predictions for the Bs0- anti Bs0 mixing parameter xs, (or, equivalently, ΔMs) and the quantities sin 2α, sin 2β and sin2 γ, which characterize the CP-asymmetries in B-decays. Various theoretical issues related to the so-called ''penguin-pollution'', which are of importance for the determination of the phases α and γ from the CP-asymmetries in B decays, are also discussed. (orig.)

  10. Heavy-flavour production in ALICE at the LHC

    CERN Document Server

    Masciocchi, S

    2013-01-01

    ALICE at the LHC is the experiment dedicated to study the physics of nucleus-nucleus collisions. The apparatus is well suited for the measurement of heavy-quark hadron production, making use of the high spatial resolution provided by the tracking detectors and the excellent particle identification, which are distinctive of the ALICE apparatus. Results from proton-proton collisions at sqrt(s) = 2.76 and 7 TeV, and from Pb--Pb collisions at sqrt(s_NN) = 2.76 TeV are presented. The measurements in pp collisions provide an important test of perturbative QCD predictions. The precise vertex reconstruction together with the electron identification, allows the separation of the charm and the beauty components. Furthermore, the pp results are essential as a reference for the measurements in heavy-ion collisions. Nuclear modification factors were measured for D mesons, for electrons and for muons from heavy-flavour hadron decays. The elliptic flow of D mesons is also discussed. These measurements are important because ...

  11. A taste of dark matter: Flavour constraints on pseudoscalar mediators

    International Nuclear Information System (INIS)

    Dark matter interacting via the exchange of a light pseudoscalar can induce observable signals in indirect detection experiments and experience large self-interactions while evading the strong bounds from direct dark matter searches. The pseudoscalar mediator will however induce flavour-changing interactions in the Standard Model, providing a promising alternative way to test these models. We investigate in detail the constraints arising from rare meson decays and fixed target experiments for different coupling structures between the pseudoscalar and Standard Model fermions. The resulting bounds are highly complementary to the information inferred from the dark matter relic density and the constraints from primordial nucleosynthesis. We discuss the implications of our findings for the dark matter self-interaction cross section and the prospects of probing dark matter coupled to a light pseudoscalar with direct or indirect detection experiments. In particular, we find that a pseudoscalar mediator can only explain the Galactic Centre excess if its mass is above that of the B mesons, and that it is impossible to obtain a sufficiently large direct detection cross section to account for the DAMA modulation

  12. Real-time flavour tagging selection in ATLAS

    CERN Document Server

    \\v{Z}ivkovi{c}, Lidija; The ATLAS collaboration

    2015-01-01

    In high-energy physics experiments, online selection is crucial to select interesting collisions from the large data volume. ATLAS b-jet triggers are designed to identify heavy-flavour content in real-time and provide the only option to efficiently record events with fully hadronic final states containing b-jets. In doing so, two different, but related, challenges are faced. The physics goal is to optimise as far as possible the rejection of light jets, while retaining a high efficiency on selecting b-jets and maintaining affordable trigger rates without raising jet energy thresholds. This maps into a challenging computing task, as tracks and their corresponding vertices must be reconstructed and analysed for each jet above the desired threshold, regardless of the increasingly harsh pile-up conditions. We present an overview of the ATLAS strategy for online b-jet selection for the LHC Run 2, including the use of novel methods and sophisticated algorithms designed to face the above mentioned challenges. A firs...

  13. Real-time flavour tagging selection in ATLAS

    CERN Document Server

    Bogavac, Danijela; The ATLAS collaboration

    2015-01-01

    In high-energy physics experiments, online selection is crucial to identify the few interesting collisions from the large data volume processed. In the overall ATLAS trigger strategy, b-jet triggers are designed to identify heavy-flavour content in real-time and, in particular, provide the only option to efficiently record events with fully hadronic final states containing b-jets. In doing so, two different, but related, challenges are faced. The physics goal is to optimise as far as possible the rejection of light jets from multijet processes, while retaining a high efficiency on selecting jets from beauty, and maintaining affordable trigger rates without raising jet energy thresholds. This maps into a challenging computing task, as charged tracks and their corresponding vertexes must be reconstructed and analysed for each jet above the desired threshold, regardless of the increasingly harsh pile-up conditions. The performance of b-jet triggers during the LHC Run 1 data-taking campaigns is presented, togethe...

  14. Real-time flavour tagging selection in ATLAS

    CERN Document Server

    Zivkovic, Lidija; The ATLAS collaboration

    2015-01-01

    In high-energy physics experiments, online selection is crucial to select interesting collisions from the large data volume. ATLAS b-jet triggers are designed to identify heavy-flavour content in real-time and provide the only option to efficiently record events with fully hadronic final states containing b-jets. In doing so, two different, but related, challenges are faced. The physics goal is to optimise as far as possible the rejection of light jets, while retaining a high efficiency on selecting b-jets and maintaining affordable trigger rates without raising jet energy thresholds. This maps into a challenging computing task, as tracks and their corresponding vertexes must be reconstructed and analysed for each jet above the desired threshold, regardless of the increasingly harsh pile-up conditions. We present an overview of the ATLAS strategy for online b-jet selection for the LHC Run 2, including the use of novel methods and sophisticated algorithms designed to face the above mentioned challenges. A firs...

  15. Heavy flavours production in DIS events at HERA

    International Nuclear Information System (INIS)

    The estimation of the fraction of events in which an heavy quark is produced in the deeply inelastic electron-proton collisions is the measurement performed in the present analysis. The analysed data sample corresponds to about 130 pb-1 collected during the years 2004-2005 by the ZEUS detector, located in one of the interaction points of the HERA collider in Hamburg. The measured percentages are directly related to the proton structure, formally encoded by the contribution of the heavy quarks to the structure functions F2. The tagging of the events in which an heavy quark is produced is achieved by means of the Impact Parameter method. The correlation between the lifetime of the hadrons and the geometrical properties of the relative tracks makes possible to pick out the heavy flavours production form the background. This kind of 'topological' method makes an extensive use of the silicon Micro Vertex Detector (MVD). This essential component of the tracking suite of the ZEUS detector has been the major upgrade realized in the second half of the ZEUS experiment data taking period. The achievement of the physical goal has strongly leaned on its performance and reliability, so a considerable part of the work consisted in feasibility, refinement and optimization studies. (orig.)

  16. A taste of dark matter. Flavour constraints on pseudoscalar mediators

    International Nuclear Information System (INIS)

    Dark matter interacting via the exchange of a light pseudoscalar can induce observable signals in indirect detection experiments and experience large self-interactions while evading the strong bounds from direct dark matter searches. The pseudoscalar mediator will however induce flavour-changing interactions in the Standard Model, providing a promising alternative way to test these models. We investigate in detail the constraints arising from rare meson decays and fixed target experiments for different coupling structures between the pseudoscalar and Standard Model fermions. The resulting bounds are highly complementary to the information inferred from the dark matter relic density and the constraints from primordial nucleosynthesis. We discuss the implications of our findings for the dark matter self-interaction cross section and the prospects of probing dark matter coupled to a light pseudoscalar with direct or indirect detection experiments. In particular, we find that a pseudoscalar mediator can only explain the Galactic Centre excess if its mass is above that of the B mesons, and that it is impossible to obtain a sufficiently large direct detection cross section to account for the DAMA modulation.

  17. Lepton Flavour Violation (LFV) upper limits for LEP2 experiments

    International Nuclear Information System (INIS)

    LFV is predicted by many models beyond the Standard Model(SM). Though the SM has been successful in accounting for essentially all the data from the laboratory experiments to date, physicists are looking for phenomena beyond the SM. One of these is the lepton flavour violation in electroweak interactions. LEP experiments have established an upper limit for neutrinoless m and t decays and two fermion production at Z0 energy. Data obtained at LEP2 are analysed for establishing upper limits at higher energies. The forthcoming results are exciting because there are models which predict LFV at a level attained by LEP and LHC experiment's sensitivities.A review of the results both theoretical and experimental is presented along with the cosmological implications. Using the L3 collaboration Monte Carlo simulations at 189 - 209 GeV we tried a prediction for the upper limit for LFV in the e+ e- > t+ t- channel. Selection criteria for tauons are presented and selection efficiency is computed. (authors)

  18. CP Violating Phase and Quark Mixing Angles from Flavour Permutational Symmetry-Breaking

    CERN Document Server

    Mondragón, A

    2000-01-01

    The phase equivalence of the theoretical quark mixing matrix ${\\bf V}^{th}$ derived from the breaking of the flavour permutational symmetry and the phenomenological parametrizations ${\\bf V}^{PDG}$ and ${\\bf V}^{KM}$ is explicitly exhibited. From here, we derive exact explicit expressions for the three mixing angles and the CP violating phase of the two phenomenological parametrizations in terms of the quark mass ratios $(m_{u}/m_{t}, m_{c}/m_{t}, m_{d}/m_{b}, m_{s}/m_{b})$ and the parameters $Z^{*1/2}$ and $\\Phi^*$ characterizing the preferred symmetry breaking pattern. The computed values for the CP violating phase and the mixing angles of the standard parametrization advocated by the Particle Data Group are $\\delta^*_{13}=73.2^\\circ$, $\\sin\\theta^*_{12}=0.222$, $\\sin\\theta^*_{13}=0.0036$, and $\\sin\\theta^*_{23}=0.040$. The computed values of the CP-violating phase and the mixing angles of the Kobayashi-Maskawa parametrization are $\\delta^*_{KM}=96.4^\\circ$, $\\sin\\theta^*_{1}=0.2225$, $\\sin\\theta^*_{2}=0.03...

