Directory of Open Access Journals (Sweden)
Hideaki Yamamoto
Full Text Available Adherens junctions (AJs play a role in mechanically connecting adjacent cells to maintain tissue structure, particularly in epithelial cells. The major cell-cell adhesion molecules at AJs are cadherins and nectins. Afadin binds to both nectins and α-catenin and recruits the cadherin-β-catenin complex to the nectin-based cell-cell adhesion site to form AJs. To explore the role of afadin in radial glial and ependymal cells in the brain, we generated mice carrying a nestin-Cre-mediated conditional knockout (cKO of the afadin gene. Newborn afadin-cKO mice developed hydrocephalus and died neonatally. The afadin-cKO brain displayed enlarged lateral ventricles and cerebral aqueduct, resulting from stenosis of the caudal end of the cerebral aqueduct and obliteration of the ventral part of the third ventricle. Afadin deficiency further caused the loss of ependymal cells from the ventricular and aqueductal surfaces. During development, radial glial cells, which terminally differentiate into ependymal cells, scattered from the ventricular zone and were replaced by neurons that eventually covered the ventricular and aqueductal surfaces of the afadin-cKO midbrain. Moreover, the denuded ependymal cells were only occasionally observed in the third ventricle and the cerebral aqueduct of the afadin-cKO midbrain. Afadin was co-localized with nectin-1 and N-cadherin at AJs of radial glial and ependymal cells in the control midbrain, but these proteins were not concentrated at AJs in the afadin-cKO midbrain. Thus, the defects in the afadin-cKO midbrain most likely resulted from the destruction of AJs, because AJs in the midbrain were already established before afadin was genetically deleted. These results indicate that afadin is essential for the maintenance of AJs in radial glial and ependymal cells in the midbrain and is required for normal morphogenesis of the cerebral aqueduct and ventral third ventricle in the midbrain.
Canoe-Kayak Club
2015-01-01
Jeudi 9 juillet avait lieu les championnats de France Masters de canoë-kayak slalom sur le stade d’eau vive de Saint Clément dans les Hautes Alpes. Ce championnat était réservé aux meilleurs vétérans du classement national, les compétiteurs de 35 ans au plus âgé 77 ans se disputaient les titres de V1 à V5. Parmi eux d’anciens membres de l’équipe de France, qui ont fait la gloire du canoë kayak, comme le duo Adisson-Forgues champion olympique de canoë biplace en 1996, Benoit Peschier champion olympique de kayak en 2004, Philippe Quemerais champion du monde par équipe de canoë biplace en 2002, Jérôme Daille triple champion du monde par équipe de canoë biplace en 1987, 1989 et 1991… Lors de ces championnats, le Canoë Kayak CERN &am...
Directory of Open Access Journals (Sweden)
Carola Dewitz
2018-02-01
Full Text Available Motor neurons in the spinal cord are found grouped in nuclear structures termed pools, whose position is precisely orchestrated during development. Despite the emerging role of pool organization in the assembly of spinal circuits, little is known about the morphogenetic programs underlying the patterning of motor neuron subtypes. We applied three-dimensional analysis of motor neuron position to reveal the roles and contributions of cell adhesive function by inactivating N-cadherin, catenin, and afadin signaling. Our findings reveal that nuclear organization of motor neurons is dependent on inside-out positioning, orchestrated by N-cadherin, catenin, and afadin activities, controlling cell body layering on the medio-lateral axis. In addition to this lamination-like program, motor neurons undergo a secondary, independent phase of organization. This process results in segregation of motor neurons along the dorso-ventral axis of the spinal cord, does not require N-cadherin or afadin activity, and can proceed even when medio-lateral positioning is perturbed.
Dewitz, Carola; Pimpinella, Sofia; Hackel, Patrick; Akalin, Altuna; Jessell, Thomas M; Zampieri, Niccolò
2018-02-13
Motor neurons in the spinal cord are found grouped in nuclear structures termed pools, whose position is precisely orchestrated during development. Despite the emerging role of pool organization in the assembly of spinal circuits, little is known about the morphogenetic programs underlying the patterning of motor neuron subtypes. We applied three-dimensional analysis of motor neuron position to reveal the roles and contributions of cell adhesive function by inactivating N-cadherin, catenin, and afadin signaling. Our findings reveal that nuclear organization of motor neurons is dependent on inside-out positioning, orchestrated by N-cadherin, catenin, and afadin activities, controlling cell body layering on the medio-lateral axis. In addition to this lamination-like program, motor neurons undergo a secondary, independent phase of organization. This process results in segregation of motor neurons along the dorso-ventral axis of the spinal cord, does not require N-cadherin or afadin activity, and can proceed even when medio-lateral positioning is perturbed. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Canoë-kaxak club
2014-01-01
Voici quelques nouvelles de nos compétiteurs qui se sont illustrés lors des dernières compétitions organisées depuis la fin du mois d’août. Tout d’abord en slalom, les frères Jimmy et Tomy Ly en participant à la TRASS du 19 au 29 août, tournée Rhône Alpes Slalom sur les bassins d’Etrembières, Sault-Brenaz et Saint Pierre de Bœuf, ont pu prendre leurs marques pour ensuite aller performer avec le Canoë Club de Genève à la course nationale Suisse de Grenchen où ils ont obtenu les résultats suivants : Jimmy en minime 1er en kayak, 1er en Canoë biplace et 2ème en Canoë monoplace Tomy en cadet 1er en Canoë monoplace, 3ème en kayak et 3ème en Canoë biplace Je tiens à F&...
Canoe Journeys and Cultural Revival
Johansen, Bruce E.
2012-01-01
For the state of Washington's one-hundredth birthday, in 1989, Native peoples there decided to revive a distinctive mode of transportation--long-distance journeys by canoe--along with an entire culture associated with it. Born as the "Paddle to Seattle," during the past two decades these canoe journeys have become a summertime staple for…
Canoë-Kayak Club
2012-01-01
Mobilisation Initiatives Océanes. Pour la deuxième année consécutive, le Canoë Kayak CERN s’est mobilisé pour soutenir l’action de la fondation Surfrider en participant aux Initiatives Océanes qui se déroulent chaque année au début du printemps pour lutter contre les déchets qui polluent nos océans, plages, lacs et rivières. En 2011, cela représentait dans le monde 40’000 participants, 7’500 scolaires, 34 pays et plus de 950 nettoyages. Le Canoë kayak CERN a souhaité poursuivre l’action mené en 2011, de la Jonction (à Genève) jusqu’au Lignon, en continuant de nettoyer les berges du Rhône du Lignon jusqu’au port d’Aire-la-Ville et la plage de Peney, avec une équipe sur l'eau, en cano...
Dams and Obstructions along Iowa's Canoe Routes
Iowa State University GIS Support and Research Facility — This dataset represents obstruction to canoe and boat users of the canoe routes of Iowa. This may represent actual dams, rock dams (natural or man made), large...
Canoe-Kayak Club
2011-01-01
Higgs, antimatter, the Tour de France and white water After it was founded in 2007 the CERN canoe and kayak club has been expanding activities in many different aspects of water sports. Now in 2011 the club offers a wide range of activities to our members, including beginners training on flat water, dragonboating, Canadian style canoe/camping, white water slalom and river-running, flat water endurance paddling and “Eskimo roll” training in swimming pool. For the second year running the club organised a trip to the Haute-Alpes, renowned world wide for first class white water. Altogether 13 paddling enthusiasts travelled to L’Argentiere la Bessee, for a week of white water slalom, river running and other mountain sports. L’Argentiere, home to a world cup slalom course offers easy access the regions of Briancon, Guillestre and the Ubaye valley with their wide range of classic white water rivers. With little water from the snowmelt (due to the mild winter) and a long ...
Canoe-Kayak Club
2017-01-01
Avec le printemps le Canoë Kayak CERN lance le coup d’envoi de la saison 2017. Cette nouvelle saison a commencé de la plus belle des manières, par la cérémonie de la remise des clés du nouveau camion, mercredi 22 mars, au garage du Lac à Segny. Ce camion est le fruit d’un partenariat entre le club et le garage FORD pays de Gex à Segny, dans le but de promouvoir le Canoë kayak, le dragon boat et le stand up paddle dans le bassin Genevois, mais également de promouvoir l’image de la concession FORD dans le Pays de Gex. Ce Partenariat est né au printemps 2014 avec un premier camion qui vient d’être renouvelé pour une durée de 30mois. Il faut noté également que depuis la fin de l’année 2016 Ford Pays de Gex est membre d’Interfon proposant des remises sur certains...
Un canoéiste du CERN vice-champion de France V3
Canoe-Kayak Club
2016-01-01
Le monde du canoë-kayak slalom à rendez-vous depuis le 23 juillet à Bourg Saint Maurice pour une semaine de compétition pour disputer les championnats de France. Les hostilités ont commencé par les catégories masters qui comptent d’anciens membres de l’équipe de France et des grands noms qui ont fait la gloire du canoë kayak, comme le duo Adisson-Forgues champion olympique de canoë biplace en 1996, Philippe Quemerais double champion du monde de canoë biplace en 1999, 2002 et 5ème des jeux d’Athènes et des participants au passé plus modeste comme Olivier Barrière qui représentait le Canoë Kayak CERN en canoë monoplace ‘’C1’’ et en kayak ‘’K1’’ dans la catégorie homme V3 (45-50ans). A l&am...
Kayak Club
2014-01-01
Canoë Kayak CERN (CKC) Bon début de saison pour le Canoë Kayak CERN (CKC) qui a obtenu de bons résultats lors des deux dernières compétions auxquelles il a participé. Le 11 mai, lors du Festival de Dragon Boat de Divonne-les-Bains, organisé par l’association Kayak sans Frontières, l’équipe composée des membres du CKC et de DB2 Divonne a remporté une très belle 1ère place sur la distance de 200 m et une honorable 2ème place sur 1200 m juste derrière le Dojo-Gessien, ce qui lui a permis de finir à la 2ème place du classement général parmi les 16 équipages engagés. Ces résultats sont encourageants pour cette équipe récemment composée qui s’entraîne désormais ...
Why keep on paddling? Evidence from a South African canoe ...
African Journals Online (AJOL)
Despite the growth and potential future market for water-based recreation activities such as canoeing, to date research on the sport and its participants is sparse. Little is known about who canoeists are and why ... and product development decisions. Keywords: Canoe tourism, sport tourism, canoeist, motives, segmentation.
The CERN Canoe and Kayak Club has a swimming time
2008-01-01
The new Canoe and Kayak Club, which was formed at the start of the 2006 winter season, already has around twenty members, including some former top-level sportsmen. Catharine Noble, of the IT Department was ranked 13th overall in women’s British freestyle in 1997. Here she is performing a flat loop, a position that can be held for several seconds.Would you be interested in a spot of lunchtime canoeing or kayaking to break up a long working day? Or are you more of an evening sports enthusiast? The CERN Canoe and Kayak Club offers both options, as well as a choice of flat-water and white-water activities to suit all temperaments. With its calm waters and easy access for boats, the Peney nature reserve is ideal for beginners. Outings comprise a few exercises to acquire the techniques, as well as games to make the learning experience more fun and spontaneous. These waters are not only frequented by beginners, however, but also by thos...
Canoe: An Autonomous Infrastructure-Free Indoor Navigation System
Directory of Open Access Journals (Sweden)
Kai Dong
2017-04-01
Full Text Available The development of the Internet of Things (IoT has accelerated research in indoor navigation systems, a majority of which rely on adequate wireless signals and sources. Nonetheless, deploying such a system requires periodic site-survey, which is time consuming and labor intensive. To address this issue, in this paper we present Canoe, an indoor navigation system that considers shopping mall scenarios. In our system, we do not assume any prior knowledge, such as floor-plan or the shop locations, access point placement or power settings, historical RSS measurements or fingerprints, etc. Instead, Canoe requires only that the shop owners collect and publish RSS values at the entrances of their shops and can direct a consumer to any of these shops by comparing the observed RSS values. The locations of the consumers and the shops are estimated using maximum likelihood estimation. In doing this, the direction of the target shop relative to the current orientation of the consumer can be precisely computed, such that the direction that a consumer should move can be determined. We have conducted extensive simulations using a real-world dataset. Our experiments in a real shopping mall demonstrate that if 50% of the shops publish their RSS values, Canoe can precisely navigate a consumer within 30 s, with an error rate below 9%.
Directory of Open Access Journals (Sweden)
Bateman Alex
2009-09-01
Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication
2010-07-01
... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Navigation of aircraft within airspace reservation over the Boundary Waters Canoe Area Wilderness, Superior National Forest, Minnesota... Boundary Waters Canoe Area Wilderness, Superior National Forest, Minnesota. (a) Description of areas...
2012-11-16
... recreation and tourism, with minimal temporary negative impact on the ecosystem and the adjacent communities... Environmental Impact Statement and Feasibility Report for the Cano Martin Pena Ecosystem Restoration, San Juan... Environmental Impact Statement (DEIS) and Feasibility Report (FR) for the ecosystem restoration of the Cano...
Du, Jing; Guo, Shirong; Sun, Jin; Shu, Sheng
2018-05-01
The mechanism of exogenous Spd-induced Ca(NO 3 ) 2 stress tolerance in cucumber was studied by proteomics and physiological analyses. Protein-protein interaction network revealed 13 key proteins involved in Spd-induced Ca(NO 3 ) 2 stress resistance. Ca(NO 3 ) 2 stress is one of the major reasons for secondary salinization that limits cucumber plant development in greenhouse. The conferred protective role of exogenous Spd on cucumber in response to Ca(NO 3 ) 2 stress cues involves changes at the cellular and physiological levels. To investigate the molecular foundation of exogenous Spd in Ca(NO 3 ) 2 stress tolerance, a proteomic approach was performed in our work. After a 9 days period of Ca(NO 3 ) 2 stress and/or exogenous Spd, 71 differential protein spots were confidently identified. The resulting proteins were enriched in seven different categories of biological processes, including protein metabolism, carbohydrate and energy metabolism, ROS homeostasis and stress defense, cell wall related, transcription, others and unknown. Protein metabolism (31.2%), carbohydrate and energy metabolism (15.6%), ROS homeostasis and stress defense (32.5%) were the three largest functional categories in cucumber root and most of them were significantly increased by exogenous Spd. The Spd-responsive protein interaction network revealed 13 key proteins, whose accumulation changes could be critical for Spd-induced resistance; all 13 proteins were upregulated by Spd at transcriptional and protein levels in response to Ca(NO 3 ) 2 stress. Furthermore, accumulation of antioxidant enzymes, non-enzymatic antioxidant and polyamines, along with reduction of H 2 O 2 and MDA, were detected after exogenous Spd application during Ca(NO 3 ) 2 stress. The results of these proteomic and physiological analyses in cucumber root may facilitate a better understanding of the underlying mechanism of Ca(NO 3 ) 2 stress tolerance mediated by exogenous Spd.
The Goat Portage: Students' Stories and Learning from Canoe Trips.
Horwood, Bert
This study explores how high school students learn from their experiences in an extracurricular adventure program and illustrates how students' narrative inquiries relate to experiential learning. Twelve canoe trips were studied by participant observation methods. Data were collected from recorded interviews with students and staff, field notes,…
Craft's brand equity in CZ, focusing on canoeing
Šťastný, Šimon
2013-01-01
Title: Craft's brand equity in CZ, focusing on flat water canoeing. Objectives: The objective of this dissertation is to find out what is the Craft's brand equity and to suggest how to improve it on the Czech market. That would be based on marketing research and supplementary interview. I will be using marketing research and supplementary interview. Methods: In this dissertation the method of electronic questioning was used. The questionnaires were sent by email address after first contact on...
Shu, Sheng; Gao, Pan; Li, Lin; Yuan, Yinghui; Sun, Jin; Guo, Shirong
2016-01-01
With the aim to clarifying the role of the ABA/H2O2 signaling cascade in the regulating the antioxidant capacity of grafted cucumber plants in response to Ca(NO3)2 stress, we investigated the relationship between ABA-mediated H2O2 production and the activities of antioxidant enzymes in the leaves of pumpkin-grafted cucumber seedlings. The results showed that both ABA and H2O2 were detected in pumpkin-grafted cucumber seedlings in response to Ca(NO3)2 treatment within 0.5 h in the leaves and peaked at 3 and 6 h after Ca(NO3)2 treatment, respectively, compared to the levels under control conditions. The activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), and peroxidase (POD) in pumpkin-grafted cucumber leaves gradually increased over time and peaked at 12 h of Ca(NO3)2 stress. Furthermore, in the leaves of pumpkin-grafted cucumber seedlings, the H2O2 generation, the antioxidant enzyme activities and the expression of SOD, POD and cAPX were strongly blocked by an inhibitor of ABA under Ca(NO3)2 stress, but this effect was eliminated by the addition of exogenous ABA. Moreover, the activities and gene expressions of these antioxidant enzymes in pumpkin-grafted leaves were almost inhibited under Ca(NO3)2 stress by pretreatment with ROS scavengers. These results suggest that the pumpkin grafting-induced ABA accumulation mediated H2O2 generation, resulting in the induction of antioxidant defense systems in leaves exposed to Ca(NO3)2 stress in the ABA/H2O2 signaling pathway. PMID:27746808
High prevalence of asthma in Danish elite canoe- and kayak athletes
DEFF Research Database (Denmark)
Ulrik, Charlotte Suppli; Svenningsen, Claus
2012-01-01
Asthma is common in elite athletes, but our knowledge of asthma in elite canoe and kayak athletes is limited. The aim of the present prospective cross-sectional study was therefore to investigate the prevalence of asthma, including asthma-like symptoms, exhaled nitric oxide, and airway reactivity...
Finds in Belize document Late Classic Maya salt making and canoe transport
McKillop, Heather
2005-01-01
How did people in preIndustrial ancient civilizations produce and distribute bulk items, such as salt, needed for everyday use by their large urban populations? This report focuses on the ancient Maya who obtained quantities of salt at cities in the interior of the Yucatan peninsula of Mexico, Belize, and Guatemala in an area where salt is scarce. I report the discovery of 41 Late Classic Maya saltworks (anno Domini 600–900) in Punta Ycacos Lagoon on the south coast of Belize, including one with the first-known ancient Maya canoe paddle. The discoveries add important empirical information for evaluating the extent of surplus salt production and river transport during the height of Late Classic civilization in the southern Maya lowlands. The discovery of the saltworks indicates that there was extensive production and distribution of goods and resources outside the cities in the interior of the Yucatan. The discovery of a wooden canoe paddle from one of the Punta Ycacos saltworks, Ka'k' Naab', ties the production of salt to its inland transport by rivers and documents the importance of canoe trade between the coast and the interior during the Late Classic. Archaeological discovery of multiple saltworks on the Belizean coast represents surplus production of salt destined largely for the inland Peten Maya during their Late Classic peak, underscoring the importance of non-state-controlled workshop production in preIndustrial societies. PMID:15809426
All Aboard: Leading Change by Canoe, Sailboat, or Cruise Ship
Dereef, Marvin
2011-01-01
Anyone who wants to make a difference may face a wall of opposition that must be removed with little or no damage. The situation could be delicate, a balance of one's desire and others' resistance. In this article, the author discusses three approaches to leading change; (1) the canoe approach--a one-on-one method that is best used when change…
Prehispanic Dugout Canoes in Mexico: A Typology Based on a Multidisciplinary Approach
Biar, Alexandra
2017-12-01
Navigation implies a deep knowledge of the environment in which it is practised as well as the development of correlated technologies and techniques. In fact, sailing in lakes, rivers, along coasts or in high seas requires specific skills. This is why watercraft reflect the specific expertise of cultures in relation to the available resources and materials. Navigation as a means of movement and boats as modes of transportation is a well-documented topic in Europe, Asia and the Pacific Ocean, whether focusing on antiquity or the present. Nonetheless, in the New World, especially in Mesoamerica where the Aztec, Tarascan and Mayan Empires flourished, indigenous maritime history has been thoroughly under-investigated. This article explores the first prehispanic dugout canoes of the region, based on a multidisciplinary approach for the Mexico and Pátzcuaro Basins, in the Late Postclassic period (AD 1325-1521). For the first time, a typology of these dugout types is proposed, with a discussion of the importance of dugout canoes as a means of transportation in Mesoamerican civilizations, where wheels and draught animals did not exist.
Canoe Pedagogy and Colonial History: Exploring Contested Spaces of Outdoor Environmental Education
Newbery, Liz
2012-01-01
In this paper, I explore how histories of colonialism are integral to the Euro-Western idea of wilderness at the heart of much outdoor environmental education. In the context of canoe tripping, I speculate about why the politics of land rarely enters into teaching on the land. Finally, because learning from difficult knowledge often troubles the…
Xing, Wen-wen; Li, Lin; Gao, Pan; Li, He; Shao, Qiao-sai; Shu, Sheng; Sun, Jin; Guo, Shi-rong
2015-02-01
This study investigated the effects of grafting on the carbohydrate status and the enzymes of carbohydrate metabolism in self-grafted and grafted cucumber seedlings using the salt-tolerant pumpkin rootstock 'Qingzhen 1' (Cucurbita maxima × Cucurbita moschata) under 80 mM Ca(NO3)2 stress for 6 d. The growth of self-grafted seedlings was significantly inhibited after the treatment of Ca(NO3)2 stress, whereas the inhibition of growth was alleviated in pumpkin rootstock-grafted seedlings. Ca(NO3)2 stress increased the contents of the total soluble sugar, sucrose and fructose, but decreased the starch content in rootstock-grafted leaves. However, compared with self-grafted plants, rootstock-grafted seedlings were observed with a higher content of sucrose and total soluble sugar (TSS) under salt stress. Rootstock-grafted seedlings exhibited higher activities of acid invertase (AI), neutral invertase (NI) and phosphate sucrose synthase (SPS) of sucrose metabolism in leaves than that of self-grafted seedlings under salinity. Moreover, the activities of fructokinase (FK), hexokinase (HK), phosphofructokinase (PFK) and pyruvate kinase (PK) of glycolysis were maintained at a higher level in leaves of rootstock-grafted seedlings after Ca(NO3)2 stress. Additionally, rootstock-grafting decrease the high percentage enhancement of key enzymes gene expression in glycolysis in the scion leaves of cucumber seedlings induced by salt stress. These results suggest that the rootstock-grafting improved salt tolerance, which might play a role in elevated sucrose metabolism and a glycolytic pathway regulated by the pumpkin rootstock. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Messias, Leonardo H D; Ferrari, Homero G; Reis, Ivan G M; Scariot, Pedro P M; Manchado-Gobatto, Fúlvia B
2015-03-01
The purpose of this study was to analyze if different combinations of trials as well as mathematical models can modify the aerobic and anaerobic estimates from critical velocity protocol applied in canoe slalom. Fourteen male elite slalom kayakers from Brazilian canoe slalom team (K1) were evaluated. Athletes were submitted to four predictive trials of 150, 300, 450 and 600 meters in a lake and the time to complete each trial was recorded. Critical velocity (CV-aerobic parameter) and anaerobic paddling capacity (APC-anaerobic parameter) were obtained by three mathematical models (Linear1=distance-time; Linear 2=velocity-1/time and Non-Linear = time-velocity). Linear 1 was chosen for comparison of predictive trials combinations. Standard combination (SC) was considered as the four trials (150, 300, 450 and 600 m). High fits of regression were obtained from all mathematical models (range - R² = 0.96-1.00). Repeated measures ANOVA pointed out differences of all mathematical models for CV (p = 0.006) and APC (p = 0.016) as well as R² (p = 0.033). Estimates obtained from the first (1) and the fourth (4) predictive trials (150 m = lowest; and 600 m = highest, respectively) were similar and highly correlated (r=0.98 for CV and r = 0.96 for APC) with the SC. In summary, methodological aspects must be considered in critical velocity application in canoe slalom, since different combinations of trials as well as mathematical models resulted in different aerobic and anaerobic estimates. Key pointsGreat attention must be given for methodological concerns regarding critical velocity protocol applied on canoe slalom, since different estimates were obtained depending on the mathematical model and the predictive trials used.Linear 1 showed the best fits of regression. Furthermore, to the best of our knowledge and considering practical applications, this model is the easiest one to calculate the estimates from critical velocity protocol. Considering this, the abyss between science
Specific characteristics of physical fitness at work anaerobic endurance type of rowers in canoe
Directory of Open Access Journals (Sweden)
Penchen Guo
2014-12-01
Full Text Available Purpose: to determine the effect of the reactive properties cardiorespiratory system to a special performance by canoe paddlers who specialize in the 200 m. Material : The study involved 22 paddler aged 18 - 29 years. Results : there were significant indicators of the reaction due to pulmonary performance and efficiency of anaerobic metabolism. The range of correlation coefficients (r was -0.54 - 0.77 (T 50 V E and 0,55-0,71 (V E. Conclusions : It was found that the optimization of the reactive properties of the cardiorespiratory system to realize the potential impact endurance rowers when using anaerobic nature. The greatest number of significant connections were indicators of efficiency and response of pulmonary ventilation. This allowed the evaluation of the functional improve information security work and increase specialized training sessions focus in the development of anaerobic endurance while working character in canoeing.
Conformance Testing of SGSF-064-1 Using CANoe
Directory of Open Access Journals (Sweden)
Intaek Kim
2015-11-01
Full Text Available In this paper, the authors describe a conformance testing system for SGSF-064-1, the communication protocol between electric vehicles and conductive DC (direct current chargers in Korea. Since the SGSF-064-1 is based on CAN (controller area network, the testing system was developed by CANoe. The DC charger known as EVSE (electric vehicle supply equipment is the system being tested and the developed system implemented in PC (personal computer. The developed system performs as a tester to ensure that the DC chargers from various manufactures can conform to the communication protocol in SGSF-064-1. The testing system contains four testing modes which also consist of several test cases.
Boundary Waters Canoe Area Wilderness - A long history of management guided by science
David Cole
2016-01-01
The Boundary Waters Canoe Area Wilderness (BWCAW) in northern Minnesota is one of the most iconic and cherished wilderness areas in the United States. One of the original wilderness areas established in 1964, the BWCAW protects a glaciated landscape of about 1,175 lakes, connected by several hundred miles of streams. Located adjacent to Canada's Quetico Provincial...
Electrokinetic removal of Ca(NO3)2 from bricks to avoid salt induced decay
DEFF Research Database (Denmark)
Ottosen, Lisbeth M.; Rörig-Dalgaard, Inge
2007-01-01
Salt-induced decay of masonry is a serious threat to our cultural heritage. In buildings near agricultural land or stables the masonry may suffer seriously from salt-induced decay from nitrates. It was investigated in laboratory scale with a single brick if Ca(NO$-3$/) $-2$/ could be removed by e...
Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved
Directory of Open Access Journals (Sweden)
Manasi S. Apte
2012-01-01
Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.
2010-07-01
... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Special provisions governing the Boundary Waters Canoe Area Wilderness, Superior National Forest, Minnesota. 293.16 Section 293.16 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE WILDERNESS-PRIMITIVE AREAS...
Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved
Apte, Manasi S.; Meller, Victoria H.
2011-01-01
Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...
Gyan P. Nyaupane; Duarte B. Morais; Alan Graefe
2003-01-01
The purpose of this study was to compare leisure constraints across three outdoor recreation activities, whitewater rafting, canoeing, and overnight horseback riding, in the context of the three-dimensional leisure constraints model proposed by Crawford and Godbey (1987). The sample consisted of 650 outdoor enthusiasts from 14 U.S. states who showed an interest in...
Training loads of female canoeing youth national team in sprint competitions
Directory of Open Access Journals (Sweden)
Cieslicka Miroslawa.
2012-12-01
Full Text Available Introduction Long-term training process need precise, scientific management, based on recognition indicators of fitness preparation, technical, mental health status of the player. Control is treated as a collection of information allowing to organize rational technological solution. Verification should provide high reliability and information of the test results, what is achieved by standardizing test conditions, sets of samples used in any of the disciplines and measurement techniques. Objective The objective was to calculate the training loads of female canoeing youth national team (sprint. In addition, attempts to answer the following questions: What was the structure of the annual training plans and whether it is consistent with the theory of training canoeist?; What was the pace and direction of changes in the volume of work within each group of training? Materials and methods The study used records of logs implementation training loads what competitors have done in the years 2009 to 2010. The analysis included data on training loads and boot. The loads presented as the number of kilometers completed during each season training and during each period of the season and in arbitrary units. Results and conclusions Based on the collected material research analysed training of female canoeing youth national team both in terms of its subject, as well as temporary structures. Every aspect of fitness requires adequate time, necessary to make adaptive changes. Therefore, it is necessary to vary the time required for development. Comparing the training load can be seen that in 2009 competitors have done more work in the run-up than in 2010, but much smaller loads can be seen in 2009 during start season comparing the training load during startup in 2010.
Monolayer structures of alkyl aldehydes: Odd-membered homologues
International Nuclear Information System (INIS)
Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.
2011-01-01
Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.
Vicente Salvador Gómez, Alonso Cano y la pintura valenciana de la segunda mitad del siglo XVII
Directory of Open Access Journals (Sweden)
Salort Pons, Salvador
2001-12-01
Full Text Available In the following pages, we study different unpublished documentation on the saga of valencian painters of last name Salvador. It is, fundamentally, the last will and inventory of goods of Vicente Salvador Gómez,' the contract that he carried out with the Convent of Santo Domingo of Valencia, for the realisation of three paintings on San Vicente's Ferrer life, and other notarial texts related with him, his father Pere and his brother Luciano that will allow us to better understand the biography and the pictorial work of this family of artists. In addition, the fact of having located the one mentioned inventory, dated after the purchase that Vicente Salvador made of the belongings left by Alonso Cano in the Chartreuse of Portacoeli of Valencia, will give us the opportunity to know, in some measure, the goods that Cano possessed in 1645, arnong them his library that, for the first time, it is published. Finally, with the study of several of Vicente's Salvador drawings we will be able to determine some og his labour bonds with the Madrid nobility, as well as to support the theory of his possible trip to Italy.
No disponible
Nuevos dibujos de Alonso Cano y su círculo
Directory of Open Access Journals (Sweden)
Navarrete Prieto, Benito
2001-12-01
Full Text Available No es fácil abordar el estudio de los dibujos de Alonso Cano. Su versatilidad, su dominio y aplicación en las diferentes técnicas y sobre todo las obras de su círculo más inmediato y de seguidores y copistas dificultan en grado extremo la catalogación correcta de sus diseños, algo imprescindible para poder conocer en profundidad la obra y el alcance de la pintura del artista granadino, así como su forma de trabajo, que ejemplifica sin lugar a dudas las preocupaciones de un hombre culto, formado en un ambiente intelectual y erudito y sobre todo con un bagaje cultural amplio según se deduce de su biblioteca comprada por Vicente Salvador Gómez en 1673 y que se publica en este mismo número de Archivo.…
The Mycobacterium tuberculosis homologue of the Mycobacterium ...
African Journals Online (AJOL)
With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...
de Frutos Sastre, Leticia M.
2003-01-01
A pesar de los nuevos datos que están siendo publicados, y de la considerable importancia de la etapa madrileña de Alonso Cano, aún son muchas las dudas en torno a la actividad del granadino en la Corte. José Manuel Cruz Valdovinos ya recalcó la importancia de la figura del conde-duque de Olivares, gracias a la cual, Cano entraría en contacto con un importante círculo de funcionarios al servicio de la Corona. Poco a poco se ha ido conociendo y documentando la existencia de una clientela del a...
Detection of a Yersinia pestis gene homologue in rodent samples
Directory of Open Access Journals (Sweden)
Timothy A. Giles
2016-08-01
Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.
Alan E. Watson; Ann Schwaller; Robert Dvorak; Neal Christensen; William T. Borrie
2013-01-01
The Boundary Waters Canoe Area Wilderness (BWCAW) in northern Minnesota has a rich history of advocacy for protection as wilderness. In the 1950s, Sigurd Olsen best described the song of the wilderness in Minnesota's north country: "I have heard the singing in many places, but I seem to hear it best in the wilderness lake country of the Quetico-Superior,...
Ho-Lastimosa, Ilima; Hwang, Phoebe W; Lastimosa, Bob
2014-01-01
Historical trauma occurs across generations and is evidenced by indigenous disparities. Efforts made to address this issue commonly utilize European ethnocentric methods. Rather, a community-based approach should be used to empower indigenous communities. God's Country Waimanalo (GCW) is a grassroots organization developed by Native Hawaiians for Native Hawaiians. Its wa‘a (canoe) project, Ho‘omana‘o Mau (everlasting memories; abbreviated Ho‘o) is meant to perpetuate pre-colonial Hawaiian pra...
Li, Lin; Shu, Sheng; Xu, Qing; An, Ya-Hong; Sun, Jin; Guo, Shi-Rong
2017-05-01
Nitric oxide (NO) and hydrogen peroxide (H 2 O 2 ), two important signaling molecules, are stimulated in plants by abiotic stresses. In this study, we investigated the role of NO and its interplay with H 2 O 2 in the response of self-grafted (S-G) and salt-tolerant pumpkin-grafted (Cucurbita maxima × C. moschata) cucumber seedlings to 80 mM Ca(NO 3 ) 2 stress. Endogenous NO and H 2 O 2 production in S-G seedlings increased in a time-dependent manner, reaching maximum levels after 24 h of Ca(NO 3 ) 2 stress. In contrast, a transient increase in NO production, accompanied by H 2 O 2 accumulation, was observed at 2 h in rootstock-grafted plants. N w -Nitro-l-Arg methyl ester hydrochloride (l-NAME), an inhibitor of nitric oxide synthase (NOS), tungstate, an inhibitor of nitrate reductase (NR), and 2-(4-carboxyphenyl)-4,4,5,5-tetramethy-limidazoline-1-oxyl-3-oxide (cPTIO), a scavenger of NO, were found to significantly inhibit NO accumulation induced by salt stress in rootstock-grafted seedlings. H 2 O 2 production was unaffected by these stress conditions. Ca(NO 3 ) 2 stress-induced NO accumulation was blocked by pretreatment with an H 2 O 2 scavenger (dimethylthiourea, DMTU) and an inhibitor of NADPH oxidase (diphenyleneiodonium, DPI). In addition, maximum quantum yield of PSII (Fv/Fm), as well as the activities and transcript levels of antioxidant enzymes, were significantly decreased by salt stress in rootstock grafted seedlings after pretreatment with these above inhibitors; antioxidant enzyme transcript levels and activities were higher in rootstock-grafted seedlings compared with S-G seedlings. These results suggest that rootstock grafting could alleviate the oxidative damage induced by Ca(NO 3 ) 2 stress in cucumber seedlings, an effect that may be attributable to the involvement of NO in H 2 O 2 -dependent antioxidative metabolism. © 2016 Scandinavian Plant Physiology Society.
Phosphatase and tensin homologue deleted on chromosome 10 ...
African Journals Online (AJOL)
Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...
2013-03-29
...-AA00 Safety Zone; Spanish Navy School Ship San Sebastian El Cano Escort; Bahia de San Juan; San Juan... temporary moving safety zone on the waters of Bahia de San Juan during the transit of the Spanish Navy... Channel entrance, and to protect the high ranking officials on board the Spanish Navy School Ship San...