  19. Generalised Geometrical CP Violation in a $T^{\\prime}$ Lepton Flavour Model

    CERN Document Server

    Girardi, Ivan; Petcov, S T; Spinrath, Martin

    2014-01-01

    We analyse the interplay of generalised CP transformations and the non-Abelian discrete group $T^{\\prime}$ and use the semi-direct product $G_f= T^{\\prime}\\rtimes H_{\\text{CP}}$, as family symmetry acting in the lepton sector. The family symmetry is shown to be spontaneously broken in a geometrical manner. In the resulting flavour model, naturally small Majorana neutrino masses for the light active neutrinos are obtained through the type I see-saw mechanism. The known masses of the charged leptons, lepton mixing angles and the two neutrino mass squared differences are reproduced by the model with a good accuracy. The model allows for two neutrino mass spectra with normal ordering (NO) and one with inverted ordering (IO). For each of the three spectra the absolute scale of neutrino masses is predicted with relatively small uncertainty. The value of the Dirac CP violation (CPV) phase $\\delta$ in the lepton mixing matrix is predicted to be $\\delta \\cong \\pi/2~{\\rm or}~ 3\\pi/2$. Thus, the CP violating effects in ...

  20. Influence of flavour absorption on oxygen permeation through LDPE, PP, PC and PET plastics food packaging.

    Science.gov (United States)

    van Willige, R W G; Linssen, J P H; Meinders, M B J; van der Stege, H J; Voragen, A G J

    2002-03-01

    The effect of flavour absorption on the oxygen permeability of low-density polyethylene (LDPE), polypropylene (PP), polycarbonate (PC) and polyethylene terephthalate (PET) was studied using an isostatic continuous flow system. Polymer samples were exposed to a model solution containing limonene, hexyl acetate, nonanone and decanal at 40 degrees C. After exposure, one part of each sample was analysed for absorbed flavour compounds using a Large Volume Injection GC Ultrasonic 'in vial' extraction method, and from the other part, oxygen permeability was measured in a permeation cell at 25 degrees C. After 8 h of exposure, LDPE and PP samples showed a significant linear (R2 = 0.82 and 0.99) increase in oxygen permeability of 21 and 130%, respectively. Owing to swelling of the polymer samples resulting from flavour absorption, the structure of the polymeric network changed (i.e. opened) and consequently increased oxygen permeability. The oxygen permeability of exposed PC showed a significant linear (R2 = 0.78) decrease of 11% after 21 days. PC obviously did not swell like LDPE or PP. Therefore, it was suggested that absorbed flavour compounds occupied or blocked 'microcavities' through which normally oxygen is transported. Absorption of flavour compounds by PET did not affect the oxygen permeability of PET significantly. PMID:11837243

  1. Charged Lepton Flavour Violation in Supersymmetric Low-Scale Seesaw Models

    CERN Document Server

    Ilakovac, Amon; Popov, Luka

    2013-01-01

    We study charged lepton flavour violation in low-scale seesaw models of minimal supergravity, which realize large neutrino Yukawa couplings thanks to approximate lepton-number symmetries. There are two dominant sources of lepton flavour violation in such models. The first source originates from the usual soft supersymmetry-breaking sector, whilst the second one is entirely supersymmetric and comes from the supersymmetric neutrino Yukawa sector. Within the framework of minimal supergravity, we consider both sources of lepton flavour violation, soft and supersymmetric, and calculate a number of possible lepton-flavour-violating transitions, such as the photonic decays of muons and taus, mu -> e gamma, tau -> e gamma and tau -> mu gamma, their neutrinoless three-body decays, mu -> e e e, tau -> e e e, tau -> mu mu mu, tau -> e e mu and tau -> e mu mu, and the coherent mu -> e conversion in nuclei. After taking into account the exclusion bounds placed by present experiments of lepton flavour violation, we derive ...

  2. Flavour-changing-neutral-current processes in B physics

    International Nuclear Information System (INIS)

    Recent progress in flavour-changing-neutral-current (FCNC) processes is reviewed with particular emphasis on the role of QCD. Standard model (SM) is consistent with data. In particular, the rate and final-state distributions in radiative rare B decays, B→Xs+γ, are well accounted for in the SM in terms of the short-distance contribution. The CLEO measurement of the inclusive rate B(B→Xsγ)=(2.32±0.67)x10-4 yields vertical stroke Vtsvertical stroke /vertical stroke Vcbvertical stroke =0.85±0.23, in agreement with unity expected from the unitarity of the CKM matrix. Likewise, most QCD-based theoretical estimates, using short-distance dominance, yield for the exclusive-to-inclusive decay rate ratio B(B→K*+γ)/B(B→Xs+γ)=0.1-0.2, in agreement with the data giving 0.19±0.1 for the same quantity. Along the same lines, the present measurements of the branching ratio B(B→K*+γ) and upper limits on the branching ratios B(B→ρ+γ) and B(B→ω+γ) can be interpreted in terms of an upper limit on the CKM matrix element ratio, yielding vertical stroke Vtdvertical stroke /vertical stroke Vtsvertical stroke ≤0.75. This bound is less restrictive than the unitarity bounds and the ones that follow from the lower limit on the B0→ B0 mixing ratio ΔMs/ΔMd>11.3, reported recently by the ALEPH collaboration. The potential of rare B decays in searching for physics beyond the standard model is also reviewed with emphasis on the decays B→Xs+γ and B→Xsl+l-. ((orig.))

  3. 六味地黄汤活性成分组方LW-AFC对高热量饲料诱导小鼠代谢综合征的改善作用%Improvement effect of LW-AFC, an active component of prescription from Liuwei Dihuang decoction, on metabolic syndrome induced by high energy diet in mice

    Institute of Scientific and Technical Information of China (English)

    郭妍; 迟晓丽; 马渊; 肖智勇; 周文霞; 张永祥

    2013-01-01

    OBJECTIVE To evaluate the effect and mechanism of LW-AFC,an active component from Liuwei Dihuang decoction,against metabolic syndrome (MS) in a high-energy-diet induced model mice with similar characters of human MS.METHODS The models of high-caloric-diet-induced Kunming mice were ig given with metformin 0.2 g· kg-1 or LW-AFC 0.2,0.8 and 3.2 g· kg-1 consecutively for 6 weeks.At the end of the expreiment,the food intake and body mass of mice were dynamically weighted,and the fast blood total cholesterol (TC),low density lipoprotein-cholesterol (LDL-C),high density lipoprotein-cholesterol (HDL-C),connecting peptide,glucose (FBG),and fasting blood insulins (FINS) were measured.Homeostasis model assessment of insulin resistance (HOMA-IR) was calculated after that.The mice were sacrificed,and the coel-fat and orchio-fat were collected and weighted as visceral fat mass (VFM),and the visceral fat coefficient (VFC) was calculated.The levels of serum leptin,resistin,tumor necrosis factor-α (TNF-c) and interleukin-6 (IL-6) (Luminex method),TC and FBG (oxidase method),LDL-C and HDL-C (clearance method),FINS and NPY (radioimmunoassay)were also detected.Histological micrographs of liver were stained by hematoxylin-eosin.RESULTS Compared with normal control group,TC,LDL-C,FBG,HOMA-IR and connecting peptide significantly decreased (P < 0.01) in diet induced mouse MS model.LW-AFC improved hepatic steatosis,decreased food intake (P <0.05),NPY (P < 0.05),resistin (P < 0.05),TNF-α (P < 0.05) and IL-6 (P<0.05,P <0.01),and increased leptin levels (P < 0.01),though it had no effect on abdominal obesity and serum insulin levels.The variable cluster analysis showed that IL-6 level was close to lipid metabolism,the level of leptin was close to glucose metabolism,and resistin level was close to appetite and inflammation.CONCLUSION LW-AFC might improve MS by reducing hyperglycemia,improving dyslipidemia,increasing insulin sensitivity and reducing the pathologic damage of

  4. The supersymmetric flavour problem in 5D GUTs and its consequences for LHC phenomenology

    Energy Technology Data Exchange (ETDEWEB)

    Bruemmer, F. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Fichet, S.; Kraml, S. [CNRS/IN2P3, Grenoble (France). Lab. de Physique Subatomique et de Cosmologie

    2011-09-15

    We study supersymmetric models with a GUT-sized extra dimension, where both the Higgs fields and the SUSY breaking hidden sector are localized on a 4D brane. Exponential wave function profiles of the matter fields give rise to hierarchical structures in the Yukawa couplings and soft terms. Such structures can naturally explain hierarchical fermion masses and mixings, while at the same time alleviating the supersymmetric flavour problem. We discuss two sources of supersymmetry breaking, radion mediation and brane fields, and perform a detailed numerical analysis, thoroughly taking into account the proliferation of unknown O(1) coefficients that occurs in this class of models. It turns out that additional assumptions on supersymmetry breaking are necessary to evade the stringent experimental bounds on lepton flavour violation. The favourable regions of parameter space are then examined with regards to their LHC phenomenology. They generically feature heavy gluinos and squarks beyond current bounds. Lepton flavour violation in SUSY cascade decays can give interesting signatures. (orig.)

  5. Measurements of open heavy-flavour production with ALICE at the LHC

    CERN Document Server

    De, Sudipan

    2016-01-01

    In ALICE, open heavy-flavour production is studied through the measurements of the leptons (electrons and muons) from heavy-flavour hadron decays at central and forward rapidity and via the reconstruction of D-meson hadronic decays at mid-rapidity. An overview of the open heavy-flavour production with ALICE in pp ($\\sqrt{s}$ = 2.76 TeV and 7 TeV), p--Pb ($\\sqrt {s_{\\rm NN}}$ = 5.02 TeV) and Pb--Pb ($\\sqrt {s_{\\rm NN}}$ = 2.76 TeV) collisions will be presented. We will discuss the production cross sections, modifications of the transverse momentum distributions, azimuthal anisotropic emissions and correlations with hadrons in comparison with various theoretical predictions.