Lee, Myung Mo; Lee, Kyeong Jin; Song, Chang Ho
2018-04-27
BACKGROUND Virtual reality (VR) training with motion-controlled console games can be incorporated into stroke rehabilitation programs. The use of a variety of gaming software can provide the patient with an opportunity to perform activities that are exciting, entertaining, and that may not be feasible in clinical environments. The aim of this preliminary randomized controlled study was to investigate the effects of game-based VR canoe paddling training, when combined with conventional physical rehabilitation programs, on postural balance and upper extremity function in 30 patients with subacute stroke. MATERIAL AND METHODS Thirty patients, who were within six months following the diagnosis of stroke, were randomly allocated to either the experimental group (n=15) or the control group (n=15). All participants participated in a conventional rehabilitation program. Also, the experimental group (n=15) performed the VR canoe paddling training for 30 minutes each day, three times per week, for five weeks. After five weeks, outcomes of changes in postural balance and upper extremity function were evaluated and compared between the two groups. RESULTS At five weeks, postural balance and upper extremity function showed significant improvements in both patients groups when compared with the baseline measurements (pGame-based VR canoe paddling training is an effective rehabilitation therapy that enhances postural balance and upper extremity function in patients with subacute stroke when combined with conventional physical rehabilitation programs.
Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)
International Nuclear Information System (INIS)
Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo
2006-01-01
The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system
Los límites artísticos en los ensayos sobre arte y estética de Baldomero Sanín Cano
Directory of Open Access Journals (Sweden)
Efrén Giraldo
2015-12-01
Full Text Available La obra del ensayista y crítico colombiano Baldomero Sanín Cano ha despertado recientemente el interés académico, a causa de su participación en las discusiones estéticas y literarias de Colombia y América Latina. Pese a esto, se carece de trabajos que valoren su aporte a la discusión sobre expresiones plásticas y visuales en Colombia. Este texto se ocupa de uno de los temas recurrentes de su trabajo: las diferencias entre las artes y, más específicamente, entre las artes de la imagen y de la palabra. Se revisa el estado de la discusión en torno a los textos de Sanín Cano que se ocuparon de artes visuales y estética. Por último, se consideran algunos de ellos y se postula una hipótesis sobre el papel que el parangón entre pintura y poesía tiene en sus ideas sobre la taxonomía de las artes.
Directory of Open Access Journals (Sweden)
Zhirnov A.V.
2011-07-01
Full Text Available In the article information of expert estimation of different types of preparation is presented in boating. On the basis of analysis of literary sources the structure of the sporting training is certain. Principles of application of quantitative methods of estimation of quality are considered in sport. The most priority types of sporting preparation are exposed in different disciplines of rowing. On the basis of opinions of experts the comparative analysis of influence on the sporting result of different types of preparation is conducted in a boat-racing and rowing on kayaks and canoe.
Directory of Open Access Journals (Sweden)
Anne Rutherford
2011-10-01
Full Text Available This article explores the genesis of the film Ten Canoes in the photographs taken by anthropologist Donald Thomson, in Arnhem Land, in the 1930s. Thomson’s images profoundly informed the look and content of the film, and the paper traces this genealogy in order to identify a ‘cultural imaginary’ at work in the film. I argue that a close study of Thomson’s original photographs reveals an approach to photography and to culture that dramatically exceeds the boundaries of the detached anthropological/scientific gaze. Thomson’s vision is a highly tactile one. His images are as much an encounter with the light of the world as they are a document of a time, an environment and a culture; his lens is as much an organ of touch as an instrument of observation. In a remarkable example of what Tim Ingold has called ‘animate thought’, Thomson uses the materiality of photography to make manifest a life-world in which reeds, water and sky are as animate as human figures. Not easily accessible to established criteria for analysing ethnographic images, such as questions of self-reflexivity, Thomson’s polycentric images profoundly challenge the humanist assumptions of many contemporary approaches to reading images. This insight raises new questions about both ethnographic photography and the relationship between the photographs and Ten Canoes.
Isolation and characterization of an AGAMOUS homologue from cocoa
Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.
2006-01-01
We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that
The actin homologue MreB organizes the bacterial cell membrane
Strahl, H.; Burmann, F.; Hamoen, L.W.
2014-01-01
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate
Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.
Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross
2002-12-01
The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.
Characterization and cloning of TMV resistance gene N homologues ...
African Journals Online (AJOL)
Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...
Directory of Open Access Journals (Sweden)
de Frutos Sastre, Leticia M.
2003-09-01
Full Text Available A pesar de los nuevos datos que están siendo publicados, y de la considerable importancia de la etapa madrileña de Alonso Cano, aún son muchas las dudas en torno a la actividad del granadino en la Corte. José Manuel Cruz Valdovinos ya recalcó la importancia de la figura del conde-duque de Olivares, gracias a la cual, Cano entraría en contacto con un importante círculo de funcionarios al servicio de la Corona. Poco a poco se ha ido conociendo y documentando la existencia de una clientela del artista dentro de ese grupo, con personajes tan relacionados con el Valido como José González, abogado particular del propio Conde-Duque; Sebastián Vicente, tesorero del Buen Retiro; José de Cisneros, pagador general de Galeras; Juan de Vallecas, escribano mayor de Millones...
The great canoes in the sky starlore and astronomy of the South Pacific
Chadwick, Stephen Robert
2017-01-01
Presenting spectacular photographs of astronomical objects of the southern sky, all taken by author Stephen Chadwick, this book explores what peoples of the South Pacific see when they look up at the heavens and what they have done with this knowledge. From wives killing brothers to emus rising out of the desert and great canoes in the sky, this book offers the perfect blend of science, tradition and mythology to bring to life the most famous sights in the heavens above the southern hemisphere. The authors place this starlore in the context of contemporary understandings of astronomy. The night sky of southern societies is as rich in culture as it is in stars. Stories, myths and legends based on constellations, heavenly bodies and other night sky phenomena have played a fundamental role in shaping the culture of pre-modern civilizations throughout the world. Such starlore continues to influence societies throughout the Pacific to this day, with cultures throughout the region – from Australia and New Zealand...
DEFF Research Database (Denmark)
Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D
2011-01-01
The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...
International Nuclear Information System (INIS)
Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo
2012-01-01
A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution
Energy Technology Data Exchange (ETDEWEB)
Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)
2012-08-31
A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.
Alonso Cano, diseñador. Aproximación contemporánea a un artista del Barroco
Directory of Open Access Journals (Sweden)
Emilio Ángel Villanueva Muñoz
2009-12-01
Full Text Available Este trabajo no pretende agregar una faceta más a la clásica trilogía profesional de Alonso Cano pintor, escultor y arquitecto, sino interpretar su producción artística desde la perspectiva contemporánea del diseñador, lo que contribuye a comprender su polémica obra arquitectónica, conectarla con su actividad en los campos afines de la retablística y la decoración, y subrayar, desde este enfoque, la importancia de sus dibujos arquitectónicos. Una perspectiva que además da sentido a otros aspectos puntuales como su logotipo personal y las incursiones en el ámbito del grabado, pudiendo, incluso, arrojar luz sobre su aptitud ante la escultura y la pintura.
Cloning and characterization of maize ZmSPK1, a homologue to ...
African Journals Online (AJOL)
hope&shola
2006-03-15
Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.
Linthorst, K; Bauer, U; Osipov, I; Pinheiro, P; Rehder, M
2015-09-01
Children of parents who suffer from mental health disorders are more likely to develop mental disorders than children of parents not suffering from mental disorders. For children at risk, preventive strategies are hardly available and, if available, rarely supported by a scientific evaluation. "Kanu - Gemeinsam weiterkommen (canoe - moving jointly forward)" is a preventive strategy that was developed within a research project focusing on primary prevention in children who live in families with parents affected by mental disorders. The intervention is characterised by a multi-modular concept and was tested in the adult psychiatric setting. Preliminary results indicate a preventive impact of the intervention programme. © Georg Thieme Verlag KG Stuttgart · New York.
From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions
DEFF Research Database (Denmark)
van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.
2017-01-01
, but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...
Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas
Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu
2017-01-01
Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036
Behaviour of the homologues of Rf and Db in complexing media
International Nuclear Information System (INIS)
Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.
1999-01-01
In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)
The actin homologue MreB organizes the bacterial cell membrane
Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.
2014-01-01
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...
Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M
2007-01-01
Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...
Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.
2010-01-01
Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083
DEFF Research Database (Denmark)
Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj
2009-01-01
hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....
Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.
2004-01-01
Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1
Structural studies on a non-toxic homologue of type II RIPs from ...
Indian Academy of Sciences (India)
Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...
Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.
1994-01-01
The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...
Casieri, Cinzia; Terenzi, Camilla; De Luca, Francesco
2015-01-01
NMR transverse relaxation time (T(2)) distribution of (1)H nuclei of water has been used to monitor the moisture condensation kinetics in Ca(NO(3))(2) · (4)H(2)O-polluted Lecce stone, a calcareous stone with highly regular porous structure often utilized as basic material in Baroque buildings. Polluted samples have been exposed to water vapor adsorption at controlled relative humidity to mimic environmental conditions. In presence of pollutants, the T(2) distributions of water in stone exhibit a range of relaxation time values and amplitudes not observed in the unpolluted case. These characteristics could be exploited for in situ noninvasive detection of salt pollution in Lecce stone or as damage precursors in architectural buildings of cultural heritage interest. Copyright © 2014 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.
1997-01-01
Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)
Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue
DEFF Research Database (Denmark)
Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard
2006-01-01
A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...
Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.
Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng
2012-10-18
Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.
Macías Cardona, Hugo
2013-01-01
En el mes de febrero de 2013, Ediciones de la U publicó el libro Contabilidad gerencial y presupuestaria, escrito por el profesor Abel Cano Morales, de la Universidad de Medellín. El libro es novedoso desde su título, ya que hace referencia a la contabilidad gerencial y no a la contabilidad de gestión, administrativa o de costos, como lo hacen varios libros de texto que circulan de tiempo atrás en Colombia. El cambio en la denominación es intencional y tiene un sentido profundo que se present...
Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael
2006-08-15
Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).
The role of the leukemia-associated ETO homologue repressors in hematopoiesis
Olsson, André
2006-01-01
The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...
International Nuclear Information System (INIS)
Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.
2009-01-01
Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex
Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.
Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D
1995-11-01
We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.
Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto
2015-10-14
The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.
Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.
Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain
2015-03-01
NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.
Is the Prosthetic Homologue Necessary for Embodiment?
Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael
2016-01-01
Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.
Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.
Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji
2015-08-01
Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.
Hermes, Fatemah A; Cronan, John E
2013-10-01
The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee
2013-09-15
Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.
A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue
Spassieva, S; Hille, J
Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed
Directory of Open Access Journals (Sweden)
M Hagner-Derengowska
2015-01-01
Full Text Available The somatic build, biological age, general state of health, mental predisposition and physical fitness are the criteria for selection of individuals in competitive sport. The present study aims to analys the differences in body structure and composition of canoeists and kayakers and derive conclusions regarding the criteria for selection of individuals incompetitive sport. The research was conducted on a group of 32 men aged between 17 and 22: 16 kayakers and 16 Canadian canoeists of the junior and teenage Polish national canoeing team. Body composition was examined by means of bioelectrical segmental impedance. Body build type was determined using the anthropometric Heath-Carter method. Statistical analysis was performed using the Welch t-test. The examination of morphological features reveals significant differences in the studied parameters between the canoeists and kayakers. There are also significant differences between competitors of the Sydney 2000 Olympic Games and the studied group. We found that competitive kayakers should be taller than canoeists. The lower part of the body in kayakers is more developed than in canoeists and canoeists are more dehydrated than kayakers.
Hagner-Derengowska, M; Hagner, W; Zubrzycki, Iz; Krakowiak, H; Słomko, W; Dzierżanowski, M; Rakowski, A; Wiącek-Zubrzycka, M
2014-12-01
The somatic build, biological age, general state of health, mental predisposition and physical fitness are the criteria for selection of individuals in competitive sport. The present study aims to analys the differences in body structure and composition of canoeists and kayakers and derive conclusions regarding the criteria for selection of individuals incompetitive sport. The research was conducted on a group of 32 men aged between 17 and 22: 16 kayakers and 16 Canadian canoeists of the junior and teenage Polish national canoeing team. Body composition was examined by means of bioelectrical segmental impedance. Body build type was determined using the anthropometric Heath-Carter method. Statistical analysis was performed using the Welch t-test. The examination of morphological features reveals significant differences in the studied parameters between the canoeists and kayakers. There are also significant differences between competitors of the Sydney 2000 Olympic Games and the studied group. We found that competitive kayakers should be taller than canoeists. The lower part of the body in kayakers is more developed than in canoeists and canoeists are more dehydrated than kayakers.
Directory of Open Access Journals (Sweden)
Jianrao HU, Mingfu CAO, Jiong Chen
2009-10-01
Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].
El San José de Cano y Mena y la abadesa del convento del Ángel Custodio de Granada
Directory of Open Access Journals (Sweden)
García Cueto, David
2003-03-01
Full Text Available Los trabajos de Alonso Cano para la Catedral de Granada, iniciados tras conseguir por mediación regia el cargo de Racionero de ese templo, fueron compaginados por el artista con la realización de encargos de distintos conventos de la misma ciudad; entre éstos, fue el del Ángel Custodio el que más atenciones recibió por parte del maestro, ya que para él diseñó su arquitectura y realizó buena parte de su decoración pictórica y escultórica. Estas obras fueron emprendidas y financiadas por Sor María de Llagas, hija de los marqueses de Camarasa, fundadora y abadesa del Ángel Custodio, quien así cumplió un deseo de su padre, ya que el marqués estimaba que su hija era dama de muy alta posición como para ser religiosa en una fundación ajena…
Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.
Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas
2015-01-01
ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...
Directory of Open Access Journals (Sweden)
Bart eGeurten
2012-03-01
Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.
International Nuclear Information System (INIS)
Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.
1997-01-01
Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)
Xu, F; Liang, X; Lin, B; Su, F
1999-03-01
Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.
Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan
2015-12-01
Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.
Coelomycetous Dothideomycetes with emphasis on the families Cucurbitariaceae and Didymellaceae
Directory of Open Access Journals (Sweden)
N. Valenzuela-Lopez
2018-06-01
Full Text Available The taxonomy of the coelomycetes has undergone dramatic changes in recent years, but remains controversial due to the high number of taxa involved, their poor morphological differentiation, the rare occurrence of the sexual morphs, and rapid loss of fertility in vitro. In the present study, we revisited the families Cucurbitariaceae and Didymellaceae (Pleosporales, Dothideomycetes, which include numerous plant pathogens, endophytic species associated with a wide host range, and saprobes. The taxonomy of two of the most relevant genera, i.e. Phoma and Pyrenochaeta, remains ambiguous after several phylogenetic studies, and needs further revision. We have studied a total of 143 strains of coelomycetes from clinical or environmental origin, by combining the LSU, ITS, tub2 and rpb2 sequences for a multi-locus analysis and a detailed morphological comparison. The resulting phylogenetic tree revealed that some fungi previously considered as members of Cucurbitariaceae represented five different families, and four of them, Neopyrenochaetaceae, Parapyrenochaetaceae, Pseudopyrenochaetaceae and Pyrenochaetopsidaceae, are proposed here as new. Furthermore, 13 new genera, 28 new species, and 20 new combinations are proposed within the Pleosporineae. Moreover, four new typifications are introduced to stabilise the taxonomy of these fungi. Key words: Cucurbitariaceae, Didymellaceae, Multigene phylogeny, New taxa, Phoma, Pleosporineae, Pleosporales, Pyrenochaeta, Pyrenochaetopsis, Taxonomy, Taxonomic novelties: New families: Neopyrenochaetaceae Valenzuela-Lopez, Crous, Cano, Guarro & Stchigel, Parapyrenochaetaceae Valenzuela-Lopez, Crous, Stchigel, Guarro & Cano, Pseudopyrenochaetaceae Valenzuela-Lopez, Crous, Stchigel, Guarro & Cano, Pyrenochaetopsidaceae Valenzuela-Lopez, Crous, Cano, Guarro & Stchigel, New genera: Allocucurbitaria Valenzuela-Lopez, Stchigel, Guarro & Cano, Cumuliphoma Valenzuela-Lopez, Stchigel, Crous, Guarro & Cano, Ectophoma Valenzuela
The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...
Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma
Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev
2012-01-01
Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205
Directory of Open Access Journals (Sweden)
Moore Landon L
2008-02-01
Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.
Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.
2002-01-01
In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial
Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P
2004-01-01
A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in
International Nuclear Information System (INIS)
Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.
1993-01-01
Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined
The actin homologue MreB organizes the bacterial cell membrane.
Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W
2014-03-07
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.
Directory of Open Access Journals (Sweden)
Grauman Peter L
2007-07-01
Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.
Nilsson, G.; Svensson, G.
2001-01-01
Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.
Directory of Open Access Journals (Sweden)
Rebecca M. Sealey
2011-03-01
Full Text Available This study aimed to identify the effect of different stroke rates on various kinematic parameters during 1000 m outrigger canoeing. Sixteen, experienced female outrigger canoeists completed three 1000 m outrigger ergometer time trials, one trial each using a self-selected, a Hawaiian ( 65 strokes·min-1 stroke rate. Stroke rate, stroke length, stroke time, proportion of time spent in propulsion and recovery, torso flexion angle and 'twist' were measured and compared with repeated measures ANOVAs. Stroke rate, stroke length and stroke time were significantly different across all interventions (p < 0.05 despite no difference in the percentage of time spent in the propulsive and recovery phases of the stroke. Stroke length and stroke time were negatively correlated to stroke rate for all interventions (r = -0.79 and -0.99, respectively. Female outrigger canoeists maintain consistent stroke kinematics throughout a 1000 m time trial, most likely as a learned skill to maximize crew paddling synchrony when paddling on-water. While the Hawaiian stroke rate resulted in the greatest trunk flexion movement and 'twist' action, this potential increased back injury risk may be offset by the slow stroke rate and long stroke length and hence slow rate of force development.
Isolation of a cotton NADP(H oxidase homologue induced by drought stress
Directory of Open Access Journals (Sweden)
NEPOMUCENO ALEXANDRE LIMA
2000-01-01
Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.
Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin
2017-01-01
Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.
García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A
2011-08-01
Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs
Energy Technology Data Exchange (ETDEWEB)
Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)
2012-08-21
DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.
Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus
DEFF Research Database (Denmark)
Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt
2010-01-01
The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...
Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I
2001-08-01
The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...
Herpes simplex virus glycoprotein D relocates nectin-1 from intercellular contacts.
Bhargava, Arjun K; Rothlauf, Paul W; Krummenacher, Claude
2016-12-01
Herpes simplex virus (HSV) uses the cell adhesion molecule nectin-1 as a receptor to enter neurons and epithelial cells. The viral glycoprotein D (gD) is used as a non-canonical ligand for nectin-1. The gD binding site on nectin-1 overlaps with a functional adhesive site involved in nectin-nectin homophilic trans-interaction. Consequently, when nectin-1 is engaged with a cellular ligand at cell junctions, the gD binding site is occupied. Here we report that HSV gD is able to disrupt intercellular homophilic trans-interaction of nectin-1 and induce a rapid redistribution of nectin-1 from cell junctions. This movement does not require the receptor's interaction with the actin-binding adaptor afadin. Interaction of nectin-1 with afadin is also dispensable for virion surfing along nectin-1-rich filopodia. Cells seeded on gD-coated surfaces also fail to accumulate nectin-1 at cell contact. These data indicate that HSV gD affects nectin-1 locally through direct interaction and more globally through signaling. Copyright © 2016 Elsevier Inc. All rights reserved.
Signaling through the PI 3-K, Akt and SGK Pathway in Breast Cancer Progression
2013-12-01
Moritz A, Li Y, Guo A, Villen J, Wang Y, MacNeill J, et al. Akt-RSK-S6 Kinase 552 Signaling Networks Activated by Oncogenic Receptor Tyrosine Kinases. Sci...polarity by afadin during the formation of embryoid bodies. Genes Cells. 2008;13:79– 570 90. 571 23. Su L, Hattori M, Moriyama M, Murata N, Harazaki M
The urokinase receptor and its structural homologue C4.4A in human cancer
DEFF Research Database (Denmark)
Jacobsen, B; Ploug, M
2008-01-01
The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...
Directory of Open Access Journals (Sweden)
Phelan Anne
2007-06-01
Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.
Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4
International Nuclear Information System (INIS)
Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko
2004-01-01
To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family
Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves
Energy Technology Data Exchange (ETDEWEB)
Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson
2011-12-31
The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.
A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein
Wang, W.; Takezawa, D.; Poovaiah, B. W.
1996-01-01
A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.
Górnaś, Paweł
2015-04-01
The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.
Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A
2003-05-01
Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.
Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA
Directory of Open Access Journals (Sweden)
Goldman Gustavo H
2010-01-01
Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin
Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J
2005-08-01
The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.
Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M
2018-03-01
Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so
Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis
Energy Technology Data Exchange (ETDEWEB)
Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)
2008-02-01
The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.
Directory of Open Access Journals (Sweden)
Wang Haiyang
2002-12-01
Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.
Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J
2017-10-02
The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.
Kumar, L; Sridhara, S; Singh, B P; Gangal, S V
1998-11-01
Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.
Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.
1996-01-01
In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...
Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao
2017-06-01
This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.
2013-01-01
We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes
International Nuclear Information System (INIS)
Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine
2005-01-01
The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry
Czech Academy of Sciences Publication Activity Database
Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla
2012-01-01
Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
International Nuclear Information System (INIS)
Singh, S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
Energy Technology Data Exchange (ETDEWEB)
Singh,S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the
The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages
International Nuclear Information System (INIS)
Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo
2005-01-01
We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways
Directory of Open Access Journals (Sweden)
Adam Alexander Thil Smith
2012-05-01
Full Text Available Of all biochemically characterized metabolic reactions formalized by the IUBMB, over one out of four have yet to be associated with a nucleic or protein sequence, i.e. are sequence-orphan enzymatic activities. Few bioinformatics annotation tools are able to propose candidate genes for such activities by exploiting context-dependent rather than sequence-dependent data, and none are readily accessible and propose result integration across multiple genomes. Here, we present CanOE (Candidate genes for Orphan Enzymes, a four-step bioinformatics strategy that proposes ranked candidate genes for sequence-orphan enzymatic activities (or orphan enzymes for short. The first step locates "genomic metabolons", i.e. groups of co-localized genes coding proteins catalyzing reactions linked by shared metabolites, in one genome at a time. These metabolons can be particularly helpful for aiding bioanalysts to visualize relevant metabolic data. In the second step, they are used to generate candidate associations between un-annotated genes and gene-less reactions. The third step integrates these gene-reaction associations over several genomes using gene families, and summarizes the strength of family-reaction associations by several scores. In the final step, these scores are used to rank members of gene families which are proposed for metabolic reactions. These associations are of particular interest when the metabolic reaction is a sequence-orphan enzymatic activity. Our strategy found over 60,000 genomic metabolons in more than 1,000 prokaryote organisms from the MicroScope platform, generating candidate genes for many metabolic reactions, of which more than 70 distinct orphan reactions. A computational validation of the approach is discussed. Finally, we present a case study on the anaerobic allantoin degradation pathway in Escherichia coli K-12.
Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.
Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D
2007-07-01
Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.
The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.
Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi
2016-01-01
We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.
2005-01-01
In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures
DEFF Research Database (Denmark)
Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl
2010-01-01
The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....
Energy Technology Data Exchange (ETDEWEB)
Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu
2014-01-03
Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.
Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT
Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David
2011-01-01
High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025
Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron
2011-11-01
Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.
International Nuclear Information System (INIS)
Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru
2006-01-01
Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)
Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton
2017-07-01
The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.
Directory of Open Access Journals (Sweden)
Watanabe Haruo
2005-10-01
Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.
Directory of Open Access Journals (Sweden)
Jalpa Kotecha
2016-09-01
Full Text Available Background: Declining lung function signifies disease progression in idiopathic pulmonary fibrosis (IPF. Vascular endothelial growth factor (VEGF concentration is associated with declining lung function in 6 and 12-month studies. Alveolar nitric oxide concentration (CANO is increased in patients with IPF, however its significance is unclear. This study investigated whether baseline plasma VEGF concentration and CANO are associated with disease progression or mortality in IPF. Methods: 27 IPF patients were studied (maximum follow-up 65 months. Baseline plasma VEGF concentration, CANO and pulmonary function tests (PFTs were measured. PFTs were performed the preceding year and subsequent PFTs and data regarding mortality were collected. Disease progression was defined as one of: death, relative decrease of ≥10% in baseline forced vital capacity (FVC % predicted, or relative decrease of ≥15% in baseline single breath diffusion capacity of carbon monoxide (TLCO-SB % predicted. Results: Plasma VEGF concentration was not associated with progression-free survival or mortality. There was a trend towards shorter time to disease progression and death with higher CANO. CANO was significantly higher in patients with previous declining versus stable lung function. Conclusion: The role of VEGF in IPF remains uncertain. It may be of value to further investigate CANO in IPF.
Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M
2013-05-10
Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad
DEFF Research Database (Denmark)
Koch, Birgit; Nybroe, Ole
2006-01-01
A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J
2013-09-11
Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.
Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.
Directory of Open Access Journals (Sweden)
Yanyan Lu
2018-04-01
Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.
Characterization of a novel organic solute transporter homologue from Clonorchis sinensis
Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok
2018-01-01
Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646
Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.
2014-01-01
Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850
Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues
Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.
2017-10-01
Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.
The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK
Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A
2014-01-01
A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930
Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam
2017-10-01
In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Lim, Tae Hawn; Lee, Tae Keun; Seong, Ki Hong; Mun, Chi Woong; Kim, Sang Tae; Shin, Myung Jin
1992-01-01
In vivo 3P NMR spectroscopic study of forearm wrist flexor muscles was performed in two groups of volunteers composed respectively of 6 sedentaries and 6 canoe athletes. A continuous isometric contraction of endurance exercise was adopted in order to assess the endurance capacity and recovery potential of skeletal muscles. Differences in high energy phosphorus metabolism between the sedentaries and athletes were evaluated with and emphasis on the intracellular pH and Pi/PCr ratio as indicators of high energy phosphorus metabolism, There were no differences of baseline pH and Pi/ PCr ratio between the two groups. The athletes sustained the exercise at a more acidic intracellular pH and at a higher Pi/ PCr radio of intracellular conditions for an all out than did the sedentaries. The recovery rate of pH showed no difference between the two groups. There was a tendency of faster recovery of Pi/ PCr in athletes showing half recovery time (T 1/2 ) of 39.0 ± 3.0 seconds as compared to that of sedentaries (55.7 ± 7.5 seconds). The recovery rate of Pi/ PCr as a function of Pi/ PCr rate at a given period of time was significantly faster in athletes than in sedentaries (P<0.001). The correlation coefficient of the recovery rate of Pi/ PCr against the Pi/ PCr ratio was 0.985 and 0.914 respectively for the athletes and sedentaries. The pH and the Pi/ PCr ratio at an all-out state can be used as indicators of endurance capacity and the recovery rate of Pi/ PCr, as a recovery potential of skeletal muscles
Brown, N K; Harvey, D J
1988-04-01
Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.
Logging activities in mangrove forests: A case study of Douala ...
African Journals Online (AJOL)
Administrator
2 School of Resources Science and Management, Southern Cross University, PO Box 157 .... such tools as canoes, engine-powered canoes or boats, chain .... manufacturers, and government and private sector reti- ..... supply and demand.
Neuhausen, J; Eichler, B
2004-01-01
The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.
TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.
Yasuhara, Hiroki; Oe, Yuki
2011-07-01
TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.
International Nuclear Information System (INIS)
Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu
2007-01-01
RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1
Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes
International Nuclear Information System (INIS)
Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver
2005-01-01
Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin
Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana
2013-01-01
Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should
TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.
Directory of Open Access Journals (Sweden)
Shuai Wang
Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.
Energy Technology Data Exchange (ETDEWEB)
Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)
2013-11-29
Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.
International Nuclear Information System (INIS)
Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki
2013-01-01
Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions
Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli
Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger
2015-03-01
Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.
International Nuclear Information System (INIS)
Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka
2007-01-01
A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications
Serrano-Martínez, Enrique; Quispe, Marco; Andrade, Roy; Casas, Gina; Tantalean, Manuel
2016-01-01
En el mes de mayo de 2012, el Perú registró una inexplicable mortalidad de especies de pelícanos y delfines. Un aproximado de 5000 pelícanos y 877 delfines entre moribundos y muertos, fueron encontrados en la costa peruana, atribuyéndosele a este episodio como el ¨efecto pelícano¨; sin embargo, la causa del fenómeno ocurrido fue atribuido a diversos factores, como los medioambientales, a patógenos virales, a factores alimenticios y a la mano del hombre, entre otros, no llegándose a esclarecer...
Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun
2015-12-01
The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter
2018-02-28
Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.
International Nuclear Information System (INIS)
Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.
2003-01-01
Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L
Directory of Open Access Journals (Sweden)
Yi-Ting Lee
2016-09-01
Full Text Available We have overcome the synthetic difficulty of 9,9′,9′′,9′′′,9′′′′,9′′′′′-((phenylsilanetriyltris(benzene-5,3,1-triylhexakis(9H-carbazole (SimCP3 an advanced homologue of previously known SimCP2 as a solution-processed, high triplet gap energy host material for a blue phosphorescence dopant. A series of organic light-emitting diodes based on blue phosphorescence dopant iridium (III bis(4,6-difluorophenylpyridinatopicolate, FIrpic, were fabricated and tested to demonstrate the validity of solution-processed SimCP3 in the device fabrication.
Directory of Open Access Journals (Sweden)
Teruo Umemoto
2012-03-01
Full Text Available Various arylsulfur pentafluorides, ArSF5, have long been desired in both academic and industrial areas, and ArSF5 compounds have attracted considerable interest in many areas such as medicines, agrochemicals, and other new materials, since the highly stable SF5 group is considered a “super-trifluoromethyl group” due to its significantly higher electronegativity and lipophilicity. This article describes the first practical method for the production of various arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides, from the corresponding diaryl disulfides or aryl thiols. The method consists of two steps: (Step 1 treatment of a diaryl disulfide or an aryl thiol with chlorine in the presence of an alkali metal fluoride, and (step 2 treatment of the resulting arylsulfur chlorotetrafluoride with a fluoride source, such as ZnF2, HF, and Sb(III/V fluorides. The intermediate arylsulfur chlorotetrafluorides were isolated by distillation or recrystallization and characterized. The aspects of these new reactions are revealed and reaction mechanisms are discussed. As the method offers considerable improvement over previous methods in cost, yield, practicality, applicability, and large-scale production, the new processes described here can be employed as the first practical methods for the economical production of various arylsulfur pentafluorides and their higher homologues, which could then open up a new era of “super-trifluoromethyl” arene chemistry and its applications in many areas.
International Nuclear Information System (INIS)
Black, Amanda; McLaren, Ronald G.; Reichman, Suzanne M.; Speir, Thomas W.; Condron, Leo M.
2011-01-01
Few studies have quantified the accuracy of soil metal bioavailability assays using large datasets. A meta-analysis from experiments spanning 6 months to 13 years on 12 soil types, compared bioavailability estimate efficiencies for wheat and ryegrass. Treatments included biosolids ± metals, comparing total metal, Ca(NO 3 ) 2 , EDTA, soil solution, DGT and free ion activity. The best correlations between soil metal bioavailability and shoot concentrations were for Ni using Ca(NO 3 ) 2 (r 2 = 0.72) which also provided the best estimate of Zn bioavailability (r 2 = 0.64). DGT provided the best estimate of Cd bioavailability, accounting for 49% of shoot Cd concentrations. There was no reliable descriptor of Cu bioavailability, with less than 35% of shoot Cu concentrations defined. Thus interpretation of data obtained from many soil metal bioavailability assays is unreliable and probably flawed, and there is little justification to look beyond Ca(NO 3 ) 2 for Ni and Zn, and DGT for Cd. - Highlights: → A meta-analysis evaluated the efficacy of soil metal bioavailability assays. → DGT could explain 49% of shoot Cd concentration. → There is little justification to look beyond Ca(NO 3 ) 2 for Ni and Zn. - A meta-analysis of soil metal bioavailability estimates for 12 soil types concluded that there is little justification to look beyond Ca(NO 3 ) 2 for Ni and Zn, and DGT for Cd.
Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela
2018-01-11
Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.
Directory of Open Access Journals (Sweden)
Aldo Nicosia
2018-01-01
Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.
The Effect of Physics in the Development of Indigenous Technology ...
African Journals Online (AJOL)
FIRST LADY
Abstract. This study was an attempt to determine empirically the effect of physics in the development of indigenous technology (production of local talking drum and canoe) in Akwa Ibom State. A total of 70 indigenous technologists (40 canoe makers and 30 talking drum makers) from Ikot Abasi, Essien Udim and Ikot. Ekpene ...
Davis, Wendy; Henderson, Bob
1998-01-01
Provides outdoor educators with background information for historical interpretation activities during Canadian canoe trips. Discusses the history, evolution, and uses of brightly colored sashes and garters worn by voyageurs during the fur trade era, and speculates on the origins of the Lauburu canoe emblem, used by both the Mic Mac peoples and…
Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano
2009-12-01
Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.
Spectroscopic study of trivalent rare earth ions in calcium nitrate hydrate melt
International Nuclear Information System (INIS)
Fujii, Toshiyuki; Asano, Hideki; Kimura, Takaumi; Yamamoto, Takeshi; Uehara, Akihiro; Yamana, Hajimu
2006-01-01
Influence of the water content to chemical status of trivalent rare earth ions in calcium nitrate hydrate melt was studied by spectroscopic techniques. Fluorescence spectrometry for Eu(III) in Ca(NO 3 ) 2 .RH 2 O and electronic absorption spectrometry for Nd(III) in Ca(NO 3 ) 2 .RH 2 O were performed for analyzing the changing coordination symmetries through the changes in their hypersensitive transitions. Raman spectroscopic study and EXAFS study were performed for Y(NO 3 ) 3 solutions and Y(III) in Ca(NO 3 ) 2 .RH 2 O for analyzing the oxygen bonding to Y(III). Luminescence lifetime study of Eu(III) and Dy(III) in Ca(NO 3 ) 2 .RH 2 O was performed for evaluating the hydration number changes. Results of these spectroscopic studies indicated that, with the decrease of water content (R), the hydration number decreases while the interaction between trivalent rare earth ion and nitrate ion increases. It was also revealed that the symmetry of the coordination sphere gets distorted gradually by this interaction
Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.
Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique
2014-10-01
Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights
Shao, Chung-Ping; Hor, Lien-I
2001-01-01
Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950
Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean
Institute of Scientific and Technical Information of China (English)
Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair
2014-01-01
Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.
Canoë-Kayak Club
2011-01-01
Le coup d’envoi de la saison vient d’être donné, le 6 mars dernier avait lieu le sélectif national2 de slalom à Cessenon sur Orb dans l’Hérault sur le stade d’eau vive de Réals. Des compétiteurs de toute la France avaient fait le déplacement. Olivier Barrière seul représentant du club qualifié a défendu fièrement les couleurs du club en réalisant deux bonnes manches sanctionnées d’une seule faute et a ainsi pris une sérieuse option pour la qualification aux championnats de France vétérans, qui se disputeront fin juillet à Metz, en remontant à la cinquième place du classement national vétérans 2. Ce déplacement dans le sud était également l’occasion de récup...
Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium
International Nuclear Information System (INIS)
Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.
2010-01-01
Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)
DEFF Research Database (Denmark)
Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael
2010-01-01
Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...
Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome
International Nuclear Information System (INIS)
Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon
2007-01-01
Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein
Directory of Open Access Journals (Sweden)
McNeel Gordon Jantzen
2014-03-01
Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.
Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel
2011-02-25
Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.
Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium
Energy Technology Data Exchange (ETDEWEB)
Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)
2010-07-01
Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)
Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M
2000-04-01
The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Fluorescence Quenching of Humic Acid by Coated Metallic Silver Particles.