  6. Heavy-flavour correlations in pp, p–Pb and Pb–Pb collisions

    International Nuclear Information System (INIS)

    Heavy quarks (charm and beauty) are produced in initial hard scattering processes in heavy-ion collisions, before the formation of a strongly interacting medium, the Quark Gluon Plasma. Insight into the effects of the medium on charm and beauty production can be obtained by measuring the angular correlations between open heavy-flavour hadrons and charged particles. In Pb–Pb collisions, the azimuthal correlation can provide information on the way heavy quarks lose energy in the QGP and is sensitive to possible modifications of the charm parton shower and hadronisation in the presence of the medium. The observed double-ridge long-range correlations in p–Pb collisions for light-flavour hadrons could originate from a collective expansion of the system, as well as from gluon saturation in the initial state (colour glass condensate). The same effect can be studied for heavier quarks via the correlation between heavy-flavour hadrons (or their decay electrons) and charged particles

  7. Natural suppression of flavour-changing neutral currents in supersymmetric gauge theories

    International Nuclear Information System (INIS)

    Induced flavour-changing neutral currents (FCNC) in supersymmetric unified theories are investigated both in models with the standard SU(2)sub(L) x U(1) gauge symmetry and in models with an extra U tilde(1) gauge symmetry. Supersymmetric extension of the natural flavour conservation laws for neutral currents is obtained by adding a condition regarding the assumed type of supersymmetry breaking. This condition ensures no direct flavour-changing couplings of neutral gauge-Higgs fermions and at the same time is necessary and sufficient for the natural suppression of the induced FCNC. It is found that in the class of models satisfying the new condition the contribution of the scalar partners of quarks to the induced strangeness-changing neutral current is comparable to that of the quarks in K sub(L) → μantiμ, while it is negligibly small in K sub(L)-K sub(S) mass difference. (author)

  8. Quark flavour observables in the Littlest Higgs model with T-parity after LHC Run 1

    CERN Document Server

    Blanke, Monika; Recksiegel, Stefan

    2016-01-01

    The Littlest Higgs Model with T-parity (LHT) belongs to the simplest new physics scenarios with new sources of flavour and CP violation. We present a new analysis of quark observables in the LHT model in view of the oncoming flavour precision era. We use all available information on the CKM parameters, lattice QCD input and experimental data on quark flavour observables and corresponding theoretical calculations, taking into account new lower bounds on the symmetry breaking scale and the mirror quark masses from the LHC. We investigate by how much the branching ratios for a number of rare $K$ and $B$ decays are still allowed to depart from their SM values. This includes $K^+\\to\\pi^+\

  9. Release of peppermint flavour compounds from chewing gum: effect of oral functions

    DEFF Research Database (Denmark)

    Haahr, Anne-Mette; Bardow, A.; Thomsen, C.E.;

    2004-01-01

    During chewing, the oral cavity functions like a bellow, forcing volatile flavour compounds into the exhaling air to the nasal compartment. Accordingly, we hypothesised that flavour release from chewing gum is predominantly governed by chewing frequency (CF), although other oral functions, like...... masseter muscle activity (MMA), chewing force (CFO), and saliva flow rate (SFR), may also play a role. In 10 healthy young males, the retronasal expired air of menthol and menthone from peppermint-flavoured (2%) chewing gum was determined as functions of CF, SFR, MMA, and CFO. The experimental setup...... comprised three separate series of a 4-min chewing period. These series differed only with respect to CF, i.e., habitual frequency, and 60 and 88 strokes/min. Results showed that more than 50% of the released menthol and menthone could be retrieved in the expired air and saliva. After 2-min of chewing, the...

  10. Masses and magnetic moments of triple heavy flavour baryons in hypercentral model

    Indian Academy of Sciences (India)

    Bhavin Patel; Ajay Majethiya; P C Vinodkumar

    2009-04-01

    Triple heavy flavour baryons are studied using the hypercentral description of the three-body system. The confinement potential is assumed as hypercentral Coulomb plus power potential with power index . The ground state ($J^{P} = \\dfrac{1}{2}^{+}$ and $\\dfrac{3}{2}^{+}$) masses of heavy flavour baryons are computed for different power index, starting from 0.5 to 2.0. The predicted masses are found to attain a saturated value with respect to variation in p beyond the power index > 1.0. Using the spin-flavour structure of the constituting quarks and by defining effective mass of the confined quarks within the baryons, the magnetic moments are computed with no additional free parameters.

  11. Benzaldehyde in cherry flavour as a precursor of benzene formation in beverages.

    Science.gov (United States)

    Loch, Christine; Reusch, Helmut; Ruge, Ingrid; Godelmann, Rolf; Pflaum, Tabea; Kuballa, Thomas; Schumacher, Sandra; Lachenmeier, Dirk W

    2016-09-01

    During sampling and analysis of alcohol-free beverages for food control purposes, a comparably high contamination of benzene (up to 4.6μg/L) has been detected in cherry-flavoured products, even when they were not preserved using benzoic acid (which is a known precursor of benzene formation). There has been some speculation in the literature that formation may occur from benzaldehyde, which is contained in natural and artificial cherry flavours. In this study, model experiments were able to confirm that benzaldehyde does indeed degrade to benzene under heating conditions, and especially in the presence of ascorbic acid. Analysis of a large collective of authentic beverages from the market (n=170) further confirmed that benzene content is significantly correlated to the presence of benzaldehyde (r=0.61, pcherry flavoured beverages, industrial best practices should include monitoring for benzene. Formulations containing either benzoic acid or benzaldehyde in combination with ascorbic acid should be avoided. PMID:27041300

  12. The LCFIVertex package: Vertexing, flavour tagging and vertex charge reconstruction with an ILC vertex detector

    International Nuclear Information System (INIS)

    The precision measurements envisaged at the International Linear Collider (ILC) depend on excellent instrumentation and reconstruction software. The correct identification of heavy flavour jets, placing unprecedented requirements on the quality of the vertex detector, will be central for the ILC programme. This paper describes the LCFIVertex software, which provides tools for vertex finding and for identification of the flavour and charge of the leading hadron in heavy flavour jets. These tools are essential for the ongoing optimisation of the vertex detector design for linear colliders such as the ILC. The paper describes the algorithms implemented in the LCFIVertex package as well as the scope of the code and its performance for a typical vertex detector design.

  13. Non-universal Z' models with protected flavour-changing interactions

    CERN Document Server

    Jung, Martin

    2016-01-01

    We define a new class of Z' models with neutral flavour-changing interactions at tree level in the down-quark sector. They are related in an exact way to elements of the quark mixing matrix due to an underlying flavoured U(1)' gauge symmetry, rendering these models particularly predictive. The same symmetry implies lepton-flavour non-universal couplings, fully determined by the gauge structure of the model. Our models allow to address several presently observed deviations from the SM and specific correlations among the new physics contributions to the Wilson coefficients C9,10(l) can be tested in b->sll transitions. We furthermore predict lepton-universality violations in Z' decays, testable at the LHC.

  14. pi-pi and pi-K scatterings in three-flavour resummed chiral perturbation theory

    CERN Document Server

    Descotes-Genon, S

    2008-01-01

    The (light but not-so-light) strange quark may play a special role in the low-energy dynamics of QCD. The presence of strange quark pairs in the sea may have a significant impact of the pattern of chiral symmetry breaking : in particular large differences can occur between the chiral limits of two and three massless flavours (i.e., whether m_s is kept at its physical value or sent to zero). This may induce problems of convergence in three-flavour chiral expansions. To cope with such difficulties, we introduce a new framework, called Resummed Chiral Perturbation Theory. We exploit it to analyse pi-pi and pi-K scatterings and match them with dispersive results in a frequentist framework. Constraints on three-flavour chiral order parameters are derived.

  15. The supersymmetric flavour problem in 5D GUTs and its consequences for LHC phenomenology

    International Nuclear Information System (INIS)

    We study supersymmetric models with a GUT-sized extra dimension, where both the Higgs fields and the SUSY breaking hidden sector are localized on a 4D brane. Exponential wave function profiles of the matter fields give rise to hierarchical structures in the Yukawa couplings and soft terms. Such structures can naturally explain hierarchical fermion masses and mixings, while at the same time alleviating the supersymmetric flavour problem. We discuss two sources of supersymmetry breaking, radion mediation and brane fields, and perform a detailed numerical analysis, thoroughly taking into account the proliferation of unknown O(1) coefficients that occurs in this class of models. It turns out that additional assumptions on supersymmetry breaking are necessary to evade the stringent experimental bounds on lepton flavour violation. The favourable regions of parameter space are then examined with regards to their LHC phenomenology. They generically feature heavy gluinos and squarks beyond current bounds. Lepton flavour violation in SUSY cascade decays can give interesting signatures. (orig.)

  16. Phenomenology of anomaly-mediated supersymmetry breaking scenarios with non-minimal flavour violation

    Energy Technology Data Exchange (ETDEWEB)

    Fuks, Benjamin [Strasbourg Univ. (France). Inst. Pluridisciplinaire Hubert Curien; Herrmann, Bjoern [Savoie Univ., Annecy-le-Vieux (France). LAPTh; Klasen, Michael [Muenster Univ. (Germany). Inst. fuer Theoretische Physik 1

    2011-12-15

    In minimal anomaly-mediated supersymmetry breaking models, tachyonic sleptons are avoided by introducing a common scalar mass similar to the one introduced in minimal supergravity. This may lead to non-minimal flavour-violating interactions, e.g., in the squark sector. In this paper, we analyze the viable anomaly-mediated supersymmetry breaking parameter space in the light of the latest limits on low-energy observables and LHC searches, complete our analytical calculations of flavour-violating supersymmetric particle production at hadron colliders with those related to gluino production, and study the phenomenological consequences of non-minimal flavour violation in anomaly-mediated supersymmetry breaking scenarios at the LHC. Related cosmological aspects are also briefly discussed.

  17. The LCFIVertex package: vertexing, flavour tagging and vertex charge reconstruction with an ILC vertex detector

    CERN Document Server

    Bailey, David; Grimes, Mark; Harder, Kristian; Hillert, Sonja; Jackson, David; Jayawardena, Talini Pinto; Jeffery, Ben; Lastovicka, Tomas; Lynch, Clare; Martin, Victoria; Walsh, Roberval; Allport, Phil; Banda, Yambazi; Buttar, Craig; Cheplakov, Alexandre; Cussans, David; Damerell, Chris; de Groot, Nicolo; Fopma, Johan; Foster, Brian; Galagedera, Senerath; Gao, Rui; Gillman, Anthony; Goldstein, Joel; Greenshaw, Timothy; Halsall, Robert; Hawes, Brian; Hayrapetyan, Karen; Heath, Helen; John, Jaya; Johnson, Erik; Kundu, Nikhil; Laing, Andrew; Lastovicka-Medin, Gordana; Lau, Wing; Li, Yiming; Lintern, Andrew; Mandry, Scott; Murray, Peter; Nichols, Andy; Nomerotski, Andrei; Page, Ryan; Parkes, Chris; Perry, Colin; O'Shea, Val; Sopczak, Andre; Stefanov, Konstantin; Tabassam, Hajrah; Thomas, Stephen; Tikkanen, Tuomo; Turchetta, Renato; Tyndel, Mike; Velthuis, Jaap; Villani, Giulio; Wijnen, Thei; Woolliscroft, Tim; Worm, Steven; Yang, Stephanie; Zhang, Zhige

    2009-01-01

    The precision measurements envisaged at the International Linear Collider (ILC) depend on excellent instrumentation and reconstruction software. The correct identification of heavy flavour jets, placing unprecedented requirements on the quality of the vertex detector, will be central for the ILC programme. This paper describes the LCFIVertex software, which provides tools for vertex finding and for identification of the flavour and charge of the leading hadron in heavy flavour jets. These tools are essential for the ongoing optimisation of the vertex detector design for linear colliders such as the ILC. The paper describes the algorithms implemented in the LCFIVertex package, as well as the scope of the code and its performance for a typical vertex detector design.

  18. Studies of Higgs and flavour physics at the high pT frontier (top & FCNC) with ATLAS

    CERN Document Server

    Schaarschmidt, Jana; The ATLAS collaboration

    2016-01-01

    The studies performed by ATLAS in the sector of flavour physics in the high-pT range will be discussed, including FCNC in top decays involving coupling to gamma, Z, and Higgs, single top production, and lepton-flavour violation in Higgs decays.

  19. Azimuthal angular correlations between heavy-flavour decay particles and charged hadrons in pp collisions in ALICE

    International Nuclear Information System (INIS)

    Heavy quarks produced in pp and heavy ion collisions are studied using heavy-flavour decay electrons and heavy-flavour mesons. Detailed understanding of the production processes and fragmentation of heavy quarks can be obtained by studying the azimuthal angular correlation of heavy-flavour hadrons. The azimuthal angular correlations of heavy-flavour mesons and charged hadrons can be used to disentangle charm and beauty-hadrons in pp collisions. In this contribution the fraction of electrons from beauty-hadron decays in the heavy-flavour decay electron yield is shown as well as the beauty production cross section in pp collisions at √S = 2.76 TeV. The measurements are compared to the predictions from next-to leading order perturbative QCD calculations. We also show the results from correlation analysis of charged D* mesons and hadrons performed using pp collision data at √S = 7 TeV

  20. Search for lepton-number and lepton-flavour violation in tau decays

    International Nuclear Information System (INIS)

    We have searched for neutrinoless tau decays into three charged particles as evidence for lepton-flavour or lepton-number violation. The data were collected using the ARGUS detector at the DORIS II storage ring. Tau pairs were produced by e+e- annhilation at centre-of-mass energies near 10 GeV. No evidence for lepton-number or lepton-flavour violation was observed, but the upper limits obtained are an order of magnitude lower than those previously published. (orig.)

  1. Measurements of heavy-flavour production in p-Pb collisions with ALICE

    CERN Document Server

    Wilkinson, Jeremy

    2015-01-01

    The production of open heavy-flavour particles was studied in p-Pb collisions at $\\sqrt{s_\\mathrm{NN}}=5.02$ TeV using the ALICE detector. Three separate observables were used: the hadronic decays of D mesons at mid-rapidity, and semileptonic decays of heavy-flavour hadrons to electrons and muons at mid-rapidity and forward rapidity, respectively. The most recent ALICE measurements of the nuclear modification factor, $R_\\mathrm{pPb}$, of open charm and beauty are reported, along with the centrality and multiplicity dependence of D-meson production in p-Pb collisions.

  2. Measurements of flavour dependent fragmentation functions in $Z^{0} \\to q\\overline{q}$ events

    CERN Document Server

    Ackerstaff, K; Allison, J; Altekamp, N; Anderson, K J; Anderson, S; Arcelli, S; Asai, S; Ashby, S F; Axen, D A; Azuelos, Georges; Ball, A H; Barberio, E; Barlow, R J; Bartoldus, R; Batley, J Richard; Baumann, S; Bechtluft, J; Behnke, T; Bell, K W; Bella, G; Bentvelsen, Stanislaus Cornelius Maria; Bethke, Siegfried; Betts, S; Biebel, O; Biguzzi, A; Bird, S D; Blobel, Volker; Bloodworth, Ian J; Bobinski, M; Bock, P; Böhme, J; Boutemeur, M; Braibant, S; Bright-Thomas, P G; Brown, R M; Burckhart, Helfried J; Burgard, C; Bürgin, R; Capiluppi, P; Carnegie, R K; Carter, A A; Carter, J R; Chang, C Y; Charlton, D G; Chrisman, D; Ciocca, C; Clarke, P E L; Clay, E; Cohen, I; Conboy, J E; Cooke, O C; Couyoumtzelis, C; Coxe, R L; Cuffiani, M; Dado, S; Dallavalle, G M; Davis, R; De Jong, S; del Pozo, L A; de Roeck, A; Desch, Klaus; Dienes, B; Dixit, M S; Doucet, M; Dubbert, J; Duchovni, E; Duckeck, G; Duerdoth, I P; Eatough, D; Estabrooks, P G; Etzion, E; Evans, H G; Fabbri, Franco Luigi; Fanfani, A; Fanti, M; Faust, A A; Fiedler, F; Fierro, M; Fischer, H M; Fleck, I; Folman, R; Fürtjes, A; Futyan, D I; Gagnon, P; Gary, J W; Gascon, J; Gascon-Shotkin, S M; Geich-Gimbel, C; Geralis, T; Giacomelli, G; Giacomelli, P; Gibson, V; Gibson, W R; Gingrich, D M; Glenzinski, D A; Goldberg, J; Gorn, W; Grandi, C; Gross, E; Grunhaus, Jacob; Gruwé, M; Hanson, G G; Hansroul, M; Hapke, M; Hargrove, C K; Hartmann, C; Hauschild, M; Hawkes, C M; Hawkings, R; Hemingway, Richard J; Herndon, M; Herten, G; Heuer, R D; Hildreth, M D; Hill, J C; Hillier, S J; Hobson, P R; Höcker, Andreas; Homer, R James; Honma, A K; Horváth, D; Hossain, K R; Howard, R; Hüntemeyer, P; Igo-Kemenes, P; Imrie, D C; Ishii, K; Jacob, F R; Jawahery, A; Jeremie, H; Jimack, Martin Paul; Joly, A; Jones, C R; Jovanovic, P; Junk, T R; Karlen, D A; Kartvelishvili, V G; Kawagoe, K; Kawamoto, T; Kayal, P I; Keeler, Richard K; Kellogg, R G; Kennedy, B W; Klier, A; Kluth, S; Kobayashi, T; Kobel, M; Koetke, D S; Kokott, T P; Kolrep, M; Komamiya, S; Kowalewski, R V; Kress, T; Krieger, P; Von Krogh, J; Kyberd, P; Lafferty, G D; Lanske, D; Lauber, J; Lautenschlager, S R; Lawson, I; Layter, J G; Lazic, D; Lee, A M; Lefebvre, E; Lellouch, Daniel; Letts, J; Levinson, L; Liebisch, R; List, B; Littlewood, C; Lloyd, A W; Lloyd, S L; Loebinger, F K; Long, G D; Losty, Michael J; Ludwig, J; Liu, D; Macchiolo, A; MacPherson, A L; Mannelli, M; Marcellini, S; Markopoulos, C; Martin, A J; Martin, J P; Martínez, G; Mashimo, T; Mättig, P; McDonald, W J; McKenna, J A; McKigney, E A; McMahon, T J; McPherson, R A; Meijers, F; Menke, S; Merritt, F S; Mes, H; Meyer, J; Michelini, Aldo; Mihara, S; Mikenberg, G; Miller, D J; Mir, R; Mohr, W; Montanari, A; Mori, T; Nagai, K; Nakamura, I; Neal, H A; Nellen, B; Nisius, R; O'Neale, S W; Oakham, F G; Odorici, F; Ögren, H O; Oreglia, M J; Orito, S; Pálinkás, J; Pásztor, G; Pater, J R; Patrick, G N; Patt, J; Pérez-Ochoa, R; Petzold, S; Pfeifenschneider, P; Pilcher, J E; Pinfold, James L; Plane, D E; Poffenberger, P R; Poli, B; Polok, J; Przybycien, M B; Rembser, C; Rick, Hartmut; Robertson, S; Robins, S A; Rodning, N L; Roney, J M; Roscoe, K; Rossi, A M; Rozen, Y; Runge, K; Runólfsson, O; Rust, D R; Sachs, K; Saeki, T; Sahr, O; Sang, W M; Sarkisyan-Grinbaum, E; Sbarra, C; Schaile, A D; Schaile, O; Scharf, F; Scharff-Hansen, P; Schieck, J; Schmitt, B; Schmitt, S; Schöning, A; Schörner-Sadenius, T; Schröder, M; Schumacher, M; Schwick, C; Scott, W G; Seuster, R; Shears, T G; Shen, B C; Shepherd-Themistocleous, C H; Sherwood, P; Siroli, G P; Sittler, A; Skuja, A; Smith, A M; Snow, G A; Sobie, Randall J; Söldner-Rembold, S; Sproston, M; Stahl, A; Stephens, K; Steuerer, J; Stoll, K; Strom, D; Ströhmer, R; Tafirout, R; Talbot, S D; Tanaka, S; Taras, P; Tarem, S; Teuscher, R; Thiergen, M; Thomson, M A; Von Törne, E; Torrence, E; Towers, S; Trigger, I; Trócsányi, Z L; Tsur, E; Turcot, A S; Turner-Watson, M F; Van Kooten, R; Vannerem, P; Verzocchi, M; Vikas, P; Voss, H; Wäckerle, F; Wagner, A; Ward, C P; Ward, D R; Watkins, P M; Watson, A T; Watson, N K; Wells, P S; Wermes, N; White, J S; Wilson, G W; Wilson, J A; Wyatt, T R; Yamashita, S; Yekutieli, G; Zacek, V; Zer-Zion, D