Zhu, Guocheng; Yin, Jun
2017-07-01
Natural organic matter is an important component of the aquatic environments, which has attracted wide attention to its influence of interaction with other pollutants. The present work aimed to investigate its fluorescence quenching (FQ) by coated metallic silver particles (AgNPs). In this work, using fluorescence spectroscopy in conjunction with UV-Vis spectroscopy and dynamic light scattering, the effect of coated AgNPs on fluorescence quenching intensity (FQI) of humic acid (HA) was assessed. In addition, the influence of electrolytes (NaCl, NaNO 3 and CaNO 3 ) in the FQI was observed. Results showed that with AgNPs dosage increased (>1.17X10 -3 mM), fluorescence quantum yield of HA gradually decreased, which implies that the FQ occurred. Furher observation showed that the FQ process followed both first-order and second-order Stern-Volmer functions. The FQ process was affected by the electrolytes: NaCl had an effect on reduction of FQI, possibly resulting from dissolution of AgNPs; Both of NaNO 3 and Ca(NO 3 ) 2 had an effect on the FQ of HA but Ca(NO 3 ) 2 presented greater degree. As a result, the FQ degree of HA by alone electrolyte was listed in descent order as Ca(NO 3 ) 2 > NaNO 3 > NaCl, which also implies the subsequent experimental results, indicating the FQ degree of HA by mutual electrolytes as Ca(NO 3 ) 2 + NaNO 3 > Ca(NO 3 ) 2 + NaCl > NaNO 3 + NaCl.
Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla
2009-09-01
Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.
Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite
He, Li-Sheng
2013-05-22
The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.
Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite
He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan
2013-01-01
The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.
Morale as a Protection Factor against Mission Related Stress
2006-04-01
Inventory [34]. Morale as a Protection Factor against Mission Related Stress RTO-MP HFM-134 10 - 7 - Inventario de Valoración y Afrontamiento...17-37. [27] Miguel-Tobal, J. J. and Cano Vindel, A. (1986). Inventario de Situaciones y Respuestas de Ansiedad. Madrid: Tea Ediciones. (2ª Edic...Psychology, 56, 2, 267-283. [35] Cano Vindel, A. and Miguel-Tobal, J. J. (1992). Inventario de Valoración y Afrontamiento (IVA). Mimeo: Universidad
Directory of Open Access Journals (Sweden)
Linxi Li
2017-08-01
Full Text Available In the rat testis, studies have shown that cell polarity, in particular spermatid polarity, to support spermatogenesis is conferred by the coordinated efforts of the Par-, Crumbs-, and Scribble-based polarity complexes in the seminiferous epithelium. Furthermore, planar cell polarity (PCP is conferred by PCP proteins such as Van Gogh-like 2 (Vangl2 in the testis. On the other hand, cell junctions at the Sertoli cell–spermatid (steps 8–19 interface are exclusively supported by adhesion protein complexes (for example, α6β1-integrin-laminin-α3,β3,γ3 and nectin-3-afadin at the actin-rich apical ectoplasmic specialization (ES since the apical ES is the only anchoring device in step 8–19 spermatids. For cell junctions at the Sertoli cell–cell interface, they are supported by adhesion complexes at the actin-based basal ES (for example, N-cadherin-β-catenin and nectin-2-afadin, tight junction (occludin-ZO-1 and claudin 11-ZO-1, and gap junction (connexin 43-plakophilin-2 and also intermediate filament-based desmosome (for example, desmoglein-2-desmocollin-2. In short, the testis-specific actin-rich anchoring device known as ES is crucial to support spermatid and Sertoli cell adhesion. Accumulating evidence has shown that the Par-, Crumbs-, and Scribble-based polarity complexes and the PCP Vangl2 are working in concert with actin- or microtubule-based cytoskeletons (or both and these polarity (or PCP protein complexes exert their effects through changes in the organization of the cytoskeletal elements across the seminiferous epithelium of adult rat testes. As such, there is an intimate relationship between cell polarity, cell adhesion, and cytoskeletal function in the testis. Herein, we critically evaluate these recent findings based on studies on different animal models. We also suggest some crucial future studies to be performed.
Bernhards, Yasmine; Pöggeler, Stefanie
2011-04-01
Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.
Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli
Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger
2015-10-01
To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work
Gaseous losses of fertilizer nitrogen from soils under various conditions
International Nuclear Information System (INIS)
Smirnov, P.M.; Pedishyus, R.K.
1974-01-01
Effects of aerobic and anaerobic conditions; pH, and soil sterilization on the nitrogen loss from ( 15 NH 4 ) 2 SO 4 , Ca( 15 NO 3 ) 2 and Na 15 NO 2 have been studied in vitro. Composition of the liberated gases has been determined by the adsorption chromatography technique. Gaseous losses of fertilizer nitrogen are shown to proceed most intensely during first 10 to 30 days after nitrogen application, Ca(NO 3 ) 2 nitrogen loss being much higher than that of (NH 4 ) 2 SO 4 . Under anaerobic conditions nitrogen losses are markedly higher than in the presence of oxygen. Nitrogen of Ca(NO 3 ) 2 and (NH 4 ) 2 SO 4 is lost mainly as N 2 O and N 2 , the proportion of NO and NO 2 under aerobic and, particularly, anaerobic conditions is very small. Fertilizer type and aeration affect strongly the composition of liberated gases and the N 2 O:N 2 ratio. Under anaerobic conditions, Ca(NO 3 ) 2 nitrogen, beginning from the first days, is lost mainly as N 2 (75-80%), N 2 O makes up only 12 to 14%. Under aerobic conditions, (NH 4 ) 2 SO 4 and Ca(NO 3 ) 2 release initially a considerable amount of N 2 O, its reduction to N 2 being inhibited. In the course of time, however, a noticeable growth of the N 2 fraction occurs and it is accompanied by the decrease in N 2 O. Soil pH effects are related mainly to the composition of gases released rather than to the total nitrogen loss by Ca(NO 3 ) 2 . Under anaerobic conditions, more reduced gaseous products N 2 O and N 2 - are formed at acidic and neutral soil reaction, the amount of N 2 being greater at pH 7 than at pH 4.4. Under aerobic conditions, Ca(NO 3 ) 2 at pH 7 loses nitrogen mostly as N 2 , while under acidic soil reaction (pH 4.1-4.4) the losses occur as N 2 O and in part as NO and NO 2 . Sterilized soil at acidic pH liberates primarily nitrogen oxide which is formed apparently as a result of chemical reactions with participation of nitrites
van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C
1997-05-01
We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.
Molecular Identification of Human Fungal Pathogens
2011-03-01
Zhang, S., Cuenca- Estrella , M., Tudela, J. L. R., Castelli, J. L. R., Mellado, E., Kidd, S., Morrissey, O., Simmon, K., Petti, C., Snelders, E...J. Cano, M. Cuenca- Estrella , E. Dannaoui, J. Guarro, G. Haase, C. Kibbler, W. Meyer, K. O’Donnell, C. Petti, J. Rodriguez-Tudela, D. Sutton, A...1. Balajee, S. A., A. M. Borman, M. E. Brandt, J. Cano, M. Cuenca- Estrella , E. Dannaoui, J. Guarro, G. Haase, C. C. Kibbler, W. Meyer, K
Institute of Scientific and Technical Information of China (English)
无
2008-01-01
The leaching characteristics of a garden soil may be greatly affected by application of poultry and livestock manures from intensive farming.Packed soil columns of a garden soil(CK)and the soils after respectively receiving 2% pig manure (PM),chicken manure(CM),and commercial organic manure(OM)were leached with 0.05 mol L-1 Ca(NO3)2 and 0.01 mol L-1 EDTA solutions.The leachate EC(electric conductivity)values gradually increased at the beginning and then reached a stable value when the soil columns were leached with 0.05 mol L-1 Ca(NO3)2 solution.The leachate EC values showed a peak-shape when leached with 0.01 mol L-1 EDTA solution.In all the soil columns,the pH values of the leachates decreased with increase of displacement volumes when the Ca(NO3)2 solution was used.The total amounts of Cu and Zn eluted from the four soil columns were significantly correlated with the extracted soil Cu and Zn concentrations by 1.0 mol L-1 NH4NO3,but were not correlated with the leachate dissolved organic carbon(DOC)contents.The Zn concentration in the leachate of the PM-treated soil column with 0.05 mol L-1 Ca(NO3)2 solution was above the Quality Standard III for Ground Water of China(GB/T 14848-93,Zn < 1.0 mg L-1).When compared with 0.05 mol L-1 Ca(NO3)2,the EDTA solution significantly accelerated Cu and Zn elutions in the manure-treated columns.This suggested that applying poultry and livestock manures from intensive farming to farmland might pose a threat to the groundwater quality.
Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni
2017-08-01
Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.
La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H
2012-11-30
Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.
Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo
2013-10-15
CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.
Directory of Open Access Journals (Sweden)
Yeon Soo Han
2013-10-01
Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.
Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo
2013-01-01
CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157
Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal
2013-12-01
Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.
Menand, Benoit
2002-01-01
TOR (target of rapamycin) protein kinases were identified in yeast, mammals and Drosophila as central controllers of cell growth. Thu, G1 to S phases progression through the cell cycle is blocked by rapamycin, a drug which specifically inhibits TOR activity by forming a ternary complex with the peptidyl-prolyl isomerase FKBP12 (FK506 and rapamycin binding protein), and the FKBP-rapamycin binding domain (FRB) of TOR proteins. This work presents the study, the Arabidopsis homologue of yeast and...
Directory of Open Access Journals (Sweden)
E Wyroba
2009-08-01
Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.
Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu
2008-02-01
The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.
Directory of Open Access Journals (Sweden)
Srinivas Garlapati
2011-03-01
Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.
Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk
2017-01-01
The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.
Directory of Open Access Journals (Sweden)
Nikola Kellner
2014-01-01
Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.
Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A
2017-11-01
Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.
Energy Technology Data Exchange (ETDEWEB)
Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)
2014-08-01
Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.
Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine
2015-07-30
Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.
Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann
2012-10-22
The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum (M.ma) a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although M.ma possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by M.ma remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from M.ma, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that M.ma Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the M.ma/zebrafish model. Copyright © 2012 Elsevier B.V. All rights reserved.
The formula that oxygenated the economy
International Nuclear Information System (INIS)
Carta Petrolera
1995-01-01
Cano Limon changed the economic perspectives of Colombia completely; country that at the beginning of the years eighty confronted conflicting situations regarding the exchange handling, the exports had fallen substantially and the fiscal deficit affected the finances of the state. From final of the years seventy, until when the development of Cano Limon, Colombia took place it suffered a severe economic crisis, summarized in such aspects as the growth of the GDP it fell at inferior levels to 2 annual percent in 1982 and 1983
[Salt stress tolerance of cucumber-grafted rootstocks].
Wang, Li-Ping; Sun, Jin; Guo, Shi-Rong; Liu, Shu-Ren; Liu, Chao-Jie; Tian, Jing
2012-05-01
Taking 4 different Cucurbita maxima x C. moschata rootstocks for cucumber (Cucumis sativus) as test materials, a solution culture experiment was conducted to study their growth and antioxidative enzyme activities under the stresses of Ca(NO3)2 and NaCl, with the salt stress tolerance of the rootstocks evaluated by subordinate function. At 30 mmol x L(-1) of Ca (NO3)2 or 45 mmol x L(-1) of NaCl, the growth of the rootstock seedlings was improved; but at 60 and 120 mmol x L(-1) of Ca(NO3)2 or 90 and 180 mmol x L(-1) of NaCl, the growth and the antioxidative systems of the seedlings were inhibited, and the salt injury index of 'Qingzhen No. 1' was the smallest, with the decrement of biomass and SOD, POD and CAT activities and the increment of relative conductance being significantly lower than those of the others. Under the stress of high concentration Ca(NO3)2, the SOD, POD and CAT activities of test rootstocks were higher, and the salt injury index and relative conductance were lower, as compared with those under high concentration NaCl, suggesting that the damage of Ca(NO3)2 stress to cucumber-grafted rootstock were smaller than that of NaCl stress. Among the 4 rootstocks, 'Qingzhen No. 1' had the strongest salt stress tolerance, followed by 'Zuomu Nangua', 'Fengyuan Tiejia', and 'Chaoba Nangua'.
Directory of Open Access Journals (Sweden)
Zhitao Qi
2015-01-01
Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.
Directory of Open Access Journals (Sweden)
Miki Noda
2016-06-01
Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.
Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A
2010-01-01
The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.
Directory of Open Access Journals (Sweden)
Markéta Kostrouchová
2017-06-01
Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.
International Nuclear Information System (INIS)
Linnow, Kirsten; Steiger, Michael
2007-01-01
Confined growth of crystals in porous building materials is generally considered to be a major cause of damage. We report on the use of X-ray diffraction under controlled conditions of temperature and relative humidity (RH-XRD) for the investigation of potentially deleterious phase transition reactions. An improved procedure based on rate measurements is used for the accurate and reproducible determination of equilibrium humidities of deliquescence and hydration reactions. The deliquescence humidities of NaCl (75.4 ± 0.5% RH) and Ca(NO 3 ) 2 .4H 2 O (50.8 ± 0.7% RH) at 25 deg. C determined with this improved RH-XRD technique are in excellent agreement with available literature data. Measurement of the hydration of anhydrous Ca(NO 3 ) 2 to form Ca(NO 3 ) 2 .2H 2 O revealed an equilibrium humidity of 10.2 ± 0.3%, which is also in reasonable agreement with available data. In conclusion, dynamic X-ray diffraction measurements are an appropriate method for the accurate and precise determination of equilibrium humidities with a number of interesting future applications
Directory of Open Access Journals (Sweden)
Livia C. T. Scorza
2017-02-01
Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also
DEFF Research Database (Denmark)
Madsen, Jens; Tornøe, Ida; Nielsen, Ole
2003-01-01
CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...
Directory of Open Access Journals (Sweden)
Thomas Anne VT
2005-10-01
Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.
Directory of Open Access Journals (Sweden)
Zengliang Ruan
Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.
International Nuclear Information System (INIS)
Camargo, Iara Maria Carneiro de.
2005-01-01
Studies of partition coefficient show that Kp values of metals can vary orders of magnitude according to the soil physical-chemistry characteristics. Therefore, the Kp is a sensible parameter in human health risk assessment model. In general, a default value is adopted by environmental agencies and often it is not represent suitably the soil studied and can cause errors in the risk calculation. The objectives of this work are: evaluate the heavy metals soil contamination around the Figueira coal-fired power plant; determine the metal Kp of As, Cd, Co, Cr, Cu, Mo, Ni, Pb and Zn in soil by the ratio between the metal concentration obtained by concentrate HNO 3 digestion and the metal concentration obtained by extraction with EDTA 0,05 mol L -1 (Kp EDTA ) or Ca(NO 3 ) 2 0,1 mol L -1 (Kp Ca(NO3)2 ); and evaluate the influence of the application of different Kp values in human health risk assessment C-Soil model in risk calculation. The main conclusions of the present study were: As, Cd, Mo, Pb e Zn were the Figueira soil metal contaminants, being As the pollutant of major human health concern; either Kp Ca(NO3)2 or Kp EDTA values could be used for human health risk calculation, in Figueira case, except for Pb, and the Kp EDTA values were preferably recommended due to the less dispersion of their values; the KpC Soil metals default values could be applied for the human health risk calculation in Figueira case, in other words, it would not have necessity to determine Kp values of region (Kp EDTA and Kp Ca(NO3)2 ), except to Pb. (author)
Directory of Open Access Journals (Sweden)
Razul harfi
2017-10-01
Full Text Available PT. TLP is a company which employs the service area and the task is to preserve the TCC building and to fulfill the needs of its users through providing complete facilities and service. But have the customers satisfied with the facilities and services? Therefore, the aim of this research is to measure the level of customer satisfaction, to determine which service attributes are prioritized for improvements, and the efforts to the improvement. The method used is servqual methods and models of canoes. The servqual method is intended to determine the level of customer satisfaction, while the canoe models is for finding out the preferred improvement services. The result of servqual analysis shows that there is a gap of all attributes and the scores are negative. These means that the quality of customer service of PT.TLP is not satisfactory. The average percentage for the customer's perception is 75.25% and 88.10% for expectations. Moreover, the canoe analysis also shows that out of 32 service attributes, there are 25 attributes that should be corrected, namely 3 services are categorized Attractive, 5 service category One-dimensional, and 17 services are categorized ‘Must be’. Having integrated the servqual with canoes model, it is obtained that there is a sorting of the improvements priority, then determined improvements suggestion to evaluation for the company, such as setting the lobby and courtyard regularly, implementing the service with heart, socializing the call center, having the training regularly, making the data collection and the disposition of the vehicle, also testing of fire protection and alarm regularly
Directory of Open Access Journals (Sweden)
Jesus Eduardo Escovar
2013-12-01
Full Text Available On the southwest Pacific Coast of Colombia, a field study was initiated to determine the human-vector association between Anopheles (Kerteszia neivai and fishermen, including their nearby houses. Mosquitoes were collected over 24-h periods from mangrove swamps, marshlands and fishing vessels in three locations, as well as in and around the houses of fishermen. A total of 6,382 mosquitoes were collected. An. neivai was most abundant in mangroves and fishing canoes (90.8%, while Anopheles albimanus was found indoors (82% and outdoors (73%. One An. neivai and one An. albimanus collected during fishing activities in canoes were positive for Plasmodium vivax , whereas one female An. neivai collected in a mangrove was positive for P. vivax . In the mangroves and fishing canoes, An. neivai demonstrated biting activity throughout the day, peaking between 06:00 pm-07:00 pm and there were two minor peaks at dusk and dawn. These peaks coincided with fishing activities in the marshlands and mangroves, a situation that places the fishermen at risk of contracting malaria when they are performing their daily activities. It is recommended that protective measures be implemented to reduce the risk that fishermen will contract malaria.
Directory of Open Access Journals (Sweden)
Pedro Ángel López Miñarro
2008-01-01
dorsal en bipedestación fueron de 42,22º ± 7,76º para los kayakistas y de 37,45º ± 8,68º para los canoístas. En cuanto a la lordosis lumbar estos valores fueron de 27,91º ± 6,21º y 25,70º ± 6,15º, respectivamente. En el test dedos-planta, en las curvas dorsal y lumbar los resultados obtenidos fueron de 63,78º ± 6,21º y 33,70º ± 7,18º, respectivamente para kayakistas y de 65,35º ± 11,48º y 30,55º ± 6,33º para canoístas. No existieron diferencias significativas entre kayakistas y canoístas. En base a las referencias de normalidad, se encontró un alto porcentaje de morfotipos cifóticos, especialmente en la curva lumbar. En conclusión, existe una alta frecuencia de morfotipos alterados en flexión máxima del tronco y en sedentación asténica, especialmente en el raquis lumbar, aunque la disciplina practicada (kayak o canoa no genera diferencias significativas en la disposición sagital del raquis.
Enteric viruses in a mangrove lagoon, survival and shellfish incidence
Energy Technology Data Exchange (ETDEWEB)
Lopez de Cardona, I.; Bermudez, M.; Billmire, E.; Hazen, T.C. [Univ. of Puerto Rico, Rio Piedras (Puerto Rico)
1988-12-31
Mangrove oysters (Crassostrea rhizophorae) were screened for enteric viruses. For 18 months oysters were collected from Cano Boqueron, a tropical mangrove lagoon on the southwest coast of Puerto Rico. This popular tourist resort has two primary sewage treatment plants which service 158 single family cabanas. In spite of the heavy seasonal input of sewage to Cano Boqueron and high densities of fecal coliform bacteria, enteric viruses were not detected in shellfish meat. Because no viruses were detected in the oysters, a virus survival study was performed. Poliovirus type 1 was placed in diffusion chambers in situ at two sites in Cano Boqueron. More than 95% of the poliovirus inactivation occurred within 24 h. Virus inactivation was significantly different by site, indicating different inactivation rates within the lagoon. Chamber studies done simultaneously with Escherichia coli did not reveal differences between sites. It is suggested that the sewage effluent had an antiviral effect in the absence of an antibacterial effect. This study demonstrates the importance for establishing microbial contamination standards for shellfish growing waters in the tropics based upon in situ studies with tropical species, e.g. mangrove oyster.
Ictiofauna and fishing in the surroundines of Penedo, Alagoas
Directory of Open Access Journals (Sweden)
Emerson Carlos Soares
2011-02-01
Full Text Available Twenty-eight months of data collection revealed the profile of fishing production in the region of lower São Francisco. Catches consist of up to approximately 22 species, of which five are the most common: Prochilodus argenteus, Leporinus spp., Anchoviella vaillantii, Centropomus spp. and Eugerres brasilianus. The fishing fleet that is active in the region is made up of non-motorized canoes, motorized canoes and boats, and the vast majority employ the most common types of fishing nets and other fishing gear. The CPUE (Catch per Unit Effort ranged from 2.5kg/fisherman/day to 4.5kg/fisherman/day during the months analyzed.
Directory of Open Access Journals (Sweden)
Miriam Torres
2013-03-01
Full Text Available Reportamos observaciones de individuos albinos en tres especies de aves peruanas, el Zambullidor Grande (Podiceps major, el Pelícano peruano (Pelecanus thagus y el Churrete cordillerano (Cinclodes fuscus. Los individuos eran albinos parciales casi totalmente blancos, aparentemente adultos, que mostraron un comportamiento normal entre sus conespecíficos. La supervivencia después de varios meses pudo ser comprobada para el Pelícano peruano y el Churrete cordillerano. Debido a que la información publicada sobre albinismo en aves peruanas es muy escasa, se realizó una revisión y se recopilaron registros para otras nueve especies que son también presentados.
Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew
2016-01-01
Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.
Qiu, Jiaen
2016-06-23
Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.
Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J
2017-04-01
Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.
Grabner, Amy N; Alfonso, Jorge; Kayano, Anderson M; Moreira-Dill, Leandro S; Dos Santos, Ana Paula de A; Caldeira, Cleópatra A S; Sobrinho, Juliana C; Gómez, Ana; Grabner, Fernando P; Cardoso, Fabio F; Zuliani, Juliana Pavan; Fontes, Marcos R M; Pimenta, Daniel C; Gómez, Celeste Vega; Teles, Carolina B G; Soares, Andreimar M; Calderon, Leonardo A
2017-09-01
Snake venoms contain various proteins, especially phospholipases A 2 (PLA 2 s), which present potential applications in diverse areas of health and medicine. In this study, a new basic PLA 2 from Bothrops marajoensis with parasiticidal activity was purified and characterized biochemically and biologically. B. marajoensis venom was fractionated through cation exchange followed by reverse phase chromatographies. The isolated toxin, BmajPLA 2 -II, was structurally characterized with MALDI-TOF (Matrix-assisted laser desorption/ionization-time of flight) mass spectrometry, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by two-dimensional electrophoresis, partial amino acid sequencing, an enzymatic activity assay, circular dichroism, and dynamic light scattering assays. These structural characterization tests presented BmajPLA 2 -II as a basic Lys49 PLA 2 homologue, compatible with other basic snake venom PLA 2 s (svPLA 2 ), with a tendency to form aggregations. The in vitro anti-parasitic potential of B. marajoensis venom and of BmajPLA 2 -II was evaluated against Leishmania infantum promastigotes and Trypanosoma cruzi epimastigotes, showing significant activity at a concentration of 100μg/mL. The venom and BmajPLA 2 -II presented IC 50 of 0.14±0.08 and 6.41±0.64μg/mL, respectively, against intraerythrocytic forms of Plasmodium falciparum with CC 50 cytotoxicity values against HepG2 cells of 43.64±7.94 and >150μg/mL, respectively. The biotechnological potential of these substances in relation to leishmaniasis, Chagas disease and malaria should be more deeply investigated. Copyright © 2017. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi
1990-01-01
Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types
Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil
2012-01-01
Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988
2010-05-06
... observation, wildlife photography, auto touring, birding, hiking, boating/canoeing, visitor center, special...: Visitors to national wildlife refuges. Respondent's Obligation: Required to obtain or retain a benefit...
Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S
1999-04-30
Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.
Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R
2012-04-01
The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.
Helwani, Z.; Fatra, W.; Saputra, E.; Maulana, R.
2018-03-01
A palm fly ash supported calcium oxide (CaO) catalyst was prepared and used in transesterification from off-grade palm oil for biodiesel production. The catalyst synthesized by loading CaO of calcium nitrate tetrahydrate (Ca(NO3)2.4H2O) into fly ash through impregnation method. The optimum catalyst preparation conditions were determined by influence of calcination temperature and weight ratio of Ca(NO3)2.4H2O and fly ash. Catalyst with highest catalytic activity was achieved when calcined at 800 °C and proportion of Ca(NO3)2.4H2O to fly ash is 80:20. Under the conditions of oil : methanol ratio of 1:6, catalyst dosage of 6 wt% and temperature of 70 °C for 2 h, the biodiesel yield reaches to 71.77%. CaO, SiO2, Ca(OH)2 and Ca2SiO4 were found in the catalyst through X-ray diffraction (XRD) while the basic strength of the catalyst H_ in the range 9.3 – 11. Surface area of the developed catalyst is 24.342 m2/g through Brunauer-Emmett-Teller (BET). Characteristics of biodiesel such as density, kinematic viscosity, acid value, flash point has been matched with standard for biodiesel specification of Indonesia.
Wang, Xue-Tong; Xu, Si-Yue; Wang, Xi-Kui; Hu, Bao-Ping; Jia, Hao-Hao
2017-08-01
In order to systematically investigate the spatial distribution, homologue profiles, and sources of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in suburban soils in Shanghai, SCCPs and MCCPs in soils were analyzed using gas chromatography coupled with low resolution mass spectrometry in electron capture negative ion (ECNI) mode (GC-ECNI-MS). The CP concentrations in soils were between not detected (ND) - 697 ng g -1 with a median value of 3.52 ng g -1 for SCCPs, and ND - 666 ng g -1 with a median value of 15.3 ng g -1 for MCCPs, respectively. The concentrations of MCCPs in most soils were higher than that of SCCPs. The total CP concentrations (sum of SCCPs and MCCPs) in soils varied from ND to 964 ng g -1 with a median value of 20.5 ng g -1 . The concentration of MCCPs was higher than that of SCCPs in most soils. The levels of SCCPs and MCCPs in suburban soils in Shanghai were at the medium level when compared to other areas around the world. No significant correlation was observed between soil CP concentrations and total organic carbon contents (p > 0.05). For different use type of soils, the median concentrations of CPs in soils were found higher in greenland than that in other areas probably due to busy traffic, sewage sludge application and/or wastewater irrigation. All soils were divided into two groups by hierarchical cluster analysis (HCA) both for SCCPs and MCCPs. Three discharge sources of CPs in suburban soil of Shanghai were identified by PMF model. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zebala, John A; Mundell, Alan; Messinger, Linda; Griffin, Craig E; Schuler, Aaron D; Kahn, Stuart J
2014-01-01
Options are limited for patients with atopic dermatitis (AD) who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD. This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg) or twice-weekly (0.007 mg/kg) LD-aminopterin. The primary efficacy outcome was the Global Score (GS), a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01). The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo. Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.
Directory of Open Access Journals (Sweden)
John A Zebala
Full Text Available Options are limited for patients with atopic dermatitis (AD who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR. However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD.This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg or twice-weekly (0.007 mg/kg LD-aminopterin. The primary efficacy outcome was the Global Score (GS, a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01. The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo.Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.
Directory of Open Access Journals (Sweden)
Pavol Mikoláš
Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.
78 FR 76903 - Lockhart Power Company, Inc.; Notice of Availability of Draft Environmental Assessment
2013-12-19
... minimize erosion and sedimentation during soil-disturbing activities associated with project construction... channels), tailrace, project access road, and the proposed canoe take-out, put-in, portage trail, and...
Indigenous Control Methods for Parasites among Pastoralists ...
African Journals Online (AJOL)
RLG
Indigenous knowledge system should ... Therefore, ignoring these local knowledge practices by the ..... International Journal of Science and Rural Development. ... Ethno-medicine: Its potential in the health care system, Canoe Press.
Ye, Kaishan; Wang, Shuanke; Yang, Yong; Kang, Xuewen; Wang, Jing; Han, Hua
2015-09-01
Aplasia Ras homologue member Ⅰ (ARHI), an imprinted tumor-suppressor gene, is downregulated in various types of cancer. However, the expression, function and specific mechanisms of ARHI in human osteosarcoma (OS) cells remain unclear. The aim of the present study was to assess the effect of ARHI on OS cell proliferation and apoptosis and its associated mechanism. In the study, ARHI mRNA and protein levels were markedly downregulated in OS cells compared with the human osteoblast precursor cell line hFOB1.19. By generating stable transfectants, ARHI was overexpressed in OS cells that had low levels of ARHI. Overexpression of ARHI inhibited cell viability and proliferation and induced apoptosis. However, caspase‑3 activity was not changed by ARHI overexpression. In addition, phosphorylated Akt protein expression decreased in the ARHI overexpression group compared to that in the control vector group. The knockdown of ARHI also resulted in the promotion of cell proliferation and the attenuation of apoptosis in MG‑63 cells. Additionally, ARHI silencing increased the level of p‑Akt. The present results indicate that ARHI inhibits OS cell proliferation and may have a key role in the development of OS.
Developing a Canoe Tour for Upitrek Ltd.
Matzner, Ute
2011-01-01
The thesis was aimed to result in a sound paddling tourism product for the tour operator Upitrek Ltd. This request of product extension was based on the customer demands the company is facing. Therefore Upitrek Ltd. has acted as the commissioning party in this thesis, as the company will be provided with a fully developed tour product. The first section of this work investigates the history and current situation of the sector of water-based tourism, with an emphasis on paddling tourism, b...
MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.
Directory of Open Access Journals (Sweden)
Hui Xu
2010-11-01
Full Text Available MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.
MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.
Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad
2010-11-01
MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.
Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo
2006-10-01
Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.
78 FR 46407 - Qualification of Drivers; Exemption Applications; Vision
2013-07-31
...'s disease, and refractive amblyopia. In most cases, their eye conditions were not recently developed...), Juan R. Cano (TX), John Cole (IL), Kenneth Crider (KY), Jon R. Grunschel (MA), Dean Hawley (NC...
Directory of Open Access Journals (Sweden)
Knüchel Ruth
2008-05-01
Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian
Caffeine: How Does It Affect Blood Pressure?
... naturally increase your blood pressure, such as exercise, weightlifting or hard physical labor. To see if caffeine ... blood pressure and stress indices in healthy individuals. Nutrition Journal. 2016;15:26. Cano-Marquina A, et ...
National Oceanic and Atmospheric Administration, Department of Commerce — The northeast tip of the Yucatan Peninsula is a largely unexplored coastline where ancient Maya traders traveled in massive dugout canoes filled with goods from...
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G
2007-07-01
A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD
Future Students | College of Engineering & Applied Science
race car with the Society of Automotive Engineers. Members of the American Society of Mechanical . icons_100x100_Engage Over 20 engineering and computer science organizations await! Race a Baja car or concrete canoe
Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.
2013-01-01
PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807
Exercise, Sports and Tourette Syndrome
... suggested that extraordinarily quick reflexes may be a beneficial core feature of TS1—and obviously this would ... that gets your heart pumping and your motor running can be helpful. Dancing, canoeing, rock-climbing, skateboarding, ...
Cavernous Angioma and Children
... Bike and scooter riding – Wear a helmet Skydiving Hiking Canoeing – Wear a life vest and helmet Caving ... 2000, he may not be eligible for government benefits such as Medicare/Medicaid or SSI. There are ...
Evolution of AF6-RAS association and its implications in mixed-lineage leukemia
Energy Technology Data Exchange (ETDEWEB)
Smith, Matthew J.; Ottoni, Elizabeth; Ishiyama, Noboru; Goudreault, Marilyn; Haman, André; Meyer, Claus; Tucholska, Monika; Gasmi-Seabrook, Genevieve; Menezes, Serena; Laister, Rob C.; Minden, Mark D.; Marschalek, Rolf; Gingras, Anne-Claude; Hoang, Trang; Ikura, Mitsuhiko
2017-10-23
Elucidation of activation mechanisms governing protein fusions is essential for therapeutic development. MLL undergoes rearrangement with numerous partners, including a recurrent translocation fusing the epigenetic regulator to a cytoplasmic RAS effector, AF6/afadin. We show here that AF6 employs a non-canonical, evolutionarily conserved α-helix to bind RAS, unique to AF6 and the classical RASSF effectors. Further, all patients with MLL-AF6 translocations express fusion proteins missing only this helix from AF6, resulting in exposure of hydrophobic residues that induce dimerization. We provide evidence that oligomerization is the dominant mechanism driving oncogenesis from rare MLL translocation partners and employ our mechanistic understanding of MLL-AF6 to examine how dimers induce leukemia. Proteomic data resolve association of dimerized MLL with gene expression modulators, and inhibiting dimerization disrupts formation of these complexes while completely abrogating leukemogenesis in mice. Oncogenic gene translocations are thus selected under pressure from protein structure/function, underscoring the complex nature of chromosomal rearrangements.
Exercise and Cystic Fibrosis (CF)
... Gymnastics G Downhill skiing DS Team sports T (soccer, volleyball, basketball, etc.) Ice skating I Rowing, canoeing ... PhD Professor Emeritus of Pediatrics and Exercise and Nutrition Sciences Woman’s and Children’s Hospital of Buffalo and ...
2005-01-01
On the way back from the summit, Miguel Cerqueira Bastos (AB/PO), David Collados Polidura (IT/GM), Sandra Sequeira Tavares (PH/CMI) and Daniel Cano Ott (n_TOF) raised the official CERN Jubilee flag at 4750 metres altitude.
African Journals Online (AJOL)
2008-11-11
Nov 11, 2008 ... pfeifferi and the Bulinus spp the intermediate host for schistosome at all canoe landing sites at Kigungu, these ..... transmission site and facilitates prompt reporting to the health ... This study received financial assistant from the ...
Be Active Your Way: A Guide for Adults
... couple of months. You might want to add biking on the weekends for variety. 4 Be Active ... activities (check off the ones you will try): ❑ Biking slowly ❑ Canoeing ❑ Dancing ❑ General gardening (raking, trimming shrubs) ❑ ...
Directory of Open Access Journals (Sweden)
Adriano Senatore
Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.
Directory of Open Access Journals (Sweden)
Aino L K Liukko
Full Text Available Lipocalin allergens form a notable group of proteins, as they contain most of the significant respiratory allergens from mammals. The basis for the allergenic capacity of allergens in the lipocalin family, that is, the development of T-helper type 2 immunity against them, is still unresolved. As immunogenicity has been proposed to be a decisive feature of allergens, the purpose of this work was to examine human CD4+ T cell responses to the major dog allergen Can f 1 and to compare them with those to its human homologue, tear lipocalin (TL. For this, specific T cell lines were induced in vitro from the peripheral blood mononuclear cells of Can f 1-allergic and healthy dog dust-exposed subjects with peptides containing the immunodominant T cell epitopes of Can f 1 and the corresponding TL peptides. We found that the frequency of Can f 1 and TL-specific T cells in both subject groups was low and close to each other, the difference being about two-fold. Importantly, we found that the proliferative responses of both Can f 1 and TL-specific T cell lines from allergic subjects were stronger than those from healthy subjects, but that the strength of the responses within the subject groups did not differ between these two antigens. Moreover, the phenotype of the Can f 1 and TL-specific T cell lines, determined by cytokine production and expression of cell surface markers, resembled each other. The HLA system appeared to have a minimal role in explaining the allergenicity of Can f 1, as the allergic and healthy subjects' HLA background did not differ, and HLA binding was very similar between Can f 1 and TL peptides. Along with existing data on lipocalin allergens, we conclude that strong antigenicity is not decisive for the allergenicity of Can f 1.
Energy Technology Data Exchange (ETDEWEB)
McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.
1997-12-15
Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)
Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.
2016-01-01
Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141
Directory of Open Access Journals (Sweden)
Ling Nie
2016-01-01
Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.
Although recently introduced, film-coating of agronomic seeds is now widely accepted in modern agriculture as an effective technology for protecting germinating seeds and seedlings. These experiments explored the possibility of using a bioplastic-based formulation to film-coat corn (maize) and cano...
African Journals Online (AJOL)
abp
Pearled papules over tattoo: Molluscum cotagiosum. Ricardo Ruiz-Villaverde1,&, Daniel Sánchez-Cano2. 1Dermatology Unit. Complejo Hospitalario de Jaen, Jaen, Spain, 2Internal Medicine. Hospital Santa Ana, Motril, Granada, Spain. &Corresponding author: Ricardo Ruiz-Villaverde, Dermatology Unit. Complejo ...
The Succession Dispute to the Throne of Lagos and the British ...
African Journals Online (AJOL)
info
the early years of his reign Adele won popularity by making lavish gifts to his chiefs. This royal largesse ..... thousand followers had left Lagos in about fifty or sixty canoes to Badone, a village on ..... their influence in a more spectacular fashion.
the value of outdoor adventure activities as part of the enviro course ...
African Journals Online (AJOL)
technique of belaying is taught and specific safety precaut1ons are ... safety drills such as what to do if the canoe over- turns and the ... drive through the game area prior to the night march. ... the Wilderness Leadership School, works well with.
Tough Times: Strategic Planning as a War Canoe
Seymour, Daniel
2011-01-01
In this article, the author discusses how to make strategic planning a more valuable tool for higher education in today's tough times. Strategic planning is really the answer to five straightforward questions. The first three represent the plan itself, while the last two are what makes the plan vital and dynamic: (1) Why do we exist?; (2) What do…
Kayak Club
2014-01-01
Canoë Kayak CERN (CKC) Le Partenariat entre la concession Ford Pays de Gex du groupe Maurin et le Canoë kayak CERN (CKC), s'est concrétisé le jeudi 12 juin lors de la livraison du Ford transit Custom que la concession met à disposition du club pour favoriser le développement de ses activités dans le bassin Lémanique, eau vive sur le bassin d'Etrembières et Chancy , eau plate à Aire-la-Ville et le lac Leman, ou encore le Dragon boat à Divonne les Bains. Pour la remise des clés, Philippe Murgia directeur commercial Ford Pays de Gex, Olivier Barriere président du CKC et Yann Dunant jeune stagiaire a...
Kayak CERN Club
2014-01-01
Canoë Kayak CERN (CKC) Mikko Karppinen Vainqueur de la Maxi Kayak Pour la première édition de la course maxi kayak d’Annecy dimanche 1er juin, organisée par l’association Kayak sans Frontières, trois membres du Canoë Kayak CERN prenaient le départ de la boucle de 34kms autour du lac, Nicolas Roget qui après 23kms d’effort dû abandonner suite à plusieurs dessalages dans la partie la plus mouvementée du lac, René Dague franchissait la ligne d’arrivée après 3h15 de course se classant à la 10ème place juste devant l’ancien champion du monde de slalom Jacques Calori...
Directory of Open Access Journals (Sweden)
Aleksander F Sikorski
2007-01-01
Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.
78 FR 7427 - Environmental Impacts Statements; Notice of Availability
2013-02-01
... Waters Canoe Area Wilderness (BWCAW) Non-native Plant Management Project, Cook, Lake and St. Louis... EIS, AFS, OR, Rim Paunina Project and Forest Plan Amendments, Crescent Ranger District, Deschutes... Development Project, Approval of Gaming Development and Management, Spokane County, WA, Review Period Ends: 03...
75 FR 52821 - Federal Property Suitable as Facilities To Assist the Homeless
2010-08-27
... plan, existing sanitary facilities, exact street address), providers should contact the appropriate... Property Number: 97199230006 Status: Excess Comments: 310 sq. ft., 1 story stone structure, no sanitary or... Project Canoe Ridge, State Hwy 52 Celina Co: Clay TN 38551 Landholding Agency: COE Property Number...
2012-07-05
... by persons and vessels operating in close proximity to swimmers crossing navigation channels make... water activities includes but is not limited to sail boat regattas, boat parades, power boat racing, swimming events, crew racing, canoe and sail board racing. This rule is categorically excluded from further...
A Theory of Revolutionary Warfare and its Application to the Bolivian Adventure of Che Guevara
1973-01-01
training in Cuba Molses Nato Molses Guevara Rodriguez Julio Mendez Cano .Member of Center; later Joined the Rearguard; recrui ter Member of...Fort Bragg, North Carolina, 1965. Carol ! na. Counterinsurgency Planning Guide. ST-31-176, Fort Bragg, North Von Lsz&r, Arpad and Robert R. Kaufman
2013-07-10
... environmental education and interpretation. The Refuge engaged a diverse stakeholder base during the CCP process... opportunities for guided kayak and canoe tours on Malheur Lake. A stronger emphasis will be placed on modern... plants for traditional uses will expand. Monitoring and inventory of archaeological resources and...
40 CFR 230.52 - Water-related recreation.
2010-07-01
... Section 230.52 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING SECTION... Effects on Human Use Characteristics § 230.52 Water-related recreation. (a) Water-related recreation.... canoeing and sight-seeing. (b) Possible loss of values: One of the more important direct impacts of dredged...
La arquitectura del pleno barroco en Granada: el hospital del Corpus Christi
Directory of Open Access Journals (Sweden)
Barrios Rozúa, Juan Manuel
2011-03-01
Full Text Available The Corpus Christi hospital of Granada was a victim of prejudices against the baroque on the part of influential historians. Nevertheless, the building is an interesting example of hospital architecture with a frankly original temple. Thanks to the exhaustive analysis of the institution’s very complete archive, it can be determined that some thirty artists worked there, including Alonso Cano and his disciple Juan Luis de Ortega, whose architectural works are evaluated here.
El hospital del Corpus Christi de Granada fue víctima de los prejuicios contra el barroco de influyentes historiadores. Sin embargo, el edificio constituye un interesante ejemplo de arquitectura hospitalaria con un templo francamente original. Gracias al análisis exhaustivo de su completo archivo, puede detectarse la labor de una treintena de artífices, entre ellos Alonso Cano y su discípulo Juan Luis de Ortega, cuyas obras arquitectónicas son valoradas aquí.
Sebastián de Benavente y la capilla de San Diego de Alcalá
Directory of Open Access Journals (Sweden)
Cruz Yábar, Juan María
2008-12-01
Full Text Available The correct interpretation of the documents concerning the chapel of San Diego in the convent of Santa María de Jesús in Alcalá de Henares demonstrates that the master-architect Sebastián de Benavente played a fundamental role in its invention and realization, including the main altarpiece. For both documental and stylistic reasons, the author attributes to Benavente the drawing from a Florentine private collection until now attributed to Alonso Cano.
La correcta interpretación de los documentos relativos a la capilla de San Diego en el convento de Santa María de Jesús de Alcalá de Henares demuestra que el maestro arquitecto Sebastián de Benavente tuvo un papel fundamental en su invención y realización, incluido el retablo mayor. Consideramos suyo el dibujo de colección particular florentina hasta ahora atribuido a Alonso Cano, lo que defendemos por razones documentales y estilísticas.
International Nuclear Information System (INIS)
Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim
2005-01-01
E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation
Jin, Taewon; Kim, Oh Yoen; Shin, Min-Jeong; Choi, Eun Young; Lee, Sung Sook; Han, Ye Sun; Chung, Ji Hyung
2014-10-29
Adiponectin, an adipokine, has been described as showing physiological benefits against obesity-related malfunctions and vascular dysfunction. Several natural compounds that promote the expression and secretion of adipokines in adipocytes could be useful for treating metabolic disorders. This study investigated the effect of fisetin, a dietary flavonoid, on the regulation of adiponectin in adipocytes using 3T3-L1 preadipocytes. The expression and secretion of adiponectin increased in 3T3-L1 cells upon treatment with fisetin in a dose-dependent manner. Fisetin-induced adiponectin secretion was inhibited by peroxisome proliferator-activated receptor (PPAR) antagonists. It was also revealed that fisetin increased the activities of PPARs and silent mating type information regulation 2 homologue 1 (SIRT1) in a dose-dependent manner. Furthermore, the up-regulation of adiponectin and the activation of PPARs induced by fisetin were prevented by a SIRT1 inhibitor. Fisetin also promoted deacetylation of PPAR γ coactivator 1 (PGC-1) and its interaction with PPARs. SIRT knockdown by siRNA significantly decreased both adiponectin production and PPARs-PGC-1 interaction. These results provide evidence that fisetin promotes the gene expression of adiponectin through the activation of SIRT1 and PPARs in adipocytes.
Kamp, A.
2016-01-01
When drafting the first issue of this document it sometimes felt like I was manoeuvring a small canoe through a highly viscous fluid of conservatism and complacency, with everybody bogged down by today’s thinking, preparing next Tuesday’s nine o’clock lecture, aiming for the best learning experience
Analysis of Muon Induced Neutrons in Detecting High Z Nuclear Materials
2015-03-01
pyramids for hidden chambers [4]. A similar technique could be applied to weapons inspection procedures to probe the unobservable physics package for...placed one 4000 cm2 AgBr emulsion cloud chamber located underground approximately 1 km away from the Asama vol- cano in Japan to gather density data
We examined growth performance and lipid content in juvenile cobia, Rachycentron canadum, fed a taurine supplemented (1.5%), plant protein based diet with two fish oil replacements. The first fish oil replacement was a thraustochytrid meal (TM+SOY) plus soybean oil (~9% CL) and the second was a cano...
Esteban Fernandez-Juricic; Patrick A. Zollner; Cherie LeBlanc Fisher; Lynne M. Westphal
2007-01-01
We assessed the effects of the presence and the frequency of canoe and pedestrian disturbance during two breeding seasons on multiple behavioral responses (scanning, freezing, grooming, sleeping, moving, wing-raising, and standing-up) of Black-crowned Night Heron ( Nycticorax nycticorax ) nestlings in a breeding colony in southeast Chicago. Short-...
Petrusma, Mirjan; Hessels, Gerda; Dijkhuizen, Lubbert; van der Geize, Robert
2011-01-01
The well-known large catabolic potential of rhodococci is greatly facilitated by an impressive gene multiplicity. This study reports on the multiplicity of kshA, encoding the oxygenase component of 3-ketosteroid 9 alpha-hydroxylase, a key enzyme in steroid catabolism. Five kshA homologues (kshA1 to kshA5) were previously identified in Rhodococcus rhodochrous DSM43269. These KshA(DSM43269) homologues are distributed over several phylogenetic groups. The involvement of these KshA homologues in ...
Effect Of Seasonal Rainfall And Other Environmental Changes, On ...
African Journals Online (AJOL)
Background: The last study on snail population density in relation to rainfall pattern in Kigungu canoe landing and recreational sites on Lake Victoria shore was earlier carried out about fifteen years ago. This study also reviewed the influence of other environmental factors on the snails\\' infection rate. Objective: To reassess ...
Evaluation of Schistosoma mansoni morbidity one year after ...
African Journals Online (AJOL)
The design was a Prospective cohorts study; and the setting was a busy canoe landing sites along Albert Nile in Schistosoma (S) mansoni hyperendemic areas of Rhino Camp and Obongi fishing village were selected for the study. Previously in 2005, 1562 people including fishermen and women, school pupils, teachers, ...
Visitor attitudes towards fire and wind disturbances in wilderness
Robert G. Dvorak; Erin D. Small
2011-01-01
This study examines visitor attitudes across the Boundary Waters Canoe Area Wilderness regarding the effects of natural disturbances on visitor planning and wilderness conditions. Visitors were intercepted at entry points and permit distribution locations during 2007. Results suggest that respondents were aware of recent wind and fire disturbances. Few respondents...
The Prevalence and Importance of Epithelial Plasticity in Metastatic Prostate Cancer
2014-10-01
34Dermatol"Sci#61,śV33" 13.൪" Ocana,"O."H.," Corcoles ,"R.,"Fabra,"A.,"MorenoVBueno,"G.,"Acloque,"H.,"Vega,"S.,"BarralloVGimeno,"A.,"Cano,൫" A.,"and
Pre-colonial transport systems: A veritable instrument for inter-group ...
African Journals Online (AJOL)
It thinks that pre-colonial transport systems, due to its commercial and strategic importance, were extensively used by farmers and traders, who participated actively in both internal and long distance commerce. This paper submits that, pre-colonial transport systems such as human porterage on land and dug-out canoe on ...
DEFF Research Database (Denmark)
Berlepsch, Peter; Armbruster, Thomas; Makovicky, Emil
2002-01-01
geology, xilingolite, crystal structure, twinning, lillianite homologue, electron-microprobe analyses, cannizzarite, Bi-containing galena, Mittal-Hohtenn, Valais, Switzerland......geology, xilingolite, crystal structure, twinning, lillianite homologue, electron-microprobe analyses, cannizzarite, Bi-containing galena, Mittal-Hohtenn, Valais, Switzerland...
Directory of Open Access Journals (Sweden)
Charnock F Mark L
2002-10-01
Full Text Available Abstract Background In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62% on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM. To identify the putative tumour suppressor gene, we established a physical map initially with YACs and subsequently with PACs/BACs from D6S264 to D6S149. To accelerate the identification of genes, we sequenced the entire contig of approximately 1.1 Mb. Seven genes were identified within the region of allele loss between D6S264 and D6S149. Results The human homologue of unc-93 (UNC93A in C. elegans was identified to be within the interval of allele loss centromeric to D6S149. This gene is 24.5 kb and comprises of 8 exons. There are two transcripts with the shorter one due to splicing out of exon 4. It is expressed in testis, small intestine, spleen, prostate, and ovary. In a panel of 8 ovarian cancer cell lines, UNC93A expression was detected by RT-PCR which identified the two transcripts in 2/8 cell lines. The entire coding sequence was examined for mutations in a panel of ovarian tumours and ovarian cancer cell lines. Mutations were identified in exons 1, 3, 4, 5, 6 and 8. Only 3 mutations were identified specifically in the tumour. These included a c.452G>A (W151X mutation in exon 3, c.676C>T (R226X in exon 5 and c.1225G>A(V409I mutation in exon 8. However, the mutations in exon 3 and 5 were also present in 6% and 2% of the normal population respectively. The UNC93A cDNA was shown to express at the cell membrane and encodes for a protein of 60 kDa. Conclusions These results suggest that no evidence for UNC93A as a tumour suppressor gene in sporadic ovarian cancer has been identified and further research is required to evaluate its normal function and role in the pathogenesis of ovarian cancer.
25 CFR 309.17 - What are examples of woodwork that are Indian products?
2010-04-01
... 25 Indians 2 2010-04-01 2010-04-01 false What are examples of woodwork that are Indian products... INDIAN ARTS AND CRAFTS PRODUCTS § 309.17 What are examples of woodwork that are Indian products? (a..., hunting hats, spirit masks, bows and arrows, atlatls, redwood dug out canoes, war clubs, flutes, dance...
Trends in wilderness recreation use characteristics
Alan E. Watson; David N. Cole; Joseph W. Roggenbuck
1995-01-01
Recent studies at the Leopold Institute have included analysis of use and user trends at the Boundary Waters Canoe Area Wilderness, Desolation Wilderness, Shining Rock Wilderness, the Bob Marshall Wilderness Complex, Great Smoky Mountains National Park and Eagle Cap Wilderness. Some sociodemographics, like age, education, and the proportion of female visitors, have...
Maailma põnevamatest ja populaarsematest maratonidest / Ahti Reinup
Reinup, Ahti
2015-01-01
Kõige huvitavamatest, karmimatest, pikematest või rahvarohkematest süstamaratonidest maailmas: The Dusi Canoe Marathon Lõuna-Aafrika Vabariigis, Yukon River Quest Canadas, Dalslad Kanot Maraton Rootsis, Adige Marathon Itaalias, Krumlovský vodácký maraton Tšehhis, Marathon International des Gorges de l'Ardèche Prantsusmaal ja veel mõningatest teistest
A century of forest management research in Uganda: 1898-1998
African Journals Online (AJOL)
The early people of Ugant.la derived their livelihood from natural forests by collecting wild fruits for food, fuelwood for domestic heating and metal working, wood for building and making canoes for fishing and warfare, herbs and other plant parts for. medicine, and many other social and cultural uses. Subsequently forestry ...
Barbosa Pool ,Gliserio Romeli sustentante.
2012-01-01
tesis que para obtener el grado de Doctor en Ingeniería Eléctrica, presenta liserio Romeli Barbosa Pool ; asesor Ulises Cano CastilloXVI, 135 páginas : diagramasDoctorado en Ingeniería Eléctrica UNAM, Centro de Investigación en Energía, 2012
Nolan, Christy David
2013-01-01
The Keystone Learning Community was implemented by the Department of Campus Recreation to address retention at the institution. This learning community for incoming freshmen consists of two phases. Phase I is as an outdoor orientation program that includes a three day, two night canoeing and camping experience lead by upperclassmen leaders.…
Socha, Teresa; Potter, Tom; Potter, Stephanie; Jickling, Bob
2016-01-01
This paper shares our experiences using pinhole photography with adolescents as both a pedagogical tool to support and deepen adolescent experiences in wild nature, and as a visual methodological tool to elucidate their experiences. Reflecting on a journey that explored the nature-based experiences of two adolescents on a family canoe trip in…
Winning the War on Drugs in Mexico? Toward an Integrated Approach to the Illegal Drug Trade
2009-12-01
Distributed in the USA by Palgrave Macmillan. Cano, A. (2009a, May 23). Ese verde tan peculiar de la marihuana . La Jornada, 1, 38. Retrieved May 23, 2009...on estimates of HIV and syphilis prevalence. Journal of Urban Health: Bulletin of the New York Academy of Medicine , 83(7), 83-97. Retrieved October
Public Opinion and frames: crisis of the dugout canoes
Directory of Open Access Journals (Sweden)
Dra. Raquel Rodríguez Díaz
2008-01-01
Full Text Available According to public opinion the increasing number of foreign population has became one of the most problematic issues in the last decade. Since 2005 immigration is the second biggest concern for Spaniards after unemployment and followed by terrorism. It is has became a state issue and a central government worry of utmost importance. The media coverage given to immigration is very important, specifically the way in which it is approached and presented to the readers. This paper shows the different perspectives or frames used by two key nationwide Spanish newspapers, El País y El Mundo, to cover one of the migration crises that took place in the Canary Islands in spring 2006. Following Framing theory, media content has been analyzed using variables to show the different ways in which these media depict the phenomenon of migration and the approach which each newspaper follows.
Yasugi, Mayo; Otsuka, Keisuke; Miyake, Masami
2016-10-01
Clostridium perfringens type A is a common source of food-borne illness in humans. Ingested vegetative cells sporulate in the small intestinal tract and in the process produce C. perfringens enterotoxin (CPE). Although sporulation plays a critical role in the pathogenesis of food-borne illness, the molecules triggering/inhibiting sporulation are still largely unknown. It has previously been reported by our group that sporulation is induced in C. perfringens strain NCTC8239 co-cultured with Caco-2 cells in Dulbecco's Modified Eagle Medium (DMEM). In contrast, an equivalent amount of spores was not observed when bacteria were co-cultured in Roswell Park Memorial Institute-1640 medium (RPMI). In the present study it was found that, when these two media are mixed, RPMI inhibits sporulation and CPE production induced in DMEM. When a component of RPMI was added to DMEM, it was found that calcium nitrate (Ca[NO 3 ] 2 ) significantly inhibits sporulation and CPE production. The number of spores increased when Ca(NO 3 ) 2 -deficient RPMI was used. The other nitrate salts significantly suppressed sporulation, whereas the calcium salts used did not. qPCR revealed that nitrate salts increased expression of bacterial nitrate/nitrite reductase. Furthermore, it was found that nitrite and nitric oxide suppress sporulation. In the sporulation stages, Ca(NO 3 ) 2 down-regulated the genes controlled by Spo0A, a master regulator of sporulation, but not spo0A itself. Collectively, these results indicate that nitrate salts suppress sporulation and CPE production by down-regulating Spo0A-regulated genes in C. perfringens strain NCTC8239. Nitrate reduction may be associated with inhibition of sporulation. © 2016 The Societies and John Wiley & Sons Australia, Ltd.
Calcium Solubility and Cation Exchange Properties in Zeoponic Soil
Beiersdorfer, Raymond E.
1999-01-01
An important aspect of a regenerative life support system at a Lunar or Martian outpost is the ability to produce food. Essential plant nutrients, as well as a solid support substrate, can be provided by: (1) treated Lunar or Martian regolith; (2) a synthetic soil or (3) some combination of both. A synthetic soil composed of ammonium- and potassium-saturated chinoptlolite (a zeolite mineral) and apatite, can provide slow-release fertilization of plants via dissolution and ion-exchange reactions. Previous equilibrium studies (Beiersdorfer, 1997) on mixtures of synthetic hydroxyapatite and saturated-clinoptilolite indicate that the concentrations of macro-nutrients such as ammonium, phosphorous, potassium, magnesium, and calcium are a function of the ratio of chinoptilolite to apatite in the sample and to the ratio of potassium to ammonium on the exchange sites in the clinoptilolite. Potassium, ammonium, phosphorous, and magnesium are available to plants at sufficient levels. However, calcium is deficient, due to the high degree of calcium adsorption by the clinoptilolite. Based on a series of batch-equilibration experiments, this calcium deficiency can be reduced by (1) treating the clinoptilolite with CaNO3 or (2) adding a second Ca-bearing mineral (calcite, dolomite or wollastonite) to the soil. Treating the Cp with CaNO3 results in increased Ca in solution, decreased P in solution and decreased NH4 in solution. Concentrations of K were not effected by the CaNO3 treatment. Additions of Cal, Dol and Wol changed the concentrations of Ca and P in solution in a systematic fashion. Cal has the greatest effect, Dol the least and Wol is intermediate. The changes are consistent with changes expected for a common ion effect with Ca. Higher concentrations of Ca in solution with added Cal, Dol or Wol do not result in changes in K or NH4 concentrations.
Directory of Open Access Journals (Sweden)
Anna Sykuta
2015-01-01
Full Text Available From the alga Scenedesmus acuminatus 10 carotenoids were isolated: α-carotene, β-carotene, neo-β-carotene, lutein, lutein-5,6-epoxide, violaxanthine, loroxanthine, neoxanthine, antheraxanthine and from old algae - echinenone. Algae cultured on calcium-free medium contained about 60 (per cent cartoenoids less than those from medium with Ca(NO32.
Hydrographic Measurements in the Western Arlboran Sea, October 1982.
1984-04-01
about 1 km. Individual fixes based on the satellite system were accurate to about 0.5 km and on omega to about 2.0 km. 9 Table 3. Salinity Calibration...Activity Technical Note 224. 100 p. Cano, C. and F.F. de Castillejo (1972). Contribucion al Conocimiento del Mar de Alboran: III. Variaciones del
Assessment of fishing gear and catch rate in Oguta Lake, south ...
African Journals Online (AJOL)
This study was carried out in Oguta Lake, Imo State, Nigeria, from January, 2012 to December, 2013 at five stations (Onu Utu, Okposha, Ogbe Hausa, Osemotor and Ede Ngwugwu) to ascertain the percentage abundance and catch rate of gear and craft. The average weight of fish caught per canoe per day ranged between ...
33 CFR 187.103 - What information must be collected to identify a vessel?
2010-07-01
... participating State must collect the following information on a vessel it has numbered or titled and make it... issuing authority. (f) Name of manufacturer, builder, or make. (g) Model year, manufacture year, or year...”, “auxiliary sail”, “sail only”, “personal watercraft”, “pontoon”, “houseboat”, “rowboat”, “canoe/kayak”, or...
Choo, Lehua
In this short guide, activities are described in five areas: musical instruments, games, canoe building, clothing instruction, and cooking with Hawaiian recipes. All of these activities are designed to help young Hawaiians find out about Hawaii's past. This guide is part of an artifacts kit which contains a few of the many different kinds of…
Richesse de la pharmacopée malinké : rôle médicinal de l'arbre a ...
African Journals Online (AJOL)
SARAH
28 févr. 2014 ... (les nausées/vomissements) et Borassus aethiopum (la fièvre jaune). REFERENCES BIBLIOGRAPHIQUES. Argueta, V. A., Cano A. J., 1994. Atlas de las Plantas de la Medicina Tradicional Mexicana. Instituto Nacional Indigenista. Mexico. p.1785. Caceres A., Giron, L.M., Alvarado, S.R., Torres, M.F.,. 1987.
A qualitative exploration of the wilderness experience as a source of spiritual inspiration
Laura M. Fredrickson; Dorothy H. Anderson
1999-01-01
On-site observations, personal field journals, and in-depth interviews were used to examine qualitative aspects of the wilderness experience as a source of spiritual inspiration. Two groups of women kept personal journal accounts of their daily 'lived-experience' during one of two outdoor recreation trips; five participants went to the Boundary Waters Canoe...
Right under Their Noses: Native Plants in the Schoolyard.
Reed, Bracken
2003-01-01
A Portland (Oregon) middle school teacher teaches an ethnobotany class using plants identified in Lewis and Clark's journals. After months of learning about native plants, Native American culture, and the Lewis and Clark Expedition, the class culminates in a 3-day canoe trip down the Columbia River. A Lewis and Clark Rediscovery grant provides…
Yokota, Etsuo; Vidali, Luis; Tominaga, Motoki; Tahara, Hiroshi; Orii, Hidefumi; Morizane, Yosuke; Hepler, Peter K; Shimmen, Teruo
2003-10-01
In many cases, actin filaments are arranged into bundles and serve as tracks for cytoplasmic streaming in plant cells. We have isolated an actin-filament bundling protein, which is composed of 115-kDa polypeptide (P-115-ABP), from the germinating pollen of lily, Lilium longiflorum [Nakayasu et al. (1998) BIOCHEM: Biophys. Res. Commun. 249: 61]. P-115-ABP shared similar antigenicity with a plant 135-kDa actin-filament bundling protein (P-135-ABP), a plant homologue of villin. A full-length cDNA clone (ABP115; accession no. AB097407) was isolated from an expression cDNA library of lily pollen by immuno-screening using antisera against P-115-ABP and P-135-ABP. The amino acid sequence of P-115-ABP deduced from this clone showed high homology with those of P-135-ABP and four villin isoforms of Arabidopsis thaliana (AtVLN1, AtVLN2, AtVLN3 and AtVLN4), especially AtVLN4, indicating that P-115-ABP can also be classified as a plant villin. The P-115-ABP isolated biochemically from the germinating lily pollen was able to arrange F-actin filaments with uniform polarity into bundles and this bundling activity was suppressed by Ca2+-calmodulin (CaM), similar to the actin-filament bundling properties of P-135-ABP. The P-115-ABP type of plant villin was widely distributed in plant cells, from algae to land plants. In root hair cells of Hydrocharis dubia, this type of plant villin was co-localized with actin-filament bundles in the transvacuolar strands and the sub-cortical regions. Microinjection of the antiserum against P-115-ABP into living root hair cells caused the disappearance of transvaculor strands and alteration of the route of cytoplasmic streaming. In internodal cells of Chara corallina in which the P-135-ABP type of plant villin is lacking, the P-115-ABP type showed co-localization with actin-filament cables anchored on the intracellular surface of chloroplasts. These results indicated that plant villins are widely distributed and involved in the organization of actin
2009-01-01
Dating back nearly 2000 years, the ancient Chinese tradition of Dragon Boat Racing was originally a celebration that fell on the 5th day of the 5th lunar month as a gesture to please the Gods and bring forth necessary rains to cultivate the lands. Now the CERN Canoe and Kayak Club, too, participates in this tradition, though not so much to please the Gods on the ritualistic date, but to bring forth giant smiles on the faces of members. Dragon Boat Racing has been rising steadily in popularity in Europe since the mid nineties and with the great potential to host and promote Dragon Boat Racing in the Geneva area, the CERN Canoe and Kayak Club, has taken the initiative to bring the sport to the region. Some members of the Club traveled to Dole in June to participate in the Festival Dragon Boat 2009. Under perfect sunny conditions, the team triumphed in their first ever tournament, cruising to a convincing first place overall finish. T...
Institute of Scientific and Technical Information of China (English)
1998-01-01
In the northwest of Yunnan Province lies an area of 14,703 square kilometers called Nujiang Lisu Autonomous Prefecture, which is inhabited by an ethnic group unique to Yunnan—the Nu ethnicity. The Nu people are the most ancient settlers and the earliest pioneers of the region. With a population of 27, 123(13,000 females), the Nu are among the smallest of China’s 55 ethnic groups. The Nu live in a mountainous area filled with sloping hills and steep cliffs. The roaring Nujiang River and Lacangjiang River separate the Nu from the outside world. In addition to using rope bridges, the Nu cross the rivers bv means of dugout canoes. The canoes are so small that it is hard to imagine they can be rowed in the rolling waves, but the Nu are good ferrymen. Some people believe that the changeable weather and the complicated natural environment nurtures the Nu to develop rugged and straightforward personalities. The Nu are an optimistic people who take delight in their life. The men like to play the musical instrument k
Lifescience Database Archive (English)
Full Text Available ene and FLC gene homologue concerning induction of flowering, the one of the homologue region of the top of A. thaliana chromosome 5 5 pO160E1 LG_O03 ... 2.6 ... 10.1139/g01-082 11681610
Lifescience Database Archive (English)
Full Text Available ene and FLC gene homologue concerning induction of flowering, the one of the homologue region of the top of A. thaliana chromosome 5 5 pN59E5 LG_O09 ... 2.7 ... 10.1139/g01-082 11681610
Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime
2015-07-01
Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.
Fishing effort statistics of the artisanal fisheries of the Cross River ...
African Journals Online (AJOL)
Frame surveys were carried out in 1997 and 1998 to assess the effort statistics of the artisanal fisheries of the Cross River Estuary. These surveys covered the inner Estuary and the West coast of the outer Estuary. Fishing effort was taken as number of fishers, number of canoes, and types of fishing gears. A total of 64 fishing ...
Ecological drought in the Hawaiian Islands: unique tropical systems are vulnerable to drought
Dave Helweg; Christian Giardina
2017-01-01
The Hawaiian Islands are among the most isolated and recently inhabited places on Earth. Discovered by Polynesian voyagers some 1000 years ago, people arrived to find unique wildlife and plants arrayed across a remarkable range of ecosystems. Polynesian settlers relied on traditional methods to cultivate canoe crops across the wide range of climate and soils. Early...
Influence of light, UV-B radiation, and herbicides on wax biosynthesis of cucumber seedlings
International Nuclear Information System (INIS)
Tevini, M.; Steinmüller, D.
1987-01-01
The behavior of cuticular alkane-1-ols and alkanes were studied in different developmental stages of cucumber seedlings grown in the dark or under white light, with or without UV-B radiation or in presence of wax biosynthesis inhibitors, trichloroacetic acid and metolachlor. Accumulation of alkane-1-ols increased light independently with seedling age. Synthesis of alkanes was strictly light and dose dependent. Addition of UV-B radiation did not alter the amounts of alkanes or alcohols, however, the distribution of homologues was shifted towards shorter chain homologues. Treatments with Cl 3 AcOH resulted in strong inhibition of alkane accumulation, whereas the amount of alkane-1-ols was changed neither at low nor at moderate concentrations of Cl 3 AcOH but their homologue distribution shifted towards longer chain lengths. This shifting was depressed in the presence of UV-B. At high concentrations of Cl 3 Ac0H similar homologue distributions as produced by UV-B (shift to shorter homologues) were observed. Metolachlor treatment resulted in an inhibition of alkane-1-ol production connected with rising amounts of alkanes, predominantly of short chain species. A simple model of wax biosynthesis is proposed which describes the interactions with white light, UV-B radiation and herbicides. (author)
DEFF Research Database (Denmark)
Vindas, Marco A; Gorissen, Marnix; Höglund, Erik
2017-01-01
of the 5-HT1A receptor abundance) in the proposed amygdala homologue (Dm), increased expression of the neuroplasticity marker brain derived neurotropic factor (bdnf) in both Dl and Vv (lateral septum homologue), as well as increased expression of the corticotropin releasing factor 1 (crf1) receptor...
TRAP230/ARC240 and TRAP240/ARC250 Mediator subunits are functionally conserved through evolution
DEFF Research Database (Denmark)
Samuelsen, Camilla O; Baraznenok, Vera; Khorosjutina, Olga
2003-01-01
In Saccharomyces cerevisiae Mediator, a subgroup of proteins (Srb8, Srb9, Srb10, and Srb11) form a module, which is involved in negative regulation of transcription. Homologues of Srb10 and Srb11 are found in some mammalian Mediator preparations, whereas no clear homologues have been reported...... for Srb8 and Srb9. Here, we identify a TRAP240/ARC250 homologue in Schizosaccharomyces pombe and demonstrate that this protein, spTrap240, is stably associated with a larger form of Mediator, which also contains conserved homologues of Srb8, Srb10, and Srb11. We find that spTrap240 and Sch. pombe Srb8 (sp......Srb8) regulate the same distinct subset of genes and have indistinguishable phenotypic characteristics. Importantly, Mediator containing the spSrb8/spTrap240/spSrb10/spSrb11 subunits is isolated only in free form, devoid of RNA polymerase II. In contrast, Mediator lacking this module associates...
Energy Technology Data Exchange (ETDEWEB)
Garcia, V.
2001-12-15
The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)
Sex determination of baleen whale artefacts
DEFF Research Database (Denmark)
Sinding, Mikkel Holger Strander; Tervo, Outi M.; Grønnow, Bjarne
2016-01-01
to 4500 years old bowhead whale samples, and for comparison on dilution series from modern bowhead whales of known sex. DNA sequencing of PCR products obtained from the ancient material confirmed a higher proportion of successful PCR amplifications of the X homologue over the Y homologue. This potentially...
Directory of Open Access Journals (Sweden)
Jianmin Yan
Full Text Available The translocon at the outer envelope membrane of chloroplasts (Toc mediates the recognition and initial import into the organelle of thousands of nucleus-encoded proteins. These proteins are translated in the cytosol as precursor proteins with cleavable amino-terminal targeting sequences called transit peptides. The majority of the known Toc components that mediate chloroplast protein import were originally identified in pea, and more recently have been studied most extensively in Arabidopsis. With the completion of the tomato genome sequencing project, it is now possible to identify putative homologues of the chloroplast import components in tomato. In the work reported here, the Toc GTPase cDNAs from tomato were identified, cloned and analyzed. The analysis revealed that there are four Toc159 homologues (slToc159-1, -2, -3 and -4 and two Toc34 homologues (slToc34-1 and -2 in tomato, and it was shown that tomato Toc159 and Toc34 homologues share high sequence similarity with the comparable import apparatus components from Arabidopsis and pea. Thus, tomato is a valid model for further study of this system. The expression level of Toc complex components was also investigated in different tissues during tomato development. The two tomato Toc34 homologues are expressed at higher levels in non-photosynthetic tissues, whereas, the expression of two tomato Toc159 homologues, slToc159-1 and slToc159-4, were higher in photosynthetic tissues, and the expression patterns of slToc159-2 was not significantly different in photosynthetic and non-photosynthetic tissues, and slToc159-3 expression was limited to a few select tissues.
The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases.