    1999-01-01

    Fragmentation functions for charged particles in Z -> qq(bar) events have been measured for bottom (b), charm (c) and light (uds) quarks as well as for all flavours together. The results are based on data recorded between 1990 and 1995 using the OPAL detector at LEP. Event samples with different flavour compositions were formed using reconstructed D* mesons and secondary vertices. The \\xi_p = ln(1/x_E) distributions and the position of their maxima \\xi_max are also presented separately for uds, c and b quark events. The fragmentation function for b quarks is significantly softer than for uds quarks.

  3. Renormalization constants for Wilson fermion lattice QCD with four dynamical flavours

    CERN Document Server

    Dimopoulos, P; Herdoiza, G; Jansen, K; Lubicz, V; Palao, D; Rossi, G C

    2010-01-01

    We report on an ongoing non-perturbative computation of RI-MOM scheme renormalization constants for the lattice action with four dynamical flavours currently in use by ETMC. For this goal dedicated simulations with four degenerate sea quark flavours are performed at several values of the standard and twisted quark mass parameters. We discuss a method for removing possible O(a) artifacts at all momenta and extrapolating renormalization constant estimators to the chiral limit. We give preliminary results at one lattice spacing.

  4. Adolescents’ responses to the promotion and flavouring of e-cigarettes

    OpenAIRE

    Ford, Allison; MacKintosh, Anne Marie; Bauld, Linda; Moodie, Crawford; Hastings, Gerard

    2015-01-01

    Objectives The purpose of the study is to examine adolescents’ awareness of e-cigarette marketing and investigate the impact of e-cigarette flavour descriptors on perceptions of product harm and user image. Methods Data come from the 2014 Youth Tobacco Policy Survey, a cross-sectional in-home survey conducted with 11–16 year olds across the UK (n = 1205). Adolescents’ awareness of e-cigarette promotion, brands, and flavours was assessed. Perceptions of product harm, and likely user of four ex...

  5. Measurement of interactions between polysaccharides and flavour compounds by exclusion size chromatography: advantages and limits.

    Science.gov (United States)

    Guichard, E; Etiévant, P

    1998-12-01

    Interactions between flavour compounds and polysaccharides have been studied by exclusion size chromatography, the Hummel and Dreyer method. Hydrogen bonding was found between 2-acetyl thiazole and dextrines of different degrees of polymerisation. The number of binding sites and the affinity constant increase by increasing the degree of polymerisation. Hydrogen bonding was also responsible for the interactions between xanthane and 1-octen-3-ol or 2-acetyl pyrazine, with 1 mole of 1-octen-3-ol bound per pentasaccharide repeating unit. Unfortunately, the number of flavour compounds, which can be studied with this method, is limited due to their low water solubility and their low UV absorption. PMID:9881364

  6. Assessment of dietary exposure to flavouring substances via consumption of flavoured teas. Part II: transfer rates of linalool and linalyl esters into Earl Grey tea infusions.

    Science.gov (United States)

    Orth, Anne-Marie; Poplacean, Iulia; Fastowski, Oxana; Engel, Karl-Heinz

    2014-01-01

    The assessment of dietary exposure via the consumption of flavoured foods is a key element of the safety evaluation of flavouring substances. Linalyl acetate and linalool are the major flavouring substances in Earl Grey teas; the objective of this study was to determine their transfer rates from the tea leaves into the tea beverage upon preparation of a hot water infusion. Spiking experiments revealed a transfer rate of 66% for linalool. In contrast, the transfer rate for linalyl acetate was only 1.9%; in turn, the hydrolysis product linalool (17.0%) and a spectrum (19.9%) of degradation and rearrangement products (monoterpene alcohols, esters and hydrocarbons) were present in the tea beverage. The transfer rates were shown to be proportional to the length of the infusion. The impact of the hot water treatment on the enantiomeric compositions of linalyl acetate and linalool was determined, and structure-dependent experiments were performed by variation of the acyl and the alcohol moiety of the monoterpene ester. Comparative dietary exposure assessments demonstrated the need to take correction factors based on the experimentally determined transfer rates into account. Based on tea consumption data from the UK National Diet and Nutrition Survey (2000/2001), the exposure to linalyl acetate ranges from 0.2 mg day(-1) (average) to 1.8 mg day(-1) (high). The corresponding values for linalool are 4.2 mg day(-1) (average) and 46.6 mg day(-1) (high). The exposure of linalool via consumption of the tea beverage is approximately 26 times higher than that of linalyl acetate, although in the flavoured tea leaves the median content of linalyl acetate is approximately 1.8 times higher than that of linalool. PMID:24237351

  7. Thermodynamics of lattice QCD with 3 flavours of colour-sextet quarks

    CERN Document Server

    Kogut, J B

    2011-01-01

    We have been studying QCD with 2 flavours of colour-sextet quarks to distinguish whether it is QCD-like or conformal. For comparison we are now studying QCD with 3 flavours of colour-sextet quarks, which is believed to be conformal in the chiral limit. Here we present the results of simulations of lattice QCD with 3 colour-sextet quarks at finite temperatures on lattices of temporal extent $N_t=4$ and 6, with masses small enough to yield access to the chiral limit. As for the 2-flavour case, we find well-separated deconfinement and chiral-symmetry restoration transitions, both of which move to appreciably weaker couplings as $N_t$ is increased from 4 to 6. If this theory is conformal, we would expect there to be a bulk chiral transition at a fixed coupling. For this reason we conclude that for $N_t=4$ and 6, the chiral and hence the deconfinement transitions are in the strong-coupling domain where the theory is essentially quenched. The similarity between the behaviours of the 2 and 3 flavour theories suggest...

  8. Safety assessment of smoke flavouring primary products by the European Food Safety Authority

    NARCIS (Netherlands)

    Theobald, A.; Arcella, D.; Carere, A.; Croera, C.; Engel, K.H.; Gott, D.; Gurtler, R.; Meier, D.; Pratt, I.; Rietjens, I.M.C.M.; Simon, R.; Walker, R.

    2012-01-01

    This paper summarises the safety assessments of eleven smoke flavouring primary products evaluated by the European Food Safety Authority (EFSA). Data on chemical composition, content of polyaromatic hydrocarbons and results of genotoxicity tests and subchronic toxicity studies are presented and disc

  9. A straightforward method to determine flavouring substances in food by GC-MS

    NARCIS (Netherlands)

    Lopez Sanchez, P.; Sisseren, van M.; Marco, De S.; Jekel, A.A.; Nijs, de W.C.M.; Mol, J.G.J.

    2015-01-01

    A straightforward GC–MS method was developed to determine the occurrence of fourteen flavouring compounds in food. It was successfully validated for four generic types of food (liquids, semi-solids, dry solids and fatty solids) in terms of limit of quantification, linearity, selectivity, matrix effe

  10. Neutrino Masses at LHC: Minimal Lepton Flavour Violation in Type-III See-saw

    CERN Document Server

    Eboli, O J P; Gonzalez-Garcia, M C

    2011-01-01

    We study the signatures of minimal lepton flavour violation in a simple Type-III see--saw model in which the flavour scale is given by the new fermion triplet mass and it can be naturally light enough to be produced at the LHC. In this model the flavour structure of the couplings of the triplet fermions to the Standard Model leptons can be reconstructed from the neutrino mass matrix and the smallness of the neutrino mass is associated with a tiny violation of total lepton number. Characteristic signatures of this model include suppressed lepton number violation decays of the triplet fermions, absence of displaced vertices in their decays and predictable lepton flavour composition of the states produced in their decays. We study the observability of these signals in the processes $pp\\rightarrow 3\\ell + 2j +\\Sla{E_T}$ and $pp\\rightarrow 2\\ell + 4j$ with $\\ell =e$ or $\\mu$ taking into account the present low energy data on neutrino physics and the corresponding Standard Model backgrounds. Our results indicate th...

  11. Quarkonium and heavy flavour meson production at 13 TeV at ATLAS

    CERN Document Server

    Gladilin, Leonid; The ATLAS collaboration

    2016-01-01

    First results of the ATLAS experiment at LHC on quarkonium and heavy flavour meson production in proton-proton collisions at 13 TeV are presented. A brief summary of the results obtained at 7-8 TeV is also reported. Comparison of the data cross sections with various theoretical predictions is discussed.