Wang, Tao; Xiong, Jian-Qiong
2016-02-01
The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated by TLX and its homologues in specific tissues during various developmental stages. This review aims to summarize previous studies including many recent updates from different aspects concerning TLX and its homologues in Drosophila and mouse.
Indian Academy of Sciences (India)
Madhu
The discovery of the. RNAi-based gene silencing process called meiotic silencing by unpaired DNA now provides an explana- tion for how normal sequence strains come to be selected. Meiotic silencing silences genes that are unpaired in meiosis, as well as their homologues, regardless of whether or not the homologues ...
Dennis Neitzke
2007-01-01
This case study illustrates the positive effects of strategic fuels treatments in continuous heavy fuels. In 1999, a severe windstorm blew down close to 1,000 square miles of forest land in northern Minnesota and Canada. As much as 400,000 acres of the blowdown occurred in the Boundary Waters Canoe Area Wilderness. Fire experts were invited to assess the hazardous...
2010-11-01
dimensional organic superconductors: new aspects from experiments to theory - New quantum phenomena in strongly correlated systems Distribution A: Approved...electric motors (e.g. for vehicle propulsion, or maglev trains), magnetic levitation devices, fault current limiters and superconducting magnetic...Netherlands) Spin-charge-density wave instability in 2D tight-binding models Cano-Cotes (Spain) Quantum criticality in quarter-filled layered organic
The Effects of College Students' Personal Values on Changes in Learning Approaches
Lietz, Petra; Matthews, Bobbie
2010-01-01
Many studies of changes in learning approaches have used data from different age groups at one point in time only (Gow and Kember, High Educ 19:307-322, 1990; Watkins and Hattie, Br J Educ Psychol 51:384-393, 1981) or have analyzed the effects of just two or three factors using single level analytical techniques (Cano, Br J Educ Psychol…
African Journals Online (AJOL)
gelida. Non ho più nulla da offrire. Sono veramente solo. Nudo. Pronto a riceverli. Al grido sfrecciano verso di me tre lunghe canoe. Li vedo bene mentre avanzano. Sembrano per lo più muti e tesi, questi. Inuit della costa orientale. Sono tutti uomini, tranne una donna, ritta sulla prua. Mi grida: “Dicci il tuo nome! Dicci chi sei!
Development of the Zebra Danio Model: Carcinogenesis and Gene Transfer Studies
1996-09-01
Volhard, C. (1992). The protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of...protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of the early embryo
Kroczynska, Barbara; Evangelista, Christina M; Samant, Shalaka S; Elguindi, Ebrahim C; Blond, Sylvie Y
2004-03-19
The murine tumor cell DnaJ-like protein 1 or MTJ1/ERdj1 is a membrane J-domain protein enriched in microsomal and nuclear fractions. We previously showed that its lumenal J-domain stimulates the ATPase activity of the molecular chaperone BiP/GRP78 (Chevalier, M., Rhee, H., Elguindi, E. C., and Blond, S. Y. (2000) J. Biol. Chem. 275, 19620-19627). MTJ1/ERdj1 also contains a large carboxyl-terminal cytosolic extension composed of two tryptophan-mediated repeats or SANT domains for which the function(s) is unknown. Here we describe the cloning of the human homologue HTJ1 and its interaction with alpha(1)-antichymotrypsin (ACT), a member of the serine proteinase inhibitor (serpin) family. The interaction was initially identified in a two-hybrid screening and further confirmed in vitro by dot blots, native electrophoresis, and fluorescence studies. The second SANT domain of HTJ1 (SANT2) was found to be sufficient for binding to ACT, both in yeast and in vitro. Single tryptophan-alanine substitutions at two strictly conserved residues significantly (Trp-497) or totally (Trp-520) abolished the interaction with ACT. SANT2 binds to human ACT with an intrinsic affinity equal to 0.5 nm. Preincubation of ACT with nearly stoichiometric concentrations of SANT2 wild-type but not SANT2: W520A results in an apparent loss of ACT inhibitory activity toward chymotrypsin. Kinetic analysis indicates that the formation of the covalent inhibitory complex ACT-chymotrypsin is significantly delayed in the presence of SANT2 with no change on the catalytic efficiency of the enzyme. This work demonstrates for the first time that the SANT2 domain of MTJ1/HTJ1/ERdj1 mediates stable and high affinity protein-protein interactions.
Dewitz, C.; Pimpinella, S.; Hackel, P.; Akalin, A.; Jessell, T.M.; Zampieri, N.
2018-01-01
Motor neurons in the spinal cord are found grouped in nuclear structures termed pools, whose position is precisely orchestrated during development. Despite the emerging role of pool organization in the assembly of spinal circuits, little is known about the morphogenetic programs underlying the patterning of motor neuron subtypes. We applied three-dimensional analysis of motor neuron position to reveal the roles and contributions of cell adhesive function by inactivating N-cadherin, catenin, a...
Contrastive Analysis of the Raman Spectra of Polychlorinated Benzene: Hexachlorobenzene and Benzene
Directory of Open Access Journals (Sweden)
Zhengjun Zhang
2011-12-01
Full Text Available Detection of persistent pollutants such as polychlorinated benzene in environment in trace amounts is challenging, but important. It is more difficult to distinguish homologues and isomers of organic pollutantd when present in trace amounts because of their similar physical and chemical properties. In this work we simulate the Raman spectra of hexachlorobenzene and benzene, and figure out the vibration mode of each main peak. The effect on the Raman spectrum of changing substituents from H to Cl is analyzed to reveal the relations between the Raman spectra of homologues and isomers of polychlorinated benzene, which should be helpful for distinguishing one kind of polychlorinated benzene from its homologues and isomers by surface enhanced Raman scattering.
2006-04-01
follows U.S. Highway 98. This ridge divides the Base into the Beach Dunes and Wave- Cut Bluffs physiographic region to the west and the Flatwoods Forest...wild petunia Ruellia noctiflora E Wet prairie BIRDS American oystercatcher Haematopus palliates SSC Shoreline Bald eagle Haliaeetus leucocephalus...outdoor recreation activities, including boating, canoeing, fishing, fuel wood cutting , horseback riding, hunting, and trail walking. The Base has nine
2007-11-08
increasingly important, corresponding to development of the tomol (a plank canoe), single-piece shell fishhooks, and harpoons (Glassow 1996; King 1990). The...Moratto 1984:118). Leadership was hereditary and chiefs exercised control over more than one village, reflecting a simple chiefdom social organization...Archaeology, University of California, Los Angeles. Erlandson, Jon M., and Kevin Bartoy 1995 Cabrillo, the Chumash, and Old World Diseases. Journal
Pollination induces autophagy in petunia petals via ethylene.
Shibuya, Kenichi; Niki, Tomoko; Ichimura, Kazuo
2013-02-01
Autophagy is one of the main mechanisms of degradation and remobilization of macromolecules, and it appears to play an important role in petal senescence. However, little is known about the regulatory mechanisms of autophagy in petal senescence. Autophagic processes were observed by electron microscopy and monodansylcadaverine staining of senescing petals of petunia (Petunia hybrida); autophagy-related gene 8 (ATG8) homologues were isolated from petunia and the regulation of expression was analysed. Nutrient remobilization was also examined during pollination-induced petal senescence. Active autophagic processes were observed in the mesophyll cells of senescing petunia petals. Pollination induced the expression of PhATG8 homologues and was accompanied by an increase in ethylene production. Ethylene inhibitor treatment in pollinated flowers delayed the induction of PhATG8 homologues, and ethylene treatment rapidly upregulated PhATG8 homologues in petunia petals. Dry weight and nitrogen content were decreased in the petals and increased in the ovaries after pollination in detached flowers. These results indicated that pollination induces autophagy and that ethylene is a key regulator of autophagy in petal senescence of petunia. The data also demonstrated the translocation of nutrients from the petals to the ovaries during pollination-induced petal senescence.
Isotherms of ion exchange on titanates of alkaline metals
International Nuclear Information System (INIS)
Fillina, L.P.; Belinskaya, F.A.
1986-01-01
Present article is devoted to isotherms of ion exchange on titanates of alkaline metals. Therefore, finely dispersed hydrated titanates of alkaline metals (lithium, sodium, potassium) with ion exchange properties are obtained by means of alkaline hydrolysis of titanium chloride at high ph rates. Sorption of cations from salts solution of Li 2 SO 4 , NaNO 3 , Ca(NO 3 ) 2 , AgNO 3 by titanates is studied.
2009-12-01
in size, would be cut and the vegetation within this area would be maintained below a height of2 feet. The site is located adjacent to industrial...slopes, cypress swamps White-flowered wild petunia Ruellia noctiflora E G2/S2 Wet prairies, wet flatwoods, seepage slopes Common Name...recreational activities, including boating, canoeing, fishing, wood cutting , hunting, and trail walking. The Base has nine fishing lakes, three nature
Vliv vybraných kondičních a psychických faktorů na výkon závodníka ve vodním slalomu
Jančar, David
2008-01-01
Title of project: Influence of selected conditions and psychological factors on final athletes performance in white water slalom. Objectives: The aim of this work is to compare selected fitness and psychological parameters in athletes Canoe slalom and determine their impact on the resulting performance in the race. Methods of data processing: To determine the statistical correlation between sports performance and selected factors of sports performance was used nonparametric correlation study ...
1989-07-01
antibodies which fix the infecting micro -organisms, do not kill them, but which favour their phagocytosis by neutrophils by allowing binding of the complement...aneurysms, can also induce the same systemic response. In the case of infection, the type of invading micro -organisms does not seem to influence the...INVOLVED IN THE PATHOPHYSIOLOGY OF SHOCK M. Sanchez Crespo, S. Fernandez-Gallardo and E. Cano Servicio de Nefrologia, Fundacion Jimenez Diaz Avenida
Management a marketing sportovní akce: ICF Slalom World Ranking Race Prague 2009
Kubričan, Lukáš
2009-01-01
Title: Management and marketing of sport's event: ICF Slalom World Ranking Race Prague 2009 Objectives: Present strengths and weaknesses of ICF Slalom World Ranking Race Prague 2009 based on analyse of recent years and present ideas for its improvement. Methods: Descriptive analysis, SWOT analysis and interview with expert. Results: Conclusion and advices for organizers of sport's events. Key words: Management, marketing, SWOT analysis, descriptive analysis, sport's event, canoe slalom compet...
2015-05-15
1 = Baseball/ Softball 2 = Basketball 3 = Biking 4 = Bird Watching 5 = Boating (sailing, kayaking, canoeing) 6 = Fishing 7 = Flying a Kite 8...visit to Fort Dupont Park today: Select all that apply. 1 = Baseball/ Softball 2 = Basketball 3 = Biking 4 = Bird Watching 5 = Boating (sailing...select which of the following activities you did during your visit to Rock Creek Park today: Select all that apply. 1 = Baseball/ Softball 2
Pemasaran Bagi Petualang sebagai Kegiatan Komunikasi Pemasaran
Tresnati, Ratih
2006-01-01
Marketing for Adventurer aims adventurer as its consumers. Instead of revenue-based, adventurer consumer is based on lifestyle. Their hobbies are outdoor sports such as bungee jumping, rock climbing, off-road driving, wild-river canoeing, etc. Marketing for adventurer has specific strategic: (1) STP Strategy—market segmenting, market targeting, market positioning; (2) Customer Experience Strategy (CES) as the sequel of Experiential Marketing (EM). EM focuses more on emotion touch and feelings.
Pemasaran bagi Petualang sebagai Kegiatan Komunikasi Pemasaran
Ratih Tresnati
2006-01-01
Marketing for Adventurer aims adventurer as its consumers. Instead of revenue-based, adventurer consumer is based on lifestyle. Their hobbies are outdoor sports such as bungee jumping, rock climbing, off-road driving, wild-river canoeing, etc. Marketing for adventurer has specific strategic: (1) STP Strategy—market segmenting, market targeting, market positioning; (2) Customer Experience Strategy (CES) as the sequel of Experiential Marketing (EM). EM focuses more on emotion touch and feelings.
Characterization of the Pseudomonas aeruginosa Lol system as a lipoprotein sorting mechanism.
Tanaka, Shin-Ya; Narita, Shin-Ichiro; Tokuda, Hajime
2007-05-04
Escherichia coli lipoproteins are localized to either the inner or the outer membrane depending on the residue that is present next to the N-terminal acylated Cys. Asp at position 2 causes the retention of lipoproteins in the inner membrane. In contrast, the accompanying study (9) revealed that the residues at positions 3 and 4 determine the membrane specificity of lipoproteins in Pseudomonas aeruginosa. Since the five Lol proteins involved in the sorting of E. coli lipoproteins are conserved in P. aeruginosa, we examined whether or not the Lol proteins of P. aeruginosa are also involved in lipoprotein sorting but utilize different signals. The genes encoding LolCDE, LolA, and LolB homologues were cloned and expressed. The LolCDE homologue thus purified was reconstituted into proteoliposomes with lipoproteins. When incubated in the presence of ATP and a LolA homologue, the reconstituted LolCDE homologue released lipoproteins, leading to the formation of a LolA-lipoprotein complex. Lipoproteins were then incorporated into the outer membrane depending on a LolB homologue. As revealed in vivo, lipoproteins with Lys and Ser at positions 3 and 4, respectively, remained in proteoliposomes. On the other hand, E. coli LolCDE released lipoproteins with this signal and transferred them to LolA of not only E. coli but also P. aeruginosa. These results indicate that Lol proteins are responsible for the sorting of lipoproteins to the outer membrane of P. aeruginosa, as in the case of E. coli, but respond differently to inner membrane retention signals.
Directory of Open Access Journals (Sweden)
Thiago Barbosa Batista
2016-01-01
Full Text Available Palisade grass is a forage plant that is widely used in pasture cropping in the Brazilian savannah. The aim of this experiment was to evaluate palisade grass (Brachiaria brizantha cv. MG–5 seeds subjected to priming and stress at high humidity and temperature (before and after conditioning. The experimental design was completely randomized in a 2x5 factorial arrangement. Seeds were exposed to stress under high humidity and temperature (before and after conditioning and five priming treatments [Water (Control, potassium nitrate (KNO3 at 0.2%, calcium nitrate Ca(NO32 at 0.2%, gibberellin (GA3 at 0.2% and glucose at 10%] with four replications. Two experiments were performed: Experiment I - seed with chemical scarification using H2SO4 and Experiment II - without scarification. The stress on the seed was applied using artificial aging at 41°C for 96 hours. Seed priming was accomplished by immersion at 25°C for 2 hours. Thereafter, the seeds were oven-dried at 35°C until they regained hygroscopic equilibrium. Seed germination and vigor were evaluated. Priming using KNO3 and Ca(NO32 produced seeds with high tolerance to stress under high temperature, and this process is efficient to overcome dormancy.
Molecular characterization of the thioredoxin system from Methanosarcina acetivorans
McCarver, Addison C.; Lessner, Daniel J.
2014-01-01
The thioredoxin system, composed of thioredoxin reductase (TrxR) and thioredoxin (Trx), is widely distributed in nature, where it serves key roles in electron transfer and in defense against oxidative stress. Although recent evidence reveals Trx homologues are almost universally present among the methane-producing archaea (methanogens), a complete thioredoxin system has not been characterized from any methanogen. We examined the phylogeny of Trx homologues among methanogens and characterized ...
Conduct and Support of Amphibious Operations from United States Submarines in World War II
2010-11-01
indoctrination. He worked with his staff to develop new tactics and force structure , and lobbied for special consideration for extra firepower. While...remaining seventy men by boat and outrigger canoe in the more sheltered lagoon that evening. In less than forty hours on the island, the raiders...months later, they accepted the burden of a radio system that required four men to carry because it was ―absolutely reliable.‖88 In addition to
Environmental Assessment for Landfill Drainage Improvements Vandenberg Air Force Base, California
2003-04-07
became increasingly important, corresponding to development of the tomol (a plank canoe), single-piece shell fishhooks, and harpoons (Glassow 1996...Chumash had a culture that "was as elaborate as that of any hunter-gatherer society on earth" (Moratto 1984: 118). Leadership was hereditary and chiefs...Improvements Vandenberg Air Force Base, California I I I I I I I Erlandson, Jon M., and Kevin Bartoy 1995 Cabrillo, the Chumash, and Old
Pemasaran bagi Petualang sebagai Kegiatan Komunikasi Pemasaran
Directory of Open Access Journals (Sweden)
Ratih Tresnati
2006-12-01
Full Text Available Marketing for Adventurer aims adventurer as its consumers. Instead of revenue-based, adventurer consumer is based on lifestyle. Their hobbies are outdoor sports such as bungee jumping, rock climbing, off-road driving, wild-river canoeing, etc. Marketing for adventurer has specific strategic: (1 STP Strategy—market segmenting, market targeting, market positioning; (2 Customer Experience Strategy (CES as the sequel of Experiential Marketing (EM. EM focuses more on emotion touch and feelings.
Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.
Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J
2011-08-01
DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.
Elucidating the Role of CaMKK in Cell Cycle and Cell Fate using a C. elegans model
2000-07-01
domain) or the Aspergillus homologue, anCaMKB (48% overall)(Figure 2). To functionally compare the C. elegans proteins with their mammalian homologues...subunit on the yeast proteome . EMBO J 18, 4157-68 (1999). 14 19. H. Tokumitsu et aL, Substrate recognition by Ca2+/Calmodulin-dependent protein kinase...2 Nicholas School of the Environment Duke University, Durham, NC 27710 Ethan@Duke.Edu In a variety of models, from Xenopus oocytes to Aspergillus to
Investigación del conglomerado colapsable de la Cano-Vitor Arequipa
Fernández Sixto, Erasmo Alejandro; Fernández Sixto, Erasmo Alejandro
1998-01-01
El conocimiento de la existencia de suelos compuestos por un conglomerado de partículas gruesas (gravas, guijarros y botones) embebidos dentro de una matriz de partículas menores (arenas, limos y arcillas), que posee un comportamiento colapsable; no tiene precedentes en el Perú a excepción de la advertencia señalada por el profesor Alberto Martínez Vargas (1980). Justamente el mencionado investigador atribuyó al suelo de la formación Sotillo localizado en la escarpa del Pie de la Cuesta en el...
Advanced Infusion Techniques with 3-D Printed Tooling
Energy Technology Data Exchange (ETDEWEB)
Nuttall, David [ORNL; Elliott, Amy M [ORNL; Post, Brian K [ORNL; Love, Lonnie J [ORNL
2016-05-10
The manufacturing of tooling for large, contoured surfaces for fiber-layup applications requires significant effort to understand the geometry and then to subtractively manufacture the tool. Traditional methods for the auto industry use clay that is hand sculpted. In the marine pleasure craft industry, the exterior of the model is formed from a foam lay-up that is either hand cut or machined to create smooth lines. Engineers and researchers at Oak Ridge National Laboratory s Manufacturing Demonstration Facility (ORNL MDF) collaborated with Magnum Venus Products (MVP) in the development of a process for reproducing legacy whitewater adventure craft via digital scanning and large scale 3-D printed layup molds. The process entailed 3D scanning a legacy canoe form, converting that form to a CAD model, additively manufacturing (3-D Print) the mold tool, and subtractively finishing the mold s transfer surfaces. Future work will include applying a gelcoat to the mold transfer surface and infusing using vacuum assisted resin transfer molding, or VARTM principles, to create a watertight vessel. The outlined steps were performed on a specific canoe geometry found by MVP s principal participant. The intent of utilizing this geometry is to develop an energy efficient and marketable process for replicating complex shapes, specifically focusing on this particular watercraft, and provide a finished product for demonstration to the composites industry. The culminating part produced through this agreement has been slated for public presentation and potential demonstration at the 2016 CAMX (Composites and Advanced Materials eXpo) exposition in Anaheim, CA. Phase I of this collaborative research and development agreement (MDF-15-68) was conducted under CRADA NFE-15-05575 and was initiated on May 7, 2015, with an introduction to the MVP product line, and concluded in March of 2016 with the printing of and processing of a canoe mold. The project partner Magnum Venous Products (MVP) is
Ma, Q.; He, H.
2012-12-01
Internally mixed oxalic acid with mineral dust has been frequently detected in field measurements (Sullivan and Prather, 2007; Wang et al., 2012; Yang et al., 2009). Meanwhile, Furukawa and Takahashi (Furukawa and Takahashi, 2011) found that most of the oxalic acid in mineral mixture is present as metal oxalate complexes in the aerosols, however, the formation mechanism of these complexes is not well known. It was reported that cloud process of H2C2O4/CaCO3 mixture could lead to the formation of calcium oxalate (Gierlus et al., 2012). Recently, we used Raman spectroscopy to investigate the hygroscopic behavior of H2C2O4/CaCO3 mixture below saturation condition as well as the effect of coexisting hygroscopic compositions, e.g. Ca(NO3)2, NaCl, NH4NO3, and (NH4)2SO4. It was found that there was no interaction between H2C2O4 and calcite without third component during humidifying process under ambient condition. In contrast, the presence of coexisting Ca(NO)3, NaCl, or NH4NO3 could promote the reaction between H2C2O4 and calcite by providing an aqueous circumstance after deliquescence, resulting in the formation of calcium oxalate hydrates. Moreover, substitution of strong acid (HNO3) by medium acid (H2C2O4) occurred when water vapor was absorbed in Ca(NO3)2/H2C2O4 mixture (Ma and He, 2012). As for (NH4)2SO4, there existed a competition effect between (NH4)2SO4 and H2C2O4 for the reaction with CaCO3. CaCO3 was preferentially reacted with (NH4)2SO4 to form gypsum in the solution, while the residual NH4+ and C2O42- ions were bonded to (NH4)2C2O4 after efflorescence. These results implies a potential formation pathway of metal oxalate complexes in the atmosphere and also suggests that synergistic effect between different constituents in humidifying process of mixed particles should be considered in future hygroscopic behavior studies.
Maurer, Joshua A.; Elmore, Donald E.; Lester, Henry A.; Dougherty, Dennis A.
2000-01-01
Sequence analysis of 35 putative MscL homologues was used to develop an optimal alignment for Escherichia coli and Mycobacterium tuberculosis MscL and to place these homologues into sequence subfamilies. By using this alignment, previously identified E. coli MscL mutants that displayed severe and very severe gain of function phenotypes were mapped onto the M. tuberculosis MscL sequence. Not all of the resulting M. tuberculosis mutants displayed a gain of function phenotype; for instance, norm...
Conserved chromosomal positions of dual domains of the ets protooncogene in cats, mice, and humans
International Nuclear Information System (INIS)
Watson, D.K.; McWilliams-Smith, M.J.; Kozak, C.
1986-01-01
The mammalian protooncogene homologue of the avian v-ets sequence from the E26 retrovirus consists of two sequentially distinct domains located on different chromosomes. Using somatic cell hybrid panels, the authors have mapped the mammalian homologue of the 5' v-ets-domain to chromosome 11 (ETS1) in man, to chromosome 9 (ets-1) in mouse, and to chromosome D1 (ETS1) in the domestic cat. The mammalian homologue of the 3' v-ets domain was similarly mapped to human chromosome 21 (ETS2), to mouse chromosome 16 (Ets-2), and to feline chromosome C2 (ETS2). Both protooncogenes fell in syntenic groups of homologous linked loci that were conserved among the three species. The occurrence of two distinct functional protooncogenes and their conservation of linkage positions in the three mammalian orders indicate that these two genes have been separate since before the evolutionary divergence of mammals
Tule Reeds and Stone - Localized, Non-Specialized Technology in Laguna Canyon, Santa Cruz Island
Sunell, Scott David
2013-01-01
This project aims to understand the ways in which the Island Chumash who were not participating in specialized bead-making activities invested their labor. Considerable research on the Northern Channel Islands focuses on the nature and distribution of specialist labor spent on beads, drills, and sewn-plank canoes. The history of small-scale production based on the resources in individual canyons on the islands has received less attention. I categorize two new types of heavy igneous tools that...
1979-05-01
Stewart (an American missionary) accompanied Lord Byron on his voyage to Hawai’i to return the bodies of Kamehameha II and his wife, who had died in...Upon going ashore, Kamehameha caught his foot in a crevice, and an opponent struck him with a canoe paddle. As a result, Kamehameha issued his famous...presence of a bay (Papa’i) suit- able for fishing, the historic Kamehameha legend implying the existence of some inhabitants, and the apparent
Arsenic in your food: potential health hazards from arsenic found in rice
Carbonell-Barrachina, Ãngel; Munera-Picazo,Sandra; Cano-Lamadrid,Marina; Burló,Francisco; Castaño-Iglesias,MarÃa Concepción
2015-01-01
Sandra Munera-Picazo,1 Marina Cano-Lamadrid,1 María Concepción Castaño-Iglesias,2 Francisco Burló,1 Ángel A Carbonell-Barrachina11Food Quality and Safety Group, Department of Agro-Food Technology, Universidad Miguel Hernández, Orihuela, 2Servicio de Pediatría, Hospital Universitario San Juan de Alicante, Alicante, SpainAbstract: Rice is a staple food for over half of the world population, but there is some concern ab...
Human exposure to cyanotoxins and their effects on health.
Drobac, Damjana; Tokodi, Nada; Simeunović, Jelica; Baltić, Vladimir; Stanić, Dina; Svirčev, Zorica
2013-06-01
Cyanotoxins are secondary metabolites produced by cyanobacteria. They pose a threat to human health and the environment. This review summarises the existing data on human exposure to cyanotoxins through drinking water, recreational activities (e.g., swimming, canoeing or bathing), the aquatic food web, terrestrial plants, food supplements, and haemodialysis. Furthermore, it discusses the tolerable daily intake and guideline values for cyanotoxins (especially microcystins) as well as the need to implement risk management measures via national and international legislation.
Smith, Joseph T.; Singha, Ujjal K.; Misra, Smita
2018-01-01
ABSTRACT The small Tim proteins belong to a group of mitochondrial intermembrane space chaperones that aid in the import of mitochondrial inner membrane proteins with internal targeting signals. Trypanosoma brucei, the protozoan parasite that causes African trypanosomiasis, possesses multiple small Tim proteins that include homologues of T. brucei Tim9 (TbTim9) and Tim10 (TbTim10) and a unique small Tim that shares homology with both Tim8 and Tim13 (TbTim8/13). Here, we found that these three small TbTims are expressed as soluble mitochondrial intermembrane space proteins. Coimmunoprecipitation and mass spectrometry analysis showed that the small TbTims stably associated with each other and with TbTim17, the major component of the mitochondrial inner membrane translocase in T. brucei. Yeast two-hybrid analysis indicated direct interactions among the small TbTims; however, their interaction patterns appeared to be different from those of their counterparts in yeast and humans. Knockdown of the small TbTims reduced cell growth and decreased the steady-state level of TbTim17 and T. brucei ADP/ATP carrier (TbAAC), two polytopic mitochondrial inner membrane proteins. Knockdown of small TbTims also reduced the matured complexes of TbTim17 in mitochondria. Depletion of any of the small TbTims reduced TbTim17 import moderately but greatly hampered the stability of the TbTim17 complexes in T. brucei. Altogether, our results revealed that TbTim9, TbTim10, and TbTim8/13 interact with each other, associate with TbTim17, and play a crucial role in the integrity and maintenance of the levels of TbTim17 complexes. IMPORTANCE Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite’s mitochondrion represents a useful source for potential chemotherapeutic targets. Similarly to yeast and humans, mitochondrial functions depend on the import of proteins that are encoded in the nucleus and made in the cytosol. Even though the machinery involved in this
Nicolas Sarkozy a recu son homologue estonien
2008-01-01
Prantsusmaa president Nicolas Sarkozy pakkus 7. aprillil 2008 Elysée palees kohtumisel president Toomas Hendrik Ilvesega Eestile Prantsusmaa abi tuumaenergeetika küsimustes. Vabariigi President töövisiidil Pariisis 6.-8.04.2008
LBP/BPI homologue in Eisenia andrei earthworms
Czech Academy of Sciences Publication Activity Database
Škanta, František; Procházková, Petra; Roubalová, Radka; Dvořák, Jiří; Bilej, Martin
2016-01-01
Roč. 54, č. 1 (2016), s. 1-6 ISSN 0145-305X R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Earthworm * Eisenia * LBP/BPI Subject RIV: EC - Immunology Impact factor: 3.218, year: 2016
Directory of Open Access Journals (Sweden)
Jiankun Peng
2015-06-01
Full Text Available This paper presents a rule-based energy management strategy for a plug-in hybrid school bus (PHSB. In order to verify the effectiveness and rationality of the proposed energy management strategy, the powertrain and control models were built with MATLAB/Simulink. The PHSB powertrain model includes an engine model, ISG (integrated started and generator model, drive motor model, power battery packs model, driver model, and vehicle longitudinal dynamics model. To evaluate the controller area network (CAN bus performance features such as the bus load, signal hysteresis, and to verify the reliability and real-time performance of the CAN bus multi-node control method, a co-simulation platform was built with CANoe and MATLAB/Simulink. The co-simulation results show that the control strategy can meet the requirements of the PHSB’s dynamic performance. Meanwhile, the charge-depleting mode (CD and charge-sustaining mode (CS can switch between each other and maintain a state-of-charge (SoC of around 30%, indicating that the energy management strategy effectively extends the working period of the CD mode and improves the fuel economy further. The energy consumption per 100 km includes 13.7 L diesel and 10.5 kW·h electricity with an initial SoC of 75%. The CANoe simulation results show that the bus communication performs well without error frames.
Yu, Xian-Mei; Wang, Jin-Zheng; Nie, Pei-Xian; Xue, Xaio-Min; Wang, Gui-Ping; An, Miao
2018-04-20
The preharvest application of Ca-containing foliar fertilizers can reduce bitter pit (BP) incidence in apples and improve fruit quality by increasing the Ca content and decreasing both the N content and the N/Ca ratio in fruits. In this study, we aimed to investigate the control efficacy of Ca-containing fertilizers on BP incidence and the effects on the Ca and N contents in bagged 'Fuji' apple by spraying the foliar fertilizer containing calcium chloride (CaCl 2 ), calcium nitrate [Ca(NO 3 ) 2 ] or calcium formate [Ca(HCOO) 2 ] at early stage [5 days after full bloom (DAFB) + 40 DAFB] and at late stage (80 DAFB + 125 DAFB). The BP incidences were reduced significantly with the reduce percentage of 43.2~73.0%, and the efficacy of spraying at early stage was significantly higher than that of spraying at late stage. The Ca content of bagged apple fruits was increased while the N content and N/Ca ratio were decreased after spraying Ca-containing foliar fertilizers, however, the Ca content, N content and N/Ca ratio of apple leaves were differentially influenced. The foliar fertilizer containing CaCl 2, Ca(NO 3 ) 2 or Ca(HCOO) 2 could be used at early stage to control BP in apple and improve the quality of bagged apple fruits. This article is protected by copyright. All rights reserved.
Si-substituted hydroxyapatite nanopowders: Synthesis, thermal stability and sinterability
International Nuclear Information System (INIS)
Bianco, Alessandra; Cacciotti, Ilaria; Lombardi, Mariangela; Montanaro, Laura
2009-01-01
Synthetic hydroxyapatites incorporating small amounts of Si have shown improved biological performances in terms of enhanced bone apposition, bone in-growth and cell-mediated degradation. This paper reports a systematic investigation on Si-substituted hydroxyapatite (Si 1.40 wt%) nanopowders produced following two different conventional wet methodologies: (a) precipitation of Ca(NO 3 ) 2 .4H 2 O and (b) titration of Ca(OH) 2 . The influence of the synthesis process on composition, thermal behaviour and sinterability of the resulting nanopowders is studied. Samples were characterised by electron microscopy, induced coupled plasma atomic emission spectroscopy, thermal analysis, infrared spectroscopy, N 2 adsorption measurements, X-ray diffraction and dilatometry. Semicrystalline Si-substituted hydroxyapatite powders made up of needle-like nanoparticles were obtained, the specific surface area ranged between 84 and 110 m 2 /g. Pure and Si-substituted hydroxyapatite nanopowders derived from Ca(NO 3 ) 2 .4H 2 O decomposed around 1000 deg. C. Si-substituted hydroxyapatite nanopowders obtained from Ca(OH) 2 were thermally stable up to 1200 deg. C and showed a distinct decreased thermal stability with respect to the homologous pure sample. Si-substituted hydroxyapatites exhibited higher sintering temperature and increased total shrinkage with respect to pure powders. Nanostructured dense ceramics were obtained by sintering at 1100 deg. C Si-substituted hydroxyapatites derived from Ca(OH) 2
Maximum Intervention: Renewal of a Maori Waka by George Nuku and National Museums Scotland
Directory of Open Access Journals (Sweden)
Charles Stable
2012-05-01
Full Text Available National Museums Scotland (NMS has in its collections a Mäori war canoe (A.UC.767 or 'Waka Taua 'from New Zealand'.' The 'Waka' had been held in the Museum stores for many years and due to its incompleteness and poor state of repair had not been on public display. It was proposed that the 'Waka' be restored with the intention of it being a focal point of a new permanent gallery in the Royal Museum in Edinburgh dedicated to South Pacific cultures and communities. The gallery was being developed as one part of a £44 million redevelopment of Royal Museum building. Due to its poor condition assistance was sought to help in the restoration, reconstruction and visual interpretation of the 'Waka'. NMS commissioned George Nuku, a Mäori carver, to remake missing parts. Nuku uses a variety of mediums to carve including Polymethyl Methacrylate (PMMA. This made a clear distinction between new and original material that could be easily read by the public and reflected Nuku’s conceptual vision of creating physical “ghosts” influenced by the original carvings. Due to the composite construction and condition of the canoe the project became more complex and involved. This paper describes how the renewal was done and relationships that developed between the artist, curator and conservator.
Vliv úzkosti na výkon závodníka v rychlostní kanoistice.
Andrlík, Jan
2011-01-01
Title of diploma paper: Effect of anxiety on the athlete's sports performance in flatwater canoeing. Objectives: The aim of the study was to find out the values of competitive state anxiety and evaluate its influence on sports performance in a race. Methods: The questionnaire method CSAI-2 has been used to determine the values of the components of competitive state anxiety. The observed values were statistically compared with the standards of the best athletes and then analyzed with the perfo...
Synthesis and characterization of porous calcium phosphate
International Nuclear Information System (INIS)
Granados C, F.; Serrano G, J.; Bonifacio M, J.
2007-01-01
The porous calcium phosphate was prepared by the continuous precipitation method using Ca(NO 3 ) 2 .4H 2 O and NH 4 H 2 PO 4 salts. The synthesized material was structurally and superficially characterized using the XRD, BET, IR TGA and SEM techniques. The obtained inorganic material was identified as calcium phosphate that presents a great specific area for what can be efficiently used as adsorbent material for adsorption studies in the radioactive wastes treatment present in aqueous solution. (Author)
Connective Tissue Growth Factor (CTGF) as a Regulator of Lactogenic Differentiation
2009-06-09
Gonzalez- Nieves, Ms. Anne Marie Dizon, and Mr. James Warren. I would like to say a special thank you to Mr. Young Lee, who spent his free time...bio-pathological features and prognosis. Ann Oncol 19:73-80. 214. Rico, M. C., J. J. Rough, F. E. Del Carpio-Cano, S. P. Kunapuli, and R. A. Dela...Lewis, K. Terrell , J. P. McManaman, and S. M. Anderson. 2008. Lactation failure in Src knockout mice is due to impaired secretory activation. BMC Dev
MirHassan Rasouli-Sadaghiani; Mohammad Moghaddas Gerani; Sanaz Ashrafi Saeidlou; Ebrahim Sepehr
2017-01-01
In order to determine the effect of different Ca sources, in improving enzymatic activity and some qualitative properties of red apple (Malusdomestica) an experiment was carried out in a completely randomized design. Apple trees were sprayed 5 times with CaCl2, CaO, Ca-EDTA and Ca(NO3)2 salts with an interval of 20 days from late June until early October. After harvesting fruits were kept in cold storage at standard condition for 150 days. Nitrogen, phosphorus, potassium, calcium, magnesium, ...