  12. Status of the ALICE experiment and first results on heavy flavour production

    International Nuclear Information System (INIS)

    The ALICE experiment is the LHC detector mainly dedicated to the study of the Quark Gluon Plasma (QGP) in Pb-Pb collisions. The detector has started the data taking less than one year ago, delivering immediately relevant results. An overview of the first physics results obtained in the first six month of running of the experiment will be summarized, giving special emphasis to heavy flavour measurements. Heavy flavours are ideal probes to explore both the formation and properties of the QGP, since they experience the full collision history and are expected to be copiously produced at LHC, much more than at any other collider. With ALICE we will measure heavy flavours down to small transverse momentum, combining hadronic and leptonic channels, both at central and forward rapidity. In particular, in the central rapidity region, it is possible to exclusively reconstruct open charm mesons and baryons via hadronic decay channels. Furthermore, the good identification of electrons allows to measure the production both of charmonium and open beauty. First results from p-p collisions at 7 TeV will be shown, including the clear signals of open and hidden charm hadrons reconstructed at ALICE. These data provide interesting insight into QCD processes in a new energy regime, are important as a baseline for the Pb-Pb program and demonstrate the potential for heavy flavour cross section measurements with the ALICE detector.

  13. Flavour-changing decays of a 125 GeV Higgs-like particle

    International Nuclear Information System (INIS)

    The ATLAS and CMS experiments at the LHC have reported the observation of a possible excess of events corresponding to a new particle h with mass ∼125 GeV that might be the long-sought Higgs boson, or something else. Decyphering the nature of this possible signal will require constraining the couplings of the h and measuring them as accurately as possible. Here we analyze the indirect constraints on flavour-changing h decays that are provided by limits on low-energy flavour-changing interactions. We find that indirect limits in the quark sector impose such strong constraints that flavour-changing h decays to quark-antiquark pairs are unlikely to be observable at the LHC. On the other hand, the upper limits on lepton-flavour-changing decays are weaker, and the experimental signatures less challenging. In particular, we find that either B(h→τμ¯+μ¯τ) or B(h→τe¯+e¯τ) could be O(10)%, i.e., comparable to B(h→τ+τ-) and potentially observable at the LHC.

  14. Flavour Physics Beyond the Standard Model: Recent Developments and Future Perspectives

    CERN Document Server

    Blanke, Monika

    2014-01-01

    Flavour physics plays a crucial role in the search for physics beyond the Standard Model (SM). While $B$ physics offers many observables to look for deviations from the SM, the highest new physics sensitivity can be obtained in the rare kaon decays $K\\to\\pi\

  15. Reviewing progress towards finding an acceptable natural flavour alternative to salt

    NARCIS (Netherlands)

    Busch, J.L.H.C.; Batenburg, M.; Velden, van der R.; Smit, G.

    2009-01-01

    The level of sodium in food products needs to be lowered in order to help reduce incidences of hypertension and cardiovascular diseases of the world population. Important functionalities of salt (NaCl) – salty taste and flavour enhancement – are to be delivered by replacer systems. One approach is e

  16. Perspectives for heavy-flavour measurements in ALICE with the upgraded Inner Tracking System

    Directory of Open Access Journals (Sweden)

    Fionda F.

    2014-01-01

    Full Text Available The ALICE detector at the LHC is specifically designed to investigate the properties of the hot and dense medium, consisting of deconfined quarks and gluons (QGP, created in high energy heavy-ion collisions. Heavy-flavour particles are wellsuited probes to investigate the properties of such a medium, since they are mainly produced in the initial phase and they subsequently experience the full evolution of the collision. In the ALICE experiment, the Inner Tracking System (ITS plays an important role for heavy-flavour measurements. Interesting results have been obtained by analyzing pp, p–Pb and Pb–Pb data collected so far. The upgrade of the ITS, combined with the expected increase of LHC luminosity in Pb–Pb collisions, will allow the current performance for heavy flavour measurements to be significantly improved in particular in the low momentum region, and new measurements will become accessible (e.g. the Λc baryon in Pb–Pb collisions. The perspectives for heavy-flavour measurements expected after the second long shut-down (LS2 of LHC will be discussed.

  17. SuSeFLAV: A program for calculating supersymmetric spectra and lepton flavour violation

    Indian Academy of Sciences (India)

    Debtosh Chowdhury; Raghuveer Garani; Sudhir K Vempti

    2012-10-01

    The program $\\mathnormal{SuSeFLAV}$ is introduced for computing supersymmetric mass spectra with flavour violation in various supersymmetric breaking scenarios with/without see-saw mechanism. A short user guide summarizing the compilation, executables and the input files is provided.

  18. Safety assessment of allylalkoxybenzene derivatives used as flavouring substances - methyl eugenol and estragole

    NARCIS (Netherlands)

    Smith, R.L.; Adams, T.B.; Doull, J.; Feron, V.J.; Goodman, J.I.; Marnett, L.J.; Portoghese, P.S.; Waddell, W.J.; Wagner, B.M.; Rogers, A.E.; Caldwell, J.; Sipes, I.G.

    2002-01-01

    This publication is the seventh in a series of safety evaluations performed by the Expert Panel of the Flavor and Extract Manufacturers' Association (FEMA). In 1993, the Panel initiated a comprehensive program to re-evaluate the safety of more than 1700 GRAS flavouring substances under conditions of

  19. A new algorithm for identifying the flavour of $B_s^0$ mesons at LHCb

    CERN Document Server

    AUTHOR|(CDS)2075808; Adeva, Bernardo; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; d'Argent, Philippe; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belloli, Nicoletta; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bifani, Simone; Billoir, Pierre; Bird, Thomas; Birnkraut, Alex; Bizzeti, Andrea; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borgheresi, Alessio; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Demmer, Moritz; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Ruscio, Francesco; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dungs, Kevin; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farley, Nathanael; Farry, Stephen; Fay, Robert; Fazzini, Davide; Ferguson, Dianne; Fernandez Albor, Victor; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fohl, Klaus; Fol, Philip; Fontana, Marianna; Fontanelli, Flavio; Forshaw, Dean Charles; Forty, Roger; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gligorov, Vladimir; Göbel, Carla; Golubkov, Dmitry

    2016-01-01

    A new algorithm for the determination of the initial flavour of $B_s^0$ mesons is presented. The algorithm is based on two neural networks and exploits the $b$ hadron production mechanism at a hadron collider. The first network is trained to select charged kaons produced in association with the $B_s^0$ meson. The second network combines the kaon charges to assign the $B_s^0$ flavour and estimates the probability of a wrong assignment. The algorithm is calibrated using data corresponding to an integrated luminosity of 3 fb$^{-1}$ collected by the LHCb experiment in proton-proton collisions at 7 and 8 TeV centre-of-mass energies. The calibration is performed in two ways: by resolving the $B_s^0$-$\\bar{B}_s^0$ flavour oscillations in $B_s^0 \\to D_s^- \\pi^+$ decays, and by analysing flavour-specific $B_{s 2}^{*}(5840)^0 \\to B^+ K^-$ decays. The tagging power measured in $B_s^0 \\to D_s^- \\pi^+$ decays is found to be $(1.80 \\pm 0.19({\\rm stat}) \\pm 0.18({\\rm syst}))$\\%, which is an improvement of about 50\\% compare...

  20. Geosmin causes off-flavours in artic char raised in recirculating aquaculture systems

    Science.gov (United States)

    The “earthy” and “muddy” off-flavour taste in pond-reared fish is due to the presence of geosmin and 2-methylisoborneol (MIB) in the flesh of the fish. Planktonic and benthic cyanobacteria and actinomycetes are known sources of MIB and geosmin. When these compounds are absorbed into the flesh of the...

  1. Successful $N_2$ leptogenesis with flavour coupling effects in realistic unified models

    CERN Document Server

    Di Bari, Pasquale

    2015-01-01

    In realistic unified models involving an $SO(10)$-like pattern of Dirac and heavy right-handed (RH) neutrino masses, the lightest right-handed neutrino $N_1$ is too light to yield successful thermal leptogenesis, barring highly fine tuned solutions, while the second heaviest right-handed neutrino $N_2$ is typically in the correct mass range. We show that flavour coupling effects in the Boltzmann equations may be crucial to the success of such $N_2$ dominated leptogenesis, by helping to ensure that the flavour asymmetries produced at the $N_2$ scale survive $N_1$ washout. To illustrate these effects we focus on $N_2$ dominated leptogenesis in an existing model, the A to Z of flavour with Pati-Salam, where the neutrino Dirac mass matrix may be equal to an up-type quark mass matrix and has a particular constrained structure. The numerical results, supported by analytical insight, show that in order to achieve successful $N_2$ leptogenesis, consistent with neutrino phenomenology, requires a "flavour swap scenario...

  2. "Flavour Tagging and Systematics for Bs→J/ψϕ Measurement in ATLAS"

    CERN Document Server

    "Agatonovic Jovin, T; The ATLAS collaboration

    2013-01-01

    Poster for the Beauty 2013 Conference in Bologna. Flavour tagging methods and the tagging informaton used in the mass-lifetime angular fit to perform the measurement of the CP-violating phase in the channel Bs→J/ψϕ, are presented. Study of systematic uncertainties is also shown by considering several effect that are not accounted for in the likelihood fit.

  3. The role of α-amylase in the perception of oral texture and flavour in custards

    NARCIS (Netherlands)

    Wijk, R.A.de; Prinz, J.F.; Engelen, L.; Weenen, H.