DEFF Research Database (Denmark)
Hansen, Michael; Bowra, Steve; Lange, Mette
2010-01-01
The storage proteins of barley, in terms of both amino acid profile and quantity, are traits strongly influenced by the amount of nitrogen applied. Given this, we performed a developmental expression analysis of the genes from barley grains grown under field conditions to further our understanding...... profile under different N regimes. Reviewing the expression of the storage protein homologues within the families revealed markedly different temporal profiles; for example, some alleles were expressed very early in development. Furthermore, the differential temporal expression of the homologues suggested...
Czudnochowski, Nadine; Wang, Amy Liya; Finer-Moore, Janet; Stroud, Robert M
2013-10-23
Human pseudouridine (Ψ) synthase Pus1 (hPus1) modifies specific uridine residues in several non-coding RNAs: tRNA, U2 spliceosomal RNA, and steroid receptor activator RNA. We report three structures of the catalytic core domain of hPus1 from two crystal forms, at 1.8Å resolution. The structures are the first of a mammalian Ψ synthase from the set of five Ψ synthase families common to all kingdoms of life. hPus1 adopts a fold similar to bacterial Ψ synthases, with a central antiparallel β-sheet flanked by helices and loops. A flexible hinge at the base of the sheet allows the enzyme to open and close around an electropositive active-site cleft. In one crystal form, a molecule of Mes [2-(N-morpholino)ethane sulfonic acid] mimics the target uridine of an RNA substrate. A positively charged electrostatic surface extends from the active site towards the N-terminus of the catalytic domain, suggesting an extensive binding site specific for target RNAs. Two α-helices C-terminal to the core domain, but unique to hPus1, extend along the back and top of the central β-sheet and form the walls of the RNA binding surface. Docking of tRNA to hPus1 in a productive orientation requires only minor conformational changes to enzyme and tRNA. The docked tRNA is bound by the electropositive surface of the protein employing a completely different binding mode than that seen for the tRNA complex of the Escherichia coli homologue TruA. Copyright © 2013 Elsevier Ltd. All rights reserved.
Islam, Mohammad T; Garg, Gagan; Hancock, William S; Risk, Brian A; Baker, Mark S; Ranganathan, Shoba
2014-01-03
The chromosome-centric human proteome project (C-HPP) aims to define the complete set of proteins encoded in each human chromosome. The neXtProt database (September 2013) lists 20,128 proteins for the human proteome, of which 3831 human proteins (∼19%) are considered "missing" according to the standard metrics table (released September 27, 2013). In support of the C-HPP initiative, we have extended the annotation strategy developed for human chromosome 7 "missing" proteins into a semiautomated pipeline to functionally annotate the "missing" human proteome. This pipeline integrates a suite of bioinformatics analysis and annotation software tools to identify homologues and map putative functional signatures, gene ontology, and biochemical pathways. From sequential BLAST searches, we have primarily identified homologues from reviewed nonhuman mammalian proteins with protein evidence for 1271 (33.2%) "missing" proteins, followed by 703 (18.4%) homologues from reviewed nonhuman mammalian proteins and subsequently 564 (14.7%) homologues from reviewed human proteins. Functional annotations for 1945 (50.8%) "missing" proteins were also determined. To accelerate the identification of "missing" proteins from proteomics studies, we generated proteotypic peptides in silico. Matching these proteotypic peptides to ENCODE proteogenomic data resulted in proteomic evidence for 107 (2.8%) of the 3831 "missing proteins, while evidence from a recent membrane proteomic study supported the existence for another 15 "missing" proteins. The chromosome-wise functional annotation of all "missing" proteins is freely available to the scientific community through our web server (http://biolinfo.org/protannotator).
International Nuclear Information System (INIS)
Shaposhnikov, M.V.; Zainullin, V.G.
2003-01-01
Full text: In primary study on Drosophila it was found that irradiated male X-chromosomes induce recessive lethals in unirradiated female homologues (Abeleva et al., 1961, Radiobiologya. 1:123-126). The same effects were obtained in Drosophila in some recent investigations. The mechanisms of these effects is unknown. However it may be responsible for low-dose radiation effects as it induce mutations in unirradiated DNA. We assume that this effect may be a result of activation of error prone repair in response to preliminary DNA lesions in irradiated chromosome. In this research we analyse the frequencies of the recessive lethal mutations in the X-chromosome of Drosophila females mated with irradiated Basc males. We used acute irradiation with a dose rate of 10 Gy. For testing our hypothesis we use the mus209 and mei-41 mutant females. Mus209 is a PCNA gene homologue and mei-41 is a homologue of ATM gene. These genes are involved in post-replication DNA repair which may be error prone repair in Drosophila. It was obtained the tendency to decreasing the mutation rate at the mei-41[D5] background and decreasing mutation rate in mus209[B1] background in comparison with wild type strains CS (p<0.05). The obtained results demonstrate the possible role of mus209[B1] and mei-41[D5] genes in the inducing of mutations in the unirradiated X-chromosome in the presence of irradiated homologue
Synthesis and antimicrobial activity of long-chain 3,4-Epoxy-2-alkanones.
Wood, William F
2010-01-01
3,4-Epoxy-2-dodecanone, a major component in the preorbital gland of the African grey duiker (Sylvicapra grimmia), showed antimicrobial activity in preliminary tests. The C(11) to C(17) homologues of this compound were prepared and their activity against several pathogenic dermal bacteria and fungi was tested. 3,4-Epoxy-2-dodecanone and 3,4-epoxy-2-tridecanone inhibited the growth of Trichophyton mentagrophytes at 25 Îg/mL. Moderate inhibition of the growth of the bacteria Propionibacterium acnes and the lipophilic yeast, Pityrosporum ovale, was seen for several of the homologues.
Michael Hoch
2011-01-01
Photo 1-4: Visit to CMS Control Room with G. Tonelli,CMS Collaboration Spokesperson Photo 5-9,16-20:CMS experimental area Photo 10-15:LHC Tunnel at Point 5 Photo 21:F. Madlener,Director of IRCAM Paris+S. Dorny,Director-General Lyon Opera House+C. Bollman,Art by Genève+M. Doser,AEgIS Collaboration Spokesperson,Former Physics Department Deputy Head+A. Koek,International Arts Development+G. Tonelli+M. Monje Cano,Arts Development Assistant (part-time work experience)+B. Ruf,Director of Kunsthalle Zürich
El bestiario de Cristo en los Autos Sacramentales de Calderón
Alonso Rey, Maria Dolores
2005-01-01
communication en attente de publication. El maravilloso mundo de los autos sacramentales. Casa de Velázquez. Madrid. 2005; Del conjunto de figuras y símbolos con los que Calderón representa a Cristo nos interesa analizar los símbolos zoomórficos. Nos interrogaremos sobre su utilización, los contextos en los que aparecen, sus valores visuales y sus potencialidades expresivas. No se elige más que a cinco de ellos : ciervo, león, cordero, pelícano y serpiente.
Fiftieth Anniversary at the summit
2005-01-01
Neither fear of heights nor the cold succeeded in cooling the ardour of four brave climbers from CERN who celebrated CERN's 50th Anniversary at the summit of Mount Kilimanjaro (5,895 metres). On the way back from the summit, Miguel Cerqueira Bastos (AB/PO), David Collados Polidura (IT/GM), Sandra Sequeira Tavares (PH/CMI) and Daniel Cano Ott (n_TOF) raised the official CERN Jubilee flag at 4750 metres altitude. How long will it be before a CERN flag is planted on the moon?
Ca2+-dependent phospholipid scrambling by a reconstituted TMEM16 ion channel.
Malvezzi, Mattia; Chalat, Madhavan; Janjusevic, Radmila; Picollo, Alessandra; Terashima, Hiroyuki; Menon, Anant K; Accardi, Alessio
2013-01-01
Phospholipid (PL) scramblases disrupt the lipid asymmetry of the plasma membrane, externalizing phosphatidylserine to trigger blood coagulation and mark apoptotic cells. Recently, members of the TMEM16 family of Ca(2+)-gated channels have been shown to be involved in Ca(2+)-dependent scrambling. It is however controversial whether they are scramblases or channels regulating scrambling. Here we show that purified afTMEM16, from Aspergillus fumigatus, is a dual-function protein: it is a Ca(2+)-gated channel, with characteristics of other TMEM16 homologues, and a Ca(2+)-dependent scramblase, with the expected properties of mammalian PL scramblases. Remarkably, we find that a single Ca(2+) site regulates separate transmembrane pathways for ions and lipids. Two other purified TMEM16-channel homologues do not mediate scrambling, suggesting that the family diverged into channels and channel/scramblases. We propose that the spatial separation of the ion and lipid pathways underlies the evolutionary divergence of the TMEM16 family, and that other homologues, such as TMEM16F, might also be dual-function channel/scramblases.
Prokaryotic cells: structural organisation of the cytoskeleton and organelles
Directory of Open Access Journals (Sweden)
Wanderley de Souza
2012-05-01
Full Text Available For many years, prokaryotic cells were distinguished from eukaryotic cells based on the simplicity of their cytoplasm, in which the presence of organelles and cytoskeletal structures had not been discovered. Based on current knowledge, this review describes the complex components of the prokaryotic cell cytoskeleton, including (i tubulin homologues composed of FtsZ, BtuA, BtuB and several associated proteins, which play a fundamental role in cell division, (ii actin-like homologues, such as MreB and Mb1, which are involved in controlling cell width and cell length, and (iii intermediate filament homologues, including crescentin and CfpA, which localise on the concave side of a bacterium and along its inner curvature and associate with its membrane. Some prokaryotes exhibit specialised membrane-bound organelles in the cytoplasm, such as magnetosomes and acidocalcisomes, as well as protein complexes, such as carboxysomes. This review also examines recent data on the presence of nanotubes, which are structures that are well characterised in mammalian cells that allow direct contact and communication between cells.
Makou, Matthew; Eglinton, Timothy; McIntyre, Cameron; Montluçon, Daniel; Antheaume, Ingrid; Grossi, Vincent
2018-01-01
Specific n-alkanes and n-alkanoic acids are commonly used as biomarkers in paleoenvironmental reconstruction, yet any individual homologue may originate from multiple biological sources. Here we improve source and age controls for these compounds in meromictic systems by measuring the radiocarbon (14C) ages of specific homologues preserved in twentieth century Lake Pavin (France) sediments. In contrast to many studies, 14C ages generally decreased with increasing carbon chain length, from 7.3 to 2.6 ka for the C14-C30 n-alkanoic acids and from 9.2 to 0.3 ka for the C21-C33 n-alkanes. Given a known hard water effect, these values suggest that aquatic microbial sources predominate and contributed to most of the homologues measured. Only the longest chain n-alkanes exclusively represent inputs of higher plant waxes, which were previously sequestered in soils over centennial to millennial timescales prior to transport and deposition. These findings suggest that biomarker source and age should be carefully established for lacustrine settings.
Levine, Lanfang H.; Garland, Jay L.; Johnson, Jodie V.
2002-01-01
An amphoteric (cocamidopropylbetaine, CAPB) and a nonionic (alcohol polyethoxylate, AE) surfactant were characterized by electrospray ionization quadrupole ion trap mass spectrometry (ESI-MS) as to their homologue distribution and ionization/fragmentation chemistry. Quantitative methods involving reversed-phase gradient HPLC and (+)ESI-MSn were developed to directly determine these surfactants in hydroponic plant growth medium that received simulated graywater. The predominant homologues, 12 C alkyl CAPB and 9 EO AE, were monitored to represent the total amount of the respective surfactants. The methods demonstrated dynamic linear ranges of 0.5-250 ng (r2 > 0.996) for CAPB and 8-560 ng (r2 > 0.998) for AE homologue mixture, corresponding to minimum quantification limits of 25 ppb CAPB and 0.4 ppm AE with 20-microL injections. This translated into an even lower limit for individual components due to the polydispersive nature of the surfactants. The procedure was successfully employed for the assessment of CAPB and AE biodegradation in a hydroponic plant growth system used as a graywater bioreactor.
Zhong, Guannan; Zhao, Qunfei; Zhang, Qinglin; Liu, Wen
2017-07-01
γ-Glutamyltranspeptidases (γ-GTs), ubiquitous in glutathione metabolism for γ-glutamyl transfer/hydrolysis, are N-terminal nucleophile (Ntn)-hydrolase fold proteins that share an autoproteolytic process for self-activation. γ-GT homologues are widely present in Gram-positive actinobacteria where their Ntn-hydrolase activities, however, are not involved in glutathione metabolism. Herein, we demonstrate that the formation of 4-Alkyl-L-(dehydro)proline (ALDP) residues, the non-proteinogenic α-amino acids that serve as vital components of many bioactive metabolites found in actinobacteria, involves unprecedented Ntn-hydrolase activity of γ-GT homologue for C-C bond cleavage. The related enzymes share a key Thr residue, which acts as an internal nucleophile for protein hydrolysis and then as a newly released N-terminal nucleophile for carboxylate side-chain processing likely through the generation of an oxalyl-Thr enzyme intermediate. These findings provide mechanistic insights into the biosynthesis of various ALDP residues/associated natural products, highlight the versatile functions of Ntn-hydrolase fold proteins, and particularly generate interest in thus far less-appreciated γ-GT homologues in actinobacteria.
Directory of Open Access Journals (Sweden)
Koffi, KD.
2009-01-01
Full Text Available Costal Upwelling Impact on the Abundance and Sizes of Blue Marlins (Makaira nigricans, Lacepède, 1802 Captures by Artisans Fishers in the Offing of Ivory Coast. This study concern blue marlins (Makaira nigricans, Lacepede 1802 landed by sea artisan fishers in Abidjan port (Ivory Coast from February 2006 to January 2007. During the Great Warm Season (GWS March-April-May, the surface temperature average is 28.61 °C. With a Fishing Effort (FE of 3,874 canoes; 285 blue marlins have been landed. Their weigh average is 77.70 kg with a Capture by Unit Effort (CPUE of 5.62 kg. During this warm season, 187 blue marlins (65.61 % have their sizes between 105 and 200 cm against only 98 (34.39% which exceeds 200 cm. During the Great Cold Season (GCS july-august-september, the average temperature is 25.58 °C. With 7,338 canoes (FE went in sea, 244 fishes have a average weigh of 140.36 kg and a CPUE of 4.23 kg. During this upwelling period, only 43 M. nigricans (17.62% have their size between 105 and 200 cm, against 201 (82.38% which measure more than 200 cm. Therefore these two seasons, sizes and weights variance analyze with the Test-t show respectively a p-value highly significant (p- value = 2,255 x 10 -15 < 5% et (p- value = 7,508 x10 -12 < 5%.
Directory of Open Access Journals (Sweden)
Ricardo Ventura Santos
1985-12-01
Full Text Available Foram realizados 639 exames parasitológicos das fezes na população indígena dos vales dos rios Guaporé e Mamoré, no Estado de Rondônia, constituída predominantemente por índios Pacaas-Novos e outros grupos populacionalmente menores (Massacá, Ajuru, Canoé, Jabuti, Mequém, Tupari e Macurap. Os resultados foram os seguintes: Ascaris lumbricoides (21,3%, Trichuris trichiura (1,6%, ancilostomídeos (12,2%, Strongyloides stercoralis (3,9%, Enterobius vermicularis (2,0%, Hymenolepis nana (0,3%, Capillaria sp. (0,2%, Giardia lamblia (12,7% e Entamoeba hystolitica (8,8%. Os dados obtidos são comparados com os de outros autores que realizaram inquéritos semelhantes em outras áreas indígenas da Amazônia.This paper reports the results of parasitological studies of stools carried among the amerindian population of the Guaporé and Mamoré river valleys, in the State of Rondônia, Brazil The population is constituted mainly of Pacaas-Novos indians and other smaller groups (Massacá, Ajuru, Canoé, Jabuti, Mequém, Tupari and Macurap. The following species were found: Ascaris lumbricoides (21,3%, Trichuris trichiura (1,6%Ancilostomidae (12,2%, Strongyloides stercoralis (3,9%, Enterobius vermicularis (2,0%, Hymenolepis nana (0,3%, Capillaria sp. (0,2%, Giardia lamblia (12,7% and Entamoeba hystolitica (8,8%. The results are discussed and compared with those obtained by other authors among different Amazonian groups.
Directory of Open Access Journals (Sweden)
J. Gajewski
2011-11-01
Full Text Available The goal of the study was to determine a strength profile in young female athletes practising different sports and to use allometry to evaluate muscular strength with respect to body mass. The study included 42 women who practised taekwondo (n = 10, weightlifting (n = 10, canoeing (n = 14 and speed skating (n = 8. Measurements of maximal muscle torques under static conditions in 10 groups of flexors and extensors of the elbow, shoulder, hip, knee and trunk were carried out. The MANCOVA procedure was employed to compare means between the groups. A logarithm of body mass was adopted as a covariate. Relationships between body mass and muscle torques in each muscle group were determined using a procedure of linear regression. The analysis of residuals was employed for the evaluation of maximal muscle torques. Mean values of logarithms of maximal muscle torques were significantly different for the representatives of individual sports and they depended on the logarithm of body mass. It was proposed to use a mean of residuals normalized for individual muscle groups as a synthetic strength index (mean of the strength profile. The women practising canoeing were characterized by the highest strength index. Its lowest values were obtained by weightlifting and taekwondo athletes. Differences in strength profiles in the tested athletes were attributed to the specific nature of their sports. It is suggested to use an allometric relationship scaled by body mass for strength assessment.
Climate windows for Polynesian voyaging to New Zealand and Easter Island.
Goodwin, Ian D; Browning, Stuart A; Anderson, Atholl J
2014-10-14
Debate about initial human migration across the immense area of East Polynesia has focused upon seafaring technology, both of navigation and canoe capabilities, while temporal variation in sailing conditions, notably through climate change, has received less attention. One model of Polynesian voyaging observes that as tradewind easterlies are currently dominant in the central Pacific, prehistoric colonization canoes voyaging eastward to and through central East Polynesia (CEP: Society, Tuamotu, Marquesas, Gambier, Southern Cook, and Austral Islands) and to Easter Island probably had a windward capacity. Similar arguments have been applied to voyaging from CEP to New Zealand against prevailing westerlies. An alternative view is that migration required reliable off-wind sailing routes. We investigate the marine climate and potential voyaging routes during the Medieval Climate Anomaly (MCA), A.D. 800-1300, when the initial colonization of CEP and New Zealand occurred. Paleoclimate data assimilation is used to reconstruct Pacific sea level pressure and wind field patterns at bidecadal resolution during the MCA. We argue here that changing wind field patterns associated with the MCA provided conditions in which voyaging to and from the most isolated East Polynesian islands, New Zealand, and Easter Island was readily possible by off-wind sailing. The intensification and poleward expansion of the Pacific subtropical anticyclone culminating in A.D. 1140-1260 opened an anomalous climate window for off-wind sailing routes to New Zealand from the Southern Austral Islands, the Southern Cook Islands, and Tonga/Fiji Islands.
Selenium utilization in thioredoxin and catalytic advantage provided by selenocysteine
International Nuclear Information System (INIS)
Kim, Moon-Jung; Lee, Byung Cheon; Hwang, Kwang Yeon; Gladyshev, Vadim N.; Kim, Hwa-Young
2015-01-01
Thioredoxin (Trx) is a major thiol-disulfide reductase that plays a role in many biological processes, including DNA replication and redox signaling. Although selenocysteine (Sec)-containing Trxs have been identified in certain bacteria, their enzymatic properties have not been characterized. In this study, we expressed a selenoprotein Trx from Treponema denticola, an oral spirochete, in Escherichia coli and characterized this selenoenzyme and its natural cysteine (Cys) homologue using E. coli Trx1 as a positive control. 75 Se metabolic labeling and mutation analyses showed that the SECIS (Sec insertion sequence) of T. denticola selenoprotein Trx is functional in the E. coli Sec insertion system with specific selenium incorporation into the Sec residue. The selenoprotein Trx exhibited approximately 10-fold higher catalytic activity than the Sec-to-Cys version and natural Cys homologue and E. coli Trx1, suggesting that Sec confers higher catalytic activity on this thiol-disulfide reductase. Kinetic analysis also showed that the selenoprotein Trx had a 30-fold higher K m than Cys-containing homologues, suggesting that this selenoenzyme is adapted to work efficiently with high concentrations of substrate. Collectively, the results of this study support the hypothesis that selenium utilization in oxidoreductase systems is primarily due to the catalytic advantage provided by the rare amino acid, Sec. - Highlights: • The first characterization of a selenoprotein Trx is presented. • The selenoenzyme Trx exhibits 10-fold higher catalytic activity than Cys homologues. • Se utilization in Trx is primarily due to the catalytic advantage provided by Sec residue
Selenium utilization in thioredoxin and catalytic advantage provided by selenocysteine
Energy Technology Data Exchange (ETDEWEB)
Kim, Moon-Jung [Department of Biochemistry and Molecular Biology, Yeungnam University College of Medicine, Daegu 705-717 (Korea, Republic of); Lee, Byung Cheon [Division of Genetics, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA 02115 (United States); Division of Biotechnology, College of Life Sciences & Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Hwang, Kwang Yeon [Division of Biotechnology, College of Life Sciences & Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Gladyshev, Vadim N. [Division of Genetics, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA 02115 (United States); Kim, Hwa-Young, E-mail: hykim@ynu.ac.kr [Department of Biochemistry and Molecular Biology, Yeungnam University College of Medicine, Daegu 705-717 (Korea, Republic of)
2015-06-12
Thioredoxin (Trx) is a major thiol-disulfide reductase that plays a role in many biological processes, including DNA replication and redox signaling. Although selenocysteine (Sec)-containing Trxs have been identified in certain bacteria, their enzymatic properties have not been characterized. In this study, we expressed a selenoprotein Trx from Treponema denticola, an oral spirochete, in Escherichia coli and characterized this selenoenzyme and its natural cysteine (Cys) homologue using E. coli Trx1 as a positive control. {sup 75}Se metabolic labeling and mutation analyses showed that the SECIS (Sec insertion sequence) of T. denticola selenoprotein Trx is functional in the E. coli Sec insertion system with specific selenium incorporation into the Sec residue. The selenoprotein Trx exhibited approximately 10-fold higher catalytic activity than the Sec-to-Cys version and natural Cys homologue and E. coli Trx1, suggesting that Sec confers higher catalytic activity on this thiol-disulfide reductase. Kinetic analysis also showed that the selenoprotein Trx had a 30-fold higher K{sub m} than Cys-containing homologues, suggesting that this selenoenzyme is adapted to work efficiently with high concentrations of substrate. Collectively, the results of this study support the hypothesis that selenium utilization in oxidoreductase systems is primarily due to the catalytic advantage provided by the rare amino acid, Sec. - Highlights: • The first characterization of a selenoprotein Trx is presented. • The selenoenzyme Trx exhibits 10-fold higher catalytic activity than Cys homologues. • Se utilization in Trx is primarily due to the catalytic advantage provided by Sec residue.
Directory of Open Access Journals (Sweden)
Vera Forsbach-Birk
Full Text Available Enzootic abortion of ewes (EAE due to infection with the obligate intracellular pathogen Chlamydia (C. abortus is an important zoonosis leading to considerable economic loss to agriculture worldwide. The pathogen can be transmitted to humans and may lead to serious infection in pregnant women. Knowledge about epidemiology, clinical course and transmission to humans is hampered by the lack of reliable diagnostic tools. Immunoreactive proteins, which are expressed in infected animals and humans, may serve as novel candidates for diagnostic marker proteins and represent putative virulence factors. In order to broaden the spectrum of immunogenic C. abortus proteins we applied 2D immunoblot analysis and screening of an expression library using human and animal sera. We have identified 48 immunoreactive proteins representing potential diagnostic markers and also putative virulence factors, such as CAB080 (homologue of the "macrophage infectivity potentiator", MIP, CAB167 (homologue of the "translocated actin recruitment protein", TARP, CAB712 (homologue of the "chlamydial protease-like activity factor", CPAF, CAB776 (homologue of the "Polymorphic membrane protein D", PmpD, and the "hypothetical proteins" CAB063, CAB408 and CAB821, which are predicted to be type III secreted. We selected two putative virulence factors for further characterization, i.e. CAB080 (cMIP and CAB063, and studied their expression profiles at transcript and protein levels. Analysis of the subcellular localization of both proteins throughout the developmental cycle revealed CAB063 being the first C. abortus protein shown to be translocated to the host cell nucleus.
Forsbach-Birk, Vera; Foddis, Corinna; Simnacher, Ulrike; Wilkat, Max; Longbottom, David; Walder, Gernot; Benesch, Christiane; Ganter, Martin; Sachse, Konrad; Essig, Andreas
2013-01-01
Enzootic abortion of ewes (EAE) due to infection with the obligate intracellular pathogen Chlamydia (C.) abortus is an important zoonosis leading to considerable economic loss to agriculture worldwide. The pathogen can be transmitted to humans and may lead to serious infection in pregnant women. Knowledge about epidemiology, clinical course and transmission to humans is hampered by the lack of reliable diagnostic tools. Immunoreactive proteins, which are expressed in infected animals and humans, may serve as novel candidates for diagnostic marker proteins and represent putative virulence factors. In order to broaden the spectrum of immunogenic C. abortus proteins we applied 2D immunoblot analysis and screening of an expression library using human and animal sera. We have identified 48 immunoreactive proteins representing potential diagnostic markers and also putative virulence factors, such as CAB080 (homologue of the "macrophage infectivity potentiator", MIP), CAB167 (homologue of the "translocated actin recruitment protein", TARP), CAB712 (homologue of the "chlamydial protease-like activity factor", CPAF), CAB776 (homologue of the "Polymorphic membrane protein D", PmpD), and the "hypothetical proteins" CAB063, CAB408 and CAB821, which are predicted to be type III secreted. We selected two putative virulence factors for further characterization, i.e. CAB080 (cMIP) and CAB063, and studied their expression profiles at transcript and protein levels. Analysis of the subcellular localization of both proteins throughout the developmental cycle revealed CAB063 being the first C. abortus protein shown to be translocated to the host cell nucleus.
Forsbach-Birk, Vera; Foddis, Corinna; Simnacher, Ulrike; Wilkat, Max; Longbottom, David; Walder, Gernot; Benesch, Christiane; Ganter, Martin; Sachse, Konrad; Essig, Andreas
2013-01-01
Enzootic abortion of ewes (EAE) due to infection with the obligate intracellular pathogen Chlamydia (C.) abortus is an important zoonosis leading to considerable economic loss to agriculture worldwide. The pathogen can be transmitted to humans and may lead to serious infection in pregnant women. Knowledge about epidemiology, clinical course and transmission to humans is hampered by the lack of reliable diagnostic tools. Immunoreactive proteins, which are expressed in infected animals and humans, may serve as novel candidates for diagnostic marker proteins and represent putative virulence factors. In order to broaden the spectrum of immunogenic C. abortus proteins we applied 2D immunoblot analysis and screening of an expression library using human and animal sera. We have identified 48 immunoreactive proteins representing potential diagnostic markers and also putative virulence factors, such as CAB080 (homologue of the “macrophage infectivity potentiator”, MIP), CAB167 (homologue of the “translocated actin recruitment protein”, TARP), CAB712 (homologue of the “chlamydial protease-like activity factor”, CPAF), CAB776 (homologue of the “Polymorphic membrane protein D”, PmpD), and the “hypothetical proteins” CAB063, CAB408 and CAB821, which are predicted to be type III secreted. We selected two putative virulence factors for further characterization, i.e. CAB080 (cMIP) and CAB063, and studied their expression profiles at transcript and protein levels. Analysis of the subcellular localization of both proteins throughout the developmental cycle revealed CAB063 being the first C. abortus protein shown to be translocated to the host cell nucleus. PMID:24260366
Scherthan, Harry; Schöfisch, Karina; Dell, Thomas; Illner, Doris
2014-12-01
The spatial distribution of parental genomes has attracted much interest because intranuclear chromosome distribution can modulate the transcriptome of cells and influence the efficacy of meiotic homologue pairing. Pairing of parental chromosomes is imperative to sexual reproduction as it translates into homologue segregation and genome haploidization to counteract the genome doubling at fertilization. Differential FISH tagging of parental pericentromeric genome portions and specific painting of euchromatic chromosome arms in Mus musculus (MMU) × Mus spretus (MSP) hybrid spermatogenesis disclosed a phase of homotypic non-homologous pericentromere clustering that led to parental pericentric genome separation from the pre-leptoteneup to zygotene stages. Preferential clustering of MMU pericentromeres correlated with particular enrichment of epigenetic marks (H3K9me3), HP1-γ and structural maintenance of chromosomes SMC6 complex proteins at the MMU major satellite DNA repeats. In contrast to the separation of heterochromatic pericentric genome portions, the euchromatic arms of homeologous chromosomes showed considerable presynaptic pairing already during leptotene stage of all mice investigated. Pericentric genome separation was eventually disbanded by telomere clustering that concentrated both parental pericentric genome portions in a limited nuclear sector of the bouquet nucleus. Our data disclose the differential behavior of pericentromeric heterochromatin and the euchromatic portions of the parental genomes during homologue search. Homotypic pericentromere clustering early in prophase I may contribute to the exclusion of large repetitive DNA domains from homology search, while the telomere bouquet congregates and registers spatially separated portions of the genome to fuel synapsis initiation and high levels of homologue pairing, thus contributing to the fidelity of meiosis and reproduction.
The vacuolar channel VvALMT9 mediates malate and tartrate accumulation in berries of Vitis vinifera.
De Angeli, Alexis; Baetz, Ulrike; Francisco, Rita; Zhang, Jingbo; Chaves, Maria Manuela; Regalado, Ana
2013-08-01
Vitis vinifera L. represents an economically important fruit species. Grape and wine flavour is made from a complex set of compounds. The acidity of berries is a major parameter in determining grape berry quality for wine making and fruit consumption. Despite the importance of malic and tartaric acid (TA) storage and transport for grape berry acidity, no vacuolar transporter for malate or tartrate has been identified so far. Some members of the aluminium-activated malate transporter (ALMT) anion channel family from Arabidopsis thaliana have been shown to be involved in mediating malate fluxes across the tonoplast. Therefore, we hypothesised that a homologue of these channels could have a similar role in V. vinifera grape berries. We identified homologues of the Arabidopsis vacuolar anion channel AtALMT9 through a TBLASTX search on the V. vinifera genome database. We cloned the closest homologue of AtALMT9 from grape berry cDNA and designated it VvALMT9. The expression profile revealed that VvALMT9 is constitutively expressed in berry mesocarp tissue and that its transcription level increases during fruit maturation. Moreover, we found that VvALMT9 is targeted to the vacuolar membrane. Using patch-clamp analysis, we could show that, besides malate, VvALMT9 mediates tartrate currents which are higher than in its Arabidopsis homologue. In summary, in the present study we provide evidence that VvALMT9 is a vacuolar malate channel expressed in grape berries. Interestingly, in V. vinifera, a tartrate-producing plant, the permeability of the channel is apparently adjusted to TA.
Fernandes, Josely Dantas; Dantas, Edilma Rodrigues Bento; Barbosa, Juliana Nóbrega; Barbosa, Edimar Alves
2011-01-01
A ocorrência de solos contaminados com o elemento chumbo está se tornando cada vez mais comum. Ele é, essencialmente, um contaminante ambiental e suas concentrações no meio ambiente vem aumentando de acordo com a aplicação sempre crescente em diversos produtos industriais necessários à sociedade moderna. Hoje, usa-se o chumbo, por exemplo, na fabricação de canos, em revestimentos de cabos elétricos, de chapas para pias, cisternas e telhados e, principalmente, na indústria de baterias automoti...
Composición e invarianza factorial del cuestionario IMAGEN en adolescentes mexicanos y españoles
Blanco, J.R.; Solano, N.; Benavides, E.V.; Ornelas, M.
2017-01-01
El presente estudio analiza las propiedades psicométricas propuestos por Solano-Pinto y Cano-Vindel (2010) para el cuestionario IMAGEN. La muestra total fue de 533 participantes 257 mexicanos y 276 españoles, con una edad media de 13.15 años (DE=1.10). La estructura factorial del cuestionario se analizó a través de análisis factoriales exploratorios y confirmatorios. Los análisis, muestran que una estructura de cinco factores es viable y adecuada. La estructura de cinco factores (perceptivo, ...
Rodríguez-Ríos, Hernán E; Campos-Parra, Jorge A; Williams-Salinas, Pamela A; Blanck-Heimann, Markus H; Astudillo-Neira, Rita G; Grande-Cano, Jesús D
2015-01-01
H.E. Rodríguez-Ríos, J.A. Campos-Parra, P.A. Williams-Salinas, M.H. Blanck-Heimann, R.G. Astudillo-Neira, and J.D. Grande-Cano. 2015. The inclusion of distiller’s dried corn grains with solubles in the feed of laying hens during the production stage. Cien. Inv. Agr. 42(3): 331-339. The aim of this study was to assess the effects of distiller’s dried corn grains with solubles (DDGS) in the diet of laying hens on their productive parameters (live weight, laying percentage, and feed intake) and ...
The contribution of Nth and Nei DNA glycosylases to mutagenesis in Mycobacterium smegmatis.
Moolla, Nabiela; Goosens, Vivianne J; Kana, Bavesh D; Gordhan, Bhavna G
2014-01-01
The increased prevalence of drug resistant strains of Mycobacterium tuberculosis (Mtb) indicates that significant mutagenesis occurs during tuberculosis disease in humans. DNA damage by host-derived reactive oxygen/nitrogen species is hypothesized to be critical for the mutagenic process in Mtb thus, highlighting an important role for DNA repair enzymes in maintenance of genome fidelity. Formamidopyrimidine (Fpg/MutM/Fapy) and EndonucleaseVIII (Nei) constitute the Fpg/Nei family of DNA glycosylases and together with EndonucleaseIII (Nth) are central to the base excision repair pathway in bacteria. In this study we assess the contribution of Nei and Nth DNA repair enzymes in Mycobacterium smegmatis (Msm), which retains a single nth homologue and duplications of the Fpg (fpg1 and fpg2) and Nei (nei1 and nei2) homologues. Using an Escherichia coli nth deletion mutant, we confirm the functionality of the mycobacterial nth gene in the base excision repair pathway. Msm mutants lacking nei1, nei2 and nth individually or in combination did not display aberrant growth in broth culture. Deletion of nth individually results in increased UV-induced mutagenesis and combinatorial deletion with the nei homologues results in reduced survival under oxidative stress conditions and an increase in spontaneous mutagenesis to rifampicin. Deletion of nth together with the fpg homolgues did not result in any growth/survival defects or changes in mutation rate. Furthermore, no differential emergence of the common rifampicin resistance conferring genotypes were noted. Collectively, these data confirm a role for Nth in base excision repair in mycobacteria and further highlight a novel interplay between the Nth and Nei homologues in spontaneous mutagenesis. Copyright © 2013 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Villa, A.; Strina, D.; Frattini, A. [Consiglio Nazionale delle Ricerche, Milan (Italy)] [and others
1996-07-15
We have previously reported the characterization of the human ZNF75 gene located on Xq26, which has only limited homology (less than 65%) to other ZF genes in the databases. Here, we describe three human zinc finger genes with 86 to 95% homology to ZNF75 at the nucleotide level, which represent all the members of the human ZNF75 subfamily. One of these, ZNF75B, is a pseudogene mapped to chromosome 12q13. The other two, ZNF75A and ZNF75C, maintain on ORF in the sequenced region, and at least the latter is expressed in the U937 cell line. They were mapped to chromosomes 16 and 11, respectively. All these genes are conserved in chimpanzees, gorillas, and orangutans. The ZNF75B homologue is a pseudogene in all three great apes, and in chimpanzee it is located on chromosome 10 (phylogenetic XII), at p13 (corresponding to the human 12q13). The chimpanzee homologue of ZNF75 is also located on the Xq26 chromosome, in the same region, as detected by in situ hybridization. As expected, nucleotide changes were clearly more abundant between human and organutan than between human and chimpanzee or gorilla homologues. Members of the same class were more similar to each other than to the other homologues within the same species. This suggests that the duplication and/or retrotranscription events occurred in a common ancestor long before great ape speciation. This, together with the existance of at least two genes in cows and horses, suggests a relatively high conservation of this gene family. 20 refs., 5 figs., 1 tab.