    2004-01-01

    The role of salivary α-amylase in odour, flavour, and oral texture sensations was investigated in two studies in which the activity of salivary amylase present in the mouth of human subjects was either increased by presenting custards with added α-amylase or decreased by presenting custards with add

  4. Flavour Profiling of 'Marion' and Thornless Blackberries by Instrumental and Sensory Analysis

    Science.gov (United States)

    The flavour of thornless blackberries grown in Pacific Northwest including 'Thornless Evergreen', 'Black Diamond', 'Black Pearl', 'Nightfall', ORUS 1843-3, 'Waldo', NZ 9351-4, and 'Chester Thornless' as well as 'Marion' was profiled by sensory evaluation and instrumental analysis. Sensory results sh...

  5. Dark Matter and Dark Energy via Non-Perturbative (Flavour) Vacua

    CERN Document Server

    Tarantino, Walter

    2011-01-01

    A non-perturbative field theoretical approach to flavour physics (Blasone-Vitiello formalism) has been shown to imply a highly non-trivial vacuum state. In a previous work, we implemented the approach on a simple supersymmetric model (free Wess-Zumino), with flavour mixing, which was regarded as a model for free neutrinos and sneutrinos. The resulting effective vacuum (called "flavour vacuum") was found to be characterized by a strong SUSY breaking. In this paper we explore the phenomenology of the model and we argue that the flavour vacuum is a consistent source for both Dark Energy (thanks to the bosonic sector of the model) and Dark Matter (via the fermionic one). Quite remarkably, besides the parameters connected with neutrino physics, in this model no other parameters have been introduced, possibly leading to a predictive theory of Dark Energy/Matter. Despite its oversimplification, such a toy model already seems capable to shed some light on the observed energy hierarchy between neutrino physics, Dark E...

  6. B Flavour Tagging with Artificial Neural Networks for the CDF II Experiment

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, Andreas; /Karlsruhe U., EKP

    2010-01-01

    One of the central questions arising from human curiosity has always been what matter is ultimately made of, with the idea of some kind of elementary building-block dating back to the ancient greek philosophers. Scientific activities of multiple generations have contributed to the current best knowledge about this question, the Standard Model of particle physics. According to it, the world around us is composed of a small number of stable elementary particles: Electrons and two different kinds of quarks, called up and down quarks. Quarks are never observed as free particles, but only as bound states of a quark-antiquark pair (mesons) or of three quarks (baryons), summarized as hadrons. Protons and Neutrons, the constituents forming the nuclei of all chemical elements, are baryons made of up and down quarks. The electron and the electron neutrino - a nearly massless particle without electric charge - belong to a group called leptons. These two quarks and two leptons represent the first generation of elementary particles. There are two other generations of particles, which seem to have similar properties as the first generation except for higher masses, so there are six quarks and six leptons altogether. They were around in large amounts shortly after the beginning of the universe, but today they are only produced in high energetic particle collisions. Properties of particles are described by quantum numbers, for example charge or spin. For every type of particle, a corresponding antiparticle exists with the sign of all charges swapped, but similar properties otherwise. The Standard Model is a very successful theory, describing the properties of all known particles and the interactions between them. Many of its aspects have been tested in various experiments at very high precision. Although none of these experimental tests has shown a significant deviation from the corresponding Standard Model prediction, the theory can not be complete yet: Cosmological aspects like

  7. B Flavour Tagging with Artificial Neural Networks for the CDF II Experiment

    International Nuclear Information System (INIS)

    One of the central questions arising from human curiosity has always been what matter is ultimately made of, with the idea of some kind of elementary building-block dating back to the ancient greek philosophers. Scientific activities of multiple generations have contributed to the current best knowledge about this question, the Standard Model of particle physics. According to it, the world around us is composed of a small number of stable elementary particles: Electrons and two different kinds of quarks, called up and down quarks. Quarks are never observed as free particles, but only as bound states of a quark-antiquark pair (mesons) or of three quarks (baryons), summarized as hadrons. Protons and Neutrons, the constituents forming the nuclei of all chemical elements, are baryons made of up and down quarks. The electron and the electron neutrino - a nearly massless particle without electric charge - belong to a group called leptons. These two quarks and two leptons represent the first generation of elementary particles. There are two other generations of particles, which seem to have similar properties as the first generation except for higher masses, so there are six quarks and six leptons altogether. They were around in large amounts shortly after the beginning of the universe, but today they are only produced in high energetic particle collisions. Properties of particles are described by quantum numbers, for example charge or spin. For every type of particle, a corresponding antiparticle exists with the sign of all charges swapped, but similar properties otherwise. The Standard Model is a very successful theory, describing the properties of all known particles and the interactions between them. Many of its aspects have been tested in various experiments at very high precision. Although none of these experimental tests has shown a significant deviation from the corresponding Standard Model prediction, the theory can not be complete yet: Cosmological aspects like

  8. Subtle changes in the flavour and texture of a drink enhance expectations of satiety

    Directory of Open Access Journals (Sweden)

    McCrickerd Keri

    2012-10-01

    Full Text Available Abstract Background The consumption of liquid calories has been implicated in the development of obesity and weight gain. Energy-containing drinks are often reported to have a weak satiety value: one explanation for this is that because of their fluid texture they are not expected to have much nutritional value. It is important to consider what features of these drinks can be manipulated to enhance their expected satiety value. Two studies investigated the perception of subtle changes in a drink’s viscosity, and the extent to which thick texture and creamy flavour contribute to the generation of satiety expectations. Participants in the first study rated the sensory characteristics of 16 fruit yogurt drinks of increasing viscosity. In study two, a new set of participants evaluated eight versions of the fruit yogurt drink, which varied in thick texture, creamy flavour and energy content, for sensory and hedonic characteristics and satiety expectations. Results In study one, participants were able to perceive small changes in drink viscosity that were strongly related to the actual viscosity of the drinks. In study two, the thick versions of the drink were expected to be more filling and have a greater expected satiety value, independent of the drink’s actual energy content. A creamy flavour enhanced the extent to which the drink was expected to be filling, but did not affect its expected satiety. Conclusions These results indicate that subtle manipulations of texture and creamy flavour can increase expectations that a fruit yogurt drink will be filling and suppress hunger, irrespective of the drink’s energy content. A thicker texture enhanced expectations of satiety to a greater extent than a creamier flavour, and may be one way to improve the anticipated satiating value of energy-containing beverages.

  9. Successful N{sub 2} leptogenesis with flavour coupling effects in realistic unified models

    Energy Technology Data Exchange (ETDEWEB)

    Bari, Pasquale Di; King, Stephen F. [Department of Physics and Astronomy, University of Southampton,Highfield, Southampton SO17 1BJ (United Kingdom)

    2015-10-02

    In realistic unified models involving so-called SO(10)-inspired patterns of Dirac and heavy right-handed (RH) neutrino masses, the lightest right-handed neutrino N{sub 1} is too light to yield successful thermal leptogenesis, barring highly fine tuned solutions, while the second heaviest right-handed neutrino N{sub 2} is typically in the correct mass range. We show that flavour coupling effects in the Boltzmann equations may be crucial to the success of such N{sub 2} dominated leptogenesis, by helping to ensure that the flavour asymmetries produced at the N{sub 2} scale survive N{sub 1} washout. To illustrate these effects we focus on N{sub 2} dominated leptogenesis in an existing model, the A to Z of flavour with Pati-Salam, where the neutrino Dirac mass matrix may be equal to an up-type quark mass matrix and has a particular constrained structure. The numerical results, supported by analytical insight, show that in order to achieve successful N{sub 2} leptogenesis, consistent with neutrino phenomenology, requires a “flavour swap scenario” together with a less hierarchical pattern of RH neutrino masses than naively expected, at the expense of some mild fine-tuning. In the considered A to Z model neutrino masses are predicted to be normal ordered, with an atmospheric neutrino mixing angle well into the second octant and the Dirac phase δ≃20{sup ∘}, a set of predictions that will be tested in the next years in neutrino oscillation experiments. Flavour coupling effects may be relevant for other SO(10)-inspired unified models where N{sub 2} leptogenesis is necessary.

  10. Successful N2 leptogenesis with flavour coupling effects in realistic unified models

    Science.gov (United States)

    Di Bari, Pasquale; King, Stephen F.

    2015-10-01

    In realistic unified models involving so-called SO(10)-inspired patterns of Dirac and heavy right-handed (RH) neutrino masses, the lightest right-handed neutrino N1 is too light to yield successful thermal leptogenesis, barring highly fine tuned solutions, while the second heaviest right-handed neutrino N2 is typically in the correct mass range. We show that flavour coupling effects in the Boltzmann equations may be crucial to the success of such N2 dominated leptogenesis, by helping to ensure that the flavour asymmetries produced at the N2 scale survive N1 washout. To illustrate these effects we focus on N2 dominated leptogenesis in an existing model, the A to Z of flavour with Pati-Salam, where the neutrino Dirac mass matrix may be equal to an up-type quark mass matrix and has a particular constrained structure. The numerical results, supported by analytical insight, show that in order to achieve successful N2 leptogenesis, consistent with neutrino phenomenology, requires a ``flavour swap scenario'' together with a less hierarchical pattern of RH neutrino masses than naively expected, at the expense of some mild fine-tuning. In the considered A to Z model neutrino masses are predicted to be normal ordered, with an atmospheric neutrino mixing angle well into the second octant and the Dirac phase δsimeq 20o, a set of predictions that will be tested in the next years in neutrino oscillation experiments. Flavour coupling effects may be relevant for other SO(10)-inspired unified models where N2 leptogenesis is necessary.