Structure of a hexameric form of RadA recombinase from Methanococcus voltae
International Nuclear Information System (INIS)
Du, Liqin; Luo, Yu
2012-01-01
Hexameric rings of RadA recombinase from M. voltae have been crystallized. Structural comparisons suggest that homologues of RadA tend to form double-ringed assemblies. Archaeal RadA proteins are close homologues of eukaryal Rad51 and DMC1 proteins and are remote homologues of bacterial RecA proteins. For the repair of double-stranded breaks in DNA, these recombinases promote a pivotal strand-exchange reaction between homologous single-stranded and double-stranded DNA substrates. This DNA-repair function also plays a key role in the resistance of cancer cells to chemotherapy and radiotherapy and in the resistance of bacterial cells to antibiotics. A hexameric form of a truncated Methanococcus voltae RadA protein devoid of its small N-terminal domain has been crystallized. The RadA hexamers further assemble into two-ringed assemblies. Similar assemblies can be observed in the crystals of Pyrococcus furiosus RadA and Homo sapiens DMC1. In all of these two-ringed assemblies the DNA-interacting L1 region of each protomer points inward towards the centre, creating a highly positively charged locus. The electrostatic characteristics of the central channels can be utilized in the design of novel recombinase inhibitors
Impact of dechlorination processes on the sediment-water exchange of PCDD/F in Passaic river cores
Energy Technology Data Exchange (ETDEWEB)
Adriaens, P.; Khijniak, A. [Civil and Environmental Engineering, Univ. of Michigan, Ann Arbor (United States); Jones, K.; Green, N. [Environmental Science, Lancaster Univ. (United Kingdom); Gruden, C. [Univ. of Toledo, OH (United States)
2004-09-15
The potential for natural dechlorination processes in sediments to impact the biogeochemical cycling of dioxins and furans has been proposed as a possible mechanism to explain the prevalence of lesser halogenated dioxins and furans at the air-water interface. The hypothesis was supported by multiple lines of evidence, but has not been directly demonstrated. Field evidence indicated dynamic air-water exchange of PCDD/Fs in the Raritan Bay/Hudson River Estuary, whereby lesser chlorinated (predominantly diCDD/F) were present in the particle and apparent dissolved phase. Fugacity calculations indicated that the water column served as the source of these homologue groups. Laboratory evidence from Passaic River sediment cores and microbiallymediated dechlorination demonstrated that historic dioxins can undergo extensive dechlorination reactions, culminating in the formation of mono-and diCDD homologues. Similar pathways have been observed with PCDF, resulting in the accumulation of triCDF. The current paper reports on an investigation addressing the hypothesis of whether the lesser chlorinated PCDD/F observed at the air-water interface could be the result of selective dissolution of these congeners or homologues from sediments as they are produced during microbial dechlorination.
Tush, Daniel; Meyer, Michael T
2016-06-07
Polyoxyethylene tallow amine (POEA) is an inert ingredient added to formulations of glyphosate, the most widely applied agricultural herbicide. POEA has been shown to have toxic effects to some aquatic organisms making the potential transport of POEA from the application site into the environment an important concern. This study characterized the adsorption of POEA to soils and assessed its occurrence and homologue distribution in agricultural soils from six states. Adsorption experiments of POEA to selected soils showed that POEA adsorbed much stronger than glyphosate; calcium chloride increased the binding of POEA; and the binding of POEA was stronger in low pH conditions. POEA was detected on a soil sample from an agricultural field near Lawrence, Kansas, but with a loss of homologues that contain alkenes. POEA was also detected on soil samples collected between February and early March from corn and soybean fields from ten different sites in five other states (Iowa, Illinois, Indiana, Missouri, Mississippi). This is the first study to characterize the adsorption of POEA to soil, the potential widespread occurrence of POEA on agricultural soils, and the persistence of the POEA homologues on agricultural soils into the following growing season.
Spirometry effects on conventional and multiple flow exhaled nitric oxide in children.
Eckel, Sandrah P; Linn, William S; Salam, Muhammad T; Bastain, Theresa M; Zhang, Yue; Rappaport, Edward B; Liu, Meng; Berhane, Kiros
2015-03-01
Clinical and research settings often require sequencing multiple respiratory tests in a brief visit. Guidelines recommend measuring the concentration of exhaled nitric oxide (FeNO) before spirometry, but evidence for a spirometry carryover effect on FeNO is mixed. Only one study has investigated spirometry carryover effects on multiple flow FeNO analysis. The objective of this study was to evaluate evidence for carryover effects of recent spirometry on three exhaled NO summary measures: FeNO at 50 ml/s, airway wall NO flux [J'awNO] and alveolar NO concentration [CANO] in a population-based sample of schoolchildren. Participants were 1146 children (191 with asthma), ages 12-15, from the Southern California Children's Health Study who performed spirometry and multiple flow FeNO on the same day. Approximately, half the children performed spirometry first. Multiple linear regression was used to estimate differences in exhaled NO summary measures associated with recent spirometry testing, adjusting for potential confounders. In the population-based sample, we found no evidence of spirometry carryover effects. However, for children with asthma, there was a suggestion that exhaled NO summary measures assessed ≤6 min after spirometry were lower (FeNO: 25.8% lower, 95% CI: -6.2%, 48.2%; J'awNO: 15.1% lower 95% CI: -26.5%, 43.0%; and CANO 0.43 parts per billion lower, 95% CI: -0.12, 0.98). In clinical settings, it is prudent to assess multiple flow FeNO before spirometry. In studies of healthy subjects, it may not be necessary to assess FeNO first.
Electrospinning of calcium carbonate fibers and their conversion to nanocrystalline hydroxyapatite
International Nuclear Information System (INIS)
Holopainen, Jani; Santala, Eero; Heikkilä, Mikko; Ritala, Mikko
2014-01-01
Calcium carbonate (CaCO 3 ) fibers were prepared by electrospinning followed by annealing. Solutions consisting of calcium nitrate tetrahydrate (Ca(NO 3 ) 2 ·4H 2 O) and polyvinylpyrrolidone (PVP) dissolved in ethanol or 2-methoxyethanol were used for the fiber preparation. By varying the precursor concentrations in the electrospinning solutions CaCO 3 fibers with average diameters from 140 to 290 nm were obtained. After calcination the fibers were identified as calcite by X-ray diffraction (XRD). The calcination process was studied in detail with high temperature X-ray diffraction (HTXRD) and thermogravimetric analysis (TGA). The initially weak fiber-to-substrate adhesion was improved by adding a strengthening CaCO 3 layer by spin or dip coating Ca(NO 3 ) 2 /PVP precursor solution on the CaCO 3 fibers followed by annealing of the gel formed inside the fiber layer. The CaCO 3 fibers were converted to nanocrystalline hydroxyapatite (HA) fibers by treatment in a dilute phosphate solution. The resulting hydroxyapatite had a plate-like crystal structure with resemblance to bone mineral. The calcium carbonate and hydroxyapatite fibers are interesting materials for bone scaffolds and bioactive coatings. - Highlights: • Calcium carbonate fibers were prepared by electrospinning. • The electrospun fibers crystallized to calcite upon calcination at 500 °C. • Spin and dip coating methods were used to improve the adhesion of the CaCO 3 fibers. • The CaCO 3 fibers were converted to hydroxyapatite by treatment in phosphate solution. • The hydroxyapatite fibers consisted of plate-like nanocrystals
Preparation and characterization of silk fibroin as a biomaterial with potential for drug delivery
Directory of Open Access Journals (Sweden)
Zhang Hao
2012-06-01
Full Text Available Abstract Background Degummed silk fibroin from Bombyx mori (silkworm has potential carrier capabilities for drug delivery in humans; however, the processing methods have yet to be comparatively analyzed to determine the differential effects on the silk protein properties, including crystalline structure and activity. Methods In this study, we treated degummed silk with four kinds of calcium-alcohol solutions, and performed secondary structure measurements and enzyme activity test to distinguish the differences between the regenerated fibroins and degummed silk fibroin. Results Gel electrophoresis analysis revealed that Ca(NO32-methanol, Ca(NO32-ethanol, or CaCl2-methanol treatments produced more lower molecular weights of silk fibroin than CaCl2-ethanol. X-ray diffraction and Fourier-transform infrared spectroscopy showed that CaCl2-ethanol produced a crystalline structure with more silk I (α-form, type II β-turn, while the other treatments produced more silk II (β-form, anti-parallel β-pleated sheet. Solid-State 13C cross polarization and magic angle spinning-nuclear magnetic resonance measurements suggested that regenerated fibroins from CaCl2-ethanol were nearly identical to degummed silk fibroin, while the other treatments produced fibroins with significantly different chemical shifts. Finally, enzyme activity test indicated that silk fibroins from CaCl2-ethanol had higher activity when linked to a known chemotherapeutic drug, L-asparaginase, than the fibroins from other treatments. Conclusions Collectively, these results suggest that the CaCl2-ethanol processing method produces silk fibroin with biomaterial properties that are appropriate for drug delivery.
Hickel, Eduardo R.; Peruzzo, Edegar L.; Schuck, Enio
2001-01-01
A pérola-da-terra, Eurhizococcus brasiliensis (Hempel) (Homoptera: Margarodidae), é a principal praga da videira no Sul do Brasil. As estratégias normais de controle desta praga não afetam a população do inseto porque os indivíduos estão no subsolo e desenvolvem um corpo globoso resistente a intempéries. Assim sendo, um ensaio foi conduzido em laboratório para verificar a possibilidade de aplicar a insetigação no controle da pérola-da-terra. Tubos de 50 mm de altura de cano PVC (150 mm fi) fo...
Boletim Epidemiológico Observações: Vol. 5 (2016), Número Especial 8, Alimentação e Nutrição
Instituto Nacional de Saúde Doutor Ricardo Jorge
2016-01-01
Ficha técnica: Diretor: Fernando de Almeida; Editores:Carlos Matias Dias, Elvira Silvestre; Conselho Editorial Científico: Carlos Matias Dias, Manuela Cano, Jorge Machado, Manuela Caniça, Peter Jordan, Sílvia Viegas, Luciana Costa. Número Especial dedicado à Alimentação e Nutrição do Boletim Epidemiológico Observações. Observações é uma publicação científica do INSA, IP, que visa contribuir para o conhecimento da saúde da população, os fatores que a influenciam, a decisão e a intervenção e...
Flórez M., Arturo
2013-01-01
En la costa sur del Perú, donde la lluvia es mínima, ha sido posible sembrar diversos cultivos mediante la construcción de represas, generalmente localizadas en las partes altas de la sierra, y de allí a través de canales de irrigación el agua es conducida a los terrenos de cultivo. Tal es el caso de las irrigaciones de Majes, Santa Rita, La Joya, San Isidro, La Cano, San Camilo, Mejía, Iberia y Bombón en el Departamento de Arequipa; Los Angeles, Huaracaní, Montalvo, Omo y La Banda en el Depa...
CERN. Geneva
2012-01-01
CERN, jointly with Canton and City of Geneva, presents the public lecture of Gilles Jobin, the first winner of the Prix Collide@CERN Geneva, residency award for Dance and Performance arts, and his inspiration partner. They will present their work in dance and science at the CERN Globe of Science and Innovation on Wendesday 23 May 2012 at 19h (open doors at 18.30h) Refreshments will be served afterwards. Please reserve your places for you and your friends by contacting merce.monje.cano@cern.ch. +41 22 76 75246 We very much look forward to seeing you there.
Tablatures : Exposition photographique d'instruments virtuels GENESIS
Cadoz, Claude
2012-01-01
International audience; Le concept de « composer le son », introduit et expérimenté musicalement par Jean-Claude Risset à partir des années 1960 par la synthèse de sons par ordinateur, prolonge, élargit, dépasse et transforme l'acte d'écriture pour des instruments mécano-acoustiques. Il ne résout cependant pas la question de l'instrumentalité, particulièrement mise à mal avec l'ordinateur. Les technologies de modélisation et de simulation numériques pour « écrire l'instrument pour le composer...
El mundo del libro: noviembre de 1961
Directory of Open Access Journals (Sweden)
Agustín Rodríguez Garavito
1961-11-01
Full Text Available El documento presenta la reseña de los siguientes títulos: Nubes de antaño. 1940-1960. Por Octavio Amórtegui. México, 1961. Colombia Cara a Cara. Por Belisario Betancourt. Pesadumbre de la belleza y otros cuentos y apologos. Por Baldomero Sanín Cano. Ediciones MITO. Bogotá, D. E. Dos Ciclos de lirismo colombiano.-Por Carlos Arturo Caparroso. El Método psicoanalítico de Erich Fromm. -Por José Gutiérrez. De los Duros trabajos.-Por Jaime Paredes. Libro de las crónicas. -Por Luis Tejada.
Mycobacterium smegmatis Ku binds DNA without free ends.
Kushwaha, Ambuj K; Grove, Anne
2013-12-01
Ku is central to the non-homologous end-joining pathway of double-strand-break repair in all three major domains of life, with eukaryotic homologues being associated with more diversified roles compared with prokaryotic and archaeal homologues. Ku has a conserved central 'ring-shaped' core domain. While prokaryotic homologues lack the N- and C-terminal domains that impart functional diversity to eukaryotic Ku, analyses of Ku from certain prokaryotes such as Pseudomonas aeruginosa and Mycobacterium smegmatis have revealed the presence of distinct C-terminal extensions that modulate DNA-binding properties. We report in the present paper that the lysine-rich C-terminal extension of M. smegmatis Ku contacts the core protein domain as evidenced by an increase in DNA-binding affinity and a decrease in thermal stability and intrinsic tryptophan fluorescence upon its deletion. Ku deleted for this C-terminus requires free DNA ends for binding, but translocates to internal DNA sites. In contrast, full-length Ku can directly bind DNA without free ends, suggesting that this property is conferred by its C-terminus. Such binding to internal DNA sites may facilitate recruitment to sites of DNA damage. The results of the present study also suggest that extensions beyond the shared core domain may have independently evolved to expand Ku function.
Suarez, Sebastián A; Muller, Federico; Gutiérrez Suburu, Matías E; Fonrouge, Ana; Baggio, Ricardo F; Cukiernik, Fabio D
2016-10-01
The crystalline structures of four homologues of the 1,2-dibromo-4,5-dialkoxybenzene series [Br 2 C 6 H 2 (OC n H 2n + 1 ) 2 for n = 2, 12, 14 and 18] have been solved by means of single-crystal crystallography. Comparison along the series, including the previously reported n = 10 and n = 16 derivatives, shows a clear metric trend (b and c essentially fixed along the series and a growing linearly with n), in spite of some subtle differences in space groups and/or packing modes. A uniform packing pattern for the aliphatic chains has been found for the n = 12 to 18 homologues, which slightly differs from that of the n = 10 derivative. The crystalline structures of all the higher homologues (n = 10-18) seem to arise from van der Waals interchain interactions and, to a lesser extent, type II Br...Br interactions. The dominant role of interchain interactions provides direct structural support for the usual interpretation of melting point trends like that found along this series. Atoms in Molecules (AIM) analysis allows a comparison of the relative magnitude of the interchain and Br...Br interactions, an analysis validated by the measured melting enthalpies.
Directory of Open Access Journals (Sweden)
Iqmal Tahir
2010-06-01
Full Text Available Modeling of several alkyl salicylates based on electronic transition by using semiempriical mechanical quantum ZINDO/s calculation has been done. Object of these research were assumed only alkyl salicylates of C4 (butyl until C8 (octyl homologue with 4-7 example structures of each homologue. All of the computation have been performed using quantum chemistry - package software Hyperchem 6.0. The research covered about drawing each of the structure, geometry optimization using semiempirical AM1 algorithm and followed with single point calculation using semiempirical ZINDO/s technique. ZINDO/s calculations used a defined criteria that is singly excited - Configuration Interaction (CI, gap of HOMO-LUMO energy transition was 2 and degeneracy level was 3. Analysis of the theoretical spectra was focused in the UV-B (290-320 nm and UV-C (200-290 nm area. The result showed that modeling of the compound can be used for predicting the type of UV protection activity depending with the electronic transition in the UV area. Modification of the alkyl homologue relatively did not change the value of wavelength absorbtion to indicate the UV protection activity. Alkyl salicylate compounds were predicted as UV-C sunscreen or relatively the compounds have protection effect for UV-C. Keywords: alkyl salicylate, sunscreen, semiempirical methods
Effects of alkylresorcinols on volume and structure of yeast-leavened bread.
Andersson, Annica Am; Landberg, Rikard; Söderman, Thomas; Hedkvist, Sofie; Katina, Kati; Juvonen, Riikka; Holopainen, Ulla; Lehtinen, Pekka; Aman, Per
2011-01-30
Alkylresorcinols (AR) are amphiphilic phenolic compounds found in high amounts in wheat, durum wheat and rye, with different homologue composition for each cereal. The effect of different amounts of added AR from these cereals on bread volume, height, porosity and microstructure was studied. Breads with added rye bran (with high levels of AR) or acetone-extracted rye bran (with low levels of AR) were also baked, as well as breads with finely milled forms of each of these brans. Breads with high amounts of added AR, irrespective of AR homologue composition, had a lower volume, a more compact structure and an adverse microstructure compared with breads with no or low levels of added AR. AR were also shown to inhibit the activity of baker's yeast. There was no difference in bread volume and porosity between bread baked with rye bran and acetone-extracted rye bran or with brans of different particle size. Irrespective of homologue composition, AR had a negative effect on wheat bread properties when added in high amounts as purified extracts from wheat, durum wheat and rye. Natural levels of AR in rye bran, however, did not affect the volume and porosity of yeast-leavened wheat breads. 2010 Society of Chemical Industry.
Delaney, Kamila; Mailler, Jonathan; Wenda, Joanna M; Gabus, Caroline; Steiner, Florian A
2018-04-10
Replication-independent variant histones replace canonical histones in nucleosomes and act as important regulators of chromatin function. H3.3 is a major variant of histone H3 that is remarkably conserved across all taxa and is distinguished from canonical H3 by just four key amino acids. Most genomes contain two or more genes expressing H3.3, and complete loss of the protein usually causes sterility or embryonic lethality. Here we investigated the developmental expression pattern of the five Caenorhabditis elegans H3.3 homologues and identified two previously uncharacterized homologues to be restricted to the germ line. We demonstrate an essential role for the conserved histone chaperone HIRA in the nucleosomal loading of all H3.3 variants. This requirement can be bypassed by mutation of the H3.3-specific residues to those found in H3. Analysis of H3.3 knockout mutants revealed a surprising absence of developmental phenotypes. While removal of all H3.3 homologues did not result in lethality, it led to reduced fertility and viability in response to high temperature stress. Our results thus show that H3.3 is non-essential in C. elegans , but is critical for ensuring adequate response to stress. Copyright © 2018, Genetics.
The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements
LENUS (Irish Health Repository)
Thornton, Roibeard F
2010-04-23
Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.
Directory of Open Access Journals (Sweden)
Hewitt Jane E
2010-11-01
Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.
The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements
Directory of Open Access Journals (Sweden)
Kagawa Todd F
2010-04-01
Full Text Available Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.
National Research Council Canada - National Science Library
Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M
2004-01-01
.... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...
Identification of Salp15 homologues in Ixodes ricinus ticks
Hovius, J. W. R.; Ramamoorthi, N.; van't Veer, C.; de Groot, K. A.; Nijhof, A. M.; Jongejan, F.; van Dam, A. P.; Fikrig, E.
2007-01-01
The 15-kDa Ixodes scapularis salivary gland protein Salp15 protects Borrelia burgdorferi sensu stricto from antibody-mediated killing and facilitates infection of the mammalian host. In addition, Salp 15 has been shown to inhibit T-cell activation. We determined whether Ixodes ricinus, the major
Some Cholón discourse particles and Quechua homologues
Alexander-Bakkerus, A.; Romero-Figueroa, A.
2011-01-01
Cholón belongs to a small language family. It was spoken in North Peru in the valley of the Huallaga River. Cholón is an agglutinative SOV language, and it has, amongst other things, some twenty interesting, suffixed discourse particles: adverbial markers, emphasis markers, exclamation markers,
Valerophenone synthase-like chalcone synthase homologues in Humulus lupulus
Czech Academy of Sciences Publication Activity Database
Novák, Petr; Matoušek, Jaroslav; Bříza, Jindřich
2003-01-01
Roč. 46, - (2003), s. 375-381 ISSN 0006-3134 R&D Projects: GA ČR GA521/99/1591 Institutional research plan: CEZ:AV0Z5051902 Keywords : plant genetic Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.919, year: 2003
Johnson, Lane B; Kipfmueller, Kurt F
2016-06-01
We reconstructed fire occurrence near a fur-trade era canoe travel corridor (used ca. 1780-1802) in the Quetico-Superior region west of Lake Superior to explore the possibility of human influence on pre-fire suppression rates of fire occurrence. Our research objectives were to (1) examine the spatial and temporal patterns of fire in the study area, (2) test fires' strength of association with regional drought, and (3) assess whether reconstructed fire frequencies could be explained by observed rates of lightning fire ignition over the modern period of record. We developed a 420-year fire history for the eastern portion of Lac La Croix in the Boundary Waters Canoe Area Wilderness (BWCAW). Seventy-one fire-scarred samples were collected from remnant Pinus resinosa Ait. (red pine) stumps and logs from thirteen distinct island and three mainland forest stands. Collectively these samples contained records of 255 individual fire scars representing 79 fire events from 1636 to 1933 (study area mean fire intervals [MFI] 3.8 yr). Reconstructed fires were spatially and temporally asynchronous and not strongly associated with regional drought (P > 0.05). When compared to the conservative, tree-ring reconstructed estimate of historical fire occurrence and modern lightning-caused fires (1929-2012), a noticeable change in the distribution and frequency of fires within the study area was evident with only two lightning-ignited island fires since 1934 in the study area. Our results suggest a high likelihood that indigenous land use contributed to surface fire ignitions within our study area and highlights the importance of examining the potential effects of past indigenous land use when determining modern approaches to fire and wilderness management in fire-adapted ecosystems.
Early ceramic sites in southern Lau, Fiji
International Nuclear Information System (INIS)
Clark, G.
2009-01-01
The Lau Group is a dispersed chain of islands in east Fiji trending north-south on the inactive Lau Ridge remnant volcanic arc, which is part of the convergent margin system comprising the Lau Basin and Tonga Ridge to the east. In the south of the Lau Group are several remote islands that are closer to Tangatapu than they are to the largest islands of Viti Levu and Vanua Levu in the Fiji Group. Two of these islands, Vatoa and Doi islands in the Ono-i-Lau Group, were visited briefly in 2006 after field work on Kabara when the government supply boat 'Sandy' made scheduled stops to unload and collect cargo. Lapita pottery and a fortification were recorded on Doi Island in the Ono Group, and on Vatoa Island a site with plain ware ceramics dating to c. 2000 cal. BP was located. The position of the two remote islands lying between the main islands of Fiji and Tongan archipelago suggests they were particularly subject to influence from population contacts and movements from islands to their east and west in prehistory. In the eighteenth and nineteenth century central and southern Lau were the centre of an important canoe building industry based on the hardwood Instia bijuga (vesi) used to construct large sailing canoes which were the prerogative of Tongan and Fijian chiefs. Archaeological and linguistic studies of the Lau Group suggest a complicated history of population movements earlier during Lapita (2900-2500 BP) and post-Lapita (∼2500-1000 BP) times, which can be examined from the study of ceramic sites in southern Lau. (author). 27 refs., 3 figs
Shahbaz, Ali Khan; Iqbal, Muhammad; Jabbar, Abdul; Hussain, Sabir; Ibrahim, Muhammad
2018-03-01
Application of immobilizing agents may efficiently reduce the bioavailability of nickel (Ni) in the soil. Here we report the effect of biochar (BC), gravel sludge (GS) and zeolite (ZE) as a sole treatment and their combinations on the bioavailability of Ni after their application into a Ni-polluted soil. The bioavailability of Ni after the application of immobilizing agents was assessed through an indicator plant (red clover) and chemical indicators of bioavailability like soil water extract (SWE), DTPA and Ca(NO 3 ) 2 extracts. Additionally, the effects of Ni bioavailability and immobilizing agents on the growth, physiological and biochemical attributes of red clover were also observed. Application of ZE significantly reduced Ni concentrations in all chemical extracts compared to rest of the treatments. Similarly, the combined application of BC and ZE (BC+ ZE) significantly reduced Ni concentrations, reactive oxygen species (ROS) whereas, significant enhancement in the growth, physiological and biochemical attributes along with an improvement in antioxidant defence machinery of red clover plant, compared to rest of the treatments, were observed. Furthermore, BC+ ZE treatment significantly reduced bioconcentration factor (BCF) and bioaccumulation factor (BAF) of Ni in red clover, compared to rest of the treatments. The Ni concentrations in red clover leaves individually reflected a good correlation with Ni concentrations in the extracts (SWE at R 2 =0.79, DTPA extract at R 2 =0.84 and Ca(NO 3 ) 2 extracts at R 2 =0.86). Our results indicate that combined application of ZE and BC can significantly reduce the Ni bioavailability in the soil while in parallel improve the antioxidant defence mechanism in plants. Copyright © 2017 Elsevier Inc. All rights reserved.
Jiddawi, Narriman S; Ohman, Marcus C
2002-12-01
Fishery resources are a vital source of food and make valuable economic contributions to the local communities involved in fishery activities along the 850 km stretch of the Tanzania coastline and numerous islands. Small-scale artisanal fishery accounts for the majority of fish catch produced by more than 43 000 fishermen in the country, mainly operating in shallow waters within the continental shelf, using traditional fishing vessels including small boats, dhows, canoes, outrigger canoes and dinghys. Various fishing techniques are applied using uncomplicated passive fishing gears such as basket traps, fence traps, nets as well as different hook and line techniques. Species composition and size of the fish varies with gear type and location. More than 500 species of fish are utilized for food with reef fishes being the most important category including emperors, snappers, sweetlips, parrotfish, surgeonfish, rabbitfish, groupers and goatfish. Most of the fish products are used for subsistence purposes. However, some are exported. Destructive fishing methods such as drag nets and dynamite fishing pose a serious problem as they destroy important habitats for fish and other organisms, and there is a long-term trend of overharvested fishery resources. However, fishing pressure varies within the country as fishery resources are utilized in a sustainable manner in some areas. For this report more than 340 references about Tanzanian fishery and fish ecology were covered. There are many gaps in terms of information needed for successful fishery management regarding both basic and applied research. Most research results have been presented as grey literature (57%) with limited distribution; only one-fifth were scientific publications in international journals.
Some studies on tar pillets at Veraval coast (Gujarat)
Digital Repository Service at National Institute of Oceanography (India)
Kadam, A.N.
Infrared spectroscopic (IR) analysis indicated that the tar pillets contain saturated hydrocarbons particularly higher homologues of n-paraffins, unsaturated and carbonyl type of polar compounds. Gas chromatographic (GLC) fingerprint pattern...
The homodimeric GBS1074 from Streptococcus agalactiae
International Nuclear Information System (INIS)
Shukla, Anshuman; Pallen, Mark; Anthony, Mark; White, Scott A.
2010-01-01
The homodimeric nature of the ESAT-6 homologue GBS1074 and the potential for fibre-like assemblies are revealed by the 2 Å resolution crystal structure. ESAT-6 is a well characterized secreted protein from Mycobacterium tuberculosis and represents the archetype of the WXG100 family of proteins. Genes encoding ESAT-6 homologues have been identified in the genome of the human pathogen Streptococcus agalactiae; one of these genes, esxA, has been cloned and the recombinant protein has been crystallized. In contrast to M. tuberculosis ESAT-6, the crystal structure of GBS1074 reveals a homodimeric structure similar to homologous structures from Staphylococcus aureus and Helicobacter pylori. Intriguingly, GBS1074 forms elongated fibre-like assemblies in the crystal structure
A nucleator arms race: cellular control of actin assembly.
Campellone, Kenneth G; Welch, Matthew D
2010-04-01
For over a decade, the actin-related protein 2/3 (ARP2/3) complex, a handful of nucleation-promoting factors and formins were the only molecules known to directly nucleate actin filament formation de novo. However, the past several years have seen a surge in the discovery of mammalian proteins with roles in actin nucleation and dynamics. Newly recognized nucleation-promoting factors, such as WASP and SCAR homologue (WASH), WASP homologue associated with actin, membranes and microtubules (WHAMM), and junction-mediating regulatory protein (JMY), stimulate ARP2/3 activity at distinct cellular locations. Formin nucleators with additional biochemical and cellular activities have also been uncovered. Finally, the Spire, cordon-bleu and leiomodin nucleators have revealed new ways of overcoming the kinetic barriers to actin polymerization.
Viral Pseudo Enzymes Activate RIG-I via Deamidation to Evade Cytokine Production
He, Shanping; Zhao, Jun; Song, Shanshan; He, Xiaojing; Minassian, Arlet; Zhou, Yu; Zhang, Junjie; Brulois, Kevin; Wang, Yuqi; Cabo, Jackson; Zandi, Ebrahim; Liang, Chengyu; Jung, Jae U; Zhang, Xuewu; Feng, Pinghui
2015-01-01
SUMMARY RIG-I is a pattern recognition receptor that senses viral RNA and is crucial for host innate immune defense. Here we describe a mechanism of RIG-I activation through amidotransferase-mediated deamidation. We show that viral homologues of phosphoribosylformyglycinamide synthase (PFAS), although lacking intrinsic enzyme activity, recruit cellular PFAS to deamidate and activate RIG-I. Accordingly, depletion and biochemical inhibition of PFAS impair RIG-I deamidation and concomitant activation. Purified PFAS and viral homologue thereof deamidate RIG-I in vitro. Ultimately, herpesvirus hijacks activated RIG-I to avoid antiviral cytokine production; loss of RIG-I or inhibition of RIG-I deamidation results in elevated cytokine production. Together, these findings demonstrate a surprising mechanism of RIG-I activation that is mediated by an enzyme. PMID:25752576
Separation of radionuclides from spent decontamination solutions and/or evaporator concentrates
International Nuclear Information System (INIS)
Sebesta, F.; John, J.; Rosikova, K.; Motl, A.
1999-01-01
Separation of radionuclides from spent alkaline decontamination solutions has been tested in model experiments with strontium separation from simulant solution. The composite absorbers tested included TiO-PAN and NaTiO-PAN materials (titanium dioxide or sodium titanate incorporated into a matrix of polyacrylonitrile binder). As an alkaline simulant, solution of 1 M NaOH + 1 M NaNO 3 + 10 -4 M Ca(NO 3 ) 2 + 10 -5 M Sr(NO 3 ) 2 spiked with a carrier-free 85 Sr tracer, was used. The experiments were performed at a flow rate of 12.5 BV/hr. Some experiments with real and simulant spent decontamination solutions are described
López Roa, Lina María
2013-01-01
Introducción: la utilización de caballos como agentes terapéuticos es una opción implementada desde la antigüedad y está en permanente desarrollo. En la actualidad ofrece a la rehabilitación una alternativa y complemento a las técnicas tradicionalmente utilizadas. Métodos: en el presente estudio de caso, realizado con el grupo de investigación “Salud en movimiento” de la Fundación Universitaria María Cano Extensión Neiva, en la Fundación Centro de Equinoterapia ips-de tipo descriptivo, se pla...
Industria y peronismo: la fábrica de tubos de SIAM Di Tella SA (1948-1955
Directory of Open Access Journals (Sweden)
Rougier, Marcelo
2008-01-01
Full Text Available Depois da Segunda Guerra Mundial, o Estado argentino desenvolveu uma série de grandes empreendimentos na área de energia e a construção de oleodutos e gasodutos. Para fazer frente a essa demanda, uma tradicional empresa argentina, SIAM Di Tella, iniciou a fabricação de tubos sem costura, em 1948. Mas a nova empresa não seria muito exitosa durante os anos do peronismo, como conseqüência das deficiências que se apresentaram no funcionamento da máquina destinada a fabricar canos de grande diâmetro, o que a obrigou a diversificar sua produção
Directory of Open Access Journals (Sweden)
Karl Johns
2015-06-01
Full Text Available Riegl’s lecture about Maori ornament was held before the Anthropological Society in Vienna in 1890 and anticipates much of what he then said in his Stilfragen. After reiterating his milestone criticism of the ‘materialist’ theories of Semper and his followers, he suggests that the spiral motif was used for more profound and spontaneous reasons at the knee of a figure and the point of a canoe because of its complexity in being read in more than one direction, with and without other intervening elements. It seems to have arisen independently in various places with widely varying climates and cultures.
Equilíbrio líquido-vapor de solventes na presença de solutos não voláteis
Parente, Bruno Miguel Ramos
2009-01-01
Neste trabalho estudou-se o efeito da adição de alguns sais e líquidos iónicos no equilíbrio líquido-vapor (ELV) de algumas misturas importantes na indústria química, tais como etanol + água, 1-propanol + água, 2-propanol + água, acetona + metanol, acetato de metilo + metanol e clorofórmio + etanol. O conjunto de solutos não voláteis estudados é formado por Ca(NO3)2, CuCl2, NaI, KI, LiNO3, LiCl, NaSCN, KCH3COO, CaCl2, [BMIM][Cl] e [EMIM][triflate]. Em primeiro lugar, realizo...
Isolation and characterization of differentially expressed genes in ...
African Journals Online (AJOL)
USER
Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.
Stellingwerff, Trent; Maughan, Ronald J; Burke, Louise M
2011-01-01
Contemporary training for power sports involves diverse routines that place a wide array of physiological demands on the athlete. This requires a multi-faceted nutritional strategy to support both general training needs--tailored to specific training phases--as well as the acute demands of competition. Elite power sport athletes have high training intensities and volumes for most of the training season, so energy intake must be sufficient to support recovery and adaptation. Low pre-exercise muscle glycogen reduces high-intensity performance, so daily carbohydrate intake must be emphasized throughout training and competition phases. There is strong evidence to suggest that the timing, type, and amount of protein intake influence post-exercise recovery and adaptation. Most power sports feature demanding competition schedules, which require aggressive nutritional recovery strategies to optimize muscle glycogen resynthesis. Various power sports have different optimum body compositions and body weight requirements, but increasing the power-to-weight ratio during the championship season can lead to significant performance benefits for most athletes. Both intra- and extracellular buffering agents may enhance performance, but more research is needed to examine the potential long-term impact of buffering agents on training adaptation. Interactions between training, desired physiological adaptations, competition, and nutrition require an individual approach and should be continuously adjusted and adapted.