  11. Sensory profile of warmed-over flavour in tenderloin from steers supplemented with alpha-tocopherol

    Directory of Open Access Journals (Sweden)

    Moacir Evandro Lage

    2012-08-01

    Full Text Available The objective of the present study was to evaluate the occurrence of warmed-over flavour (WOF in cooked tenderloin and the influence of alpha-tocopherol on its inhibition. A total of 24 animals were confined, 12 of which received 1200 mg/head/day of alpha-tocopherol acetate for 90 days. Longissimus dorsi muscle cuts (tenderloin were obtained for sensory profile assessment by nine trained tasters. The tasters evaluated the taste of the meat based on four general and 18 specific attributes. The results of the evaluations were analysed with ANOVA, post-hoc tests of the means (Tukey tests, and principal component analysis (PCA. There was no significant difference in the WOF between the cuts of meat from the supplemented and non-supplemented animals. However, as the refrigeration period increased, there was a decrease in the intensity of the umami and sweet taste attributes and the flavour and aroma of the roast meat as well as an increase in the intensity of the oxidised vegetable oil flavour and the aromas of fish, hard-boiled egg, flaxseed oil, and oxidised vegetable oil. The samples that had been stored for one day were characterised by PCA as having sweet and umami tastes and the flavour and aroma of roast meat, whereas after three days, the samples were classified as having sour and bitter tastes, the flavour of chicken and nuts, and the aroma of fish. The typical sensory attributes desirable for roasted meat decreased in intensity during the three days of storage after cooking, whereas the intensity of unpleasant (oxidative attributes for the consumer increased.

  12. Towards a new determination of the QCD Λ parameter from running couplings in the tree-flavour theory

    Energy Technology Data Exchange (ETDEWEB)

    Dalla Brida, M.; Sint, S. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC; Trinity College, Dublin (Ireland). School of Mathematics; Fritzsch, P.; Korzec, T. [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik; Ramos, A.; Sommer, R. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC

    2014-12-15

    We review our new strategy and current status towards a high precision computation of the Λ parameter from three-flavour simulations in QCD. To reach this goal we combine specific advantages of the Schroedinger functional and gradient flow couplings.

  13. Impact of heavy-flavour production cross sections measured by the LHCb experiment on parton distribution functions at low x

    International Nuclear Information System (INIS)

    The impact of recent measurements of heavy-flavour production in deep inelastic ep scattering and in pp collisions on parton distribution functions is studied in a QCD analysis in the fixed-flavour number scheme at next-to-leading order. Differential cross sections of charm- and beauty-hadron production measured by LHCb are used together with inclusive and heavy-flavour production cross sections in deep inelastic scattering at HERA. The heavy-flavour data of the LHCb experiment impose additional constraints on the gluon and the sea-quark distributions at low partonic fractions x of the proton momentum, down to x∝5 x 10-6. This kinematic range is currently not covered by other experimental data in perturbative QCD fits.

  14. Headspace-solid phase microextraction coupled to gas chromatography-combustion-isotope ratio mass spectrometer and to enantioselective gas chromatography for strawberry flavoured food quality control.

    Science.gov (United States)

    Schipilliti, Luisa; Dugo, Paola; Bonaccorsi, Ivana; Mondello, Luigi

    2011-10-21

    Authenticity assessment of flavoured strawberry foods was performed using headspace-solid phase microextraction (HS-SPME) coupled to gas chromatography-combustion-isotope ratio mass spectrometry (GC-C-IRMS). An authenticity range was achieved, investigating on the carbon isotope ratio of numerous selected aroma active volatile components (methyl butanoate, ethyl butanoate, hex-(2E)-enal, methyl hexanoate, buthyl butanoate, ethyl hexanoate, hexyl acetate, linalool, hexyl butanoate, octyl isovalerate, γ-decalactone and octyl hexanoate) of organic Italian fresh strawberries. To the author's knowledge, this is the first time that all these components were investigated simultaneously by GC-C-IRMS on the same sample. The results were compared, when applicable, with those obtained by analyzing the HS-SPME extracts of commercial flavoured food matrices. In addition, one Kenyan pineapple and one fresh Italian peach were analyzed to determine the δ(13)C(VPDB) of the volatile components common to strawberry. The δ(13)C(VPDB) values are allowed to differentiate between different biogenetic pathways (C(3) and CAM plants) and more interestingly between plants of the same CO(2) fixation group (C(3) plants). Additional analyses were performed on all the samples by means of Enantioselective Gas Chromatography (Es-GC), measuring the enantiomeric distribution of linalool and γ-decalactone. It was found that GC-C-IRMS and Es-GC measurements were in agreement to detect the presence of non-natural strawberry aromas in the food matrices studied. PMID:21872872

  15. Effect of gamma irradiation and ethyl methane sulphonate on flavour formation in garlic (Allium sativum L. ) cultures

    International Nuclear Information System (INIS)

    In callus cultures both gamma irradiation and EMS treatments produced stimul ation of flavour formation at lower as well as at higher dosages. Different results were obtained when the plantlets differentiated from both the treatments were analysed. There was a gradual increase in flavour formation with increasing dosages, which declined at a higher dosages. Cytological observations showed an increase in polyploidy with increasing dosages. (author). 5 refs., 5 tabs

  16. Physico-chemical change and heat stability of extra virgin olive oils flavoured by selected Tunisian aromatic plants.

    Science.gov (United States)

    Ayadi, M A; Grati-Kamoun, N; Attia, H

    2009-10-01

    Objectives of this work were studying physico-chemical change and heat stability of olive oils flavoured by selected Tunisian aromatic plants. Flavoured olive oils were prepared by maceration of fresh plant materials (rosemary, lavender, sage, menthe, basil, lemon and thyme) with olive oil at a 5% w/w level for 15 days. A sensorial evaluation was applied to select more appreciate flavoured olive oils by consumers. An oxidative procedure was applied to test the stability of selected flavoured olive oils: oils samples were kept in glass bottles and heated at 60 and 130 degrees C during 55 days and 6h, respectively. The resistance to oxidation of these selected flavoured oils was compared to a control samples by measuring PV, K232 and K270 values and change in chlorophyll, carotenes and polyphénols contents. Obtained results show that addition of aromatic plants causes a slight increase in free acidity and viscosity of aromatised olive oils. L*, b* and a* values show that addition of thyme cause a great change in olive oil colours. Heat stability results shows that from selected aromatic plants, rosemary was effectiveness against oxidation followed by thyme and lemon. However, olive oil flavoured with basil exhibit a similar behaviour versus thermal oxidation then the natural olive oil. PMID:19635520

  17. Role in Cheese Flavour Formation of Heterofermentative Lactic Acid Bacteria from Mesophilic Starter Cultures

    DEFF Research Database (Denmark)

    Pedersen, Thomas Bæk

    Undefined mesophilic cheese starters are complex ecosystems that contain both homofermentative and heterofermentative lactic acid bacteria, with the Lactococcus genera representing the former and Lceuonostoc and sometimes Lactobacillus the latter. These starters originate from old butter starters...... dairy strains had, in comparison with plant isolates, the ability to ferment citrate and lacked several genes involved in the fermentation of complex carbohydrates. The presented research in this thesis has gained insight in to the role of heterofermentative lactic acid bacteria in cheese flavour...... formation. The traditional DL-starters contained numerous of strains of heterofermentative Le. mesenteroides, whereas Le. pseudomesenteroides and  only were found in some starters. The potential of heterofermentative lactic acid bacteria to effect the flavour formation in cheese seems to be dependent on how...

  18. The lepton-flavour violating decay \\tau \\to \\mu \\mu \\antimu at the LHC

    CERN Document Server

    Giffels, M; Krämer, M; O'Leary, B; Stahl, A

    2008-01-01

    Lepton-flavour violating tau-decays are predicted in many extensions of the Standard Model at a rate observable at future collider experiments. In this article we focus on the decay tau to mu mu antimu, which is a promising channel to observe lepton-flavour violation at the Large Hadron Collider LHC. We present analytic expressions for the differential decay width derived from a model-independent effective Lagrangian with general four-fermion operators, and estimate the experimental acceptance for detecting the decay tau to mu mu antimu at the LHC. Specific emphasis is given to decay angular distributions and how they can be used to discriminate new physics models. We provide specific predictions for various extensions of the Standard Model, including supersymmetric, little Higgs and technicolour models.

  19. A novel experiment searching for the lepton flavour violating decay μ → eee

    International Nuclear Information System (INIS)

    Since the discovery of neutrino oscillations it is known that lepton flavour is not conserved. Lepton flavour violating processes in the charged lepton sector have so far however eluded detection; as they are heavily suppressed in the standard model of particle physics, an observation would be a clear signal for new physics and help to understand the source of neutrino masses and CP violation. We propose a novel experiment searching for the decay μ → eee with the aim of ultimately reaching a sensitivity of 10−16, an improvement by four orders of magnitude compared to previous experiments. The technologies enabling this step are thin high-voltage monolithic active pixel sensors for precise tracking at high rates with a minimum of material and scintillating fibres for high resolution time measurements.

  20. QCD-aware partonic jet clustering for truth-jet flavour labelling

    Science.gov (United States)

    Buckley, Andy; Pollard, Chris

    2016-02-01

    We present an algorithm for deriving partonic flavour labels to be applied to truth particle jets in Monte Carlo event simulations. The inputs to this approach are final pre-hadronisation partons, to remove dependence on unphysical details such as the order of matrix element calculation and shower generator frame recoil treatment. These are clustered using standard jet algorithms, modified to restrict the allowed pseudojet combinations to those in which tracked flavour labels are consistent with QCD and QED Feynman rules. The resulting algorithm is shown to be portable between the major families of shower generators, and largely insensitive to many possible systematic variations: it hence offers significant advantages over existing ad hoc labelling schemes. However, it is shown that contamination from multi-parton scattering simulations can disrupt the labelling results. Suggestions are made for further extension to incorporate more detailed QCD splitting function kinematics, robustness improvements, and potential uses for truth-level physics object definitions and tagging.