Guide pour la construction d'ensembles mécano-soudés conception - fabrication
Jubin, Laurent
2016-01-01
Le milieu des assemblages soudés dans la construction d’ensembles mécanosoudés et dans le secteur du levage et de la manutention a vu son environnement normatif évoluer de manière significative ces derniers temps. Les normes françaises NF E83-100 et NF E52-109, qui régissaient le secteur, ont été annulées, et les acteurs doivent dorénavant se conformer aux normes européennes ou internationales. Pour autant, ces normes françaises présentaient les règles de l’art en la matière et des aspects « métiers » utiles aux bureaux d’études, aux services méthodes et fabrications ainsi qu’aux sous-traitants du secteur, à qui elles servaient de références. C’est donc l’objet du présent rapport que de valoriser ces aspects « métiers », complétés par des retours d’expériences précis, tout en renvoyant aux textes européens et internationaux sur les aspects normatifs, leurs évolutions et leurs mises à jour. Ce rapport (9Q282) a pour but de conseiller les concepteurs et fabrica...
Surviving Secularization: Masking the Spirit in the Jankunu (John Canoe Festivals of the Caribbean
Directory of Open Access Journals (Sweden)
Kenneth M. Bilby
2010-12-01
Full Text Available Jankunu (Jonkonnu, Junkanoo, an Afro-Caribbean Yuletide tradition centering on masked dance, is generally characterized as a secular festival. This article presents contemporary ethnographic evidence showing that certain older variants of the tradition remain closely connected with African-derived religious concepts and practices. On the basis of this new evidence, the author argues for a reexamination and reevaluation of the historical significance of this tradition, which even today, despite its ostensible secularity, has vaguely "spiritual" associations for many in the region—including some of those who represent it as "secular." The article interprets this apparent contradiction as the result of a historical process of secularization (in response to the stigmatization of African modes of religiosity that was only partly successful.
Understanding sex determination in the mouse: genetics ...
Indian Academy of Sciences (India)
challenge now is to understand how controlled epigenomic changes effect the now familiar sexually dimorphic transcriptomic profiles of the ... Cattanach, personal communication, April 2015. .... The human homologue, DMRT1, is found on.
Directory of Open Access Journals (Sweden)
Jan Åke Jönsson
2011-10-01
Full Text Available Hollow fiber liquid phase micro-extraction (LPME of linear alkylbenzene sulfonates (LAS from aqueous samples was studied. Ion pair extraction of C10, C11, C12 and C13 homologues was facilitated with trihexylamine as ion-pairing agent, using di-n-hexylether as solvent for the supported liquid membrane (SLM. Effects of extraction time, acceptor buffer concentration, stirring speed, sample volume, NaCl and humic acids were studied. At 10–50 µg L−1 linear R2-coefficients were 0.99 for C10 and C11 and 0.96 for C12. RSD was typically ~15%. Three observations were especially made. Firstly, LPME for these analytes was unusually slow with maximum enrichment observed after 15–24 h (depending on sample volume. Secondly, the enrichment depended on LAS sample concentration with 35–150 times enrichment below ~150 µg L−1 and 1850–4400 times enrichment at 1 mg L−1. Thirdly, lower homologues were enriched more than higher homologues at low sample concentrations, with reversed conditions at higher concentrations. These observations may be due to the fact that LAS and the amine counter ion themselves influence the mass transfer at the water-SLM interface. The observations on LPME of LAS may aid in LPME application to other compounds with surfactant properties or in surfactant enhanced membrane extraction of other compounds.
Directory of Open Access Journals (Sweden)
Hong-Wen Sun
2014-01-01
Full Text Available Nonylphenol polyethoxylates (NPnEOs, a major class of nonionic surfactants, can easily enter into aquatic environments through various pathways due to their wide applications, which leads to the extensive existence of their relative stable metabolites, namely nonylphenol (NP and mono- to tri-ethoxylates. This study investigated the bioconcentration and degradation of NP and NPnEO oligomers (n = 1–12 by a green algae, Chlorella vulgaris. Experimental results showed that C. vulgaris can remove NP from water phase efficiently, and bioconcentration and degradation accounted for approximately half of its loss, respectively, with a 48 h BCF (bioconcentration factor of 2.42 × 103. Moreover, C. vulgaris could concentrate and degrade NPnEOs, distribution profiles of the series homologues of the NPnEOs in algae and water phase were quite different from the initial homologue profile. The 48 h BCF of the NPnEO homologues increased with the length of the EO chain. Degradation extent of total NPnEOs by C. vulgaris was 95.7%, and only 1.1% remained in water phase, and the other 3.2% remained in the algal cells. The algae removed the NPnEOs mainly through degradation. Due to rapid degradation, concentrations of the long chain NPnEO homologous in both water (n ≥ 2 and the algal phase (n ≥ 5 was quite low at the end of a 48 h experiment.
Presson, Nora; Krishnaswamy, Deepa; Wagener, Lauren; Bird, William; Jarbo, Kevin; Pathak, Sudhir; Puccio, Ava M; Borasso, Allison; Benso, Steven; Okonkwo, David O; Schneider, Walter
2015-03-01
There is an urgent, unmet demand for definitive biological diagnosis of traumatic brain injury (TBI) to pinpoint the location and extent of damage. We have developed High-Definition Fiber Tracking, a 3 T magnetic resonance imaging-based diffusion spectrum imaging and tractography analysis protocol, to quantify axonal injury in military and civilian TBI patients. A novel analytical methodology quantified white matter integrity in patients with TBI and healthy controls. Forty-one subjects (23 TBI, 18 controls) were scanned with the High-Definition Fiber Tracking diffusion spectrum imaging protocol. After reconstruction, segmentation was used to isolate bilateral hemisphere homologues of eight major tracts. Integrity of segmented tracts was estimated by calculating homologue correlation and tract coverage. Both groups showed high correlations for all tracts. TBI patients showed reduced homologue correlation and tract spread and increased outlier count (correlations>2.32 SD below control mean). On average, 6.5% of tracts in the TBI group were outliers with substantial variability among patients. Number and summed deviation of outlying tracts correlated with initial Glasgow Coma Scale score and 6-month Glasgow Outcome Scale-Extended score. The correlation metric used here can detect heterogeneous damage affecting a low proportion of tracts, presenting a potential mechanism for advancing TBI diagnosis. Reprint & Copyright © 2015 Association of Military Surgeons of the U.S.
Characterization of 3-Aminopropyl Oligosilsesquioxane.
Dimzon, Ian Ken D; Frömel, Tobias; Knepper, Thomas P
2016-05-03
The synthesis routes in the production of polysilsesquioxanes have largely relied upon in situ formations. This perspective often leads to polymers in which their basic structures including molecular weight and functionality are unknown [ Lichtenhan , J. D. ; et al. Silsesquioxane-siloxane copolymers from polyhedral silsesquioxanes Macromolecules , 1993 , 26 , 2141 - 2142 , http://dx.doi.org/10.1021/ma0060a053 ]. For a better understanding of the polysilsesquioxane properties and applications, there is a need to develop more techniques to enable their chemical characterization. An innovative method was developed to determine the molecular weight distribution (MWD) of an oligosilsesquioxane synthesized in-house from (3-aminopropyl)triethoxysilane. This method, which can be applied to other silsesquioxanes, siloxanes, and similar oligomers and polymers, involved separation using high performance liquid chromatography (HPLC) and detection using mass spectrometry (MS) with electrospray ionization (ESI). The novelty of the method lies on the unique determination of the absolute concentrations of the individual homologues present in the sample formulation. The use of absolute concentrations is necessary in estimating the MWD of the formulation when relative percentage, which is based solely on mass spectral ion intensities, becomes irrelevant due to the disproportionate response factors of the homologues. Determination of absolute concentration requires the use of single-homologue calibration standards. Because of commercial unavailability, these standards were prepared by efficient fractionation of the original formulation.
Reference: 306 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available of the endoreduplication cycle in Arabidopsis requires a plant homologue of archaeal DNA topoisomerase (topo) VI. To further understa...nd how DNA is endoreduplicated and how this process is r
Palaeotsunamis and their significance for prehistoric coastal communities
Goff, J. R.
2011-12-01
The damage caused by large tsunamis to human populations at the coast has been all too evident over the past few years. However, while we have seen the immediate after-effects of such events, we are less familiar with the longer term changes associated with them. Using prehistoric New Zealand as a case study, the talk first addresses the wider geological context associated with a tsunami - what caused it and what were the consequences for the physical environment? Prehistoric Maori lived predominantly in coastal settlements, particularly during their early settlement period. They had far ranging canoe trade routes and made widespread use of intertidal and coastal resources. As such it is possible to determine much of the ecological and societal ramifications of a 15th century tsunami inundation. The 15th century tsunami is recorded in numerous purakau or oral recordings. These form part of Maori Traditional Environmental Knowledge (TEK), but the event can also be identified through archaeological, geological and palaeo-ecological indicators. One of several purakau from the 15th century refers to the "Coming of the Sand". This centres on a place called Potiki-taua, where Potiki and his group settled. Mango-huruhuru, the old priest, built a large house on low land near the sea while Potiki-roa and his wife put theirs on higher ground further inland. Mango-huruhuru's house had a rocky beach in front of it that was unsuitable for landing canoes and so he decided to use his powers to bring sand from Hawaiki. After sunset he sat on his roof and recited a karakia (prayer/chant). On conclusion a dark cloud with its burden of sand reached the shore. The women called out "A! The sea rises; the waves and the sand will overwhelm us". The people fell where they stood and were buried in the sand along with the house and cultivations and all the surrounding country, and with them, the old priest and his youngest daughter (memorialised and turned into a rock which stands there
Directory of Open Access Journals (Sweden)
Zoilo Emilio García-Batista
2015-07-01
Full Text Available Se realizó un análisis de las propiedades psicométricas del Inventario de Situaciones y Respuestas de Ansiedad (ISRA en una muestra dominicana (n = 80, compuesta por 40 mujeres y 40 hombres estudiantes de Medicina con edades de 18 años, teniendo como criterio de inclusión no haber sido diagnosticados por algún trastorno de ansiedad. Se aplicó el Inventario de Situaciones y Respuestas de Ansiedad-ISRA (Miguel-Tobal & Cano-Vindel, 2002 y el Inventario de Ansiedad Estado-Rasgo (STAI: State-Trait Anxiety Inventory; Spielberg, Goursch & Lushene, 1994. Los resultados señalan que las características psi- cométricas de la muestra dominicana son similares a las obtenidas en la versión española original. Se concluye que el ISRA es fiable y válido para evaluar la ansiedad en los tres sistemas de respuestas en población dominicana. Abstract This paper is focused on an analysis of the psychometric properties of the Inventory of Situations and Response Anxiety (ISRA in a Dominican sample (n = 80, composed of 40 women and 40 men who are 18-year-old medical students, who fulfilled the inclusion criteria of not being diagnosed by any anxiety disorder. Inventory of Situations and Responses of Anx- iety-ISRA (Miguel-Tobal and Cano-Vindel, 2002 and State Anxiety Inventory – STAI (Spielberg, Goursch & Lushene, 1994 ventory STAI - were applied. The results show that the psychometric characteristics of the Dominican sample are similar to those obtained in the original Spanish version. We conclude that ISRA is reliable and valid to assess anxiety in three sets of answers in Dominican population. ResumoFoi feita uma análise das propriedades psicométricas do Inventário de Situações de Ansiedade e resposta (ISRA em uma amostra Dominicana (n = 80, composta por 40 mulheres e 40 homens, estudantes de medicina com a idade de 18 anos, ten- do como critério de inclusão não terem sido diagnosticados com uma desordem de ansiedade. O
Krätschmer, Kerstin; Cojocariu, Cristian; Schächtele, Alexander; Malisch, Rainer; Vetter, Walter
2018-03-02
For decades, high quantities of short-chain chlorinated paraffins (SCCP) and medium-chain chlorinated paraffins (MCCP) have been widely used, for instance as plasticizers or flame retardants, leading to global pollution due to unintentional emissions from products or waste. Due to the high complexity of chlorinated paraffins with several thousand congeners there is no consensus on an analytical procedure for SCCPs and MCCPs in food samples. Amongst the multitude of methods currently in use, high-resolution mass spectrometry is particularly valuable for in-depth studies of homologue patterns. Here we analyse SCCPs and MCCPs with gas chromatography coupled to high-resolution Orbitrap mass spectrometry (GC-Orbitrap-HRMS) operated in full-scan acquisition in electron capture negative ion (ECNI) mode at 60,000 and 120,000 resolution (FWHM, m/z 200, equals roughly 30,000 and 60,000 at 5% peak height). Linear dynamic range, selectivity and sensitivity tests confirmed an excellent linearity in a concentration range of 25-15,000 pg/μL with very low limits of detection (LODs) in the low pg/μL range. Spiking experiments with high levels of native mono- and di-ortho-polychlorinated biphenyls (PCBs) and mixtures of MCCP and SCCP standards did not have a negative impact on isotope ratios of the examined homologues. Besides the [M-Cl] - fragment ions used for quantification, the mass spectra of homologues also featured [M-HCl] - ions whose abundance increased with decreasing chlorination degree. In addition, [M-HCl-Cl] - ions were detected with a relative abundance of 5-10%. Three salmon (Salmo salar) samples farmed in Norway showed a consistent CP homologue pattern which differed both from the CP pattern in a sample from Scottish aquaculture and a wild salmon sample. These measurements produce evidence that discretely different CP patterns may exist in different areas of origin. Our results demonstrate that GC/ECNI-Orbitrap-HRMS is well-suited for the analysis of CPs by
Expressionof Drosophila FOXO regulates growth and can phenocopy starvation
Directory of Open Access Journals (Sweden)
Lockyer Joseph M
2003-07-01
Full Text Available Abstract Background Components of theinsulin signaling pathway are important regulators of growth. TheFOXO (forkhead box, sub-group "O" transcriptionfactors regulate cellular processes under conditions of low levelsof insulin signaling. Studies in mammalian cell culture show thatactivation of FOXO transcription factors causes cell death or cellcycle arrest. The Caenorhabiditis elegans homologue ofFOXO, Daf-16, is required for the formation of dauer larvae in responseto nutritional stress. In addition, FOXO factors have been implicatedin stress resistance and longevity. Results We have identifiedthe Drosophila melanogaster homologue of FOXO (dFOXO,which is conserved in amino acid sequence compared with the mammalianFOXO homologues and Daf-16. Expression of dFOXO during early larvaldevelopment causes inhibition of larval growth and alterations infeeding behavior. Inhibition of larval growth is reversible upondiscontinuation of dFOXO expression. Expression of dFOXO duringthe third larval instar or at low levels during development leadsto the generation of adults that are reduced in size. Analysis ofthe wings and eyes of these small flies indicates that the reductionin size is due to decreases in cell size and cell number. Overexpressionof dFOXO in the developing eye leads to a characteristic phenotypewith reductions in cell size and cell number. This phenotype canbe rescued by co-expression of upstream insulin signaling components,dPI3K and dAkt, however, this rescue is not seen when FOXO is mutatedto a constitutively active form. Conclusions dFOXO is conservedin both sequence and regulatory mechanisms when compared with otherFOXO homologues. The establishment of Drosophila as a model forthe study of FOXO transcription factors should prove beneficialto determining the biological role of these signaling molecules.The alterations in larval development seen upon overexpression ofdFOXO closely mimic the phenotypic effects of starvation, suggestinga
Meng, Xiangzhi; Schoggins, John; Rose, Lloyd; Cao, Jingxin; Ploss, Alexander; Rice, Charles M; Xiang, Yan
2012-04-01
Vaccinia virus (VACV) K1L and C7L function equivalently in many mammalian cells to support VACV replication and antagonize antiviral activities induced by type I interferons (IFNs). While K1L is limited to orthopoxviruses, genes that are homologous to C7L are found in diverse mammalian poxviruses. In this study, we showed that the C7L homologues from sheeppox virus and swinepox virus could rescue the replication defect of a VACV mutant deleted of both K1L and C7L (vK1L(-)C7L(-)). Interestingly, the sheeppox virus C7L homologue could rescue the replication of vK1L(-)C7L(-) in human HeLa cells but not in murine 3T3 and LA-4 cells, in contrast to all other C7L homologues. Replacing amino acids 134 and 135 of the sheeppox virus C7L homologue, however, made it functional in the two murine cell lines, suggesting that these two residues are critical for antagonizing a putative host restriction factor which has some subtle sequence variation in human and murine cells. Furthermore, the C7L family of host range genes from diverse mammalian poxviruses were all capable of antagonizing type I IFN-induced antiviral activities against VACV. Screening of a library of more than 350 IFN-stimulated genes (ISGs) identified interferon-regulated factor 1 (IRF1) as an inhibitor of vK1L(-)C7L(-) but not wild-type VACV. Expression of either K1L or C7L, however, rendered vK1L(-)C7L(-) resistant to IRF1-induced antiviral activities. Altogether, our data show that K1L and C7L antagonize IRF1-induced antiviral activities and that the host modulation function of C7L is evolutionally conserved in all poxviruses that can readily replicate in tissue-cultured mammalian cells.
Adenosine triphosphate stimulates Aquifex aeolicus MutL endonuclease activity.
Directory of Open Access Journals (Sweden)
Jerome Mauris
2009-09-01
Full Text Available Human PMS2 (hPMS2 homologues act to nick 5' and 3' to misincorporated nucleotides during mismatch repair in organisms that lack MutH. Mn(++ was previously found to stimulate the endonuclease activity of these homologues. ATP was required for the nicking activity of hPMS2 and yPMS1, but was reported to inhibit bacterial MutL proteins from Thermus thermophilus and Aquifex aeolicus that displayed homology to hPMS2. Mutational analysis has identified the DQHA(X(2E(X(4E motif present in the C-terminus of PMS2 homologues as important for endonuclease activity.We examined the effect ATP had on the Mn(++ induced nicking of supercoiled pBR322 by full-length and mutant A. aeolicus MutL (Aae MutL proteins. Assays were single time point, enzyme titration experiments or reaction time courses. The maximum velocity for MutL nicking was determined to be 1.6+/-0.08x10(-5 s(-1 and 4.2+/-0.3x10(-5 s(-1 in the absence and presence of ATP, respectively. AMPPNP stimulated the nicking activity to a similar extent as ATP. A truncated Aae MutL protein composed of only the C-terminal 123 amino acid residues was found to nick supercoiled DNA. Furthermore, mutations in the conserved C-terminal DQHA(X(2E(X(4E and CPHGRP motifs were shown to abolish Aae MutL endonuclease activity.ATP stimulated the Mn(++ induced endonuclease activity of Aae MutL. Experiments utilizing AMPPNP implied that the stimulation did not require ATP hydrolysis. A mutation in the DQHA(X(2E(X(4E motif of Aae MutL further supported the role of this region in endonclease activity. For the first time, to our knowledge, we demonstrate that changing the histidine residue in the conserved CPHGRP motif abolishes endonucleolytic activity of a hPMS2 homologue. Finally, the C-terminal 123 amino acid residues of Aae MutL were sufficient to display Mn(++ induced nicking activity.
Krivtsova, Nadezhda Igorevna; Tataurshikov, A.; Kotkova, Elena
2016-01-01
Modelling of sulfur compounds kinetics was performed, including kinetics of benzothiophene and dibenzothiophene homologues. Modelling is based on experimental data obtained from monitoring of industrial hydrotreating set. Obtained results include kinetic parameters of reactions.
A common variation of the PTEN gene is associated with peripheral insulin resistance
DEFF Research Database (Denmark)
Grinder-Hansen, L; Ribel-Madsen, R; Wojtaszewski, Jørgen
2016-01-01
. RESULTS: The minor G allele of PTEN rs11202614 was associated with elevated fasting plasma insulin levels and a decreased peripheral glucose disposal rate, but not with the hepatic insulin resistance index or insulin secretion measured as the first-phase insulin response and disposition index. The single...... nucleotide polymorphism was not associated with either PI3K or Akt activities. CONCLUSION: A common PTEN variation is associated with peripheral insulin resistance and subsequent risk of developing T2D. However, the association with insulin resistance is not explained by decreased proximal insulin signalling......AIM: Phosphatase and tensin homologue (PTEN) reduces insulin sensitivity by inhibiting the phosphatidylinositol 3-kinase (PI3K)/v-akt murine thymoma viral oncogene homologue (Akt) pathway. This study investigated how a common single nucleotide polymorphism near PTEN, previously associated...
Structural and cell adhesion properties of zebrafish syndecan-4 are shared with higher vertebrates
DEFF Research Database (Denmark)
Whiteford, James; Ko, Sunggeon; Lee, Weontae
2008-01-01
, but no molecular and cellular studies have been reported. Here it is demonstrated that key functional attributes of syndecan-4 are common to both zebrafish and mammalian homologues. These include glycosaminoglycan substitution, a NXIP motif in the extracellular domain that promotes integrin-mediated cell adhesion......The syndecan proteoglycans are an ancient class of receptor, bearing heparan sulfate chains that interact with numerous potential ligands including growth factors, morphogens, and extracellular matrix molecules. The single syndecan of invertebrates appears not to have cell adhesion roles......, but these have been described for mammalian paralogues, especially syndecan-4. This member is best understood in terms of interactions, signaling, and structure of its cytoplasmic domain. The zebrafish homologue of syndecan-4 has been genetically linked to cell adhesion and migration in zebrafish embryos...
A telencephalospinal projection in the Tegu lizard (Tupinambis teguixin).
Follett, K A
1989-09-04
Tegu lizards (Tupinambis teguixin) were studied to determine the presence of a homologue of the mammalian corticospinal tract. The sources of telencephalic efferent projections to the spinal cord were determined by evaluating the localization of retrogradely transported horseradish peroxidase applied in the cervical spinal cord. Labeled cells were present in subtelencephalic sites reported previously by other authors and, in addition, were found in the principal sensory and motor nuclei of the trigeminal nerve and in the nucleus of the posterior commissure. A telencephalospinal projection was identified, originating in the ventral caudal telencephalon. Histochemical staining revealed a high concentration of acetylcholinesterase in cells and neuropil in the same area. This tract is suggested to be homologous to the mammalian amygdalospinal tract. No reptilian homologue of the corticospinal tract was identified.
DeepLoc: prediction of protein subcellular localization using deep learning
DEFF Research Database (Denmark)
Almagro Armenteros, Jose Juan; Sønderby, Casper Kaae; Sønderby, Søren Kaae
2017-01-01
The prediction of eukaryotic protein subcellular localization is a well-studied topic in bioinformatics due to its relevance in proteomics research. Many machine learning methods have been successfully applied in this task, but in most of them, predictions rely on annotation of homologues from...... knowledge databases. For novel proteins where no annotated homologues exist, and for predicting the effects of sequence variants, it is desirable to have methods for predicting protein properties from sequence information only. Here, we present a prediction algorithm using deep neural networks to predict...... current state-of-the-art algorithms, including those relying on homology information. The method is available as a web server at http://www.cbs.dtu.dk/services/DeepLoc . Example code is available at https://github.com/JJAlmagro/subcellular_localization . The dataset is available at http...
DEFF Research Database (Denmark)
Seppänen, Mervi M; Pakarinen, Kirsi; Jokela, Venla
2010-01-01
Background Timothy is a long-day grass species well adapted for cultivation in northern latitudes. It produces elongating tillers not only in spring growth but also later in summer. As the quantity and quality of harvested biomass is dictated by canopy architecture and the proportion of stem......-forming flowering tillers, the regulation of flowering is of great interest in forage grass production. Methods Canopy architecture, stem morphology and freezing tolerance of vernalized timothy were investigated in greenhouse and field experiments. The molecular control of development was examined by analysing......, however, divergent morphology. Vernalization enhanced flowering, and the expression of the VRN1 homologue was elevated when the apex had passed into the reproductive stage. High VRN1 homologue expression was not associated with reduction in freezing tolerance and the expression coincided with increased...
Indian Academy of Sciences (India)
Prakash
hetC homologue in the genome of P. syringae by analysing the genome sequence of ... 1994 Vegetative incompatibility in Neurospora – its effect on horizontal transfer of mitochondrial plasmids and senescence in natural populations; Curr.
Directory of Open Access Journals (Sweden)
Diego Gonçalves Feitosa
2011-06-01
Full Text Available A degradação do cerrado e a perda de sua biodiversidade demandam a revegetação de áreas desse bioma, onde existem espécies com potencial de uso econômico e ambiental pouco conhecidos. Este trabalho teve o objetivo de avaliar o efeito de diferentes fontes e doses de nitrogênio sobre o crescimento de mudas de Gonçalo-Alves (Astronium fraxinifolium, espécie arbórea nativa do cerrado ameaçada de extinção. O experimento foi realizado em estufa na UNESP/Campus de Ilha Solteira. O solo utilizado (Latossolo Vermelho foi coletado na profundidade de 0,0 a 0,20 m, em Selvíria (MS. As fontes de nitrogênio utilizadas ((NH42SO4, NH4NO3 e Ca(NO32 foram aplicadas nas doses de 0; 50; 100; 150 e 200 mg dm-3. O N aplicado na forma de Ca(NO32 apresentou melhor resultado para o solo utilizado. O crescimento das mudas de Gonçalo-Alves não foi influenciado pelas diferentes fontes de N, mas respondeu às doses. A altura da planta, o diâmetro do coleto, o teor de clorofila foliar, o peso da matéria fresca e seca da parte aérea e do sistema radicular, o peso seco total, bem como o IQD e a razão entre o peso da matéria seca da parte aérea e do sistema radicular, apresentaram valor máximo para doses que variaram de 59,0 a 72,5 mg dm-3 de N, permitindo sugerir a dose de 72,5 mg dm-3 de N como suficiente para o crescimento satisfatório de mudas de Gonçalo-Alves.
Yang, Sha; Wang, Fang; Guo, Feng; Meng, Jing-Jing; Li, Xin-Guo; Dong, Shu-Ting; Wan, Shu-Bo
2013-01-01
Peanut is one of the calciphilous plants. Calcium (Ca) serves as a ubiquitous central hub in a large number of signaling pathways. The effect of exogenous calcium nitrate [Ca(NO3)2] (6 mM) on the dissipation of excess excitation energy in the photosystem II (PSII) antenna, especially on the level of D1 protein and the xanthophyll cycle in peanut plants under heat (40°C) and high irradiance (HI) (1 200 µmol m−2 s−1) stress were investigated. Compared with the control plants [cultivated in 0 mM Ca(NO3)2 medium], the maximal photochemical efficiency of PSII (Fv/Fm) in Ca2+-treated plants showed a slighter decrease after 5 h of stress, accompanied by higher non-photochemical quenching (NPQ), higher expression of antioxidative genes and less reactive oxygen species (ROS) accumulation. Meanwhile, higher content of D1 protein and higher ratio of (A+Z)/(V+A+Z) were also detected in Ca2+-treated plants under such stress. These results showed that Ca2+ could help protect the peanut photosynthetic system from severe photoinhibition under heat and HI stress by accelerating the repair of D1 protein and improving the de-epoxidation ratio of the xanthophyll cycle. Furthermore, EGTA (a chelant of Ca ion), LaCl3 (a blocker of Ca2+ channel in cytoplasmic membrane), and CPZ [a calmodulin (CaM) antagonist] were used to analyze the effects of Ca2+/CaM on the variation of (A+Z)/(V+A+Z) (%) and the expression of violaxanthin de-epoxidase (VDE). The results indicated that CaM, an important component of the Ca2+ signal transduction pathway, mediated the expression of the VDE gene in the presence of Ca to improve the xanthophyll cycle. PMID:23940721
Directory of Open Access Journals (Sweden)
Sha Yang
Full Text Available Peanut is one of the calciphilous plants. Calcium (Ca serves as a ubiquitous central hub in a large number of signaling pathways. The effect of exogenous calcium nitrate [Ca(NO32] (6 mM on the dissipation of excess excitation energy in the photosystem II (PSII antenna, especially on the level of D1 protein and the xanthophyll cycle in peanut plants under heat (40°C and high irradiance (HI (1 200 µmol m(-2 s(-1 stress were investigated. Compared with the control plants [cultivated in 0 mM Ca(NO32 medium], the maximal photochemical efficiency of PSII (Fv/Fm in Ca(2+-treated plants showed a slighter decrease after 5 h of stress, accompanied by higher non-photochemical quenching (NPQ, higher expression of antioxidative genes and less reactive oxygen species (ROS accumulation. Meanwhile, higher content of D1 protein and higher ratio of (A+Z/(V+A+Z were also detected in Ca(2+-treated plants under such stress. These results showed that Ca(2+ could help protect the peanut photosynthetic system from severe photoinhibition under heat and HI stress by accelerating the repair of D1 protein and improving the de-epoxidation ratio of the xanthophyll cycle. Furthermore, EGTA (a chelant of Ca ion, LaCl3 (a blocker of Ca(2+ channel in cytoplasmic membrane, and CPZ [a calmodulin (CaM antagonist] were used to analyze the effects of Ca(2+/CaM on the variation of (A+Z/(V+A+Z (% and the expression of violaxanthin de-epoxidase (VDE. The results indicated that CaM, an important component of the Ca(2+ signal transduction pathway, mediated the expression of the VDE gene in the presence of Ca to improve the xanthophyll cycle.
Liao, Xiao-Yong; Chen, Tong-Bin; Xiao, Xi-Yuan; Xie, Hua; Yan, Xiu-Lan; Zhai, Li-Mei; Wu, Bin
2007-01-01
Certain plant species have been shown to vigorously accumulate some metals from soil, and thus represent promising and effective remediation alternatives. In order to select the optimum forms of nitrogen (N) fertilizers for the arsenic (As) hyperaccumulator, Pteris vittata L., to maximize As extraction, five forms of N were added individually to different treatments to study the effect of N forms on As uptake of the plants under soil culture in a greenhouse. Although shoot As concentration tended to decrease and As translocation from root to shoot was inhibited, overall As accumulation was greater due to higher biomass when N fertilizer was added. Arsenic accumulation in plants with N fertilization was 100-300% more than in the plants without N fertilization. There were obvious differences in plant biomass and As accumulation among the N forms, i.e., NH4HCO3, (NH4)2S04, Ca(NO3)2, KNO3, urea. The total As accumulation in the plants grown in As-supplied soil, under different forms of N fertilizer, decreased as NH4HCO3>(NH4)2S04 > urea > Ca(NO3)2 >KNO3>CK. The plants treated with N and As accumulated up to 5.3-7.97 mg As/pot and removed 3.7-5.5% As from the soils, compared to approximately 2.3% of As removal in the control. NH4+ -N was apparently more effective than other N fertilizers in stimulating As removal when soil was supplied with As at initiation. No significant differences in available As were found among different forms of N fertilizer after phytoremediation. It is concluded that NH4+ -N was the preferable fertilizer for P. vittata to maximize As removal.
Detailed mechanistic investigation into the S-nitrosation of cysteamine.
Morakinyo, Moshood K; Chipinda, Itai; Hettick, Justin; Siegel, Paul D; Abramson, Jonathan; Strongin, Robert; Martincigh, Bice S; Simoyi, Reuben H
The nitrosation of cysteamine (H 2 NCH 2 CH 2 SH) to produce cysteamine- S -nitrosothiol (CANO) was studied in slightly acidic medium by using nitrous acid prepared in situ. The stoichiometry of the reaction was H 2 NCH 2 CH 2 SH + HNO 2 → H 2 NCH 2 CH 2 SNO + H 2 O. On prolonged standing, the nitrosothiol decomposed quantitatively to yield the disulfide, cystamine: 2H 2 NCH 2 CH 2 SNO → H 2 NCH 2 CH 2 S-SCH 2 CH 2 NH 2 + 2NO. NO 2 and N 2 O 3 are not the primary nitrosating agents, since their precursor (NO) was not detected during the nitrosation process. The reaction is first order in nitrous acid, thus implicating it as the major nitrosating agent in mildly acidic pH conditions. Acid catalyzes nitrosation after nitrous acid has saturated, implicating the protonated nitrous acid species, the nitrosonium cation (NO + ) as a contributing nitrosating species in highly acidic environments. The acid catalysis at constant nitrous acid concentrations suggests that the nitrosonium cation nitrosates at a much higher rate than nitrous acid. Bimolecular rate constants for the nitrosation of cysteamine by nitrous acid and by the nitrosonium cation were deduced to be 17.9 ± 1.5 (mol/L) -1 s -1 and 6.7 × 10 4 (mol/L) -1 s -1 , respectively. Both Cu(I) and Cu(II) ions were effective catalysts for the formation and decomposition of the cysteamine nitrosothiol. Cu(II) ions could catalyze the nitrosation of cysteamine in neutral conditions, whereas Cu(I) could only catalyze in acidic conditions. Transnitrosation kinetics of CANO with glutathione showed the formation of cystamine and the mixed disulfide with no formation of oxidized glutathione (GSSG). The nitrosation reaction was satisfactorily simulated by a simple reaction scheme involving eight reactions.
Do fish have rights in artisanal fisheries?
Directory of Open Access Journals (Sweden)
Mustapha MK
2013-09-01
Full Text Available Artisanal fishers in developing world are unaware that fish are capable of suffering or discomfort, though researches have shown that fish do feel pain. Five fish welfare domains have been identified which constitute their rights in their environment. The needs of wild fish are usually provided in their natural, undisturbed and unperturbed aquatic environment, of which the fish will prefer. However, various anthropogenic activities by humans (including artisanal fisheries itself and some natural perturbations in the watershed, riparian zone, water body of the fish habitat and on the fish tend to take away these needs thereby compromising the fish welfare. These activities include environmental degradation, boat/canoe building, use of motorized engine boats/canoes, use of active and passive fishing gears, obnoxious cultural, religious and social fishing practices, fish harvesting, handling and processing among others. One way to understand the welfare needs of an individual fish is to understand its biology. Poor welfare conditions could then be assessed by how far the individual fish has deviated from the normal conditions. Non-intrusive signs based on the health, behavior, morphological anomalies, swimming, reduction in population and growth, outbreak of parasitic infections, injuries and loss of condition can be used to assess fish whose welfare has been compromised. Artisanal fishers should not only be concerned with catch, but, also the welfare of the fish being caught. This is because if the welfare of the fish is compromised, it is going to definitely affect the catch. As indispensable as fish is to humans, humans should not derive its pleasure at the expense of fish suffering. Human activities that impinge on the welfare of wild fish may not necessarily be stopped, but at least minimized in order to have continued sustainable artisanal exploitation of the fisheries.
National Research Council Canada - National Science Library
Harnandez-Barrantes, Sonia
2001-01-01
.... Thus, under certain conditions, TIMP-2 is a positive regulator of MMP activity. TIMP-4, a close homologue of TIMP-2 also binds to pro-MMP- 2 and can potentially participate in pro-MMP-2 activation...
A Novel Tyrosine Kinase Expressed in Breast Tumors
National Research Council Canada - National Science Library
Tyner, Angela
1999-01-01
.... Sik interacts with Sam68 through both its SH3 and SH2 domains. Transfected Sik and Sam68 colocalize to the nucleoplasm of nontransformed NMuMG mammary epithelial cells, while the human homologue of Sik (BRK...
Directory of Open Access Journals (Sweden)
Krivtcova Nadezhda
2016-01-01
Full Text Available Modelling of sulfur compounds kinetics was performed, including kinetics of benzothiophene and dibenzothiophene homologues. Modelling is based on experimental data obtained from monitoring of industrial hydrotreating set. Obtained results include kinetic parameters of reactions.